WorldWideScience

Sample records for nuclear-encoded plastid-targeted glyceraldehyde-3-phosphate

  1. A hypothesis for the evolution of nuclear-encoded, plastid-targeted glyceraldehyde-3-phosphate dehydrogenase genes in "chromalveolate" members.

    Directory of Open Access Journals (Sweden)

    Kiyotaka Takishita

    Full Text Available Eukaryotes bearing red alga-derived plastids--photosynthetic alveolates (dinoflagellates plus the apicomplexan Toxoplasma gondii plus the chromerid Chromera velia, photosynthetic stramenopiles, haptophytes, and cryptophytes--possess unique plastid-targeted glyceraldehyde-3-phosphate dehydrogenases (henceforth designated as "GapC1". Pioneering phylogenetic studies have indicated a single origin of the GapC1 enzymes in eukaryotic evolution, but there are two potential idiosyncrasies in the GapC1 phylogeny: Firstly, the GapC1 tree topology is apparently inconsistent with the organismal relationship among the "GapC1-containing" groups. Secondly, four stramenopile GapC1 homologues are consistently paraphyletic in previously published studies, although these organisms have been widely accepted as monophyletic. For a closer examination of the above issues, in this study GapC1 gene sampling was improved by determining/identifying nine stramenopile and two cryptophyte genes. Phylogenetic analyses of our GapC1 dataset, which is particularly rich in the stramenopile homologues, prompt us to propose a new scenario that assumes multiple, lateral GapC1 gene transfer events to explain the incongruity between the GapC1 phylogeny and the organismal relationships amongst the "GapC1-containing" groups. Under our new scenario, GapC1 genes uniquely found in photosynthetic alveolates, photosynthetic stramenopiles, haptophytes, and cryptopyhytes are not necessarily a character vertically inherited from a common ancestor.

  2. Functional divergence and convergent evolution in the plastid-targeted glyceraldehyde-3-phosphate dehydrogenases of diverse eukaryotic algae.

    Science.gov (United States)

    Gaston, Daniel; Roger, Andrew J

    2013-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a key enzyme of the glycolytic pathway, reversibly catalyzing the sixth step of glycolysis and concurrently reducing the coenzyme NAD(+) to NADH. In photosynthetic organisms a GAPDH paralog (Gap2 in Cyanobacteria, GapA in most photosynthetic eukaryotes) functions in the Calvin cycle, performing the reverse of the glycolytic reaction and using the coenzyme NADPH preferentially. In a number of photosynthetic eukaryotes that acquired their plastid by the secondary endosymbiosis of a eukaryotic red alga (Alveolates, haptophytes, cryptomonads and stramenopiles) GapA has been apparently replaced with a paralog of the host's own cytosolic GAPDH (GapC1). Plastid GapC1 and GapA therefore represent two independent cases of functional divergence and adaptations to the Calvin cycle entailing a shift in subcellular targeting and a shift in binding preference from NAD(+) to NADPH. We used the programs FunDi, GroupSim, and Difference Evolutionary-Trace to detect sites involved in the functional divergence of these two groups of GAPDH sequences and to identify potential cases of convergent evolution in the Calvin-cycle adapted GapA and GapC1 families. Sites identified as being functionally divergent by all or some of these programs were then investigated with respect to their possible roles in the structure and function of both glycolytic and plastid-targeted GAPDH isoforms. In this work we found substantial evidence for convergent evolution in GapA/B and GapC1. In many cases sites in GAPDHs of these groups converged on identical amino acid residues in specific positions of the protein known to play a role in the function and regulation of plastid-functioning enzymes relative to their cytosolic counterparts. In addition, we demonstrate that bioinformatic software like FunDi are important tools for the generation of meaningful biological hypotheses that can then be tested with direct experimental techniques.

  3. Phylogeny of nuclear-encoded plastid-targeted GAPDH gene supports separate origins for the peridinin- and the fucoxanthin derivative-containing plastids of dinoflagellates.

    Science.gov (United States)

    Takishita, Kiyotaka; Ishida, Ken-Ichiro; Maruyama, Tadashi

    2004-12-01

    Although most photosynthetic dinoflagellates have plastids with peridinin, the three dinoflagellate genera Karenia, Karlodinium, and Takayama possess anomalously pigmented plastids that contain fucoxanthin and its derivatives (19'-hexanoyloxy-fucoxanthin and 19'-butanoyloxy-fucoxanthin) instead of the peridinin. This pigment composition is similar to that of haptophytes. All peridinin-containing dinoflagellates investigated so far have at least two types of glyceraldehyde-3-phosphate dehydrogenase (GAPDH): cytosolic and plastid-targeted forms. In the present study, we cloned and sequenced genes encoding cytosolic and plastid-targeted GAPDH proteins from three species of the fucoxanthin derivative-containing dinoflagellates. Based on the molecular phylogeny, the plastid-targeted GAPDH genes of the fucoxanthin derivative-containing dinoflagellates were closely related to those of haptophyte algae rather than to the peridinin-containing dinoflagellates, while one of several cytosolic versions from the peridinin- and the fucoxanthin derivative-containing dinoflagellates are closely related to each other. Considering a previously reported theory that the plastid-targeted GAPDH from the peridinin-containing dinoflagellates originated by a gene duplication of the cytosolic form before the splitting of the dinoflagellate lineage, it is highly likely that the plastid-targeted GAPDH gene of the peridinin-containing dinoflagellates is original in this algal group and that in the fucoxanthin-containing dinoflagellates, the original plastid-targeted GAPDH was replaced by that of a haptophyte endosymbiont during a tertiary endosymbiosis. The present results strongly support the hypothesis that the plastids of the peridinin- and the fucoxanthin derivative-containing dinoflagellates are of separate origin.

  4. Buformin suppresses the expression of glyceraldehyde 3-phosphate dehydrogenase.

    Science.gov (United States)

    Yano, Akiko; Kubota, Masafumi; Iguchi, Kazuhiro; Usui, Shigeyuki; Hirano, Kazuyuki

    2006-05-01

    The biguanides metformin and buformin, which are clinically used for diabetes mellitus, are known to improve resistance to insulin in patients. Biguanides were reported to cause lactic acidosis as a side effect. Since the mechanism of the side effect still remains obscure, we have examined genes whose expression changes by treating HepG2 cells with buformin in order to elucidate the mechanisms of the side effect. A subtraction cDNA library was constructed by the method of suppressive subtractive hybridization and the screening of the library was performed with cDNA probes prepared from HepG2 cells treated with or without buformin for 12 h. The expression of the gene and the protein obtained by the screening was monitored by real-time RT-PCR with specific primers and Western blotting with specific antibody. The amounts of ATP and NAD+ were determined with luciferase and alcohol dehydrogenase, respectively. We found that expression of the glyceraldehyde 3-phosphate dehydrogenase (GAPD) gene was suppressed by treating HepG2 cells with 0.25 mM buformin for 12 h as a result of the library screening. The decrease in the expression depended on the treatment period. The amount of GAPD protein also decreased simultaneously with the suppression of the gene expression by the treatment with buformin. The amount of ATP and NAD+ in the HepG2 cells treated with buformin decreased to 10 and 20% of the control, respectively. These observations imply that the biguanide causes deactivation of the glycolytic pathway and subsequently the accumulation of pyruvate and NADH and a decrease in NAD+. Therefore, the reaction equilibrium catalyzed by lactate dehydrogenase leans towards lactate production and this may result in lactic acidosis.

  5. Heme binding properties of glyceraldehyde-3-phosphate dehydrogenase.

    Science.gov (United States)

    Hannibal, Luciana; Collins, Daniel; Brassard, Julie; Chakravarti, Ritu; Vempati, Rajesh; Dorlet, Pierre; Santolini, Jérôme; Dawson, John H; Stuehr, Dennis J

    2012-10-30

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a glycolytic enzyme that also functions in transcriptional regulation, oxidative stress, vesicular trafficking, and apoptosis. Because GAPDH is required for the insertion of cellular heme into inducible nitric oxide synthase [Chakravarti, R., et al. (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 18004-18009], we extensively characterized the heme binding properties of GAPDH. Substoichiometric amounts of ferric heme bound to GAPDH (one heme per GAPDH tetramer) to form a low-spin complex with UV-visible maxima at 362, 418, and 537 nm and when reduced to ferrous gave maxima at 424, 527, and 559 nm. Ferric heme association and dissociation rate constants at 10 °C were as follows: k(on) = 17800 M(-1) s(-1), k(off1) = 7.0 × 10(-3) s(-1), and k(off2) = 3.3 × 10(-4) s(-1) (giving approximate affinities of 19-390 nM). Ferrous heme bound more poorly to GAPDH and dissociated with a k(off) of 4.2 × 10(-3) s(-1). Magnetic circular dichroism, resonance Raman, and electron paramagnetic resonance spectroscopic data on the ferric, ferrous, and ferrous-CO complexes of GAPDH showed that the heme is bis-ligated with His as the proximal ligand. The distal ligand in the ferric complex was not displaced by CN(-) or N(3)(-) but in the ferrous complex could be displaced by CO at a rate of 1.75 s(-1) (for >0.2 mM CO). Studies with heme analogues revealed selectivity toward the coordinating metal and porphyrin ring structure. The GAPDH-heme complex was isolated from bacteria induced to express rabbit GAPDH in the presence of δ-aminolevulinic acid. Our finding of heme binding to GAPDH expands the protein's potential roles. The strength, selectivity, reversibility, and redox sensitivity of heme binding to GAPDH are consistent with it performing heme sensing or heme chaperone-like functions in cells.

  6. Statistical Measure of a Gene Evolution The Case of Glyceraldehyde-3-Phosphate Dehydrogenase Gene

    CERN Document Server

    Chattopadhyay, S; Chakrabarti, J; Chattopadhyay, Sujay; Sahoo, Satyabrata; Chakrabarti, Jayprokas

    2000-01-01

    The enzyme Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) catalyses the decomposition of glucose. The gene that produces the GAPDH is therefore present in a wide class of organisms. We show that for this gene the average value of the fluctuations in nucleotide distribution in the codons, normalized to strand bias, provides a reasonable measure of how the gene has evolved in time.

  7. Fusion of phospholipid vesicles induced by muscle glyceraldehyde-3-phosphate dehydrogenase in the absence of calcium.

    Science.gov (United States)

    Morero, R D; Viñals, A L; Bloj, B; Farías, R N

    1985-04-01

    Ca2+-induced fusion of phospholipid vesicles (phosphatidylcholine/phosphatidic acid, 9:1 mol/mol) prepared by ethanolic injection was followed by five different procedures: resonance energy transfer, light scattering, electron microscopy, intermixing of aqueous content, and gel filtration through Sepharose 4-B. The five methods gave concordant results, showing that vesicles containing only 10% phosphatidic acid can be induced to fuse by millimolar concentrations of Ca2+. When the fusing capability of several soluble proteins was assayed, it was found that concanavalin A, bovine serum albumin, ribonuclease, and protease were inactive. On the other hand, lysozyme, L-lactic dehydrogenase, and muscle and yeast glyceraldehyde-3-phosphate dehydrogenase were capable of inducing vesicle fusion. Glyceraldehyde-3-phosphate dehydrogenase from rabbit muscle, the most extensively studied protein, proved to be very effective: 0.1 microM was enough to induce complete intermixing of bilayer phospholipid vesicles. Under conditions used in this work, fusion was accompanied by leakage of internal contents. The fusing capability of glyceraldehyde-3-phosphate dehydrogenase was not affected by 5 mM ethylenediaminetetraacetic acid. The Ca2+ concentration in the medium, as determined by atomic absorption spectroscopy, was 5 ppm. Heat-denatured enzyme was incapable of inducing fusion. We conclude that glyceraldehyde-3-phosphate dehydrogenase is a soluble protein inherently endowed with the capability of fusing phospholipid vesicles.

  8. Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack

    DEFF Research Database (Denmark)

    Morgan, Philip E; Dean, Roger T; Davies, Michael Jonathan

    2002-01-01

    the active-site thiol of the enzyme and the peroxide. A number of low-molecular-mass compounds including thiols and ascorbate, but not Trolox C, can prevent inhibition by removing the initial peroxide, or species derived from it. In contrast, glutathione reductase and lactate dehydrogenase are poorly......Reaction of certain peptides and proteins with singlet oxygen (generated by visible light in the presence of rose bengal dye) yields long-lived peptide and protein peroxides. Incubation of these peroxides with glyceraldehyde-3-phosphate dehydrogenase, in the absence of added metal ions, results...

  9. Cloning and Characterization of Glyceraldehyde-3-phosphate Dehydrogenase Encoding Gene in Gracilaria/Gracilariopsis lemaneiformis

    Institute of Scientific and Technical Information of China (English)

    REN Xueying; SUI Zhenghong; ZHANG Xuecheng

    2006-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plays important roles in various cellular processes. A cytosolic GAPDH encoding gene (gpd) of Gracilaria/Gracilariopsis lemaneiformis was cloned and characterized. Deduced amino acid sequence of the enzyme of G. lemaneiformis had high homology with those of seven red algae. The 5'-untranslated regions of the GAPDHs encoding genes of these red algae varied greatly. GAPDHs of these red algae shared the highly conserved glyceraldehyde 3-phosphate dehydrogenase active site ASCTTNCL. However, such active site of Cyanidium caldarium was different from those of the other six algae at the last two residues (CL to LF), thus the spatial structure of its GAPDH active center may be different from those of the other six. Phylogenetic analysis indicated that GAPDH of G. lemaneiformis might have undergone an evolution similar to those of Porphyra yezoensis, Chondrus crispus, and Gracilaria verrucosa. C. caldarium had a closer evolutionary relationship with Cyanidioschyzon merolae than with Cyanidium sp. Virtual Northern blot analysis revealed that gpd of G. lemaneiformis expressed constitutively, which suggested that it might be house-keeping and could be adapted as an inner control in gene expression analysis of G. lemaneiformis.

