Cloning and functional expression of the mitochondrial alternative oxidase gene (aox1) of Aspergillus niger in Lactococcus lactis and its induction by oxidizing conditions.

Science.gov (United States)

Papagianni, Maria; Avramidis, Nicholaos

2012-01-05

Lactococcus lactis is a widely used food bacterium mainly known for its fermentation metabolism. An important, and for long time overlooked, trait of this species is its ability to perform respiratory metabolism in the presence of heme and under aerobic conditions. There is no evidence however for the presence of an alternative respiration pathway and AOX activity. In this study, a cDNA fragment encoding the mitochondrial alternative oxidase, the enzyme responsible for alternative respiration, from a citric acid producing Aspergillus niger strain was cloned and expressed in L. lactis as a host strain. Expression of aox1 conferred on this organism cyanide-resistant and salicylhydroxamate-sensitive growth. Bioreactor cultures under fully aerobic conditions of the transformed L. lactis showed that the alternative respiratory pathway operates and improves significantly the microorganism's response to oxidizing stress conditions as it enhances biomass production, suppresses lactate formation, and leads to accumulation of large amounts of nisin. Copyright © 2011 Elsevier Inc. All rights reserved.

Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris*

Science.gov (United States)

Wang, Xiaolong; Wang, Qi; Wang, Jinjia; Bai, Peng; Shi, Lei; Shen, Wei; Zhou, Mian; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

2016-01-01

The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1. PMID:26828066

A broad distribution of the alternative oxidase in microsporidian parasites.

Directory of Open Access Journals (Sweden)

Bryony A P Williams

2010-02-01

Full Text Available Microsporidia are a group of obligate intracellular parasitic eukaryotes that were considered to be amitochondriate until the recent discovery of highly reduced mitochondrial organelles called mitosomes. Analysis of the complete genome of Encephalitozoon cuniculi revealed a highly reduced set of proteins in the organelle, mostly related to the assembly of iron-sulphur clusters. Oxidative phosphorylation and the Krebs cycle proteins were absent, in keeping with the notion that the microsporidia and their mitosomes are anaerobic, as is the case for other mitosome bearing eukaryotes, such as Giardia. Here we provide evidence opening the possibility that mitosomes in a number of microsporidian lineages are not completely anaerobic. Specifically, we have identified and characterized a gene encoding the alternative oxidase (AOX, a typically mitochondrial terminal oxidase in eukaryotes, in the genomes of several distantly related microsporidian species, even though this gene is absent from the complete genome of E. cuniculi. In order to confirm that these genes encode functional proteins, AOX genes from both A. locustae and T. hominis were over-expressed in E. coli and AOX activity measured spectrophotometrically using ubiquinol-1 (UQ-1 as substrate. Both A. locustae and T. hominis AOX proteins reduced UQ-1 in a cyanide and antimycin-resistant manner that was sensitive to ascofuranone, a potent inhibitor of the trypanosomal AOX. The physiological role of AOX microsporidia may be to reoxidise reducing equivalents produced by glycolysis, in a manner comparable to that observed in trypanosomes.

Engineering the central pathways in Lactococcus lactis: functional expression of the phosphofructokinase (pfk) and alternative oxidase (aox1) genes from Aspergillus niger in Lactococcus lactis facilitates improved carbon conversion rates under oxidizing conditions.

Science.gov (United States)

Papagianni, Maria; Avramidis, Nicholaos

2012-08-10

The present work describes a novel central pathway engineering method that has been designed with the aim to increase the carbon conversion rates under oxidizing conditions in L. lactis fermentations. The nisin producer L. lactis ATCC11454 strain has been genetically engineered by cloning a truncated version of the phosphofructokinase gene (pfk13), along with the pkaC, encoding for the catalytic subunit of cAMP-dependent protein kinase, and the alternative oxidase (aox1) genes of A. niger. Functional expression of the above genes resulted in enhanced PFK activity and the introduction of AOX activity and alternative respiration in the presence of a source of heme in the substrate, under fully aerobic growth conditions. The constructed strain is capable of fermenting high concentrations of glucose as was demonstrated in a series of glucostat fed-batch fermentations with glucose levels maintained at 55, 138 and 277 mM. The high maximum specific uptake rate of glucose of 1.8 mMs(-1)gCDW(-1) at 277 mM glucose is characteristic of the improved ability of the microorganism to handle elevated glucose concentrations under conditions otherwise causing severe reduction of PFK activity. The increased carbon flow through glycolysis led to increased protein synthesis that was reflected in increased biomass and nisin levels. The pfk 13-pkaC-aox1-transformant strain's fermentation at 277 mM glucose gave a final biomass concentration of 7.5 g/l and nisin activity of 14,000 IU/ml which is, compared to the parental strain's production levels at its optimal 55 mM glucose, increased by a factor of 2.34 for biomass and 4.37 for nisin. Copyright © 2012 Elsevier Inc. All rights reserved.

Identification and characterization of an antennae-specific aldehyde oxidase from the navel orangeworm.

Directory of Open Access Journals (Sweden)

Young-Moo Choo

Full Text Available Antennae-specific odorant-degrading enzymes (ODEs are postulated to inactivate odorant molecules after they convey their signal. Different classes of insect ODEs are specific to esters, alcohols, and aldehydes--the major functional groups of female-produced, hydrophobic sex pheromones from moth species. Esterases that rapidly inactive acetate and other esters have been well-studied, but less is known about aldehyde oxidases (AOXs. Here we report cloning of an aldehyde oxidase, AtraAOX2, from the antennae of the navel orangeworm (NOW, Amyelois transitella, and the first activity characterization of a recombinant insect AOX. AtraAOX2 gene spans 3,813 bp and encodes a protein with 1,270 amino acid residues. AtraAOX2 cDNA was expressed in baculovirus-infected insect Sf21 cells as a ≈280 kDa homodimer with 140 kDa subunits. Recombinant AtraAOX2 degraded Z11Z13-16Ald and plant volatile aldehydes as substrates. However, as expected for aldehyde oxidases, recombinant AtraAOX2 did not show specificity for Z11Z13-16Ald, the main constituent of the sex pheromone, but showed high activity for plant volatile aldehydes. Our data suggest AtraAOX2 might be involved in degradation of a diversity of aldehydes including sex pheromones, plant-derived semiochemicals, and chemical cues for oviposition sites. Additionally, AtraAOX2 could protect the insect's olfactory system from xenobiotics, including pesticides that might reach the sensillar lymph surrounding the olfactory receptor neurons.

Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

Science.gov (United States)

Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

2017-02-09

In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

Key role of alternative oxidase in lovastatin solid-state fermentation.

Science.gov (United States)

Pérez-Sánchez, Ailed; Uribe-Carvajal, Salvador; Cabrera-Orefice, Alfredo; Barrios-González, Javier

2017-10-01

Lovastatin is a commercially important secondary metabolite produced by Aspergillus terreus, either by solid-state fermentation or by submerged fermentation. In a previous work, we showed that reactive oxygen species (ROS) accumulation in idiophase positively regulates lovastatin biosynthetic genes. In addition, it has been found that lovastatin-specific production decreases with aeration in solid-state fermentation (SSF). To study this phenomenon, we determined ROS accumulation during lovastatin SSF, under high and low aeration conditions. Paradoxically, high aeration caused lower ROS accumulation, and this was the underlying reason of the aeration effect on lovastatin production. Looking for a mechanism that is lowering ROS production under those conditions, we studied alternative respiration. The alternative oxidase provides an alternative route for electrons passing through the electron transport chain to reduce oxygen. Here, we showed that an alternative oxidase (AOX) is expressed in SSF, and only during idiophase. It was shown that higher aeration induces higher alternative respiration (AOX activity), and this is a mechanism that limits ROS generation and keeps them within healthy limits and adequate signaling limits for lovastatin production. Indeed, the aox gene was induced in idiophase, i.e., at the time of ROS accumulation. Moreover, exogenous ROS (H 2 O 2 ), added to lovastatin solid-state fermentation, induced higher AOX activity. This suggests that high O 2 availability in SSF generates dangerously high ROS, so alternative respiration is induced in SSF, indirectly favoring lovastatin production. Conversely, alternative respiration was not detected in lovastatin-submerged fermentation (SmF), although exogenous ROS also induced relatively low AOX activity in SmF.

Alternative Oxidase: A Mitochondrial Respiratory Pathway to Maintain Metabolic and Signaling Homeostasis during Abiotic and Biotic Stress in Plants

Directory of Open Access Journals (Sweden)

Greg C. Vanlerberghe

2013-03-01

Full Text Available Alternative oxidase (AOX is a non-energy conserving terminal oxidase in the plant mitochondrial electron transport chain. While respiratory carbon oxidation pathways, electron transport, and ATP turnover are tightly coupled processes, AOX provides a means to relax this coupling, thus providing a degree of metabolic homeostasis to carbon and energy metabolism. Beside their role in primary metabolism, plant mitochondria also act as “signaling organelles”, able to influence processes such as nuclear gene expression. AOX activity can control the level of potential mitochondrial signaling molecules such as superoxide, nitric oxide and important redox couples. In this way, AOX also provides a degree of signaling homeostasis to the organelle. Evidence suggests that AOX function in metabolic and signaling homeostasis is particularly important during stress. These include abiotic stresses such as low temperature, drought, and nutrient deficiency, as well as biotic stresses such as bacterial infection. This review provides an introduction to the genetic and biochemical control of AOX respiration, as well as providing generalized examples of how AOX activity can provide metabolic and signaling homeostasis. This review also examines abiotic and biotic stresses in which AOX respiration has been critically evaluated, and considers the overall role of AOX in growth and stress tolerance.

Peroxisomal Polyamine Oxidase and NADPH-Oxidase cross-talk for ROS homeostasis which affects respiration rate in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Efthimios A. Andronis

2014-04-01

Full Text Available Homeostasis of reactive oxygen species (ROS in the intracellular compartments is of critical importance as ROS have been linked with nearly all cellular processes and more importantly with diseases and aging. PAs are nitrogenous molecules with an evolutionary conserved role in the regulation of metabolic and energetic status of cells. Recent evidence also suggests that polyamines (PA are major regulators of ROS homeostasis. In Arabidopsis the backconversion of the PAs spermidine (Spd and spermine (Spm to putrescine (Put and Spd, respectively is catalyzed by two peroxisomal PA oxidases (AtPAO. However, the physiological role of this pathway remains largely elusive. Here we explore the role of peroxisomal PA backconversion and in particular that catalyzed by the highly expressed AtPAO3 in the regulation of ROS homeostasis and mitochondrial respiratory burst. Exogenous PAs exert an NADPH-oxidase dependent stimulation of oxygen consumption, with Spd exerting the strongest effect. This increase is attenuated by treatment with the NADPH-oxidase blocker diphenyleneiodonium iodide (DPI. Loss-of-function of AtPAO3 gene results to increased NADPH-oxidase-dependent production of superoxide anions (O2.-, but not H2O2, which activate the mitochondrial alternative oxidase pathway (AOX. On the contrary, overexpression of AtPAO3 results to an increased but balanced production of both H2O2 and O2.-. These results suggest that the ratio of O2.-/H2O2 regulates respiratory chain in mitochondria, with PA-dependent production of O2.- by NADPH-oxidase tilting the balance of electron transfer chain in favor of the AOX pathway. In addition, AtPAO3 seems to be an important component in the regulating module of ROS homeostasis, while a conserved role for PA backconversion and ROS across kingdoms is discussed.

Mitochondrial terminal alternative oxidase and its enhancement by thermal stress in the coral symbiont Symbiodinium

Science.gov (United States)

Oakley, Clinton A.; Hopkinson, Brian M.; Schmidt, Gregory W.

2014-06-01

A terminal electron acceptor alternative to mitochondrial cytochrome c oxidase (COX), mitochondrial alternative oxidase (AOX), is ubiquitous in higher plants and represented in nearly every algal taxon but is poorly documented in dinoflagellates. AOX competes for electrons with the conventional COX and has been hypothesized to function as a means of reducing oxidative stress in mitochondria, as well as a potential mechanism for ameliorating thermal and other physiological stressors. Here, the presence of an active AOX in cultured Symbiodinium was assayed by the response of oxygen consumption to the AOX inhibitor salicylhydroxamic acid (SHAM) and the COX inhibitor cyanide (CN). CN-insensitive, SHAM-sensitive oxygen consumption was found to account for a large portion (26 %) of Symbiodinium dark respiration and is consistent with high levels of AOX activity. This experimental evidence of the existence of a previously unreported terminal oxidase was further corroborated by analysis of publicly available Symbiodinium transcriptome data. The potential for enhanced AOX expression to play a compensatory role in mediating thermal stress was supported by inhibitor assays of cultured Symbiodinium at low (18 °C), moderate (26 °C), and high (32 °C) temperature conditions. Maximum capacity of the putative AOX pathway as a proportion of total dark oxygen consumption was found to increase from 26 % at 26 °C to 45 % and 53 % at 18 °C and 32 °C, respectively, when cells were acclimated to the treatment temperatures. Cells assayed at 18 and 32 °C without acclimation exhibited either the same or lower AOX capacity as controls, suggesting that the AOX protein is upregulated under temperature stress. The physiological implications for the presence of AOX in the coral/algal symbiosis and its potential role in response to many forms of biotic and abiotic stress, particularly oxidative stress, are discussed.

Identification of crucial amino acids in mouse aldehyde oxidase 3 that determine substrate specificity.

Directory of Open Access Journals (Sweden)

Martin Mahro

Full Text Available In order to elucidate factors that determine substrate specificity and activity of mammalian molybdo-flavoproteins we performed site directed mutagenesis of mouse aldehyde oxidase 3 (mAOX3. The sequence alignment of different aldehyde oxidase (AOX isoforms identified variations in the active site of mAOX3 in comparison to other AOX proteins and xanthine oxidoreductases (XOR. Based on the structural alignment of mAOX3 and bovine XOR, differences in amino acid residues involved in substrate binding in XORs in comparison to AOXs were identified. We exchanged several residues in the active site to the ones found in other AOX homologues in mouse or to residues present in bovine XOR in order to examine their influence on substrate selectivity and catalytic activity. Additionally we analyzed the influence of the [2Fe-2S] domains of mAOX3 on its kinetic properties and cofactor saturation. We applied UV-VIS and EPR monitored redox-titrations to determine the redox potentials of wild type mAOX3 and mAOX3 variants containing the iron-sulfur centers of mAOX1. In addition, a combination of molecular docking and molecular dynamic simulations (MD was used to investigate factors that modulate the substrate specificity and activity of wild type and AOX variants. The successful conversion of an AOX enzyme to an XOR enzyme was achieved exchanging eight residues in the active site of mAOX3. It was observed that the absence of the K889H exchange substantially decreased the activity of the enzyme towards all substrates analyzed, revealing that this residue has an important role in catalysis.

Direct Comparison of the Enzymatic Characteristics and Superoxide Production of the Four Aldehyde Oxidase Enzymes Present in Mouse.

Science.gov (United States)

Kücükgöze, Gökhan; Terao, Mineko; Garattini, Enrico; Leimkühler, Silke

2017-08-01

Aldehyde oxidases (AOXs) are molybdoflavoenzymes with an important role in the metabolism and detoxification of heterocyclic compounds and aliphatic as well as aromatic aldehydes. The enzymes use oxygen as the terminal electron acceptor and produce reduced oxygen species during turnover. Four different enzymes, mAOX1, mAOX3, mAOX4, and mAOX2, which are the products of distinct genes, are present in the mouse. A direct and simultaneous comparison of the enzymatic properties and characteristics of the four enzymes has never been performed. In this report, the four catalytically active mAOX enzymes were purified after heterologous expression in Escherichia coli The kinetic parameters of the four mouse AOX enzymes were determined and compared with the use of six predicted substrates of physiologic and toxicological interest, i.e., retinaldehyde, N 1 -methylnicotinamide, pyridoxal, vanillin, 4-(dimethylamino)cinnamaldehyde ( p- DMAC), and salicylaldehyde. While retinaldehyde, vanillin, p- DMAC, and salycilaldehyde are efficient substrates for the four mouse AOX enzymes, N 1 -methylnicotinamide is not a substrate of mAOX1 or mAOX4, and pyridoxal is not metabolized by any of the purified enzymes. Overall, mAOX1, mAOX2, mAOX3, and mAOX4 are characterized by significantly different K M and k cat values for the active substrates. The four mouse AOXs are also characterized by quantitative differences in their ability to produce superoxide radicals. With respect to this last point, mAOX2 is the enzyme generating the largest rate of superoxide radicals of around 40% in relation to moles of substrate converted, and mAOX1, the homolog to the human enzyme, produces a rate of approximately 30% of superoxide radicals with the same substrate. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

Alternative oxidase: a respiratory electron transport chain pathway essential for maintaining photosynthetic performance during drought stress.

Science.gov (United States)

Vanlerberghe, Greg C; Martyn, Greg D; Dahal, Keshav

2016-07-01

Photosynthesis and respiration are the hubs of energy metabolism in plants. Drought strongly perturbs photosynthesis as a result of both diffusive limitations resulting from stomatal closure, and in some cases biochemical limitations that are associated with a reduced abundance of key photosynthetic components. The effects of drought on respiration, particularly respiration in the light (RL ), are less understood. The plant mitochondrial electron transport chain includes a non-energy conserving terminal oxidase called alternative oxidase (AOX). Several studies have shown that drought increases AOX transcript, protein and maximum capacity. Here we review recent studies comparing wild-type (WT) tobacco to transgenic lines with altered AOX protein amount. Specifically during drought, RL was compromised in AOX knockdown plants and enhanced in AOX overexpression plants, compared with WT. Significantly, these differences in RL were accompanied by dramatic differences in photosynthetic performance. Knockdown of AOX increased the susceptibility of photosynthesis to drought-induced biochemical limitations, while overexpression of AOX delayed the development of such biochemical limitations, compared with WT. Overall, the results indicate that AOX is essential to maintaining RL during drought, and that this non-energy conserving respiration maintains photosynthesis during drought by promoting energy balance in the chloroplast. This review also outlines several areas for future research, including the possibility that enhancement of non-energy conserving respiratory electron sinks may be a useful biotechnological approach to increase plant performance during stress. © 2016 Scandinavian Plant Physiology Society.

An overview of aldehyde oxidase: an enzyme of emerging importance in novel drug discovery.

Science.gov (United States)

Rashidi, Mohammad-Reza; Soltani, Somaieh

2017-03-01

Given the rising trend in medicinal chemistry strategy to reduce cytochrome P450-dependent metabolism, aldehyde oxidase (AOX) has recently gained increased attention in drug discovery programs and the number of drug candidates that are metabolized by AOX is steadily growing. Areas covered: Despite the emerging importance of AOX in drug discovery, there are certain major recognized problems associated with AOX-mediated metabolism of drugs. Intra- and inter-species variations in AOX activity, the lack of reliable and predictive animal models using the common experimental animals, and failure in the predictions of in vivo metabolic activity of AOX using traditional in vitro methods are among these issues that are covered in this article. A comprehensive review of computational human AOX (hAOX) related studies are also provided. Expert opinion: Following the recent progress in the stem cell field, the authors recommend the application of organoids technology as an effective tool to solve the fundamental problems associated with the evaluation of AOX in drug discovery. The recent success in resolving the hAOX crystal structure can too be another valuable data source for the study of AOX-catalyzed metabolism of new drug candidates, using computer-aided drug discovery methods.

Alternative oxidase in the branched mitochondrial respiratory network: an overview on structure, function, regulation, and role

Directory of Open Access Journals (Sweden)

Sluse F.E.

1998-01-01

Full Text Available Plants and some other organisms including protists possess a complex branched respiratory network in their mitochondria. Some pathways of this network are not energy-conserving and allow sites of energy conservation to be bypassed, leading to a decrease of the energy yield in the cells. It is a challenge to understand the regulation of the partitioning of electrons between the various energy-dissipating and -conserving pathways. This review is focused on the oxidase side of the respiratory chain that presents a cyanide-resistant energy-dissipating alternative oxidase (AOX besides the cytochrome pathway. The known structural properties of AOX are described including transmembrane topology, dimerization, and active sites. Regulation of the alternative oxidase activity is presented in detail because of its complexity. The alternative oxidase activity is dependent on substrate availability: total ubiquinone concentration and its redox state in the membrane and O2 concentration in the cell. The alternative oxidase activity can be long-term regulated (gene expression or short-term (post-translational modification, allosteric activation regulated. Electron distribution (partitioning between the alternative and cytochrome pathways during steady-state respiration is a crucial measurement to quantitatively analyze the effects of the various levels of regulation of the alternative oxidase. Three approaches are described with their specific domain of application and limitations: kinetic approach, oxygen isotope differential discrimination, and ADP/O method (thermokinetic approach. Lastly, the role of the alternative oxidase in non-thermogenic tissues is discussed in relation to the energy metabolism balance of the cell (supply in reducing equivalents/demand in energy and carbon and with harmful reactive oxygen species formation.

Implications of terminal oxidase function in regulation of salicylic acid on soybean seedling photosynthetic performance under water stress.

Science.gov (United States)

Tang, Yanping; Sun, Xin; Wen, Tao; Liu, Mingjie; Yang, Mingyan; Chen, Xuefei

2017-03-01

The aim of this study is to investigate whether exogenous application of salicylic acid (SA) could modulate the photosynthetic capacity of soybean seedlings in water stress tolerance, and to clarify the potential functions of terminal oxidase (plastid terminal oxidase (PTOX) and alternative oxidase (AOX)) in SA' s regulation on photosynthesis. The effects of SA and water stress on gas exchange, pigment contents, chlorophyll fluorescence, enzymes (guaiacol peroxidase (POD; EC 1.11.1.7), superoxide dismutase (SOD; EC 1.15.1.1), catalase (CAT; EC 1.11.1.6), ascorbate peroxidase (APX; EC 1.11.1.11) and NADP-malate dehydrogenase (NADP-MDH; EC1.1.1.82)) activity and transcript levels of PTOX, AOX1, AOX2a, AOX2b were examined in a hydroponic cultivation system. Results indicate that water stress significantly decreased the photosynthetic rate (Pn), stomatal conductance (Gs), transpiration rate (E), pigment contents (Chla + b, Chla/b, Car), maximum quantum yield of PSⅡphotochemistry (Fv/Fm), efficiency of excitation capture of open PSⅡcenter (Fv'/Fm'), quantum efficiency of PSⅡphotochemistry (ΦPSⅡ), photochemical quenching (qP), and increased malondialdehyde (MDA) content and the activity of all the enzymes. SA pretreatment led to significant decreases in Ci and MDA content, and increases in Pn, Gs, E, pigment contents, Fv/Fm, Fv'/Fm', ΦPSⅡ, qP, and the activity of all the enzymes. SA treatment and water stress alone significantly up-regulated the expression of PTOX, AOX1 and AOX2b. SA pretreatment further increased the transcript levels of PTOX and AOX2b of soybean seedling under water stress. These results indicate that SA application alleviates the water stress-induced decrease in photosynthesis may mainly through maintaining a lower reactive oxygen species (ROS) level, a greater PSⅡefficiency, and an enhanced alternative respiration and chlororespiration. PTOX and AOX may play important roles in SA-mediated resistance to water stress. Copyright © 2016

Activity and functional interaction of alternative oxidase and uncoupling protein in mitochondria from tomato fruit

Directory of Open Access Journals (Sweden)

F.E. Sluse

2000-03-01

Full Text Available Cyanide-resistant alternative oxidase (AOX is not limited to plant mitochondria and is widespread among several types of protists. The uncoupling protein (UCP is much more widespread than previously believed, not only in tissues of higher animals but also in plants and in an amoeboid protozoan. The redox energy-dissipating pathway (AOX and the proton electrochemical gradient energy-dissipating pathway (UCP lead to the same final effect, i.e., a decrease in ATP synthesis and an increase in heat production. Studies with green tomato fruit mitochondria show that both proteins are present simultaneously in the membrane. This raises the question of a specific physiological role for each energy-dissipating system and of a possible functional connection between them (shared regulation. Linoleic acid, an abundant free fatty acid in plants which activates UCP, strongly inhibits cyanide-resistant respiration mediated by AOX. Moreover, studies of the evolution of AOX and UCP protein expression and of their activities during post-harvest ripening of tomato fruit show that AOX and plant UCP work sequentially: AOX activity decreases in early post-growing stages and UCP activity is decreased in late ripening stages. Electron partitioning between the alternative oxidase and the cytochrome pathway as well as H+ gradient partitioning between ATP synthase and UCP can be evaluated by the ADP/O method. This method facilitates description of the kinetics of energy-dissipating pathways and of ATP synthase when state 3 respiration is decreased by limitation of oxidizable substrate.

Fabrication and optimisation of optical biosensor using alcohol oxidase enzyme to evaluate detection of formaldehyde

Science.gov (United States)

Rachim, A.; Sari, A. P.; Nurlely, Fauzia, V.

2017-07-01

In this study, a new and simple biosensor base on alcohol oxidase (AOX)-enzyme for detecting formaldehyde in aqueous solutions has been successfully fabricated. The alcohol oxidase (AOX) enzyme was immobilized on poly-n-butyl acrylic-co-N-acryloxysuccinimide (nBA-NAS) membrane containing chromoionophore. The chemical reaction between AOX and formaldehyde generates a colour change of chromoionophore detected by optical absorbance measured in UV Vis. This paper focuses on the concentration optimization of buffer phosphate solution, response time, the quantity of enzyme and the measurement of the detection range of biosensors. The result shows that the optimum concentration and pH of buffer phosphate solution is 0.05 M and pH 7, respectively. The optimum response time is 3 min, the optimum unit of enzyme for biosensor is 1 unit/sample and the detection range of biosensor is 0.264 mM with R2 = 0.9421.

A classification scheme for alternative oxidases reveals the taxonomic distribution and evolutionary history of the enzyme in angiosperms.

Science.gov (United States)

Costa, José Hélio; McDonald, Allison E; Arnholdt-Schmitt, Birgit; Fernandes de Melo, Dirce

2014-11-01

A classification scheme based on protein phylogenies and sequence harmony method was used to clarify the taxonomic distribution and evolutionary history of the alternative oxidase (AOX) in angiosperms. A large data set analyses showed that AOX1 and AOX2 subfamilies were distributed into 4 phylogenetic clades: AOX1a-c/1e, AOX1d, AOX2a-c and AOX2d. High diversity in AOX family compositions was found. While the AOX2 subfamily was not detected in monocots, the AOX1 subfamily has expanded (AOX1a-e) in the large majority of these plants. In addition, Poales AOX1b and 1d were orthologous to eudicots AOX1d and then renamed as AOX1d1 and 1d2. AOX1 or AOX2 losses were detected in some eudicot plants. Several AOX2 duplications (AOX2a-c) were identified in eudicot species, mainly in the asterids. The AOX2b originally identified in eudicots in the Fabales order (soybean, cowpea) was divergent from AOX2a-c showing some specific amino acids with AOX1d and then it was renamed as AOX2d. AOX1d and AOX2d seem to be stress-responsive, facultative and mutually exclusive among species suggesting a complementary role with an AOX1(a) in stress conditions. Based on the data collected, we present a model for the evolutionary history of AOX in angiosperms and highlight specific areas where further research would be most beneficial. Copyright © 2014 Elsevier B.V. All rights reserved.

A discrete role for alternative oxidase under hypoxia to increase nitric oxide and drive energy production.

Science.gov (United States)

Vishwakarma, Abhaypratap; Kumari, Aprajita; Mur, Luis A J; Gupta, Kapuganti Jagadis

2018-03-28

Alternative oxidase (AOX) is an integral part of the mitochondrial electron transport and can prevent reactive oxygen species (ROS) and nitric oxide (NO) production under non-stressed, normoxic conditions. Here we assessed the roles of AOX by imposing stress under normoxia in comparison to hypoxic conditions using AOX over expressing (AOX OE) and anti-sense (AOX AS) transgenic Arabidopsis seedlings and roots. Under normoxic conditions stress was induced with the defence elicitor flagellin (flg22). AOX OE reduced NO production whilst this was increased in AOX AS. Moreover AOX AS also exhibited an increase in superoxide and therefore peroxynitrite, tyrosine nitration suggesting that scavenging of NO by AOX can prevent toxic peroxynitrite formation under normoxia. In contrast, during hypoxia interestingly we found that AOX is a generator of NO. Thus, the NO produced during hypoxia, was enhanced in AOX OE and suppressed in AOX AS. Additionally, treatment of WT or AOX OE with the AOX inhibitor SHAM inhibited hypoxic NO production. The enhanced levels of NO correlated with expression of non-symbiotic haemoglobin, increased NR activity and ATP production. The ATP generation was suppressed in nia1,2 mutant and non symbiotic haemoglobin antisense line treated with SHAM. Taken together these results suggest that hypoxic NO generation mediated by AOX has a discrete role by feeding into the haemoglobin-NO cycle to drive energy efficiency under conditions of low oxygen tension. Copyright © 2018 Elsevier Inc. All rights reserved.

Molecular characterization and expression of a novel alcohol oxidase from Aspergillus terreus MTCC6324.

Directory of Open Access Journals (Sweden)

Mitun Chakraborty

Full Text Available The alcohol oxidase (AOx cDNA from Aspergillus terreus MTCC6324 with an open reading frame (ORF of 2001 bp was constructed from n-hexadecane induced cells and expressed in Escherichia coli with a yield of ∼4.2 mg protein g-1 wet cell. The deduced amino acid sequences of recombinant rAOx showed maximum structural homology with the chain B of aryl AOx from Pleurotus eryngii. A functionally active AOx was achieved by incubating the apo-AOx with flavin adenine dinucleotide (FAD for ∼80 h at 16°C and pH 9.0. The isoelectric point and mass of the apo-AOx were found to be 6.5±0.1 and ∼74 kDa, respectively. Circular dichroism data of the rAOx confirmed its ordered structure. Docking studies with an ab-initio protein model demonstrated the presence of a conserved FAD binding domain with an active substrate binding site. The rAOx was specific for aryl alcohols and the order of its substrate preference was 4-methoxybenzyl alcohol >3-methoxybenzyl alcohol>3, 4-dimethoxybenzyl alcohol > benzyl alcohol. A significantly high aggregation to ∼1000 nm (diameter and catalytic efficiency (kcat/Km of 7829.5 min-1 mM-1 for 4-methoxybenzyl alcohol was also demonstrated for rAOx. The results infer the novelty of the AOx and its potential biocatalytic application.

Isolation and characterization of mutated alcohol oxidases from the yeast Hansenula polymorpha with decreased affinity toward substrates and their use as selective elements of an amperometric biosensor

Directory of Open Access Journals (Sweden)

Schuhmann Wolfgang

2007-06-01

Full Text Available Abstract Background Accurate, rapid, and economic on-line analysis of ethanol is very desirable. However, available biosensors achieve saturation at very low ethanol concentrations and thus demand the time and labour consuming procedure of sample dilution. Results Hansenula polymorpha (Pichia angusta mutant strains resistant to allyl alcohol in methanol medium were selected. Such strains possessed decreased affinity of alcohol oxidase (AOX towards methanol: the KM values for AOX of wild type and mutant strains CA2 and CA4 are shown to be 0.62, 2.48 and 1.10 mM, respectively, whereas Vmax values are increased or remain unaffected. The mutant AOX alleles from H. polymorpha mutants CA2 and CA4 were isolated and sequenced. Several point mutations in the AOX gene, mostly different between the two mutant alleles, have been identified. Mutant AOX forms were isolated and purified, and some of their biochemical properties were studied. An amperometric biosensor based on the mutated form of AOX from the strain CA2 was constructed and revealed an extended linear response to the target analytes, ethanol and formaldehyde, as compared to the sensor based on the native AOX. Conclusion The described selection methodology opens up the possibility of isolating modified forms of AOX with further decreased affinity toward substrates without reduction of the maximal velocity of reaction. It can help in creation of improved ethanol biosensors with a prolonged linear response towards ethanol in real samples of wines, beers or fermentation liquids.

Modified expression of alternative oxidase in transgenic tomato and petunia affects the level of tomato spotted wilt virus resistance.

Science.gov (United States)

Ma, Hao; Song, Congfeng; Borth, Wayne; Sether, Diane; Melzer, Michael; Hu, John

2011-10-20

Tomato spotted wilt virus (TSWV) has a very wide host range, and is transmitted in a persistent manner by several species of thrips. These characteristics make this virus difficult to control. We show here that the over-expression of the mitochondrial alternative oxidase (AOX) in tomato and petunia is related to TSWV resistance. The open reading frame and full-length sequence of the tomato AOX gene LeAox1au were cloned and introduced into tomato 'Healani' and petunia 'Sheer Madness' using Agrobacterium-mediated transformation. Highly expressed AOX transgenic tomato and petunia plants were selfed and transgenic R1 seedlings from 10 tomato lines and 12 petunia lines were used for bioassay. For each assayed line, 22 to 32 tomato R1 progeny in three replications and 39 to 128 petunia progeny in 13 replications were challenged with TSWV. Enzyme-Linked Immunosorbent Assays showed that the TSWV levels in transgenic tomato line FKT4-1 was significantly lower than that of wild-type controls after challenge with TSWV. In addition, transgenic petunia line FKP10 showed significantly less lesion number and smaller lesion size than non-transgenic controls after inoculation by TSWV. In all assayed transgenic tomato lines, a higher percentage of transgenic progeny had lower TSWV levels than non-transgenic plants after challenge with TSWV, and the significantly increased resistant levels of tomato and petunia lines identified in this study indicate that altered expression levels of AOX in tomato and petunia can affect the levels of TSWV resistance.

Modified expression of alternative oxidase in transgenic tomato and petunia affects the level of tomato spotted wilt virus resistance

Directory of Open Access Journals (Sweden)

Ma Hao

2011-10-01

Full Text Available Abstract Background Tomato spotted wilt virus (TSWV has a very wide host range, and is transmitted in a persistent manner by several species of thrips. These characteristics make this virus difficult to control. We show here that the over-expression of the mitochondrial alternative oxidase (AOX in tomato and petunia is related to TSWV resistance. Results The open reading frame and full-length sequence of the tomato AOX gene LeAox1au were cloned and introduced into tomato 'Healani' and petunia 'Sheer Madness' using Agrobacterium-mediated transformation. Highly expressed AOX transgenic tomato and petunia plants were selfed and transgenic R1 seedlings from 10 tomato lines and 12 petunia lines were used for bioassay. For each assayed line, 22 to 32 tomato R1 progeny in three replications and 39 to 128 petunia progeny in 13 replications were challenged with TSWV. Enzyme-Linked Immunosorbent Assays showed that the TSWV levels in transgenic tomato line FKT4-1 was significantly lower than that of wild-type controls after challenge with TSWV. In addition, transgenic petunia line FKP10 showed significantly less lesion number and smaller lesion size than non-transgenic controls after inoculation by TSWV. Conclusion In all assayed transgenic tomato lines, a higher percentage of transgenic progeny had lower TSWV levels than non-transgenic plants after challenge with TSWV, and the significantly increased resistant levels of tomato and petunia lines identified in this study indicate that altered expression levels of AOX in tomato and petunia can affect the levels of TSWV resistance.

Kinetics of AOX Formation in Chlorine Dioxide Bleaching of Bagasse Pulp

Directory of Open Access Journals (Sweden)

Shuangxi Nie

2014-07-01

Full Text Available In this paper, a kinetic model of the first chlorine dioxide bleaching stage (D0 in an elemental chlorine-free (ECF bleaching sequence is presented for bagasse pulps. The model is based on the rate of adsorbable organic halogen (AOX formation. The effects of the chlorine dioxide dosage, the sulfuric acid dosage, and the reaction temperature on the AOX content of wastewater are examined. The reaction of AOX formation could be divided into two periods. A large amount of AOX was formed rapidly within the first 10 min. Ten minutes later, the AOX formation rate significantly decreased. The kinetics could be expressed as: dW⁄dt=660.8•e^(-997.98/T 〖•[ClO〗_2 ]^0.877•[H2SO4 ]^0.355•W^(-1.065, where W is the AOX content, t is the bleaching time (min, T is the temperature (K, [ClO2] is the dosage of chlorine dioxide (kg/odt, and [H2SO4] is the dosage of sulfuric acid (kg/odt. The fit of the experiment results obtained for different temperatures, initial chlorine dioxide dosages, initial sulfuric acid dosages, and AOX content were very good, revealing the ability of the model to predict typical mill operating conditions.

Nitric oxide induces the alternative oxidase pathway in Arabidopsis seedlings deprived of inorganic phosphate.

Science.gov (United States)

Royo, Beatriz; Moran, Jose F; Ratcliffe, R George; Gupta, Kapuganti J

2015-10-01

Phosphate starvation compromises electron flow through the cytochrome pathway of the mitochondrial electron transport chain, and plants commonly respond to phosphate deprivation by increasing flow through the alternative oxidase (AOX). To test whether this response is linked to the increase in nitric oxide (NO) production that also increases under phosphate starvation, Arabidopsis thaliana seedlings were grown for 15 d on media containing either 0 or 1mM inorganic phosphate. The effects of the phosphate supply on growth, the production of NO, respiration, the AOX level and the production of superoxide were compared for wild-type (WT) seedlings and the nitrate reductase double mutant nia. Phosphate deprivation increased NO production in WT roots, and the AOX level and the capacity of the alternative pathway to consume electrons in WT seedlings; whereas the same treatment failed to stimulate NO production and AOX expression in the nia mutant, and the plants had an altered growth phenotype. The NO donor S-nitrosoglutathione rescued the growth phenotype of the nia mutants under phosphate deprivation to some extent, and it also increased the respiratory capacity of AOX. It is concluded that NO is required for the induction of the AOX pathway when seedlings are grown under phosphate-limiting conditions. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Probing the ubiquinol-binding site of recombinant Sauromatum guttatum alternative oxidase expressed in E. coli membranes through site-directed mutagenesis.

Science.gov (United States)

Young, Luke; May, Benjamin; Pendlebury-Watt, Alice; Shearman, Julia; Elliott, Catherine; Albury, Mary S; Shiba, Tomoo; Inaoka, Daniel Ken; Harada, Shigeharu; Kita, Kiyoshi; Moore, Anthony L

2014-07-01

In the present paper we have investigated the effect of mutagenesis of a number of highly conserved residues (R159, D163, L177 and L267) which we have recently shown to line the hydrophobic inhibitor/substrate cavity in the alternative oxidases (AOXs). Measurements of respiratory activity in rSgAOX expressed in Escherichia coli FN102 membranes indicate that all mutants result in a decrease in maximum activity of AOX and in some cases (D163 and L177) a decrease in the apparent Km (O2). Of particular importance was the finding that when the L177 and L267 residues, which appear to cause a bottleneck in the hydrophobic cavity, are mutated to alanine the sensitivity to AOX antagonists is reduced. When non-AOX anti-malarial inhibitors were also tested against these mutants widening the bottleneck through removal of isobutyl side chain allowed access of these bulkier inhibitors to the active-site and resulted in inhibition. Results are discussed in terms of how these mutations have altered the way in which the AOX's catalytic cycle is controlled and since maximum activity is decreased we predict that such mutations result in an increase in the steady state level of at least one O2-derived AOX intermediate. Such mutations should therefore prove to be useful in future stopped-flow and electron paramagnetic resonance experiments in attempts to understand the catalytic cycle of the alternative oxidase which may prove to be important in future rational drug design to treat diseases such as trypanosomiasis. Furthermore since single amino acid mutations in inhibitor/substrate pockets have been found to be the cause of multi-drug resistant strains of malaria, the decrease in sensitivity to main AOX antagonists observed in the L-mutants studied in this report suggests that an emergence of drug resistance to trypanosomiasis may also be possible. Therefore we suggest that the design of future AOX inhibitors should have structures that are less reliant on the orientation by the two

Inhibitory effects of drugs on the metabolic activity of mouse and human aldehyde oxidases and influence on drug-drug interactions.

Science.gov (United States)

Takaoka, Naoki; Sanoh, Seigo; Okuda, Katsuhiro; Kotake, Yaichiro; Sugahara, Go; Yanagi, Ami; Ishida, Yuji; Tateno, Chise; Tayama, Yoshitaka; Sugihara, Kazumi; Kitamura, Shigeyuki; Kurosaki, Mami; Terao, Mineko; Garattini, Enrico; Ohta, Shigeru

2018-04-17

As aldehyde oxidase (AOX) plays an emerging role in drug metabolism, understanding its significance for drug-drug interactions (DDI) is important. Therefore, we tested 10 compounds for species-specific and substrate-dependent differences in the inhibitory effect of AOX activity using genetically engineered HEK293 cells over-expressing human AOX1, mouse AOX1 or mouse AOX3. The IC 50 values of 10 potential inhibitors of the three AOX enzymes were determined using phthalazine and O 6 -benzylguanine as substrates. 17β-Estradiol, menadione, norharmane and raloxifene exhibited marked differences in inhibitory effects between the human and mouse AOX isoforms when the phthalazine substrate was used. Some of the compounds tested exhibited substrate-dependent differences in their inhibitory effects. Docking simulations with human AOX1 and mouse AOX3 were conducted for six representative inhibitors. The rank order of the minimum binding energy reflected the order of the corresponding IC 50 values. We also evaluated the potential DDI between an AOX substrate (O 6 -benzylguanine) and an inhibitor (hydralazine) using chimeric mice with humanized livers. Pretreatment of hydralazine increased the maximum plasma concentration (C max ) and the area under the plasma concentration-time curve (AUC 0-24 ) of O 6 -benzylguanine compared to single administration. Our in vitro data indicate species-specific and substrate-dependent differences in the inhibitory effects on AOX activity. Our in vivo data demonstrate the existence of a DDI which may be of relevance in the clinical context. Copyright © 2018 Elsevier Inc. All rights reserved.

Performance of optical biosensor using alcohol oxidase enzyme for formaldehyde detection

Science.gov (United States)

Sari, A. P.; Rachim, A.; Nurlely, Fauzia, V.

2017-07-01

The recent issue in the world is the long exposure of formaldehyde which is can increase the risk of human health, therefore, that is very important to develop a device and method that can be optimized to detect the formaldehyde elements accurately, have a long lifetime and can be fabricated and produced in large quantities. A new and simple prepared optical biosensor for detection of formaldehyde in aqueous solutions using alcohol oxidase (AOX) enzyme was successfully fabricated. The poly-n-butyl acrylic-co-N-acryloxysuccinimide (nBA-NAS) membranes containing chromoionophore ETH5294 were used for immobilization of alcohol oxidase enzyme (AOX). Biosensor response was based on the colour change of chromoionophore as a result of enzymatic oxidation of formaldehyde and correlated with the detection concentration of formaldehyde. The performance of biosensor parameters were measured through the optical absorption value using UV-Vis spectrophotometer including the repeatability, reproducibility, selectivity and lifetime. The results showed that the prepared biosensor has good repeatability (RSD = 1.9 %) and good reproducibility (RSD = 2.1 %). The biosensor was selective formaldehyde with no disturbance by methanol, ethanol, and acetaldehyde, and also stable before 49 days and decrease by 41.77 % after 49 days.

Inducing the Alternative Oxidase Forms Part of the Molecular Strategy of Anoxic Survival in Freshwater Bivalves

Science.gov (United States)

Yusseppone, Maria S.; Rocchetta, Iara; Sabatini, Sebastian E.; Luquet, Carlos M.; Ríos de Molina, Maria del Carmen; Held, Christoph; Abele, Doris

2018-01-01

Hypoxia in freshwater ecosystems is spreading as a consequence of global change, including pollution and eutrophication. In the Patagonian Andes, a decline in precipitation causes reduced lake water volumes and stagnant conditions that limit oxygen transport and exacerbate hypoxia below the upper mixed layer. We analyzed the molecular and biochemical response of the North Patagonian bivalve Diplodon chilensis after 10 days of experimental anoxia (<0.2 mg O2/L), hypoxia (2 mg O2/L), and normoxia (9 mg O2/L). Specifically, we investigated the expression of an alternative oxidase (AOX) pathway assumed to shortcut the regular mitochondrial electron transport system (ETS) during metabolic rate depression (MRD) in hypoxia-tolerant invertebrates. Whereas, the AOX system was strongly upregulated during anoxia in gills, ETS activities and energy mobilization decreased [less transcription of glycogen phosphorylase (GlyP) and succinate dehydrogenase (SDH) in gills and mantle]. Accumulation of succinate and induction of malate dehydrogenase (MDH) activity could indicate activation of anaerobic mitochondrial pathways to support anoxic survival in D. chilensis. Oxidative stress [protein carbonylation, glutathione peroxidase (GPx) expression] and apoptotic intensity (caspase 3/7 activity) decreased, whereas an unfolded protein response (HSP90) was induced under anoxia. This is the first clear evidence of the concerted regulation of the AOX and ETS genes in a hypoxia-tolerant freshwater bivalve and yet another example that exposure to hypoxia and anoxia is not necessarily accompanied by oxidative stress in hypoxia-tolerant mollusks. PMID:29527172

Inducing the Alternative Oxidase Forms Part of the Molecular Strategy of Anoxic Survival in Freshwater Bivalves

Directory of Open Access Journals (Sweden)

Maria S. Yusseppone

2018-02-01

Full Text Available Hypoxia in freshwater ecosystems is spreading as a consequence of global change, including pollution and eutrophication. In the Patagonian Andes, a decline in precipitation causes reduced lake water volumes and stagnant conditions that limit oxygen transport and exacerbate hypoxia below the upper mixed layer. We analyzed the molecular and biochemical response of the North Patagonian bivalve Diplodon chilensis after 10 days of experimental anoxia (<0.2 mg O2/L, hypoxia (2 mg O2/L, and normoxia (9 mg O2/L. Specifically, we investigated the expression of an alternative oxidase (AOX pathway assumed to shortcut the regular mitochondrial electron transport system (ETS during metabolic rate depression (MRD in hypoxia-tolerant invertebrates. Whereas, the AOX system was strongly upregulated during anoxia in gills, ETS activities and energy mobilization decreased [less transcription of glycogen phosphorylase (GlyP and succinate dehydrogenase (SDH in gills and mantle]. Accumulation of succinate and induction of malate dehydrogenase (MDH activity could indicate activation of anaerobic mitochondrial pathways to support anoxic survival in D. chilensis. Oxidative stress [protein carbonylation, glutathione peroxidase (GPx expression] and apoptotic intensity (caspase 3/7 activity decreased, whereas an unfolded protein response (HSP90 was induced under anoxia. This is the first clear evidence of the concerted regulation of the AOX and ETS genes in a hypoxia-tolerant freshwater bivalve and yet another example that exposure to hypoxia and anoxia is not necessarily accompanied by oxidative stress in hypoxia-tolerant mollusks.

Mitochondrial energy-dissipating systems (alternative oxidase, uncoupling proteins, and external NADH dehydrogenase) are involved in development of frost-resistance of winter wheat seedlings.

Science.gov (United States)

Grabelnych, O I; Borovik, O A; Tauson, E L; Pobezhimova, T P; Katyshev, A I; Pavlovskaya, N S; Koroleva, N A; Lyubushkina, I V; Bashmakov, V Yu; Popov, V N; Borovskii, G B; Voinikov, V K

2014-06-01

Gene expression, protein synthesis, and activities of alternative oxidase (AOX), uncoupling proteins (UCP), adenine nucleotide translocator (ANT), and non-coupled NAD(P)H dehydrogenases (NDex, NDPex, and NDin) were studied in shoots of etiolated winter wheat (Triticum aestivum L.) seedlings after exposure to hardening low positive (2°C for 7 days) and freezing (-2°C for 2 days) temperatures. The cold hardening efficiently increased frost-resistance of the seedlings and decreased the generation of reactive oxygen species (ROS) during further cold shock. Functioning of mitochondrial energy-dissipating systems can represent a mechanism responsible for the decrease in ROS under these conditions. These systems are different in their response to the action of the hardening low positive and freezing temperatures. The functioning of the first system causes induction of AOX and UCP synthesis associated with an increase in electron transfer via AOX in the mitochondrial respiratory chain and also with an increase in the sensitivity of mitochondrial non-phosphorylating respiration to linoleic and palmitic acids. The increase in electron transfer via AOX upon exposure of seedlings to hardening freezing temperature is associated with retention of a high activity of NDex. It seems that NDex but not the NDPex and NDin can play an important role in maintaining the functional state of mitochondria in heterotrophic tissues of plants under the influence of freezing temperatures. The involvement of the mitochondrial energy-dissipating systems and their possible physiological role in the adaptation of winter crops to cold and frost are discussed.

Changes in the activity of the alternative oxidase in Orobanche seeds during conditioning and their possible physiological function.

Science.gov (United States)

Bar Nun, Nurit; Plakhine, Dina; Joel, Daniel M; Mayer, Alfred M

2003-09-01

The appearance of the activity of the cyanide insensitive, alternative oxidase (AOX), pathway of oxygen uptake was followed in seeds of Orobanche aegyptiaca during conditioning. The pathway becomes operative during conditioning, up to day three as determined by inhibition of oxygen uptake of the seeds by propyl gallate. At the same time an increasing percentage of oxygen uptake is insensitive to cyanide and an increased oxygen uptake, responsive to propyl gallate, is induced by brief salicylic acid treatment of seeds. By day six of conditioning, these responses decrease and the AOX pathway could not be detected in germinating seeds, after treatment with a germination stimulant. These results were confirmed by following the reaction of extracts of fractions enriched with mitochondria from the conditioned seeds, using a specific antibody against AOX. Treatment of the seeds with inhibitors of AOX during conditioning significantly inhibited their subsequent germination. Addition of hydrogen peroxide after 4 and 7 days of conditioning resulted in reduced germination. In addition treatment of seed with propyl or octyl gallate during conditioning reduced the infection of tomato plants by Orobanche seeds and the development of tubercles of the parasite on the host roots. These results together indicate that the operation of AOX during conditioning has a significant function on the subsequent germination behaviour and pathogenicity of the root parasite. Some potential practical applications of these findings are discussed.

Cytokinin-induced cell death is associated with elevated expression of alternative oxidase in tobacco BY-2 cells.