  10. Structure of Streptococcus agalactiae glyceraldehyde-3-phosphate dehydrogenase holoenzyme reveals a novel surface.

    Science.gov (United States)

    Ayres, Chapelle A; Schormann, Norbert; Senkovich, Olga; Fry, Alexandra; Banerjee, Surajit; Ulett, Glen C; Chattopadhyay, Debasish

    2014-10-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a conserved cytosolic enzyme, which plays a key role in glycolysis. GAPDH catalyzes the oxidative phosphorylation of D-glyceraldehyde 3-phosphate using NAD or NADP as a cofactor. In addition, GAPDH localized on the surface of some bacteria is thought to be involved in macromolecular interactions and bacterial pathogenesis. GAPDH on the surface of group B streptococcus (GBS) enhances bacterial virulence and is a potential vaccine candidate. Here, the crystal structure of GBS GAPDH from Streptococcus agalactiae in complex with NAD is reported at 2.46 Å resolution. Although the overall structure of GBS GAPDH is very similar to those of other GAPDHs, the crystal structure reveals a significant difference in the area spanning residues 294-307, which appears to be more acidic. The amino-acid sequence of this region of GBS GAPDH is also distinct compared with other GAPDHs. This region therefore may be of interest as an immunogen for vaccine development.

  11. Characterization of an Arabidopsis thaliana mutant lacking a cytosolic non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase.

    Science.gov (United States)

    Rius, Sebastián P; Casati, Paula; Iglesias, Alberto A; Gomez-Casati, Diego F

    2006-08-01

    Non-phosphorylating glyceraldehyde- 3-phosphate dehydrogenase (NP-GAPDH) is a conserved cytosolic protein found in higher plants. In photosynthetic cells, the enzyme is involved in a shuttle transfer mechanism to export NADPH from the chloroplast to the cytosol. To investigate the role of this enzyme in plant tissues, we characterized a mutant from Arabidopsis thaliana having an insertion at the NP-GAPDH gene locus. The homozygous mutant was determined to be null respect to NP-GAPDH, as it exhibited undetectable levels of both transcription of NP-GAPDH mRNA, protein expression and enzyme activity. Transcriptome analysis demonstrated that the insertion mutant plant shows altered expression of several enzymes involved in carbohydrate metabolism. Significantly, cytosolic phosphorylating (NAD-dependent) glyceraldehyde-3-phosphate dehydrogenase mRNA levels are induced in the mutant, which correlates with an increase in enzyme activity. mRNA levels and enzymatic activity of glucose-6-phosphate dehydrogenase were also elevated, correlating with an increase in NADPH concentration. Moreover, increased ROS levels were measured in the mutant plants. Down-regulation of several glycolytic and photosynthetic genes suggests that NP-GAPDH is important for the efficiency of both metabolic processes. The results presented demonstrate that NP-GAPDH has a relevant role in plant growth and development.

  12. Succination of proteins by fumarate: mechanism of inactivation of glyceraldehyde-3-phosphate dehydrogenase in diabetes.

    Science.gov (United States)

    Blatnik, Matthew; Thorpe, Suzanne R; Baynes, John W

    2008-04-01

    S-(2-succinyl)cysteine (2SC) is a chemical modification of proteins formed by a Michael addition reaction between the Krebs cycle intermediate, fumarate, and thiol groups in protein--a process known as succination of protein. Succination causes irreversible inactivation of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in vitro. GAPDH was immunoprecipitated from muscle of diabetic rats, then analyzed by ultra-performance liquid chromatography-electrospray ionization-mass spectroscopy. Succination of GAPDH was increased in muscle of diabetic rats, and the extent of succination correlated strongly with the decrease in specific activity of the enzyme. We propose that 2SC is a biomarker of mitochondrial and oxidative stress in diabetes and that succination of GAPDH and other thiol proteins may provide the chemical link between glucotoxicity and the pathogenesis of diabetic complications.

  13. Screening of Trypanosoma cruzi glycosomal glyceraldehyde-3-phosphate dehydrogenase enzyme inhibitors

    Directory of Open Access Journals (Sweden)

    Ana C. Leite

    2009-03-01

    Full Text Available The inhibitory activity of crude extracts of Meliaceae and Rutaceae plants on glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH enzyme from Trypanosoma cruzi was evaluated at 100 μg/mL. Forty-six extracts were tested and fifteen of them showed significant inhibitory activity (IA % > 50. The majority of the assayed extracts of Meliaceae plants (Cedrela fissilis, Cipadessa fruticosa and Trichilia ramalhoi showed high ability to inhibit the enzymatic activity. The fractionation of the hexane extract from branches of C. fruticosa led to the isolation of three flavonoids: flavone, 7-methoxyflavone and 3',4',5',5,7-pentamethoxyflavone. The two last compounds showed high ability to inhibit the gGAPDH activity. Therefore, the assayed Meliaceae species could be considered as a promising source of lead compounds against Chagas' disease.

  14. Pattern Recognition Techniques Applied to the Study of Leishmanial Glyceraldehyde-3-Phosphate Dehydrogenase Inhibition

    Directory of Open Access Journals (Sweden)

    Norka B. H. Lozano

    2014-02-01

    Full Text Available Chemometric pattern recognition techniques were employed in order to obtain Structure-Activity Relationship (SAR models relating the structures of a series of adenosine compounds to the affinity for glyceraldehyde 3-phosphate dehydrogenase of Leishmania mexicana (LmGAPDH. A training set of 49 compounds was used to build the models and the best ones were obtained with one geometrical and four electronic descriptors. Classification models were externally validated by predictions for a test set of 14 compounds not used in the model building process. Results of good quality were obtained, as verified by the correct classifications achieved. Moreover, the results are in good agreement with previous SAR studies on these molecules, to such an extent that we can suggest that these findings may help in further investigations on ligands of LmGAPDH capable of improving treatment of leishmaniasis.

  15. Several novel transcripts of glyceraldehyde-3-phosphate dehydrogenase expressed in adult chicken testis.

    Science.gov (United States)

    Mezquita, J; Pau, M; Mezquita, C

    1998-10-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), in addition to being a classic glycolytic enzyme, is a multifunctional protein involved in relevant cell functions such as DNA replication, DNA repair, translational control of gene expression, and apoptosis. Although the multifunctional nature of GAPDH suggests versatility in the mechanisms regulating its expression, no major qualitative changes and few quantitative changes in the GAPDH transcripts have been reported. While studying the expression of GAPDH during spermatogenesis, we detected alternative initiations to TATA box and alternative splicings in the 5' region of the pre-mRNA, resulting in at least six different types of mRNAs. The amount and the polyadenylation of the GAPDH transcripts increased in mature testis in relation to immature testis and further increased when cell suspensions from mature testis were exposed to heat shock. These results suggest that alternative initiation, alternative splicing, and polyadenylation could provide the necessary versatility to the regulation of the expression of this multifunctional protein during spermatogenesis.

  16. Molecular cloning and characterization of the glyceraldehyde-3-phosphate dehydrogenase gene from Penicillium expansum PE-12.

    Science.gov (United States)

    Zhang, T; Qi, Z; Yu, Q S; Tang, K X

    2013-07-15

    Penicillium expansum produces large amounts of lipase, which is widely used in laundry detergent and leather industry. We isolated the glyceraldehyde-3-phosphate dehydrogenase gene (PeGPD) from P. expansum PE-12 through reverse transcriptase PCR and 5'-3' rapid amplification of cDNA ends (RACE-PCR). The gene is 1266 bp long, including an ORF of 1014 bp, encoding a polypeptide chain of 337 amino acids. A phylogenetic tree based on GPD proteins showed that P. expansum is close to Aspergillus species, but comparatively distant from P. marneffei. Southern blot results revealed a single copy of PeGPD, and expression analysis gave evidence of high expression levels. PeGPD genes have potential for genetic engineering of P. expansum for industrial lipase production.

  17. Sperm-Specific Glyceraldehyde-3-Phosphate Dehydrogenase - An Evolutionary Acquisition of Mammals.

    Science.gov (United States)

    Muronetz, V I; Kuravsky, M L; Barinova, K V; Schmalhausen, E V

    2015-12-01

    This review is focused on the mammalian sperm-specific glyceraldehyde-3-phosphate dehydrogenase (GAPDS). GAPDS plays the major role in the production of energy required for sperm cell movement and does not perform non-glycolytic functions that are characteristic of the somatic isoenzyme of glyceraldehyde-3-phosphate dehydrogenase. The GAPDS sequence is composed of 408 amino acid residues and includes an additional N-terminal region of 72 a.a. that binds the protein to the sperm tail cytoskeleton. GAPDS is present only in the sperm cells of mammals and lizards, possibly providing them with certain evolutionary advantages in reproduction. In this review, studies concerning the problems of GAPDS isolation, its catalytic properties, and its structural features are described in detail. GAPDS is much more stable compared to the somatic isoenzyme, perhaps due to the necessity of maintaining the enzyme function in the absence of protein expression. The site-directed mutagenesis approach revealed the two GAPDS-specific proline residues, as well as three salt bridges, which seem to be the basis of the increased stability of this protein. As distinct from the somatic isoenzyme, GAPDS exhibits positive cooperativity in binding of the coenzyme NAD+. The key role in transduction of structural changes induced by NAD+ is played by the salt bridge D311-H124. Disruption of this salt bridge cancels GAPDS cooperativity and twofold increases its enzymatic activity instead. The expression of GAPDS was detected in some melanoma cells as well. Its role in the development of certain pathologies, such as cancer and neurodegenerative diseases, is discussed.

  18. Comparative molecular analysis of evolutionarily distant glyceraldehyde-3-phosphate dehydrogenase from Sardina pilchardus and Octopus vulgaris.

    Science.gov (United States)

    Baibai, Tarik; Oukhattar, Laila; Mountassif, Driss; Assobhei, Omar; Serrano, Aurelio; Soukri, Abdelaziz

    2010-12-01

    The NAD(+)-dependent cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPDH, EC 1.2.1.12), which is recognized as a key to central carbon metabolism in glycolysis and gluconeogenesis and as an important allozymic polymorphic biomarker, was purified from muscles of two marine species: the skeletal muscle of Sardina pilchardus Walbaum (Teleost, Clupeida) and the incompressible arm muscle of Octopus vulgaris (Mollusca, Cephalopoda). Comparative biochemical studies have revealed that they differ in their subunit molecular masses and in pI values. Partial cDNA sequences corresponding to an internal region of the GapC genes from Sardina and Octopus were obtained by polymerase chain reaction using degenerate primers designed from highly conserved protein motifs. Alignments of the deduced amino acid sequences were used to establish the 3D structures of the active site of two enzymes as well as the phylogenetic relationships of the sardine and octopus enzymes. These two enzymes are the first two GAPDHs characterized so far from teleost fish and cephalopod, respectively. Interestingly, phylogenetic analyses indicated that the sardina GAPDH is in a cluster with the archetypical enzymes from other vertebrates, while the octopus GAPDH comes together with other molluscan sequences in a distant basal assembly closer to bacterial and fungal orthologs, thus suggesting their different evolutionary scenarios.

  19. Sequestration of Glyceraldehyde-3-phosphate Dehydrogenase to Aggregates Formed by Mutant Huntingtin

    Institute of Scientific and Technical Information of China (English)

    Junchao WU; Fang LIN; Zhenghong QIN

    2007-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has been reported to interact with proteins containing the polyglutamine (polyQ) domain. The present study was undertaken to evaluate the potential contributions of the polyQ and polyproline (polyP) domains to the co-localization of mutant huntingtin (htt) and GAPDH. Overexpression of N-terminal htt (1-969 amino acids) with 100Q and 46Q (htt1-969-100Q and httl-969-46Q, mutant htt) in human mammary gland carcinoma MCF-7 cells formed more htt aggregates than that of htt1-969-18Q (wild-type htt). The co-localization of GAPDH with htt aggregates was found in the cells expressing mutant but not wild-type htt. Deletion of the polyp region in the N-terminal htt had no effect on the co-localization of GAPDH and mutant htt aggregates. These results suggest that the polyQ domain, but not the polyp domain, plays a role in the sequestration of GAPDH to aggregates by mutant htt. This effect might contribute to the dysfunction of neurons caused by mutant htt in Huntington's disease.

  20. Glyceraldehyde 3-phosphate dehydrogenase-telomere association correlates with redox status in Trypanosoma cruzi.

    Directory of Open Access Journals (Sweden)

    Ricardo Pariona-Llanos

    Full Text Available Glyceraldehyde 3-phosphate dehydrogenase (GAPDH is a classical metabolic enzyme involved in energy production and plays a role in additional nuclear functions, including transcriptional control, recognition of misincorporated nucleotides in DNA and maintenance of telomere structure. Here, we show that the recombinant protein T. cruzi GAPDH (rTcGAPDH binds single-stranded telomeric DNA. We demonstrate that the binding of GAPDH to telomeric DNA correlates with the balance between oxidized and reduced forms of nicotinamide adenine dinucleotides (NAD+/NADH. We observed that GAPDH-telomere association and NAD+/NADH balance changed throughout the T. cruzi life cycle. For example, in replicative epimastigote forms of T. cruzi, which show similar intracellular concentrations of NAD+ and NADH, GAPDH binds to telomeric DNA in vivo and this binding activity is inhibited by exogenous NAD+. In contrast, in the T. cruzi non-proliferative trypomastigote forms, which show higher NAD+ concentration, GAPDH was absent from telomeres. In addition, NAD+ abolishes physical interaction between recombinant GAPDH and synthetic telomere oligonucleotide in a cell free system, mimicking exogenous NAD+ that reduces GAPDH-telomere interaction in vivo. We propose that the balance in the NAD+/NADH ratio during T. cruzi life cycle homeostatically regulates GAPDH telomere association, suggesting that in trypanosomes redox status locally modulates GAPDH association with telomeric DNA.