Science.gov (United States)

Mlejnek, Petr

2013-10-01

N(6)-benzyladenine (BA) and N(6)-benzyladenosine ([9R]BA) induce massive production of reactive oxygen species (ROS) that is eventually followed by a loss of cell viability in tobacco BY-2 cells (Mlejnek et al. Plant Cell Environ 26:1723-1735, 2003, Plant Sci 168:389-395, 2005). Results presented in this work suggest that the main sources of ROS are likely mitochondria and that the maintenance of the mitochondrial transmembrane potential is crucial for ROS production in cytokinin-treaded BY-2 cells. Therefore, the possible involvement of alternative oxidase (AOX) in cell death process induced by BA and [9R]BA was studied. About three- to fourfold increase in mRNA levels of AOX1 was observed a few hours after the BA and [9R]BA addition into the growth medium. The elevated expression of AOX1 mRNA could be prevented by adding adenine and adenosine which simultaneously reduced the cytotoxic effects of BA and [9R]BA, respectively. N(6)-benzyladenine 7-β-D-glucoside ([7G]BA) which is a common non-toxic metabolite of BA and [9R]BA did not affect the AOX1 mRNA expression. Although AOX1 seemed to be involved in protection of BY-2 cells against the abiotic stress induced by BA and [9R]BA, the results do not support the idea that it protects cells from death exclusively by scavenging of reactive oxygen species. Indeed, N-propyl gallate, an inhibitor of AOX, decreased cell survival despite it concomitantly decreased the ROS production. This finding is in contrast to the effect of salicylhydroxamic acid, another well-known inhibitor of AOX, which also increased the number of dying cells while it increased the ROS production.

Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

Science.gov (United States)

Diane Dietrich; Casey Crooks

2009-01-01

A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

Molecular evolution of the polyamine oxidase gene family in Metazoa

Directory of Open Access Journals (Sweden)

Polticelli Fabio

2012-06-01

Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported

Gene cloning and characterization of NADH oxidase from ...

African Journals Online (AJOL)

The genome search of Thermococcus kodakarensis revealed three open reading frames, Tk0304, Tk1299 and Tk1392 annotated as nicotinamide adenine dinucleotide (NADH) oxidases. This study deals with cloning, and characterization of Tk0304. The gene, composed of 1320 nucleotides, encodes a protein of 439 ...

Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

Science.gov (United States)

Hiesel, Rudolf; Brennicke, Axel

1983-01-01

The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

A novel amperometric alcohol biosensor developed in a 3rd generation bioelectrode platform using peroxidase coupled ferrocene activated alcohol oxidase as biorecognition system.

Science.gov (United States)

Chinnadayyala, Somasekhar R; Kakoti, Ankana; Santhosh, Mallesh; Goswami, Pranab

2014-05-15

Alcohol oxidase (AOx) with a two-fold increase in efficiency (Kcat/Km) was achieved by physical entrapment of the activator ferrocene in the protein matrix through a simple microwave based partial unfolding technique and was used to develop a 3rd generation biosensor for improved detection of alcohol in liquid samples. The ferrocene molecules were stably entrapped in the AOx protein matrix in a molar ratio of ~3:1 through electrostatic interaction with the Trp residues involved in the functional activity of the enzyme as demonstrated by advanced analytical techniques. The sensor was fabricated by immobilizing ferrocene entrapped alcohol oxidase (FcAOx) and sol-gel chitosan film coated horseradish peroxidase (HRP) on a multi-walled carbon nanotube (MWCNT) modified glassy carbon electrode through layer-by-layer technique. The bioelectrode reactions involved the formation of H2O2 by FcAOx biocatalysis of substrate alcohol followed by HRP-catalyzed reduction of the liberated H2O2 through MWCNT supported direct electron transfer mechanism. The amperometric biosensor exhibited a linear response to alcohol in the range of 5.0 × 10(-6) to 30 × 10(-4)mol L(-1) with a detection limit of 2.3 × 10(-6) mol L(-1), and a sensitivity of 150 µA mM(-1) cm(-2). The biosensor response was steady for 28 successive measurements completed in a period of 5h and retained ~90% of the original response even after four weeks when stored at 4 °C. The biosensor was successfully applied for the determination of alcohol in commercial samples and its performance was validated by comparing with the data obtained by GC analyses of the samples. © 2013 Published by Elsevier B.V.

Simultaneous removal of AOX and COD from real recycled paper wastewater using GAC-SBBR.

Science.gov (United States)

Osman, Wan Hasnidah Wan; Abdullah, Siti Rozaimah Sheikh; Mohamad, Abu Bakar; Kadhum, Abdul Amir H; Rahman, Rakmi Abd

2013-05-30

A lab-scale granular activated carbon sequencing batch biofilm reactor (GAC-SBBR), a combined adsorption and biological process, was developed to treat real wastewater from a recycled paper mill. In this study, one-consortia of mixed culture (4000-5000 mg/L) originating from recycled paper mill activated sludge from Kajang, Malaysia was acclimatized. The GAC-SBBR was fed with real wastewater taken from the same recycled paper mill, which had a high concentration of chemical oxygen demand (COD) and adsorbable organic halides (AOX). The operational duration of the GAC-SBBR was adjusted from 48 h to 24, 12 and finally 8 h to evaluate the effect of the hydraulic retention time (HRT) on the simultaneous removal of COD and AOX. The COD and AOX removals were in the range of 53-92% and 26-99%, respectively. From this study, it was observed that the longest HRT (48 h) yielded a high removal of COD and AOX, at 92% and 99%, respectively. Copyright © 2013 Elsevier Ltd. All rights reserved.

Color, TOC and AOX removals from pulp mill effluent by advanced oxidation processes: A comparative study

International Nuclear Information System (INIS)

Catalkaya, Ebru Cokay; Kargi, Fikret

2007-01-01

Pulp mill effluent containing toxic chemicals was treated by different advanced oxidation processes (AOPs) consisting of treatments by hydrogen peroxide, Fenton's reagent (H 2 O 2 /Fe 2+ ), UV, UV/H 2 O 2 , photo-Fenton (UV/H 2 O 2 /Fe 2+ ), ozonation and peroxone (ozone/H 2 O 2 ) in laboratory-scale reactors for color, total organic carbon (TOC) and adsorbable organic halogens (AOX) removals from the pulp mill effluent. Effects of some operating parameters such as the initial pH, oxidant and catalyst concentrations on TOC, color, AOX removals were investigated. Almost every method used resulted in some degree of color removal from the pulp mill effluent. However, the Fenton's reagent utilizing H 2 O 2 /Fe 2+ resulted in the highest color, TOC and AOX removals under acidic conditions when compared with the other AOPs tested. Approximately, 88% TOC, 85% color and 89% AOX removals were obtained by the Fenton's reagent at pH 5 within 30 min. Photo-Fenton process yielded comparable TOC (85%), color (82%) and AOX (93%) removals within 5 min due to oxidations by UV light in addition to the Fenton's reagent. Fast oxidation reactions by the photo-Fenton treatment makes this approach more favorable as compared to the others used

Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

African Journals Online (AJOL)

The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

Transgenic cassava lines carrying heterologous alternative oxidase ...

African Journals Online (AJOL)

Afuape

2013-07-03

Jul 3, 2013 ... Organized embryogenic callus development: In our experiment, somatic embryos were developed from leaf lobes collected from transgenic cassava lines carrying the AtAOX1a gene. Immature leaf lobes measuring about 1 to 6 mm obtained from about six weeks old in vitro derived plants were used.

Xylanase-Aided Chlorine Dioxide Bleaching of Bagasse Pulp to Reduce AOX Formation

Directory of Open Access Journals (Sweden)

Yi Dai

2016-02-01

Full Text Available Xylanase pretreatment was used to improve the chlorine dioxide bleaching of bagasse pulp. The pulp was pretreated with xylanase, which was followed by a chlorine dioxide bleaching stage. The HexA content of the pulp and the AOX content of the bleaching effluent were measured using UV-Vis and GC-MS methods, respectively. The results showed that a good correlation occurred between HexA and kappa number. HexA content of the pulp decreased significantly after the xylanase pretreatment. The AOX content of the bleaching effluent decreased as HexA was removed from the pulp. It was found that AOX could be reduced by up to 29.8%, comparing XD0 with a D0 stage. Fourier transform infrared spectroscopy (FTIR was employed to determine the breakage of chemical bonds in the pulp. It revealed that some lignin and hemicellulose were removed after xylanase treatment. The GC-MS results showed that some toxic chloride such as 2,4,6-trichlorophenol could be completely removed after xylanase pretreatment.

ADVANCED OXIDATION PROCESSES (AOX) TEXTILE WASTEWATER

OpenAIRE

Salas C., G.

2014-01-01

Advanced Oxidation Processes (AOX) are based on the in situ generation of hydroxyradicals (·OH), which have a high oxidation potential. In the case of Fenton processes !he generation of hydroxy radicals takes place by the combination of an oxidation agent (H202) with a catalyst (Fe(II)). These radicals are not selective and they react very fast with the organic matter,being able to oxidize a high variety of organic compounds. This property allows the degradation of pollutants into more biodeg...

EXPRESSION OF SOME ANTIOXIDANT GENES IN SUNFLOWER INFECTED WITH BROOMRAPE

Directory of Open Access Journals (Sweden)

Tatiana Shestakova

2015-11-01

Full Text Available Expression levels of ROS-scavenging genes (MnSODI, APX3 and AOX1A in leaves (R5 stage; 90 days after sowing of seven sunflower genotypes infected with three Orobanche cumana Wallr. populations were assayed in plants with/without broomrape aerial shoots and control group. Five lines were highly susceptible to all three populations. MS-2161A was resistant and MS-2039A was tolerant to broomrape populations. The expression of studied genes was much more altered in highly susceptible genotypes than in those resistant. Significant differences in number of cases of ROS-scavenging genes with modified transcriptional activity in infected and non-symptomatic plants were not ascertained. The transcriptional activity of MnSODI, APX3 and AOX1A genes was weakly influenced by infection with broomrape (67 % cases or was down-regulated (24 % cases. Some up-regulation cases (9 % for MnSODI (MS-2039 and AOX1A gene (MS-2067 were revealed. AOX1A was the most responsive gene, especially when infection was produced by population from Anenii Noi. 

A Potentiometric Formaldehyde Biosensor Based on Immobilization of Alcohol Oxidase on Acryloxysuccinimide-modified Acrylic Microspheres

Directory of Open Access Journals (Sweden)

Lee Yook Heng

2010-11-01

Full Text Available A new alcohol oxidase (AOX enzyme-based formaldehyde biosensor based on acrylic microspheres has been developed. Hydrophobic poly(n-butyl acrylate-N-acryloxy-succinimide [poly(nBA-NAS] microspheres, an enzyme immobilization matrix, was synthesized using photopolymerization in an emulsion form. AOX-poly(nBA-NAS microspheres were deposited on a pH transducer made from a layer of photocured and self-plasticized polyacrylate membrane with an entrapped pH ionophore coated on a Ag/AgCl screen printed electrode (SPE. Oxidation of formaldehyde by the immobilized AOX resulted in the production of protons, which can be determined via the pH transducer. Effects of buffer concentrations, pH and different amount of immobilization matrix towards the biosensor’s analytical performance were investigated. The formaldehyde biosensor exhibited a dynamic linear response range to formaldehyde from 0.3–316.2 mM and a sensitivity of 59.41 ± 0.66 mV/decade (R2 = 0.9776, n = 3. The lower detection limit of the biosensor was 0.3 mM, while reproducibility and repeatability were 3.16% RSD (relative standard deviation and 1.11% RSD, respectively (n = 3. The use of acrylic microspheres in the potentiometric formaldehyde biosensor improved the biosensor’s performance in terms of response time, linear response range and long term stability when compared with thick film immobilization methods.

Integrative response of plant mitochondrial electron transport chain to nitrogen source.

Science.gov (United States)

Hachiya, Takushi; Noguchi, Ko

2011-02-01

Nitrogen (N) availability is widely known as a determinant of plant growth and respiration rate. However, less attention has been paid to the effect of the type of N source (nitrate, nitrite or ammonium) on the respiratory system. This review summarizes the latest findings on this topic, with an emphasis on the effect of ammonium and nitric oxide (NO) on the respiratory system, and the physiological role of alternative oxidase (AOX). First, concentrated ammonium has been found to increase plant respiration rate (ammonium-dependent respiratory increase, ARI). We will introduce two hypotheses to explain ARI, futile ammonium cycling and excess reducing equivalents, and verify the validity of each hypothesis. We suggest that these two hypotheses are not necessarily mutually exclusive. Second, gene expression of AOX is suppressed when N is predominately available as nitrate instead of ammonium. We will discuss possible signaling pathways leading to this expression pattern. Third, while AOX expression is induced by NO, AOX activity itself is insensitive to NO. In contrast, activity of cytochrome c oxidase (COX) is sensitive to NO. We outline the NO production pathway, focusing on nitrite-dependent NO production, and discuss the physiological significance of the fact that AOX activity is insensitive to NO. Finally, this review aims to build an integrated scheme of the respiratory response to the type of N source, considering leaves in high light conditions or hypoxic roots.

Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha

NARCIS (Netherlands)

Bruinenberg, P. G.; Evers, M.; Waterham, H. R.; Kuipers, J.; Arnberg, A. C.; AB, G.

1989-01-01

We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC 1.4.3.6) from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence

Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

Science.gov (United States)

Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

2015-09-29

The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

AOX determination in industrial waste water according to EN 1485, DEV H14. Experience with high salt freights and interfering organic matter; AOX-Bestimmungen in Industrieabwaessern nach EN 1485, DEV H14 Erfahrungen mit hohen Salzfrachten und organischen Stoerstoffen

Energy Technology Data Exchange (ETDEWEB)

Helmreich, B. [Technische Univ. Muenchen, Garching (Germany). Lehrstuhl und Pruefamt fuer Wasserguete- und Abfallwirtschaft

1999-07-01

AOX determination in industrial waste water is not always trivial on account of high salt freights or high organic loads. Interfering substances of inorganic or organic nature can cause increases or decreases of readings that often are not plausible or reproducible. In most cases the AOX enrichment step is limiting to quantitative analysis. In the present work, enrichment in two industrial waste waters was critically assessed according to EN 1485 DEV H14. In addition, experience with the enrichment method according to Dr. Lange is reported. For the elimination of high salt freights beside a low organic concentration, cleanup by means of solid-phase extraction is considered. The results suggest that the standardized procedure is not universally applicable to any type of sample. However, appropriate action can minimize flaws of enrichment and, thereby, AOX determination. (orig.) [German] Die AOX-Bestimmung aus Industrieabwaessern ist aufgrund hoher Salzfrachten oder hoher organischer Belastungen nicht immer trivial. Stoerstoffe anorganischer wie auch organischer Art koennen zu Mehr- oder Minderbefunden fuehren, die oft nicht plausibel und reproduzierbar sind. In den meisten Faellen ist der Anreicherungsschritt des AOX fuer die quantitative Analyse limitierend. In der vorliegenden Arbeit wurde die Anreicherung nach den EN 1485 DEV H14 fuer zwei Industrieabwaesser kritisch betrachtet. Zudem werden Erfahrungen mit der Anreicherungsmethode nach Dr. Lange vorgestellt. Zur Entfernung hoher Salzfrachten neben einer geringen organischen Konzentration wurde ein Clean-up mittels Festphasenextraktion betrachtet. Die Ergebnisse legen nahe, dass das genormte Verfahren nicht universell auf jeden Probentyp anwendbar ist. Durch ein gezieltes Vorgehen koennen jedoch Fehler bei der Anreicherung und damit bei der AOX-Bestimmung minimiert werden. (orig.)

An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

Energy Technology Data Exchange (ETDEWEB)

Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)

1997-03-01

An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

An Adaptation to Low Copper in Candida albicans Involving SOD Enzymes and the Alternative Oxidase.

Directory of Open Access Journals (Sweden)

Chynna N Broxton

Full Text Available In eukaryotes, the Cu/Zn superoxide dismutase (SOD1 is a major cytosolic cuproprotein with a small fraction residing in the mitochondrial intermembrane space (IMS to protect against respiratory superoxide. Curiously, the opportunistic human fungal pathogen Candida albicans is predicted to express two cytosolic SODs including Cu/Zn containing SOD1 and manganese containing SOD3. As part of a copper starvation response, C. albicans represses SOD1 and induces the non-copper alternative SOD3. While both SOD1 and SOD3 are predicted to exist in the same cytosolic compartment, their potential role in mitochondrial oxidative stress had yet to be investigated. We show here that under copper replete conditions, a fraction of the Cu/Zn containing SOD1 localizes to the mitochondrial IMS to guard against mitochondrial superoxide. However in copper starved cells, localization of the manganese containing SOD3 is restricted to the cytosol leaving the mitochondrial IMS devoid of SOD. We observe that during copper starvation, an alternative oxidase (AOX form of respiration is induced that is not coupled to ATP synthesis but maintains mitochondrial superoxide at low levels even in the absence of IMS SOD. Surprisingly, the copper-dependent cytochrome c oxidase (COX form of respiration remains high with copper starvation. We provide evidence that repression of SOD1 during copper limitation serves to spare copper for COX and maintain COX respiration. Overall, the complex copper starvation response of C. albicans involving SOD1, SOD3 and AOX minimizes mitochondrial oxidative damage whilst maximizing COX respiration essential for fungal pathogenesis.

Salicylic Acid Regulation of Respiration in Higher Plants: Alternative Oxidase Expression.

Science.gov (United States)

Rhoads, DM; McIntosh, L

1992-01-01

Alternative respiratory pathway capacity increases during the development of the thermogenic appendix of a voodoo lily inflorescence. The levels of the alternative oxidase proteins increased dramatically between D-4 (4 days prior to the day of anthesis) and D-3 and continued to increase until the day of anthesis (D-day). The level of salicylic acid (SA) in the appendix is very low early on D-1, but increases to a high level in the evening of D-1. Thermogenesis occurs after a few hours of light on D-day. Therefore, the initial accumulation of the alternative oxidase proteins precedes the increase in SA by 3 days, indicating that other regulators may be involved. A 1.6-kb transcript encoding the alternative oxidase precursor protein accumulated to a high level in the appendix tissue by D-1. Application of SA to immature appendix tissue caused an increase in alternative pathway capacity and a dramatic accumulation of the alternative oxidase proteins and the 1.6-kb transcript. Time course experiments showed that the increase in capacity, protein levels, and transcript level corresponded precisely. The response to SA was blocked by cycloheximide or actinomycin D, indicating that de novo transcription and translation are required. However, nuclear, in vitro transcription assays indicated that the accumulation of the 1.6-kb transcript did not result from a simple increase in the rate of transcription of aox1. PMID:12297672

Biological Effects of Potato Plants Transformation with Glucose Oxidase Gene and their Resistance to Hyperthermia

Directory of Open Access Journals (Sweden)

O.I. Grabelnych

2017-02-01

Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.

Influence of methanol/sorbitol co-feeding rate on pAOX1 induction in a Pichia pastoris Mut+ strain in bioreactor with limited oxygen transfer rate.

Science.gov (United States)

Carly, F; Niu, H; Delvigne, F; Fickers, P

2016-04-01

High Pichia pastoris biomass density could be obtained using high co-feeding rate of methanol and sorbitol in a fed-batch or continuous culture, while further higher feeding rate finally leads to oxygen limitation in bioreactor. In the literature, there is lack of report about AOX1 promoter regulation with regard to dissolved oxygen level (DO). Therefore, in this work, chemostat cultures were performed to investigate the cell growth, metabolism and regulation of the AOX1 promoter (pAOX1) regarding co-feeding rate of optimized methanol/sorbitol mixture (methanol fraction 0.60 C-mol/C-mol) using a P. pastoris Mut+/pAOX1-lacZ strain. The oxygen transfer rates (OTR) in bioreactor were kept in the range of typical values of large bioreactor, i.e., 4-8 g/(L h) if DO equals 30 % saturation or 5-10 g/(L h) if DO nears zero. For DO >0, an increase of the carbon fed led to an increase of pAOX1 induction. By contrast, when dissolved oxygen was completely depleted, methanol accumulated, causing a 30 % decrease of pAOX1 induction. However, this decrease is more likely to be lined to methanol accumulation than to low level of dissolved oxygen (sorbitol co-feeding allowed cells to adapt to oxygen transient limitations that often occur at industrial scale with reduced effect on pAOX1 induction. The optimal feeding rate tested here was 6.6 mmol C (DCW h)(-1) at an OTR of 8.28 g O2(L h)(-1) with over fivefold pAOX1 induction (probably directly associated with target protein productivity) compared with previous work.

The terminal oxidases of Paracoccus denitrificans

NARCIS (Netherlands)

de Gier, J.-W.; Lübben, M; Reijnders, W N; Tipker, C A; Slotboom, D.J.; van Spanning, R J; Stouthamer, A.H.; van der Oost, J.

Three distinct types of terminal oxidases participate in the aerobic respiratory pathways of Paracoccus denitrificans. Two alternative genes encoding subunit I of the aa3-type cytochrome c oxidase have been isolated before, namely ctaDI and ctaDII. Each of these genes can be expressed separately to

A quantitative study of methanol/sorbitol co-feeding process of a Pichia pastoris Mut+/pAOX1-lacZ strain

Science.gov (United States)

2013-01-01

Background One of the main challenges for heterologous protein production by the methylotrophic yeast Pichia pastoris at large-scale is related to its high oxygen demand. A promising solution is a co-feeding strategy based on a methanol/sorbitol mixture during the induction phase. Nonetheless, a deep understanding of the cellular physiology and the regulation of the AOX1 promoter, used to govern heterologous protein production, during this co-feeding strategy is still scarce. Results Transient continuous cultures with a dilution rate of 0.023 h-1 at 25°C were performed to quantitatively assess the benefits of a methanol/sorbitol co-feeding process with a Mut+ strain in which the pAOX1-lacZ construct served as a reporter gene. Cell growth and metabolism, including O2 consumption together with CO2 and heat production were analyzed with regard to a linear change of methanol fraction in the mixed feeding media. In addition, the regulation of the promoter AOX1 was investigated by means of β-galactosidase measurements. Our results demonstrated that the cell-specific oxygen consumption (qO2) could be reduced by decreasing the methanol fraction in the feeding media. More interestingly, maximal β-galactosidase cell-specific activity (>7500 Miller unit) and thus, optimal pAOX1 induction, was achieved and maintained in the range of 0.45 ~ 0.75 C-mol/C-mol of methanol fraction. In addition, the qO2 was reduced by 30% at most in those conditions. Based on a simplified metabolic network, metabolic flux analysis (MFA) was performed to quantify intracellular metabolic flux distributions during the transient continuous cultures, which further shed light on the advantages of methanol/sorbitol co-feeding process. Finally, our observations were further validated in fed-batch cultures. Conclusion This study brings quantitative insight into the co-feeding process, which provides valuable data for the control of methanol/sorbitol co-feeding, aiming at enhancing biomass and

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

OpenAIRE

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...

Alternative oxidase pathway optimizes photosynthesis during osmotic and temperature stress by regulating cellular ROS, malate valve and antioxidative systems

Directory of Open Access Journals (Sweden)

DINAKAR eCHALLABATHULA

2016-02-01

Full Text Available The present study reveals the importance of alternative oxidase (AOX pathway in optimizing photosynthesis under osmotic and temperature stress conditions in the mesophyll protoplasts of Pisum sativum. The responses of photosynthesis and respiration were monitored at saturating light intensity of 1000 µmoles m-2 s-1 at 25 oC under a range of sorbitol concentrations from 0.4 M to 1.0M to induce hyper-osmotic stress and by varying the temperature of the thermo-jacketed pre-incubation chamber from 25 oC to 10 oC to impose sub-optimal temperature stress. Compared to controls (0.4 M sorbitol and 25 OC, the mesophyll protoplasts showed remarkable decrease in NaHCO3-dependent O2 evolution (indicator of photosynthetic carbon assimilation, under both hyper-osmotic (1.0 M sorbitol and sub-optimal temperature stress conditions (10 OC, while the decrease in rates of respiratory O2 uptake were marginal. The capacity of AOX pathway increased significantly in parallel to increase in intracellular pyruvate and reactive oxygen species (ROS levels under both hyper-osmotic stress and sub-optimal temperature stress under the background of saturating light. The ratio of redox couple (Malate/OAA related to malate valve increased in contrast to the ratio of redox couple (GSH/GSSG related to antioxidative system during hyper-osmotic stress. Nevertheless, the ratio of GSH/GSSG decreased in the presence of sub-optimal temperature, while the ratio of Malate/OAA showed no visible changes. Also, the redox ratios of pyridine nucleotides increased under hyper-osmotic (NADH/NAD and sub-optimal temperature (NADPH/NADP stresses, respectively. However, upon restriction of AOX pathway by using salicylhydroxamic acid (SHAM, the observed changes in NaHCO3 dependent O2 evolution, cellular ROS, redox ratios of Malate/OAA, NAD(PH/NAD(P and GSH/GSSG were further aggravated under stress conditions with concomitant modulations in NADP-MDH and antioxidant enzymes. Taken together, the

Molecular characterisation and expression analysis of acc oxidase gene from guzmania ruiz and pav

International Nuclear Information System (INIS)

Jianxin, L.; Huaqiao, D.; Weiyong, W.; Danqing, T.

2017-01-01

ACC oxidase is the last key enzyme of ethylene synthesis pathway, while ethylene is a key factor affecting flowering in ornamental bromeliad. To understand ACC oxidase gene's characteristics and its effect on ornamental bromeliad flowering, we cloned 1504bp full-length cDNA sequence (GenBank: JX972145) and 2546bp corresponding genomic sequence (GenBank: JX972146)of GoACO1 (ACC oxidase gene) from Guzmania variety: Ostara. Prokaryotic expression study showed that expression of GoACO1 can produced a 41 KD protein precipitation in Escherichia coli DE3(BL-21); Real-time quantitative analysis showed that GoACO1 can express in all tested tissues including floral organ, bract, leaf and scape, and expression quantity in bract was the highest. Through constructing plant overexpression vector, transforming into Arabidopsis thaliana, and investigating blossom character of T2 generation seeds, we found that first flowering time of the goal Arabidopsis thaliana was 1.5 days earlier, and their peak flowering time(the number of flowering more than 50%) was 1.8 days earlier, compared with wild type one. Taken together, our results suggested that GoACO1can express in all kinds of tissues and seems to promote Arabidopsis thaliana flowering earlier. (author)

A quantitative study of methanol/sorbitol co-feeding process of a Pichia pastoris Mut⁺/pAOX1-lacZ strain.

Science.gov (United States)

Niu, Hongxing; Jost, Laurent; Pirlot, Nathalie; Sassi, Hosni; Daukandt, Marc; Rodriguez, Christian; Fickers, Patrick

2013-04-08

One of the main challenges for heterologous protein production by the methylotrophic yeast Pichia pastoris at large-scale is related to its high oxygen demand. A promising solution is a co-feeding strategy based on a methanol/sorbitol mixture during the induction phase. Nonetheless, a deep understanding of the cellular physiology and the regulation of the AOX1 promoter, used to govern heterologous protein production, during this co-feeding strategy is still scarce. Transient continuous cultures with a dilution rate of 0.023 h(-1) at 25°C were performed to quantitatively assess the benefits of a methanol/sorbitol co-feeding process with a Mut+ strain in which the pAOX1-lacZ construct served as a reporter gene. Cell growth and metabolism, including O2 consumption together with CO2 and heat production were analyzed with regard to a linear change of methanol fraction in the mixed feeding media. In addition, the regulation of the promoter AOX1 was investigated by means of β-galactosidase measurements. Our results demonstrated that the cell-specific oxygen consumption (qO2) could be reduced by decreasing the methanol fraction in the feeding media. More interestingly, maximal β-galactosidase cell-specific activity (>7500 Miller unit) and thus, optimal pAOX1 induction, was achieved and maintained in the range of 0.45 ~ 0.75 C-mol/C-mol of methanol fraction. In addition, the qO2 was reduced by 30% at most in those conditions. Based on a simplified metabolic network, metabolic flux analysis (MFA) was performed to quantify intracellular metabolic flux distributions during the transient continuous cultures, which further shed light on the advantages of methanol/sorbitol co-feeding process. Finally, our observations were further validated in fed-batch cultures. This study brings quantitative insight into the co-feeding process, which provides valuable data for the control of methanol/sorbitol co-feeding, aiming at enhancing biomass and heterologous protein productivities

Kinetics of Adsorbable Organic Halides (AOX Reduction in Laccase-Aided Chlorine Dioxide Bleaching of Bagasse Pulp

Directory of Open Access Journals (Sweden)

Xueping Song

2016-07-01

Full Text Available This paper presents a kinetic model of the laccase-aided chlorine dioxide bleaching of bagasse pulp. The kinetic model was based on the rate of reduction of adsorbed organic halogen (AOX. The effects of the laccase enzyme dosage, the mediator 1-hydroxybenzotriazole (HBT dosage, and the reaction temperature on the AOX content of the bleaching effluent are discussed. Good fits were obtained for the experimental data obtained from the different laccase enzyme dosages, HBT dosages, and reaction temperatures, indicating the feasibility of the kinetic model as a means of predicting the optimal operation conditions for the laccase-aided chlorine dioxide bleaching of bagasse pulp in the future.

[THE INFLUENCE OF SEROTONIN TRANSPORTER AND MONOAMINE OXIDASE A GENES POLYMORPHISM ON PSYCHO-EMOTION AND KARYOLOGICAL STABILITY OF ATHLETES].

Science.gov (United States)

Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A

2015-11-01

The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.

Biogenesis of mitochondria in cauliflower (Brassica oleracea var. botrytis) curds subjected to temperature stress and recovery involves regulation of the complexome, respiratory chain activity, organellar translation and ultrastructure.

Science.gov (United States)

Rurek, Michal; Woyda-Ploszczyca, Andrzej M; Jarmuszkiewicz, Wieslawa

2015-01-01

The biogenesis of the cauliflower curd mitochondrial proteome was investigated under cold, heat and the recovery. For the first time, two dimensional fluorescence difference gel electrophoresis was used to study the plant mitochondrial complexome in heat and heat recovery. Particularly, changes in the complex I and complex III subunits and import proteins, and the partial disintegration of matrix complexes were observed. The presence of unassembled subunits of ATP synthase was accompanied by impairment in mitochondrial translation of its subunit. In cold and heat, the transcription profiles of mitochondrial genes were uncorrelated. The in-gel activities of respiratory complexes were particularly affected after stress recovery. Despite a general stability of respiratory chain complexes in heat, functional studies showed that their activity and the ATP synthesis yield were affected. Contrary to cold stress, heat stress resulted in a reduced efficiency of oxidative phosphorylation likely due to changes in alternative oxidase (AOX) activity. Stress and stress recovery differently modulated the protein level and activity of AOX. Heat stress induced an increase in AOX activity and protein level, and AOX1a and AOX1d transcript level, while heat recovery reversed the AOX protein and activity changes. Conversely, cold stress led to a decrease in AOX activity (and protein level), which was reversed after cold recovery. Thus, cauliflower AOX is only induced by heat stress. In heat, contrary to the AOX activity, the activity of rotenone-insensitive internal NADH dehydrogenase was diminished. The relevance of various steps of plant mitochondrial biogenesis to temperature stress response and recovery is discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis

Science.gov (United States)

Kwak, June M.; Mori, Izumi C.; Pei, Zhen-Ming; Leonhardt, Nathalie; Torres, Miguel Angel; Dangl, Jeffery L.; Bloom, Rachel E.; Bodde, Sara; Jones, Jonathan D.G.; Schroeder, Julian I.

2003-01-01

Reactive oxygen species (ROS) have been proposed to function as second messengers in abscisic acid (ABA) signaling in guard cells. However, the question whether ROS production is indeed required for ABA signal transduction in vivo has not yet been addressed, and the molecular mechanisms mediating ROS production during ABA signaling remain unknown. Here, we report identification of two partially redundant Arabidopsis guard cell-expressed NADPH oxidase catalytic subunit genes, AtrbohD and AtrbohF, in which gene disruption impairs ABA signaling. atrbohD/F double mutations impair ABA-induced stomatal closing, ABA promotion of ROS production, ABA-induced cytosolic Ca2+ increases and ABA- activation of plasma membrane Ca2+-permeable channels in guard cells. Exogenous H2O2 rescues both Ca2+ channel activation and stomatal closing in atrbohD/F. ABA inhibition of seed germination and root elongation are impaired in atrbohD/F, suggesting more general roles for ROS and NADPH oxidases in ABA signaling. These data provide direct molecular genetic and cell biological evidence that ROS are rate-limiting second messengers in ABA signaling, and that the AtrbohD and AtrbohF NADPH oxidases function in guard cell ABA signal transduction. PMID:12773379

Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

Science.gov (United States)

Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

1998-01-01

In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.

Role of Lysyl oxidase-like 1 gene polymorphisms in Pakistani patients with pseudoexfoliative glaucoma

NARCIS (Netherlands)

Micheal, S.; Khan, M.I.; Akhtar, F.; Ali, M.; Ahmed, A.; Hollander, A.I. den; Qamar, R.

2012-01-01

PURPOSE: Single nucleotide polymorphisms (SNPs) rs1048661 (p.R141L) and rs3825942 (p.G153D) in the lysyl oxidase-like 1 (LOXL1) gene have been previously reported to be associated with pseudoexfoliation glaucoma (PEXG) in various Asian and European populations, but these SNPs have not yet been

Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

Science.gov (United States)

Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

2016-08-01

Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

Expression Profile of Genes Related to Drug Metabolism in Human Brain Tumors.

Directory of Open Access Journals (Sweden)

Pantelis Stavrinou

Full Text Available Endogenous and exogenous compounds as well as carcinogens are metabolized and detoxified by phase I and II enzymes, the activity of which could be crucial to the inactivation and hence susceptibility to carcinogenic factors. The expression of these enzymes in human brain tumor tissue has not been investigated sufficiently. We studied the association between tumor pathology and the expression profile of seven phase I and II drug metabolizing genes (CYP1A1, CYP1B1, ALDH3A1, AOX1, GSTP1, GSTT1 and GSTM3 and some of their proteins.Using qRT-PCR and western blotting analysis the gene and protein expression in a cohort of 77 tumors were investigated. The major tumor subtypes were meningioma, astrocytoma and brain metastases, -the later all adenocarcinomas from a lung primary.Meningeal tumors showed higher expression levels for AOX1, CYP1B1, GSTM3 and GSTP1. For AOX1, GSTM and GSTP1 this could be verified on a protein level as well. A negative correlation between the WHO degree of malignancy and the strength of expression was identified on both transcriptional and translational level for AOX1, GSTM3 and GSTP1, although the results could have been biased by the prevalence of meningiomas and glioblastomas in the inevitably bipolar distribution of the WHO grades. A correlation between the gene expression and the protein product was observed for AOX1, GSTP1 and GSTM3 in astrocytomas.The various CNS tumors show different patterns of drug metabolizing gene expression. Our results suggest that the most important factor governing the expression of these enzymes is the histological subtype and to a far lesser extent the degree of malignancy itself.

Cloning and molecular analyses of a gibberellin 20-oxidase gene expressed specifically in developing seeds of watermelon.

Science.gov (United States)

Kang, H G; Jun, S H; Kim, J; Kawaide, H; Kamiya, Y; An, G

1999-10-01

To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA(12) at C-20 to the C(19) compound GA(9), a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the beta-glucuronidase (GUS) gene. In a transient expression system, beta-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds.

Transient Transcriptional Regulation of the CYS-C1 Gene and Cyanide Accumulation upon Pathogen Infection in the Plant Immune Response1[C][W

Science.gov (United States)

García, Irene; Rosas, Tábata; Bejarano, Eduardo R.; Gotor, Cecilia; Romero, Luis C.

2013-01-01

Cyanide is produced concomitantly with ethylene biosynthesis. Arabidopsis (Arabidopsis thaliana) detoxifies cyanide primarily through the enzyme β-cyanoalanine synthase, mainly by the mitochondrial CYS-C1. CYS-C1 loss of function is not toxic for the plant and leads to an increased level of cyanide in cys-c1 mutants as well as a root hairless phenotype. The classification of genes differentially expressed in cys-c1 and wild-type plants reveals that the high endogenous cyanide content of the cys-c1 mutant is correlated with the biotic stress response. Cyanide accumulation and CYS-C1 gene expression are negatively correlated during compatible and incompatible plant-bacteria interactions. In addition, cys-c1 plants present an increased susceptibility to the necrotrophic fungus Botrytis cinerea and an increased tolerance to the biotrophic Pseudomonas syringae pv tomato DC3000 bacterium and Beet curly top virus. The cys-c1 mutation produces a reduction in respiration rate in leaves, an accumulation of reactive oxygen species, and an induction of the alternative oxidase AOX1a and pathogenesis-related PR1 expression. We hypothesize that cyanide, which is transiently accumulated during avirulent bacterial infection and constitutively accumulated in the cys-c1 mutant, uncouples the respiratory electron chain dependent on the cytochrome c oxidase, and this uncoupling induces the alternative oxidase activity and the accumulation of reactive oxygen species, which act by stimulating the salicylic acid-dependent signaling pathway of the plant immune system. PMID:23784464

Adaptation of respiratory chain biogenesis to cytochrome c oxidase deficiency caused by SURF1 gene mutations

Czech Academy of Sciences Publication Activity Database

Kovářová, Nikola; Vrbacká-Čížková, Alena; Pecina, Petr; Stránecký, V.; Pronicka, E.; Kmoch, S.; Houštěk, Josef

2012-01-01

Roč. 1822, č. 7 (2012), s. 1114-1124 ISSN 0925-4439 R&D Projects: GA MZd(CZ) NS9759; GA MZd(CZ) NT12370; GA ČR(CZ) GD305/08/H037 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : mitochondrial disorder * SURF1 gene * Leigh syndrome * gene expression * oxidative phosphorylation * cytochrome c oxidase Subject RIV: FG - Pediatrics Impact factor: 4.910, year: 2012

NADPH oxidase is involved in regulation of gene expression and ROS overproduction in soybean (Glycine max L. seedlings exposed to cadmium

Directory of Open Access Journals (Sweden)

Jagna Chmielowska-Bąk

2017-06-01

Full Text Available Cadmium-induced oxidative burst is partially mediated by NADPH oxidase. The aim of the present research was to evaluate the role of NADPH oxidase in soybeans’ response to short-term cadmium stress. The application of an NADPH oxidase inhibitor, diphenyleneiodonium chloride (DPI, affected expression of two Cd-inducible genes, encoding DOF1 and MYBZ2 transcription factors. This effect was observed after 3 h of treatment. Interestingly, Cd-dependent increases in NADPH oxidase activity occurred only after a period of time ranging from 6 and 24 h of stress. Stimulation of the enzyme correlated in time with a significant accumulation of reactive oxygen species (ROS. Further analysis revealed that pharmacological inhibition of NADPH oxidase activity during 24 h of Cd stress does not affect Cd uptake, seedling growth, or the level of lipid peroxidation. The role of NADPH oxidase in the response of soybean seedlings to short-term Cd exposure is discussed.

Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

Science.gov (United States)

Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-01-01

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

Cloning and Molecular Analyses of a Gibberellin 20-Oxidase Gene Expressed Specifically in Developing Seeds of Watermelon1

Science.gov (United States)

Kang, Hong-Gyu; Jun, Sung-Hoon; Kim, Junyul; Kawaide, Hiroshi; Kamiya, Yuji; An, Gynheung

1999-01-01

To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA12 at C-20 to the C19 compound GA9, a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the β-glucuronidase (GUS) gene. In a transient expression system, β-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds. PMID:10517828

Isolated sulfite oxidase deficiency.

Science.gov (United States)

Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

1996-12-01

Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp.

Directory of Open Access Journals (Sweden)

Hamed Esmaeil Lashgarian

2016-10-01

Full Text Available Cholesterol oxidase (CHO is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. This enzyme was produced by several bacterial strains. Wild type enzyme produced by Rhodococcus sp. secret two forms of CHO enzyme: extra cellular and membrane bound type which its amount is low and unstable. The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. CHO gene was isolated from native bacteria and cloned into pET23a. In the next step, the construct was expressed in E.coli BL21 and induced by different concentration of IPTG ranges from 0.1 - 0.9 mM. This gene contains 1642 bp and encodes a protein consists of 533 amino acids. It has about 96 % homology with CHO gene isolated from Rhodococcus equi. The high expression was obtained in 0.5 mM concentration of IPTG after 4 hour induction. This recombinant enzyme had a molecular weight of 55 kDa, that secretion of intra cellular type is much more than extracellular form. The optimum pH and temperature conditions for the recombinant enzyme were 7.5 and 45°C, respectively. CHO enzyme obtained from Rhodococcus sp. is a cheap enzyme with medical and industrial applications that can be produced easily and purified in large scale with simple methods.

A role for NADPH oxidase in antigen presentation

Directory of Open Access Journals (Sweden)

Gail J Gardiner

2013-09-01

Full Text Available The nicotinamide adenine dinucleotide phosphate (NADPH oxidase expressed in phagocytes is a multi-subunit enzyme complex that generates superoxide (O2.-. This radical is an important precursor of hydrogen peroxide (H2O2 and other reactive oxygen species (ROS needed for microbicidal activity during innate immune responses. Inherited defects in NADPH oxidase give rise to chronic granulomatous disease (CGD, a primary immunodeficiency characterized by recurrent infections and granulomatous inflammation. Interestingly, CGD, CGD carrier status, and oxidase gene polymorphisms have all been associated with autoinflammatory and autoimmune disorders, suggesting a potential role for NADPH oxidase in regulating adaptive immune responses. Here, NADPH oxidase function in antigen processing and presentation is reviewed. NADPH oxidase influences dendritic cell (DC crosspresentation by major histocompatibility complex class I molecules (MHC-I through regulation of the phagosomal microenvironment, while in B lymphocytes, NADPH oxidase alters epitope selection by major histocompatibility complex class II molecules (MHC-II.

Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

Science.gov (United States)

Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

2015-02-01

Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.

Co-ordinate expression of glycine betaine synthesis genes linked by the FMDV 2A region in a single open reading frame in Pichia pastoris.

Science.gov (United States)

Wang, Sanhong; Yao, Quanhong; Tao, Jianmin; Qiao, Yushan; Zhang, Zhen

2007-12-01

The genes encoding the two enzymes choline monooxygenase (CMO) and betaine aldehyde dehydrogenase (BADH) of glycine betaine synthesis in Suaeda salsa were cloned and fused with the 2A region of foot-and-mouth disease virus in a single open reading frame. The fused genes were placed under the control of the alcohol oxidase (AOX1) promoter in pPIC3B and transformed into P. pastoris GS115. The expression of the fused genes in P. pastoris and the ability of recombinant yeasts to tolerate environmental stresses were studied. The results showed that induced with 0.5% methanol for 96 h, the maximal activities of CMO and BADH in the tested recombinant yeasts were 45- and 44-fold higher than those in the control yeast transformed empty vector only, respectively; the content of glycine betaine in the recombinant yeasts was 28- to 35-fold higher than that in the control. The fused genes linked by 2A region of foot-and-mouth disease virus were expressed in P. pastoris successfully and the polyprotein was 'cleaved' to each functional protein. The yeasts transformed the fused genes, which were more resistant to salt, methanol, and high temperature stresses than the control as result of glycine betaine synthesis genes introduced.

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study.

Science.gov (United States)

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-05-01

Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of

Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

Science.gov (United States)

Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

2004-01-01

A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins.

Science.gov (United States)

Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo

2003-04-01

We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.

Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose.

Science.gov (United States)

Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L

2017-03-01

It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

Science.gov (United States)

Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

2009-01-01

The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.

Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

Science.gov (United States)

Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

2015-12-01

Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.

Associations Between Genetic Variants of NADPH Oxidase-Related Genes and Blood Pressure Responses to Dietary Sodium Intervention: The GenSalt Study.

Science.gov (United States)

Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng

2017-04-01

The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

Science.gov (United States)

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

Gene cloning and characterization of NADH oxidase from ...

African Journals Online (AJOL)

use

2011-12-07

Dec 7, 2011 ... potent inhibitors of NADH oxidases, silver nitrate and potassium cyanide did not show any significant ... anaerobes, a class of organisms that have not been ... DNA and amino acid sequence analyses were performed using.

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Effects of temperature and glycerol and methanol-feeding profiles on the production of recombinant galactose oxidase in Pichia pastoris

Science.gov (United States)

Anasontzis, George E; Salazar Penã, Margarita; Spadiut, Oliver; Brumer, Harry; Olsson, Lisbeth

2014-01-01

Optimization of protein production from methanol-induced Pichia pastoris cultures is necessary to ensure high productivity rates and high yields of recombinant proteins. We investigated the effects of temperature and different linear or exponential methanol-feeding rates on the production of recombinant Fusarium graminearum galactose oxidase (EC 1.1.3.9) in a P. pastoris Mut+ strain, under regulation of the AOX1 promoter. We found that low exponential methanol feeding led to 1.5-fold higher volumetric productivity compared to high exponential feeding rates. The duration of glycerol feeding did not affect the subsequent product yield, but longer glycerol feeding led to higher initial biomass concentration, which would reduce the oxygen demand and generate less heat during induction. A linear and a low exponential feeding profile led to productivities in the same range, but the latter was characterized by intense fluctuations in the titers of galactose oxidase and total protein. An exponential feeding profile that has been adapted to the apparent biomass concentration results in more stable cultures, but the concentration of recombinant protein is in the same range as when constant methanol feeding is employed. © 2014 The Authors Biotechnology Progress published by Wiley Periodicals, Inc. on behalf of American Institute of Chemical Engineers Biotechnol. Prog., 30:728–735, 2014 PMID:24493559

Genetics Home Reference: isolated sulfite oxidase deficiency

Science.gov (United States)

... and Management Resources (1 link) GeneReview: Isolated Sulfite Oxidase Deficiency General Information from MedlinePlus (5 links) Diagnostic Tests Drug Therapy Genetic Counseling Palliative Care Surgery and ...

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora.

Directory of Open Access Journals (Sweden)

Yan Zhao

Full Text Available BACKGROUND: The mitochondrial cytochrome c oxidase subunit I (COI gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. CONCLUSIONS: Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales.

Science.gov (United States)

Pöggeler, Stefanie

2011-04-01

Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.

Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza

OpenAIRE

Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

2017-01-01

Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially exp...

Arctic Observing Experiment (AOX) Field Campaign Report

Energy Technology Data Exchange (ETDEWEB)

Rigor, Ignatius [Applied Physics Lab, University of Washington; Johnson, Jim [Applied Physics Lab, University of Washington; Motz, Emily [National Ice Center; Bisic, Aaron [National Ice Center

2017-06-30

Our ability to understand and predict weather and climate requires an accurate observing network. One of the pillars of this network is the observation of the fundamental meteorological parameters: temperature, air pressure, and wind. We plan to assess our ability to measure these parameters for the polar regions during the Arctic Observing Experiment (AOX, Figure 1) to support the International Arctic Buoy Programme (IABP), Arctic Observing Network (AON), International Program for Antarctic Buoys (IPAB), and Southern Ocean Observing System (SOOS). Accurate temperature measurements are also necessary to validate and improve satellite measurements of surface temperature across the Arctic. Support for research associated with the campaign is provided by the National Science Foundation, and by other US agencies contributing to the US Interagency Arctic Buoy Program. In addition to the support provided by the U.S Department of Energy (DOE) Atmospheric Radiation Measurement (ARM) Climate Research Facility’s North Slope of Alaska (NSA) site at Barrow and the National Science Foundation (NSF), the U.S. IABP is supported by the U.S. Coast Guard (USCG), the National Aeronautics and Space Administration (NASA), the National Ice Center (NIC), the National Oceanic and Atmospheric Administration (NOAA), and the Office of Naval Research (ONR).

A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

Science.gov (United States)

Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

2000-01-01

The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

Science.gov (United States)

Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

1991-01-01

Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

A reference gene set for sex pheromone biosynthesis and degradation genes from the diamondback moth, Plutella xylostella, based on genome and transcriptome digital gene expression analyses.

Science.gov (United States)

He, Peng; Zhang, Yun-Fei; Hong, Duan-Yang; Wang, Jun; Wang, Xing-Liang; Zuo, Ling-Hua; Tang, Xian-Fu; Xu, Wei-Ming; He, Ming

2017-03-01

Female moths synthesize species-specific sex pheromone components and release them to attract male moths, which depend on precise sex pheromone chemosensory system to locate females. Two types of genes involved in the sex pheromone biosynthesis and degradation pathways play essential roles in this important moth behavior. To understand the function of genes in the sex pheromone pathway, this study investigated the genome-wide and digital gene expression of sex pheromone biosynthesis and degradation genes in various adult tissues in the diamondback moth (DBM), Plutella xylostella, which is a notorious vegetable pest worldwide. A massive transcriptome data (at least 39.04 Gb) was generated by sequencing 6 adult tissues including male antennae, female antennae, heads, legs, abdomen and female pheromone glands from DBM by using Illumina 4000 next-generation sequencing and mapping to a published DBM genome. Bioinformatics analysis yielded a total of 89,332 unigenes among which 87 transcripts were putatively related to seven gene families in the sex pheromone biosynthesis pathway. Among these, seven [two desaturases (DES), three fatty acyl-CoA reductases (FAR) one acetyltransferase (ACT) and one alcohol dehydrogenase (AD)] were mainly expressed in the pheromone glands with likely function in the three essential sex pheromone biosynthesis steps: desaturation, reduction, and esterification. We also identified 210 odorant-degradation related genes (including sex pheromone-degradation related genes) from seven major enzyme groups. Among these genes, 100 genes are new identified and two aldehyde oxidases (AOXs), one aldehyde dehydrogenase (ALDH), five carboxyl/cholinesterases (CCEs), five UDP-glycosyltransferases (UGTs), eight cytochrome P450 (CYP) and three glutathione S-transferases (GSTs) displayed more robust expression in the antennae, and thus are proposed to participate in the degradation of sex pheromone components and plant volatiles. To date, this is the most

Functionally undefined gene, yggE, alleviates oxidative stress generated by monoamine oxidase in recombinant Escherichia coli.

Science.gov (United States)

Ojima, Yoshihiro; Kawase, Daisuke; Nishioka, Motomu; Taya, Masahito

2009-01-01

Real-time PCR analysis showed that yggE gene was about two and three times up-regulated in Escherichia coli cells exposed to UVA irradiation and thermal elevation, respectively, suggesting that this gene is responsive to physiological stress. The yggE gene was introduced into E. coli BL21 cells, together with a monoamine oxidase (MAO) gene as a model source for oxidative stress generation. The distribution of independently isolated transformants (two dozen isolates) was examined in terms of MAO activity and cell vitality. In the case of control strain expressing MAO alone, the largest number of transformants existed in the low range of MAO activity less than 2 units mg(-1) and the number significantly decreased at increased MAO activity. On the other hand, the distribution of MAO/YggE-coexpressing transformants shifted to higher MAO activity with frequent appearance in the activity range of 4-8 units mg(-1). The yggE gene product therefore has a possible function for alleviating the stress generated in the cells.

The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

Directory of Open Access Journals (Sweden)

Tran Lan T

2012-08-01

Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

Science.gov (United States)

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

2010-06-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

Science.gov (United States)

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

Tet1 oxidase regulates neuronal gene transcription, active DNA hydroxymethylation, object location memory, and threat recognition memory

Directory of Open Access Journals (Sweden)

Dinesh Kumar

2015-10-01

Full Text Available A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the central nervous system. In this study, we used Tet1 gene knockout (Tet1KO mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.

Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

Science.gov (United States)

Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

2016-01-01

Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

Science.gov (United States)

De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

2016-08-01

Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

Alcohol biosensing by polyamidoamine (PAMAM)/cysteamine/alcohol oxidase-modified gold electrode.

Science.gov (United States)

Akin, Mehriban; Yuksel, Merve; Geyik, Caner; Odaci, Dilek; Bluma, Arne; Höpfner, Tim; Beutel, Sascha; Scheper, Thomas; Timur, Suna

2010-01-01

A highly stable and sensitive amperometric alcohol biosensor was developed by immobilizing alcohol oxidase (AOX) through Polyamidoamine (PAMAM) dendrimers on a cysteamine-modified gold electrode surface. Ethanol determination is based on the consumption of dissolved oxygen content due to the enzymatic reaction. The decrease in oxygen level was monitored at -0.7 V vs. Ag/AgCl and correlated with ethanol concentration. Optimization of variables affecting the system was performed. The optimized ethanol biosensor showed a wide linearity from 0.025 to 1.0 mM with 100 s response time and detection limit of (LOD) 0.016 mM. In the characterization studies, besides linearity some parameters such as operational and storage stability, reproducibility, repeatability, and substrate specificity were studied in detail. Stability studies showed a good preservation of the bioanalytical properties of the sensor, 67% of its initial sensitivity was kept after 1 month storage at 4 degrees C. The analytical characteristics of the system were also evaluated for alcohol determination in flow injection analysis (FIA) mode. Finally, proposed biosensor was applied for ethanol analysis in various alcoholic beverage as well as offline monitoring of alcohol production through the yeast cultivation. Copyright 2010 American Institute of Chemical Engineers

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

NARCIS (Netherlands)

Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

2006-01-01

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

Discovery, characterization, and kinetic analysis of an alditol oxidase from streptomyces coelicolor

NARCIS (Netherlands)

Heuts, Dominic P. H. M.; van Hellemond, Erik W.; Janssen, Dick B.; Fraaije, Marco W.

2007-01-01

A gene encoding an alditol oxidase was found in the genome of Streptomyces coelicolor A3(2). This newly identified oxidase, AldO, was expressed at extremely high levels in Escherichia coli when fused to maltose-binding protein. AldO is a soluble monomeric flavoprotein with subunits of 45.1 kDa, each

A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis.

Science.gov (United States)

Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming

2013-05-01

A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

Neonatal epileptic encephalopathy caused by mutations in the PNPO gene encoding pyridox(am)ine 5'-phosphate oxidase.

Science.gov (United States)

Mills, Philippa B; Surtees, Robert A H; Champion, Michael P; Beesley, Clare E; Dalton, Neil; Scambler, Peter J; Heales, Simon J R; Briddon, Anthony; Scheimberg, Irene; Hoffmann, Georg F; Zschocke, Johannes; Clayton, Peter T

2005-04-15

In the mouse, neurotransmitter metabolism can be regulated by modulation of the synthesis of pyridoxal 5'-phosphate and failure to maintain pyridoxal phosphate (PLP) levels results in epilepsy. This study of five patients with neonatal epileptic encephalopathy suggests that the same is true in man. Cerebrospinal fluid and urine analyses indicated reduced activity of aromatic L-amino acid decarboxylase and other PLP-dependent enzymes. Seizures ceased with the administration of PLP, having been resistant to treatment with pyridoxine, suggesting a defect of pyridox(am)ine 5'-phosphate oxidase (PNPO). Sequencing of the PNPO gene identified homozygous missense, splice site and stop codon mutations. Expression studies in Chinese hamster ovary cells showed that the splice site (IVS3-1g>a) and stop codon (X262Q) mutations were null activity mutations and that the missense mutation (R229W) markedly reduced pyridox(am)ine phosphate oxidase activity. Maintenance of optimal PLP levels in the brain may be important in many neurological disorders in which neurotransmitter metabolism is disturbed (either as a primary or as a secondary phenomenon).

Tet1 Oxidase Regulates Neuronal Gene Transcription, Active DNA Hydroxy-methylation, Object Location Memory, and Threat Recognition Memory.

Science.gov (United States)

Kumar, Dinesh; Aggarwal, Milan; Kaas, Garrett A; Lewis, John; Wang, Jing; Ross, Daniel L; Zhong, Chun; Kennedy, Andrew; Song, Hongjun; Sweatt, J David

2015-10-01

A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the CNS. In this study, we used Tet1 gene knockout (Tet1KO) mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to: altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning) and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.

Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.

Science.gov (United States)

Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D

2017-01-23

The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

Overexpressing key component genes of the secretion pathway for enhanced secretion of an Aspergillus niger glucose oxidase in Trichoderma reesei.

Science.gov (United States)

Wu, Yilan; Sun, Xianhua; Xue, Xianli; Luo, Huiying; Yao, Bin; Xie, Xiangming; Su, Xiaoyun

2017-11-01

Vast interest exists in developing T. reesei for production of heterologous proteins. Although rich genomic and transcriptomic information has been uncovered for the T. reesei secretion pathway, little is known about whether engineering its key components could enhance expression of a heterologous gene. In this study, snc1, a v-SNARE gene, was first selected for overexpression in T. reesei. In engineered T. reesei with additional copies of snc1, the Aspergillus niger glucose oxidase (AnGOD) was produced to a significantly higher level (2.2-fold of the parental strain). hac1 and bip1, two more component genes in the secretion pathway, were further tested for overexpression and found to be also beneficial for AnGOD secretion. The overexpression of one component gene more or less affected the expression of the other two genes, suggesting a complex regulating mechanism. Our study demonstrates the potential of engineering the secretion pathway for enhancing heterologous gene production in T. reesei. Copyright © 2017 Elsevier Inc. All rights reserved.

Inter-relationships between light and respiration in the control of ascorbic acid synthesis and accumulation in Arabidopsis thaliana leaves.

Science.gov (United States)

Bartoli, Carlos G; Yu, Jianping; Gómez, Facundo; Fernández, Laura; McIntosh, Lee; Foyer, Christine H

2006-01-01

The effects of growth irradiance and respiration on ascorbic acid (AA) synthesis and accumulation were studied in the leaves of wild-type and transformed Arabidopsis thaliana with modified amounts of the mitochondrial alternative oxidase (AOX) protein. Plants were grown under low (LL; 50 micromol photons m(-2) s(-1)), intermediate (IL; 100 micromol photons m(-2) s(-1)), or high (HL; 250 micromol photons m(-2) s(-1)) light. Increasing growth irradiance progressively elevated leaf AA content and hence the values of dark-induced disappearance of leaf AA, which were 11, 55, and 89 nmol AA lost g(-1) fresh weight h(-1), from LL-, IL-, and HL-grown leaves, respectively. When HL leaves were supplied with L-galactone-1,4-lactone (L-GalL; the precursor of AA), they accumulated twice as much AA and had double the maximal L-galactone-1,4-lactone dehydrogenase (L-GalLDH) activities of LL leaves. Growth under HL enhanced dehydroascorbate reductase and monodehydroascorbate reductase activities. Leaf respiration rates were highest in the HL leaves, which also had higher amounts of cytochrome c and cytochrome c oxidase (CCO) activities, as well as enhanced capacity of the AOX and CCO electron transport pathways. Leaves of the AOX-overexpressing lines accumulated more AA than wild-type or antisense leaves, particularly at HL. Intact mitochondria from AOX-overexpressing lines had higher AA synthesis capacities than those from the wild-type or antisense lines even though they had similar L-GalLDH activities. AOX antisense lines had more cytochrome c protein than wild-type or AOX-overexpressing lines. It is concluded that regardless of limitations on L-GalL synthesis by regulation of early steps in the AA synthesis pathway, the regulation of L-GalLDH activity via the interaction of light and respiratory controls is a crucial determinant of the overall ability of leaves to produce and accumulate AA.

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

Science.gov (United States)

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis.

Directory of Open Access Journals (Sweden)

Xiuchun Ge

Full Text Available Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation.

Transgenic cassava lines carrying heterologous alternative oxidase ...

African Journals Online (AJOL)

Afuape

2013-07-03

Jul 3, 2013 ... production of flowers, apomixis (Nassar et al., 2000; ... In order to increase the stress tolerance capacity of ... stress-related procedure due to the activities of auxin ... the evaluation of the transgenic lines for rate of OES .... Some transgenic lines carrying the 35S-AOX fragment amplified using 35S303F1 and.

Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

Science.gov (United States)

Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

2001-01-01

The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that

Association study of monoamine oxidase A/B genes and schizophrenia in Han Chinese

Directory of Open Access Journals (Sweden)

Li Sheng-Bin

2011-10-01

Full Text Available Abstract Background Monoamine oxidases (MAOs catalyze the metabolism of dopaminergic neurotransmitters. Polymorphisms of isoforms MAOA and MAOB have been implicated in the etiology of mental disorders such as schizophrenia. Association studies detected these polymorphisms in several populations, however the data have not been conclusive to date. Here, we investigated the association of MAOA and MAOB polymorphisms with schizophrenia in a Han Chinese population. Methods Two functional single nucleotide polymorphisms (SNPs, rs6323 of MAOA and rs1799836 of MAOB, were selected for association analysis in 537 unrelated schizophrenia patients and 536 healthy controls. Single-locus and Haplotype associations were calculated. Results No differences were found in the allelic distribution of rs6323. The G allele of rs1799836 was identified as a risk factor in the development of schizophrenia (P = 0.00001. The risk haplotype rs6323T-rs1799836G was associated with schizophrenia in female patients (P = 0.0002, but the frequency difference was not significant among male groups. Conclusions Our results suggest that MAOB is a susceptibility gene for schizophrenia. In contrast, no significant associations were observed for the MAOA functional polymorphism with schizophrenia in Han Chinese. These data support further investigation of the role of MAO genes in schizophrenia.

Genome-wide analysis and identification of cytokinin oxidase/dehydrogenase (CKX gene family in foxtail millet (Setaria italica

Directory of Open Access Journals (Sweden)

Yuange Wang

2014-08-01

Full Text Available Cytokinin oxidase/dehydrogenase (CKX; EC.1.5.99.12 regulates cytokinin (CK level in plants and plays an essential role in CK regulatory processes. CKX proteins are encoded by a small gene family with a varying number of members in different plants. In spite of their physiological importance, systematic analyses of SiCKX genes in foxtail millet have not yet been examined. In this paper, we report the genome wide isolation and characterization of SiCKXs using bioinformatic methods. A total of 11 members of the family were identified in the foxtail millet genome. SiCKX genes were distributed in seven chromosomes (chromosome 1, 3, 4, 5, 6, 7, and 11. The coding sequences of all the SiCKX genes were disrupted by introns, with numbers varying from one to four. These genes expanded in the genome mainly due to segmental duplication events. Multiple alignment and motif display results showed that all SiCKX proteins share FAD- and CK-binding domains. Putative cis-elements involved in Ca2 +-response, abiotic stress response, light and circadian rhythm regulation, disease resistance and seed development were present in the promoters of SiCKX genes. Expression data mining suggested that SiCKX genes have diverse expression patterns. Real-time PCR analysis indicated that all 11 SiCKX genes were up-regulated in embryos under 6-BA treatment, and some were NaCl or PEG inducible. Collectively, these results provide molecular insights into CKX research in plants.

The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

Directory of Open Access Journals (Sweden)

Buades-Rotger M

2014-07-01

Full Text Available Macià Buades-Rotger,1,2 David Gallardo-Pujol1,3 1Department of Personality, Faculty of Psychology, University of Barcelona, Barcelona, Spain; 2Department of Neurology, University of Lübeck, Lübeck, Germany; 3Institute for Brain, Cognition and Behavior (IR3C, University of Barcelona, Barcelona, Spain Abstract: Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. Keywords: behavioral genetics, antisocial behaviors, monoamine oxidase A

Hot or not? Discovery and characterization of a thermostable alditol oxidase from Acidothermus cellulolyticus 11B

NARCIS (Netherlands)

Winter, Remko T.; Heuts, Dominic P. H. M.; Rijpkema, Egon M. A.; van Bloois, Edwin; Wijma, Hein J.; Fraaije, Marco W.

We describe the discovery, isolation and characterization of a highly thermostable alditol oxidase from Acidothermus cellulolyticus 11B. This protein was identified by searching the genomes of known thermophiles for enzymes homologous to Streptomyces coelicolor A3(2) alditol oxidase (AldO). A gene

Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1

Science.gov (United States)

Frisse, Andrea; Pimenta, Maria João; Lange, Theo

2003-01-01

Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Directory of Open Access Journals (Sweden)

Shan Xin

Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Science.gov (United States)

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

Effect of a heme oxygenase-1 inducer on NADPH oxidase ...

African Journals Online (AJOL)

Effect of a heme oxygenase-1 inducer on NADPH oxidase expression in ... and immunohistochemistry of hepatic NOX1 and NOX4 were investigated in week 4. ... (HO-1 inhibitor) administration caused upregulation of NOX gene expression ...

The occurrence and control of nitric oxide generation by the plant mitochondrial electron transport chain.

Science.gov (United States)

Alber, Nicole A; Sivanesan, Hampavi; Vanlerberghe, Greg C

2017-07-01

The plant mitochondrial electron transport chain (ETC) is bifurcated such that electrons from ubiquinol are passed to oxygen via the usual cytochrome path or through alternative oxidase (AOX). We previously showed that knockdown of AOX in transgenic tobacco increased leaf concentrations of nitric oxide (NO), implying that an activity capable of generating NO had been effected. Here, we identify the potential source of this NO. Treatment of leaves with antimycin A (AA, Q i -site inhibitor of Complex III) increased NO amount more than treatment with myxothiazol (Myxo, Q o -site inhibitor) despite both being equally effective at inhibiting respiration. Comparison of nitrate-grown wild-type with AOX knockdown and overexpression plants showed a negative correlation between AOX amount and NO amount following AA. Further, Myxo fully negated the ability of AA to increase NO amount. With ammonium-grown plants, neither AA nor Myxo strongly increased NO amount in any plant line. When these leaves were supplied with nitrite alongside the AA or Myxo, then the inhibitor effects across lines mirrored that of nitrate-grown plants. Hence the ETC, likely the Q-cycle of Complex III generates NO from nitrite, and AOX reduces this activity by acting as a non-energy-conserving electron sink upstream of Complex III. © 2016 John Wiley & Sons Ltd.

RNA Interference of 1-Aminocyclopropane-1-carboxylic Acid Oxidase (ACO1 and ACO2 Genes Expression Prolongs the Shelf Life of Eksotika (Carica papaya L. Papaya Fruit

Directory of Open Access Journals (Sweden)

Rogayah Sekeli

2014-06-01

Full Text Available The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6. Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

Putative pathway of sex pheromone biosynthesis and degradation by expression patterns of genes identified from female pheromone gland and adult antenna of Sesamia inferens (Walker).

Science.gov (United States)

Zhang, Ya-Nan; Xia, Yi-Han; Zhu, Jia-Yao; Li, Sheng-Yun; Dong, Shuang-Lin

2014-05-01

The general pathway of biosynthesis and degradation for Type-I sex pheromones in moths is well established, but some genes involved in this pathway remain to be characterized. The purple stem borer, Sesamia inferens, employs a pheromone blend containing components with three different terminal functional groups (Z11-16:OAc, Z11-16:OH, and Z11-16:Ald) of Type-I sex pheromones. Thus, it provides a good model to study the diversity of genes involved in pheromone biosynthesis and degradation pathways. By analyzing previously obtained transcriptomic data of the sex pheromone glands and antennae, we identified 73 novel genes that are possibly related to pheromone biosynthesis (46 genes) or degradation (27 genes). Gene expression patterns and phylogenetic analysis revealed that one desaturase (SinfDes4), one fatty acid reductase (SinfFAR2), and one fatty acid xtransport protein (SinfFATP1) genes were predominantly expressed in pheromone glands, and clustered with genes involved in pheromone synthesis in other moth species. Ten genes including five carboxylesterases (SinfCXE10, 13, 14, 18, and 20), three aldehyde oxidases (SinfAOX1, 2 and 3), and two alcohol dehydrogenases (SinfAD1 and 3) were expressed specifically or predominantly in antennae, and could be candidate genes involved in pheromone degradation. SinfAD1 and 3 are the first reported alcohol dehydrogenase genes with antennae-biased expression. Based on these results we propose a pathway involving these potential enzyme-encoding gene candidates in sex pheromone biosynthesis and degradation in S. inferens. This study provides robust background information for further elucidation of the genetic basis of sex pheromone biosynthesis and degradation, and ultimately provides potential targets to disrupt sexual communication in S. inferens for control purposes.

Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*

Science.gov (United States)

Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun

2010-01-01

Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

[Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidase Ⅱ gene variations and the risk of noise-induced hearing loss].

Science.gov (United States)

Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

2017-01-06

Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

Science.gov (United States)

Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

2015-03-01

Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

Genetic effect of monoamine oxidase B (MAOB gene on ASD associated behavior phenotypes

Directory of Open Access Journals (Sweden)

Deepak Verma

2017-10-01

Full Text Available Autism spectrum disorder (ASD is a male predominance, behaviorally defined neurodevelopmental disorder which is characterized by impairment in social communication and restricted and repetitive activities. Abnormalities in serotoninergic function play a major role in ASD pathophysiology. Monoamine oxidases, encoded by two X-chromosomal genes MAOA and MAOB regulate the serotonergic function by the degradation of serotonin and other biological amines. Therefore, the objective of present study is to investigate genetic correlation of MAOB markers with the severity of specific behavioral traits as scored by Childhood Autism Rating Scale (CARS has been examined as quantitative trait (QT analysis using IBM-SPSS program. A total of 225 ASD patients (190 male and 35 female were recruited after psychometric evaluation done by DSM-IV-TR/DSM-5 criteria and assessment by CARS. Genotyping carried by PCR/RFLP/sequencing methods, and population were found in Hardy-Weinberg equilibrium. The outcome of the QT analysis indicating the increased score in overall CARS were associated with G and C allele of MAOB marker rs3027449 (p-value: 0.03 and rs1040399 (p-value: 0.01, respectively in male ASD children. In addition to this, major alleles of studied polymorphisms of gene were found to be statistically associated with the higher impairment in social communication domain only in male ASD children. Overall outcome of the study suggests likely involvement of MAOB with ASD in a gender-specific manner with the severity in behavior phenotypes. Considering the cumulative impact of these markers in regulating the severity of the behavioral symptoms of ASD, it is likely that MAOB gene is associated with the disorder.

Immunological and molecular comparison of polyphenol oxidase in Rosaceae fruit trees.

Science.gov (United States)

Haruta, M; Murata, M; Kadokura, H; Homma, S

1999-03-01

An antibody raised against apple polyphenol oxidase (PPO) cross-reacted with PPOs from Japanese pear (Pyrus pyrifolia), pear (Pyrus communis), peach (Prunus persica), Chinese quince (Pseudocydonia sinensis) and Japanese loquat (Eriobotrya japonica). Core fragments (681 bp) of the corresponding PPO genes were amplified and characterized. The deduced protein sequences showed identities of 85.3 to 97.5%. Chlorogenic acid oxidase activity of these PPOs showed higher activities when assayed at pH 4 than at pH 6. These results indicate that PPOs in Rosaceae plants are structurally and enzymatically similar.

Mapping genes governing flower architecture and pollen development in a double mutant population of carrot

Directory of Open Access Journals (Sweden)

Holger eBudahn

2014-10-01

Full Text Available A linkage map of carrot (Daucus carota L. was developed in order to study reproductive traits. The F2 mapping population derived from an initial cross between a yellow leaf (yel chlorophyll mutant and a compressed lamina (cola mutant with unique flower defects of the sporophytic parts of male and female organs. The genetic map has a total length of 781 cM and included 285 loci. The length of the nine linkage groups ranged between 65 cM and 145 cM. All linkage groups have been anchored to the reference map. The objective of this study was the generation of a well-saturated linkage map of D. carota. Mapping of the cola-locus associated with flower development and fertility was successfully demonstrated. Two MADS-box genes (DcMADS3, DcMADS5 with prominent roles in flowering and reproduction as well as three additional genes (DcAOX2a, DcAOX2b, DcCHS2 with further importance for male reproduction were assigned to different loci that did not co-segregate with the cola-locus.

Dysbindin and d-amino-acid-oxidase gene polymorphisms associated with positive and negative symptoms in schizophrenia

DEFF Research Database (Denmark)

Wirgenes, Katrine V; Djurovic, Srdjan; Agartz, Ingrid

2009-01-01

-amino-acid-oxidase (DAO) gene, both involved in glutamate receptor function, reported associations with negative symptoms and with anxiety and depression, respectively, when measured with the Positive and Negative Syndrome Scale (PANSS). METHODS: In the present study, the suggested association between dysbindin and DAO...... single nucleotide polymorphisms (SNPs) and PANSS scores was analyzed in 155 Norwegian schizophrenia patients. RESULTS: There was a significant association between the dysbindin SNP rs3213207 and severity of both negative symptoms and total symptom load, as well as between the DAO SNP rs2070587 and total...... symptom score and severity of anxiety and depression. CONCLUSION: The present association of dysbindin SNPs with negative symptoms and DAO SNPs with anxiety and depression is a replication of earlier findings and strengthens the hypothesis of a genetic association. It further indicates involvement...

Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

Science.gov (United States)

Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

2016-11-05

As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.

Cloning and shake flask expression of hrIDS- Like in Pichia pastoris ...

African Journals Online (AJOL)

The human Iduronate-2-sulfate sulfatase (hIDS-Like) was cloned into the methylotrophic yeast Pichia pastoris under the control of alcohol oxidase promoter (AOX1) and the -mating factor signal peptide (a-factor). Six clones were identified by PCR. Using clone IDS28, the enzyme was secreted into the culture medium, ...

Galactose Oxidase from Fusarium oxysporum - Expression in E. coli and P. pastoris and Biochemical Characterization

Czech Academy of Sciences Publication Activity Database

Paukner, R.; Staudigl, P.; Choosri, W.; Sygmund, Ch.; Halada, Petr; Haltrich, D.; Leitner, CH.

2014-01-01

Roč. 9, č. 6 (2014) E-ISSN 1932-6203 Grant - others:Austrian Science Foundation(AT) L 504-B11 Institutional support: RVO:61388971 Keywords : galactose oxidase * gene * Fusarium * gene expression Subject RIV: CE - Biochemistry Impact factor: 3.234, year: 2014

Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.

Science.gov (United States)

Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine

2017-08-01

Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.

Cytokinin oxidase/dehydrogenase genes in barley and wheat. Cloning and heterologous expression

Czech Academy of Sciences Publication Activity Database

Galuszka, P.; Frébortová, Jitka; Werner, T.; Yamada, M.; Strnad, Miroslav; Schmülling, T.; Frébort, I.

2004-01-01

Roč. 271, č. 20 (2004), s. 3990-4002 ISSN 0014-2956 Institutional research plan: CEZ:AV0Z5038910 Keywords : cereals * cloning * cytokinin oxidase/dehydrogenase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.260, year: 2004

Removal of absorbable organic halides (aox) from recycled paper mill effluent using granular activated carbon-sequencing batch biofilm reactor (GAC-SBBR)

International Nuclear Information System (INIS)

Mohamad, A.B.; Rahman, R.A.; Kadhum, A.A.H.; Abdullah, S.R.S.; Shaari, S.

2006-01-01

Paper mills generate varieties of pollutants depending upon the type of the pulping process. Paper mill wastewaters have high chemical oxygen demand (COD) and colour, indicating high concentrations of recalcitrant organics. The study was conducted employing a Granular Activated Carbon - Sequencing Batch Biofilm Reactor (GAC-SBBR), containing 3.0 L working volume, operated in aerobic condition and packed with 200 g/L of 2-3 mm granular activated carbon (coconut shells) as a medium for biofilm growth. For the first couple of month, the HRT was 36 hours and the HRT of this reactor was adjusted to 24 hours in order to evaluate the performance of the system. The treated wastewater sample for these studies came from a recycle paper factory from MNI Sdn Bhd with 4 different samples characteristics. The adsorbable organic halides (AOX) to be determined and treated were Pentachlorophenol (PCP), 2,3,4,5-Tetrachlorophenol (2,3,4,5-TeCP), 2,4,6-Trichlorophenol (2,4,6-TCP), 2,4-Dichlorophenol ( 2,4-DCP), 2-Chlorophenol (CP) and phenol. Results showed that, the biofilm attached onto granular activated carbon (GAC) could substantially remove these recalcitrant in the wastewater. More over, results from the studies showed that high removal was achieved by the biofilm SBR with 10-100% removal of AOX and depending on HRT. (Author)

Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

Science.gov (United States)

Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

2012-01-01

The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

Aspergillus fumigatus mitochondrial electron transport chain mediates oxidative stress homeostasis, hypoxia responses and fungal pathogenesis.

Science.gov (United States)

Grahl, Nora; Dinamarco, Taisa Magnani; Willger, Sven D; Goldman, Gustavo H; Cramer, Robert A

2012-04-01

We previously observed that hypoxia is an important component of host microenvironments during pulmonary fungal infections. However, mechanisms of fungal growth in these in vivo hypoxic conditions are poorly understood. Here, we report that mitochondrial respiration is active in hypoxia (1% oxygen) and critical for fungal pathogenesis. We generated Aspergillus fumigatus alternative oxidase (aoxA) and cytochrome C (cycA) null mutants and assessed their ability to tolerate hypoxia, macrophage killing and virulence. In contrast to ΔaoxA, ΔcycA was found to be significantly impaired in conidia germination, growth in normoxia and hypoxia, and displayed attenuated virulence. Intriguingly, loss of cycA results in increased levels of AoxA activity, which results in increased resistance to oxidative stress, macrophage killing and long-term persistence in murine lungs. Thus, our results demonstrate a previously unidentified role for fungal mitochondrial respiration in the pathogenesis of aspergillosis, and lay the foundation for future research into its role in hypoxia signalling and adaptation. © 2012 Blackwell Publishing Ltd.

Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

Science.gov (United States)

Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

2015-09-01

Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

Characterization of Two VAO-Type Flavoprotein Oxidases from Myceliophthora thermophila

Directory of Open Access Journals (Sweden)

Alessandro R. Ferrari

2018-01-01

Full Text Available The VAO flavoprotein family consists mostly of oxidoreductases harboring a covalently linked flavin cofactor. The linkage can be either monocovalent at position 8 with a histidine or tyrosine or bicovalent at position 8 with a histidine and at position 6 with a cysteine. Bicovalently bound flavoproteins show a preference for bulkier substrates such as oligosaccharides or secondary metabolites. The genome of the thermophilic fungus Myceliophthora thermophila C1 was found to be rich in genes encoding putative covalent VAO-type flavoproteins. Enzymes from this fungus have the advantage of being rather thermostable and homologous overexpression in M. thermophila C1 is feasible. Recently we discovered a new and VAO-type carbohydrate oxidase from this fungus: xylooligosaccharide oxidase. In this study, two other putative VAO-type oxidases, protein sequence XP_003663615 (MtVAO615 and XP_003665713 (MtVAO713, were expressed in M. thermophila C1, purified and characterized. Enzyme MtVAO615 was found to contain a bicovalently bound FAD, while enzyme MtVAO713 contained a monocovalent histidyl-bound FAD. The crystal structures of both proteins were obtained which revealed atypical active site architectures. It could be experimentally verified that both proteins, when reduced, rapidly react with molecular oxygen, a hallmark of flavoprotein oxidases. A large panel of alcohols, including carbohydrates, steroids and secondary alcohols were tested as potential substrates. For enzyme MtVAO713 low oxidase activity was discovered towards ricinoleic acid.

Glucose oxidase variants with improved properities

OpenAIRE

Fischer, Rainer; Ostafe, Raluca; Prodanovic, Radivoje

2014-01-01

Source: WO14173822A3 [EN] The technology provided herein relates to novel variants of microbial glucose oxidase with improved properties, more specifically to polypeptides having glucose oxidase activity as their major enzymatic activity; to nucleic acid molecules encoding said glucose oxidases; vectors and host cells containing the nucleic acids and methods for producing the glucose oxidase; compositions comprising said glucose oxidase; methods for the preparation and production of such enzy...

Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

Science.gov (United States)

Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

2004-01-01

Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

Evolutionary origin and function of NOX4-art, an arthropod specific NADPH oxidase

OpenAIRE

Gandara, Ana Caroline Paiva; Torres, Andr?; Bahia, Ana Cristina; Oliveira, Pedro L.; Schama, Renata

2017-01-01

Background NADPH oxidases (NOX) are ROS producing enzymes that perform essential roles in cell physiology, including cell signaling and antimicrobial defense. This gene family is present in most eukaryotes, suggesting a common ancestor. To date, only a limited number of phylogenetic studies of metazoan NOXes have been performed, with few arthropod genes. In arthropods, only NOX5 and DUOX genes have been found and a gene called NOXm was found in mosquitoes but its origin and function has not b...

Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population.

Science.gov (United States)

Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi

2012-01-01

Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.

Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.

Science.gov (United States)

Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori

2017-11-01

Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Norrie disease gene is distinct from the monoamine oxidase genes

OpenAIRE

Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

1989-01-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondelet...

Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

Science.gov (United States)

Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

2000-06-01

Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

Science.gov (United States)

Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

2015-09-01

Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.

Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

Directory of Open Access Journals (Sweden)

Verónica Loera-Castañeda

2014-01-01

Full Text Available Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS. Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12% harbored the A8027G polymorphism and three of them were early onset (EO AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn’t been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

Science.gov (United States)

Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

2014-01-01

A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes

Science.gov (United States)

Phil Kersten; Dan Cullen

2014-01-01

Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...

Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes.

Science.gov (United States)

Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E

1992-01-01

Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

Dynamic 1-aminocyclopropane-1-carboxylate-synthase and -oxidase transcript accumulation patterns during pollen tube growth in tobacco styles.

Science.gov (United States)

Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina

2002-11-01

In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene.

Science.gov (United States)

Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip

2017-01-01

The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship.

Sequence variation in the cytochrome oxidase subunit I and II genes of two commonly found blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) (Diptera: Calliphoridae) in Malaysia.

Science.gov (United States)

Tan, Siew Hwa; Aris, Edah Mohd; Surin, Johari; Omar, Baharudin; Kurahashi, Hiromu; Mohamed, Zulqarnain

2009-08-01

The mitochondiral DNA region encompassing the cytochrome oxidase subunit I (COI) and cytochrome oxidase subunit II (COII) genes of two Malaysian blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) were studied. This region, which spans 2303bp and includes the COI, tRNA leucine and partial COII was sequenced from adult fly and larval specimens, and compared. Intraspecific variations were observed at 0.26% for Ch. megacephala and 0.17% for Ch. rufifacies, while sequence divergence between the two species was recorded at a minimum of 141 out of 2303 sites (6.12%). Results obtained in this study are comparable to published data, and thus support the use of DNA sequence to facilitate and complement morphology-based species identification.

Immunolocalization of an alternative respiratory chain in Antonospora (Paranosema) locustae spores: mitosomes retain their role in microsporidial energy metabolism.

Science.gov (United States)

Dolgikh, Viacheslav V; Senderskiy, Igor V; Pavlova, Olga A; Naumov, Anton M; Beznoussenko, Galina V

2011-04-01

Microsporidia are a group of fungus-related intracellular parasites with severely reduced metabolic machinery. They lack canonical mitochondria, a Krebs cycle, and a respiratory chain but possess genes encoding glycolysis enzymes, a glycerol phosphate shuttle, and ATP/ADP carriers to import host ATP. The recent finding of alternative oxidase genes in two clades suggests that microsporidial mitosomes may retain an alternative respiratory pathway. We expressed the fragments of mitochondrial chaperone Hsp70 (mitHsp70), mitochondrial glycerol-3-phosphate dehydrogenase (mitG3PDH), and alternative oxidase (AOX) from the microsporidium Antonospora (Paranosema) locustae in Escherichia coli. Immunoblotting with antibodies against recombinant polypeptides demonstrated specific accumulation of both metabolic enzymes in A. locustae spores. At the same time comparable amounts of mitochondrial Hsp70 were found in spores and in stages of intracellular development as well. Immunoelectron microscopy of ultrathin cryosections of spores confirmed mitosomal localization of the studied proteins. Small amounts of enzymes of an alternative respiratory chain in merogonial and early sporogonial stages, alongside their accumulation in mature spores, suggest conspicuous changes in components and functions of mitosomes during the life cycle of microsporidia and the important role of these organelles in parasite energy metabolism, at least at the final stages of sporogenesis.

A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development.

Science.gov (United States)

Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J

2014-01-01

Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.

Identification and validation of highly frequent CpG island hypermethylation in colorectal adenomas and carcinomas

DEFF Research Database (Denmark)

Øster, Bodil; Thorsen, Kasper; Lamy, Philippe

2011-01-01

), in carcinomas only (ABHD9, AOX1 and RERG), or in MSI but not MSS carcinomas (RAMP2, DSC3 and MLH1) were validated using MS-HRM. Four of these genes (MLH1, AOX1, EYA4 and TWIST1) had previously been reported to be hypermethylated in CRC. Eleven genes, not previously known to be affected by CRC specific...

Characterization of three bioenergetically active respiratory terminal oxidases in the cyanobacterium Synechocystis sp. strain PCC 6803.

Science.gov (United States)

Pils, D; Schmetterer, G

2001-09-25

Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.

Population Structure and Abundance of Arsenite-Oxidizing Bacteria along an Arsenic Pollution Gradient in Waters of the Upper Isle River Basin, France▿ †

Science.gov (United States)

Quéméneur, Marianne; Cébron, Aurélie; Billard, Patrick; Battaglia-Brunet, Fabienne; Garrido, Francis; Leyval, Corinne; Joulian, Catherine

2010-01-01

Denaturing gradient gel electrophoresis (DGGE) and quantitative real-time PCR (qPCR) were successfully developed to monitor functional aoxB genes as markers of aerobic arsenite oxidizers. DGGE profiles showed a shift in the structure of the aoxB-carrying bacterial population, composed of members of the Alpha-, Beta- and Gammaproteobacteria, depending on arsenic (As) and Eh levels in Upper Isle River Basin waters. The highest aoxB gene densities were found in the most As-polluted oxic surface waters but without any significant correlation with environmental factors. Arsenite oxidizers seem to play a key role in As mobility in As-impacted waters. PMID:20453153

[Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test].

Science.gov (United States)

Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo

2006-11-01

Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P times of posture change and standing up against walls were also higher than those in CC (P time in CC genotype puppies were higher than that in TT (P walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P open-field test and TT genotype has favorable effects in these behavior traits.

[The X+ chronic granulomatous disease as a fabulous model to study the NADPH oxidase complex activation].

Science.gov (United States)

Stasia, Marie-José

2007-05-01

Chronic granulomatous disease (CGD) is a rare inherited disorder in which phagocytes lack NADPH oxidase activity. Patients with CGD suffer from recurrent bacterial and fungal infections because of the absence of superoxide anions (O2- degrees ) generatingsystem. The NADPH oxidase complex is composed of a membranous cytochrome b558, cytosolic proteins p67phox, p47phox, p40phox and two small GTPases Rac2 and Rap1A. Cytochrome b558 consists of two sub-units gp91phox and p22phox. The most common form of CGD is due to mutations in CYBB gene encoding gp91phox. In some rare cases, the mutated gp91phox is normally expressed but is devoided of oxidase activity. These variants called X+ CGD, have provided interesting informations about oxidase activation mechanisms. However modelization of such variants is necessary to obtain enough biological material for studies at the molecular level. A cellular model (knock-out PLB-985 cells) has been developed for expressing recombinant mutated gp91phox for functional analysis of the oxidase complex. Recent works demonstrated that this cell line genetically deficient in gp91phox is a powerful tool for functional analysis of the NADPH oxidase complex activation.

Norrie disease gene is distinct from the monoamine oxidase genes.

Science.gov (United States)

Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A

1989-09-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.

Oxidase-based biocatalytic processes

DEFF Research Database (Denmark)

Ramesh, Hemalata; Woodley, John; Krühne, Ulrich

interestingbiocatalystsbecause they use a mild oxidant (oxygen) as a substrateas opposed to their chemical counterparts which use strong oxidants such as permanganates. A class of oxidases calledmonoamine oxidases has been used as the central case study for the thesis. The rationale for choosing thissystemis that it has been...

The Characteristics of Cytochrome C Oxidase Gene Subunit I in Wild Silkmoth Cricula trifenestrata Helfer and Its Evaluation for Species Marker

Directory of Open Access Journals (Sweden)

Suriana

2012-08-01

Full Text Available The study was conducted to assess the characteristics of partial gene of cytochrome C oxidase subunit I (COI of wild silkmoth Cricula trifenestrata, and to detect the diagnostic sites from these gene for evaluation as species marker. A total of fifteen larvae of C. tifenestrata were collected from Bogor, Purwakarta, and Bantul Regencies. Genomic DNA was extracted from silk gland of individual larvae, then amplified by PCR method and sequenced. DNA sequencing was done to characterize their nucleotide and amino acid contents. The results showed that 595 nucleotides at the 5 ‘end of COI gene of C. tifenestrata was conserved at the species level, but varies at the family level. Nucleotide dominated by thymine and adenine bases (± 70%. There were 25 diagnostic sites for C. tifenestrata, and four diagnostic sites for genus level. One hundred eigthty nine (189 amino acids were alignment, and only one percent of the genes was varied among species. The 107th amino acid (valine and 138th (threonine were diagnostics amino acid for C. tifenestrata. Based on nucleotides and amino acids sequences, the phylogeny showed that C. tifenestrata lied on the same nodes with Antheraea, so the Saturniidae family is monophyletic.

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene.

Directory of Open Access Journals (Sweden)

Hoi-Sen Yong

Full Text Available The tephritid fruit fly Zeugodacus tau (Walker is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1 the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2 the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3 and 15835 bp for the China specimen (ZT1, with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes and a non-coding A + T-rich control region (D-loop. Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China and Z. tau ZT1 (China formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia. Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes instead of partial sequence is more appropriate for determining phylogenetic relationship.

Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

Science.gov (United States)

Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

2012-01-01

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

Characterization of a flavoprotein oxidase from opium poppy catalyzing the final steps in sanguinarine and papaverine biosynthesis.

Science.gov (United States)

Hagel, Jillian M; Beaudoin, Guillaume A W; Fossati, Elena; Ekins, Andrew; Martin, Vincent J J; Facchini, Peter J

2012-12-14

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The K(m) values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism.

Expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and mitochondrial oxidative phosphorylation in septic patients.

Directory of Open Access Journals (Sweden)

Laura A Nucci

Full Text Available Sepsis is a complex disease that is characterized by activation and inhibition of different cell signaling pathways according to the disease stage. Here, we evaluated genes involved in the TLR signaling pathway, oxidative phosphorylation and oxidative metabolism, aiming to assess their interactions and resulting cell functions and pathways that are disturbed in septic patients.Blood samples were obtained from 16 patients with sepsis secondary to community acquired pneumonia at admission (D0, and after 7 days (D7, N = 10 of therapy. Samples were also collected from 8 healthy volunteers who were matched according to age and gender. Gene expression of 84 genes was performed by real-time polymerase chain reactions. Their expression was considered up- or down-regulated when the fold change was greater than 1.5 compared to the healthy volunteers. A p-value of ≤ 0.05 was considered significant.Twenty-two genes were differently expressed in D0 samples; most of them were down-regulated. When gene expression was analyzed according to the outcomes, higher number of altered genes and a higher intensity in the disturbance was observed in non-survivor than in survivor patients. The canonical pathways altered in D0 samples included interferon and iNOS signaling; the role of JAK1, JAK2 and TYK2 in interferon signaling; mitochondrial dysfunction; and superoxide radical degradation pathways. When analyzed according to outcomes, different pathways were disturbed in surviving and non-surviving patients. Mitochondrial dysfunction, oxidative phosphorylation and superoxide radical degradation pathway were among the most altered in non-surviving patients.Our data show changes in the expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and oxidative phosphorylation. Importantly, distinct patterns are clearly observed in surviving and non-surviving patients. Interferon signaling, marked by changes in JAK-STAT modulation, had prominent changes in

Paraquat and maneb co-exposure induces noradrenergic locus coeruleus neurodegeneration through NADPH oxidase-mediated microglial activation

International Nuclear Information System (INIS)

Hou, Liyan; Zhang, Cong; Wang, Ke; Liu, Xiaofang; Wang, Hongwei; Che, Yuning; Sun, Fuqiang; Zhou, Xueying; Zhao, Xiulan; Wang, Qingshan

2017-01-01

Highlights: • Microglial activation induced by paraquat and maneb precedes noradrenergic neurodegeneration in locus coeruleus. • NADPH oxidase activation contributes to microglia-mediated neuroinflammation and related noradrenergic neurodegeneration. • Inhibition of NADPH oxidase by apocynin protects noradrenergic neurons against paraquat and maneb-induced toxicity. - Abstract: Co-exposure to paraquat (PQ) and maneb (Mb) has been shown to increase the risk of Parkinson’s disease (PD) and dopaminergic (DA) neurodegeneration in the substantia nigra pars compacta (SNpc) is observed in PQ and Mb-treated experimental animals. The loss of noradrenergic locus coeruleus (LC/NE) neurons in brainstem is a common feature shared by multiple neurodegenerative diseases, including PD. However, whether PQ and Mb is able to damage LC/NE neurons remains undefined. In this study, mice treated with combined PQ and Mb displayed progressive LC/NE neurodegeneration. Time course studies revealed that the activation of microglia preceded LC/NE neurodegeneration. Mechanistically, the activation of NADPH oxidase contributed to microglial activation and subsequent LC/NE neurodegeneration. We found that PQ and Mb co-exposure induced activation of NADPH oxidase as shown by increased superoxide production and membrane translocation of p47 phox , a cytosolic subunit of NADPH oxidase. Inhibition of NADPH oxidase by apocynin, a widely used NADPH oxidase inhibitor, suppressed microglial activation and gene expressions of proinflammatory factors. Furthermore, reduced activation of nuclear factor-κB (NF-κB) pathway was observed in apocynin-treated mice. More importantly, inhibition of NADPH oxidase by apocynin afforded LC/NE neuroprotection against PQ and Mb-induced neurotoxicity. Thus, our findings revealed the critical role NADPH oxidase-mediated microglial activation in driving LC/NE neurodegeneration induced by PQ and Mb, providing new insights into the pathogenesis of environmental

Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

Science.gov (United States)

Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

2013-04-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

Science.gov (United States)

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.

Science.gov (United States)

Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K

2009-09-01

Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.

Exploring flavin-containing carbohydrate oxidases

NARCIS (Netherlands)

Ferrari, Alessandro Renato

2017-01-01

Oxidases are enzymes capable of removing one or more electrons from their substrate and transfer them to molecular oxygen, forming hydrogen peroxide. Due to their high regio- and enantioselectivity, their use is preferred over traditional organic chemistry methods. Among the oxidases, flavoprotein

NADPH oxidase-mediated generation of reactive oxygen species: A new mechanism for X-ray-induced HeLa cell death

International Nuclear Information System (INIS)

Liu Qing; He Xiaoqing; Liu Yongsheng; Du Bingbing; Wang Xiaoyan; Zhang Weisheng; Jia Pengfei; Dong Jingmei; Ma Jianxiu; Wang Xiaohu; Li Sha; Zhang Hong

2008-01-01

Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91 phox was dose-dependent. Meanwhile, the cytoplasmic subunit p47 phox was translocated to the cell membrane and localized with p22 phox and gp91 phox to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.

Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

Science.gov (United States)

Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

2016-01-01

Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.

Effects of exposure to Prestige-like heavy fuel oil and to perfluorooctane sulfonate on conventional biomarkers and target gene transcription in the thicklip grey mullet Chelon labrosus

International Nuclear Information System (INIS)

Bilbao, E.; Raingeard, D.; Diaz de Cerio, O.; Ortiz-Zarragoitia, M.; Ruiz, P.; Izagirre, U.; Orbea, A.; Marigomez, I.; Cajaraville, M.P.; Cancio, I.

2010-01-01

Thicklip grey mullets Chelon labrosus inhabit coastal and estuarine areas where they can be chronically exposed to commonly released pollutants such as polycyclic aromatic hydrocarbons (PAHs) and perfluorinated compounds. These pollutants can also originate from accidental spills, such as the Prestige oil spill in 2002, which resulted in the release of a heavy fuel oil that affected coastal ecosystems in the Bay of Biscay. Peroxisome proliferation (PP), induced biotransformation metabolism, immunosuppression and endocrine disruption are some of the possible biological effects caused by such chemicals. With the aim of studying the effects of organic toxic chemicals on such biological processes at the transcriptional and at the cell/tissue level, juvenile mullets were exposed to the typical mammalian peroxisome proliferator perfluorooctane sulfonate (PFOS), and to fresh (F) and weathered (WF) Prestige-like heavy fuel oil for 2 and 16 days. First, fragments of genes relevant to biotransformation, immune/inflammatory and endocrine disruption processes were cloned using degenerate primers. Fuel oil elicited a significant PP response as proved by the transcriptional upregulation of palmitoyl-CoA oxidase (aox1), peroxisome proliferator activated receptor α (pparα) and retinoic X receptor, by the AOX1 activity induction and by the increased peroxisomal volume density. PFOS only elicited a significant induction of AOX1 activity at day 2 and of PPARα mRNA expression at day 16. All treatments significantly increased catalase mRNA expression at day 16 in liver and at day 2 in gill. Cyp1a transcription (liver and gill) and EROD activity were induced in fuel oil treated organisms. In the case of phase II metabolism only hepatic glutathione S-transferase mRNA was overexpressed in mullets exposed to WF for 16 days. Functionally, this response was reflected in a significant accumulation of bile PAH metabolites. WF treated fish accumulated mainly high molecular weight metabolites

Effects of exposure to Prestige-like heavy fuel oil and to perfluorooctane sulfonate on conventional biomarkers and target gene transcription in the thicklip grey mullet Chelon labrosus

Energy Technology Data Exchange (ETDEWEB)

Bilbao, E.; Raingeard, D.; Diaz de Cerio, O.; Ortiz-Zarragoitia, M.; Ruiz, P.; Izagirre, U.; Orbea, A.; Marigomez, I.; Cajaraville, M.P. [Laboratory of Cell Biology and Histology, Department of Zoology and Animal Cell Biology, School of Science and Technology, University of the Basque Country, E-48080 Bilbao, Basque Country (Spain); Cancio, I., E-mail: ibon.cancio@ehu.es [Laboratory of Cell Biology and Histology, Department of Zoology and Animal Cell Biology, School of Science and Technology, University of the Basque Country, E-48080 Bilbao, Basque Country (Spain)

2010-07-01

Thicklip grey mullets Chelon labrosus inhabit coastal and estuarine areas where they can be chronically exposed to commonly released pollutants such as polycyclic aromatic hydrocarbons (PAHs) and perfluorinated compounds. These pollutants can also originate from accidental spills, such as the Prestige oil spill in 2002, which resulted in the release of a heavy fuel oil that affected coastal ecosystems in the Bay of Biscay. Peroxisome proliferation (PP), induced biotransformation metabolism, immunosuppression and endocrine disruption are some of the possible biological effects caused by such chemicals. With the aim of studying the effects of organic toxic chemicals on such biological processes at the transcriptional and at the cell/tissue level, juvenile mullets were exposed to the typical mammalian peroxisome proliferator perfluorooctane sulfonate (PFOS), and to fresh (F) and weathered (WF) Prestige-like heavy fuel oil for 2 and 16 days. First, fragments of genes relevant to biotransformation, immune/inflammatory and endocrine disruption processes were cloned using degenerate primers. Fuel oil elicited a significant PP response as proved by the transcriptional upregulation of palmitoyl-CoA oxidase (aox1), peroxisome proliferator activated receptor {alpha} (ppar{alpha}) and retinoic X receptor, by the AOX1 activity induction and by the increased peroxisomal volume density. PFOS only elicited a significant induction of AOX1 activity at day 2 and of PPAR{alpha} mRNA expression at day 16. All treatments significantly increased catalase mRNA expression at day 16 in liver and at day 2 in gill. Cyp1a transcription (liver and gill) and EROD activity were induced in fuel oil treated organisms. In the case of phase II metabolism only hepatic glutathione S-transferase mRNA was overexpressed in mullets exposed to WF for 16 days. Functionally, this response was reflected in a significant accumulation of bile PAH metabolites. WF treated fish accumulated mainly high molecular

Effects of exposure to Prestige-like heavy fuel oil and to perfluorooctane sulfonate on conventional biomarkers and target gene transcription in the thicklip grey mullet Chelon labrosus.