  1. Catalysis of nitrite generation from nitroglycerin by glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

    Science.gov (United States)

    Seabra, Amedea B; Ouellet, Marc; Antonic, Marija; Chrétien, Michelle N; English, Ann M

    2013-11-30

    Vascular relaxation to nitroglycerin (glyceryl trinitrate; GTN) requires its bioactivation by mechanisms that remain controversial. We report here that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) catalyzes the release of nitrite from GTN. In assays containing dithiothreitol (DTT) and NAD(+), the GTN reductase activity of purified GAPDH produces nitrite and 1,2-GDN as the major products. A vmax of 2.6nmolmin(-)(1)mg(-)(1) was measured for nitrite production by GAPDH from rabbit muscle and a GTN KM of 1.2mM. Reductive denitration of GTN in the absence of DTT results in dose- and time-dependent inhibition of GAPDH dehydrogenase activity. Disulfiram, a thiol-modifying drug, inhibits both the dehydrogenase and GTN reductase activity of GAPDH, while DTT or tris(2-carboxyethyl)phosphine reverse the GTN-induced inhibition. Incubation of intact human erythrocytes or hemolysates with 2mM GTN for 60min results in 50% inhibition of GAPDH's dehydrogenase activity, indicating that GTN is taken up by these cells and that the dehydrogenase is a target of GTN. Thus, erythrocyte GAPDH may contribute to GTN bioactivation.

  2. Purification and Characterization of Cytosolic Glyceraldehyde-3-phosphate Dehydrogenase from the Dromedary Camel

    Institute of Scientific and Technical Information of China (English)

    Latifa FOURRAT; Abdelghani IDDAR; Abdelaziz SOUKRI

    2007-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12), a key enzyme of carbon metabolism, was purified and characterized to homogeneity from skeletal muscle of Camelus dromedarius. The protein was purified approximately 26.8 folds by conventional ammonium sulphate fractionation followed by Blue Sepharose CL-6B chromatography, and its physical and kinetic properties were investigated. The native protein is a homotetramer with an apparent molecular weight of approximately 146 kDa. Isoelectric focusing analysis showed the presence of only one GAPDH isoform with an isoelectric point of 7.2. The optimum pH of the purified enzyme was 7.8. Studies on the effect of temperature on enzyme activity revealed an optimal value of approximately 28-32 ℃ with activation energy of 4.9 kcal/mol.The apparent Km values for NAD+ and DL-glyceraldehyde-3-phophate were estimated to be 0.025±0.040 mM and 0.21±0.08 mM, respectively. The Vmax of the purified protein was estimated to be 52.7±5.9 U/mg.These kinetic parameter values were different from those described previously, reflecting protein differences between species.

  3. Different Thermostability of Skeletal Muscle Glyceraldehyde-3-phosphate Dehydrogenase from Hibernating and Euthermic Jerboa (Jaculus orientalis)

    Institute of Scientific and Technical Information of China (English)

    IDDAR Abdelghani; CAMPOS Luis A.; SANCHO Javier; SERRANO Aurelio; SOUKRI Abdelaziz

    2003-01-01

    In previous study, we demonstrated that the specific activity of D-glyceraldehyde-3-phosphate dehydrogenase (GAPDH, EC 1.2.1.12) in skeletal muscle of induced hibernating jerboa (hibernating GAPDH) was 3-4 folds lower than that of the one in the skeletal muscle of the euthermic jerboa (euthermic GAPDH). A significant decrease in both GAPDH protein and GapC mRNA levels occurs when hibernating, but the purified hibernating GAPDH is less active than the euthermic GAPDH. To investigate the physico-chemical basis of this lower activity, the behaviour during thermal inactivation of skeletal muscle GAPDH from hibernating and euthermic tissues was examined by a variety of spectroscopic techniques, including fluorescence emission, circular dichroism and ultraviolet absorption. A clear resistance to thermal denaturation was observed in the hibernating GAPDH compared with the euthermic GAPDH. The different temperature of denaturation found in these proteins by both fluorimetry and circular dichroism indicates that there might exist conformational changes of GAPDH upon hibernation that could affect the stability of this enzyme.

  4. Immunoaffinity purification and characterization of glyceraldehyde-3-phosphate dehydrogenase from human erythrocytes

    Institute of Scientific and Technical Information of China (English)

    Driss Mountassif; Tarik Baibai; Latifa Fourrat; Adnane Moutaouakkil; Abdelghani Iddar; M'Hammed Sa(i)d El Kebbaj; Abdelaziz Soukri

    2009-01-01

    A new procedure utilizing immunoaffinity column chromatography has been used for the purification of glyceraldehyde-3-phosphate dehydrogenase(GAPDH,EC 1.2.1.12)from human erythrocytes.The comparison between this rapid method(one step)and the traditional procedure including ammonium sulfate fractionation followed by Blue Sepharose CL-6B chromatography shows that the new method gives a highest specific activity with a highest yield in a short time.The characterization of the purified GAPDH reveals that the native enzyme is a homotetramer of ~150 kDa with an absolute specificity for the oxidized form of nicotinamide adenine dinucleotide(NAD+).Western blot analysis using purified monospecific poly clonal antibodies raised against the purified GAPDH showed a singie 36 kDa band corresponding to the enzyme subunit.Studies on the effect of temperature and pH on enzyme activity revealed optimal values of about 43℃ and 8.5, respectively.The kinetic par ameters were also calculated:the Vmax was 4.3 U/mg and the Km values against G3P and NAD+ were 20.7and 17.8μM,respectively.The new protocol described represents a simple,economic,and reproducible tool for the purification Of GAPDH and can be used for other proteins.

  5. Bioreaction Engineering Leading to Efficient Synthesis of L-Glyceraldehyd-3-Phosphate.

    Science.gov (United States)

    Molla, Getachew S; Kinfu, Birhanu M; Chow, Jennifer; Streit, Wolfgang; Wohlgemuth, Roland; Liese, Andreas

    2017-03-01

    Enantiopure L-glyceraldehyde-3-phosphate (L-GAP) is a useful building block in natural biological and synthetic processes. A biocatalytic process using glycerol kinase from Cellulomonas sp. (EC 2.7.1.30) catalyzed phosphorylation of L-glyceraldehyde (L-GA) by ATP is used for the synthesis of L-GAP. L-GAP has a half-life of 6.86 h under reaction conditions. The activity of this enzyme depends on the Mg(2+) to ATP molar ratio showing maximum activity at the optimum molar ratio of 0.7. A kinetic model is developed and validated showing a 2D correlation of 99.9% between experimental and numerical data matrices. The enzyme exhibits inhibition by ADP, AMP, methylglyoxal and Ca(2+) , but not by L-GAP and inorganic orthophosphate. Moreover, equal amount of Ca(2+) exerts a different degree of inhibition relative to the activity without the addition of Ca(2+) depending on the Mg(2+) to ATP molar ratio. If the Mg(2+) to ATP molar ratio is set to be at the optimum value or less, inorganic hexametaphosphate (PPi6) suppresses the enzyme activity; otherwise PPi6 enhances the enzyme activity. Based on reaction engineering parameters such as conversion, selectivity and specific productivity, evaluation of different reactor types reveals that batchwise operation via stirred-tank reactor is the most efficient process for the synthesis of L-GAP.

  6. Glyceraldehyde-3-phosphate dehydrogenase: a universal internal control for Western blots in prokaryotic and eukaryotic cells.

    Science.gov (United States)

    Wu, Yonghong; Wu, Min; He, Guowei; Zhang, Xiao; Li, Weiguang; Gao, Yan; Li, Zhihui; Wang, Zhaoyan; Zhang, Chenggang

    2012-04-01

    In the current study, we examined the expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein in a number of organisms and the stability of GAPDH under various conditions. Our results revealed that GAPDH is present in multiple Escherichia coli strains, the yeast strain GS115, Caenorhabditis elegans, rat PC12 cells, and both mouse and rat brain. Furthermore, GAPDH was stably expressed under different concentrations of inducer and at different times of induction in E. coli (BL21) cells and yeast GS115 cells. Stable expression of GAPDH protein was also observed in C.elegans and PC12 cells that were treated with different concentrations of paraquat or sodium sulfite, respectively. In addition, we were able to detect and identify the endogenous gapA protein in E.coli via immunoprecipitation and MALDI-TOF-MS analysis. Endogenous gapA protein and exogenously expressed (subcloned) GAPDH proteins were detected in E. coli BL21 but not for gapC. With the exception of gapC in E. coli, the various isoforms of GAPDH possessed enzymatic activity. Finally, sequence analysis revealed that the GAPDH proteins were 76% identical, with the exception of E. coli gapC. Taken together, our results indicate that GAPDH could be universally used as an internal control for the Western blot analysis of prokaryotic and eukaryotic samples.

  7. The glyceraldehyde-3-phosphate dehydrogenase and the small GTPase Rab 2 are crucial for Brucella replication.

    Directory of Open Access Journals (Sweden)

    Emilie Fugier

    2009-06-01

    Full Text Available The intracellular pathogen Brucella abortus survives and replicates inside host cells within an endoplasmic reticulum (ER-derived replicative organelle named the "Brucella-containing vacuole" (BCV. Here, we developed a subcellular fractionation method to isolate BCVs and characterize for the first time the protein composition of its replicative niche. After identification of BCV membrane proteins by 2 dimensional (2D gel electrophoresis and mass spectrometry, we focused on two eukaryotic proteins: the glyceraldehyde-3-phosphate dehydrogenase (GAPDH and the small GTPase Rab 2 recruited to the vacuolar membrane of Brucella. These proteins were previously described to localize on vesicular and tubular clusters (VTC and to regulate the VTC membrane traffic between the endoplasmic reticulum (ER and the Golgi. Inhibition of either GAPDH or Rab 2 expression by small interfering RNA strongly inhibited B. abortus replication. Consistent with this result, inhibition of other partners of GAPDH and Rab 2, such as COPI and PKC iota, reduced B. abortus replication. Furthermore, blockage of Rab 2 GTPase in a GDP-locked form also inhibited B. abortus replication. Bacteria did not fuse with the ER and instead remained in lysosomal-associated membrane vacuoles. These results reveal an essential role for GAPDH and the small GTPase Rab 2 in B. abortus virulence within host cells.

  8. Disruption of NAD~+ binding site in glyceraldehyde 3-phosphate dehydrogenase affects its intranuclear interactions

    Institute of Scientific and Technical Information of China (English)

    Manali; Phadke; Natalia; Krynetskaia; Anurag; Mishra; Carlos; Barrero; Salim; Merali; Scott; A; Gothe; Evgeny; Krynetskiy

    2015-01-01

    AIM:To characterize phosphorylation of human glyceraldehyde 3-phosphate dehydrogenase(GAPDH),and mobility of GAPDH in cancer cells treated with chemotherapeutic agents. METHODS:We used proteomics analysis to detect and characterize phosphorylation sites within human GAPDH. Site-specific mutagenesis and alanine scanning was then performed to evaluate functional significance of phosphorylation sites in the GAPDH polypeptide chain. Enzymatic properties of mutated GAPDH variants were assessed using kinetic studies. Intranuclear dynamics parameters(diffusion coefficient and the immobile fraction) were estimated using fluorescence recovery after photobleaching(FRAP) experiments and confocal microscopy. Molecular modeling experiments were performed to estimate the effects of mutations on NAD+ cofactor binding.RESULTS:Using MALDI-TOF analysis,we identified novel phosphorylation sites within the NAD+ binding center of GAPDH at Y94,S98,and T99. Using polyclonal antibody specific to phospho-T99-containing peptide within GAPDH,we demonstrated accumulation of phospho-T99-GAPDH inthe nuclear fractions of A549,HCT116,and SW48 cancer cel s after cytotoxic stress. We performed site-mutagenesis,and estimated enzymatic properties,intranuclear distribution,and intranuclear mobility of GAPDH mutated variants. Site-mutagenesis at positions S98 and T99 in the NAD+ binding center reduced enzymatic activity of GAPDH due to decreased affinity to NAD+(Km = 741 ± 257 μmol/L in T99 I vs 57 ± 11.1 μmol/L in wild type GAPDH. Molecular modeling experiments revealed the effect of mutations on NAD+ binding with GAPDH. FRAP(fluorescence recovery after photo bleaching) analysis showed that mutations in NAD+ binding center of GAPDH abrogated its intranuclear interactions. CONCLUSION:Our results suggest an important functional role of phosphorylated amino acids in the NAD+ binding center in GAPDH interactions with its intranuclear partners.

  9. Glyceraldehyde-3-phosphate dehydrogenase is a surface-associated, fibronectin-binding protein of Trichomonas vaginalis.

    Science.gov (United States)

    Lama, A; Kucknoor, A; Mundodi, V; Alderete, J F

    2009-07-01

    Trichomonas vaginalis colonizes the urogenital tract of humans and causes trichomonosis, the most prevalent nonviral sexually transmitted disease. We have shown an association of T. vaginalis with basement membrane extracellular matrix components, a property which we hypothesize is important for colonization and persistence. In this study, we identify a fibronectin (FN)-binding protein of T. vaginalis. A monoclonal antibody (MAb) from a library of hybridomas that inhibited the binding of T. vaginalis organisms to immobilized FN was identified. The MAb (called ws1) recognized a 39-kDa protein and was used to screen a cDNA expression library of T. vaginalis. A 1,086-bp reactive cDNA clone that encoded a protein of 362 amino acids with identity to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was obtained. The gapdh gene was cloned, and recombinant GAPDH (rGAPDH) was expressed in Escherichia coli cells. Natural GAPDH and rGAPDH bound to immobilized FN and to plasminogen and collagen but not to laminin. MAb ws1 inhibited binding to FN. GAPDH was detected on the surface of trichomonads and was upregulated in synthesis and surface expression by iron. Higher levels of binding to FN were seen for organisms grown in iron-replete medium than for organisms grown in iron-depleted medium. In addition, decreased synthesis of GAPDH by antisense transfection of T. vaginalis gave lower levels of organisms bound to FN and had no adverse effect on growth kinetics. Finally, GAPDH did not associate with immortalized vaginal epithelial cells (VECs), and neither GAPDH nor MAb ws1 inhibited the adherence of trichomonads to VECs. These results indicate that GAPDH is a surface-associated protein of T. vaginalis with alternative functions.

  10. Glyceraldehyde-3-phosphate dehydrogenase interacts with proapoptotic kinase mst1 to promote cardiomyocyte apoptosis.

    Directory of Open Access Journals (Sweden)

    Bei You

    Full Text Available Mammalian sterile 20-like kinase 1 (Mst1 is a critical component of the Hippo signaling pathway, which regulates a variety of biological processes ranging from cell contact inhibition, organ size control, apoptosis and tumor suppression in mammals. Mst1 plays essential roles in the heart disease since its activation causes cardiomyocyte apoptosis and dilated cardiomyopathy. However, the mechanism underlying Mst1 activation in the heart remains unknown. In a yeast two-hybrid screen of a human heart cDNA library with Mst1 as bait, glyceraldehyde-3-phosphate dehydrogenase (GAPDH was identified as an Mst1-interacting protein. The interaction of GAPDH with Mst1 was confirmed by co-immunoprecipitation in both co-transfected HEK293 cells and mouse heart homogenates, in which GAPDH interacted with the kinase domain of Mst1, whereas the C-terminal catalytic domain of GAPDH mediated its interaction with Mst1. Moreover, interaction of Mst1 with GAPDH caused a robust phosphorylation of GAPDH and markedly increased the Mst1 activity in cells. Chelerythrine, a potent inducer of apoptosis, substantially increased the nuclear translocation and interaction of GAPDH and Mst1 in cardiomyocytes. Overexpression of GAPDH significantly augmented the Mst1 mediated apoptosis, whereas knockdown of GAPDH markedly attenuated the Mst1 activation and cardiomyocyte apoptosis in response to either chelerythrine or hypoxia/reoxygenation. These findings reveal a novel function of GAPDH in Mst1 activation and cardiomyocyte apoptosis and suggest that disruption of GAPDH interaction with Mst1 may prevent apoptosis related heart diseases such as heart failure and ischemic heart disease.

  11. Oxidative modifications of glyceraldehyde 3-phosphate dehydrogenase regulate metabolic reprogramming of stored red blood cells.

    Science.gov (United States)

    Reisz, Julie A; Wither, Matthew J; Dzieciatkowska, Monika; Nemkov, Travis; Issaian, Aaron; Yoshida, Tatsuro; Dunham, Andrew J; Hill, Ryan C; Hansen, Kirk C; D'Alessandro, Angelo

    2016-09-22

    Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) plays a key regulatory function in glucose oxidation by mediating fluxes through glycolysis or the pentose phosphate pathway (PPP) in an oxidative stress-dependent fashion. Previous studies documented metabolic reprogramming in stored red blood cells (RBCs) and oxidation of GAPDH at functional residues upon exposure to pro-oxidants diamide and H2O2 Here we hypothesize that routine storage of erythrocyte concentrates promotes metabolic modulation of stored RBCs by targeting functional thiol residues of GAPDH. Progressive increases in PPP/glycolysis ratios were determined via metabolic flux analysis after spiking (13)C1,2,3-glucose in erythrocyte concentrates stored in Additive Solution-3 under blood bank conditions for up to 42 days. Proteomics analyses revealed a storage-dependent oxidation of GAPDH at functional Cys152, 156, 247, and His179. Activity loss by oxidation occurred with increasing storage duration and was progressively irreversible. Irreversibly oxidized GAPDH accumulated in stored erythrocyte membranes and supernatants through storage day 42. By combining state-of-the-art ultra-high-pressure liquid chromatography-mass spectrometry metabolic flux analysis with redox and switch-tag proteomics, we identify for the first time ex vivo functionally relevant reversible and irreversible (sulfinic acid; Cys to dehydroalanine) oxidations of GAPDH without exogenous supplementation of excess pro-oxidant compounds in clinically relevant blood products. Oxidative and metabolic lesions, exacerbated by storage under hyperoxic conditions, were ameliorated by hypoxic storage. Storage-dependent reversible oxidation of GAPDH represents a mechanistic adaptation in stored erythrocytes to promote PPP activation and generate reducing equivalents. Removal of irreversibly oxidized, functionally compromised GAPDH identifies enhanced vesiculation as a self-protective mechanism in ex vivo aging erythrocytes.

  12. Diacylglycerol pyrophosphate binds and inhibits the glyceraldehyde-3-phosphate dehydrogenase in barley aleurone.

    Science.gov (United States)

    Astorquiza, Paula Luján; Usorach, Javier; Racagni, Graciela; Villasuso, Ana Laura

    2016-04-01

    The aleurona cell is a model that allows the study of the antagonistic effect of gibberellic acid (GA) and abscisic acid (ABA). Previous results of our laboratory demonstrated the involvement of phospholipids during the response to ABA and GA. ABA modulates the levels of diacylglycerol, phosphatidic acid and diacylglycerol pyrophosphate (DAG, PA, DGPP) through the activities of phosphatidate phosphatases, phospholipase D, diacylglycerol kinase and phosphatidate kinase (PAP, PLD, DGK and PAK). PA and DGPP are key phospholipids in the response to ABA, since both are capable of modifying the hydrolitic activity of the aleurona. Nevertheless, little is known about the mechanism of action of these phospholipids during the ABA signal. DGPP is an anionic phospholipid with a pyrophosphate group attached to diacylglycerol. The ionization of the pyrophosphate group may be important to allow electrostatic interactions between DGPP and proteins. To understand how DGPP mediates cell functions in barley aleurone, we used a DGPP affinity membrane assay to isolate DGPP-binding proteins from Hordeum vulgare, followed by mass spectrometric sequencing. A cytosolic glyceraldehyde-3-phosphate dehydrogenase (GAPDH, EC 1.2.1.12) was identified for being bound to DGPP. To validate our method, the relatively abundant GAPDH was characterized with respect to its lipid-binding properties, by fat western blot. GAPDH antibody interacts with proteins that only bind to DGPP and PA. We also observed that ABA treatment increased GAPDH abundance and enzyme activity. The presence of phospholipids during GAPDH reaction modulated the GAPDH activity in ABA treated aleurone. These data suggest that DGPP binds to GAPDH and this DGPP and GAPDH interaction provides new evidences in the study of DGPP-mediated ABA responses in barley aleurone.

  13. Glyceraldehyde-3-phosphate Dehydrogenase Aggregates Accelerate Amyloid-β Amyloidogenesis in Alzheimer Disease*

    Science.gov (United States)

    Itakura, Masanori; Nakajima, Hidemitsu; Kubo, Takeya; Semi, Yuko; Kume, Satoshi; Higashida, Shusaku; Kaneshige, Akihiro; Kuwamura, Mitsuru; Harada, Naoki; Kita, Akinori; Azuma, Yasu-Taka; Yamaji, Ryoichi; Inui, Takashi; Takeuchi, Tadayoshi

    2015-01-01

    Alzheimer disease (AD) is a progressive neurodegenerative disorder characterized by loss of neurons and formation of pathological extracellular deposits induced by amyloid-β peptide (Aβ). Numerous studies have established Aβ amyloidogenesis as a hallmark of AD pathogenesis, particularly with respect to mitochondrial dysfunction. We have previously shown that glycolytic glyceraldehyde-3-phosphate dehydrogenase (GAPDH) forms amyloid-like aggregates upon exposure to oxidative stress and that these aggregates contribute to neuronal cell death. Here, we report that GAPDH aggregates accelerate Aβ amyloidogenesis and subsequent neuronal cell death both in vitro and in vivo. Co-incubation of Aβ40 with small amounts of GAPDH aggregates significantly enhanced Aβ40 amyloidogenesis, as assessed by in vitro thioflavin-T assays. Similarly, structural analyses using Congo red staining, circular dichroism, and atomic force microscopy revealed that GAPDH aggregates induced Aβ40 amyloidogenesis. In PC12 cells, GAPDH aggregates augmented Aβ40-induced cell death, concomitant with disruption of mitochondrial membrane potential. Furthermore, mice injected intracerebroventricularly with Aβ40 co-incubated with GAPDH aggregates exhibited Aβ40-induced pyramidal cell death and gliosis in the hippocampal CA3 region. These observations were accompanied by nuclear translocation of apoptosis-inducing factor and cytosolic release of cytochrome c from mitochondria. Finally, in the 3×Tg-AD mouse model of AD, GAPDH/Aβ co-aggregation and mitochondrial dysfunction were consistently detected in an age-dependent manner, and Aβ aggregate formation was attenuated by GAPDH siRNA treatment. Thus, this study suggests that GAPDH aggregates accelerate Aβ amyloidogenesis, subsequently leading to mitochondrial dysfunction and neuronal cell death in the pathogenesis of AD. PMID:26359500

  14. Glyceraldehyde-3-phosphate dehydrogenase of Xanthomonas campestris pv. campestris is required for extracellular polysaccharide production and full virulence.

    Science.gov (United States)

    Lu, Guang-Tao; Xie, Jia-Ri; Chen, Lei; Hu, Jiang-Ru; An, Shi-Qi; Su, Hui-Zhao; Feng, Jia-Xun; He, Yong-Qiang; Jiang, Bo-Le; Tang, Dong-Jie; Tang, Ji-Liang

    2009-05-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plays an important role in glucose catabolism, converting glyceraldehyde 3-phosphates to 1,3-bisphosphoglycerates. Open reading frame (ORF) XC_0972 in the genome of Xanthomonas campestris pv. campestris (Xcc) strain 8004 is the only ORF in this strain annotated to encode a GAPDH. In this work, we have demonstrated genetically that this ORF encodes a unique GAPDH in Xcc strain 8004, which seems to be constitutively expressed. A GAPDH-deficient mutant could still grow in medium with glucose or other sugars as the sole carbon source, and no phosphofructokinase activity was detectable in strain 8004. These facts suggest that Xcc may employ the Entner-Doudoroff pathway, but not glycolysis, to utilize glucose. The mutant could not utilize pyruvate as sole carbon source, whereas the wild-type could, implying that the GAPDH of Xcc is involved in gluconeogenesis. Furthermore, inactivation of the Xcc GAPDH resulted in impairment of bacterial growth and virulence in the host plant, and reduction of intracellular ATP and extracellular polysaccharide (EPS). This reveals that GAPDH is required for EPS production and full pathogenicity of Xcc.

  15. Structural basis for regulation of stability and activity in glyceraldehyde-3-phosphate dehydrogenases. Differential scanning calorimetry and molecular dynamics.

    Science.gov (United States)

    Makshakova, Olga N; Semenyuk, Pavel I; Kuravsky, Mikhail L; Ermakova, Elena A; Zuev, Yuriy F; Muronetz, Vladimir I

    2015-05-01

    Tissue specific isoforms of human glyceraldehyde-3-phosphate dehydrogenase, somatic (GAPD) and sperm-specific (GAPDS), have been reported to display different levels of both stability and catalytic activity. Here we apply MD simulations to investigate molecular basis of this phenomenon. The protein is a tetramer where each subunit consists of two domains - catalytic and NAD-binding one. We demonstrated key residues responsible for intersubunit and interdomain interactions. Effect of several residues was studied by point mutations. Overall we considered three mutations (Glu96Gln, Glu244Gln and Asp311Asn) disrupting GAPDS-specific salt bridges. Comparison of calculated interaction energies with calorimetric enthalpies confirmed that intersubunit interactions were responsible for enhanced thermostability of GAPDS whereas interdomain interactions had indirect influence on intersubunit contacts. Mutation Asp311Asn was around 10Å far from the active center and corresponded to the closest natural substitution in the isoenzymes. MD simulations revealed that this residue had slight interaction with catalytic residues but influenced the hydrogen bond net and dynamics in active site. These effects can be responsible for a strong influence of this residue on catalytic activity. Overall, our results provide new insight into glyceraldehyde-3-phosphate dehydrogenase structure-function relationships and can be used for the engineering of mutant proteins with modified properties and for development of new inhibitors with indirect influence on the catalytic site. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Expression, purification, crystallization and preliminary X-ray analysis of an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase from Helicobacter pylori

    Energy Technology Data Exchange (ETDEWEB)

    Elliott, Paul R.; Evans, Daniel; Greenwood, Jacqueline A.; Moody, Peter C. E., E-mail: pcem1@leicester.ac.uk [Henry Wellcome Laboratories for Structural Biology, Department of Biochemistry, University of Leicester, Leicester LE1 9HN (United Kingdom)

    2008-08-01

    Glyceraldehyde-3-phosphate dehydrogenase A has been cloned, expressed and purified. Apoprotein crystals have been grown which diffracted to 1.75 Å resolution and belonged to space group P2{sub 1}; holo crystals were grown in the presence of NADP, diffracted to 2.6 Å resolution and belonged to space group P3{sub 2}. The classical glycolytic pathway contains an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase, with NADP-dependent forms reserved for photosynthetic organisms and archaea. Here, the cloning, expression, purification, crystallization and preliminary X-ray analysis of an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase from Helicobacter pylori is reported; crystals of the protein were grown both in the presence and the absence of NADP.