Science.gov (United States)

Bilbao, E; Raingeard, D; de Cerio, O Diaz; Ortiz-Zarragoitia, M; Ruiz, P; Izagirre, U; Orbea, A; Marigómez, I; Cajaraville, M P; Cancio, I

2010-07-01

Thicklip grey mullets Chelon labrosus inhabit coastal and estuarine areas where they can be chronically exposed to commonly released pollutants such as polycyclic aromatic hydrocarbons (PAHs) and perfluorinated compounds. These pollutants can also originate from accidental spills, such as the Prestige oil spill in 2002, which resulted in the release of a heavy fuel oil that affected coastal ecosystems in the Bay of Biscay. Peroxisome proliferation (PP), induced biotransformation metabolism, immunosuppression and endocrine disruption are some of the possible biological effects caused by such chemicals. With the aim of studying the effects of organic toxic chemicals on such biological processes at the transcriptional and at the cell/tissue level, juvenile mullets were exposed to the typical mammalian peroxisome proliferator perfluorooctane sulfonate (PFOS), and to fresh (F) and weathered (WF) Prestige-like heavy fuel oil for 2 and 16 days. First, fragments of genes relevant to biotransformation, immune/inflammatory and endocrine disruption processes were cloned using degenerate primers. Fuel oil elicited a significant PP response as proved by the transcriptional upregulation of palmitoyl-CoA oxidase (aox1), peroxisome proliferator activated receptor alpha (pparalpha) and retinoic X receptor, by the AOX1 activity induction and by the increased peroxisomal volume density. PFOS only elicited a significant induction of AOX1 activity at day 2 and of PPARalpha mRNA expression at day 16. All treatments significantly increased catalase mRNA expression at day 16 in liver and at day 2 in gill. Cyp1a transcription (liver and gill) and EROD activity were induced in fuel oil treated organisms. In the case of phase II metabolism only hepatic glutathione S-transferase mRNA was overexpressed in mullets exposed to WF for 16 days. Functionally, this response was reflected in a significant accumulation of bile PAH metabolites. WF treated fish accumulated mainly high molecular weight

Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

Science.gov (United States)

Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

2006-01-01

The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.

Science.gov (United States)

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-03-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

Continuous minimally-invasive alcohol monitoring using microneedle sensor arrays

OpenAIRE

Mohan, AMV; Windmiller, JR; Mishra, RK; Wang, J

2017-01-01

The present work describes an attractive skin-worn microneedle sensing device for the minimally invasive electrochemical monitoring of subcutaneous alcohol. The device consists of an assembly of pyramidal microneedle structures integrated with Pt and Ag wires, each with a microcavity opening. The microneedle aperture was modified by electropolymerizing o-phenylene diamine onto the Pt wire microtransducer, followed by the immobilization of alcohol oxidase (AOx) in an intermediate chitosan laye...

Role of pH in oxidase variability of Aeromonas hydrophila.

OpenAIRE

Hunt, L K; Overman, T L; Otero, R B

1981-01-01

Some strains of Aeromonas hydrophila may be oxidase negative or only weakly oxidase positive by the Kovacs method taken from the surface of a differential medium, such as MacConkey agar. Six strains of A. hydrophila, two oxidase variable, one oxidase constant, and three weakly oxidase positive on MacConkey agar, were studied to determine the cause of oxidase variability. The bacteriostatic dyes in MacConkey agar were considered possible inhibitors of the oxidase reaction. The concentration of...

Effect of different NADH oxidase levels on glucose metabolism by Lactococus lactis : kinetics of intracellular metabolite pools determined by in vivo nuclear magnetic resonance

NARCIS (Netherlands)

Neves, A.R.; Ramos, A.; Costa, H.; Swam, van I.I.; Hugenholtz, J.; Kleerebezem, M.; Vos, de W.M.; Santos, H.

2002-01-01

Three isogenic strains of Lactococcus lactis with different levels of H2O-forming NADH oxidase activity were used to study the effect of oxygen on glucose metabolism: the parent strain L. lactis MG1363, a NOX- strain harboring a deletion of the gene coding for H2O-forming NADH oxidase, and a NOX

Comparative study of different alcohol sensors based on Screen-Printed Carbon Electrodes.

Science.gov (United States)

Costa Rama, Estefanía; Biscay, Julien; González García, María Begoña; Julio Reviejo, A; Pingarrón Carrazón, José Manuel; Costa García, Agustín

2012-05-30

Different very simple single-use alcohol enzyme sensors were developed using alcohol oxidase (AOX) from three different yeast, Hansenula sp., Pichia pastoris and Candida boidinii, and employing three different commercial mediator-based Screen-Printed Carbon Electrodes as transducers. The mediators tested, Prussian Blue, Ferrocyanide and Co-phthalocyanine were included into the ink of the working electrode. The procedure to obtain these sensors consists of the immobilization of the enzyme on the electrode surface by adsorption. For the immobilization, an AOX solution is deposited on the working electrode and left until dried (1h) at room temperature. The best results were obtained with the biosensor using Screen-Printed Co-phthalocyanine/Carbon Electrode and AOX from Hansenula sp. The reduced cobalt-phthalocyanine form is amperometrically detected at +0.4V (vs. Ag pseudo reference electrode). This sensor shows good sensitivity (1211 nA mM(-1)), high precision (2.1% RSD value for the slope value of the calibration plot) and wide linear response (0.05-1.00 mM) for ethanol determination. The sensor provides also accurate results for ethanol quantification in alcoholic drinks. Copyright © 2012 Elsevier B.V. All rights reserved.

Burkholderia pseudomallei Evades Nramp1 (Slc11a1- and NADPH Oxidase-Mediated Killing in Macrophages and Exhibits Nramp1-Dependent Virulence Gene Expression

Directory of Open Access Journals (Sweden)

Veerachat Muangsombut

2017-08-01

Full Text Available Bacterial survival in macrophages can be affected by the natural resistance-associated macrophage protein 1 (Nramp1; also known as solute carrier family 11 member a1 or Slc11a1 which localizes to phagosome membranes and transports divalent cations, including iron. Little is known about the role of Nramp1 in Burkholderia infection, in particular whether this differs for pathogenic species like Burkholderia pseudomallei causing melioidosis or non-pathogenic species like Burkholderia thailandensis. Here we show that transfected macrophages stably expressing wild-type Nramp1 (Nramp1+ control the net replication of B. thailandensis, but not B. pseudomallei. Control of B. thailandensis was associated with increased cytokine responses, and could be abrogated by blocking NADPH oxidase-mediated production of reactive oxygen species but not by blocking generation of reactive nitrogen species. The inability of Nramp1+ macrophages to control B. pseudomallei was associated with rapid escape of bacteria from phagosomes, as indicated by decreased co-localization with LAMP1 compared to B. thailandensis. A B. pseudomallei bipB mutant impaired in escape from phagosomes was controlled to a greater extent than the parent strain in Nramp1+ macrophages, but was also attenuated in Nramp1− cells. Consistent with reduced escape from phagosomes, B. thailandensis formed fewer multinucleated giant cells in Nramp1+ macrophages at later time points compared to B. pseudomallei. B. pseudomallei exhibited elevated transcription of virulence-associated genes of Type VI Secretion System cluster 1 (T6SS-1, the Bsa Type III Secretion System (T3SS-3 and the bimA gene required for actin-based motility in Nramp1+ macrophages. Nramp1+ macrophages were found to contain decreased iron levels that may impact on expression of such genes. Our data show that B. pseudomallei is able to evade Nramp1- and NADPH oxidase-mediated killing in macrophages and that expression of virulence

Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids.

Science.gov (United States)

Sytykiewicz, Hubert

2016-07-22

Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.

Mitochondrial cytochrome oxidase I gene analysis indicates a restricted genetic background in Finnish noble crayfish (Astacus astacus stocks

Directory of Open Access Journals (Sweden)

Makkonen J.

2015-01-01

Full Text Available The IUCN Red List indexes the noble crayfish (Astacus astacus as vulnerable, with a declining population trend. The main threats to the species are the crayfish plague caused by the oomycete Aphanomyces astaci and the introduced North American crayfish that act as the carriers of this disease. In Finland, the noble crayfish is considered as a native species, which original distribution area covers the southern part of the country, but the species distribution has been dispersed to cover almost the whole country. The aim of this study was to survey the genetic diversity among the Finnish noble crayfish populations. The mitochondrial cytochrome oxidase I (COI-gene was sequenced from 742 individuals representing 59 populations from Finland and Estonia. As a result, only a single haplotype was found. Based on these results, the genetic diversity of noble crayfish in its Northern distribution range is remarkably low. The observed lack of variation can result from several mechanisms including small size of the founder population and the intense spreading of the species by manmade stockings. The restricted diversity can also be caused by eradication of the original populations due to crayfish plague epidemics and spreading of the invasive crayfish species carrying the crayfish plague. It is also possible that all contemporary Finnish noble crayfish populations originate from stockings with no variation in respect to COI-gene.

NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

Energy Technology Data Exchange (ETDEWEB)

Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun; Kim, Hyoung Jin [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Park, Ji-hoon [Department of Biochemistry, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Koo, Sun Young; Kwak, Hyo-Shin; Park, Heui Sul; Kim, Dong Wook; Song, Myoungsub; Yim, Hyeon Joo; Seo, Dong Ook [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Kim, Soon Ha, E-mail: shakim@lgls.com [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of)

2012-08-15

Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed that 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.

Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

Science.gov (United States)

Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

2013-07-01

The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

Science.gov (United States)

Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

2009-01-01

The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

Covalently bound phosphate residues in bovine milk xanthine oxidase and in glucose oxidase from Aspergillus niger: A reevaluation

Energy Technology Data Exchange (ETDEWEB)

Johnson, J.L.; Rajagopalan, K.V. (Duke Univ. Medical Center, Durham, NC (USA)); London, R.E. (National Institute of Environmental Health Science, Research Triangle Park, NC (USA))

1989-09-01

The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and {sup 31}P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well.

Covalently bound phosphate residues in bovine milk xanthine oxidase and in glucose oxidase from Aspergillus niger: A reevaluation

International Nuclear Information System (INIS)

Johnson, J.L.; Rajagopalan, K.V.; London, R.E.

1989-01-01

The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and 31 P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well

Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

Science.gov (United States)

Li, Wande

2013-01-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

Polyphenol Oxidase Enzyme and Inactivation Methods

Directory of Open Access Journals (Sweden)

Leman Yılmaz

2018-03-01

Full Text Available Polyphenol oxidase enzyme is found in vegetables and fruits, as well as in some animal organs and microorganisms. Polyphenol oxidase enzyme responsible for enzymatic browning is a group of copper proteins that catalyses the oxidation of phenolic compounds to quinones, which produce brown pigments, commonly found in fruits and vegetables. During the industrial preparation of fruits and vegetables, results of catalytic effect of polyphenol oxidase causes enzymatic browning. Enzymatic browning impairs the appearance of products containing phenolic compounds along with undesirable colour, odor and taste formation and significant loss of nutritional value of the products. This affects the acceptability of the products by the consumers and causes economic losses. In this review, some characteristics of polyphenol oxidase enzyme in different fruits and vegetables have been reviewed and information about chemical antibrowning agents, thermal applications, irradiation applications and alternative methods such as high pressure processing, pulse electric field, supercritical carbon dioxide and ultrasound applications to inactivate this enzyme has been presented.

Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

Science.gov (United States)

Rathinam, T; Gadde, U; Chapman, H D

2015-07-01

Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.

Science.gov (United States)

Hinkkanen, A; Maly, F E; Decker, K

1983-04-01

The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.

Cytochrome oxidase assembly does not require catalytically active cytochrome C.

Science.gov (United States)

Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander

2003-03-14

Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.

Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.

Science.gov (United States)

Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H

2008-10-05

Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.

D-amino acid oxidase activator gene (DAOA) variation affects cerebrospinal fluid homovanillic acid concentrations in healthy Caucasians

DEFF Research Database (Denmark)

Andreou, Dimitrios; Saetre, Peter; Werge, Thomas

2012-01-01

The D-amino acid oxidase activator (DAOA) protein regulates the function of D-amino oxidase (DAO), an enzyme that catalyzes the oxidative deamination of D-3,4-dihydroxyphenylalanine (D-DOPA) and D-serine. D-DOPA is converted to L-3,4-DOPA, a precursor of dopamine, whereas D-serine participates...... in glutamatergic transmission. We hypothesized that DAOA polymorphisms are associated with dopamine, serotonin and noradrenaline turnover in the human brain. Four single-nucleotide polymorphisms, previously reported to be associated with schizophrenia, were genotyped. Cerebrospinal fluid (CSF) samples were drawn...... by lumbar puncture, and the concentrations of the major dopamine metabolite homovanillic acid (HVA), the major serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA) and the major noradrenaline metabolite 3-methoxy-4-hydroxyphenylglycol (MHPG) were measured. Two of the investigated polymorphisms, rs...

A new type of gene-disruption cassette with a rescue gene for Pichia pastoris.

Science.gov (United States)

Shibui, Tatsuro; Hara, Hiroyoshi

2017-09-01

Pichia pastoris has been used for the production of many recombinant proteins, and many useful mutant strains have been created. However, the efficiency of mutant isolation by gene-targeting is usually low and the procedure is difficult for those inexperienced in yeast genetics. In order to overcome these issues, we developed a new gene-disruption system with a rescue gene using an inducible Cre/mutant-loxP system. With only short homology regions, the gene-disruption cassette of the system replaces its target-gene locus containing a mutation with a compensatory rescue gene. As the cassette contains the AOX1 promoter-driven Cre gene, when targeted strains are grown on media containing methanol, the DNA fragment, i.e., the marker, rescue and Cre genes, between the mutant-loxP sequences in the cassette is excised, leaving only the remaining mutant-loxP sequence in the genome, and consequently a target gene-disrupted mutant can be isolated. The system was initially validated on ADE2 gene disruption, where the disruption can easily be detected by color-change of the colonies. Then, the system was applied for knocking-out URA3 and OCH1 genes, reported to be difficult to accomplish by conventional gene-targeting methods. All three gene-disruption cassettes with their rescue genes replaced their target genes, and the Cre/mutant-loxP system worked well to successfully isolate their knock-out mutants. This study identified a new gene-disruption system that could be used to effectively and strategically knock out genes of interest, especially whose deletion is detrimental to growth, without using special strains, e.g., deficient in nonhomologous end-joining, in P. pastoris. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:1201-1208, 2017. © 2017 American Institute of Chemical Engineers.

Respiratory arsenate reductase as a bidirectional enzyme

Science.gov (United States)

Richey, C.; Chovanec, P.; Hoeft, S.E.; Oremland, R.S.; Basu, P.; Stolz, J.F.

2009-01-01

The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe–S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

Confirmation of a blocked amino terminus of sulfhydryl oxidase

International Nuclear Information System (INIS)

Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E.

1990-01-01

The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with [ 14 C]iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 (± 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked

Genetical polymorphism of acc synthase and ACC oxidase in Apple selections bred in Čačak

Directory of Open Access Journals (Sweden)

Marić Slađana

2005-01-01

Full Text Available The work on breeding new apple cultivars, of improved quality and longer storage life has been going on for a long time at the Fruit and Grape Research Centre in Čačak. As a result nine promising apple selections, that show the range of fruit storage capability (J/l/7, J/l/20, J/2/12, J/2/14, J/ll/31, J/54/53/59, J/60/7/63, Šumatovka 1 O.P. and Šumatovka 2 O.P., were singled out. Fruit ripening is genetically programmed, complex physiological process with the important role of plant hormone ethylene. Allelic polymorphism of the genes encoding ACC synthase and ACC oxidase, enzymes on ethylene biosynthetic pathway, was studied in promising apple selections and compared to their storage life. Polymorphism was detected by the polymerase chain reaction (PCR method and restriction analysis with 6 restriction enzymes. Two alleles of the gene encoding ACC synthase (ACS1-1 and ACS1-2, three alleles of the ACC oxidase gene (a, b and n were identified and a positive test for early seedling selection, the fruits of which will be characterized by long storage life, was indicated.

Immobilization of oxidases and their analytical applications

International Nuclear Information System (INIS)

Yasinzai, M.

2007-01-01

Immobilized enzymes are replacing their soluble counter-parts in nearly every field of application. These enzyme modifications have evolved from a research curiosity into an entire branch of Biotechnology. An immobilization method for flavin containing oxidases and their use in flow injection system is described. An electrochemical detector for H/sub 2/O/sub 2/ is assembled which is used effectively for the determination of glucose using more common glucose oxidase and the simultaneous determination of sugars. The combination of oxidases with hydrolases have been used for the determination of maltose and starch. (author)

NADPH Oxidases: Progress and Opportunities

OpenAIRE

San Martin, Alejandra; Griendling, Kathy K.

2014-01-01

From the initial discovery in 1999 that NADPH oxidases comprise a family of enzymes to our current focus on drug development to treat multiple pathologies related to this enzyme family, progress has been swift and impressive. We have expanded our understanding of the extent of the family, the basic enzymatic biochemistry, the multiple cellular functions controlled by NADPH oxidases, and their varied roles in physiology and diseases. We have developed numerous cell culture tools, animal models...

[The regulation of peroxisomal matrix enzymes (alcohol oxidase and catalase) formation by the product of the gene Mth1 in methylotrophic yeast Pichia methanolica].

Science.gov (United States)

Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M

2009-01-01

Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.

Confirmation of Two Sibling Species among Anopheles fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene.

Science.gov (United States)

Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan

2012-12-01

Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

Partial protoporphyrinogen oxidase (PPOX gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

Directory of Open Access Journals (Sweden)

Barbaro Michela

2013-01-01

Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.

NADPH oxidase is not an essential mediator of oxidative stress or liver injury in murine MCD diet-induced steatohepatitis.

Science.gov (United States)

dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C

2007-02-01

Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.

Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.

Science.gov (United States)

Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping

2016-05-01

Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.

Modulation of NADPH oxidase activity by known uraemic retention solutes

DEFF Research Database (Denmark)

Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera

2014-01-01

chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. RESULTS: Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized......BACKGROUND: Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased...... inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. METHODS: Mononuclear leucocytes...

Gravity Responsive NADH Oxidase of the Plasma Membrane

Science.gov (United States)

Morre, D. James (Inventor)

2002-01-01

A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

Identification of arsenic resistant endophytic bacteria from Pteris vittata roots and characterization for arsenic remediation application.

Science.gov (United States)

Tiwari, Sarita; Sarangi, Bijaya Ketan; Thul, Sanjog T

2016-09-15

Mitigation of arsenic (As) pollution is a topical environmental issue of high R&D priority. The present investigation was carried out to isolate As resistant endophytes from the roots of Indian ecotype Pteris vittata and characterize their As transformation and tolerance ability, plant growth promoting characteristics and their role to facilitate As uptake by the plant. A total of 8 root endophytes were isolated from plants grown in As amended soil (25 mg As kg(-1)). These isolates were studied for minimum inhibitory concentration (MIC), arsenite As(III) - arsenate As(V) transformation ability, plant growth promoting (PGP) characteristics through siderophore, indole acetic acid (IAA) production, phosphatase, ACC deaminase activity, and presence of arsenite oxidase (aox) and arsenite transporter (arsB) genes. On the basis of 16S rDNA sequence analysis, these isolates belong to Proteobacteria, Firmicutes and Bacteroidetes families under the genera Bacillus, Enterobacter, Stenotrophomonas and Rhizobium. All isolates were found As tolerant, of which one isolates showed highest tolerance up to 1000 mg L(-1) concentration in SLP medium. Five isolates were IAA positive with highest IAA production up to 60 mg/L and two isolates exhibited siderophore activity. Phosphatase activity was shown by only one isolate while ACC deaminase activity was absent in all the isolates. The As transformation study by silver nitrate test showed that only two strains had dual characteristics of As(III) oxidation and As (V) reduction, four strains exhibited either of the characteristics while other two didn't confirmed any of the two characteristics. Presence of aox gene was detected in two strains and arsB gene in six isolates. The strain with highest As tolerance also showed highest IAA production and occurrence of arsB gene. Present investigation may open up further scope of utilizing these endophytes for up gradation of phytoextraction process. Copyright © 2016 Elsevier Ltd. All

Alleviating Redox Imbalance Enhances 7-Dehydrocholesterol Production in Engineered Saccharomyces cerevisiae.

Directory of Open Access Journals (Sweden)

Wan Su

Full Text Available Maintaining redox balance is critical for the production of heterologous secondary metabolites, whereas on various occasions the native cofactor balance does not match the needs in engineered microorganisms. In this study, 7-dehydrocholesterol (7-DHC, a crucial precursor of vitamin D3 biosynthesis pathway was constructed in Saccharomyces cerevisiae BY4742 with endogenous ergosterol synthesis pathway blocked by knocking out the erg5 gene (encoding C-22 desaturase. The deletion of erg5 led to redox imbalance with higher ratio of cytosolic free NADH/NAD+ and more glycerol and ethanol accumulation. To alleviate the redox imbalance, a water-forming NADH oxidase (NOX and an alternative oxidase (AOX1 were employed in our system based on cofactor regeneration strategy. Consequently, the production of 7-dehydrocholesterol was increased by 74.4% in shake flask culture. In the meanwhile, the ratio of free NADH/NAD+ and the concentration of glycerol and ethanol were reduced by 78.0%, 50.7% and 7.9% respectively. In a 5-L bioreactor, the optimal production of 7-DHC reached 44.49(±9.63 mg/L. This study provides a reference to increase the production of some desired compounds that are restricted by redox imbalance.

Cotton Ascorbate Oxidase Promotes Cell Growth in Cultured Tobacco Bright Yellow-2 Cells through Generation of Apoplast Oxidation

Science.gov (United States)

Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin

2017-01-01

Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407

Data on cytochrome c oxidase assembly in mice and human fibroblasts or tissues induced by SURF1 defect

Directory of Open Access Journals (Sweden)

Nikola Kovářová

2016-06-01

Full Text Available This paper describes data related to a research article entitled “Tissue- and species-specific differences in cytochrome c oxidase assembly induced by SURF1 defects” [1]. This paper includes data of the quantitative analysis of individual forms of respiratory chain complexes I, III and IV present in SURF1 knockout (SURF1−/− and control (SURF1+/+ mouse fibroblasts and tissues and in fibroblasts of human control and patients with SURF1 gene mutation. Also it includes data demonstrating response of complex IV, cytochrome c oxidase (COX, to reversible inhibition of mitochondrial translation in SURF1−/− mouse and SURF1 patient fibroblast cell lines.

The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase

International Nuclear Information System (INIS)

Long, C.M.; Rohrmann, G.F.; Merrill, G.F.

2009-01-01

Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.

Cyanobacterial Lactate Oxidases Serve as Essential Partners in N2 Fixation and Evolved into Photorespiratory Glycolate Oxidases in Plants[w

Science.gov (United States)

Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin

2011-01-01

Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292

Calcium transport in vesicles energized by cytochrome oxidase

Energy Technology Data Exchange (ETDEWEB)

Rosier, Randy N. [Univ. of Rochester, NY (United States)

1979-01-01

Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K⁺ selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K⁺ flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interaction with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.

H2O2 and NADPH oxidases involve in regulation of 2-(2-phenylethyl)chromones accumulation during salt stress in Aquilaria sinensis calli.

Science.gov (United States)

Wang, Xiaohui; Dong, Xianjuan; Feng, Yingying; Liu, Xiao; Wang, Jinling; Zhang, Zhongxiu; Li, Jun; Zhao, Yunfang; Shi, Shepo; Tu, Pengfei

2018-04-01

2-(2-Phenylethyl)chromones are the main compounds responsible for the quality of agarwood, which is widely used in traditional medicines, incenses and perfumes. H 2 O 2 and NADPH oxidases (also known as respiratory burst oxidase homologs, Rbohs) mediate diverse physiological and biochemical processes in environmental stress responses. However, little is known about the function of H 2 O 2 and NADPH oxidases in 2-(2-phenylethyl)chromones accumulation. In this study, we found that salt stress induced a transient increase in content of H 2 O 2 and 2-(2-phenylethyl)chromones accumulation in Aquilaria sinensis calli. Exogenous H 2 O 2 remarkably decreased the production of 2-(2-phenylethyl)chromones, while dimethylthiourea (DMTU), a scavenger of H 2 O 2 , significantly increased 2-(2-phenylethyl)chromones accumulation in salt treated calli. Three new H 2 O 2 -generating genes, named AsRbohA-C, were isolated and characterized from A. sinensis. Salt stress also induced a transient increase in AsRbohA-C expression and NADPH oxidase activity. Furthermore, exogenous H 2 O 2 increased AsRbohA-C expression and NADPH oxidase activity, while DMTU inhibited AsRbohA-C expression and NADPH oxidase activity under salt stress. Moreover, diphenylene iodonium (DPI), the inhibitor of NADPH oxidases, reduced AsRbohA-C expression and NADPH oxidase activity, but significantly induced 2-(2-phenylethyl)chromones accumulation during salt stress. These results clearly demonstrated the central role of H 2 O 2 and NADPH oxidases in regulation of salt-induced 2-(2-phenylethyl)chromones accumulation in A. sinensis calli. Copyright © 2018 Elsevier B.V. All rights reserved.

Modulation of NADPH oxidase activity by known uraemic retention solutes.

Science.gov (United States)

Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera; Cohen, Gerald; Schaefer, Mandy; Boehringer, Falko; Tepel, Martin; Kunkel, Desiree; Zidek, Walter; Jankowski, Joachim

2014-08-01

Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. Mononuclear leucocytes isolated from buffy coats of healthy volunteers were isolated, lysed and incubated with NADH in the presence of plasma from healthy controls and patients with CKD-5D. Furthermore, the leucocytes were lysed and incubated in the presence of uraemic retention solute of interest and diphenyleneiodonium chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized as the strongest inhibitor of NADPH oxidase (90% of DPI inhibition). Surprisingly, none of the uraemic retention solutes we investigated was found to increase NADPH oxidase activity. Furthermore, plasma from patients with CKD-5D before dialysis caused significantly higher inhibitory effect on NADPH oxidase activity compared with plasma from healthy subjects. However, this effect was significantly decreased in plasma from patients with CKD-5D after dialysis. The results of this study show that uraemic retention solutes modulated the activity of the NADPH oxidase. The results of this study might be the basis for the development of inhibitors applicable as drug in the situation of increased oxidative stress. © 2014 Stichting European Society for Clinical Investigation Journal Foundation.

Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

Science.gov (United States)

Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

2014-07-15

Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.

Lysyl oxidase in colorectal cancer

DEFF Research Database (Denmark)

Cox, Thomas R; Erler, Janine T

2013-01-01

Colorectal cancer is the third most prevalent form of cancer worldwide and fourth-leading cause of cancer-related mortality, leading to ~600,000 deaths annually, predominantly affecting the developed world. Lysyl oxidase is a secreted, extracellular matrix-modifying enzyme previously suggested...... to act as a tumor suppressor in colorectal cancer. However, emerging evidence has rapidly implicated lysyl oxidase in promoting metastasis of solid tumors and in particular colorectal cancer at multiple stages, affecting tumor cell proliferation, invasion, and angiogenesis. This emerging research has...... advancements in the field of colorectal cancer....

D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate.

Science.gov (United States)

El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K

2012-01-01

Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.

Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.

Science.gov (United States)

Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof

2010-05-01

Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching.

Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution

Science.gov (United States)

Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

2013-01-01

Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

Improving glyphosate oxidation activity of glycine oxidase from Bacillus cereus by directed evolution.

Directory of Open Access Journals (Sweden)

Tao Zhan

Full Text Available Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO, we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg(51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops.

Confirmation of Two Sibling Species among Anopheles Fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene

Directory of Open Access Journals (Sweden)

Saied Reza Naddaf

2012-12-01

Full Text Available Background: Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran.Methods: DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474–475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phy­logenetic tree for obtained sequences was generated by using Kimura two parameter (K2P model of neighbor-join­ing method.Results: Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individ­uals and the group comprising individuals from other areas of Iran was 2.06%.Conclusion: Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

The gene expressions of DNA methylation/demethylation enzymes ...

African Journals Online (AJOL)

A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases (Dnmts), DNA ...

Production of rabbit antibodies against purified Glucose oxidase

Directory of Open Access Journals (Sweden)

Muhammad Anjum Zia

2012-02-01

Full Text Available Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex G-200 column for gel filtration chromatography. It was observed that enzyme achieved 59.37 U mg-1of specific activity with 27.08 fold purity and 64.36% recovery. Purified glucose oxidase was injected into rabbits through intravenous route, to raise the glucose oxidase antibodies. After 30 days incubation period, the rabbits were slaughtered and serum was separated from blood. The antibodies were isolated by ammonium sulfate precipitation and confirmed by agar gel precipitation test. This could be a convenient and low cost alternate assay for the estimation of glucose oxidase in biological fluids. Moreover, such antibodies against the said enzyme could be used in various therapeutic and diagnostic applications.

Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression

Czech Academy of Sciences Publication Activity Database

Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, I.T.; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, T.; Schmülling, T.; Vaňková, Radomíra

2013-01-01

Roč. 64, č. 10 (2013), s. 2805-2815 ISSN 0022-0957 R&D Projects: GA ČR GA206/09/2062 Institutional support: RVO:61389030 ; RVO:60077344 ; RVO:67985939 Keywords : cytokinin oxidase * cytokinin * Abscisic acid Subject RIV: ED - Physiology Impact factor: 5.794, year: 2013

Chemoenzymatic combination of glucose oxidase with titanium silicalite -1

DEFF Research Database (Denmark)

Vennestrøm, Peter Nicolai Ravnborg; Taarning, Esben; Christensen, Claus H.

2010-01-01

Zeozymes: A proof-of-concept is presented for the chemoenzymatic combination of titanium silicalite-1 zeolite with glucose oxidase. In this combination, glucose is oxidized to gluconic acid and the H2O2 byproduct formed in situ is used for the simultaneous oxidation of chemical substrates. Both...... a soluble glucose oxidase and a truly integrated heterogeneous combination whereby the oxidase enzyme is anchored onto the zeolite surface are reported....

Cell Wall Amine Oxidases: New Players in Root Xylem Differentiation under Stress Conditions

Directory of Open Access Journals (Sweden)

Sandip A. Ghuge

2015-07-01

Full Text Available Polyamines (PAs are aliphatic polycations present in all living organisms. A growing body of evidence reveals their involvement as regulators in a variety of physiological and pathological events. They are oxidatively deaminated by amine oxidases (AOs, including copper amine oxidases (CuAOs and flavin adenine dinucleotide (FAD-dependent polyamine oxidases (PAOs. The biologically-active hydrogen peroxide (H2O2 is a shared compound in all of the AO-catalyzed reactions, and it has been reported to play important roles in PA-mediated developmental and stress-induced processes. In particular, the AO-driven H2O2 biosynthesis in the cell wall is well known to be involved in plant wound healing and pathogen attack responses by both triggering peroxidase-mediated wall-stiffening events and signaling modulation of defense gene expression. Extensive investigation by a variety of methodological approaches revealed high levels of expression of cell wall-localized AOs in root xylem tissues and vascular parenchyma of different plant species. Here, the recent progresses in understanding the role of cell wall-localized AOs as mediators of root xylem differentiation during development and/or under stress conditions are reviewed. A number of experimental pieces of evidence supports the involvement of apoplastic H2O2 derived from PA oxidation in xylem tissue maturation under stress-simulated conditions.

Independently recruited oxidases from the glucose-methanol-choline oxidoreductase family enabled chemical defences in leaf beetle larvae (subtribe Chrysomelina) to evolve

Science.gov (United States)

Rahfeld, Peter; Kirsch, Roy; Kugel, Susann; Wielsch, Natalie; Stock, Magdalena; Groth, Marco; Boland, Wilhelm; Burse, Antje

2014-01-01

Larvae of the leaf beetle subtribe Chrysomelina sensu stricto repel their enemies by displaying glandular secretions that contain defensive compounds. These repellents can be produced either de novo (iridoids) or by using plant-derived precursors (e.g. salicylaldehyde). The autonomous production of iridoids, as in Phaedon cochleariae, is the ancestral chrysomeline chemical defence and predates the evolution of salicylaldehyde-based defence. Both biosynthesis strategies include an oxidative step of an alcohol intermediate. In salicylaldehyde-producing species, this step is catalysed by salicyl alcohol oxidases (SAOs) of the glucose-methanol-choline (GMC) oxidoreductase superfamily, but the enzyme oxidizing the iridoid precursor is unknown. Here, we show by in vitro as well as in vivo experiments that P. cochleariae also uses an oxidase from the GMC superfamily for defensive purposes. However, our phylogenetic analysis of chrysomeline GMC oxidoreductases revealed that the oxidase of the iridoid pathway originated from a GMC clade different from that of the SAOs. Thus, the evolution of a host-independent chemical defence followed by a shift to a host-dependent chemical defence in chrysomeline beetles coincided with the utilization of genes from different GMC subfamilies. These findings illustrate the importance of the GMC multi-gene family for adaptive processes in plant–insect interactions. PMID:24943369

Genome-Wide Identification and Expression Profiling of Cytokinin Oxidase/Dehydrogenase (CKX) Genes Reveal Likely Roles in Pod Development and Stress Responses in Oilseed Rape (Brassica napus L.).

Science.gov (United States)

Liu, Pu; Zhang, Chao; Ma, Jin-Qi; Zhang, Li-Yuan; Yang, Bo; Tang, Xin-Yu; Huang, Ling; Zhou, Xin-Tong; Lu, Kun; Li, Jia-Na

2018-03-16

Cytokinin oxidase/dehydrogenases (CKXs) play a critical role in the irreversible degradation of cytokinins, thereby regulating plant growth and development. Brassica napus is one of the most widely cultivated oilseed crops worldwide. With the completion of whole-genome sequencing of B. napus , genome-wide identification and expression analysis of the BnCKX gene family has become technically feasible. In this study, we identified 23 BnCKX genes and analyzed their phylogenetic relationships, gene structures, conserved motifs, protein subcellular localizations, and other properties. We also analyzed the expression of the 23 BnCKX genes in the B. napus cultivar Zhong Shuang 11 ('ZS11') by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), revealing their diverse expression patterns. We selected four BnCKX genes based on the results of RNA-sequencing and qRT-PCR and compared their expression in cultivated varieties with extremely long versus short siliques. The expression levels of BnCKX5-1 , 5-2 , 6-1 , and 7-1 significantly differed between the two lines and changed during pod development, suggesting they might play roles in determining silique length and in pod development. Finally, we investigated the effects of treatment with the synthetic cytokinin 6-benzylaminopurine (6-BA) and the auxin indole-3-acetic acid (IAA) on the expression of the four selected BnCKX genes. Our results suggest that regulating BnCKX expression is a promising way to enhance the harvest index and stress resistance in plants.

[Sequencing of mitochondrial DNA cytochrome oxidase subunit I gene in sarcosaphagous flies from 14 provinces in China].

Science.gov (United States)

Yang, Li; Cai, Jifeng; Wen, Jifang; Guo, Yadong

2010-08-01

To detect the 278 bp region of gene of the cytochrome oxidase subunit I (COI) in mitochondral DNA (mtDNA) of sarcosaphagous flies, identify the species of sarcosaphagous flies, and provide reference for forensic application. Samples were collected in Baotou and Chifeng of Inner Mongolia, Tianjin, Nanning, Fuzhou, Linyi of Shandong, Shijiazhuang, Yinchuan, Lanzhou, Huairou of Beijing, Xinxiang and Nanyang of Henan, Datong of Shanxi, Wuhu of Anhui, Quzhou of Zhejiang, Changsha, Zhuzhou and Yongzhou of Hunan. A total of 38 flies were randomly collected from rabbits, dogs and pigs which were set outdoors, then the flies' mitochondrial DNA (mtDNA) were extracted by the improved small insects DNA homogenate method. Amplification was conducted by Perkin-Elmer 9600 thermal cycler, then vertical non-denaturing 7% polyacrylamide gelectrophoresis. PCR products were purified using the nucleic acid purification kit. Sequences of both strands were obtained by direct sequence of the double-stranded PCR product using one of the PCR primers and the ABI PRISM big dye terminator cycle sequencing dit. Sequence reactions were electrophorsed on ABI Model 3730 DNA Sequencers. A UPGMA tree was contrasted using the maximum composite likelihood method in MEGA4. The 38 sarcosaphagous flies belonged to 3 families(Muscidae, Calliphoridae, and Sarcophagidae), 10 genuses (Musca Linnaeus, Hydrotaea Robineau-Desvoidy, Aldrichina Townsend, Hemipyrellia Townsend, Achoetandrus Bezzi, Protophormia Townsend, Chrysomya Robineau-Desvoidy, Lucilia Robineau-Desvoidy, Helicophagella Enderlein, and Boettcherisca Rohdendorf), and 12 species [Musca domestica (Linnaeus), Hydrotaea (Ophyra) capensis (Wiedemann), Lucilia caesar (Linnaeus), Lucilia illustris (Meigen), Aldrichina graham (Aldrich), Hemipyrellia ligurriens, Achoetandrus (Chrysomya) rufifacies (Macquary), Protophormia terraenovae (Robineau-Desvoidy), Chrysomya megacephala (Fabricius), Lucilia sericata (Meigen), Helicophagella melanura (Meigen), and

Gibberellin 20-oxidase gene OsGA20ox3 regulates plant stature and disease development in rice.

Science.gov (United States)

Qin, Xue; Liu, Jun Hua; Zhao, Wen Sheng; Chen, Xu Jun; Guo, Ze Jian; Peng, You Liang

2013-02-01

Gibberellin (GA) 20-oxidase (GA20ox) catalyses consecutive steps of oxidation in the late part of the GA biosynthetic pathway. A T-DNA insertion mutant (17S-14) in rice, with an elongated phenotype, was isolated. Analysis of the flanking sequences of the T-DNA insertion site revealed that an incomplete T-DNA integration resulted in enhanced constitutively expression of downstream OsGA20ox3 in the mutant. The accumulation of bioactive GA(1) and GA(4) were increased in the mutant in comparison with the wild-type plant. Transgenic plants overexpressing OsGA20ox3 showed phenotypes similar to those of the 17S-14 mutant, and the RNA interference (RNAi) lines that had decreased OsGA20ox3 expression exhibited a semidwarf phenotype. Expression of OsGA20ox3 was detected in the leaves and roots of young seedlings, immature panicles, anthers, and pollens, based on β-glucuronidase (GUS) activity staining in transgenic plants expressing the OsGA20ox3 promoter fused to the GUS gene. The OsGA20ox3 RNAi lines showed enhanced resistance against rice pathogens Magnaporthe oryzae (causing rice blast) and Xanthomonas oryzae pv. oryzae (causing bacterial blight) and increased expression of defense-related genes. Conversely, OsGA20ox3-overexpressing plants were more susceptible to these pathogens comparing with the wild-type plants. The susceptibility of wild-type plants to X. oryzae pv. oryzae was increased by exogenous application of GA(3) and decreased by S-3307 treatment. Together, the results provide direct evidence for a critical role of OsGA20ox3 in regulating not only plant stature but also disease resistance in rice.

The gene expressions of DNA methylation/demethylation enzymes ...

African Journals Online (AJOL)

user

2011-01-31

Jan 31, 2011 ... A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases.

Amine oxidases as important agents of pathological processes of rhabdomyolysis in rats.

Science.gov (United States)

Gudkova, O O; Latyshko, N V; Shandrenko, S G

2016-01-01

In this study we have tested an idea on the important role of amine oxidases (semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase) as an additional source of oxidative/carbonyl stress under glycerol-induced rhabdomyolysis, since the enhanced formation of reactive oxygen species and reactive carbonyl species in a variety of tissues is linked to various diseases. In our experiments we used the sensitive fluorescent method devised for estimation of amine oxidases activity in the rat kidney and thymus as targeted organs under rhabdomyolysis. We have found in vivo the multiple rises in activity of semicarbazide-sensitive amine oxidase, diamine oxidase, polyamine oxidase (2-4.5 times) in the corresponding cell fractions, whole cells or their lysates at the 3-6th day after glycerol injection. Aberrant antioxidant activities depended on rhabdomyolysis stage and had organ specificity. Additional treatment of animals with metal chelator ‘Unithiol’ adjusted only the activity of antioxidant enzymes but not amine oxidases in both organs. Furthermore the in vitro experiment showed that Fenton reaction (hydrogen peroxide in the presence of iron) products alone had no effect on semicarbazide-sensitive amine oxidase activity in rat liver cell fraction whereas supplementation with methylglyoxal resulted in its significant 2.5-fold enhancement. Combined action of the both agents had additive effect on semicarbazide-sensitive amine oxidase activity. We can assume that biogenic amine and polyamine catabolism by amine oxidases is upregulated by oxidative and carbonyl stress factors directly under rhabdomyolysis progression, and the increase in catabolic products concentration contributes to tissue damage in glycerol-induced acute renal failure and apoptosis stimulation in thymus.

Defects in Nicotinamide-adenine Dinucleotide Phosphate Oxidase Genes NOX1 and DUOX2 in Very Early Onset Inflammatory Bowel DiseaseSummary

Directory of Open Access Journals (Sweden)

Patti Hayes

2015-09-01

Full Text Available Background & Aims: Defects in intestinal innate defense systems predispose patients to inflammatory bowel disease (IBD. Reactive oxygen species (ROS generated by nicotinamide-adenine dinucleotide phosphate (NADPH oxidases in the mucosal barrier maintain gut homeostasis and defend against pathogenic attack. We hypothesized that molecular genetic defects in intestinal NADPH oxidases might be present in children with IBD. Methods: After targeted exome sequencing of epithelial NADPH oxidases NOX1 and DUOX2 on 59 children with very early onset inflammatory bowel disease (VEOIBD, the identified mutations were validated using Sanger Sequencing. A structural analysis of NOX1 and DUOX2 variants was performed by homology in silico modeling. The functional characterization included ROS generation in model cell lines and in in vivo transduced murine crypts, protein expression, intracellular localization, and cell-based infection studies with the enteric pathogens Campylobacter jejuni and enteropathogenic Escherichia coli. Results: We identified missense mutations in NOX1 (c.988G>A, p.Pro330Ser; c.967G>A, p.Asp360Asn and DUOX2 (c.4474G>A, p.Arg1211Cys; c.3631C>T, p.Arg1492Cys in 5 of 209 VEOIBD patients. The NOX1 p.Asp360Asn variant was replicated in a male Ashkenazi Jewish ulcerative colitis cohort. Patients with both NOX1 and DUOX2 variants showed abnormal Paneth cell metaplasia. All NOX1 and DUOX2 variants showed reduced ROS production compared with wild-type enzymes. Despite appropriate cellular localization and comparable pathogen-stimulated translocation of altered oxidases, cells harboring NOX1 or DUOX2 variants had defective host resistance to infection with C. jejuni. Conclusions: This study identifies the first inactivating missense variants in NOX1 and DUOX2 associated with VEOIBD. Defective ROS production from intestinal epithelial cells constitutes a risk factor for developing VEOIBD. Keywords: Inflammatory Bowel Disease, NADPH Oxidase

Laboratory-evolved vanillyl-alcohol oxidase produces natural vanillin

NARCIS (Netherlands)

Heuvel, van den R.H.H.; Berg, van den W.A.M.; Rovida, S.; Berkel, van W.J.H.

2004-01-01

The flavoenzyme vanillyl-alcohol oxidase was subjected to random mutagenesis to generate mutants with enhanced reactivity to creosol (2-methoxy-4-methylphenol). The vanillyl-alcohol oxidase-mediated conversion of creosol proceeds via a two-step process in which the initially formed vanillyl alcohol

Transcriptional response of P. pastoris in fed-batch cultivations to Rhizopus oryzae lipase production reveals UPR induction

Directory of Open Access Journals (Sweden)

Valero Francisco

2007-07-01

Full Text Available Abstract Background The analysis of transcriptional levels of the genes involved in protein synthesis and secretion is a key factor to understand the host organism's responses to recombinant protein production, as well as their interaction with the cultivation conditions. Novel techniques such as the sandwich hybridization allow monitoring quantitatively the dynamic changes of specific RNAs. In this study, the transcriptional levels of some genes related to the unfolded protein response (UPR and central metabolism of Pichia pastoris were analysed during batch and fed-batch cultivations using an X-33-derived strain expressing a Rhizopus oryzae lipase under control of the formaldehyde dehydrogenase promoter (FLD1, namely the alcohol oxidase gene AOX1, the formaldehyde dehydrogenase FLD1, the protein disulfide isomerase PDI, the KAR2 gene coding for the BiP chaperone, the 26S rRNA and the R. oryzae lipase gene ROL. Results The transcriptional levels of the selected set of genes were first analysed in P. pastoris cells growing in shake flask cultures containing different carbon and nitrogen sources combinations, glycerol + ammonium, methanol + methylamine and sorbitol + methylamine. The transcriptional levels of the AOX1 and FLD1 genes were coherent with the known regulatory mechanism of C1 substrates in P. pastoris, whereas ROL induction lead to the up-regulation of KAR2 and PDI transcriptional levels, thus suggesting that ROL overexpression triggers the UPR. This was further confirmed in fed-batch cultivations performed at different growth rates. Transcriptional levels of the analysed set of genes were generally higher at higher growth rates. Nevertheless, when ROL was overexpressed in a strain having the UPR constitutively activated, significantly lower relative induction levels of these marker genes were detected. Conclusion The bead-based sandwich hybridization assay has shown its potential as a reliable instrument for quantification of

Characterization of the polyphenol oxidase gene family reveals a novel microRNA involved in posttranscriptional regulation of PPOs in Salvia miltiorrhiza.

Science.gov (United States)

Li, Caili; Li, Dongqiao; Li, Jiang; Shao, Fenjuan; Lu, Shanfa

2017-03-17

Salvia miltiorrhiza is a well-known material of traditional Chinese medicine. Understanding the regulatory mechanisms of phenolic acid biosynthesis and metabolism are important for S. miltiorrhiza quality improvement. We report here that S. miltiorrhiza contains 19 polyphenol oxidases (PPOs), forming the largest PPO gene family in plant species to our knowledge. Analysis of gene structures and sequence features revealed the conservation and divergence of SmPPOs. SmPPOs were differentially expressed in plant tissues and eight of them were predominantly expressed in phloem and xylem, indicating that some SmPPOs are functionally redundant, whereas the others are associated with different physiological processes. Expression patterns of eighteen SmPPOs were significantly altered under MeJA treatment, and twelve were yeast extract and Ag + -responsive, suggesting the majority of SmPPOs are stress-responsive. Analysis of high-throughput small RNA sequences and degradome data showed that miR1444-mediated regulation of PPOs existing in P. trichocarpa is absent from S. miltiorrhiza. Instead, a subset of SmPPOs was posttranscriptionally regulated by a novel miRNA, termed Smi-miR12112. It indicates the specificity and significance of miRNA-mediated regulation of PPOs. The results shed light on the regulation of SmPPO expression and suggest the complexity of SmPPO-associated phenolic acid biosynthesis and metabolism.

Expression and functional analysis of the lysine decarboxylase and copper amine oxidase genes from the endophytic fungus Colletotrichum gloeosporioides ES026.

Science.gov (United States)

Zhang, Xiangmei; Wang, Zhangqian; Jan, Saad; Yang, Qian; Wang, Mo

2017-06-05

Huperzine A (HupA) isolated from Huperzia serrata is an important compound used to treat Alzheimer's disease (AD). Recently, HupA was reported in various endophytic fungi, with Colletotrichum gloeosporioides ES026 previously isolated from H. serrata shown to produce HupA. In this study, we performed next-generation sequencing and de novo RNA sequencing of C. gloeosporioides ES026 to elucidate the molecular functions, biological processes, and biochemical pathways of these unique sequences. Gene ontology and Kyoto Encyclopedia of Genes and Genomes assignments allowed annotation of lysine decarboxylase (LDC) and copper amine oxidase (CAO) for their conversion of L-lysine to 5-aminopentanal during HupA biosynthesis. Additionally, we constructed a stable, high-yielding HupA-expression system resulting from the overexpression of CgLDC and CgCAO from the HupA-producing endophytic fungus C. gloeosporioides ES026 in Escherichia coli. Quantitative reverse transcription polymerase chain reaction analysis confirmed CgLDC and CgCAO expression, and quantitative determination of HupA levels was assessed by liquid chromatography high-resolution mass spectrometry, which revealed that elevated expression of CgLDC and CgCAO produced higher yields of HupA than those derived from C. gloeosporioides ES026. These results revealed CgLDC and CgCAO involvement in HupA biosynthesis and their key role in regulating HupA content in C. gloeosporioides ES026.

Dithiocarbamates are teratogenic to developing zebrafish through inhibition of lysyl oxidase activity

International Nuclear Information System (INIS)

Boxtel, Antonius L. van; Kamstra, Jorke H.; Fluitsma, Donna M.; Legler, Juliette

2010-01-01

Dithiocarbamates (DTCs) are a class of compounds that are extensively used in agriculture as pesticides. As such, humans and wildlife are undoubtedly exposed to these chemicals. Although DTCs are thought to be relatively safe due to their short half lives, it is well established that they are teratogenic to vertebrates, especially to fish. In zebrafish, these teratogenic effects are characterized by distorted notochord development and shortened anterior to posterior axis. DTCs are known copper (Cu) chelators but this does not fully explain the observed teratogenic effects. We show here that DTCs cause malformations in zebrafish that highly resemble teratogenic effects observed by direct inhibition of a group of cuproenzymes termed lysyl oxidases (LOX). Additionally, we demonstrate that partial knockdown of three LOX genes, lox, loxl1 and loxl5b, sensitizes the developing embryo to DTC exposure. Finally, we show that DTCs directly inhibit zebrafish LOX activity in an ex vivo amine oxidase assay. Taken together, these results provide the first evidence that DTC induced teratogenic effects are, at least in part, caused by direct inhibition of LOX activity.