  17. Identification of Electronic and Structural Descriptors of Adenosine Analogues Related to Inhibition of Leishmanial Glyceraldehyde-3-Phosphate Dehydrogenase

    Directory of Open Access Journals (Sweden)

    Norka B. H. Lozano

    2013-04-01

    Full Text Available Quantitative structure–activity relationship (QSAR studies were performed in order to identify molecular features responsible for the antileishmanial activity of 61 adenosine analogues acting as inhibitors of the enzyme glyceraldehyde 3-phosphate dehydrogenase of Leishmania mexicana (LmGAPDH. Density functional theory (DFT was employed to calculate quantum-chemical descriptors, while several structural descriptors were generated with Dragon 5.4. Variable selection was undertaken with the ordered predictor selection (OPS algorithm, which provided a set with the most relevant descriptors to perform PLS, PCR and MLR regressions. Reliable and predictive models were obtained, as attested by their high correlation coefficients, as well as the agreement between predicted and experimental values for an external test set. Additional validation procedures were carried out, demonstrating that robust models were developed, providing helpful tools for the optimization of the antileishmanial activity of adenosine compounds.

  18. Overexpression and nuclear accumulation of glyceraldehyde-3-phosphate dehydrogenase in a transgenic mouse model of Huntington's disease.

    Science.gov (United States)

    Senatorov, Vladimir V; Charles, Vinod; Reddy, P H; Tagle, Dan A; Chuang, De-Maw

    2003-03-01

    Huntington's disease is due to an expansion of CAG repeats in the huntingtin gene. Huntingtin interacts with several proteins including glyceraldehyde-3-phosphate dehydrogenase (GAPDH). We performed immunohistochemical analysis of GAPDH expression in the brains of transgenic mice carrying the huntingtin gene with 89 CAG repeats. In all wild-type animals examined, GAPDH was evenly distributed among the different cell types throughout the brain. In contrast, the majority of transgenic mice showed GAPDH overexpression, with the most prominent GAPDH changes observed in the caudate putamen, globus pallidus, neocortex, and hippocampal formation. Double staining for NeuN and GFAP revealed that GAPDH overexpression occurred exclusively in neurons. Nissl staining analysis of the neocortex and caudate putamen indicated 24 and 27% of cell loss in transgenic mice, respectively. Subcellular fluorescence analysis revealed a predominant increase in GAPDH immunostaining in the nucleus. Thus, we conclude that mutation of huntingtin is associated with GAPDH overexpression and nuclear translocation in discrete populations of brain neurons.

  19. Over-expression of PsGPD, a mushroom glyceraldehyde-3-phosphate dehydrogenase gene, enhances salt tolerance in rice plants.

    Science.gov (United States)

    Cho, Jung-Il; Lim, Hye-Min; Siddiqui, Zamin Shaheed; Park, Sung-Han; Kim, A-Ram; Kwon, Taek-Ryoun; Lee, Seong-Kon; Park, Soo-Chul; Jeong, Mi-Jeong; Lee, Gang-Seob

    2014-08-01

    Transgenic potatoes expressing glyceraldehyde-3-phosphate dehydrogenase (GPD), isolated from the oyster mushroom, Pleurotus sajor-caju, had increased tolerance to salt stress (Jeong et al. Biochem Biophys Res Commun 278:192-196, 2000). To examine the physiological mechanisms enhancing salt tolerance in GPD-transgenic rice plants, the salt tolerance of five GPD transgenic rice lines (T1-T5) derived from Dongjin rice cultivar were evaluated in a fixed 150 mM saline environment in comparison to two known wild-type rice cultivars, Dongjin (salt sensitive) and Pokali (salt tolerant). Transgenic lines, T2, T3, and T5, had a substantial increase in biomass and relative water content compared to Dongjin. Stomatal conductance and osmotic potential were higher in the GPD transgenic lines and were similar to those in Pokali. The results are discussed based on the comparative physiological response of GPD transgenic lines with those of the salt-sensitive and salt-tolerant rice cultivars.

  20. The sweet side of RNA regulation: glyceraldehyde-3-phosphate dehydrogenase as a noncanonical RNA-binding protein.

    Science.gov (United States)

    White, Michael R; Garcin, Elsa D

    2016-01-01

    The glycolytic protein, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), has a vast array of extraglycolytic cellular functions, including interactions with nucleic acids. GAPDH has been implicated in the translocation of transfer RNA (tRNA), the regulation of cellular messenger RNA (mRNA) stability and translation, as well as the regulation of replication and gene expression of many single-stranded RNA viruses. A growing body of evidence supports GAPDH-RNA interactions serving as part of a larger coordination between intermediary metabolism and RNA biogenesis. Despite the established role of GAPDH in nucleic acid regulation, it is still unclear how and where GAPDH binds to its RNA targets, highlighted by the absence of any conserved RNA-binding sequences. This review will summarize our current understanding of GAPDH-mediated regulation of RNA function. WIREs RNA 2016, 7:53-70. doi: 10.1002/wrna.1315 For further resources related to this article, please visit the WIREs website.

  1. Glyceraldehyde 3-phosphate dehydrogenase augments the intercellular transmission and toxicity of polyglutamine aggregates in a cell model of Huntington disease.

    Science.gov (United States)

    Mikhaylova, Elena R; Lazarev, Vladimir F; Nikotina, Alina D; Margulis, Boris A; Guzhova, Irina V

    2016-03-01

    The common feature of Huntington disease is the accumulation of oligomers or aggregates of mutant huntingtin protein (mHTT), which causes the death of a subset of striatal neuronal populations. The cytotoxic species can leave neurons and migrate to other groups of cells penetrating and damaging them in a prion-like manner. We hypothesized that the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH), previously shown to elevate the aggregation of mHTT, is associated with an increased efficiency of intercellular propagation of mHTT. GAPDH, on its own or together with polyglutamine species, was shown to be released into the extracellular milieu mainly from dying cells as assessed by a novel enzyme immunoassay, western blotting, and ultrafiltration. The conditioned medium of cells with growing GAPDH-polyQ aggregates was toxic to naïve cells, whereas depletion of the aggregates from the medium lowered this cytotoxicity. The GAPDH component of the aggregates was found to increase their toxicity by two-fold in comparison with polyQ alone. Furthermore, GAPDH-polyQ complexes were shown to penetrate acceptor cells and to increase the capacity of polyQ to prionize its intracellular homolog containing a repeat of 25 glutamine residues. Finally, inhibitors of intracellular transport showed that polyQ-GAPDH complexes, as well as GAPDH itself, penetrated cells using clathrin-mediated endocytosis. This suggested a pivotal role of the enzyme in the intercellular transmission of Huntington disease pathogenicity. In conclusion, GAPDH occurring in complexes with polyglutamine strengthens the prion-like activity and toxicity of the migrating aggregates. Aggregating polygluatmine tracts were shown to release from the cells over-expressing mutant huntingtin in a complex with glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The enzyme enhances the intracellular transport of aggregates to healthy cells, prionization of normal cellular proteins and finally cell death, thus

  2. The non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase (GAPN) of Sulfolobus solfataricus: a key-enzyme of the semi-phosphorylative branch of the Entner-Doudoroff pathway

    NARCIS (Netherlands)

    Ettema, T.J.G.; Ahmed, H.; Geerling, A.C.M.; Oost, van der J.; Siebers, B.

    2008-01-01

    Archaea utilize a branched modification of the classical Entner¿Doudoroff (ED) pathway for sugar degradation. The semi-phosphorylative branch merges at the level of glyceraldehyde 3-phosphate (GAP) with the lower common shunt of the Emden-Meyerhof-Parnas pathway. In Sulfolobus solfataricus two

  3. Purification and properties of glyceraldehyde-3-phosphate dehydrogenase from the skeletal muscle of the hibernating ground squirrel, Ictidomys tridecemlineatus

    Directory of Open Access Journals (Sweden)

    Ryan A.V. Bell

    2014-10-01

    Full Text Available Glyceraldehyde-3-phosphate dehydrogenase (GAPDH from the skeletal muscle of euthermic and torpid Ictidomys tridecemlineatus was purified to electrophoretic homogeneity using a novel method involving Blue-agarose and Phenyl-agarose chromatography. Kinetic analysis of the enzymes isolated from the two conditions suggested the existence of two structurally distinct proteins, with GAPDH V max being 40–60% less for the enzyme from the torpid condition (in both glycolytic and gluconeogenic directions as compared to the euthermic enzyme form. Thermal denaturation, in part determined by differential scanning fluorimetry, revealed that purified GAPDH from the torpid animals was significantly more stable that the enzyme from the euthermic condition. Mass spectrometry combined with Western blot analyses of purified GAPDH indicate that the cellular GAPDH population is extensively modified, with posttranslational phosphorylation, acetylation and methylation being detected. Global reduction in GAPDH tyrosine phosphorylation during torpor as well as site specific alterations in methylation sites suggests that that the stable changes observed in kinetic and structural GAPDH properties may be due to posttranslational modification of this enzyme during torpor. Taken together, these results suggest a stable suppression of GAPDH (possibly by some reversible posttranslational modification during ground squirrel torpor, which likely contributes to the overall reduction in carbohydrate metabolism when these animals switch to lipid fuels during dormancy.

  4. Glyceraldehyde-3-phosphate dehydrogenase aggregation inhibitor peptide: A potential therapeutic strategy against oxidative stress-induced cell death.

    Science.gov (United States)

    Itakura, Masanori; Nakajima, Hidemitsu; Semi, Yuko; Higashida, Shusaku; Azuma, Yasu-Taka; Takeuchi, Tadayoshi

    2015-11-13

    The glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has multiple functions, including mediating oxidative stress-induced neuronal cell death. This process is associated with disulfide-bonded GAPDH aggregation. Some reports suggest a link between GAPDH and the pathogenesis of several oxidative stress-related diseases. However, the pathological significance of GAPDH aggregation in disease pathogenesis remains unclear due to the lack of an effective GAPDH aggregation inhibitor. In this study, we identified a GAPDH aggregation inhibitor (GAI) peptide and evaluated its biological profile. The decapeptide GAI specifically inhibited GAPDH aggregation in a concentration-dependent manner. Additionally, the GAI peptide did not affect GAPDH glycolytic activity or cell viability. The GAI peptide also exerted a protective effect against oxidative stress-induced cell death in SH-SY5Y cells. This peptide could potentially serve as a tool to investigate GAPDH aggregation-related neurodegenerative and neuropsychiatric disorders and as a possible therapy for diseases associated with oxidative stress-induced cell death. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Synergistic interaction of glyceraldehydes-3-phosphate dehydrogenase and ArsJ, a novel organoarsenical efflux permease, confers arsenate resistance.

    Science.gov (United States)

    Chen, Jian; Yoshinaga, Masafumi; Garbinski, Luis D; Rosen, Barry P

    2016-06-01

    Microbial biotransformations are major contributors to the arsenic biogeocycle. In parallel with transformations of inorganic arsenic, organoarsenicals pathways have recently been recognized as important components of global cycling of arsenic. The well-characterized pathway of resistance to arsenate is reduction coupled to arsenite efflux. Here, we describe a new pathway of arsenate resistance involving biosynthesis and extrusion of an unusual pentavalent organoarsenical. A number of arsenic resistance (ars) operons have two genes of unknown function that are linked in these operons. One, gapdh, encodes the glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase. The other, arsJ, encodes a major facilitator superfamily (MFS) protein. The two genes were cloned from the chromosome of Pseudomonas aeruginosa. When expressed together, but not alone, in Escherichia coli, gapdh and arsJ specifically conferred resistance to arsenate and decreased accumulation of As(V). Everted membrane vesicles from cells expressing arsJ accumulated As(V) in the presence of purified GAPDH, D-glceraldehylde 3-phosphate (G3P) and NAD(+) . GAPDH forms the unstable organoarsenical 1-arseno-3-phosphoglycerate (1As3PGA). We propose that ArsJ is an efflux permease that extrudes 1As3PGA from cells, where it rapidly dissociates into As(V) and 3-phosphoglycerate (3PGA), creating a novel pathway of arsenate resistance.

  6. Characterization of the highly active fragment of glyceraldehyde-3-phosphate dehydrogenase gene promoter for recombinant protein expression in Pleurotus ostreatus.

    Science.gov (United States)

    Yin, Chaomin; Zheng, Liesheng; Zhu, Jihong; Chen, Liguo; Ma, Aimin

    2015-03-01

    Developing efficient native promoters is important for improving recombinant protein expression by fungal genetic engineering. The promoter region of glyceraldehyde-3-phosphate dehydrogenase gene in Pleurotus ostreatus (Pogpd) was isolated and optimized by upstream truncation. The activities of these promoters with different lengths were further confirmed by fluorescence, quantitative real-time PCR and Western blot analysis. A truncated Pogpd-P2 fragment (795 bp) drove enhanced green fluorescence protein (egfp) gene expression in P. ostreatus much more efficiently than full-length Pogpd-P1. Further truncating Pogpd-P2 to 603, 403 and 231 bp reduced the eGFP expression significantly. However, the 403-bp fragment between -356 bp and the start codon was the minimal but sufficient promoter element for eGFP expression. Compact native promoters for genetic engineering of P. ostreatus were successfully developed and validated in this study. This will broaden the preexisting repertoire of fungal promoters for biotechnology application. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. SIRT1 interacts with and protects glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from nuclear translocation: Implications for cell survival after irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Joo, Hyun-Yoo [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Laboratory of Biochemistry, School of Life Sciences and Biotechnology, Korea University, Seoul 136-713 (Korea, Republic of); Woo, Seon Rang; Shen, Yan-Nan; Yun, Mi Yong; Shin, Hyun-Jin; Park, Eun-Ran; Kim, Su-Hyeon; Park, Jeong-Eun; Ju, Yeun-Jin; Hong, Sung Hee; Hwang, Sang-Gu [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of); Cho, Myung-Haing [Laboratory of Toxicology, College of Veterinary Medicine, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Joon, E-mail: joonkim@korea.ac.kr [Laboratory of Biochemistry, School of Life Sciences and Biotechnology, Korea University, Seoul 136-713 (Korea, Republic of); Lee, Kee-Ho, E-mail: khlee@kirams.re.kr [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, Seoul 139-706 (Korea, Republic of)

    2012-08-10

    Highlights: Black-Right-Pointing-Pointer SIRT1 serves to retain GAPDH in the cytosol, preventing GAPDH nuclear translocation. Black-Right-Pointing-Pointer When SIRT1 is depleted, GAPDH translocation occurs even in the absence of stress. Black-Right-Pointing-Pointer Upon irradiation, SIRT1 interacts with GAPDH. Black-Right-Pointing-Pointer SIRT1 prevents irradiation-induced nuclear translocation of GAPDH. Black-Right-Pointing-Pointer SIRT1 presence rather than activity is essential for inhibiting GAPDH translocation. -- Abstract: Upon apoptotic stimulation, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a cytosolic enzyme normally active in glycolysis, translocates into the nucleus and activates an apoptotic cascade therein. In the present work, we show that SIRT1 prevents nuclear translocation of GAPDH via interaction with GAPDH. SIRT1 depletion triggered nuclear translocation of cytosolic GAPDH even in the absence of apoptotic stress. Such translocation was not, however, observed when SIRT1 enzymatic activity was inhibited, indicating that SIRT1 protein per se, rather than the deacetylase activity of the protein, is required to inhibit GAPDH translocation. Upon irradiation, SIRT1 prevented irradiation-induced nuclear translocation of GAPDH, accompanied by interaction of SIRT1 and GAPDH. Thus, SIRT1 functions to retain GAPDH in the cytosol, protecting the enzyme from nuclear translocation via interaction with these two proteins. This serves as a mechanism whereby SIRT1 regulates cell survival upon induction of apoptotic stress by means that include irradiation.