Monoamine Oxidase A (MAOA Gene and Personality Traits from Late Adolescence through Early Adulthood: A Latent Variable Investigation

Directory of Open Access Journals (Sweden)

Man K. Xu

2017-10-01

Full Text Available Very few molecular genetic studies of personality traits have used longitudinal phenotypic data, therefore molecular basis for developmental change and stability of personality remains to be explored. We examined the role of the monoamine oxidase A gene (MAOA on extraversion and neuroticism from adolescence to adulthood, using modern latent variable methods. A sample of 1,160 male and 1,180 female participants with complete genotyping data was drawn from a British national birth cohort, the MRC National Survey of Health and Development (NSHD. The predictor variable was based on a latent variable representing genetic variations of the MAOA gene measured by three SNPs (rs3788862, rs5906957, and rs979606. Latent phenotype variables were constructed using psychometric methods to represent cross-sectional and longitudinal phenotypes of extraversion and neuroticism measured at ages 16 and 26. In males, the MAOA genetic latent variable (AAG was associated with lower extraversion score at age 16 (β = −0.167; CI: −0.289, −0.045; p = 0.007, FDRp = 0.042, as well as greater increase in extraversion score from 16 to 26 years (β = 0.197; CI: 0.067, 0.328; p = 0.003, FDRp = 0.036. No genetic association was found for neuroticism after adjustment for multiple testing. Although, we did not find statistically significant associations after multiple testing correction in females, this result needs to be interpreted with caution due to issues related to x-inactivation in females. The latent variable method is an effective way of modeling phenotype- and genetic-based variances and may therefore improve the methodology of molecular genetic studies of complex psychological traits.

Putting together a plasma membrane NADH oxidase: a tale of three laboratories.

Science.gov (United States)

Löw, Hans; Crane, Frederick L; Morré, D James

2012-11-01

The observation that high cellular concentrations of NADH were associated with low adenylate cyclase activity led to a search for the mechanism of the effect. Since cyclase is in the plasma membrane, we considered the membrane might have a site for NADH action, and that NADH might be oxidized at that site. A test for NADH oxidase showed very low activity, which could be increased by adding growth factors. The plasma membrane oxidase was not inhibited by inhibitors of mitochondrial NADH oxidase such as cyanide, rotenone or antimycin. Stimulation of the plasma membrane oxidase by iso-proterenol or triiodothyronine was different from lack of stimulation in endoplasmic reticulum. After 25 years of research, three components of a trans membrane NADH oxidase have been discovered. Flavoprotein NADH coenzyme Q reductases (NADH cytochrome b reductase) on the inside, coenzyme Q in the middle, and a coenzyme Q oxidase on the outside as a terminal oxidase. The external oxidase segment is a copper protein with unique properties in timekeeping, protein disulfide isomerase and endogenous NADH oxidase activity, which affords a mechanism for control of cell growth by the overall NADH oxidase and the remarkable inhibition of oxidase activity and growth of cancer cells by a wide range of anti-tumor drugs. A second trans plasma membrane electron transport system has been found in voltage dependent anion channel (VDAC), which has NADH ferricyanide reductase activity. This activity must be considered in relation to ferricyanide stimulation of growth and increased VDAC antibodies in patients with autism. Copyright © 2012 Elsevier Ltd. All rights reserved.

In Situ Enzymatically Generated Photoswitchable Oxidase Mimetics and Their Application for Colorimetric Detection of Glucose Oxidase.

Science.gov (United States)

Cao, Gen-Xia; Wu, Xiu-Ming; Dong, Yu-Ming; Li, Zai-Jun; Wang, Guang-Li

2016-07-09

In this study, a simple and amplified colorimetric assay is developed for the detection of the enzymatic activity of glucose oxidase (GOx) based on in situ formation of a photoswitchable oxidase mimetic of PO₄(3-)-capped CdS quantum dots (QDs). GOx catalyzes the oxidation of 1-thio-β-d-glucose to give 1-thio-β-d-gluconic acid which spontaneously hydrolyzes to β-d-gluconic acid and H₂S; the generated H₂S instantly reacts with Cd(2+) in the presence of Na₃PO₄ to give PO₄(3-)-stabilized CdS QDs in situ. Under visible-light (λ ≥ 400 nm) stimulation, the PO₄(3-)-capped CdS QDs are a new style of oxidase mimic derived by producing some active species, such as h⁺, (•)OH, O₂(•-) and a little H₂O₂, which can oxidize the typical substrate (3,3,5,5-tetramethylbenzydine (TMB)) with a color change. Based on the GOx-triggered growth of the oxidase mimetics of PO₄(3-)-capped CdS QDs in situ, we developed a simple and amplified colorimetric assay to probe the enzymatic activity of GOx. The proposed method allowed the detection of the enzymatic activity of GOx over the range from 25 μg/L to 50 mg/L with a low detection limit of 6.6 μg/L. We believe the PO₄(3-)-capped CdS QDs generated in situ with photo-stimulated enzyme-mimicking activity may find wide potential applications in biosensors.

Investigating the effect of carbon source on rabies virus glycoprotein production in Pichia pastoris by a transcriptomic approach.

Science.gov (United States)

Ben Azoun, Safa; Kallel, Héla

2017-08-01

Several factors affect protein expression in Pichia pastoris, one among them is the carbon source. In this work, we studied the effect of this factor on the expression level of rabies virus glycoprotein (RABV-G) in two recombinant clones harboring seven copies of the gene of interest. The expression was driven either by the constitutive glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter or the inducible alcohol oxidase1 (AOX1) promoter. Clones were compared in terms of cell physiology and carbon source metabolism. The transcription levels of 16 key genes involved in the central metabolic pathway, the methanol catabolism, and the oxidative stress were investigated in both clones. Cell size, as a parameter reflecting cell physiological changes, was also monitored. Our results showed that when glucose was used as the sole carbon source, large cells were obtained. Transcript levels of the genes of the central metabolic pathway were also upregulated, whereas antioxidative gene transcript levels were low. By contrast, the use of methanol as a carbon source generated small cells and a shift in carbon metabolism toward the dissimilatory pathway by the upregulation of formaldehyde dehydrogenase gene and the downregulation of those of the central metabolic. These observations are in favor of the use of glucose to enhance the expression of RABV-G in P. pastoris. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Monoamine Oxidase Inhibitors (MAOIs)

Science.gov (United States)

... health-medications/index.shtml. Accessed May 16, 2016. Hirsch M, et al. Monoamine oxidase inhibitors (MAOIs) for ... www.uptodate.com/home. Accessed May 16, 2016. Hirsch M, et al. Discontinuing antidepressant medications in adults. ...

Molecular cloning, expression, and functional analysis of the copper amine oxidase gene in the endophytic fungus Shiraia sp. Slf14 from Huperzia serrata.

Science.gov (United States)

Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du

2016-12-01

Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.

A conventional chemical reaction for use in an unconventional assay: A colorimetric immunoassay for aflatoxin B1 by using enzyme-responsive just-in-time generation of a MnO2 based nanocatalyst.

Science.gov (United States)

Lai, Wenqiang; Zeng, Qiao; Tang, Juan; Zhang, Maosheng; Tang, Dianping

2018-01-10

Schematic illustration of ascorbate oxidase (AOx)-mediated potassium permanganate (KMnO 4 )-responsive ascorbic acid (AA) for visual colorimetric immunoassay of aflatoxin B 1 (AFB 1 ) by coupling with hydrolytic reaction of AOx toward AA and the KMnO 4 -Mn(II)-TMB system [note: 3,3',5,5'-tetramethylbenzidine: TMB].

Genotypes and clinical phenotypes in children with cytochrome-c oxidase deficiency.

Science.gov (United States)

Darin, N; Moslemi, A-R; Lebon, S; Rustin, P; Holme, E; Oldfors, A; Tulinius, M

2003-12-01

Cytochrome c oxidase (COX) deficiency has been associated with a wide spectrum of clinical features and may be caused by mutations in different genes of both the mitochondrial and the nuclear DNA. In an attempt to correlate the clinical phenotype with the genotype in 16 childhood cases, mtDNA was analysed for deletion, depletion, and mutations in the three genes encoding COX subunits and the 22 tRNA genes. Furthermore, nuclear DNA was analysed for mutations in the SURF1, SCO2, COX10, and COX17 genes and cases with mtDNA depletion were analysed for mutations in the TK2 gene. SURF1-mutations were identified in three out of four cases with Leigh syndrome while a mutation in the mitochondrial tRNA (trp) gene was identified in the fourth. One case with mtDNA depletion had mutations in the TK2 gene. In two cases with leukoencephalopathy, one case with encephalopathy, five cases with fatal infantile myopathy and cardiomyopathy, two cases with benign infantile myopathy, and one case with mtDNA depletion, no mutations were identified. We conclude that COX deficiency in childhood should be suspected in a wide range of clinical settings and although an increasing number of genetic defects have been identified, the underlying mutations remain unclear in the majority of the cases.

Effects upon metabolic pathways and energy production by Sb(III and As(III/Sb(III-oxidase gene aioA in Agrobacterium tumefaciens GW4.

Directory of Open Access Journals (Sweden)

Jingxin Li

Full Text Available Agrobacterium tumefaciens GW4 is a heterotrophic arsenite [As(III]/antimonite [Sb(III]-oxidizing strain. The As(III oxidase AioAB is responsible for As(III oxidation in the periplasm and it is also involved in Sb(III oxidation in Agrobacterium tumefaciens 5A. In addition, Sb(III oxidase AnoA and cellular H2O2 are also responsible for Sb(III oxidation in strain GW4. However, the deletion of aioA increased the Sb(III oxidation efficiency in strain GW4. In the present study, we found that the cell mobility to Sb(III, ATP and NADH contents and heat release were also increased by Sb(III and more significantly in the aioA mutant. Proteomics and transcriptional analyses showed that proteins/genes involved in Sb(III oxidation and resistance, stress responses, carbon metabolism, cell mobility, phosphonate and phosphinate metabolism, and amino acid and nucleotide metabolism were induced by Sb(III and were more significantly induced in the aioA mutant. The results suggested that Sb(III oxidation may produce energy. In addition, without periplasmic AioAB, more Sb(III would enter bacterial cells, however, the cytoplasmic AnoA and the oxidative stress response proteins were significantly up-regulated, which may contribute to the increased Sb(III oxidation efficiency. Moreover, the carbon metabolism was also activated to generate more energy against Sb(III stress. The generated energy may be used in Sb transportation, DNA repair, amino acid synthesis, and cell mobility, and may be released in the form of heat.

Identification of host blood from engorged mosquitoes collected in western Uganda using cytochrome oxidase I gene sequences.

Science.gov (United States)

Crabtree, Mary B; Kading, Rebekah C; Mutebi, John-Paul; Lutwama, Julius J; Miller, Barry R

2013-07-01

Emerging infectious disease events are frequently caused by arthropod-borne viruses (arboviruses) that are maintained in a zoonotic cycle between arthropod vectors and vertebrate wildlife species, with spillover to humans in areas where human and wildlife populations interface. The greater Congo basin region, including Uganda, has historically been a hot spot for emergence of known and novel arboviruses. Surveillance of arthropod vectors is a critical activity in monitoring and predicting outbreaks of arboviral disease, and identification of blood meals in engorged arthropods collected during surveillance efforts provides insight into the ecology of arboviruses and their vectors. As part of an ongoing arbovirus surveillance project we analyzed blood meals from engorged mosquitoes collected at five sites in western Uganda November 2008-June 2010. We extracted DNA from the dissected and triturated abdomens of engorged mosquito specimens. Mitochondrial cytochrome c oxidase I gene sequence was amplified by PCR and sequenced to identify the source of the mosquito host blood. Blood meals were analyzed from 533 engorged mosquito specimens; 440 of these blood meals were successfully identified from 33 mosquito species. Species identifications were made for 285 of the 440 identified specimens with the remainder identified to genus, family, or order. When combined with published arbovirus isolation and serologic survey data, our results suggest possible vector-reservoir relationships for several arboviruses, including Rift Valley fever virus and West Nile virus.

Optimization of glucose oxidase production by Aspergillus niger

African Journals Online (AJOL)

user

2011-02-28

Feb 28, 2011 ... manganese, cobalt, thioglycolic acid, and gluconic acid according to (Liu et al., .... In this experiment duplicate media of glucose 10% were adjusted at different ... Glucose oxidase as a pharmaceutical anti oxidant Drug. Devt. ... Plush KS, Hellmuth K, Rinas U (1996). kinetics of glucose oxidase excretion by ...

Isolation of a cotton NADP(H oxidase homologue induced by drought stress

Directory of Open Access Journals (Sweden)

NEPOMUCENO ALEXANDRE LIMA

2000-01-01

Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

Biogas from MSW landfill: Composition and determination of chlorine content with the AOX (adsorbable organically bound halogens) technique

International Nuclear Information System (INIS)

Rey, M.D.; Font, R.; Aracil, I.

2013-01-01

An exhaustive characterization of the biogas from some waste disposal facilities has been carried out. The analysis includes the main components (methane, carbon dioxide, nitrogen and oxygen) as well as trace components such as hydrogen sulphide, ammonia and VOCs (volatile organic compounds) including siloxanes and halogenated compounds. VOCs were measured by GC/MS (Gas Chromatography/Mass Spectrometry) using two different procedures: thermal desorption of the Tenax TA and Carbotrap 349 tubes and SPME (Solid Phase Micro-Extraction). A method has been established to measure the total halogen content of the biogas with the AOX (adsorbable organically bound halogens) technique. The equipment used to analyze the samples was a Total Organic Halogen Analyzer (TOX-100). Similar results were obtained when comparing the TOX (Total Organic Halogen) values with those obtained by GC/MS. The halogen content in all the samples was under 22 mg Cl/Nm 3 which is below the limit of 150 mg/Nm 3 proposed in the Spanish Regulations for any use of the biogas. The low chlorine content in the biogas studied, as well as the low content of other trace compounds, makes it suitable for use as a fuel for electricity generating engines

Cytochrome cbb3 of Thioalkalivibrio is a Na+-pumping cytochrome oxidase

NARCIS (Netherlands)

Muntyan, M.S.; Cherepanov, D.A.; Malinen, A.M.; Bloch, D.A.; Sorokin, D.Y.; Severina, I.I.; Ivashina, T.V.; Lahti, R.; Muyzer, G.; Skulachev, V.P.

2015-01-01

Cytochrome c oxidases (Coxs) are the basic energy transducers in the respiratory chain of the majority of aerobic organisms. Coxs studied to date are redox-driven proton-pumping enzymes belonging to one of three subfamilies: A-, B-, and C-type oxidases. The C-type oxidases (cbb3 cytochromes), which

Neuron-specific specificity protein 4 bigenomically regulates the transcription of all mitochondria- and nucleus-encoded cytochrome c oxidase subunit genes in neurons.

Science.gov (United States)

Johar, Kaid; Priya, Anusha; Dhar, Shilpa; Liu, Qiuli; Wong-Riley, Margaret T T

2013-11-01

Neurons are highly dependent on oxidative metabolism for their energy supply, and cytochrome c oxidase (COX) is a key energy-generating enzyme in the mitochondria. A unique feature of COX is that it is one of only four proteins in mammalian cells that are bigenomically regulated. Of its thirteen subunits, three are encoded in the mitochondrial genome and ten are nuclear-encoded on nine different chromosomes. The mechanism of regulating this multisubunit, bigenomic enzyme poses a distinct challenge. In recent years, we found that nuclear respiratory factors 1 and 2 (NRF-1 and NRF-2) mediate such bigenomic coordination. The latest candidate is the specificity factor (Sp) family of proteins. In N2a cells, we found that Sp1 regulates all 13 COX subunits. However, we discovered recently that in primary neurons, it is Sp4 and not Sp1 that regulates some of the key glutamatergic receptor subunit genes. The question naturally arises as to the role of Sp4 in regulating COX in primary neurons. The present study utilized multiple approaches, including chromatin immunoprecipitation, promoter mutational analysis, knockdown and over-expression of Sp4, as well as functional assays to document that Sp4 indeed functionally regulate all 13 subunits of COX as well as mitochondrial transcription factors A and B. The present study discovered that among the specificity family of transcription factors, it is the less known neuron-specific Sp4 that regulates the expression of all 13 subunits of mitochondrial cytochrome c oxidase (COX) enzyme in primary neurons. Sp4 also regulates the three mitochondrial transcription factors (TFAM, TFB1M, and TFB2M) and a COX assembly protein SURF-1 in primary neurons. © 2013 International Society for Neurochemistry.

Association of a variant in the regulatory region of NADPH oxidase 4 gene and metabolic syndrome in patients with chronic hepatitis C.

Science.gov (United States)

Siqueira, Erika Rabelo Forte de; Pereira, Luciano Beltrao; Stefano, Jose Tadeu; Patente, Thiago; Cavaleiro, Ana Mercedes; Silva Vasconcelos, Luydson Richardson; Carmo, Rodrigo Feliciano; Moreira Beltrao Pereira, Leila Maria; Carrilho, Flair Jose; Corrêa-Giannella, Maria Lucia; Oliveira, Claudia P

2015-03-28

Given the important contribution of the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system to the generation of reactive oxygen species induced by hepatitis C virus (HCV), we investigated two single nucleotide polymorphisms (SNPs) in the putative regulatory region of the genes encoding NADPH oxidase 4 catalytic subunit (NOX4) and its regulatory subunit p22phox (CYBA) and their relation with metabolic and histological variables in patients with HCV. One hundred seventy eight naïve HCV patients (49.3% male; 65% HCV genotype 1) with positive HCV RNA were genotyped using specific primers and fluorescent-labeled probes for SNPs rs3017887 in NOX4 and -675 T → A in CYBA. No association was found between the genotype frequencies of NOX4 and CYBA SNPs and inflammation scores or fibrosis stages in the overall population. The presence of the CA + AA genotypes of the NOX4 SNP was nominally associated with a lower alanine aminotransferase (ALT) concentration in the male population (CA + AA = 72.23 ± 6.34 U/L versus CC = 100.22 ± 9.85; mean ± SEM; P = 0.05). The TT genotype of the CYBA SNP was also nominally associated with a lower ALT concentration in the male population (TT = 84.01 ± 6.77 U/L versus TA + AA = 109.67 ± 18.37 U/L; mean ± SEM; P = 0.047). The minor A-allele of the NOX4 SNP was inversely associated with the frequency of metabolic syndrome (MS) in the male population (odds ratio (OR): 0.15; 95% confidence interval (CI): 0.03 to 0.79; P = 0.025). The results suggest that the evaluated NOX4 and CYBA SNPs are not direct genetic determinants of fibrosis in HCV patients, but nevertheless NOX4 rs3017887 SNP could indirectly influence fibrosis susceptibility due to its inverse association with MS in male patients.

Probing cytokinin homeostasis in Arabidopsis thaliana by constitutively overexpressing two forms of the maize cytokinin oxidase/dehydrogenase 1 gene

Czech Academy of Sciences Publication Activity Database

Kopečný, D.; Tarkowski, Petr; Majira, M.; Bouchez-Mahiout, I.; Nogué, F.; Laurière, M.; Sandberg, G.; Laloue, M.; Houba-Hérin, N.

2006-01-01

Roč. 171, č. 1 (2006), s. 114-122 ISSN 0168-9452 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arabidopsis thaliana * Cytokinin oxidase/dehydrogenase * Homeostasis Subject RIV: CE - Biochemistry Impact factor: 1.631, year: 2006

Serum diamine oxidase activity in patients with histamine intolerance.

Science.gov (United States)

Manzotti, G; Breda, D; Di Gioacchino, M; Burastero, S E

2016-03-01

Intolerance to various foods, excluding bona fide coeliac disease and lactose intolerance, represents a growing cause of patient visits to allergy clinics.Histamine intolerance is a long-known, multifaceted clinical condition triggered by histamine-rich foods and alcohol and/or by drugs that liberate histamine or block diamine oxidase (DAO), the main enzyme involved in the metabolism of ingested histamine. Histamine limitation diets impose complex, non-standardized restrictions that may severely impact the quality of life of patients. We retrospectively evaluated 14 patients who visited allergy outpatient facilities in northern Italy with a negative diagnosis for IgE-mediated food hypersensitivity, coeliac disease, conditions related to gastric hypersecretion, and systemic nickel hypersensitivity, and who previously underwent a histamine limitation diet with benefits for their main symptoms. Serum diamine oxidase levels and the clinical response to diamine oxidase supplementation were investigated. We found that 10 out of 14 patients had serum DAO activityintolerance. Moreover, 13 out of 14 patients subjectively reported a benefit in at least one of the disturbances related to food intolerances following diamine oxidase supplementation. The mean value (±SD) of diamine oxidase activity in the cohort of patients with histamine intolerance symptoms was 7.04±6.90 U/mL compared to 39.50±18.16 U/mL in 34 healthy controls (P=0.0031). In patients with symptoms triggered by histamine-rich food, measuring the serum diamine oxidase activity can help identify subjects who can benefit from a histamine limitation diet and/or diamine oxidase supplementation.Properly designed, controlled studies investigating histamine intolerance that include histamine provocation are indispensable for providing insights into the area of food intolerances, which are currently primarily managed with non-scientific approaches in Italy. © The Author(s) 2015.

Structure and activity of Aspergillus nidulans copper amine oxidase

DEFF Research Database (Denmark)

McGrath, Aaron P; Mithieux, Suzanne M; Collyer, Charles A

2011-01-01

Aspergillus nidulans amine oxidase (ANAO) has the unusual ability among the family of copper and trihydroxyphenylalanine quinone-containing amine oxidases of being able to oxidize the amine side chains of lysine residues in large peptides and proteins. We show here that in common with the related...... enzyme from the yeast Pichia pastoris, ANAO can promote the cross-linking of tropoelastin and oxidize the lysine residues in α-casein proteins and tropoelastin. The crystal structure of ANAO, the first for a fungal enzyme in this family, has been determined to a resolution of 2.4 Å. The enzyme is a dimer...... with the archetypal fold of a copper-containing amine oxidase. The active site is the most open of any of those of the structurally characterized enzymes in the family and provides a ready explanation for its lysine oxidase-like activity....

High-level expression of the native barley alpha-amylase/subtilisin inhibitor in Pichia pastoris

DEFF Research Database (Denmark)

Micheelsen, Pernille Ollendorff; Ostergaard, Peter Rahbek; Lange, Lene

2008-01-01

An expression system for high-level expression of the native Hordeum vulgare alpha-amylase/subtilisin inhibitor (BASI) has been developed in Pichia pastoris, using the methanol inducible alcohol oxidase 1 (AOX1) promoter. To optimize expression, two codon-optimized coding regions have been designed...... and expressed alongside the wild-type coding region. To ensure secretion of the native mature protein, a truncated version of the alpha mating factor secretion signal from Saccharomyces cerevisiae was used. In order to be able to compare expression levels from different clones, single insertion transformants...

Monoamine Oxidase-A Genetic Variants and Childhood Abuse Predict Impulsiveness in Borderline Personality Disorder.

Science.gov (United States)

Kolla, Nathan J; Meyer, Jeffrey; Sanches, Marcos; Charbonneau, James

2017-11-30

Impulsivity is a core feature of borderline personality disorder (BPD) and antisocial personality disorder (ASPD) that likely arises from combined genetic and environmental influences. The interaction of the low activity variant of the monoamine oxidase-A (MAOA-L) gene and early childhood adversity has been shown to predict aggression in clinical and non-clinical populations. Although impulsivity is a risk factor for aggression in BPD and ASPD, little research has investigated potential gene-environment (G×E) influences impacting its expression in these conditions. Moreover, G×E interactions may differ by diagnosis. Full factorial analysis of variance was employed to investigate the influence of monoamine oxidase-A (MAO-A) genotype, childhood abuse, and diagnosis on Barratt Impulsiveness Scale-11 (BIS-11) scores in 61 individuals: 20 subjects with BPD, 18 subjects with ASPD, and 23 healthy controls. A group×genotype×abuse interaction was present (F(2,49)=4.4, p =0.018), such that the interaction of MAOA-L and childhood abuse predicted greater BIS-11 motor impulsiveness in BPD. Additionally, BPD subjects reported higher BIS-11 attentional impulsiveness versus ASPD participants (t(1,36)=2.3, p =0.025). These preliminary results suggest that MAOA-L may modulate the impact of childhood abuse on impulsivity in BPD. Results additionally indicate that impulsiveness may be expressed differently in BPD and ASPD.

Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.

OpenAIRE

Legge, M; Duff, G B

1981-01-01

Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less ga...

Metavanadate causes cellular accumulation of copper and decreased lysyl oxidase activity

International Nuclear Information System (INIS)

Cui, Changtai T.; Uriu-Adams, Janet Y.; Tchaparian, Eskouhie H.; Keen, Carl L.; Rucker, Robert B.

2004-01-01

Selected indices of copper metabolism in weanling rats and fibroblast cultures were progressively altered in response to increased levels of sodium metavanadate. In diets, vanadium was added in amounts ranging from 0 to 80 μg V/g of diet, that is, 0-1.6 μmol V/g of diet. In fibroblast cultures, vanadium ranged from 0 to 400 nmol V/ml. The inhibition of P-ATPase-7A activity by metavanadate, important to copper egress from cells, was a primary focus. In skin, and tendon, the copper concentration was increased in response to increased dietary levels of metavanadate, whereas lysyl oxidase activity, a secreted cuproprotein, was reduced. The reduction in lysyl oxidase activity was also accompanied by reduced redox cycling potential of isolated fractions of lysyl oxidase, presumably due to reduced lysyltyrosyl quinone (LTQ) formation at the active site of lysyl oxidase. In contrast, liver copper concentrations and plasma ceruloplasmin activity were not affected by metavanadate exposure. However, semicarbazide-sensitive benzylamine oxidase (SCBO) activity, which was taken as an indirect measure of vascular adhesive protein-1 (VAP-1), was increased. In cultured fibroblasts, cellular copper was also increased and lysyl oxidase decreased in response to metavanadate. Moreover, the steady-state levels of atp7a and lysyl oxidase mRNAs were not affected by addition of metavanadate to culture medium up to 200 nmol/ml. Taken together, these data suggest that pathways involving copper egress and lysyl oxidase activation are particularly sensitive to metavanadate exposure through processes that are predominately posttranslational

Oxidases as Breast Cancer Oncogens

National Research Council Canada - National Science Library

Yeldandi, Anjana

2000-01-01

...) in a non-tumorigenic human mammary epithelial cell line to ascertain whether oxidase overexpressing cells undergo transformation when exposed to substrate xanthine for XOX and uric acid for UOX...

Functional Analysis of the Trichoderma harzianum nox1 Gene, Encoding an NADPH Oxidase, Relates Production of Reactive Oxygen Species to Specific Biocontrol Activity against Pythium ultimum▿†

Science.gov (United States)

Montero-Barrientos, M.; Hermosa, R.; Cardoza, R. E.; Gutiérrez, S.; Monte, E.

2011-01-01

The synthesis of reactive oxygen species (ROS) is one of the first events following pathogenic interactions in eukaryotic cells, and NADPH oxidases are involved in the formation of such ROS. The nox1 gene of Trichoderma harzianum was cloned, and its role in antagonism against phytopathogens was analyzed in nox1-overexpressed transformants. The increased levels of nox1 expression in these transformants were accompanied by an increase in ROS production during their direct confrontation with Pythium ultimum. The transformants displayed an increased hydrolytic pattern, as determined by comparing protease, cellulase, and chitinase activities with those for the wild type. In confrontation assays against P. ultimum the nox1-overexpressed transformants were more effective than the wild type, but not in assays against Botrytis cinerea or Rhizoctonia solani. A transcriptomic analysis using a Trichoderma high-density oligonucleotide (HDO) microarray also showed that, compared to gene expression for the interaction of wild-type T. harzianum and P. ultimum, genes related to protease, cellulase, and chitinase activities were differentially upregulated in the interaction of a nox1-overexpressed transformant with this pathogen. Our results show that nox1 is involved in T. harzianum ROS production and antagonism against P. ultimum. PMID:21421791

Plasma diamine oxidase levels in pregnancy complicated by threatened abortion.

Science.gov (United States)

Legge, M; Duff, G B

1981-02-01

Plasma diamine oxidase levels were assayed in 66 patients who presented with pregnancy complicated by threatened abortion. Levels within the normal range were associated with continuing pregnancies, whereas levels below the normal range were associated with subsequent abortion. Among those patients in whom gestation was greater than eight weeks, 66.6% of diamine oxidase levels correctly predicted the pregnancy outcome. Assay of the diamine oxidase levels at eight weeks of gestation or less gave little useful information.

Kaempferol modulates pro-inflammatory NF-κB activation by suppressing advanced glycation endproducts-induced NADPH oxidase

Science.gov (United States)

Kim, Ji Min; Lee, Eun Kyeong; Kim, Dae Hyun; Yu, Byung Pal

2010-01-01

Advanced glycation endproducts (AGE) are oxidative products formed from the reaction between carbohydrates and a free amino group of proteins that are provoked by reactive species (RS). It is also known that AGE enhance the generation of RS and that the binding of AGE to a specific AGE receptor (RAGE) induces the activation of the redox-sensitive, pro-inflammatory transcription factor, nuclear factor-kappa B (NF-ĸB). In this current study, we investigated the anti-oxidative effects of short-term kaempferol supplementation on the age-related formation of AGE and the binding activity of RAGE in aged rat kidney. We further investigated the suppressive action of kaempferol against AGE's ability to stimulate activation of pro-inflammatory NF-ĸB and its molecular mechanisms. For this study, we utilized young (6 months old), old (24 months old), and kaempferol-fed (2 and 4 mg/kg/day for 10 days) old rats. In addition, for the molecular work, the rat endothelial cell line, YPEN-1 was used. The results show that AGE and RAGE were increased during aging and that these increases were blunted by kaempferol. In addition, dietary kaempferol reduced age-related increases in NF-κB activity and NF-ĸB-dependant pro-inflammatory gene activity. The most significant new finding from this study is that kaempferol supplementation prevented age-related NF-κB activation by suppressing AGE-induced nicotinamide adenine dinucleotide phosphate oxidase (NADPH oxidase). Taken together, our results demonstrated that dietary kaempferol exerts its anti-oxidative and anti-inflammatory actions by modulating the age-related NF-κB signaling cascade and its pro-inflammatory genes by suppressing AGE-induced NADPH oxidase activation. Based on these data, dietary kaempferol is proposed as a possible anti-AGE agent that may have the potential for use in anti-inflammation therapies. PMID:20431987

Possible bioremediation of arsenic toxicity by isolating indigenous bacteria from the middle Gangetic plain of Bihar, India

Directory of Open Access Journals (Sweden)

Ghanshyam Kumar Satyapal

2018-03-01

Full Text Available In middle Gangetic plain, high arsenic concentration is present in water, which causes a significant health risk. Total 48 morphologically distinct arsenite resistant bacteria were isolated from middle Gangetic plain. The minimum inhibitory concentration (MIC values of arsenite varied widely in the range 1–15 mM of the isolates. On the basis of their MIC, two isolates, AK1 (KY569423 and AK9 (KY569424 were selected. The analysis of the 16S rRNA gene sequence of selected isolates revealed that they are belong to the genus Pseudomonas. The AgNO3 test based microplate method revealed that isolates, AK1 and AK9, have potential in transformation of arsenic species. Further, the presence of aoxR, aoxB and aoxC genes in the both isolated strain AK1 and AK9 was confirmed, which play an important role in arsenic bioremediation by arsenite oxidation. Isolated strains also showed heavy metal resistance against Cr(IV, Ni(II, Co(II, Pb(II, Cu(II, Hg(II, Ag(I and Cd(II.

Monoamine oxidase A gene polymorphisms and enzyme activity associated with risk of gout in Taiwan aborigines.

Science.gov (United States)

Tu, Hung-Pin; Ko, Albert Min-Shan; Wang, Shu-Jung; Lee, Chien-Hung; Lea, Rod A; Chiang, Shang-Lun; Chiang, Hung-Che; Wang, Tsu-Nai; Huang, Meng-Chuan; Ou, Tsan-Teng; Lin, Gau-Tyan; Ko, Ying-Chin

2010-02-01

Taiwanese aborigines have a high prevalence of hyperuricemia and gout. Uric acid levels and urate excretion have correlated with dopamine-induced glomerular filtration response. MAOs represent one of the major renal dopamine metabolic pathways. We aimed to identify the monoamine oxidase A (MAOA, Xp11.3) gene variants and MAO-A enzyme activity associated with gout risk. This study was to investigate the association between gout and the MAOA single-nucleotide polymorphisms (SNPs) rs5953210, rs2283725, and rs1137070 as well as between gout and the COMT SNPs rs4680 Val158Met for 374 gout cases and 604 controls. MAO-A activity was also measured. All three MAOA SNPs were significantly associated with gout. A synonymous MAOA SNP, rs1137070 Asp470Asp, located in exon 14, was associated with the risk of having gout (P = 4.0 x 10(-5), adjusted odds ratio 1.46, 95% confidence intervals [CI]: 1.11-1.91). We also showed that, when compared to individuals with the MAOA GAT haplotype, carriers of the AGC haplotype had a 1.67-fold (95% CI: 1.28-2.17) higher risk of gout. Moreover, we found that MAOA enzyme activity correlated positively with hyperuricemia and gout (P for trend = 2.00 x 10(-3) vs. normal control). We also found that MAOA enzyme activity by rs1137070 allele was associated with hyperuricemia and gout (P for trend = 1.53 x 10(-6) vs. wild-type allele). Thus, our results show that some MAOA alleles, which have a higher enzyme activity, predispose to the development of gout.

Assessment of biological effects of environmental pollution along the NW Mediterranean Sea using red mullets as sentinel organisms

Energy Technology Data Exchange (ETDEWEB)

Zorita, Izaskun; Ortiz-Zarragoitia, Maren; Apraiz, Itxaso; Cancio, Ibon; Orbea, Amaia; Soto, Manu; Marigomez, Ionan [Biologia Zelularra eta Histologia Laborategia, Zoologia eta Biologia Zelularra Saila, Zientzia eta Teknologia Fakultatea, Euskal Herriko Unibertsitatea/Universidad del Pais Vasco, 644 P.K., E-48080 Bilbao, Basque Country (Spain); Cajaraville, Miren P. [Biologia Zelularra eta Histologia Laborategia, Zoologia eta Biologia Zelularra Saila, Zientzia eta Teknologia Fakultatea, Euskal Herriko Unibertsitatea/Universidad del Pais Vasco, 644 P.K., E-48080 Bilbao, Basque Country (Spain)], E-mail: mirenp.cajaraville@ehu.es

2008-05-15

A biomonitoring program was carried out in spring and autumn in three pollution hot-spots and sensitive areas of the NW Mediterranean Sea using red mullets (Mullus barbatus) as sentinel organisms and a battery of biomarkers together with gonad histology. In fish from anthropogenic impacted areas (Fos-sur-mer, Cortiou, Arenzano, Delta of Ebro) lysosomal membrane destabilization occurred indicating disturbed health. There were no significant differences in metallothionein (MT) levels among stations. Peroxisomal acyl-CoA oxidase (AOX) activity was highest in fish from Cortiou. Both MT levels and AOX activities were significantly correlated with gamete development. Prevalence of melanomacrophage centers were high in Cortiou in all samplings and in Fos-sur-mer in September samplings. In conclusion, the application of a battery of biomarkers in red mullets provided relevant data for the assessment of environmental pollution in the NW Mediterranean Sea but also showed the difficulties of using native fish as sentinels. For future studies caging strategies are recommended. - Application of biomarkers in red mullets is promising to assess environmental pollution in the NW Mediterranean Sea.

Assessment of biological effects of environmental pollution along the NW Mediterranean Sea using red mullets as sentinel organisms

International Nuclear Information System (INIS)

Zorita, Izaskun; Ortiz-Zarragoitia, Maren; Apraiz, Itxaso; Cancio, Ibon; Orbea, Amaia; Soto, Manu; Marigomez, Ionan; Cajaraville, Miren P.

2008-01-01

A biomonitoring program was carried out in spring and autumn in three pollution hot-spots and sensitive areas of the NW Mediterranean Sea using red mullets (Mullus barbatus) as sentinel organisms and a battery of biomarkers together with gonad histology. In fish from anthropogenic impacted areas (Fos-sur-mer, Cortiou, Arenzano, Delta of Ebro) lysosomal membrane destabilization occurred indicating disturbed health. There were no significant differences in metallothionein (MT) levels among stations. Peroxisomal acyl-CoA oxidase (AOX) activity was highest in fish from Cortiou. Both MT levels and AOX activities were significantly correlated with gamete development. Prevalence of melanomacrophage centers were high in Cortiou in all samplings and in Fos-sur-mer in September samplings. In conclusion, the application of a battery of biomarkers in red mullets provided relevant data for the assessment of environmental pollution in the NW Mediterranean Sea but also showed the difficulties of using native fish as sentinels. For future studies caging strategies are recommended. - Application of biomarkers in red mullets is promising to assess environmental pollution in the NW Mediterranean Sea

Pyridox(am)ine-5-Phosphate Oxidase Deficiency Treatable Cause of Neonatal Epileptic Encephalopathy With Burst Suppression: Case Report and Review of the Literature.

Science.gov (United States)

Guerin, Andrea; Aziz, Aly S; Mutch, Carly; Lewis, Jillian; Go, Cristina Y; Mercimek-Mahmutoglu, Saadet

2015-08-01

Pyridox(am)ine-5-phosphate oxidase deficiency is an autosomal recessive disorder of pyridoxine metabolism. Intractable neonatal epileptic encephalopathy is the classical presentation. Pyridoxal-5-phosphate or pyridoxine supplementation improves symptoms. We report a patient with myoclonic and tonic seizures at the age of 1 hour. Pyridoxal-5-phosphate was started on the first day of life and seizures stopped at the age of 3 days, but encephalopathy persisted for 4 weeks. She had normal neurodevelopmental outcome at the age of 12 months on pyridoxal-5-phosphate monotherapy. She had novel homozygous pathogenic frameshift mutation (c.448_451del;p.Pro150Argfs*27) in the PNPO gene. Long-lasting encephalopathy despite well-controlled clinical seizures does neither confirm nor exclude pyridox(am)ine-5-phosphate oxidase deficiency. Normal neurodevelopmental outcome of our patient emphasizes the importance of pyridoxal-5-phosphate treatment. Pyridox(am)ine-5-phosphate oxidase deficiency should be included in the differential diagnosis of Ohtahara syndrome and neonatal myoclonic encephalopathy as a treatable underlying cause. In addition, we reviewed the literature for pyridox(am)ine-5-phosphate oxidase deficiency and summarized herein all confirmed cases. © The Author(s) 2014.

21 CFR 866.2420 - Oxidase screening test for gonorrhea.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Oxidase screening test for gonorrhea. 866.2420... screening test for gonorrhea. (a) Identification. An oxidase screening test for gonorrhea is an in vitro... of gonorrhea. (b) Classification. Class III (premarket approval) (transitional device). (c) Date PMA...

Association between monoamine oxidase A gene promoter 30 bp repeat polymorphism and tardive dyskinesia in Chinese schizophrenics

Institute of Scientific and Technical Information of China (English)

Changhe Fan; Lihua Li; Yan Fu; Hehuang Deng; Xiangjiao Liao; Youcai Zhou

2006-01-01

BACKGROUND: The pathophysiology of tardive dyskinesia (TD) is not yet fully understood. With the hypothesis of altered dopaminergic neurotransmission, altered activities of dopamine degrading enzymes such as monoamine oxidase A (MAOA) and their coding genes are supposed to be related to the pathophysiology of TD.OBJECTIVE: To investigate possible association between 30 bp variable number tandem repeat (VNTR) polymorphism in the promoter of MAOA gene and susceptibility, severity of neuroleptic induced TD in Chinese Han people in Guandong Province.DESIGN: Non-randomization-synchronization controlled study. SETTING: Guangdong Mental Health Institute, Guangdong Provincial People's Hospital; Guangzhou Psychiatric Hospital; Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration. PARTICIPANTS: A total of 179 subjects were enrolled in the study. All subjects were sporadic and genetically unrelated Chinese schizophrenic patients who were hospitalizing in Guangzhou Psychiatric Hospital or Affiliated Psychiatric Hospital of Guangzhou Municipal Bureau of Civil Administration during January to April 2005. The diagnosis of schizophrenia was made according to the criteria of Diagnostic and Statistic Manual of Mental Disorder-the third edition-revised (DSM-Ⅲ-R). Among all patients, 88 were diagnosed as with TD and 91 without TD according to the research diagnostic criteria described by Schooler-Kane. Informed consent was obtained from all subjects or their relatives.METHODS: ① TD severity was assessed with the AIMS which was a 5-degree rating scale from 0 to 4 (corresponding to none, minimal, mild, moderate and severe, respectively). The study was approved by the Ethics Committees of the two hospitals and informed consent was obtained from all subjects or their relatives. ② The polymerase chain reaction (PCR) and polyacrylamide gel electrophoresis (PAGE) techniques were used to detect MAOA gene 30 bp VNTR polymorphism in schizophrenic patients

Catalytic aspects of a copper(II) complex: biological oxidase to ...

Indian Academy of Sciences (India)

BISWAJIT CHOWDHURY

2017-10-03

Oct 3, 2017 ... made with a Jasco model V-730 UV-Vis spectrophotometer. ..... Ligand-induced coordination changes ... Fet3 protein from yeast, a multinuclear copper oxidase ... of mutants of the multicopper oxidase Fet3p Biochem-.

Platelet monoamine oxidase: specific activity and turnover number in headache

International Nuclear Information System (INIS)

Summers, K.M.; Brown, G.K.; Craig, I.W.; Peatfield, R.; Rose, F.C.

1982-01-01

Monoamine oxidase turnover numbers (molecules of substrate converted to product per minute per active site) have been calculated for the human platelet enzyme using [ 3 H]pargyline. Headache patients with high and low monoamine oxidase specific activities relative to controls were found to have turnover numbers very close to those for controls. This finding suggests that their specific activities vary because of differences in the concentration of active monoamine oxidase molecules, rather than differences in the ability of those enzyme molecules to catalyse the deamination reaction. (Auth.)

The Arabidopsis aldehyde oxidase 3 (AA03) gene product catalyzes the final step in abscisic acid biosynthesis in leaves

NARCIS (Netherlands)

Seo, M.; Peeters, A.J.M.; Koiwai, H.; Oritani, T.; Marion-Poll, A.; Zeevaart, J.A.D.; Koornneef, M.; Kamiya, Y.; Koshiba, T.

2000-01-01

Abscisic acid (ABA) is a plant hormone involved in seed development and germination and in responses to various environmental stresses. The last step of ABA biosynthesis involves oxidation of abscisic aldehyde, and aldehyde oxidase (EC 1.2.3.1) is thought to catalyze this reaction. An aldehyde

Increase in activity, glycosylation and expression of cytokinin oxidase/dehydrogenase during the senescence of barley leaf segments in the dark

Czech Academy of Sciences Publication Activity Database

Conrad, K.; Motyka, Václav; Schlüter, T.

2007-01-01

Roč. 130, č. 4 (2007), s. 572-579 ISSN 0031-9317 R&D Projects: GA ČR GA206/03/0313 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : OXIDASE ACTIVITY * GENE-EXPRESSION * ZEA - MAYS Subject RIV: EF - Botanics Impact factor: 2.192, year: 2007

Immobilization of xanthine oxidase on a polyaniline silicone support.

Science.gov (United States)

Nadruz, W; Marques, E T; Azevedo, W M; Lima-Filho, J L; Carvalho, L B

1996-03-01

A polyaniline silicone support to immobilize xanthine oxidase is proposed as a reactor coil to monitor the action of xanthine oxidase on hypoxanthine, xanthine and 6-mercaptopurine. A purified xanthine oxidase immobilized on this support lost 80% of the initial activity after 12 min of use. Co-immobilization of superoxide dismutase and catalase increased the stability of immobilized xanthine oxidase so that the derivative maintained 79% of its initial activity after 4.6 h of continuous use in which 1.5 mumol purine bases were converted by the immobilized enzyme system. There is no evidence of either polyaniline or protein leaching from the coil during 3 h of continuous use. When solutions (10 ml) of hypoxanthine, xanthine and 6-mercaptopurine were circulated individually through the xanthine oxidase-superoxide dismutase-catalase-polyaniline coil (1 mm internal diameter and 3 m in length, 3 ml internal volume) activities of 8.12, 11.17 and 1.09 nmol min-1 coil-1, respectively, were obtained. The advantages of the reactor configuration and the redox properties of the polymer, particularly with respect to immobilized oxidoreductases, make this methodology attractive for similar enzyme systems. This immobilized enzyme system using polyaniline-silicone as support converted 6-mercaptopurine to 6-thiouric acid with equal efficiency as resins based on polyacrylamide and polyamide 11.

Ectopic expression of GA 2-oxidase 6 from rapeseed (Brassica napus L.) causes dwarfism, late flowering and enhanced chlorophyll accumulation in Arabidopsis thaliana.

Science.gov (United States)

Yan, Jindong; Liao, Xiaoying; He, Reqing; Zhong, Ming; Feng, Panpan; Li, Xinmei; Tang, Dongying; Liu, Xuanming; Zhao, Xiaoying

2017-02-01

Gibberellins (GAs) are endogenous hormones that play an important role in higher plant growth and development. GA2-oxidase (GA2ox) promotes catabolism and inactivation of bioactive GAs or their precursors. In this study, we identified the GA2-oxidase gene, BnGA2ox6, and found it to be highly expressed in the silique and flower. Overexpression of BnGA2ox6 in Arabidopsis resulted in GA-deficiency symptoms, including inhibited elongation of the hypocotyl and stem, delayed seed germination, and late flowering. BnGA2ox6 overexpression reduced silique growth, but had no effect on seed development. Additionally, BnGA2ox6 overexpression enhanced chlorophyll b and total chlorophyll accumulation, and downregulated mRNA expression levels of the CHL1 and RCCR genes, which are involved in the chlorophyll degradation. These findings suggest that BnGA2ox6 regulates plant hight, silique development, flowering and chlorophyll accumulation in transgenic Arabidopsis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Xanthine oxidase in human skeletal muscle following eccentric exercise

DEFF Research Database (Denmark)

Hellsten, Ylva; Frandsen, Ulrik; Orthenblad, N.

1997-01-01

the increase in xanthine oxidase in the muscle there were no detectable changes in the levels of muscle malondialdehyde or in plasma antioxidant capacity up to 4 days post-exercise. 5. It is concluded that eccentric exercise leads to an increased level of xanthine oxidase in human muscle and that the increase...

Construction of mutant glucose oxidases with increased dye-mediated dehydrogenase activity.

Science.gov (United States)

Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

2012-11-02

Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.

Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity

Science.gov (United States)

Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

2012-01-01

Mutagenesis studies on glucose oxidases (GOxs) were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe) and Aspergillus niger GOx (PDB ID; 1cf3). We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC) oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor. PMID:23203056

Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger

NARCIS (Netherlands)

Tamayo Ramos, J.A.; Berkel, van W.J.H.; Graaff, de L.H.

2012-01-01

BACKGROUND: Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. RESULTS: The

Tomato SlRbohB, a member of the NADPH oxidase family, is required for disease resistance against Botrytis cinerea and tolerance to drought stress

Directory of Open Access Journals (Sweden)

Xiaohui eLi

2015-06-01

Full Text Available NADPH oxidases (also known as respiratory burst oxidase homologues, Rbohs are the enzymes that catalyze the generation of reactive oxygen species (ROS in plants. In the present study, eight SlRboh genes were identified in tomato and their possible involvement in resistance to Botrytis cinerea and drought tolerance was examined. Expression of SlRbohs was induced by B. cinerea and Pseudomonas syringae pv. tomato but displayed distinct patterns. Virus-induced gene silencing (VIGS-based silencing of SlRbohB resulted in reduced resistance to B. cinerea but silencing of each of other SlRbohs did not affect the resistance. The SlRbohB-silenced plants accumulated more ROS and attenuated expression of defense genes after infection of B. cinerea than the nonsilenced plants. Silencing of SlRbohB also suppressed flg22-induced ROS burst and the expression of SlLrr22, a marker gene related to PAMP-triggered immunity (PTI. Transient expression of SlRbohB in Nicotiana benthamiana led to enhanced resistance to B. cinerea. Furthermore, silencing of SlRbohB resulted in decreased drought tolerance, accelerated water loss in leaves and altered expression of drought-responsive genes. Our data demonstrate that SlRbohB positively regulates the resistance to B. cinerea, flg22-induced PTI and drought tolerance in tomato.

Cytochemical Localization of Glucose Oxidase in Peroxisomes of Aspergillus niger

NARCIS (Netherlands)

Veenhuis, Marten; Dijken, Johannes Pieter van

1980-01-01

The subcellular localization of glucose oxidase (E.C. 1.1.3.4) in mycelia of Aspergillus niger has been investigated using cytochemical staining techniques. Mycelia from fermenter cultures, which produced gluconic acid from glucose, contained elevated levels of glucose oxidase and catalase. Both

Reducing cytoplasmic polyamine oxidase activity in Arabidopsis increases salt and drought tolerance by reducing reactive oxygen species production and increasing defense gene expression

Directory of Open Access Journals (Sweden)

G.H.M. eSagor

2016-02-01

Full Text Available The link between polyamine oxidases (PAOs, which function in polyamine catabolism, and stress responses remains elusive. Here, we address this issue using Arabidopsis pao mutants in which the expression of the five PAO genes is knocked-out or knocked-down. As the five single pao mutants and wild type (WT showed similar response to salt stress, we tried to generate the mutants that have either the cytoplasmic PAO pathway (pao1 pao5 or the peroxisomal PAO pathway (pao2 pao3 pao4 silenced. However, the latter triple mutant was not obtained. Thus, in this study, we used two double mutants, pao1 pao5 and pao2 pao4. Of interest, pao1 pao5 mutant was NaCl- and drought-tolerant, whereas pao2 pao4 showed similar sensitivity to those stresses as WT. To reveal the underlying mechanism of salt tolerance, further analyses were performed. Na uptake of the mutant (pao1 pao5 decreased to 75% of WT. PAO activity of the mutant was reduced to 62% of WT. The content of reactive oxygen species (ROS such as hydrogen peroxide, a reaction product of PAO action, and superoxide anion in the mutant became 81% and 72% of the levels in WT upon salt treatment. The mutant contained 2.8-fold higher thermospermine compared to WT. Moreover, the mutant induced the genes of salt overly sensitive-, abscisic acid (ABA-dependent- and ABA-independent- pathways more strongly than WT upon salt treatment. The results suggest that the Arabidopsis plant silencing cytoplasmic PAOs shows salinity tolerance by reducing ROS production and strongly inducing subsets of stress-responsive genes under stress conditions.

Phospholipid alterations in cardiac sarcoplasmic reticulum induced by xanthine oxidase: contamination of commercial preparations of xanthine oxidase by phospholipase A2

International Nuclear Information System (INIS)

Gamache, D.A.; Kornberg, L.J.; Bartolf, M.; Franson, R.C.

1986-01-01

Incubation of cardiac sarcoplasmic reticulum with xanthine oxidase alone at pH 7.0 resulted in a loss of lipid phosphorus that was potentiated by the addition of xanthine. Using autoclaved E.coli with 1- 14 C-oleate in the 2-acyl position of membrane phospholipids, the authors demonstrate that many, but not all, commercial preparations of xanthine oxidase contain significant phospholipase A 2 (PLA 2 ) activity (64.3-545.6 nmols/min/mg). The PLA 2 was maximally active in the neutral-alkaline pH range, was Ca 2+ -dependent, and was unaffected by the addition of xanthine. PLA 2 activity was totally inhibited by 1mM EDTA whereas radical production by optimal concentrations of xanthine/xanthine oxidase (X/XO) was unaffected by EDTA. Chromatographically purified xanthine oxidase (Sigma Grade III) contained high levels of PLA 2 activity (64.3 nmols/min/mg) compared to endogenous levels of neutral-active, Ca 2+ -dependent PLA 2 measured in various tissue homogenates (≤ 0.5 nmols/ min/mg). Because X/XO mixtures are used extensively to study oxygen free radical-induced cell injury and membrane phospholipid alterations, the presence of a potent extracellular PLA 2 may have influenced previously published reports, and such studies should be interpreted cautiously

Molecular characterization of Taenia multiceps isolates from Gansu Province, China by sequencing of mitochondrial cytochrome C oxidase subunit 1.

Science.gov (United States)

Li, Wen Hui; Jia, Wan Zhong; Qu, Zi Gang; Xie, Zhi Zhou; Luo, Jian Xun; Yin, Hong; Sun, Xiao Lin; Blaga, Radu; Fu, Bao Quan

2013-04-01

A total of 16 Taenia multiceps isolates collected from naturally infected sheep or goats in Gansu Province, China were characterized by sequences of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The complete cox1 gene was amplified for individual T. multiceps isolates by PCR, ligated to pMD18T vector, and sequenced. Sequence analysis indicated that out of 16 T. multiceps isolates 10 unique cox1 gene sequences of 1,623 bp were obtained with sequence variation of 0.12-0.68%. The results showed that the cox1 gene sequences were highly conserved among the examined T. multiceps isolates. However, they were quite different from those of the other Taenia species. Phylogenetic analysis based on complete cox1 gene sequences revealed that T. multiceps isolates were composed of 3 genotypes and distinguished from the other Taenia species.

Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

Science.gov (United States)

Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

2015-12-10

D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

Construction of Mutant Glucose Oxidases with Increased Dye-Mediated Dehydrogenase Activity

Directory of Open Access Journals (Sweden)

Koji Sode

2012-11-01

Full Text Available Mutagenesis studies on glucose oxidases (GOxs were conducted to construct GOxs with reduced oxidase activity and increased dehydrogenase activity. We focused on two representative GOxs, of which crystal structures have already been reported—Penicillium amagasakiense GOx (PDB ID; 1gpe and Aspergillus niger GOx (PDB ID; 1cf3. We constructed oxygen-interacting structural models for GOxs, and predicted the residues responsible for oxidative half reaction with oxygen on the basis of the crystal structure of cholesterol oxidase as well as on the fact that both enzymes are members of the glucose/methanol/choline (GMC oxidoreductase family. Rational amino acid substitution resulted in the construction of an engineered GOx with drastically decreased oxidase activity and increased dehydrogenase activity, which was higher than that of the wild-type enzyme. As a result, the dehydrogenase/oxidase ratio of the engineered enzyme was more than 11-fold greater than that of the wild-type enzyme. These results indicate that alteration of the dehydrogenase/oxidase activity ratio of GOxs is possible by introducing a mutation into the putative functional residues responsible for oxidative half reaction with oxygen of these enzymes, resulting in a further increased dehydrogenase activity. This is the first study reporting the alteration of GOx electron acceptor preference from oxygen to an artificial electron acceptor.

Isolation of a candidate gene for Norrie disease by positional cloning

NARCIS (Netherlands)

Berger, W.; Meindl, A.; van de Pol, T. J.; Cremers, F. P.; Ropers, H. H.; Döerner, C.; Monaco, A.; Bergen, A. A.; Lebo, R.; Warburg, M.

1992-01-01

The gene for Norrie disease, an X-linked disorder characterized by progressive atrophy of the eyes, mental disturbances and deafness, has been mapped to chromosome Xp11.4 close to DXS7 and the monoamine oxidase (MAO) genes. By subcloning a YAC with a 640 kilobases (kb) insert which spans the

Protein structural development of threadfin bream ( Nemipterus spp.) surimi gels induced by glucose oxidase.

Science.gov (United States)

Wang, Lei; Fan, Daming; Fu, Lulu; Jiao, Xidong; Huang, Jianlian; Zhao, Jianxin; Yan, Bowen; Zhou, Wenguo; Zhang, Wenhai; Ye, Weijian; Zhang, Hao

2018-01-01

This study investigated the effect of glucose oxidase on the gel properties of threadfin bream surimi. The gel strength of surimi increased with the addition of 0.5‰ glucose oxidase after two-step heating. Based on the results of the chemical interactions, the hydrophobic interaction and disulfide bond of glucose oxidase-treated surimi samples increased compared with the control samples at the gelation temperature and gel modori temperature. The surface hydrophobicity of samples with glucose oxidase and glucose increased significantly ( p glucose oxidase induced more α-helixes to turn into a more elongated random and flocculent structure. Glucose oxidase changes the secondary structure of the surimi protein, making more proteins depolarize and stretch and causing actomyosin to accumulate to each other, resulting in the formation of surimi gel.

Production of rabbit antibodies against purified Glucose oxidase

OpenAIRE

Zia,Muhammad Anjum; Ain,Qurat-ul; Iftikhar,Tehreema; Abbas,Rao Zahid; Rahman,Khalil-ur

2012-01-01

Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose) resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex ...

The use of galactose oxidase in lipid labeling

International Nuclear Information System (INIS)

Radin, N.S.; Evangelatos, G.P.

1981-01-01

Galactose oxidase can be used to oxidize the terminal carbon atom of lipids containing galactose or N-acetylgalactosamine, and the resultant aldehyde group can be reduced back to the original carbinol with radioactive borohydride. The efficiency of the first reaction has been investigated systematically by using [6- 3 H]galactosyl ceramide as substrate and measuring the amount of radioactive water formed. This enabled us to establish that the addition of catalase and peroxidase greatly speeded the oxidation, that phosphate and PIPES buffers were the best among those tested, that the reaction continued for 24 hr without a second addition of galactose oxidase, and that the optimum concentration of organic solvent (tetrahydrofuran) was 50%. The suggestion if made that a similar set of variables be studied for each lipid or nonlipid by the same basic technique: labeling by the oxidase/borohydride method and use of the resultant compound as substrate

Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines.

Science.gov (United States)

Houde, Mario; Diallo, Amadou Oury

2008-08-27

Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive) that differ in their response to Al were performed. Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate) needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

Chronic ethanol increases calcium/calmodulin-dependent protein kinaseIIδ gene expression and decreases monoamine oxidase amount in rat heart muscles: Rescue effect of Zingiber officinale (ginger) extract.

Science.gov (United States)

Heshmati, Elaheh; Shirpoor, Alireza; Kheradmand, Fatemeh; Alizadeh, Mohammad; Gharalari, Farzaneh Hosseini

2018-01-01

Association between chronic alcohol intake and cardiac abnormality is well known; however, the precise underlying molecular mediators involved in ethanol-induced heart abnormalities remain elusive. This study investigated the effect of chronic ethanol exposure on calcium/calmodulin-dependent protein kinase IIδ (CaMKIIδ) gene expression and monoamine oxidase (MAO) levels and histological changes in rat heart. It was also planned to find out whether Zingiber officinale (ginger) extract mitigated the abnormalities induced by ethanol in rat heart. Male wistar rats were divided into three groups of eight animals each: control, ethanol, and ginger extract treated-ethanol (GETE) groups. After 6 weeks of treatment, the results revealed a significant increase in CaMKIIδtotal and isoforms δ2 and δ3 of CaMKIIδ gene expression as well as a significant decrease in the MAO levels in the ethanol group compared to that in the control group. Moreover, compared to the control group, the ethanol group showed histological changes, such as fibrosis, heart muscle cells proliferation, myocyte hypertrophy, vacuolization, and focal lymphocytic infiltration. Consumption of ginger extract along with ethanol ameliorated CaMKIIδtotal. In addition, compared to the ethanol group, isoforms gene expression changed and increased the reduced MAO levels and mitigated heart structural changes. These findings indicate that ethanol-induced heart abnormalities may, in part, be associated with Ca 2+ homeostasis changes mediated by overexpression of CaMKIIδ gene and the decrease of MAO levels and that these effects can be alleviated by using ginger extract as an antioxidant and anti-inflammatory agent.

Ascorbate oxidase-dependent changes in the redox state of the apoplast modulate gene transcript accumulation leading to modified hormone signaling and orchestration of defense processes in tobacco.

Science.gov (United States)

Pignocchi, Cristina; Kiddle, Guy; Hernández, Iker; Foster, Simon J; Asensi, Amparo; Taybi, Tahar; Barnes, Jeremy; Foyer, Christine H

2006-06-01

The role of the redox state of the apoplast in hormone responses, signaling cascades, and gene expression was studied in transgenic tobacco (Nicotiana tabacum) plants with modified cell wall-localized ascorbate oxidase (AO). High AO activity specifically decreased the ascorbic acid (AA) content of the apoplast and altered plant growth responses triggered by hormones. Auxin stimulated shoot growth only when the apoplastic AA pool was reduced in wild-type or AO antisense lines. Oxidation of apoplastic AA in AO sense lines was associated with loss of the auxin response, higher mitogen-activated protein kinase activities, and susceptibility to a virulent strain of the pathogen Pseudomonas syringae. The total leaf glutathione pool, the ratio of reduced glutathione to glutathione disulfide, and glutathione reductase activities were similar in the leaves of all lines. However, AO sense leaves exhibited significantly lower dehydroascorbate reductase and ascorbate peroxidase activities than wild-type and antisense leaves. The abundance of mRNAs encoding antioxidant enzymes was similar in all lines. However, the day/night rhythms in the abundance of transcripts encoding the three catalase isoforms were changed in response to the AA content of the apoplast. Other transcripts influenced by AO included photorespiratory genes and a plasma membrane Ca(2+) channel-associated gene. We conclude that the redox state of the apoplast modulates plant growth and defense responses by regulating signal transduction cascades and gene expression patterns. Hence, AO activity, which modulates the redox state of the apoplastic AA pool, strongly influences the responses of plant cells to external and internal stimuli.

Molecular Basis for Converting (2S-Methylsuccinyl-CoA Dehydrogenase into an Oxidase

Directory of Open Access Journals (Sweden)

Simon Burgener

2017-12-01

Full Text Available Although flavoenzymes have been studied in detail, the molecular basis of their dioxygen reactivity is only partially understood. The members of the flavin adenosine dinucleotide (FAD-dependent acyl-CoA dehydrogenase and acyl-CoA oxidase families catalyze similar reactions and share common structural features. However, both enzyme families feature opposing reaction specificities in respect to dioxygen. Dehydrogenases react with electron transfer flavoproteins as terminal electron acceptors and do not show a considerable reactivity with dioxygen, whereas dioxygen serves as a bona fide substrate for oxidases. We recently engineered (2S-methylsuccinyl-CoA dehydrogenase towards oxidase activity by rational mutagenesis. Here we characterized the (2S-methylsuccinyl-CoA dehydrogenase wild-type, as well as the engineered (2S-methylsuccinyl-CoA oxidase, in detail. Using stopped-flow UV-spectroscopy and liquid chromatography-mass spectrometry (LC-MS based assays, we explain the molecular base for dioxygen reactivity in the engineered oxidase and show that the increased oxidase function of the engineered enzyme comes at a decreased dehydrogenase activity. Our findings add to the common notion that an increased activity for a specific substrate is achieved at the expense of reaction promiscuity and provide guidelines for rational engineering efforts of acyl-CoA dehydrogenases and oxidases.

The increasing role of monoamine oxidase type B inhibitors in Parkinson's disease therapy.

Science.gov (United States)

Elmer, Lawrence W; Bertoni, John M

2008-11-01

The role of monoamine oxidase type B inhibitors in the treatment of Parkinson's disease has expanded with the new monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets. As primary therapy in early disease monoamine oxidase B inhibitors reduce motor disability and delay the need for levodopa. In more advanced disease requiring levodopa, adjunctive monoamine oxidase B inhibitors reduce 'off' time and may improve gait and freezing. Rasagiline and selegiline oral disintegrating tablets may reduce the safety risks associated with the amfetamine and methamfetamine metabolites of conventional oral selegiline while retaining or improving therapeutic efficacy. Articles were identified by searches of PubMed and searches on the Internet and reviewed. All articles and other referenced materials were retrieved using the keywords 'Parkinson's disease', 'treatment' and 'monoamine oxidase B inhibitor' and were published between 1960 and 2007, with older references selected for historical significance. Only papers published in English were reviewed. Accumulating data support the use of monoamine oxidase B inhibitors as monotherapy for early and mild Parkinson's disease and as adjunctive therapy for more advanced Parkinson's disease with levodopa-associated motor fluctuations. The recently released monoamine oxidase B inhibitor rasagiline and a new formulation, selegiline oral disintegrating tablets, have potential advantages over conventional oral selegiline.

Amine oxidase from lentil seedlings: energetic domains and effect of temperature on activity.

Science.gov (United States)

Moosavi-Nejad, S Z; Rezaei-Tavirani, M; Padiglia, A; Floris, G; Moosavi-Movahedi, A A

2001-07-01

Copper/TPQ amine oxidases from mammalian and plant sources have shown many differences in substrate specificity and molecular properties. In this work the activity of lentil seedling amine oxidase was followed at various temperatures in 100 mM potassium phosphate buffer, pH 7, using benzylamine as substrate. The discontinuous Arrhenius plot of lentil amine oxidase showed two distinct phases with a jump between them. Thermal denaturation of the enzyme, using differential scanning calorimetry under the same experimental conditions, showed a transition at the same temperature ranges in the absence of substrate, indicating the occurrence of conformational changes, with an enthalpy change of about 175.9 kJ/mole. The temperature-induced changes of the activity of lentil amine oxidase are compared with those of bovine serum amine oxidase (taken from the literature).

Lysyl oxidase in cancer research

DEFF Research Database (Denmark)

Perryman, Lara; Erler, Janine Terra

2014-01-01

Metastasis is the main reason for cancer-associated deaths and therapies are desperately needed to target the progression of cancer. Lysyl oxidase (LOX) plays a pivotal role in cancer progression, including metastasis, and is therefore is an attractive therapeutic target. In this review we...

Angiotensin II inhibits the Na+-K+ pump via PKC-dependent activation of NADPH oxidase.

Science.gov (United States)

White, Caroline N; Figtree, Gemma A; Liu, Chia-Chi; Garcia, Alvaro; Hamilton, Elisha J; Chia, Karin K M; Rasmussen, Helge H

2009-04-01

The sarcolemmal Na(+)-K(+) pump, pivotal in cardiac myocyte function, is inhibited by angiotensin II (ANG II). Since ANG II activates NADPH oxidase, we tested the hypothesis that NADPH oxidase mediates the pump inhibition. Exposure to 100 nmol/l ANG II increased superoxide-sensitive fluorescence of isolated rabbit ventricular myocytes. The increase was abolished by pegylated superoxide dismutase (SOD), by the NADPH oxidase inhibitor apocynin, and by myristolated inhibitory peptide to epsilon-protein kinase C (epsilonPKC), previously implicated in ANG II-induced Na(+)-K(+) pump inhibition. A role for epsilonPKC was also supported by an ANG II-induced increase in coimmunoprecipitation of epsilonPKC with the receptor for the activated kinase and with the cytosolic p47(phox) subunit of NADPH oxidase. ANG II decreased electrogenic Na(+)-K(+) pump current in voltage-clamped myocytes. The decrease was abolished by SOD, by the gp91ds inhibitory peptide that blocks assembly and activation of NADPH oxidase, and by epsilonPKC inhibitory peptide. Since colocalization should facilitate NADPH oxidase-dependent regulation of the Na(+)-K(+) pump, we examined whether there is physical association between the pump subunits and NADPH oxidase. The alpha(1)-subunit coimmunoprecipitated with caveolin 3 and with membrane-associated p22(phox) and cytosolic p47(phox) NADPH oxidase subunits at baseline. ANG II had no effect on alpha(1)/caveolin 3 or alpha(1)/p22(phox) interaction, but it increased alpha(1)/p47(phox) coimmunoprecipitation. We conclude that ANG II inhibits the Na(+)-K(+) pump via PKC-dependent NADPH oxidase activation.

Contribution of the NADH-oxidase (Nox) to the aerobic life of Lactobacillus sanfranciscensis DSM20451T.

Science.gov (United States)

Jänsch, André; Freiding, Simone; Behr, Jürgen; Vogel, Rudi F

2011-02-01

Lactobacillus sanfranciscensis is the key bacterium in traditional sourdough fermentation. The molecular background of its oxygen tolerance was investigated by comparison of wild type and NADH-oxidase (Nox) knock out mutants. The nox gene of L. sanfranciscensis DSM20451(T) coding for a NADH-oxidase (Nox) was inactivated by single crossover integration to yield strain L. sanfranciscensis DSM20451Δnox. By inactivation of the native NADH-oxidase gene, it was ensured that besides fructose, O(2) can react as an electron acceptor. In aerated cultures the mutant strain was only able to grow in MRS media supplemented with fructose as electron acceptor, whereas the wild type strain showed a fructose independent growth response. The use of oxygen as an external electron acceptor enables L. sanfranciscensis to shift from acetyl-phosphate into the acetate branch and gain an additionally ATP, while the reduced cofactors were regenerated by Nox-activity. In aerated cultures the wild type strain formed a fermentation ratio of lactate to acetate of 1.09 in MRS supplemented with fructose after 24 h of fermentation, while the mutant strain formed a fermentation ratio of 3.05. Additionally, L. sanfranciscensis showed manganese-dependent growth response in aerated cultures, the final OD and growth velocity was increased in media supplemented with manganese. The expression of two predicted Mn(2+)/Fe(2+) transporters MntH1 and MntH2 in L. sanfranciscensis DSM20451(T) was verified by amplification of a 318 bp fragment of MntH1 and a 239 bp fragment of MntH2 from cDNA library obtained from aerobically, exponentially growing cells of L. sanfranciscensis DSM20451(T) in MRS. Moreover, the mutant strain DSM20451Δnox was more sensitive to the superoxide generating agent paraquat and showed inhibition of growth on diamide-treated MRS-plates without fructose supplementation. Copyright © 2010 Elsevier Ltd. All rights reserved.

Mural granulosa cell gene expression associated with oocyte developmental competence

Directory of Open Access Journals (Sweden)

Jiang Jin-Yi

2010-03-01

Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and

The role of brassinosteroids in the regulation of the plasma membrane H+-ATPase and NADPH oxidase under cadmium stress.

Science.gov (United States)

Jakubowska, Dagmara; Janicka, Małgorzata

2017-11-01

The present research aim was to define the role of brassinosteroids (BRs) in plant adaptation to cadmium stress. We observed a stimulating effect of exogenous BR on the activity of two plasma membrane enzymes which play a key role in plants adaptation to cadmium stress, H + -ATPase (EC 3.6.3.14) and NADPH oxidase (EC 1.6.3.1). Using anti-phosphothreonine antibody we showed that modification of PM H + -ATPase activity under BR action could result from phosphorylation of the enzyme protein. Also the relative expression of genes encoding both PM H + -ATPase and NADPH oxidase was affected by BR. To confirm the role of BR in the cadmium stimulating effect on activity of both studied plasma membrane enzymes, an assay in the presence of a BR biosynthesis inhibitor (propiconazole) was performed. Moreover, as a tool in our work we used commercially available plant mutants unable to BR biosynthesis or with dysfunctional BR signaling pathway, to further confirm participation of BR in plant adaptation to heavy metal stress. Presented results demonstrate some elements of the brassinosteroid-induced pathway activated under cadmium stress, wherein H + -ATPase and NADPH oxidase are key factors. Copyright © 2017 Elsevier B.V. All rights reserved.

Fluorescent Probes for Analysis and Imaging of Monoamine Oxidase Activity

Energy Technology Data Exchange (ETDEWEB)

Kim, Dokyoung; Jun, Yong Woong; Ahn, Kyo Han [POSTECH, Pohang (Korea, Republic of)

2014-05-15

Monoamine oxidases catalyze the oxidative deamination of dietary amines and amine neurotransmitters, and assist in maintaining the homeostasis of the amine neurotransmitters in the brain. Dysfunctions of these enzymes can cause neurological and behavioral disorders including Parkinson's and Alzheimer's diseases. To understand their physiological roles, efficient assay methods for monoamine oxidases are essential. Reviewed in this Perspective are the recent progress in the development of fluorescent probes for monoamine oxidases and their applications to enzyme assays in cells and tissues. It is evident that still there is strong need for a fluorescent probe with desirable substrate selectivity and photophysical properties to challenge the much unsolved issues associated with the enzymes and the diseases.

A new fatal case of pyridox(am)ine 5'-phosphate oxidase (PNPO) deficiency.

Science.gov (United States)

Ruiz, Angeles; García-Villoria, Judit; Ormazabal, Aida; Zschocke, Johannes; Fiol, Miquel; Navarro-Sastre, Aleix; Artuch, Rafael; Vilaseca, Maria Antonia; Ribes, Antonia

2008-02-01

We present a patient with severe pyridox(am)ine 5'-phosphate oxidase deficiency and homozygosity for a novel nonsense-mutation, p.A174X, in the PNPO gene who died with pyridoxal phosphate (PLP) treatment despite initial clinical recovery. He presented neonatally, with the classical clinical symptoms of the disease. Increase of urinary vanillactate was the first biochemical factor of alert. Amino acid and neurotransmitter analysis in CSF indicated reduced activity of several PLP-dependent enzymes. The diagnosis was confirmed by mutational studies. From this and the other reported patients it may be concluded that the administration of PLP should not be delayed until the complete biochemical evidence is obtained.

[Experimental rationale for the parameters of a rapid method for oxidase activity determination].

Science.gov (United States)

Butorina, N N

2010-01-01

Experimental rationale is provided for the parameters of a rapid (1-2-min) test to concurrently determine the oxidase activity of all bacteria grown on the membrane filter after water filtration. Oxidase reagents that are the aqueous solutions of tetramethyl-p-phenylenediamine dihydrochloride and demethyl-p-phenylenediamine dihydrochloride have been first ascertained to exert no effect on the viability and enzymatic activity of bacteria after one-hour contact. An algorithm has been improved for the rapid oxidase activity test: the allowable time for bacteria to contact oxidase reagents and procedures for minimizing the effect on bacterial biochemical activity following the contact. An accelerated method based on lactose medium with tergitol 7 and Endo agar has been devised to determine coliform bacteria, by applying the rapid oxidase test: the time of a final response is 18-24 hours. The method has been included into GOST 52426-2005.

Action of DCCD on the H+/O stoichiometry of mitoplast cytochrome c oxidase.

Science.gov (United States)

Lehninger, A L; Reynafarje, B; Costa, L

1985-01-01

The mechanistic H+/O ejection stoichiometry of the cytochrome c oxidase reaction in rat liver mitoplasts is close to 4 at level flow when the reduced oxidase is pulsed with O2. Dicyclohexylcarbodiimide (DCCD) up to 30 nmol/mg protein fails to influence the rate of electron flow through the mitoplast oxidase, but inhibits H+ ejection. The inhibition of H+ ejection appears to be biphasic; ejection of 2-3 H+ per O is completely inhibited by very low DCCD, whereas inhibition of the remaining H+ ejection requires very much higher concentrations of DCCD. This effect suggests the occurrence of two types of H+ pumps in the native cytochrome oxidase of mitoplasts.

Cox1 mutation abrogates need for Cox23 in cytochrome c oxidase biogenesis

Directory of Open Access Journals (Sweden)

Richard Dela Cruz

2016-06-01

Full Text Available Cox23 is a known conserved assembly factor for cytochrome c oxidase, although its role in cytochrome c oxidase (CcO biogenesis remains unresolved. To gain additional insights into its role, we isolated spontaneous suppressors of the respiratory growth defect in cox23∆ yeast cells. We recovered independent colonies that propagated on glycerol/lactate medium for cox23∆ cells at 37°C. We mapped these mutations to the mitochondrial genome and specifically to COX1 yielding an I101F substitution. The I101F Cox1 allele is a gain-of-function mutation enabling yeast to respire in the absence of Cox23. CcO subunit steady-state levels were restored with the I101F Cox1 suppressor mutation and oxygen consumption and CcO activity were likewise restored. Cells harboring the mitochondrial genome encoding I101F Cox1 were used to delete genes for other CcO assembly factors to test the specificity of the Cox1 mutation as a suppressor of cox23∆ cells. The Cox1 mutant allele fails to support respiratory growth in yeast lacking Cox17, Cox19, Coa1, Coa2, Cox14 or Shy1, demonstrating its specific suppressor activity for cox23∆ cells.

Vanillyl-alcohol oxidase, a tasteful biocatalyst

NARCIS (Netherlands)

Heuvel, van den R.H.H.; Fraaije, M.W.; Mattevi, A.; Laane, C.; Berkel, van W.J.H.

2001-01-01

The covalent flavoenzyme vanillyl-alcohol oxidase (VAO) is a versatile biocatalyst. It converts a wide range of phenolic compounds by catalysing oxidation, deamination, demethylation, dehydrogenation and hydroxylation reactions. The production of natural vanillin, 4-hydroxybenzaldehyde, coniferyl

Identification of genes and pathways associated with aluminum stress and tolerance using transcriptome profiling of wheat near-isogenic lines

Directory of Open Access Journals (Sweden)

Diallo Amadou

2008-08-01

Full Text Available Abstract Background Aluminum is considered the most limiting factor for plant productivity in acidic soils, which cover large areas of the world's potential arable lands. The inhibition of root growth is recognized as the primary effect of Al toxicity. To identify genes associated with Al stress and tolerance, transcriptome analyses of four different wheat lines (2 Al-tolerant and 2 Al sensitive that differ in their response to Al were performed. Results Microarray expression profiling revealed that 83 candidate genes are associated with Al stress and 25 are associated with tolerance. The stress-associated genes include important enzymes such as pyruvate dehydrogenase, alternative oxidase, and galactonolactone oxidase, ABC transporter and ascorbate oxido-reducatase. The Al tolerance-associated genes include the ALMT-1 malate transporter, glutathione S-transferase, germin/oxalate oxidase, fructose 1,6-bisphosphatase, cysteine-rich proteins, cytochrome P450 monooxygenase, cellulose synthase, zinc finger transcription factor, disease resistance response protein and F-box containing domain protein. Conclusion In this survey, we identified stress- and tolerance-associated genes that may be involved in the detoxification of Al and reactive oxygen species. Alternative pathways could help maintain the supply of important metabolites (H2O2, ascorbate, NADH, and phosphate needed for Al tolerance and root growth. The Al tolerance-associated genes may be key factors that regulate these pathways.

Unique role of NADPH oxidase 5 in oxidative stress in human renal proximal tubule cells

Directory of Open Access Journals (Sweden)

Peiying Yu

2014-01-01

Full Text Available NADPH oxidases are the major sources of reactive oxygen species in cardiovascular, neural, and kidney cells. The NADPH oxidase 5 (NOX5 gene is present in humans but not rodents. Because Nox isoforms in renal proximal tubules (RPTs are involved in the pathogenesis of hypertension, we tested the hypothesis that NOX5 is differentially expressed in RPT cells from normotensive (NT and hypertensive subjects (HT. We found that NOX5 mRNA, total NOX5 protein, and apical membrane NOX5 protein were 4.2±0.7-fold, 5.2±0.7-fold, and 2.8±0.5-fold greater in HT than NT. Basal total NADPH oxidase activity was 4.5±0.2-fold and basal NOX5 activity in NOX5 immunoprecipitates was 6.2±0.2-fold greater in HT than NT (P=<0.001, n=6–14/group. Ionomycin increased total NOX and NOX5 activities in RPT cells from HT (P<0.01, n=4, ANOVA, effects that were abrogated by pre-treatment of the RPT cells with diphenylene-iodonium or superoxide dismutase. Silencing NOX5 using NOX5-siRNA decreased NADPH oxidase activity (−45.1±3.2% vs. mock-siRNA, n=6–8 in HT. D1-like receptor stimulation decreased NADPH oxidase activity to a greater extent in NT (−32.5±1.8% than HT (−14.8±1.8. In contrast to the marked increase in expression and activity of NOX5 in HT, NOX1 mRNA and protein were minimally increased in HT, relative to NT; total NOX2 and NOX4 proteins were not different between HT and NT, while the increase in apical RPT cell membrane NOX1, NOX2, and NOX4 proteins in HT, relative to NT, was much less than those observed with NOX5. Thus, we demonstrate, for the first time, that NOX5 is expressed in human RPT cells and to greater extent than the other Nox isoforms in HT than NT. We suggest that the increased expression of NOX5, which may be responsible for the increased oxidative stress in RPT cells in human essential hypertension, is caused, in part, by a defective renal dopaminergic system.

Tuning of redox regulatory mechanisms, reactive oxygen species and redox homeostasis under salinity stress

Directory of Open Access Journals (Sweden)

Hossain eSazzad

2016-05-01

Full Text Available Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g. the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH, alternative oxidase (AOX, the plastid terminal oxidase (PTOX and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants.

Cytochemical localization of catalase and several hydrogen peroxide-producing oxidases in the nucleoids and matrix of rat liver peroxisomes

NARCIS (Netherlands)

Veenhuis, M.; Wendelaar Bonga, S.E.

1979-01-01

The distribution of catalase, amino acid oxidase, α-hydroxy acid oxidase, urate oxidase and alcohol oxidase was studied cytochemically in rat hepatocytes. The presence of catalase was demonstrated with the conventional diaminobenzidine technique. Oxidase activities were visualized with methods based

Lysyl Oxidase and the Tumor Microenvironment

Directory of Open Access Journals (Sweden)

Tong-Hong Wang

2016-12-01

Full Text Available The lysyl oxidase (LOX family of oxidases contains a group of extracellular copper-dependent enzymes that catalyze the cross-linking of collagen and elastin by oxidation, thus maintaining the rigidity and structural stability of the extracellular matrix (ECM. Aberrant expression or activation of LOX alters the cellular microenvironment, leading to many diseases, including atherosclerosis, tissue fibrosis, and cancer. Recently, a number of studies have shown that LOX is overexpressed in most cancers and that it is involved in the regulation of tumor progression and metastasis. In contrast, a few reports have also indicated the tumor-suppressing role of LOX. In this short review, we discuss recent research on the correlations between LOX and cancer. Further, the role of LOX in tumor microenvironment remodeling, tumorigenesis, and metastasis and the underlying mechanisms have also been elucidated.

Overexpression of a water-forming NADH oxidase improves the metabolism and stress tolerance of Saccharmyces cerevisiae in aerobic fermenation

Directory of Open Access Journals (Sweden)

Xinchi Shi

2016-09-01

Full Text Available Redox homeostasis is fundamental to the maintenance of metabolism. Redox imbalance can cause oxidative stress, which affects metabolism and growth. Water-forming NADH oxidase regulates the redox balance by oxidizing cytosolic NADH to NAD+, which relieves cytosolic NADH accumulation through rapid glucose consumption in Saccharomyces cerevisiae, thus decreasing the production of the byproduct glycerol in industrial ethanol production. Here, we studied the effects of overexpression of a water-forming NADH oxidase from Lactococcus lactis on the stress response of S. cerevisiae in aerobic batch fermentation, and we constructed an interaction network of transcriptional regulation and metabolic networks to study the effects of and mechanisms underlying NADH oxidase regulation. The oxidase-overexpressing strain (NOX showed increased glucose consumption, growth, and ethanol production, while glycerol production was remarkably lower. Glucose was exhausted by NOX at 26 h, while 18.92 ± 0.94 g/L residual glucose was left in the fermentation broth of the control strain (CON at this time point. At 29.5 h, the ethanol concentration for NOX peaked at 35.25 ± 1.76 g/L, which was 14.37 % higher than that for CON (30.82 ± 1.54 g/L. Gene expression involved in the synthesis of thiamine, which is associated with stress responses in various organisms, was increased in NOX. The transcription factor HAP4 was significantly upregulated in NOX at the late-exponential phase, indicating a diauxic shift in response to starvation. The apoptosis-inducing factor Nuc1 was downregulated while the transcription factor Sok2, which regulates the production of the small signaling molecule ammonia, was upregulated at the late-exponential phase, benefiting young cells on the rim. Reactive oxygen species production was decreased by 10% in NOX, supporting a decrease in apoptosis. The HOG pathway was not activated, although the osmotic stress was truly higher, indicating improved

Effects of bleaching wastewater irrigation on soil quality of constructed reed wetlands

Directory of Open Access Journals (Sweden)

Cheng Ding

2016-10-01

Full Text Available Constructed reed wetland microcosms (CRWs in a lab of east China have been irrigated with bleaching wastewater per month for a reed growth season. The soil physicochemical properties, enzyme activities (i.e. urease, invertase, polyphenol oxidase, alkaline phosphatase and cellulase and soil microbial diversity were assayed before and after the exposure experiment. Compared to the river water irrigated controls (CKs, bleaching wastewater application has no marked influence on soil pH, but significantly increased soil Na+, total halogen and absorbable organic halogen (AOX contents, which induced the increasing of soil electrical conductivity. Furthermore, soil enzyme activities displayed significant variation (except for polyphenol oxidase. Bleaching wastewater irrigation decreased Sorenson’s pairwise similarity coefficient (Cs, which indicated the changes of the structure of bacterial and fungal communities. However, only the diversity of bacterial community was inhibited and has no effect on the diversity of fungal community, as evidenced by the calculated Shannon–Wiener index (H.

Inactivation of 1-aminocyclopropane-1-carboxylate oxidase involves oxidative modifications.

Science.gov (United States)

Barlow, J N; Zhang, Z; John, P; Baldwin, J E; Schofield, C J

1997-03-25

1-Aminocyclopropane-1-carboxylate (ACC) oxidase catalyzes the final step in the biosynthesis of the plant signaling molecule ethylene. It is a member of the ferrous iron dependent family of oxidases and dioxygenases and is unusual in that it displays a very short half-life under catalytic conditions, typically less than 20 min, and a requirement for CO2 as an activator. The rates of inactivation of purified, recombinant ACC oxidase from tomato under various combinations of substrates and cofactors were measured. Inactivation was relatively slow in the presence of buffer alone (t1/2 > 1 h), but fast in the presence of ferrous iron and ascorbate (t1/2 approximately 10 min). The rate of iron/ascorbate-mediated inactivation was increased by the addition of ACC, unaffected by the addition of CO2 at saturation (supplied as bicarbonate) but decreased by the addition of catalase or ACC + CO2 at saturation (supplied as bicarbonate). Iron/ascorbate-mediated inactivation was accompanied by partial proteolysis as observed by SDS-PAGE analysis. The fragmentation pattern was altered when ACC was also included, suggesting that ACC can bind to ACC oxidase in the absence of bicarbonate. N-terminal sequencing of fragments resulted in identification of an internal cleavage site which we propose is proximate to active-site bound iron. Thus, ACC oxidase inactivates via relatively slow partial unfolding of the catalytically active conformation, oxidative damage mediated via hydrogen peroxide which is catalase protectable and oxidative damage to the active site which results in partial proteolysis and is not catalase protectable.

Up-Streaming Process for Glucose Oxidase by Thermophilic Penicillium sp. in Shake Flask

OpenAIRE

Muhammad Mohsin JAVED; Aroosh SHABIR; Sana ZAHOOR; Ikram UL-HAQ

2012-01-01

The present study is concerned with the production of glucose oxidase (GOD) from thermophilic Penicillium sp. in 250 mL shake flask. Fourteen different strains of thermophilic Penicillium sp. were isolated from the soil and were screened for glucose oxidase production. IIBP-13 strain gave maximum extra-cellular glucose oxidase production as compared to other isolates. Effect of submerged fermentation in shaking and static conditions, different carbon sources and incubation period on the produ...

Transcriptomic Analysis of Responses to Imbalanced Carbon: Nitrogen Availabilities in Rice Seedlings.

Directory of Open Access Journals (Sweden)

Aobo Huang

Full Text Available The internal C:N balance must be tightly controlled for the normal growth and development of plants. However, the underlying mechanisms, by which plants sense and balance the intracellular C:N status correspondingly to exogenous C:N availabilities remain elusive. In this study, we use comparative gene expression analysis to identify genes that are responsive to imbalanced C:N treatments in the aerial parts of rice seedlings. Transcripts of rice seedlings treated with four C:N availabilities (1:1, 1:60, 60:1 and 60:60 were compared and two groups of genes were classified: high C:low N responsive genes and low C:high N responsive genes. Our analysis identified several functional correlated genes including chalcone synthase (CHS, chlorophyll a-b binding protein (CAB and other genes that are implicated in C:N balancing mechanism, such as alternative oxidase 1B (OsAOX1B, malate dehydrogenase (OsMDH and lysine and histidine specific transporter 1 (OsLHT1. Additionally, six jasmonate synthetic genes and key regulatory genes involved in abiotic and biotic stresses, such as OsMYB4, autoinhibited calcium ATPase 3 (OsACA3 and pleiotropic drug resistance 9 (OsPDR9, were differentially expressed under high C:low N treatment. Gene ontology analysis showed that high C:low N up-regulated genes were primarily enriched in fatty acid biosynthesis and defense responses. Coexpression network analysis of these genes identified eight jasmonate ZIM domain protein (OsJAZ genes and several defense response related regulators, suggesting that high C:low N status may act as a stress condition, which induces defense responses mediated by jasmonate signaling pathway. Our transcriptome analysis shed new light on the C:N balancing mechanisms and revealed several important regulators of C:N status in rice seedlings.

A multicopper oxidase is essential for manganese oxidation and laccase-like activity in Pedomicrobium sp. ACM 3067.

Science.gov (United States)

Ridge, Justin P; Lin, Marianne; Larsen, Eloise I; Fegan, Mark; McEwan, Alastair G; Sly, Lindsay I

2007-04-01

Pedomicrobium sp. ACM 3067 is a budding-hyphal bacterium belonging to the alpha-Proteobacteria which is able to oxidize soluble Mn2+ to insoluble manganese oxide. A cosmid, from a whole-genome library, containing the putative genes responsible for manganese oxidation was identified and a primer-walking approach yielded 4350 bp of novel sequence. Analysis of this sequence showed the presence of a predicted three-gene operon, moxCBA. The moxA gene product showed homology to multicopper oxidases (MCOs) and contained the characteristic four copper-binding motifs (A, B, C and D) common to MCOs. An insertion mutation of moxA showed that this gene was essential for both manganese oxidation and laccase-like activity. The moxB gene product showed homology to a family of outer membrane proteins which are essential for Type I secretion in Gram-negative bacteria. moxBA has not been observed in other manganese-oxidizing bacteria but homologues were identified in the genomes of several bacteria including Sinorhizobium meliloti 1021 and Agrobacterium tumefaciens C58. These results suggest that moxBA and its homologues constitute a family of genes encoding an MCO and a predicted component of the Type I secretion system.

NADPH oxidases as novel pharmacologic targets against influenza A virus infection.

Science.gov (United States)

Vlahos, Ross; Selemidis, Stavros

2014-12-01

Influenza A viruses represent a major global health care challenge, with imminent pandemics, emerging antiviral resistance, and long lag times for vaccine development, raising a pressing need for novel pharmacologic strategies that ideally target the pathology irrespective of the infecting strain. Reactive oxygen species (ROS) pervade all facets of cell biology with both detrimental and protective properties. Indeed, there is compelling evidence that activation of the NADPH oxidase 2 (NOX2) isoform of the NADPH oxidase family of ROS-producing enzymes promotes lung oxidative stress, inflammation, injury, and dysfunction resulting from influenza A viruses of low to high pathogenicity, as well as impeding virus clearance. By contrast, the dual oxidase isoforms produce ROS that provide vital protective antiviral effects for the host. In this review, we propose that inhibitors of NOX2 are better alternatives than broad-spectrum antioxidant approaches for treatment of influenza pathologies, for which clinical efficacy may have been limited owing to poor bioavailability and inadvertent removal of beneficial ROS. Finally, we briefly describe the current suite of NADPH oxidase inhibitors and the molecular features of the NADPH oxidase enzymes that could be exploited by drug discovery for development of more specific and novel inhibitors to prevent or treat disease caused by influenza. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.

Two X-linked chronic granulomatous disease patients with unusual NADPH oxidase properties

NARCIS (Netherlands)

Wolach, Baruch; Broides, Arnon; Zeeli, Tal; Gavrieli, Ronit; de Boer, Martin; van Leeuwen, Karin; Levy, Jacov; Roos, Dirk

2011-01-01

Chronic granulomatous disease (CGD) is an immune deficiency syndrome caused by defects in the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase, the enzyme that generates reactive oxygen species (ROS) in phagocytizing leukocytes. This study evaluates the NADPH oxidase capacity in two

Development of ent-kaurene Oxidase-Based Conserved Intron Spanning Primers for Species Identification in the Genus Poa (Poaceae; Bluegrass)

OpenAIRE

Jonathan M. LaMantia; Ambika Chandra; David R. Huff

2018-01-01

Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO) has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning prime...

Overexpression of Arabidopsis thaliana gibberellic acid 20 oxidase (AtGA20ox) gene enhance the vegetative growth and fiber quality in kenaf (Hibiscus cannabinus L.) plants

Science.gov (United States)

Withanage, Samanthi Priyanka; Hossain, Md Aktar; Kumar M., Sures; Roslan, Hairul Azman B; Abdullah, Mohammad Puad; Napis, Suhaimi B.; Shukor, Nor Aini Ab.

2015-01-01

Kenaf (Hibiscus cannabinus L.; Family: Malvaceae), is multipurpose crop, one of the potential alternatives of natural fiber for biocomposite materials. Longer fiber and higher cellulose contents are required for good quality biocomposite materials. However, average length of kenaf fiber (2.6 mm in bast and 1.28 mm in whole plant) is below the critical length (4 mm) for biocomposite production. Present study describes whether fiber length and cellulose content of kenaf plants could be enhanced by increasing GA biosynthesis in plants by overexpressing Arabidopsis thaliana Gibberellic Acid 20 oxidase (AtGA20ox) gene. AtGA20ox gene with intron was overexpressed in kenaf plants under the control of double CaMV 35S promoter, followed by in planta transformation into V36 and G4 varieties of kenaf. The lines with higher levels of bioactive GA (0.3–1.52 ng g−1 fresh weight) were further characterized for their morphological and biochemical traits including vegetative and reproductive growth, fiber dimension and chemical composition. Positive impact of increased gibberellins on biochemical composition, fiber dimension and their derivative values were demonstrated in some lines of transgenic kenaf including increased cellulose content (91%), fiber length and quality but it still requires further study to confirm the critical level of this particular bioactive GA in transgenic plants. PMID:26175614

Bilirubin oxidase-like proteins from Podospora anserina: promising thermostable enzymes for application in transformation of plant biomass.

Science.gov (United States)

Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence

2015-03-01

Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Purification, characterization and decolorization of bilirubin oxidase from Myrothecium verrucaria 3.2190

Science.gov (United States)

Myrothecium verrucaria 3.2190 is a nonligninolytic fungus that produces bilirubin oxidase. Both Myrothecium verrucaria and the extracellular bilirubin oxidase were tested for their ability to decolorize indigo carmine. The biosorption and biodegradation of the dye were detected during the process of...

Blockade of TGF-β 1 Signalling Inhibits Cardiac NADPH Oxidase Overactivity in Hypertensive Rats

Directory of Open Access Journals (Sweden)

José Luis Miguel-Carrasco

2012-01-01

Full Text Available NADPH oxidases constitute a major source of superoxide anion (⋅O2 - in hypertension. Several studies suggest an important role of NADPH oxidases in different effects mediated by TGF-β 1. In this study we show that chronic administration of P144, a peptide synthesized from type III TGF-β 1 receptor, significantly reduced the cardiac NADPH oxidase expression and activity as well as in the nitrotyrosine levels observed in control spontaneously hypertensive rats (V-SHR to levels similar to control normotensive Wistar Kyoto rats. In addition, P144 was also able to reduce the significant increases in the expression of collagen type I protein and mRNA observed in hearts from V-SHR. In addition, positive correlations between collagen expression, NADPH oxidase activity, and nitrotyrosine levels were found in all animals. Finally, TGF-β 1-stimulated Rat-2 exhibited significant increases in NADPH oxidase activity that was inhibited in the presence of P144. It could be concluded that the blockade of TGF-β 1 with P144 inhibited cardiac NADPH oxidase in SHR, thus adding new data to elucidate the involvement of this enzyme in the profibrotic actions of TGF-β 1.

Herbivore-plant interactions: mixed-function oxidases and secondary plant substances.

Science.gov (United States)

Brattsten, L B; Wilkinson, C F; Eisner, T

1977-06-17

The mixed-function oxidases of a polyphagous insect larva (the southern armyworm, Spodoptera eridania) were found to be induced by a diversity of secondary plant substances. The induction proceeds rapidly and in response to a small quantity of secondary substance. Following induction, the larva is less susceptible to dietary poisoning. It is argued that mixed-function oxidases play a major role in protecting herbivores against chemical stress from secondary plant substances.

Bioprocess development for extracellular production of recombinant human interleukin-3 (hIL-3) in Pichia pastoris.

Science.gov (United States)

Dagar, Vikas Kumar; Adivitiya; Devi, Nirmala; Khasa, Yogender Pal

2016-10-01

Human interleukin-3 (hIL-3) is a therapeutically important cytokine involved in the maturation and differentiation of various cells of the immune system. The codon-optimized hIL-3 gene was cloned in fusion with the N-terminus α-mating factor signal peptide of Saccharomyces cerevisiae under an inducible alcohol oxidase 1 (AOX1) and constitutive glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter. A Zeocin concentration up to 2000 mg/L was used to select hyper-producers. The shake flask cultivation studies in the Pichia pastoris GS115 host resulted a maximum recombinant hIL-3 expression level of 145 mg/L in the extracellular medium under the control of AOX1 promoter. The batch fermentation strategy allowed us to attain a fairly pure glycosylated hIL-3 protein in the culture supernatant at a final concentration of 475 mg/L with a high volumetric productivity of 4.39 mg/L/h. The volumetric product concentration achieved at bioreactor level was 3.28 folds greater than the shake flask results. The 6x His-tagged protein was purified using Ni-NTA affinity chromatography and confirmed further by western blot analysis using anti-6x His tag antibody. The glycosylation of recombinant hIL-3 protein was confirmed in a PNGase F deglycosylation reaction where it showed a molecular weight band pattern similar to E. coli produced non-glycosylated hIL-3 protein. The structural properties of recombinant hIL-3 protein were confirmed by CD and fluorescence spectroscopy where protein showed 40 % α-helix, 12 % β-sheets with an emission maxima at 343 nm. MALDI-TOF-TOF analysis was used to establish the protein identity. The biological activity of purified protein was confirmed by the human erythroleukemia TF-1 cell proliferation assay.

Functional heterogeneity of NADPH oxidase-mediated contractions to endothelin with vascular aging.

Science.gov (United States)

Meyer, Matthias R; Barton, Matthias; Prossnitz, Eric R

2014-11-24

Aging, a physiological process and main risk factor for cardiovascular and renal diseases, is associated with endothelial cell dysfunction partly resulting from NADPH oxidase-dependent oxidative stress. Because increased formation of endothelium-derived endothelin-1 (ET-1) may contribute to vascular aging, we studied the role of NADPH oxidase function in age-dependent contractions to ET-1. Renal arteries and abdominal aortas from young and old C57BL6 mice (4 and 24 months of age) were prepared for isometric force measurements. Contractions to ET-1 (0.1-100 nmol/L) were determined in the presence and absence of the NADPH oxidase-selective inhibitor gp91ds-tat (3 μmol/L). To exclude age-dependent differential effects of NO bioactivity between vascular beds, all experiments were conducted in the presence of the NO synthase inhibitor L-NAME (300 μmol/L). In young animals, ET-1-induced contractions were 6-fold stronger in the renal artery than in the aorta (prenal artery and aorta, respectively (pAging had no effect on NADPH oxidase-dependent and -independent contractions to ET-1 in the renal artery. In contrast, contractions to ET-1 were markedly reduced in the aged aorta (5-fold, page-dependent heterogeneity of NADPH oxidase-mediated vascular contractions to ET-1, demonstrating an inherent resistance to functional changes in the renal artery but not in the aorta with aging. Thus, local activity of NADPH oxidase differentially modulates responses to ET-1 with aging in distinct vascular beds. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

A positive feedback-based gene circuit to increase the production of a membrane protein

Directory of Open Access Journals (Sweden)

Gennis Robert B

2010-05-01

Full Text Available Abstract Background Membrane proteins are an important class of proteins, playing a key role in many biological processes, and are a promising target in pharmaceutical development. However, membrane proteins are often difficult to produce in large quantities for the purpose of crystallographic or biochemical analyses. Results In this paper, we demonstrate that synthetic gene circuits designed specifically to overexpress certain genes can be applied to manipulate the expression kinetics of a model membrane protein, cytochrome bd quinol oxidase in E. coli, resulting in increased expression rates. The synthetic circuit involved is an engineered, autoinducer-independent variant of the lux operon activator LuxR from V. fischeri in an autoregulatory, positive feedback configuration. Conclusions Our proof-of-concept experiments indicate a statistically significant increase in the rate of production of the bd oxidase membrane protein. Synthetic gene networks provide a feasible solution for the problem of membrane protein production.