  8. In Silico Identification and in Vitro Activity of Novel Natural Inhibitors of Trypanosoma brucei Glyceraldehyde-3-phosphate-dehydrogenase

    Directory of Open Access Journals (Sweden)

    Fabian C. Herrmann

    2015-09-01

    Full Text Available As part of our ongoing efforts to identify natural products with activity against pathogens causing neglected tropical diseases, we are currently performing an extensive screening of natural product (NP databases against a multitude of protozoan parasite proteins. Within this project, we screened a database of NPs from a commercial supplier, AnalytiCon Discovery (Potsdam, Germany, against Trypanosoma brucei glyceraldehyde-3-phosphate dehydrogenase (TbGAPDH, a glycolytic enzyme whose inhibition deprives the parasite of energy supply. NPs acting as potential inhibitors of the mentioned enzyme were identified using a pharmacophore-based virtual screening and subsequent docking of the identified hits into the active site of interest. In a set of 700 structures chosen for the screening, 13 (1.9% were predicted to possess significant affinity towards the enzyme and were therefore tested in an in vitro enzyme assay using recombinant TbGAPDH. Nine of these in silico hits (69% showed significant inhibitory activity at 50 µM, of which two geranylated benzophenone derivatives proved to be particularly active with IC50 values below 10 µM. These compounds also showed moderate in vitro activity against T. brucei rhodesiense and may thus represent interesting starting points for further optimization.

  9. The influence of oxygen on radiation-induced structural and functional changes in glyceraldehyde-3-phosphate dehydrogenase and lactate dehydrogenase

    Science.gov (United States)

    Rodacka, Aleksandra; Serafin, Eligiusz; Bubinski, Michal; Krokosz, Anita; Puchala, Mieczyslaw

    2012-07-01

    Proteins are major targets for oxidative damage due to their abundance in cells and high reactivity with free radicals. In the present study we examined the influence of oxygen on radiation-induced inactivation and structural changes of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and lactate dehydrogenase (LDH). We chose these two enzymes because they occur at high concentrations and participate in the most important processes in organisms; furthermore, they show considerable similarity in their structure. Protein solutions were irradiated with X-rays in doses ranging from 0.1 to 0.7 kGy, in air and N2O. The much higher radiation inactivation of GAPDH as compared to LDH is correlated with substantially greater structural changes in this protein, mainly involving the loss of free thiol groups (-SH). Of lesser importance in the differentiation of the radiosensitivity of the studied enzymes are tryptophan residues. Molecular oxygen, present during irradiation, increased to a significantly greater extent the inactivation and structural changes of GAPDH than that of LDH. The results suggest that the greater effect of oxygen on GAPDH is due to the higher efficiency of the superoxide radical, the higher amount of hydroperoxides generated, and the higher degree of unfolding of this protein.

  10. Expression, purification, crystallization and preliminary X-ray analysis of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from Helicobacter pylori

    Energy Technology Data Exchange (ETDEWEB)

    Elliott, Paul R.; Mohammad, Shabaz; Melrose, Helen J.; Moody, Peter C. E., E-mail: pcem1@leicester.ac.uk [Henry Wellcome Laboratories for Structural Biology, University of Leicester, Leicester LE1 9HN (United Kingdom)

    2008-08-01

    Glyceraldehyde-3-phosphate dehydrogenase B from H. pylori has been cloned, expressed, purified and crystallized in the presence of NAD. Crystals of GAPDHB diffracted to 2.8 Å resolution and belonged to space group P6{sub 5}22, with unit-cell parameters a = b = 166.1, c = 253.1 Å. Helicobacter pylori is a dangerous human pathogen that resides in the upper gastrointestinal tract. Little is known about its metabolism and with the onset of antibiotic resistance new treatments are required. In this study, the expression, purification, crystallization and preliminary X-ray diffraction of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from H. pylori are reported.

  11. Glyceraldehyde 3-phosphate dehydrogenase and galectin from Dirofilaria immitis participate in heartworm disease endarteritis via plasminogen/plasmin system.

    Science.gov (United States)

    González-Miguel, Javier; Larrazabal, Carmen; Loa-Mesón, Diana; Siles-Lucas, Mar; Simón, Fernando; Morchón, Rodrigo

    2016-06-15

    The interaction between parasitic protozoa and helminths, both in the blood and in tissues and the fibrinolytic system of their hosts is usually considered as a survival parasite mechanism since this system is the physiological route responsible for degrading fibrin clots. The broad-range proteolytic activity of plasmin, the final enzyme of the route, implies that its recruitment by these parasites is an important mechanism that mediates their invasion and establishment in the hosts. However, recent studies have proposed a dual role for plasmin by linking its over-production with pathological mechanisms at vascular level. Most of these studies have been conducted in Dirofilaria immitis, a blood-borne parasite that survives in the pulmonary arteries of its host for years while it produces a chronic inflammatory disease, whose main pathogenic mechanism is the appearance of proliferative endarteritis. Recently, the participation of two proteins from D. immitis, glyceraldehyde 3-phosphate dehydrogenase (DiGAPDH) and galectin (DiGAL), in the activation of the fibrinolytic system of its host has been demonstrated, which has been a priori associated with parasite survival mechanisms. The aim of the present paper was to study the role of plasmin generated by these proteins in the emergence of proliferative endarteritis. An in vitro model of canine endothelial and smooth muscle cells, as well as the two parasitic recombinant proteins were employed. The results show that DiGAPDH and DiGAL stimulate the proliferation and migration of both cell types, as well as the degradation of the extracellular matrix (ECM) via plasminogen (PLG)/plasmin system, being all of these mechanisms related to the appearance of proliferative endarteritis. Due to the high degree of evolutionary conservation of these antigens, these data support the hypothesis of the survival/pathology ambivalence in the interactions between parasites and the fibrinolytic system of their hosts and represent an

  12. Active site cysteine-null glyceraldehyde-3-phosphate dehydrogenase (GAPDH) rescues nitric oxide-induced cell death.

    Science.gov (United States)

    Kubo, Takeya; Nakajima, Hidemitsu; Nakatsuji, Masatoshi; Itakura, Masanori; Kaneshige, Akihiro; Azuma, Yasu-Taka; Inui, Takashi; Takeuchi, Tadayoshi

    2016-02-29

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a homotetrameric enzyme involved in a key step of glycolysis, also has a role in mediating cell death under nitrosative stress. Our previous reports suggest that nitric oxide-induced intramolecular disulfide-bonding GAPDH aggregation, which occurs through oxidation of the active site cysteine (Cys-152), participates in a mechanism to account for nitric oxide-induced death signaling in some neurodegenerative/neuropsychiatric disorders. Here, we demonstrate a rescue strategy for nitric oxide-induced cell death accompanied by GAPDH aggregation in a mutant with a substitution of Cys-152 to alanine (C152A-GAPDH). Pre-incubation of purified wild-type GAPDH with C152A-GAPDH under exposure to nitric oxide inhibited wild-type GAPDH aggregation in a concentration-dependent manner in vitro. Several lines of structural analysis revealed that C152A-GAPDH extensively interfered with nitric oxide-induced GAPDH-amyloidogenesis. Overexpression of doxycycline-inducible C152A-GAPDH in SH-SY5Y neuroblastoma significantly rescued nitric oxide-induced death, concomitant with the decreased formation of GAPDH aggregates. Further, both co-immunoprecipitation assays and simulation models revealed a heterotetramer composed of one dimer each of wild-type GAPDH and C152A-GAPDH. These results suggest that the C152A-GAPDH mutant acts as a dominant-negative molecule against GAPDH aggregation via the formation of this GAPDH heterotetramer. This study may contribute to a new therapeutic approach utilizing C152A-GAPDH against brain damage in nitrosative stress-related disorders.

  13. Glyceraldehyde-3-phosphate dehydrogenase is largely unresponsive to low regulatory levels of hydrogen peroxide in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Sousa-Lopes Ana

    2010-12-01

    Full Text Available Abstract Background The reversible oxidation of protein SH groups has been considered to be the basis of redox regulation by which changes in hydrogen peroxide (H2O2 concentrations may control protein function. Several proteins become S-glutathionylated following exposure to H2O2 in a variety of cellular systems. In yeast, when using a high initial H2O2 dose, glyceraldehyde-3-phosphate dehydrogenase (GAPDH was identified as the major target of S-glutathionylation which leads to reversible inactivation of the enzyme. GAPDH inactivation by H2O2 functions to reroute carbohydrate flux to produce NADPH. Here we report the effect of low regulatory H2O2 doses on GAPDH activity and expression in Saccharomyces cerevisiae. Results A calibrated and controlled method of H2O2 delivery - the steady-state titration - in which cells are exposed to constant, low, and known H2O2 concentrations, was used in this study. This technique, contrary to the common bolus addition, allows determining which H2O2 concentrations trigger specific biological responses. This work shows that both in exponential- and stationary-phase cells, low regulatory H2O2 concentrations induce a large upregulation of catalase, a fingerprint of the cellular oxidative stress response, but GAPDH oxidation and the ensuing activity decrease are only observed at death-inducing high H2O2 doses. GAPDH activity is constant upon incubation with sub-lethal H2O2 doses, but in stationary-phase cells there is a differential response in the expression of the three GAPDH isoenzymes: Tdh1p is strongly upregulated while Tdh2p/Tdh3p are slightly downregulated. Conclusions In yeast GAPDH activity is largely unresponsive to low to moderate H2O2 doses. This points to a scenario where (a cellular redoxins efficiently cope with levels of GAPDH oxidation induced by a vast range of sub-lethal H2O2 concentrations, (b inactivation of GAPDH cannot be considered a sensitive biomarker of H2O2-induced oxidation in vivo

  14. The glyceraldehyde-3-phosphate dehydrogenase promoter of the food yeast Candida utilis strain NRRL Y-660 is functional in Agrobacterium tumefaciens.

    Science.gov (United States)

    González, Tania; Eng, Felipe; Fraga, Reinaldo; Fonseca, Jennifer; Amores, Isis

    2013-11-01

    The glyceraldehyde-3-phosphate dehydrogenase promoter of the food yeast Candida utilis strain NRRL Y-660 was cloned to create a novel integrative vector for Agrobacterium tumefaciens-mediated transformation. The new binary vector harbors β-glucuronidase activity as reporter and kanamicin/geneticin resistance as selection marker. Recombinant clones of A. tumefaciens show kanamycin resistance and high β-glucuronidase activity under the control of the C. utilis promoter. This finding can be explained by the presence of a prokaryotic core in the yeast promoter, predicted by in silico analysis of the sequence. This is the first report about functionality of a yeast promoter in A. tumefaciens.

  15. Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-d-glyceric acid.

    Science.gov (United States)

    Ladame, Sylvain; Castilho, Marcelo S; Silva, Carlos H T P; Denier, Colette; Hannaert, Véronique; Périé, Jacques; Oliva, Glaucius; Willson, Michèle

    2003-11-01

    We report here the first crystal structure of a stable isosteric analogue of 1,3-bisphospho-d-glyceric acid (1,3-BPGA) bound to the catalytic domain of Trypanosoma cruzi glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH) in which the two phosphoryl moieties interact with Arg249. This complex possibly illustrates a step of the catalytic process by which Arg249 may induce compression of the product formed, allowing its expulsion from the active site. Structural modifications were introduced into this isosteric analogue and the respective inhibitory effects of the resulting diphosphorylated compounds on T. cruzi and Trypanosoma brucei gGAPDHs were investigated by enzymatic inhibition studies, fluorescence spectroscopy, site-directed mutagenesis, and molecular modelling. Despite the high homology between the two trypanomastid gGAPDHs (> 95%), we have identified specific interactions that could be used to design selective irreversible inhibitors against T. cruzi gGAPDH.

  16. Comparison of the regulation, metabolic functions, and roles in virulence of the glyceraldehyde-3-phosphate dehydrogenase homologues gapA and gapB in Staphylococcus aureus.