Evaluation of the Expression of Amine Oxidase Proteins in Breast Cancer

Directory of Open Access Journals (Sweden)

Woo Young Sun

2017-12-01

Full Text Available We aimed to evaluate the expression of amine oxidase proteins in breast cancer and their clinical implications. We performed immunohistochemical staining of amine oxidase proteins (LOX, lysyl oxidase, AOC3, amine oxidase, MAOA, monoamine oxidase A, MAOB, monoamine oxidase B. Based on their hormone receptors, such as estrogen receptor (ER and progesterone receptor (PR, human epidermal growth factor receptor 2 (HER-2, and Ki-67 immunohistochemical staining, breast cancer was divided into four molecular subtypes: luminal A, luminal B, HER-2 type, and triple-negative breast cancer (TNBC. Luminal A was observed in 380 cases (49.4%, luminal B in 224 (29.1%, HER-2 type in 68 (8.8%, and TNBC in 98 (12.7%. Stromal AOC3, MAO-A, and MAO-B expression varied according to molecular subtypes. Stromal AOC3 expression was high in luminal B and HER-2 type and MAO-A expression was high in luminal A and luminal B (p < 0.001. MAO-B expression was higher in TNBC than in other subtypes (p = 0.020. LOX positivity was associated with high histological grade (p < 0.001 and high Ki-67 labeling index (LI (p = 0.009, and stromal AOC3 positivity was associated with high histological grade (p = 0.001, high Ki-67 LI (p < 0.001, and HER-2 positivity (p = 0.002. MAO-A positivity was related to low histological grade (p < 0.001, ER positivity, PR positivity (p < 0.001, and low Ki-67 LI (p < 0.001. In univariate analysis, MAO-A positivity was related to short disease-free survival in HER-2 type (p = 0.013, AOC3 negativity was related to short disease-free survival and overall survival in ER-positive breast cancer, PR-positive breast cancer, HER-2-negative breast cancer, and lymph node metastasis. In conclusion, the expression of amine oxidase proteins varies depending on the molecular subtype of breast cancer. Stromal AOC3 expression was high in luminal B and HER-2 type, and MAO-A expression was high in luminal A and luminal B.

Better Rooting Procedure to Enhance Survival Rate of Field Grown Malaysian Eksotika Papaya Transformed with 1-Aminocyclopropane-1-Carboxylic Acid Oxidase Gene

Science.gov (United States)

Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

2013-01-01

A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets. PMID:25969786

Better rooting procedure to enhance survival rate of field grown malaysian eksotika papaya transformed with 1-aminocyclopropane-1-carboxylic Acid oxidase gene.

Science.gov (United States)

Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom

2013-01-01

A high survival rate for transformed papaya plants when transferred to the field is useful in the quest for improving the commercial quality traits. We report in this paper an improved rooting method for the production of transformed Malaysian Eksotika papaya with high survival rate when transferred to the field. Shoots were regenerated from embryogenic calli transformed with antisense and RNAi constructs of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) genes using the Agrobacterium tumefaciens-mediated transformation method. Regenerated transformed shoots, each measuring approximately 3-4 cm in height, were cultured in liquid half-strength Murashige and Skoog (MS) medium or sterile distilled water, and with either perlite or vermiculite supplementation. All the culturing processes were conducted either under sterile or nonsterile condition. The results showed that rooting under sterile condition was better. Shoots cultured in half-strength MS medium supplemented with vermiculite exhibited a 92.5% rooting efficiency while perlite showed 77.5%. The survival rate of the vermiculite-grown transformed papaya plantlets after transfer into soil, contained in polybags, was 94%, and the rate after transfer into the ground was 92%. Morpho-histological analyses revealed that the tap roots were more compact, which might have contributed to the high survival rates of the plantlets.

Targeting NADPH oxidase decreases oxidative stress in the transgenic sickle cell mouse penis.

Science.gov (United States)

Musicki, Biljana; Liu, Tongyun; Sezen, Sena F; Burnett, Arthur L

2012-08-01

Sickle cell disease (SCD) is a state of chronic vasculopathy characterized by endothelial dysfunction and increased oxidative stress, but the sources and mechanisms responsible for reactive oxygen species (ROS) production in the penis are unknown. We evaluated whether SCD activates NADPH oxidase, induces endothelial nitric oxide synthase (eNOS) uncoupling, and decreases antioxidants in the SCD mouse penis. We further tested the hypothesis that targeting NADPH oxidase decreases oxidative stress in the SCD mouse penis. SCD transgenic (sickle) mice were used as an animal model of SCD. Hemizygous (hemi) mice served as controls. Mice received an NADPH oxidase inhibitor apocynin (10 mM in drinking water) or vehicle. Penes were excised at baseline for molecular studies. Markers of oxidative stress (4-hydroxy-2-nonenal [HNE]), sources of ROS (eNOS uncoupling and NADPH oxidase subunits p67(phox) , p47(phox) , and gp91(phox) ), and enzymatic antioxidants (superoxide dismutase [SOD]1, SOD2, catalase, and glutathione peroxidase-1 [GPx1]) were measured by Western blot in penes. Sources of ROS, oxidative stress, and enzymatic antioxidants in the SCD penis. Relative to hemi mice, SCD increased (Ppenis. Apocynin treatment of sickle mice reversed (P0.05) prevented eNOS uncoupling in the penis. Apocynin treatment of hemi mice did not affect any of these parameters. NADPH oxidase and eNOS uncoupling are sources of oxidative stress in the SCD penis; decreased GPx1 further contributes to oxidative stress. Inhibition of NADPH oxidase upregulation decreases oxidative stress, implying a major role for NADPH oxidase as a ROS source and a potential target for improving vascular function in the SCD mouse penis. © 2012 International Society for Sexual Medicine.

Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

DEFF Research Database (Denmark)

Brøndsted, Lone; Atlung, Tove

1996-01-01

The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

Monoamine oxidase and agitation in psychiatric patients.

Science.gov (United States)

Nikolac Perkovic, Matea; Svob Strac, Dubravka; Nedic Erjavec, Gordana; Uzun, Suzana; Podobnik, Josip; Kozumplik, Oliver; Vlatkovic, Suzana; Pivac, Nela

2016-08-01

Subjects with schizophrenia or conduct disorder display a lifelong pattern of antisocial, aggressive and violent behavior and agitation. Monoamine oxidase (MAO) is an enzyme involved in the degradation of various monoamine neurotransmitters and neuromodulators and therefore has a role in various psychiatric and neurodegenerative disorders and pathological behaviors. Platelet MAO-B activity has been associated with psychopathy- and aggression-related personality traits, while variants of the MAOA and MAOB genes have been associated with diverse clinical phenotypes, including aggressiveness, antisocial problems and violent delinquency. The aim of the study was to evaluate the association of platelet MAO-B activity, MAOB rs1799836 polymorphism and MAOA uVNTR polymorphism with severe agitation in 363 subjects with schizophrenia and conduct disorder. The results demonstrated significant association of severe agitation and smoking, but not diagnosis or age, with platelet MAO-B activity. Higher platelet MAO-B activity was found in subjects with severe agitation compared to non-agitated subjects. Platelet MAO-B activity was not associated with MAOB rs1799836 polymorphism. These results suggested the association between increased platelet MAO-B activity and severe agitation. No significant association was found between severe agitation and MAOA uVNTR or MAOB rs1799836 polymorphism, revealing that these individual polymorphisms in MAO genes are not related to severe agitation in subjects with schizophrenia and conduct disorder. As our study included 363 homogenous Caucasian male subjects, our data showing this negative genetic association will be a useful addition to future meta-analyses. Copyright © 2016 Elsevier Inc. All rights reserved.

Characterization of wheat germin (oxalate oxidase) expressed by Pichia pastoris

International Nuclear Information System (INIS)

Pan, Heng-Yen; Whittaker, Mei M.; Bouveret, Romaric; Berna, Anne; Bernier, Francois; Whittaker, James W.

2007-01-01

High-level secretory expression of wheat (Triticum aestivum) germin/oxalate oxidase was achieved in Pichia pastoris fermentation cultures as an α-mating factor signal peptide fusion, based on the native wheat cDNA coding sequence. The oxalate oxidase activity of the recombinant enzyme is substantially increased (7-fold) by treatment with sodium periodate, followed by ascorbate reduction. Using these methods, approximately 1 g (4 x 10 4 U) of purified, activated enzyme was obtained following eight days of induction of a high density Pichia fermentation culture, demonstrating suitability for large-scale production of oxalate oxidase for biotechnological applications. Characterization of the recombinant protein shows that it is glycosylated, with N-linked glycan attached at Asn47. For potential biomedical applications, a nonglycosylated (S49A) variant was also prepared which retains essentially full enzyme activity, but exhibits altered protein-protein interactions

Characterization of ent-kaurene synthase and kaurene oxidase involved in gibberellin biosynthesis from Scoparia dulcis.

Science.gov (United States)

Yamamura, Yoshimi; Taguchi, Yukari; Ichitani, Kei; Umebara, Io; Ohshita, Ayako; Kurosaki, Fumiya; Lee, Jung-Bum

2018-03-01

Gibberellins (GAs) are ubiquitous diterpenoids in higher plants, whereas some higher plants produce unique species-specific diterpenoids. In GA biosynthesis, ent-kaurene synthase (KS) and ent-kaurene oxidase (KO) are key players which catalyze early step(s) of the cyclization and oxidation reactions. We have studied the functional characterization of gene products of a KS (SdKS) and two KOs (SdKO1 and SdKO2) involved in GA biosynthesis in Scoparia dulcis. Using an in vivo heterologous expression system of Escherichia coli, we found that SdKS catalyzed a cyclization reaction from ent-CPP to ent-kaurene and that the SdKOs oxidized ent-kaurene to ent-kaurenoic acid after modification of the N-terminal region for adaptation to the E. coli expression system. The real-time PCR results showed that the SdKS, SdKO1 and SdKO2 genes were mainly expressed in the root and lateral root systems, which are elongating tissues. Based on these results, we suggest that these three genes may be responsible for the metabolism of GAs in S. dulcis.

Multi-Copper Oxidases and Human Iron Metabolism

Science.gov (United States)

Vashchenko, Ganna; MacGillivray, Ross T. A.

2013-01-01

Multi-copper oxidases (MCOs) are a small group of enzymes that oxidize their substrate with the concomitant reduction of dioxygen to two water molecules. Generally, multi-copper oxidases are promiscuous with regards to their reducing substrates and are capable of performing various functions in different species. To date, three multi-copper oxidases have been detected in humans—ceruloplasmin, hephaestin and zyklopen. Each of these enzymes has a high specificity towards iron with the resulting ferroxidase activity being associated with ferroportin, the only known iron exporter protein in humans. Ferroportin exports iron as Fe2+, but transferrin, the major iron transporter protein of blood, can bind only Fe3+ effectively. Iron oxidation in enterocytes is mediated mainly by hephaestin thus allowing dietary iron to enter the bloodstream. Zyklopen is involved in iron efflux from placental trophoblasts during iron transfer from mother to fetus. Release of iron from the liver relies on ferroportin and the ferroxidase activity of ceruloplasmin which is found in blood in a soluble form. Ceruloplasmin, hephaestin and zyklopen show distinctive expression patterns and have unique mechanisms for regulating their expression. These features of human multi-copper ferroxidases can serve as a basis for the precise control of iron efflux in different tissues. In this manuscript, we review the biochemical and biological properties of the three human MCOs and discuss their potential roles in human iron homeostasis. PMID:23807651

Cataplexy and monoamine oxidase deficiency in Norrie disease.

Science.gov (United States)

Vossler, D G; Wyler, A R; Wilkus, R J; Gardner-Walker, G; Vlcek, B W

1996-05-01

Norrie disease (ND) is an X-linked recessive disorder causing ocular atrophy, mental retardation, deafness, and dysmorphic features. Virtually absent monoamine oxidase (MAO) type-A and -B activity has been found in some boys with chromosome deletions. We report the coexistence of cataplexy and abnormal REM sleep organization with ND. Three related boys, referred for treatment of medically refractory atonic spells and apneas, underwent extended EEG-video-polysomnographic monitoring. They demonstrated attacks of cataplexy and inappropriate periods of REM sleep during which they were unarousable. One boy also had generalized tonic-clonic seizures. Previous testing revealed that all three have complete ND gene deletions. In all subjects, platelet MAO-B activity was absent, serum serotonin levels were markedly increased, and plasma catecholamine levels were normal. Data from the canine narcolepsy syndrome model implicate abnormal catecholaminergic and cholinergic activities in the pathogenesis of cataplexy. Our findings suggest that abnormal MAO activity or an imbalance between serotonin and other neurotransmitter levels may be involved in the pathogenesis of human cataplexy.

Engineering glucose oxidase to minimize the influence of oxygen on sensor response

International Nuclear Information System (INIS)

Horaguchi, Yohei; Saito, Shoko; Kojima, Katsuhiro; Tsugawa, Wakako; Ferri, Stefano; Sode, Koji

2014-01-01

Glucose oxidase (GOx) is an important industrial enzyme and is recognized as the gold standard for monitoring blood glucose. However, due to its inherent oxidase property, the presence of oxygen affects electrochemical measurements of venous blood glucose employing artificial electron mediators. We therefore attempted to engineer Penicillium amagasakiense-derived GOx into a dehydrogenase by focusing on the amino acid residues predicted to interact with oxygen. Our rational amino acid substitution approach resulted in the construction of the Ser114Ala/Phe355Leu mutant, which has an 11-fold decrease in oxidase activity and 2.8-fold increase in dehydrogenase activity compared with wild-type GOx. As a result, the dehydrogenase/oxidase activity ratio of the engineered enzyme was 32-fold greater than that of the wild-type enzyme. The enzyme sensor constructed with Ser114Ala/Phe355Leu was considerably less affected by oxygen than the wild-type GOx-based sensor at lower glucose concentrations

Radio-isotopic determination of platelet monoamine oxidase and regulation of its activity by an indigenous drug

International Nuclear Information System (INIS)

Dubey, G.P.; Srivastava, V.K.; Agrawal, A.; Udupa, K.N.

1988-01-01

Platelet monoamine oxidase is a mitochondrial enzyme taking part in the deamination reaction of total catecholamine. Recent studies of monoamine oxidase inhibitors have gained its importance in the control of variety of psychosomatic disorders like mental depression, arterial hypertension and anxiety neurosis. 30 apparently normal individuals and 42 diagnosed cases of essential hypertension were selected for the present study. The platelet monoamine oxidase activity was measured by using 14 C-tryptamine bisuccinate. Comparatively low activity of platelet monoamine oxidase was noticed in hypertension cases than in the normal. After oral administration of an indigenous drug 'Geriforte' for three months, a significant rise in platelet monoamine oxidase activity was noticed in hypertension cases. It can be concluded that this indigenous formulation has the capacity to regulate the monoamine oxidase activity, as such, it may provide an alternative remedy in the management of psychosomatic disorders. (author). 11 refs

The substrate oxidation mechanism of pyranose 2-oxidase and other related enzymes in the glucose-methanol-choline superfamily.

Science.gov (United States)

Wongnate, Thanyaporn; Chaiyen, Pimchai

2013-07-01

Enzymes in the glucose-methanol-choline (GMC) oxidoreductase superfamily catalyze the oxidation of an alcohol moiety to the corresponding aldehyde. In this review, the current understanding of the sugar oxidation mechanism in the reaction of pyranose 2-oxidase (P2O) is highlighted and compared with that of other enzymes in the GMC family for which structural and mechanistic information is available, including glucose oxidase, choline oxidase, cholesterol oxidase, cellobiose dehydrogenase, aryl-alcohol oxidase, and pyridoxine 4-oxidase. Other enzymes in the family that have been newly discovered or for which less information is available are also discussed. A large primary kinetic isotope effect was observed for the flavin reduction when 2-d-D-glucose was used as a substrate, but no solvent kinetic isotope effect was detected for the flavin reduction step. The reaction of P2O is consistent with a hydride transfer mechanism in which there is stepwise formation of d-glucose alkoxide prior to the hydride transfer. Site-directed mutagenesis of P2O and pH-dependence studies indicated that His548 is a catalytic base that facilitates the deprotonation of C2-OH in D-glucose. This finding agrees with the current mechanistic model for aryl-alcohol oxidase, glucose oxidase, cellobiose dehydrogenase, methanol oxidase, and pyridoxine 4-oxidase, but is different from that of cholesterol oxidase and choline oxidase. Although all of the GMC enzymes share similar structural folding and use the hydride transfer mechanism for flavin reduction, they appear to have subtle differences in the fine-tuned details of how they catalyze substrate oxidation. © 2013 The Authors Journal compilation © 2013 FEBS.

Direct comparison of gluco-oligosaccharide oxidase variants and glucose oxidase: substrate range and H2O2 stability.

Science.gov (United States)

Vuong, Thu V; Foumani, Maryam; MacCormick, Benjamin; Kwan, Rachel; Master, Emma R

2016-11-21

Glucose oxidase (GO) activity is generally restricted to glucose and is susceptible to inactivation by H 2 O 2 . By comparison, the Y300A variant of gluco-oligosaccharide oxidase (GOOX) from Sarocladium strictum showed broader substrate range and higher H 2 O 2 stability. Specifically, Y300A exhibited up to 40 times higher activity on all tested sugars except glucose, compared to GO. Moreover, fusion of the Y300A variant to a family 22 carbohydrate binding module from Clostridium thermocellum (CtCBM22A) nearly doubled its catalytic efficiency on glucose, while retaining significant activity on oligosaccharides. In the presence of 200 mM of H 2 O 2 , the recombinant CtCBM22A_Y300A retained 80% of activity on glucose and 100% of activity on cellobiose, the preferred substrate for this enzyme. By contrast, a commercial glucose oxidase reported to contain ≤0.1 units catalase/ mg protein, retained 60% activity on glucose under the same conditions. GOOX variants appear to undergo a different mechanism of inactivation, as a loss of histidine instead of methionine was observed after H 2 O 2 incubation. The addition of CtCBM22A also promoted functional binding of the fusion enzyme to xylan, facilitating its simultaneous purification and immobilization using edible oat spelt xylan, which might benefit the usage of this enzyme preparation in food and baking applications.

Size-selective QD@MOF core-shell nanocomposites for the highly sensitive monitoring of oxidase activities.

Science.gov (United States)

Wang, Ke; Li, Nan; Zhang, Jing; Zhang, Zhiqi; Dang, Fuquan

2017-01-15

In this work, we proposed a novel and facile method to monitor oxidase activities based on size-selective fluorescent quantum dot (QD)@metal-organic framework (MOF) core-shell nanocomposites (CSNCPs). The CSNCPs were synthesized from ZIF-8 and CdTe QDs in aqueous solution in 40min at room temperature with stirring. The prepared CdTe@ZIF-8 CSNCPs , which have excellent water dispersibility and stability, displays distinct fluorescence responses to hole scavengers of different molecular sizes (e.g., H 2 O 2 , substrate, and oxidase) due to the aperture limitation of the ZIF-8 shell. H 2 O 2 can efficiently quench the fluorescence of CdTe@ZIF-8 CSNCPs over a linearity range of 1-100nM with a detection limit of 0.29nM, whereas large molecules such as substrate and oxidase have very little effect on its fluorescence. Therefore, the highly sensitive detection of oxidase activities was achieved by monitoring the fluorescence quenching of CdTe@ZIF-8 CSNCPs by H 2 O 2 produced in the presence of substrate and oxidase, which is proportional to the oxidase activities. The linearity ranges of the uricase and glucose oxidase activity are 0.1-50U/L and 1-100U/L, respectively, and their detection limits are 0.024U/L and 0.26U/L, respectively. Therefore, the current QD@MOF CSNCPs based sensing system is a promising, widely applicable means of monitoring oxidase activities in biochemical research. Copyright © 2016 Elsevier B.V. All rights reserved.

The antioxidant properties, cytotoxicity and monoamine oxidase ...

African Journals Online (AJOL)

ajl yemi

2011-11-28

Nov 28, 2011 ... Department of Pharmaceutical Chemistry, North-West University, Private Bag X6001, Potchefstroom 2520, ..... on the inhibition of the catabolism of serotonin, .... Structure of human monoamine oxidase B, a drug target for.

Investigation of antihemolytic, xanthine oxidase inhibition ...

African Journals Online (AJOL)

Abbreviations: SVEs: Salvia Verbenaca L. aerial part Extracts; CrE: Crud Extract; ChE: Chloroform Extract ; EAE: Ethyl Acetate Extract; AqE : Aqueous Extract ; ROS: Reactive Oxygen Spices; AAPH : 2,2, -Azobis (2-AmidinoPropane) Dihydrochloride ; DPPH: DiPhenyl- Picryl-Hydrazyl; XO: Xanthine Oxidase; Gen: Gentamicin ...

Biphenyl Modulates the Expression and Function of Respiratory Oxidases in the Polychlorinated-Biphenyls Degrader Pseudomonas pseudoalcaligenes KF707

Directory of Open Access Journals (Sweden)

Federica Sandri

2017-06-01

Full Text Available Pseudomonas pseudoalcaligenes KF707 is a soil bacterium which is known for its capacity to aerobically degrade harmful organic compounds such as polychlorinated biphenyls (PCBs using biphenyl as co-metabolite. Here we provide the first genetic and functional analysis of the KF707 respiratory terminal oxidases in cells grown with two different carbon sources: glucose and biphenyl. We identified five terminal oxidases in KF707: two c(caa3 type oxidases (Caa3 and Ccaa3, two cbb3 type oxidases (Cbb31 and Cbb32, and one bd type cyanide-insensitive quinol oxidase (CIO. While the activity and expression of both Cbb31 and Cbb32 oxidases was prevalent in glucose grown cells as compared to the other oxidases, the activity and expression of the Caa3 oxidase increased considerably only when biphenyl was used as carbon source in contrast to the Cbb32 oxidase which was repressed. Further, the respiratory activity and expression of CIO was up-regulated in a Cbb31 deletion strain as compared to W.T. whereas the CIO up-regulation was not present in Cbb32 and C(caa3 deletion mutants. These results, together, reveal that both function and expression of cbb3 and caa3 type oxidases in KF707 are modulated by biphenyl which is the co-metabolite needed for the activation of the PCBs-degradation pathway.

Steady-state kinetics of substrate binding and iron release in tomato ACC oxidase.

Science.gov (United States)

Thrower, J S; Blalock, R; Klinman, J P

2001-08-14

1-Aminocyclopropane-1-carboxylate oxidase (ACC oxidase) catalyzes the last step in the biosynthetic pathway of the plant hormone, ethylene. This unusual reaction results in the oxidative ring cleavage of 1-aminocyclopropane carboxylate (ACC) into ethylene, cyanide, and CO2 and requires ferrous ion, ascorbate, and molecular oxygen for catalysis. A new purification procedure and assay method have been developed for tomato ACC oxidase that result in greatly increased enzymatic activity. This method allowed us to determine the rate of iron release from the enzyme and the effect of the activator, CO2, on this rate. Initial velocity studies support an ordered kinetic mechanism where ACC binds first followed by O2; ascorbate can bind after O2 or possibly before ACC. This kinetic mechanism differs from one recently proposed for the ACC oxidase from avocado.

Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.

Science.gov (United States)

Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

2011-01-01

Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.

Intracellular lysyl oxidase: Effect of a specific inhibitor on nuclear mass in proliferating cells

Energy Technology Data Exchange (ETDEWEB)

Saad, Fawzy A. [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States); Torres, Marie [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Wang, Hao [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States); Graham, Lila, E-mail: lilagraham@cs.com [Laboratory for the Study of Skeletal Disorders and Rehabilitation, Department of Orthopedics, Children' s Hospital Boston, 300 Longwood Avenue EN926, Boston, MA 02115 (United States); Harvard Medical School, Boston, MA 02115 (United States)

2010-06-11

LOX, the principal enzyme involved in crosslinking of collagen, was the first of several lysyl oxidase isotypes to be characterized. Its active form was believed to be exclusively extracellular. Active LOX was later reported to be present in cell nuclei; its function there is unknown. LOX expression opposes the effect of mutationally activated Ras, which is present in about 30% of human cancers. The mechanism of LOX in countering the action of Ras is also unknown. In the present work, assessment of nuclear protein for possible effects of lysyl oxidase activity led to the discovery that proliferating cells dramatically increase their nuclear protein content when exposed to BAPN ({beta}-aminopropionitrile), a highly specific lysyl oxidase inhibitor that reportedly blocks LOX inhibition of Ras-induced oocyte maturation. In three cell types (PC12 cells, A7r5 smooth muscle cells, and NIH 3T3 fibroblasts), BAPN caused a 1.8-, 1.7-, and 2.1-fold increase in total nuclear protein per cell, respectively, affecting all major components in both nuclear matrix and chromatin fractions. Since nuclear size is correlated with proliferative status, enzyme activity restricting nuclear growth may be involved in the lysyl oxidase tumor suppressive effect. Evidence is also presented for the presence of apparent lysyl oxidase isotype(s) containing a highly conserved LOX active site sequence in the nuclei of PC12 cells, which do not manufacture extracellular lysyl oxidase substrates. Results reported here support the hypothesis that nuclear lysyl oxidase regulates nuclear growth, and thereby modulates cell proliferation.

Molecular phylogeny of the Oriental butterfly genus Arhopala (Lycaenidae, Theclinae) inferred from mitochondrial and nuclear genes

NARCIS (Netherlands)

Megens, H.J.W.C.; Nes, Van W.J.; Moorsel, van C.H.M.; Pierce, N.E.; Jong, de R.

2004-01-01

We present a phylogeny for a selection of species of the butterfly genus Arhopala Boisduval, 1832 based on molecular characters. We sequenced 1778 bases of the mitochondrial genes Cytochrome Oxidase 1 and 2 including tRNALeu, and a 393-bp fragment of the nuclear wingless gene for a total of 42

Heterologous expression of chaetomium thermophilum xylanase 11-a (ctx 11-a) gene

International Nuclear Information System (INIS)

Wajid, S.; Shahid, S.; Mukhtar, Z.; Mansoor, S.

2009-01-01

Chaetomium has a potential source of xylanase and cellulase enzymes, both of which are required in the treatment of fibre in the poultry feed. The titre of the enzymes needs to be enhanced by using recombinant DNA technology for fulfilling the requirement of the industries. Efforts are made to construct prokaryotic and eukaryotic expression cassettes that can be cloned under specific strong promoters i.e., T7 and AOX1, respectively, and the enhancer elements to get the maximum gene expression. In the present study BL21 E. coli and GS115 Pichia pastoris strains are used as model organisms to express the CtX 11-A gene in the presence of 1 mM IPTG and 100% methanol upto final concentration of 0.5. In case of BL21 expression, the maximum xylanase activity was observed after 1.5 h in the presence of 1% xylose, which was 2.302 U/ml and after 7 h in the presence of 0.5% lactose, was 1.708 U/ml. However, in Pichia pastoris the maximum production of xylanase was 2.904 and 0.006 U/ml as compared to control 0.484 and 0.06 U/ml, respectively. (author)

Increased xanthine oxidase during labour--implications for oxidative stress.

Science.gov (United States)

Many, A; Roberts, J M

1997-11-01

Xanthine dehydrogenase/oxidase (XDH/XO) produces uric acid. When in the oxidase form, this production is coupled with the generation of free radicals. Hypoxia-reperfusion enhances conversion of XDH to XO. Since the placenta is exposed to short periods of hypoxia reperfusion during labour, 17 placentae of pregnancy terminated by elective caesarean section and five placentae of pregnancies terminated by caesarean section during labour were examined for XDH/XO activity. It was found that XO activity was higher in the placentae of labouring women (P = 0.003), which suggests that labour enhances conversion of XDH to XO, facilitating free radical production.

Production of a new D-amino acid oxidase from the fungus Fusarium oxysporum.

Science.gov (United States)

Gabler, M; Fischer, L

1999-08-01

The fungus Fusarium oxysporum produced a D-amino acid oxidase (EC 1. 4.3.3) in a medium containing glucose as the carbon and energy source and ammonium sulfate as the nitrogen source. The specific D-amino acid oxidase activity was increased up to 12.5-fold with various D-amino acids or their corresponding derivatives as inducers. The best inducers were D-alanine (2.7 microkat/g of dry biomass) and D-3-aminobutyric acid (2.6 microkat/g of dry biomass). The addition of zinc ions was necessary to permit the induction of peroxisomal D-amino acid oxidase. Bioreactor cultivations were performed on a 50-liter scale, yielding a volumetric D-amino acid oxidase activity of 17 microkat liter(-1) with D-alanine as an inducer. Under oxygen limitation, the volumetric activity was increased threefold to 54 microkat liter(-1) (3,240 U liter(-1)).

Mediation of glycosylated and partially-deglycosylated glucose oxidase of Aspergillus niger by a ferrocene-derivatised detergent.

Science.gov (United States)

Fraser, D M; Zakeeruddin, S M; Grätzel, M

1992-01-30

A ferrocene-derivatised detergent, (11-ferrocenylundecyl) trimethylammonium bromide (FTMAB), when oxidised to the corresponding ferricinium ion, was found by electrochemical studies to be an effective electron acceptor for reduced glucose oxidase of Aspergillus niger (EC 1.13.4) and thus acts as a electron-transfer mediator between glucose oxidase and a working electrode held at a potential sufficiently positive to reoxidise reduced FTMAB. An increase in mediating activity was produced when FTMAB was present in concentrations above its critical micelle concentration. An 'enzyme electrode' was formed by adsorption of glucose oxidase and FTMAB surfactant on a graphite rod. The electrode functioned as an amperometric biosensor for glucose in phosphate-buffered saline solution. A mixed micelle of glucose oxidase and FTMAB, probably adsorbed on the electrode surface, appears to be advantageous for the amperometric determination of glucose. Additionally, glucose oxidase was treated with alpha-mannosidase. When this partially-deglycosylated glucose oxidase was incorporated in an enzyme electrode, a 100-fold increase in the second-order rate constant (k) for electron transfer between the enzyme and FTMAB was observed, together with increased current densities, with respect to the equivalent values for FTMAB and commercial glucose oxidase. The use of deglycosylated enzymes in biosensors is suggested.

[Eukaryotic expression of Leptospira interrogans lipL32/1-ompL1/1 fusion gene encoding genus-specific protein antigens and the immunoreactivity of expression products].

Science.gov (United States)

Yan, Jie; Zhao, Shou-feng; Mao, Ya-fei; Ruan, Ping; Luo, Yi-hui; Li, Shu-ping; Li, Li-wei

2005-01-01

To construct the eukaryotic expression system of L.interrogans lipL32/1-ompL1/1 fusion gene and to identify the immunoreactivity of expression products. PCR with linking primer was used to construct the fusion gene lipL32/1-ompL1/1. The P.pastoris eukaryotic expression system of the fusion gene, pPIC9K-lipL32/1-ompL1/1-P. pastorisGS115, was constructed after the fusion gene was cloned and sequenced. Colony with phenotype His(+)Mut(+) was isolated by using MD and MM plates and His(+) Mut(+) transformant with high resistance to G418 was screened out by using YPD plate. Using lysate of His(+) Mut(+) colony with high copies of the target gene digested with yeast lyase as the template and 5'AOX1 and 3'AOX1 as the primers, the target fusion gene in chromosome DNA of the constructed P. pastoris engineering strain was detected by PCR. Methanol in BMMY medium was used to induce the target recombinant protein rLipL32/1-rOmpL1/1 expression. rLipL32/1-rOmpL1/1 in the medium supernatant was extracted by using ammonium sulfate precipitation and Ni-NTA affinity chromatography. Output and immunoreactivity of rLipL32/1-rOmpL1/1 were measured by SDS-PAGE and Western blot methods, respectively. Amplification fragments of the obtained fusion gene lipL32/1-ompL1/1 was 1794 bp in size. The homogeneity of nucleotide and putative amino acid sequences of the fusion gene were as high as 99.94 % and 100 %, respectively, compared with the sequences of original lipL32/1 and ompL1/1 genotypes. The constructed eukaryotic expression system was able to secrete rLipL32/1-rOmpL1/1 with an output of 10 % of the total proteins in the supernatant, which located the expected position after SDS-PAGE. The rabbit anti-rLipL32/1 and anti-rOmpL1/1 sera could combine the expressed rLipL32/1-rOmpL1/1. An eukaryotic expression system with high efficiency in P.pastoris of L.interrogans lipL32/1-ompL1/1 fusion gene was successfully constructed in this study. The expressed fusion protein shows specific

Studies on the relationship between cyanide-resistant respi-ration and expression of alternative oxidase in mung bean using antibodies prepared by synthetic polypeptide

Institute of Scientific and Technical Information of China (English)

LI; Chijun; (

2001-01-01

［1］Liang, Z., Liang, H. G., The respiratory metabolism of plants, in Plant Physiology and Molecular Biology (eds. Yu, S. W., Tang, Z. C.) (in Chinese), 2nd ed., Beijing: Science Press, 1998, 344-365.［2］Lü, C. S., Liang, H. G., Induced respiration in melon fruits, Scientia Sinica, 1963, 12(4): 616.［3］Liang, H. G., Lü, C. S., A comparative study of CN-resistant respiration in different cultures of tobacco callus, Plant Physiol., 1984, 75: 876.［4］Elthon, T. E., McIntosh, L., Identification of the alternative terminal oxidase of higher plant mitochondria, Proc. Natl. Acad. Sci. USA, 1987, 84: 8399.［5］Elthon, T. E., Nickels, R. L., McIntosh, L., Monoclonal antibodies to the alternative oxidase of higher plant mitochondria, Plant Physiol., 1989, 89: 1311.［6］Liang, W. S., Liang, H. G., Progress of the alternative oxidase, Chinese Bulletin of Botany (in Chinese), 1997, 14(2): 9.［7］Liang, W. S., Liang, H. G., Induction of alternative oxidase expression by endogenous ethylene in aging potato slices, Acta Phytophysiol. Sin. (in Chinese), 1999, 25(2): 205.［8］He, J. X., Wei, Z. Q., Liang, H. G., Effects of water stress on development, and operation and gene expression of cyanide-resistant respiratory pathway in wheat, Science in China, Ser. C, 1999, 42(3): 300.［9］McIntosh, L., Molecular biology of the alternative oxidase, Plant Physiol., 1994, 105: 781.［10］ Wang, J., Zhang, L. X., Liu, Z. L. et al., A possible calcium binding site in D1 protein: A fluorescence and FTIR study of the interaction between lanthanides and a synthetic peptide, Photosynthesis Research, 1995, 44: 297.［11］ Li, X. P., Du, L. F., Liang, H. G. et al., Preparation and identification of antidodecapeptide of polypeptide D1 or photosys-tem II reaction center, Prog. Biochem. Biophys. (in Chinese), 1997, 24(3): 283.［12］ Wen, J. Q., Liang, H. G., Studies on energy status and mitochondria respiration during growth and senescence of mung bean cotyledons, Physiol

Intramolecular electron transfer in ascorbate oxidase is enhanced in the presence of oxygen

DEFF Research Database (Denmark)

Farver, O; Wherland, S; Pecht, I

1994-01-01

Intramolecular electron transfer from the type 1 copper center to the type 3 copper(II) pair is induced in the multi-copper enzyme, ascorbate oxidase, following pulse radiolytic reduction of the type 1 Cu(II) ion. In the presence of a slight excess of dioxygen over ascorbate oxidase, interaction...... between the trinuclear copper center and O2 is observed even with singly reduced ascorbate oxidase molecules. Under these conditions, the rate constant for intramolecular electron transfer from type 1 Cu(I) to type 3 Cu(II) increases 5-fold to 1100 +/- 300 s-1 (20 degrees C, pH 5.8) as compared...

Characterization of three multicopper oxidases in the filamentous fungus Podospora anserina: A new role of an ABR1-like protein in fungal development?

Science.gov (United States)

Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Herbert, Eric; Ferrari, Roselyne; Chapeland-Leclerc, Florence

2018-07-01

The Podospora anserina genome contains a large family of 15 multicopper oxidases (MCOs), including three genes encoding a FET3-like protein, an ABR1-like protein and an ascorbate oxidase (AO)-like protein. FET3, ABR1 and AO1 are involved in global laccase-like activity since deletion of the relevant genes led to a decrease of activity when laccase substrate (ABTS) was used as substrate. However, contrary to the P. anserina MCO proteins previously characterized, none of these three MCOs seemed to be involved in lignocellulose degradation and in resistance to phenolic compounds and oxidative stress. We showed that the bulk of ferroxidase activity was clearly due to ABR1, and only in minor part to FET3, although ABR1 does not contain all the residues typical of FET3 proteins. Moreover, we showed that ABR1, related to the Aspergillus fumigatus ABR1 protein, was clearly and specifically involved in pigmentation of ascospores. Surprisingly, phenotypes were more severe in mutants lacking both abr1 and ao1. Deletion of the ao1 gene led to an almost total loss of AO activity. No direct involvement of AO1 in fungal developmental process in P. anserina was evidenced, except in a abr1 Δ background. Overall, unlike other previously characterized MCOs, we thus evidence a clear involvement of ABR1 protein in fungal development. Copyright © 2018 Elsevier Inc. All rights reserved.

Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence

Energy Technology Data Exchange (ETDEWEB)

Ruvolo, M.; Disotell, T.R.; Allard, M.W. (Harvard Univ., Cambridge, MA (United States)); Brown, W.M. (Univ. of Michigan, Ann Arbor (United States)); Honeycutt, R.L. (Texas A and M Univ., College Station (United States))

1991-02-15

Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yield trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time.

Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence

International Nuclear Information System (INIS)

Ruvolo, M.; Disotell, T.R.; Allard, M.W.; Brown, W.M.; Honeycutt, R.L.

1991-01-01

Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yield trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time

Rational redesign of glucose oxidase for improved catalytic function and stability.

Directory of Open Access Journals (Sweden)

J Todd Holland

Full Text Available Glucose oxidase (GOx is an enzymatic workhorse used in the food and wine industries to combat microbial contamination, to produce wines with lowered alcohol content, as the recognition element in amperometric glucose sensors, and as an anodic catalyst in biofuel cells. It is naturally produced by several species of fungi, and genetic variants are known to differ considerably in both stability and activity. Two of the more widely studied glucose oxidases come from the species Aspergillus niger (A. niger and Penicillium amagasakiense (P. amag., which have both had their respective genes isolated and sequenced. GOx from A. niger is known to be more stable than GOx from P. amag., while GOx from P. amag. has a six-fold superior substrate affinity (K(M and nearly four-fold greater catalytic rate (k(cat. Here we sought to combine genetic elements from these two varieties to produce an enzyme displaying both superior catalytic capacity and stability. A comparison of the genes from the two organisms revealed 17 residues that differ between their active sites and cofactor binding regions. Fifteen of these residues in a parental A. niger GOx were altered to either mirror the corresponding residues in P. amag. GOx, or mutated into all possible amino acids via saturation mutagenesis. Ultimately, four mutants were identified with significantly improved catalytic activity. A single point mutation from threonine to serine at amino acid 132 (mutant T132S, numbering includes leader peptide led to a three-fold improvement in k(cat at the expense of a 3% loss of substrate affinity (increase in apparent K(M for glucose resulting in a specify constant (k(cat/K(M of 23.8 (mM(-1 · s(-1 compared to 8.39 for the parental (A. niger GOx and 170 for the P. amag. GOx. Three other mutant enzymes were also identified that had improvements in overall catalysis: V42Y, and the double mutants T132S/T56V and T132S/V42Y, with specificity constants of 31.5, 32.2, and 31.8 mM(-1 · s

Ratiometric glucose sensing based on fluorescent oxygen films and glucose oxidase

Directory of Open Access Journals (Sweden)

Fengyu Su

2017-06-01

Full Text Available A new two-layer sensor film was constructed for sensing glucose based on glucose oxidase and oxygen sensing material. The first layer of film containing the oxygen sensor and intra-reference material was polymerized, then the second layer of glucose oxidase and glutaraldehyde was formed on the oxygen sensor layer. The two-layer sensor film has a resolution up to 0.05 mM and a detection range from 0 to 5 mM to glucose. The effects of pH and temperature on the sensing performance were systematically investigated. The selective detection of glucose among other monosaccharides, such as fructose, mannose and galactose indicated that the sensing film has excellent selectivity. The prepared sensor was successfully applied for glucose sample detection of glucose concentration in artificial tears. Keywords: Glucose sensor, Glucose oxidase, Fluorescence, Oxygen film, Diabetes

Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger

Directory of Open Access Journals (Sweden)

Tamayo-Ramos Juan Antonio

2012-12-01

Full Text Available Abstract Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA and 2,2-azino-di(3-ethylbenzthiazoline sulfonic acid (ABTS, and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst.

Glucose oxidase-functionalized fluorescent gold nanoclusters as probes for glucose

International Nuclear Information System (INIS)

Xia, Xiaodong; Long, Yunfei; Wang, Jianxiu

2013-01-01

Highlights: ► A glucose oxidase/gold nanocluster conjugates formed by etching chemistry. ► Integration of the bioactivities and fluorescence properties within a single unit. ► These conjugates serve as novel fluorescent probe for glucose. -- Abstract: Creation and application of noble metal nanoclusters have received continuous attention. By integrating enzyme activity and fluorescence for potential applications, enzyme-capped metal clusters are more desirable. This work demonstrated a glucose oxidase (an enzyme for glucose)-functionalized gold cluster as probe for glucose. Under physiological conditions, such bioconjugate was successfully prepared by an etching reaction, where tetrakis (hydroxylmethyl) phosphonium-protected gold nanoparticle and thioctic acid-modified glucose oxidase were used as precursor and etchant, respectively. These bioconjugates showed unique fluorescence spectra (λ em max = 650 nm, λ ex max = 507 nm) with an acceptable quantum yield (ca. 7%). Moreover, the conjugated glucose oxidase remained active and catalyzed reaction of glucose and dissolved O 2 to produce H 2 O 2 , which quenched quantitatively the fluorescence of gold clusters and laid a foundation of glucose detection. A linear range of 2.0 × 10 −6 –140 × 10 −6 M and a detection limit of 0.7 × 10 −6 M (S/N = 3) were obtained. Also, another horseradish peroxidase/gold cluster bioconjugate was produced by such general synthesis method. Such enzyme/metal cluster bioconjugates represented a promising class of biosensors for biologically important targets in organelles or cells

Ultrafine carbon particles promote rotenone-induced dopamine neuronal loss through activating microglial NADPH oxidase

Energy Technology Data Exchange (ETDEWEB)

Wang, Yinxi; Liu, Dan; Zhang, Huifeng; Wang, Yixin [Department of Occupational and Environmental Health Sciences, School of Public Health, Peking University, 100191 (China); Wei, Ling [Beijing Center for Physical & Chemical Analysis, Beijing 100089 (China); Liu, Yutong [School of Life Science, Beijing Normal University, Beijing 100875 (China); Liao, Jieying [Department of Translational Medicine, Xiamen Institute of Rare Earth Materials, Chinese Academy of Sciences, Xiamen 361024 (China); Gao, Hui-Ming [Model Animal Research Center of Nanjing University, Nanjing 211800 (China); Zhou, Hui, E-mail: hardhui@gmail.com [Department of Occupational and Environmental Health Sciences, School of Public Health, Peking University, 100191 (China)

2017-05-01

Background: Atmospheric ultrafine particles (UFPs) and pesticide rotenone were considered as potential environmental risk factors for Parkinson's disease (PD). However, whether and how UFPs alone and in combination with rotenone affect the pathogenesis of PD remains largely unknown. Methods: Ultrafine carbon black (ufCB, a surrogate of UFPs) and rotenone were used individually or in combination to determine their roles in chronic dopaminergic (DA) loss in neuron-glia, and neuron-enriched, mix-glia cultures. Immunochemistry using antibody against tyrosine hydroxylase was performed to detect DA neuronal loss. Measurement of extracellular superoxide and intracellular reactive oxygen species (ROS) were performed to examine activation of NADPH oxidase. Genetic deletion and pharmacological inhibition of NADPH oxidase and MAC-1 receptor in microglia were employed to examine their role in DA neuronal loss triggered by ufCB and rotenone. Results: In rodent midbrain neuron-glia cultures, ufCB and rotenone alone caused neuronal death in a dose-dependent manner. In particularly, ufCB at doses of 50 and 100 μg/cm{sup 2} induced significant loss of DA neurons. More importantly, nontoxic doses of ufCB (10 μg/cm{sup 2}) and rotenone (2 nM) induced synergistic toxicity to DA neurons. Microglial activation was essential in this process. Furthermore, superoxide production from microglial NADPH oxidase was critical in ufCB/rotenone-induced neurotoxicity. Studies in mix-glia cultures showed that ufCB treatment activated microglial NADPH oxidase to induce superoxide production. Firstly, ufCB enhanced the expression of NADPH oxidase subunits (gp91{sup phox}, p47{sup phox} and p40{sup phox}); secondly, ufCB was recognized by microglial surface MAC-1 receptor and consequently promoted rotenone-induced p47{sup phox} and p67{sup phox} translocation assembling active NADPH oxidase. Conclusion: ufCB and rotenone worked in synergy to activate NADPH oxidase in microglia, leading to

Ultrafine carbon particles promote rotenone-induced dopamine neuronal loss through activating microglial NADPH oxidase

International Nuclear Information System (INIS)

Wang, Yinxi; Liu, Dan; Zhang, Huifeng; Wang, Yixin; Wei, Ling; Liu, Yutong; Liao, Jieying; Gao, Hui-Ming; Zhou, Hui

2017-01-01

Background: Atmospheric ultrafine particles (UFPs) and pesticide rotenone were considered as potential environmental risk factors for Parkinson's disease (PD). However, whether and how UFPs alone and in combination with rotenone affect the pathogenesis of PD remains largely unknown. Methods: Ultrafine carbon black (ufCB, a surrogate of UFPs) and rotenone were used individually or in combination to determine their roles in chronic dopaminergic (DA) loss in neuron-glia, and neuron-enriched, mix-glia cultures. Immunochemistry using antibody against tyrosine hydroxylase was performed to detect DA neuronal loss. Measurement of extracellular superoxide and intracellular reactive oxygen species (ROS) were performed to examine activation of NADPH oxidase. Genetic deletion and pharmacological inhibition of NADPH oxidase and MAC-1 receptor in microglia were employed to examine their role in DA neuronal loss triggered by ufCB and rotenone. Results: In rodent midbrain neuron-glia cultures, ufCB and rotenone alone caused neuronal death in a dose-dependent manner. In particularly, ufCB at doses of 50 and 100 μg/cm 2 induced significant loss of DA neurons. More importantly, nontoxic doses of ufCB (10 μg/cm 2 ) and rotenone (2 nM) induced synergistic toxicity to DA neurons. Microglial activation was essential in this process. Furthermore, superoxide production from microglial NADPH oxidase was critical in ufCB/rotenone-induced neurotoxicity. Studies in mix-glia cultures showed that ufCB treatment activated microglial NADPH oxidase to induce superoxide production. Firstly, ufCB enhanced the expression of NADPH oxidase subunits (gp91 phox , p47 phox and p40 phox ); secondly, ufCB was recognized by microglial surface MAC-1 receptor and consequently promoted rotenone-induced p47 phox and p67 phox translocation assembling active NADPH oxidase. Conclusion: ufCB and rotenone worked in synergy to activate NADPH oxidase in microglia, leading to oxidative damage to DA neurons. Our

Analysis of cellulase and polyphenol oxidase production by southern pine beetle associated fungi

Science.gov (United States)

Abduvali Valiev; Zumrut B. Ogel; Dier D. Klepzig

2009-01-01

In this study, the production of extracellular enzymes by fungi associated with southern pine beetle was investigated for the first time. Cellulase and polyphenol oxidase production were analyzed for three beetle associated fungi. Only the mutualistic symbiont Entomocorticium sp. A was found to produce cellulases and polyphenol oxidase....

Ozone affects pollen viability and NAD(P)H oxidase release from Ambrosia artemisiifolia pollen

International Nuclear Information System (INIS)

Pasqualini, Stefania; Tedeschini, Emma; Frenguelli, Giuseppe; Wopfner, Nicole; Ferreira, Fatima; D'Amato, Gennaro; Ederli, Luisa

2011-01-01

Air pollution is frequently proposed as a cause of the increased incidence of allergy in industrialised countries. We investigated the impact of ozone (O 3 ) on reactive oxygen species (ROS) and allergen content of ragweed pollen (Ambrosia artemisiifolia). Pollen was exposed to acute O 3 fumigation, with analysis of pollen viability, ROS and nitric oxide (NO) content, activity of nicotinamide adenine dinucleotide phosphate (NAD[P]H) oxidase, and expression of major allergens. There was decreased pollen viability after O 3 fumigation, which indicates damage to the pollen membrane system, although the ROS and NO contents were not changed or were only slightly induced, respectively. Ozone exposure induced a significant enhancement of the ROS-generating enzyme NAD(P)H oxidase. The expression of the allergen Amb a 1 was not affected by O 3 , determined from the mRNA levels of the major allergens. We conclude that O 3 can increase ragweed pollen allergenicity through stimulation of ROS-generating NAD(P)H oxidase. - Highlights: → O 3 reduces the viability of ragweed pollen. → ROS and allergens of ragweed pollen were not affected by O 3 exposure. → O 3 enhances the activity of the ROS-generating enzyme NAD(P)H oxidase. → O 3 increases ragweed pollen allergenicity through NAD(P)H-oxidase stimulation. - This study focuses on the effects of the atmospheric pollutant ozone on ROS content and NAD(P)H oxidase activity of ragweed pollen grains.