    Science.gov (United States)

    Purves, Joanne; Cockayne, Alan; Moody, Peter C E; Morrissey, Julie A

    2010-12-01

    The Gram-positive bacterium Staphylococcus aureus contains two glyceraldehyde-3-phosphate dehydrogenase (GAPDH) homologues known as GapA and GapB. GapA has been characterized as a functional GAPDH protein, but currently there is no biological evidence for the role of GapB in metabolism in S. aureus. In this study we show through a number of complementary methods that S. aureus GapA is essential for glycolysis while GapB is essential in gluconeogenesis. These proteins are reciprocally regulated in response to glucose concentrations, and both are influenced by the glycolysis regulator protein GapR, which is the first demonstration of the role of this regulator in S. aureus and the first indication that GapR homologues control genes other than those within the glycolytic operon. Furthermore, we show that both GapA and GapB are important in the pathogenesis of S. aureus in a Galleria mellonella model of infection, showing for the first time in any bacteria that both glycolysis and gluconeogenesis have important roles in virulence.

  17. A Phytophthora sojae gene of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) induced in host infection and its anti-oxidative function in yeast

    Institute of Scientific and Technical Information of China (English)

    ZENG Juan; WANG Yuanchao; SHEN Gui; ZHENG Xiaobo

    2006-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a multifunctional protein well defined in eukaryotes, especially in mammalian and Saccharomyces cerevisiae. Using the method of suppression subtractive hybridization (SSH), we identified a Phytophthora sojae cDNA coding GAPDH, which was up-regulated during the early stage of soybean infection. The termed PsGapdh gene possessed three copies in the P. sojae genome. Its amino acid sequence harbored overall conserved domain of GADPH, homologous closest to GapC1 of Achlya bisexualis (oomycete) and adjoined to GapC2s of Odontella sinensis and Phaeodactylum tricornutum (diatom), on the C-Ⅱbranch of subfamily GapC in phylogeny tree of GAPDH. The transcriptional level of PsGapdh was up-regulated throughout early infection. Heterogenous expression of PsGapdh in the yeast tdh1-deleted mutant could rescue growth arrest under continuous exposure to H2O2. These results indicated active roles of PsGapdh in pathogen-host interaction and anti-oxidation.

  18. Taurine chloramine is more selective than hypochlorous acid at targeting critical cysteines and inactivating creatine kinase and glyceraldehyde-3-phosphate dehydrogenase.

    Science.gov (United States)

    Peskin, Alexander V; Winterbourn, Christine C

    2006-01-01

    Hypochlorous acid (HOCl) and chloramines are produced by the neutrophil enzyme, myeloperoxidase. Both react readily with thiols, although chloramines differ from HOCl in discriminating between low molecular weight thiols on the basis of their pKa. Here, we have compared the reactivity of HOCl and taurine chloramine with thiol proteins by examining inactivation of creatine kinase (CK) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). With both enzymes, loss of activity paralleled thiol loss. For CK both were complete at a 1:1 taurine chloramine:thiol mole ratio. For GAPDH each chloramine oxidized two thiols. Three times more HOCl than taurine chloramine was required for inactivation, indicating that HOCl is less thiol specific. Competition studies showed that thiols of CK were 4 times more reactive with taurine chloramine than thiols of GAPDH (rate constants of 1200 and 300 M-1s-1 respectively). These compare with 205 M-1s-1 for cysteine and are consistent with their lower pKa's. Both enzymes were equally susceptible to HOCl. GSH competed directly with the enzyme thiols for taurine chloramine and protected against oxidative inactivation. At lower GSH concentrations, mixed disulfides were formed. We propose that chloramines should preferentially attack proteins with low pKa thiols and this could be important in regulatory processes.

  19. Detection of a mutation in the intron of Sperm-specific glyceraldehyde-3-phosphate dehydrogenase gene in patients with fibrous sheath dysplasia of the sperm flagellum.

    Science.gov (United States)

    Elkina, Y L; Kuravsky, M L; Bragina, E E; Kurilo, L F; Khayat, S S; Sukhomlinova, M Y; Schmalhausen, E V

    2017-03-01

    The fibrous sheath is a unique cytoskeletal structure surrounding the axoneme and outer dense fibres of the sperm flagellum. Dysplasia of the fibrous sheath (DFS) is a defect of spermatozoa observed in severe asthenozoospermic patients and characterised by morphologically abnormal flagella with distorted fibrous sheaths. Sperm-specific glyceraldehyde-3-phosphate dehydrogenase (GAPDS) is a glycolytic enzyme that is tightly associated with the fibrous sheath of the sperm flagellum. The enzymatic activity of GAPDS was investigated in sperm samples of seven patients with DFS and compared to that of normal spermatozoa (n = 10). The difference in GAPDS activity in DFS and normal spermatozoa was statistically significant (0.19 ± 0.11 and 0.75 ± 0.11 μmol NADH per min per mg protein respectively). Immunochemical staining revealed irregular distribution of GAPDS in the flagellum of DFS spermatozoa. Other five samples with typical alterations in the fibrous sheath were assayed for mutations within human GAPDS gene. In all five cases, a replacement of guanine by adenine was revealed in the intron region between the sixth and the seventh exons of GAPDS. It is assumed that the deficiency in GAPDS observed in most DFS sperm samples is ascribable to a disorder in the regulation of GAPDS expression caused by the mutation in the intron region of GAPDS gene.

  20. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH interaction with 3' ends of Japanese encephalitis virus RNA and colocalization with the viral NS5 protein

    Directory of Open Access Journals (Sweden)

    Chou Shih-Jie

    2009-04-01

    Full Text Available Abstract Replication of the Japanese encephalitis virus (JEV genome depends on host factors for successfully completing their life cycles; to do this, host factors have been recruited and/or relocated to the site of viral replication. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, a cellular metabolic protein, was found to colocalize with viral RNA-dependent RNA polymerase (NS5 in JEV-infected cells. Subcellular fractionation further indicated that GAPDH remained relatively constant in the cytosol, while increasing at 12 to 24 hours postinfection (hpi and decreasing at 36 hpi in the nuclear fraction of infected cells. In contrast, the redistribution patterns of GAPDH were not observed in the uninfected cells. Co-immunoprecipitation of GAPDH and JEV NS5 protein revealed no direct protein-protein interaction; instead, GAPDH binds to the 3' termini of plus- and minus-strand RNAs of JEV by electrophoretic mobility shift assays. Accordingly, GAPDH binds to the minus strand more efficiently than to the plus strand of JEV RNAs. This study highlights the findings that infection of JEV changes subcellular localization of GAPDH suggesting that this metabolic enzyme may play a role in JEV replication.

  1. Comparison of the Regulation, Metabolic Functions, and Roles in Virulence of the Glyceraldehyde-3-Phosphate Dehydrogenase Homologues gapA and gapB in Staphylococcus aureus▿

    Science.gov (United States)

    Purves, Joanne; Cockayne, Alan; Moody, Peter C. E.; Morrissey, Julie A.

    2010-01-01

    The Gram-positive bacterium Staphylococcus aureus contains two glyceraldehyde-3-phosphate dehydrogenase (GAPDH) homologues known as GapA and GapB. GapA has been characterized as a functional GAPDH protein, but currently there is no biological evidence for the role of GapB in metabolism in S. aureus. In this study we show through a number of complementary methods that S. aureus GapA is essential for glycolysis while GapB is essential in gluconeogenesis. These proteins are reciprocally regulated in response to glucose concentrations, and both are influenced by the glycolysis regulator protein GapR, which is the first demonstration of the role of this regulator in S. aureus and the first indication that GapR homologues control genes other than those within the glycolytic operon. Furthermore, we show that both GapA and GapB are important in the pathogenesis of S. aureus in a Galleria mellonella model of infection, showing for the first time in any bacteria that both glycolysis and gluconeogenesis have important roles in virulence. PMID:20876289

  2. Involvement of a cytoplasmic glyceraldehyde-3-phosphate dehydrogenase GapC-2 in low-phosphate-induced anthocyanin accumulation in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    WANG XiYao; CHEN YiFang; ZOU JunJie; WU WeiHua

    2007-01-01

    Phosphorous is one of the essential mineral elements for plant growth and development. Typically,the shoots of plant seedlings usually turn a dark-brown or purple colour under low-Pi stress. Using protein 2-D gel and peptide mass fingerprinting mapping (PMF) methods,a cytoplasmic glyceraldehyde-3-phosphate dehydrogenase GapC-2 was identified as a low-Pi responsive protein in Arabidopsis plants. Expression of AtGapC-2 protein was significantly decreased after 4 d of low-Pi stress. Two independent T-DNA insertion lines of GapC-2 gene (At1g13440) showed a hypersensitive phenotype in response to low-Pi stress compared with wild type plants,while the transgenic complementation lines of the mutants showed a similar phenotype to the wild type. These results indicate that AtGapC-2 may play an important role in Arabidopsis responses to low-Pi stress,possibly by regulation of glycolysis-associated "Pi-pool" and accumulation of anthocyanin pigments in plants.

  3. A de novo NADPH generation pathway for improving lysine production of Corynebacterium glutamicum by rational design of the coenzyme specificity of glyceraldehyde 3-phosphate dehydrogenase.

    Science.gov (United States)

    Bommareddy, Rajesh Reddy; Chen, Zhen; Rappert, Sugima; Zeng, An-Ping

    2014-09-01

    Engineering the cofactor availability is a common strategy of metabolic engineering to improve the production of many industrially important compounds. In this work, a de novo NADPH generation pathway is proposed by altering the coenzyme specificity of a native NAD-dependent glyceraldehyde 3-phosphate dehydrogenase (GAPDH) to NADP, which consequently has the potential to produce additional NADPH in the glycolytic pathway. Specifically, the coenzyme specificity of GAPDH of Corynebacterium glutamicum is systematically manipulated by rational protein design and the effect of the manipulation for cellular metabolism and lysine production is evaluated. By a combinatorial modification of four key residues within the coenzyme binding sites, different GAPDH mutants with varied coenzyme specificity were constructed. While increasing the catalytic efficiency of GAPDH towards NADP enhanced lysine production in all of the tested mutants, the most significant improvement of lysine production (~60%) was achieved with the mutant showing similar preference towards both NAD and NADP. Metabolic flux analysis with (13)C isotope studies confirmed that there was no significant change of flux towards the pentose phosphate pathway and the increased lysine yield was mainly attributed to the NADPH generated by the mutated GAPDH. The present study highlights the importance of protein engineering as a key strategy in de novo pathway design and overproduction of desired products.

  4. Glyceraldehyde-3-phosphate dehydrogenase-monoamine oxidase B-mediated cell death-induced by ethanol is prevented by rasagiline and 1-R-aminoindan.

    Science.gov (United States)

    Ou, Xiao-Ming; Lu, Deyin; Johnson, Chandra; Chen, Kevin; Youdim, Moussa B H; Rajkowska, Grazyna; Shih, Jean C

    2009-08-01

    The inhibitors of monoamine oxidase B (MAO B) are effectively used as therapeutic drugs for neuropsychiatric and neurodegenerative diseases. However, their mechanism of action is not clear, since the neuroprotective effect of MAO B inhibitors is associated with the blockage of glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-death cascade, rather than the inhibition of MAO B. Here, we provide evidence that GAPDH potentiates the ethanol-induced activity of MAO B and brain cell toxicity. The levels of nuclear GAPDH and MAO B activity are significantly increased in brain-derived cell lines upon 75 mM ethanol-induced cell death. Over-expression of GAPDH in cells enhances ethanol-induced cell death, and also increases the ethanol-induced activation of MAO B. In contrast, the MAO B inhibitors rasagiline and selegiline (0.25 nM) and the rasagiline metabolite, 1-R-aminoindan (1 muM) decreases the ethanol-induced MAO B, prevents nuclear translocation of GAPDH and reduces cell death. In addition, GAPDH interacts with transforming growth factor-beta-inducible early gene (TIEG2), a transcriptional activator for MAO B, and this interaction is increased in the nucleus by ethanol but reduced by MAO B inhibitors and 1-R-aminoindan. Furthermore, silencing TIEG2 using RNAi significantly reduces GAPDH-induced MAO B upregulation and neurotoxicity. In summary, ethanol-induced cell death, attenuated by MAO B inhibitors, may result from disrupting the movement of GAPDH with the transcriptional activator into the nucleus and secondly inhibit MAO B gene expression. Thus, the neuroprotective effects of rasagiline or 1-R-aminoindan on ethanol-induced cell death mediated by a novel GAPDH-MAO B pathway may provide a new insight in the treatment of neurobiological diseases including alcohol-use disorders.

  5. Inter-species variation in the oligomeric states of the higher plant Calvin cycle enzymes glyceraldehyde-3-phosphate dehydrogenase and phosphoribulokinase.

    Science.gov (United States)

    Howard, Thomas P; Lloyd, Julie C; Raines, Christine A

    2011-07-01

    In darkened leaves the Calvin cycle enzymes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) form a regulatory multi-enzyme complex with the small chloroplast protein CP12. GAPDH also forms a high molecular weight regulatory mono-enzyme complex. Given that there are different reports as to the number and subunit composition of these complexes and that enzyme regulatory mechanisms are known to vary between species, it was reasoned that protein-protein interactions may also vary between species. Here, this variation is investigated. This study shows that two different tetramers of GAPDH (an A2B2 heterotetramer and an A4 homotetramer) have the capacity to form part of the PRK/GAPDH/CP12 complex. The role of the PRK/GAPDH/CP12 complex is not simply to regulate the 'non-regulatory' A4 GAPDH tetramer. This study also demonstrates that the abundance and nature of PRK/GAPDH/CP12 interactions are not equal in all species and that whilst NAD enhances complex formation in some species, this is not sufficient for complex formation in others. Furthermore, it is shown that the GAPDH mono-enzyme complex is more abundant as a 2(A2B2) complex, rather than the larger 4(A2B2) complex. This smaller complex is sensitive to cellular metabolites indicating that it is an important regulatory isoform of GAPDH. This comparative study has highlighted considerable heterogeneity in PRK and GAPDH protein interactions between closely related species and the possible underlying physiological basis for this is discussed.