Ozone affects pollen viability and NAD(P)H oxidase release from Ambrosia artemisiifolia pollen

Energy Technology Data Exchange (ETDEWEB)

Pasqualini, Stefania, E-mail: spas@unipg.it [Department of Applied Biology, University of Perugia, Perugia (Italy); Tedeschini, Emma; Frenguelli, Giuseppe [Department of Applied Biology, University of Perugia, Perugia (Italy); Wopfner, Nicole; Ferreira, Fatima [Department of Molecular Biology, CD Laboratory for Allergy Diagnosis and Therapy, University of Salzburg, Salzburg (Austria); D' Amato, Gennaro [Division of Respiratory and Allergic Diseases, ' A. Cardarelli' High Speciality Hospital, Naples (Italy); Ederli, Luisa [Department of Applied Biology, University of Perugia, Perugia (Italy)

2011-10-15

Air pollution is frequently proposed as a cause of the increased incidence of allergy in industrialised countries. We investigated the impact of ozone (O{sub 3}) on reactive oxygen species (ROS) and allergen content of ragweed pollen (Ambrosia artemisiifolia). Pollen was exposed to acute O{sub 3} fumigation, with analysis of pollen viability, ROS and nitric oxide (NO) content, activity of nicotinamide adenine dinucleotide phosphate (NAD[P]H) oxidase, and expression of major allergens. There was decreased pollen viability after O{sub 3} fumigation, which indicates damage to the pollen membrane system, although the ROS and NO contents were not changed or were only slightly induced, respectively. Ozone exposure induced a significant enhancement of the ROS-generating enzyme NAD(P)H oxidase. The expression of the allergen Amb a 1 was not affected by O{sub 3}, determined from the mRNA levels of the major allergens. We conclude that O{sub 3} can increase ragweed pollen allergenicity through stimulation of ROS-generating NAD(P)H oxidase. - Highlights: > O{sub 3} reduces the viability of ragweed pollen. > ROS and allergens of ragweed pollen were not affected by O{sub 3} exposure. > O{sub 3} enhances the activity of the ROS-generating enzyme NAD(P)H oxidase. > O{sub 3} increases ragweed pollen allergenicity through NAD(P)H-oxidase stimulation. - This study focuses on the effects of the atmospheric pollutant ozone on ROS content and NAD(P)H oxidase activity of ragweed pollen grains.

Functional Assembly of Soluble and Membrane Recombinant Proteins of Mammalian NADPH Oxidase Complex.

Science.gov (United States)

Souabni, Hajer; Ezzine, Aymen; Bizouarn, Tania; Baciou, Laura

2017-01-01

Activation of phagocyte cells from an innate immune system is associated with a massive consumption of molecular oxygen to generate highly reactive oxygen species (ROS) as microbial weapons. This is achieved by a multiprotein complex, the so-called NADPH oxidase. The activity of phagocyte NADPH oxidase relies on an assembly of more than five proteins, among them the membrane heterodimer named flavocytochrome b 558 (Cytb 558 ), constituted by the tight association of the gp91 phox (also named Nox2) and p22 phox proteins. The Cytb 558 is the membrane catalytic core of the NADPH oxidase complex, through which the reducing equivalent provided by NADPH is transferred via the associated prosthetic groups (one flavin and two hemes) to reduce dioxygen into superoxide anion. The other major proteins (p47 phox , p67 phox , p40 phox , Rac) requisite for the complex activity are cytosolic proteins. Thus, the NADPH oxidase functioning relies on a synergic multi-partner assembly that in vivo can be hardly studied at the molecular level due to the cell complexity. Thus, a cell-free assay method has been developed to study the NADPH oxidase activity that allows measuring and eventually quantifying the ROS generation based on optical techniques following reduction of cytochrome c. This setup is a valuable tool for the identification of protein interactions, of crucial components and additives for a functional enzyme. Recently, this method was improved by the engineering and the production of a complete recombinant NADPH oxidase complex using the combination of purified proteins expressed in bacterial and yeast host cells. The reconstitution into artificial membrane leads to a fully controllable system that permits fine functional studies.

Xanthine oxidase activity and free radical generation in patients with sepsis syndrome

DEFF Research Database (Denmark)

Galley, H F; Davies, Michael Jonathan; Webster, N R

1996-01-01

OBJECTIVE: To determine xanthine oxidase activity, free radical concentrations, and lipid peroxidation in patients with sepsis syndrome compared with noninfected critically ill patients. DESIGN: A prospective observational study. SETTING: A nine-bed intensive care unit in a university teaching......). CONCLUSIONS: Patients with sepsis have xanthine oxidase activation, high free-radical concentrations, and evidence of free radical damage. The finding that xanthine oxidase activity was lower in those patients who died, coupled with increased lactate concentrations implies more severe ischemia with incomplete...... to the Acute Physiology and Chronic Health Evaluation (APACHE) II score or to the presence of organ dysfunction. The mean ascorbyl radical concentration (arbitrary units) determined by electron paramagnetic resonance following spin trapping was increased in patients compared with healthy subjects (p

Characterisation of genes induced during memory formation in the chick

International Nuclear Information System (INIS)

Bailey, K.A.; Luermans, J.; Gibbs, M.

2002-01-01

Full text: Memory formation can be divided into short-term and long-term. Short-term memory involves electro-chemical activity in the neurons whereas long-term memory requires a permanent change that includes protein synthesis. One of the problems involved with identifying late memory related genes is determining an optimal system in which to study gene expression. We have used a discriminated passive avoidance task in chicks to identify genes that are differentially regulated during memory formation. A mRNA subtraction method was previously used to specifically identify several genes that are expressed in the chick intermediate medial hyperstriatum ventrale (IMHV) within two hours of training. Eight bands ranging in size from 400bp to 1100bp were obtained in the initially screen. We are currently cloning these PCR products into suitable vectors for further analysis. Two of these clones have been sequenced and analysed using both the blastn and blastx programs in ANGIS. The first clone was found to correspond to cytochrome c oxidase subunit 2. Cytochrome C oxidase (COX) is a transmembrane protein localized in the inner mitochondrial membrane and forms part of the mitochondrial respiratory chain complex. The second clone codes for the ferritin heavy chain. Ferritin is a ubiquitous protein that is involved in iron homeostasis. At present it is unclear what role these two proteins play in memory formation but further studies are being undertaken to determine the expression profiles of these genes following memory induction. Copyright (2002) Australian Neuroscience Society

Bienzymatic Biosensor for Rapid Detection of Aspartame by Flow Injection Analysis

Directory of Open Access Journals (Sweden)

Maria-Cristina Radulescu

2014-01-01

Full Text Available A rapid, simple and stable biosensor for aspartame detection was developed. Alcohol oxidase (AOX, carboxyl esterase (CaE and bovine serum albumin (BSA were immobilised with glutaraldehyde (GA onto screen-printed electrodes modified with cobalt-phthalocyanine (CoPC. The biosensor response was fast. The sample throughput using a flow injection analysis (FIA system was 40 h−1 with an RSD of 2.7%. The detection limits for both batch and FIA measurements were 0.1 µM for methanol and 0.2 µM for aspartame, respectively. The enzymatic biosensor was successfully applied for aspartame determination in different sample matrices/commercial products (liquid and solid samples without any pre-treatment step prior to measurement.

Bienzymatic biosensor for rapid detection of aspartame by flow injection analysis.

Science.gov (United States)

Radulescu, Maria-Cristina; Bucur, Bogdan; Bucur, Madalina-Petruta; Radu, Gabriel Lucian

2014-01-09

A rapid, simple and stable biosensor for aspartame detection was developed. Alcohol oxidase (AOX), carboxyl esterase (CaE) and bovine serum albumin (BSA) were immobilised with glutaraldehyde (GA) onto screen-printed electrodes modified with cobalt-phthalocyanine (CoPC). The biosensor response was fast. The sample throughput using a flow injection analysis (FIA) system was 40 h⁻¹ with an RSD of 2.7%. The detection limits for both batch and FIA measurements were 0.1 µM for methanol and 0.2 µM for aspartame, respectively. The enzymatic biosensor was successfully applied for aspartame determination in different sample matrices/commercial products (liquid and solid samples) without any pre-treatment step prior to measurement.

Prevalence and genotypic characterization of bovine Echinococcus granulosus isolates by using cytochrome oxidase 1 (Co1) gene in Hyderabad, Pakistan.

Science.gov (United States)

Ehsan, Muhammad; Akhter, Nasreen; Bhutto, Bachal; Arijo, Abdullah; Ali Gadahi, Javaid

2017-05-30

Cystic echinococcosis is an important zoonotic disease; it has serious impacts on animals as well as human health throughout the world. Genotypic characterization of Echinocossus granulosus (E. granulosus) in buffaloes has not been addressed in Pakistan. Therefore, the present study was conducted to evaluate the incidence and genotypic characterization of bovine E. granulosus. Out of 832 buffaloes examined, 112 (13.46%) were found infected. The favorable site for hydatid cyst development was liver (8.65%) followed by lungs (4.80%). The rate of cystic echinococcosis was found higher in females 14.43% than males 9.77%. The females above seven years aged were more infected as compared to the young ones. The partial sequence of mitochondrial cytochrome oxidase 1 (CO1) gene was used for identification and molecular analysis of buffalo's E. granulosus isolates. The alignment of redundant sequences were compared with already identified 10 genotypes available at National Centre for Biotechnology Information (NCBI) GenBank. The sequencing and phylogenetic analysis of all randomly selected buffalo isolates were belong to the G1- G3 complex (E. granulosus sensu stricto). All sequences were diverse from the reference sequence. No one showed complete identity to the buffalo strain (G3), representing substantial microsequence variability in G1, G2 and G3 genotypes. We evaluated the echinococcal infectivity and first time identification of genotypes in buffaloes in Sindh, Pakistan. This study will lead to determine accurate source of this zoonotic disease to humans in Pakistan. Copyright © 2017 Elsevier B.V. All rights reserved.

ATL9, a RING zinc finger protein with E3 ubiquitin ligase activity implicated in chitin- and NADPH oxidase-mediated defense responses.

Directory of Open Access Journals (Sweden)

Marta Berrocal-Lobo

2010-12-01

Full Text Available Pathogen associated molecular patterns (PAMPs are signals detected by plants that activate basal defenses. One of these PAMPs is chitin, a carbohydrate present in the cell walls of fungi and in insect exoskeletons. Previous work has shown that chitin treatment of Arabidopsis thaliana induced defense-related genes in the absence of a pathogen and that the response was independent of the salicylic acid (SA, jasmonic acid (JA and ethylene (ET signaling pathways. One of these genes is ATL9 ( = ATL2G, which encodes a RING zinc-finger like protein. In the current work we demonstrate that ATL9 has E3 ubiquitin ligase activity and is localized to the endoplasmic reticulum. The expression pattern of ATL9 is positively correlated with basal defense responses against Golovinomyces cichoracearum, a biotrophic fungal pathogen. The basal levels of expression and the induction of ATL9 by chitin, in wild type plants, depends on the activity of NADPH oxidases suggesting that chitin-mediated defense response is NADPH oxidase dependent. Although ATL9 expression is not induced by treatment with known defense hormones (SA, JA or ET, full expression in response to chitin is compromised slightly in mutants where ET- or SA-dependent signaling is suppressed. Microarray analysis of the atl9 mutant revealed candidate genes that appear to act downstream of ATL9 in chitin-mediated defenses. These results hint at the complexity of chitin-mediated signaling and the potential interplay between elicitor-mediated signaling, signaling via known defense pathways and the oxidative burst.

Monoamine Oxidase A in Antisocial Personality Disorder and Borderline Personality Disorder.

Science.gov (United States)

Kolla, Nathan J; Vinette, Sarah A

2017-01-01

Variation in the monoamine oxidase A (MAO-A) gene and MAO-A enzyme levels have been linked to antisocial behavior and aggression in clinical and non-clinical populations. Here, we provide an overview of the genetic, epigenetic, and neuroimaging research that has examined MAO-A structure and function in antisocial personality disorder (ASPD) and borderline personality disorder (BPD). The low-activity MAO-A variable nucleotide tandem repeat genetic polymorphism has shown a robust association with large samples of violent and seriously violent offenders, many of whom had ASPD. A recent positron emission tomography (PET) study of ASPD similarly revealed low MAO-A density in brain regions thought to contribute to the psychopathology of the condition. By contrast, PET has also demonstrated that brain MAO-A levels are increased in BPD and that they relate to symptoms of low mood and suicidality. Candidate gene studies have produced the most compelling evidence connecting MAO-A genetic variants to both ASPD and BPD. Still, conflicting results abound in the literature, making it highly unlikely that ASPD or BPD is related to a specific MAO-A genetic variant. Future research should strive to examine how MAO-A genotypes interact with broad-spectrum environmental influences to produce brain endophenotypes that may ultimately become tractable targets for novel treatment strategies.

A decade of crystallization drops: crystallization of the cbb3 cytochrome c oxidase from Pseudomonas stutzeri.

Science.gov (United States)

Buschmann, Sabine; Richers, Sebastian; Ermler, Ulrich; Michel, Hartmut

2014-04-01

The cbb3 cytochrome c oxidases are distant members of the superfamily of heme copper oxidases. These terminal oxidases couple O2 reduction with proton transport across the plasma membrane and, as a part of the respiratory chain, contribute to the generation of an electrochemical proton gradient. Compared with other structurally characterized members of the heme copper oxidases, the recently determined cbb3 oxidase structure at 3.2 Å resolution revealed significant differences in the electron supply system, the proton conducting pathways and the coupling of O2 reduction to proton translocation. In this paper, we present a detailed report on the key steps for structure determination. Improvement of the protein quality was achieved by optimization of the number of lipids attached to the protein as well as the separation of two cbb3 oxidase isoenzymes. The exchange of n-dodecyl-β-D-maltoside for a precisely defined mixture of two α-maltosides and decanoylsucrose as well as the choice of the crystallization method had a most profound impact on crystal quality. This report highlights problems frequently encountered in membrane protein crystallization and offers meaningful approaches to improve crystal quality. © 2014 The Protein Society.

Age-related ultrastructural and monoamine oxidase changes in the rat optic nerve.

Science.gov (United States)

Taurone, S; Ripandelli, G; Minni, A; Lattanzi, R; Miglietta, S; Pepe, N; Fumagalli, L; Micera, A; Pastore, F S; Artico, M

2016-01-01

The aim of this paper is to study the morphology and the distribution of the monoamine oxidase enzymatic system in the optic nerve of 4 month-old Wistar (young) and 28 month-old Wistar (old) rats. The optic nerve was harvested from 20 young and old rats. The segment of optic nerve was divided longitudinally into two pieces, each 0.1 mm in length. The first piece was used for transmission electron microscopy. The second piece was stained with histochemical reaction for monoamine oxidase. The agerelated changes in the optic nerve of rats include micro-anatomical details, ultrastructure and monoamine oxidase histochemical staining. A strong decrease of the thin nerve fibers and a swelling of the thick ones can be observed in optic nerve fibers of old rats. Increased monoamine oxidase histochemical staining of the optic nerve of aged rats is well demonstrated. The increase of meningeal shealth and the decrease of thin nerve fibers of the optic nerve in old rats are well documented. Morphological, ultrastructural and histochemical changes observed in optic nerve fibers of the old rats show a close relation with aging.

The antioxidant properties, cytotoxicity and monoamine oxidase ...

African Journals Online (AJOL)

Tarchonanthus camphoratus (camphor bush) has been widely used for numerous medicinal purposes. The aim of the present study was to evaluate the antioxidant properties, cytotoxicity and monoamine oxidase inhibition activities of the crude dichloromethane leaf extract of T. camphoratus. The antioxidant activities were ...

The Association between Infants' Self-Regulatory Behavior and MAOA Gene Polymorphism

Science.gov (United States)

Zhang, Minghao; Chen, Xinyin; Way, Niobe; Yoshikawa, Hirokazu; Deng, Huihua; Ke, Xiaoyan; Yu, Weiwei; Chen, Ping; He, Chuan; Chi, Xia; Lu, Zuhong

2011-01-01

Self-regulatory behavior in early childhood is an important characteristic that has considerable implications for the development of adaptive and maladaptive functioning. The present study investigated the relations between a functional polymorphism in the upstream region of monoamine oxidase A gene (MAOA) and self-regulatory behavior in a sample…

Heterologous Expression of Phanerochaete chrysoporium Glyoxal Oxidase and its Application for the Coupled Reaction with Manganese Peroxidase to Decolorize Malachite Green

Science.gov (United States)

Son, Yu-Lim; Kim, Hyoun-Young; Thiyagarajan, Saravanakumar; Xu, Jing Jing

2012-01-01

cDNA of the glx1 gene encoding glyoxal oxidase (GLX) from Phanerochaete chrysosporium was isolated and expressed in Pichia pastoris. The recombinant GLX (rGLX) produces H2O2 over 7.0 nmol/min/mL using methyl glyoxal as a substrate. Use of rGLX as a generator of H2O2 improved the coupled reaction with recombinant manganese peroxidase resulting in decolorization of malachite green up to 150 µM within 90 min. PMID:23323052

Glycosylation site-targeted PEGylation of glucose oxidase retains native enzymatic activity.

Science.gov (United States)

Ritter, Dustin W; Roberts, Jason R; McShane, Michael J

2013-04-10

Targeted PEGylation of glucose oxidase at its glycosylation sites was investigated to determine the effect on enzymatic activity, as well as the bioconjugate's potential in an optical biosensing assay. Methoxy-poly(ethylene glycol)-hydrazide (4.5kDa) was covalently coupled to periodate-oxidized glycosylation sites of glucose oxidase from Aspergillus niger. The bioconjugate was characterized using gel electrophoresis, liquid chromatography, mass spectrometry, and dynamic light scattering. Gel electrophoresis data showed that the PEGylation protocol resulted in a drastic increase (ca. 100kDa) in the apparent molecular mass of the protein subunit, with complete conversion to the bioconjugate; liquid chromatography data corroborated this large increase in molecular size. Mass spectrometry data proved that the extent of PEGylation was six poly(ethylene glycol) chains per glucose oxidase dimer. Dynamic light scattering data indicated the absence of higher-order oligomers in the PEGylated GOx sample. To assess stability, enzymatic activity assays were performed in triplicate at multiple time points over the course of 29 days in the absence of glucose, as well as before and after exposure to 5% w/v glucose for 24h. At a confidence level of 95%, the bioconjugate's performance was statistically equivalent to native glucose oxidase in terms of activity retention over the 29 day time period, as well as following the 24h glucose exposure. Finally, the bioconjugate was entrapped within a poly(2-hydroxyethyl methacrylate) hydrogel containing an oxygen-sensitive phosphor, and the construct was shown to respond approximately linearly with a 220±73% signal change (n=4, 95% confidence interval) over the physiologically-relevant glucose range (i.e., 0-400mg/dL); to our knowledge, this represents the first demonstration of PEGylated glucose oxidase incorporated into an optical biosensing assay. Copyright © 2013 Elsevier Inc. All rights reserved.

Development of ent-kaurene Oxidase-Based Conserved Intron Spanning Primers for Species Identification in the Genus Poa (Poaceae; Bluegrass

Directory of Open Access Journals (Sweden)

Jonathan M. LaMantia

2018-04-01

Full Text Available Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning primers (CISP can be used as a DNA marker to exploit variations of intron lengths that flank conserved gene sequences. In the present study, we developed CISP to sequence partial genomic fragments of the KO gene from seven Poa species. Through sequence analysis, species-specific primers were also developed to produce co-dominant markers that can be used to identify interspecific hybrids between Texas bluegrass and six other Poa species used in the present study.

Cyanobacterial lactate oxidases serve as essential partners in N2-fixation and evolved into photorespiratory glycolate oxidases in plants.

NARCIS (Netherlands)

Hackenberg, C.; Kern, R.; Hüge, J; Stal, L.J.; Tsuji, Y.; Kopka, J.; Shiraiwa, Y.; Bauwe, H.; Hagemann, M.

2011-01-01

Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to

Cyanobacterial lactate oxidases serve as essential partners of N2-fixation and evolved to photorespiratory glycolate oxidases in plants

NARCIS (Netherlands)

Hackenberg, C.; Kern, R.; Hüge, J.; Stal, L.J.; Tsuji, Y.; Kopka, J.; Shiraiwa, Y.; Bauwe, H.; Hagemann, M.

2011-01-01

Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to

Resveratrol protects vascular endothelial cells from high glucose-induced apoptosis through inhibition of NADPH oxidase activation-driven oxidative stress.

Science.gov (United States)

Chen, Feng; Qian, Li-Hua; Deng, Bo; Liu, Zhi-Min; Zhao, Ying; Le, Ying-Ying

2013-09-01

Hyperglycemia-induced oxidative stress has been implicated in diabetic vascular complications in which NADPH oxidase is a major source of reactive oxygen species (ROS) generation. Resveratrol is a naturally occurring polyphenol, which has vasoprotective effects in diabetic animal models and inhibits high glucose (HG)-induced oxidative stress in endothelial cells. We aimed to examine whether HG-induced NADPH oxidase activation and ROS production contribute to glucotoxicity to endothelial cells and the effect of resveratrol on glucotoxicity. Using a murine brain microvascular endothelial cell line bEnd3, we found that NADPH oxidase inhibitor (apocynin) and resveratrol both inhibited HG-induced endothelial cell apoptosis. HG-induced elevation of NADPH oxidase activity and production of ROS were inhibited by apocynin, suggesting that HG induces endothelial cell apoptosis through NADPH oxidase-mediated ROS production. Mechanistic studies revealed that HG upregulated NADPH oxidase subunit Nox1 but not Nox2, Nox4, and p22(phox) expression through NF-κB activation, which resulted in elevation of NADPH oxidase activity and consequent ROS production. Resveratrol prevented HG-induced endothelial cell apoptosis through inhibiting HG-induced NF-κB activation, NADPH oxidase activity elevation, and ROS production. HG induces endothelial cell apoptosis through NF-κB/NADPH oxidase/ROS pathway, which was inhibited by resveratrol. Our findings provide new potential therapeutic targets against brain vascular complications of diabetes. © 2013 John Wiley & Sons Ltd.

Oxoferryl-Porphyrin Radical Catalytic Intermediate in Cytochrome bd Oxidases Protects Cells from Formation of Reactive Oxygen Species*

Science.gov (United States)

Paulus, Angela; Rossius, Sebastiaan Gijsbertus Hendrik; Dijk, Madelon; de Vries, Simon

2012-01-01

The quinol-linked cytochrome bd oxidases are terminal oxidases in respiration. These oxidases harbor a low spin heme b558 that donates electrons to a binuclear heme b595/heme d center. The reaction with O2 and subsequent catalytic steps of the Escherichia coli cytochrome bd-I oxidase were investigated by means of ultra-fast freeze-quench trapping followed by EPR and UV-visible spectroscopy. After the initial binding of O2, the O–O bond is heterolytically cleaved to yield a kinetically competent heme d oxoferryl porphyrin π-cation radical intermediate (compound I) magnetically interacting with heme b595. Compound I accumulates to 0.75–0.85 per enzyme in agreement with its much higher rate of formation (∼20,000 s−1) compared with its rate of decay (∼1,900 s−1). Compound I is next converted to a short lived heme d oxoferryl intermediate (compound II) in a phase kinetically matched to the oxidation of heme b558 before completion of the reaction. The results indicate that cytochrome bd oxidases like the heme-copper oxidases break the O–O bond in a single four-electron transfer without a peroxide intermediate. However, in cytochrome bd oxidases, the fourth electron is donated by the porphyrin moiety rather than by a nearby amino acid. The production of reactive oxygen species by the cytochrome bd oxidase was below the detection level of 1 per 1000 turnovers. We propose that the two classes of terminal oxidases have mechanistically converged to enzymes in which the O–O bond is broken in a single four-electron transfer reaction to safeguard the cell from the formation of reactive oxygen species. PMID:22287551

Peroxidasin-mediated crosslinking of collagen IV is independent of NADPH oxidases

Directory of Open Access Journals (Sweden)

Gábor Sirokmány

2018-06-01

Full Text Available Collagen IV is a major component of the basement membrane in epithelial tissues. The NC1 domains of collagen IV protomers are covalently linked together through sulfilimine bonds, the formation of which is catalyzed by peroxidasin. Although hydrogen peroxide is essential for this reaction, the exact source of the oxidant remains elusive. Members of the NOX/DUOX NADPH oxidase family are specifically devoted to the production of superoxide and hydrogen peroxide. Our aim in this study was to find out if NADPH oxidases contribute in vivo to the formation of collagen IV sulfilimine crosslinks. We used multiple genetically modified in vivo model systems to provide a detailed assessment of this question. Our data indicate that in various peroxidasin-expressing tissues sulfilimine crosslinks between the NC1 domains of collagen IV can be readily detected in the absence of functioning NADPH oxidases. We also analyzed how subatmospheric oxygen levels influence the collagen IV network in collagen-producing cultured cells with rapid matrix turnover. We showed that collagen IV crosslinks remain intact even under strongly hypoxic conditions. Our hypothesis is that during collagen IV network formation PXDN cooperates with a NOX/DUOX-independent H2O2 source that is functional also at very low ambient oxygen levels. Keywords: Peroxidasin, NADPH oxidase, Hydrogen peroxide, Collagen IV, Sulfilimine

Genetic structure of the snakehead murrel, Channa striata (channidae based on the cytochrome c oxidase subunit I gene: influence of historical and geomorphological factors

Directory of Open Access Journals (Sweden)

Jamsari Amirul Firdaus Jamaluddin

2011-01-01

Full Text Available Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F ST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.

A Biocatalytic One-Pot Approach for the Preparation of Lignin Oligomers Using an Oxidase/Peroxidase Cascade Enzyme System

NARCIS (Netherlands)

Habib, Mohamed H. M.; Deuss, Peter J.; Loncar, Nikola; Trajkovic, Milos; Fraaije, Marco W.

2017-01-01

Synthetic lignin was prepared biocatalytically in a one-pot, two-step reaction using an oxidase/peroxidase cascade enzyme system. Using eugenol in combination with eugenol oxidase and a peroxidase, lignin-like material was produced. The cascade reaction takes advantage of the ability of the oxidase

Plasma diamine oxidase activity in asthmatic children

Directory of Open Access Journals (Sweden)

Kyoichiro Toyoshima

1996-01-01

Full Text Available Histamine plays an important role in the development of asthmatic symptoms. Diamine oxidase (DAO histaminase, which inactivates histamine, is located in the intestine and kidney and is released into plasma. Plasma DAO activity in asthmatic children was measured by a recently developed high performance liquid chromatographic method using histamine as the DAO substrate. Diamine oxidase activity was higher in severely asthmatic children than in those with mild asthma. A time course study during the acute exacerbation phase revealed that DAO activity rose during acute asthmatic attacks and then decreased gradually over several days. Although the mechanisms of plasma DAO activity increase during acute asthmatic attacks could not be explained, data showed that plasma DAO activity is an important index of histamine metabolism in asthmatics and may relate to some mechanisms of acute exacerbation of airway inflammation. Consequently, fluctuations in plasma DAO can be used as one of various indices of instability in management of asthma.

Glucose oxidase-functionalized fluorescent gold nanoclusters as probes for glucose

Energy Technology Data Exchange (ETDEWEB)

Xia, Xiaodong [College of Chemistry and Chemical Engineering, Central South University, Changsha 410083 (China); School of Chemistry and Chemical Engineering, Hunan University of Science and Technology, Xiangtan 411201 (China); Long, Yunfei, E-mail: l_yunfei927@163.com [School of Chemistry and Chemical Engineering, Hunan University of Science and Technology, Xiangtan 411201 (China); Wang, Jianxiu, E-mail: jxiuwang@csu.edu.cn [College of Chemistry and Chemical Engineering, Central South University, Changsha 410083 (China)

2013-04-15

Highlights: ► A glucose oxidase/gold nanocluster conjugates formed by etching chemistry. ► Integration of the bioactivities and fluorescence properties within a single unit. ► These conjugates serve as novel fluorescent probe for glucose. -- Abstract: Creation and application of noble metal nanoclusters have received continuous attention. By integrating enzyme activity and fluorescence for potential applications, enzyme-capped metal clusters are more desirable. This work demonstrated a glucose oxidase (an enzyme for glucose)-functionalized gold cluster as probe for glucose. Under physiological conditions, such bioconjugate was successfully prepared by an etching reaction, where tetrakis (hydroxylmethyl) phosphonium-protected gold nanoparticle and thioctic acid-modified glucose oxidase were used as precursor and etchant, respectively. These bioconjugates showed unique fluorescence spectra (λ{sub em} {sub max} = 650 nm, λ{sub ex} {sub max} = 507 nm) with an acceptable quantum yield (ca. 7%). Moreover, the conjugated glucose oxidase remained active and catalyzed reaction of glucose and dissolved O{sub 2} to produce H{sub 2}O{sub 2}, which quenched quantitatively the fluorescence of gold clusters and laid a foundation of glucose detection. A linear range of 2.0 × 10{sup −6}–140 × 10{sup −6} M and a detection limit of 0.7 × 10{sup −6} M (S/N = 3) were obtained. Also, another horseradish peroxidase/gold cluster bioconjugate was produced by such general synthesis method. Such enzyme/metal cluster bioconjugates represented a promising class of biosensors for biologically important targets in organelles or cells.

Significance of membrane bioreactor design on the biocatalytic performance of glucose oxidase and catalase: Free vs. immobilized enzyme systems

DEFF Research Database (Denmark)

Morthensen, Sofie Thage; Meyer, Anne S.; Jørgensen, Henning

2017-01-01

Membrane separation of xylose and glucose can be accomplished via oxidation of glucose to gluconic acid by enzymatic glucose oxidase catalysis. Oxygen for this reaction can be supplied via decomposition of hydrogen peroxide by enzymatic catalase catalysis. In order to maximize the biocatalytic...... productivity of glucose oxidase and catalase (gluconic acid yield per total amount of enzyme) the following system set-ups were compared: immobilization of glucose oxidase alone; co-immobilization of glucose oxidase and catalase; glucose oxidase and catalase free in the membrane bioreactor. Fouling......-induced enzyme immobilization in the porous support of an ultrafiltration membrane was used as strategy for entrapment of glucose oxidase and catalase. The biocatalytic productivity of the membrane reactor was found to be highly related to the oxygen availability, which in turn depended on the reactor...

Conformational lock and dissociative thermal inactivation of lentil seedling amine oxidase.

Science.gov (United States)

Moosavi-Nejad, S Zahra; Moosavi-Movahedi, Ali-Akbar; Rezaei-Tavirani, Mostafa; Floris, Giovanni; Medda, Rosaria

2003-03-31

The kinetics of thermal inactivation of copper-containing amine oxidase from lentil seedlings were studied in a 100 mM potassium phosphate buffer, pH 7, using putrescine as the substrate. The temperature range was between 47-60 degrees C. The thermal inactivation curves were not linear at 52 and 57 degrees C; three linear phases were shown. The first phase gave some information about the number of dimeric forms of the enzyme that were induced by the higher temperatures using the "conformational lock" pertaining theory to oligomeric enzyme. The "conformational lock" caused two additional dimeric forms of the enzyme when the temperature increased to 57 degrees C. The second and third phases were interpreted according to a dissociative thermal inactivation model. These phases showed that lentil amine oxidase was reversibly-dissociated before the irreversible thermal inactivation. Although lentil amine oxidase is not a thermostable enzyme, its dimeric structure can form "conformational lock," conferring a structural tolerance to the enzyme against heat stress.

The glucose oxidase-peroxidase assay for glucose

Science.gov (United States)

The glucose oxidase-peroxidase assay for glucose has served as a very specific, sensitive, and repeatable assay for detection of glucose in biological samples. It has been used successfully for analysis of glucose in samples from blood and urine, to analysis of glucose released from starch or glycog...

Khz-cp (crude polysaccharide extract obtained from the fusion of Ganoderma lucidum and Polyporus umbellatus mycelia) induces apoptosis by increasing intracellular calcium levels and activating P38 and NADPH oxidase-dependent generation of reactive oxygen species in SNU-1 cells.

Science.gov (United States)

Kim, Tae Hwan; Kim, Ju Sung; Kim, Zoo Haye; Huang, Ren Bin; Chae, Young Lye; Wang, Ren Sheng

2014-07-10

Khz-cp is a crude polysaccharide extract that is obtained after nuclear fusion in Ganoderma lucidum and Polyporus umbellatus mycelia (Khz). It inhibits the growth of cancer cells. Khz-cp was extracted by solvent extraction. The anti-proliferative activity of Khz-cp was confirmed by using Annexin-V/PI-flow cytometry analysis. Intracellular calcium increase and measurement of intracellular reactive oxygen species (ROS) were performed by using flow cytometry and inverted microscope. SNU-1 cells were treated with p38, Bcl-2 and Nox family siRNA. siRNA transfected cells was employed to investigate the expression of apoptotic, growth and survival genes in SNU-1 cells. Western blot analysis was performed to confirm the expression of the genes. In the present study, Khz-cp induced apoptosis preferentially in transformed cells and had only minimal effects on non-transformed cells. Furthermore, Khz-cp was found to induce apoptosis by increasing the intracellular Ca2+ concentration ([Ca2+]i) and activating P38 to generate reactive oxygen species (ROS) via NADPH oxidase and the mitochondria. Khz-cp-induced apoptosis was caspase dependent and occurred via a mitochondrial pathway. ROS generation by NADPH oxidase was critical for Khz-cp-induced apoptosis, and although mitochondrial ROS production was also required, it appeared to occur secondary to ROS generation by NADPH oxidase. Activation of NADPH oxidase was shown by the translocation of the regulatory subunits p47phox and p67phox to the cell membrane and was necessary for ROS generation by Khz-cp. Khz-cp triggered a rapid and sustained increase in [Ca2+]i that activated P38. P38 was considered to play a key role in the activation of NADPH oxidase because inhibition of its expression or activity abrogated membrane translocation of the p47phox and p67phox subunits and ROS generation. In summary, these data indicate that Khz-cp preferentially induces apoptosis in cancer cells and that the signaling mechanisms involve an

Interrupted reperfusion reduces the activation of NADPH oxidase after cerebral I/R injury.

Science.gov (United States)

Shen, Jia; Bai, Xiao-Yin; Qin, Yuan; Jin, Wei-Wei; Zhou, Jing-Yin; Zhou, Ji-Ping; Yan, Ying-Gang; Wang, Qiong; Bruce, Iain C; Chen, Jiang-Hua; Xia, Qiang

2011-06-15

Interrupted reperfusion reduces ischemia/reperfusion (I/R) injury. This study was designed to determine whether NADPH oxidase participates in the neural protection against global I/R injury after interrupted reperfusion. Mice were randomly divided into five groups: sham (sham-operated), I/R (20-min global I/R), RR (I/R+interrupted reperfusion), Apo (I/R+apocynin administration), and RR+Apo. Behavioral tests (pole test, beam walking, and Morris water maze) and Nissl staining were undertaken in all five groups; superoxide levels, expression of gp91(phox) and p47(phox), p47(phox) translocation, and Rac1 activation were measured in the sham, I/R, and RR groups. The motor coordination, bradykinesia, and spatial learning and memory, as well as the neuron survival rates, were better in the RR, Apo, and RR+Apo groups than in the I/R group. The NADPH oxidase-dependent superoxide levels, p47(phox) and gp91(phox) expression, p47(phox) translocation, and Rac1 activation were lower in the RR group than in the I/R group. In conclusion, the neural protective effect of interrupted reperfusion is at least partly mediated by decreasing the expression and assembly of NADPH oxidase and the levels of NADPH oxidase-derived superoxide. The most striking reduction Rac1-GTP in the RR group suggests that interrupted reperfusion also acts on the activation of assembled NADPH oxidase by reducing the availability of Rac1-GTP. Copyright © 2011 Elsevier Inc. All rights reserved.

Transgenic barley overexpressing a cytokinin dehydrogenase gene shows greater tolerance to drought stress

Czech Academy of Sciences Publication Activity Database

Pospíšilová, H.; Jiskrová, E.; Vojta, P.; Mrízová, K.; Kokáš, F.; Majeská Čudějková, M.; Bergougnoux, V.; Plíhal, O.; Klimešová, J.; Novák, Ondřej; Dzurová, L.; Frébort, I.; Galuszka, P.

2016-01-01

Roč. 33, č. 5 (2016), s. 692-705 ISSN 1871-6784 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : ROOT-GROWTH * OXIDASE/DEHYDROGENASE GENES * BETA-GLUCOSIDASE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.813, year: 2016

Production of recombinant cholesterol oxidase containing covalently bound FAD in Escherichia coli

Directory of Open Access Journals (Sweden)

Molla Gianluca

2010-04-01

Full Text Available Abstract Background Cholesterol oxidase is an alcohol dehydrogenase/oxidase flavoprotein that catalyzes the dehydrogenation of C(3-OH of cholesterol. It has two major biotechnological applications, i.e. in the determination of serum (and food cholesterol levels and as biocatalyst providing valuable intermediates for industrial steroid drug production. Cholesterol oxidases of type I are those containing the FAD cofactor tightly but not covalently bound to the protein moiety, whereas type II members contain covalently bound FAD. This is the first report on the over-expression in Escherichia coli of type II cholesterol oxidase from Brevibacterium sterolicum (BCO. Results Design of the plasmid construct encoding the mature BCO, optimization of medium composition and identification of the best cultivation/induction conditions for growing and expressing the active protein in recombinant E. coli cells, concurred to achieve a valuable improvement: BCO volumetric productivity was increased from ~500 up to ~25000 U/L and its crude extract specific activity from 0.5 up to 7.0 U/mg protein. Interestingly, under optimal expression conditions, nearly 55% of the soluble recombinant BCO is produced as covalently FAD bound form, whereas the protein containing non-covalently bound FAD is preferentially accumulated in insoluble inclusion bodies. Conclusions Comparison of our results with those published on non-covalent (type I COs expressed in recombinant form (either in E. coli or Streptomyces spp., shows that the fully active type II BCO can be produced in E. coli at valuable expression levels. The improved over-production of the FAD-bound cholesterol oxidase will support its development as a novel biotool to be exploited in biotechnological applications.

Myeloperoxidase amplified high glucose-induced endothelial dysfunction in vasculature: Role of NADPH oxidase and hypochlorous acid.

Science.gov (United States)

Tian, Rong; Ding, Yun; Peng, Yi-Yuan; Lu, Naihao

2017-03-11

Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-derived reactive oxygen species (ROS) such as superoxide and hydrogen peroxide (H 2 O 2 ), have emerged as important molecules in the pathogenesis of diabetic endothelial dysfunction. Additionally, neutrophils-derived myeloperoxidase (MPO) and MPO-catalyzed hypochlorous acid (HOCl) play important roles in the vascular injury. However, it is unknown whether MPO can use vascular-derived ROS to induce diabetic endothelial dysfunction. In the present study, we demonstrated that NADPH oxidase was the main source of ROS formation in high glucose-cultured human umbilical vein endothelial cells (HUVECs), and played a critical role in high glucose-induced endothelial dysfunction such as cell apoptosis, loss of cell viability and reduction of nitric oxide (NO). However, the addition of MPO could amplify the high glucose-induced endothelial dysfunction which was inhibited by the presence of apocynin (NADPH oxidase inhibitor), catalase (H 2 O 2 scavenger), or methionine (HOCl scavenger), demonstrating the contribution of NADPH oxidase-H 2 O 2 -MPO-HOCl pathway in the MPO/high glucose-induced vascular injury. In high glucose-incubated rat aortas, MPO also exacerbated the NADPH oxidase-induced impairment of endothelium-dependent relaxation. Consistent with these in vitro data, in diabetic rat aortas, both MPO expresion and NADPH oxidase activity were increased while the endothelial function was simultaneously impaired. The results suggested that vascular-bound MPO could amplify high glucose-induced vascular injury in diabetes. MPO-NADPH oxidase-HOCl may represent an important pathogenic pathway in diabetic vascular diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

Surface reconstitution of glucose oxidase onto a norbornylogous bridge self-assembled monolayer

International Nuclear Information System (INIS)

Liu Jingquan; Paddon-Row, Michael N.; Gooding, J. Justin

2006-01-01

An electrode construct was fabricated in which a self-assembled monolayer containing a novel norbornylogous bridge was covalently attached to flavin adenine dinucleotide (FAD), the redox active centre of several oxidase enzymes. The electrochemistry of the construct was investigated before and after the reconstitution of glucose oxidase around the surface bound FAD. Rapid rates of electron transfer were observed both before and after the reconstitution of biocatalytically active enzyme. However, no biocatalytic activity was observed under anaerobic conditions suggesting the a lack of enzyme turnover through direct electron transfer. It is proposed that a decrease in the electronic coupling between the redox active FAD and the electrode following reconstitution of the glucose oxidase - a probable consequence of the FAD being immersed in a protein environment - was responsible for the inability of the enzyme to be turned over under anaerobic conditions

Genetic defects of cytochrome c oxidase assembly

Czech Academy of Sciences Publication Activity Database

Pecina, Petr; Houšťková, H.; Hansíková, H.; Zeman, J.; Houštěk, Josef

2004-01-01

Roč. 53, Suppl. 1 (2004), s. S213-S223 ISSN 0862-8408 R&D Projects: GA ČR GA303/03/0749 Institutional research plan: CEZ:AV0Z5011922 Keywords : cytochrome c oxidase * mitochondrial disorders Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 1.140, year: 2004

Evolutionary origin and function of NOX4-art, an arthropod specific NADPH oxidase.

Science.gov (United States)

Gandara, Ana Caroline Paiva; Torres, André; Bahia, Ana Cristina; Oliveira, Pedro L; Schama, Renata

2017-03-29

NADPH oxidases (NOX) are ROS producing enzymes that perform essential roles in cell physiology, including cell signaling and antimicrobial defense. This gene family is present in most eukaryotes, suggesting a common ancestor. To date, only a limited number of phylogenetic studies of metazoan NOXes have been performed, with few arthropod genes. In arthropods, only NOX5 and DUOX genes have been found and a gene called NOXm was found in mosquitoes but its origin and function has not been examined. In this study, we analyzed the evolution of this gene family in arthropods. A thorough search of genomes and transcriptomes was performed enabling us to browse most branches of arthropod phylogeny. We have found that the subfamilies NOX5 and DUOX are present in all arthropod groups. We also show that a NOX gene, closely related to NOX4 and previously found only in mosquitoes (NOXm), can also be found in other taxonomic groups, leading us to rename it as NOX4-art. Although the accessory protein p22-phox, essential for NOX1-4 activation, was not found in any of the arthropods studied, NOX4-art of Aedes aegypti encodes an active protein that produces H 2 O 2 . Although NOX4-art has been lost in a number of arthropod lineages, it has all the domains and many signature residues and motifs necessary for ROS production and, when silenced, H 2 O 2 production is considerably diminished in A. aegypti cells. Combining all bioinformatic analyses and laboratory work we have reached interesting conclusions regarding arthropod NOX gene family evolution. NOX5 and DUOX are present in all arthropod lineages but it seems that a NOX2-like gene was lost in the ancestral lineage leading to Ecdysozoa. The NOX4-art gene originated from a NOX4-like ancestor and is functional. Although no p22-phox was observed in arthropods, there was no evidence of neo-functionalization and this gene probably produces H 2 O 2 as in other metazoan NOX4 genes. Although functional and present in the genomes of many

Population genetic structure of cotton pink bollworm, Pectinophora gossypiella (Saunders) (Lepidoptera: Gelechiidae) using mitochondrial cytochrome oxidase I (COI) gene sequences from India.

Science.gov (United States)

Sridhar, J; Chinna Babu Naik, V; Ghodke, A; Kranthi, S; Kranthi, K R; Singh, B P; Choudhary, J S; Krishna, M S R

2017-11-01

Pink bollworm (PBW), Pectinophora gossypiella is one of the most destructive pest's globally inflicting huge economic losses in cotton even during later stages of crop growth. In the present investigation, the population genetic structure, distribution, and genetic diversity of P. gossypiella in cotton growing zones of India using partial mitochondrial DNA cytochrome oxidase-I (COI) gene was addressed. The overall haplotype (Hd), number of nucleotide differences (K), and nucleotide diversity (π) were 0.3028, 0.327, and 0.00047, respectively which suggest that entire population exhibited low level of genetic diversity. Zone-wise clustering of population revealed that central zone recorded low level of Hd (0.2730) as compared to north (0.3619) and south (0.3028) zones. The most common haplotype (H1) reported in all 19 locations could be proposed as ancestral/original haplotype. This haplotype with one mutational step formed star-like phylogeny connected with 11 other haplotypes. The phylogenetic relationship studies revealed that most haplotypes of populations are closely related to each other. Haplotype 5 was exclusively present in Dharwad (South zone) shared with populations of Hanumangarh and Bathinda (North zone). The result indicated that there is no isolation by distance effect among the Indian populations of PBW. The present study reports a low genetic diversity among PBW populations of India and H1, as ancestral haplotype from which other haplotypes have evolved suggests that the migration and dispersal over long distance and invasiveness are major factors.

Combined effect of loss of the caa3 oxidase and Crp regulation drives Shewanella to thrive in redox-stratified environments.

Science.gov (United States)

Zhou, Guangqi; Yin, Jianhua; Chen, Haijiang; Hua, Yijie; Sun, Linlin; Gao, Haichun

2013-09-01

Shewanella species are a group of facultative Gram-negative microorganisms with remarkable respiration abilities that allow the use of a diverse array of terminal electron acceptors (EA). Like most bacteria, S. oneidensis possesses multiple terminal oxidases, including two heme-copper oxidases (caa3- and cbb3-type) and a bd-type quinol oxidase. As aerobic respiration is energetically favored, mechanisms underlying the fact that these microorganisms thrive in redox-stratified environments remain vastly unexplored. In this work, we discovered that the cbb3-type oxidase is the predominant system for respiration of oxygen (O2), especially when O2 is abundant. Under microaerobic conditions, the bd-type quinol oxidase has a significant role in addition to the cbb3-type oxidase. In contrast, multiple lines of evidence suggest that under test conditions the caa3-type oxidase, an analog to the mitochondrial enzyme, has no physiological significance, likely because of its extremely low expression. In addition, expression of both cbb3- and bd-type oxidases is under direct control of Crp (cAMP receptor protein) but not the well-established redox regulator Fnr (fumarate nitrate regulator) of canonical systems typified in Escherichia coli. These data, collectively, suggest that adaptation of S. oneidensis to redox-stratified environments is likely due to functional loss of the caa3-type oxidase and switch of the regulatory system for respiration.

NADPH oxidase 4 attenuates cerebral artery changes during the progression of Marfan syndrome.

Science.gov (United States)

Onetti, Yara; Meirelles, Thayna; Dantas, Ana P; Schröder, Katrin; Vila, Elisabet; Egea, Gustavo; Jiménez-Altayó, Francesc

2016-05-01

Marfan syndrome (MFS) is a connective tissue disorder that is often associated with the fibrillin-1 (Fbn1) gene mutation and characterized by cardiovascular alterations, predominantly ascending aortic aneurysms. Although neurovascular complications are uncommon in MFS, the improvement in Marfan patients' life expectancy is revealing other secondary alterations, potentially including neurovascular disorders. However, little is known about small-vessel pathophysiology in MFS. MFS is associated with hyperactivated transforming growth factor (TGF)-β signaling, which among numerous other downstream effectors, induces the NADPH oxidase 4 (Nox4) isoform of NADPH oxidase, a strong enzymatic source of H2O2 We hypothesized that MFS induces middle cerebral artery (MCA) alterations and that Nox4 contributes to them. MCA properties from 3-, 6-, or 9-mo-old Marfan (Fbn1(C1039G/+)) mice were compared with those from age/sex-matched wild-type littermates. At 6 mo, Marfan compared with wild-type mice developed higher MCA wall/lumen (wild-type: 0.081 ± 0.004; Marfan: 0.093 ± 0.002; 60 mmHg; P Marfan mice with Nox4 deficiency (Nox4(-/-)). Strikingly, Nox4 deletion in Marfan mice aggravated MCA wall thickening (cross-sectional area; Marfan: 6,660 ± 363 μm(2); Marfan Nox4(-/-): 8,795 ± 824 μm(2); 60 mmHg; P < 0.05), accompanied by decreased TGF-β expression and increased collagen deposition and Nox1 expression. These findings provide the first evidence that Nox4 mitigates cerebral artery structural changes in a murine model of MFS. Copyright © 2016 the American Physiological Society.

Identification and statistical optimization of fermentation conditions for a newly isolated extracellular cholesterol oxidase-producing Streptomyces cavourensis strain NEAE-42

OpenAIRE

El-Naggar, Noura El-Ahmady; El-Shweihy, Nancy M.; El-Ewasy, Sara M.

2016-01-01

Background Due to broad range of clinical and industrial applications of cholesterol oxidase, isolation and screening of bacterial strains producing extracellular form of cholesterol oxidase is of great importance. Results One hundred and thirty actinomycete isolates were screened for their cholesterol oxidase activity. Among them, a potential culture, strain NEAE-42 is displayed the highest extracellular cholesterol oxidase activity. It was selected and identified as Streptomyces cavourensis...

Diversity and population-genetic properties of copy number variations and multicopy genes in cattle

Science.gov (United States)

Bickhart, Derek M.; Xu, Lingyang; Hutchison, Jana L.; Cole, John B.; Null, Daniel J.; Schroeder, Steven G.; Song, Jiuzhou; Garcia, Jose Fernando; Sonstegard, Tad S.; Van Tassell, Curtis P.; Schnabel, Robert D.; Taylor, Jeremy F.; Lewin, Harris A.; Liu, George E.

2016-01-01

The diversity and population genetics of copy number variation (CNV) in domesticated animals are not well understood. In this study, we analysed 75 genomes of major taurine and indicine cattle breeds (including Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, and Romagnola), sequenced to 11-fold coverage to identify 1,853 non-redundant CNV regions. Supported by high validation rates in array comparative genomic hybridization (CGH) and qPCR experiments, these CNV regions accounted for 3.1% (87.5 Mb) of the cattle reference genome, representing a significant increase over previous estimates of the area of the genome that is copy number variable (∼2%). Further population genetics and evolutionary genomics analyses based on these CNVs revealed the population structures of the cattle taurine and indicine breeds and uncovered potential diversely selected CNVs near important functional genes, including AOX1, ASZ1, GAT, GLYAT, and KRTAP9-1. Additionally, 121 CNV gene regions were found to be either breed specific or differentially variable across breeds, such as RICTOR in dairy breeds and PNPLA3 in beef breeds. In contrast, clusters of the PRP and PAG genes were found to be duplicated in all sequenced animals, suggesting that subfunctionalization, neofunctionalization, or overdominance play roles in diversifying those fertility-related genes. These CNV results provide a new glimpse into the diverse selection histories of cattle breeds and a basis for correlating structural variation with complex traits in the future. PMID:27085184

Crystallization of carbohydrate oxidase from Microdochium nivale

Czech Academy of Sciences Publication Activity Database