  6. A recombinant plasmid of composite cysteine proteinase inhibitor/glyceraldehyde-3-phosphate dehydrogenase gene of periodic Brugia malayi functions on DNA immunity in the host

    Directory of Open Access Journals (Sweden)

    Z Fang

    2016-01-01

    Full Text Available Objectives: Both cysteine proteinase inhibitors (CPIs and glyceraldehyde-3-phosphate dehydrogenase (GAPDH play important roles in the pathogenesis of parasites and their relationship with the hosts. We constructed a new eukaryotic recombinant expression plasmid pcDNA3.1(+-BmCPI/BmGAPDH of periodic Brugia malayi for investigation of the DNA vaccine-elicited immune responses. Materials and Methods: We cloned a gene encoding the CPIs and GAPDH from periodic B. malayi into vector pcDNA3.1. The composited plasmid or the control was injected into the tibialis anterior muscle of the hind leg in BALB/c mice, respectively. The target genes were detected by reverse transcription-polymerase chain reaction in muscle tissues. The stimulation index (SI of T-lymphocyte proliferation and the levels of interferon-gamma (INF-g and interleukin-4 ( IL-4 in serum were detected by thiazolyl blue tetrazolium blue and enzyme-linked immunosorbent assays. Results: The pcDNA3.1(+-BmCPI/BmGAPDH was amplified from muscle tissues of the mice after immunisation. The SI of the immunised group was significantly higher than that of the two control groups (P < 0.05. The levels of INF-g and IL-4 of pcDNA3.1(+-BmCPI/BmGAPDH group were both higher than those of the two control groups (P < 0.05. The level of INF-g of pcDNA3.1(+-BmCPI/BmGAPDH group was significantly higher than that of pcDNA3.1(+-BmCPI/CpG group (P < 0.05. Conclusions: We conclude that the recombinant plasmid pcDNA3.1(+-BmCPI/BmGAPDH could elicit specific humoural and cellular immune responses in mice.

  7. Role of secreted glyceraldehyde-3-phosphate dehydrogenase in the infection mechanism of enterohemorrhagic and enteropathogenic Escherichia coli: interaction of the extracellular enzyme with human plasminogen and fibrinogen.

    Science.gov (United States)

    Egea, L; Aguilera, L; Giménez, R; Sorolla, M A; Aguilar, J; Badía, J; Baldoma, L

    2007-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC 1.2.1.12) is an anchorless, multifunctional protein displayed on the surface of several fungi and Gram-positive pathogens, which contributes to their adhesion and virulence. To date a role for extracellular GAPDH in the pathogenesis of Gram-negative bacteria has not been described. The aim of this study was to analyze the extracellular localization of GAPDH in enterohemorrhagic (EHEC) and enteropathogenic (EPEC) Escherichia coli strains and to examine its interaction with host components that could be related to the infection mechanism. Recombinant E. coli GAPDH was purified and polyclonal antibodies were obtained. Western blotting and immunoelectron microscopy showed that GAPDH is located on the bacterial surface and released to the culture medium of EHEC and EPEC strains. GAPDH export in these Gram-negative pathogens depends on the external medium, is not mediated by vesicles and leads to an extracellular active enzyme. Non-pathogenic E. coli strains do not secrete GAPDH. Two-dimensional electrophoresis analysis showed that in E. coli GAPDH is present at least in two major forms with different isoelectric points. Of these forms, the more basic is secreted. Purified GAPDH was found to bind human plasminogen and fibrinogen in Far-Western blot and ELISA-based assays. In addition, GAPDH remained associated with colonic Caco-2 epithelial cells after adhesion of EHEC or EPEC. These observations indicate that exported GAPDH may act as a virulence factor which could contribute to EHEC and EPEC pathogenesis. This is the first description of an extracellular localization for this enzyme, with a function other than its glycolytic role in Gram-negative pathogens.

  8. Oxygen transfer as a tool for fine-tuning recombinant protein production by Pichia pastoris under glyceraldehyde-3-phosphate dehydrogenase promoter.

    Science.gov (United States)

    Güneş, Hande; Çalık, Pınar

    2016-07-01

    Effects of oxygen transfer on recombinant protein production by Pichia pastoris under glyceraldehyde-3-phosphate dehydrogenase promoter were investigated. Recombinant glucose isomerase was chosen as the model protein. Two groups of oxygen transfer strategies were applied, one of which was based on constant oxygen transfer rate where aeration rate was Q O/V = 3 and 10 vvm, and agitation rate was N = 900 min(-1); while the other one was based on constant dissolved oxygen concentrations, C DO = 5, 10, 15, 20 and 40 % in the fermentation broth, by using predetermined exponential glucose feeding with μ o = 0.15 h(-1). The highest cell concentration was obtained as 44 g L(-1) at t = 9 h of the glucose fed-batch phase at C DO = 20 % operation while the highest volumetric and specific enzyme activities were obtained as 4440 U L(-1) and 126 U g(-1) cell, respectively at C DO = 15 % operation. Investigation of specific enzyme activities revealed that keeping C DO at 15 % was more advantageous with an expense of relatively higher by-product formation and lower specific cell growth rate. For this strategy, the highest oxygen transfer coefficient and oxygen uptake rate were K L a = 0.045 s(-1) and OUR = 8.91 mmol m(-3) s(-1), respectively.

  9. Protein S-Bacillithiolation Functions in Thiol Protection and Redox Regulation of the Glyceraldehyde-3-Phosphate Dehydrogenase Gap in Staphylococcus aureus Under Hypochlorite Stress.

    Science.gov (United States)

    Imber, Marcel; Huyen, Nguyen Thi Thu; Pietrzyk-Brzezinska, Agnieszka J; Loi, Vu Van; Hillion, Melanie; Bernhardt, Jörg; Thärichen, Lena; Kolšek, Katra; Saleh, Malek; Hamilton, Chris J; Adrian, Lorenz; Gräter, Frauke; Wahl, Markus C; Antelmann, Haike

    2017-01-18

    Bacillithiol (BSH) is the major low-molecular-weight thiol of the human pathogen Staphylococcus aureus. In this study, we used OxICAT and Voronoi redox treemaps to quantify hypochlorite-sensitive protein thiols in S. aureus USA300 and analyzed the role of BSH in protein S-bacillithiolation. The OxICAT analyses enabled the quantification of 228 Cys residues in the redox proteome of S. aureus USA300. Hypochlorite stress resulted in >10% increased oxidation of 58 Cys residues (25.4%) in the thiol redox proteome. Among the highly oxidized sodium hypochlorite (NaOCl)-sensitive proteins are five S-bacillithiolated proteins (Gap, AldA, GuaB, RpmJ, and PpaC). The glyceraldehyde-3-phosphate (G3P) dehydrogenase Gap represents the most abundant S-bacillithiolated protein contributing 4% to the total Cys proteome. The active site Cys151 of Gap was very sensitive to overoxidation and irreversible inactivation by hydrogen peroxide (H2O2) or NaOCl in vitro. Treatment with H2O2 or NaOCl in the presence of BSH resulted in reversible Gap inactivation due to S-bacillithiolation, which could be regenerated by the bacilliredoxin Brx (SAUSA300_1321) in vitro. Molecular docking was used to model the S-bacillithiolated Gap active site, suggesting that formation of the BSH mixed disulfide does not require major structural changes. Conclusion and Innovation: Using OxICAT analyses, we identified 58 novel NaOCl-sensitive proteins in the pathogen S. aureus that could play protective roles against the host immune defense and include the glycolytic Gap as major target for S-bacillithiolation. S-bacillithiolation of Gap did not require structural changes, but efficiently functions in redox regulation and protection of the active site against irreversible overoxidation in S. aureus. Antioxid. Redox Signal. 00, 000-000.

  10. Pleurocidin Peptide Enhances Grouper Anti-Vibrio harveyi Immunity Elicited by Poly(lactide-co-glycolide-Encapsulated Recombinant Glyceraldehyde-3-phosphate Dehydrogenase

    Directory of Open Access Journals (Sweden)

    Shu-Chun Chuang

    2014-05-01

    Full Text Available Outer membrane proteins, such as glyceraldehyde-3-phosphate dehydrogenase (GAPDH, are considered immunodominant antigens for eliciting protective immunity against Vibrio harveyi, the main etiological agent of vibriosis in fish. Cationic antimicrobial peptides (AMPs, such as pleurocidin (PLE, play important roles in activating and recruiting immune cells, thereby contributing to subsequent innate and adaptive immune responses. In the present study, we aimed to use PLE peptide as a potent adjuvant to improve the immunogenicity of V. harveyi recombinant GAPDH (rGAPDH. In order to prepare a controlled-release vaccine, PLE peptide and rGAPDH protein were simultaneously encapsulated into polymeric microparticles made from the biodegradable poly(lactide-co-glycolide (PLG polymer. The resulting PLG-encapsulated PLE plus rGAPDH (PLG-PLE/rGAPDH microparticles, 3.21–6.27 μm in diameter, showed 72%–83% entrapment efficiency and durably released both PLE and rGAPDH for a long 30-day period. Following peritoneal immunization in grouper (Epinephelus coioides, PLG-PLE/rGAPDH microparticles resulted in significantly higher (p < 0.05, nested design long-lasting GAPDH-specific immunity (serum titers and lymphocyte proliferation than PLG-encapsulated rGAPDH (PLG-rGAPDH microparticles. After an experimental challenge of V. harveyi, PLG-PLE/rGAPDH microparticles conferred a high survival rate (85%, which was significantly higher (p < 0.05, chi-square test than that induced by PLG-rGAPDH microparticles (67%. In conclusion, PLE peptide exhibits an efficacious adjuvant effect to elicit not only improved immunity, but also enhanced protection against V. harveyi in grouper induced by rGAPDH protein encapsulated in PLG microparticles.

  11. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    Directory of Open Access Journals (Sweden)

    Chattopadhyay Debasish

    2009-02-01

    Full Text Available Abstract Background The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips to the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. Results We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2Å resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in

  12. Improved production of 2,3-butanediol in Bacillus amyloliquefaciens by over-expression of glyceraldehyde-3-phosphate dehydrogenase and 2,3-butanediol dehydrogenase.

    Directory of Open Access Journals (Sweden)

    Taowei Yang

    Full Text Available BACKGROUND: Previously, a safe strain, Bacillus amyloliquefaciens B10-127 was identified as an excellent candidate for industrial-scale microbial fermentation of 2,3-butanediol (2,3-BD. However, B. amyloliquefaciens fermentation yields large quantities of acetoin, lactate and succinate as by-products, and the 2,3-BD yield remains prohibitively low for commercial production. METHODOLOGY/PRINCIPAL FINDINGS: In the 2,3-butanediol metabolic pathway, glyceraldehyde-3-phosphate dehydrogenase (GAPDH catalyzes the conversion of 3-phosphate glyceraldehyde to 1,3-bisphosphoglycerate, with concomitant reduction of NAD(+ to NADH. In the same pathway, 2,3-BD dehydrogenase (BDH catalyzes the conversion of acetoin to 2,3-BD with concomitant oxidation of NADH to NAD(+. In this study, to improve 2,3-BD production, we first over-produced NAD(+-dependent GAPDH and NADH-dependent BDH in B. amyloliquefaciens. Excess GAPDH reduced the fermentation time, increased the 2,3-BD yield by 12.7%, and decreased the acetoin titer by 44.3%. However, the process also enhanced lactate and succinate production. Excess BDH increased the 2,3-BD yield by 16.6% while decreasing acetoin, lactate and succinate production, but prolonged the fermentation time. When BDH and GAPDH were co-overproduced in B. amyloliquefaciens, the fermentation time was reduced. Furthermore, in the NADH-dependent pathways, the molar yield of 2,3-BD was increased by 22.7%, while those of acetoin, lactate and succinate were reduced by 80.8%, 33.3% and 39.5%, relative to the parent strain. In fed-batch fermentations, the 2,3-BD concentration was maximized at 132.9 g/l after 45 h, with a productivity of 2.95 g/l·h. CONCLUSIONS/SIGNIFICANCE: Co-overexpression of bdh and gapA genes proved an effective method for enhancing 2,3-BD production and inhibiting the accumulation of unwanted by-products (acetoin, lactate and succinate. To our knowledge, we have attained the highest 2,3-BD fermentation yield thus far

  13. Antitrypanosomal compounds from the essential oil and extracts of Keetia leucantha leaves with inhibitor activity on Trypanosoma brucei glyceraldehyde-3-phosphate dehydrogenase.

    Science.gov (United States)

    Bero, J; Beaufay, C; Hannaert, V; Hérent, M-F; Michels, P A; Quetin-Leclercq, J

    2013-02-15

    Keetia leucantha is a West African tree used in traditional medicine to treat several diseases among which parasitic infections. The dichloromethane extract of leaves was previously shown to possess growth-inhibitory activities on Plasmodium falciparum, Trypanosoma brucei brucei and Leishmania mexicana mexicana with low or no cytotoxicity (>100 μg/ml on human normal fibroblasts) (Bero et al. 2009, 2011). In continuation of our investigations on the antitrypanosomal compounds from this dichloromethane extract, we analyzed by GC-FID and GC-MS the essential oil of its leaves obtained by hydrodistillation and the major triterpenic acids in this extract by LC-MS. Twenty-seven compounds were identified in the oil whose percentages were calculated using the normalization method. The essential oil, seven of its constituents and the three triterpenic acids were evaluated for their antitrypanosomal activity on Trypanosoma brucei brucei bloodstream forms (Tbb BSF) and procyclic forms (Tbb PF) to identify an activity on the glycolytic process of trypanosomes. The oil showed an IC(50) of 20.9 μg/ml on Tbb BSF and no activity was observed on Tbb PF. The best antitrypanosomal activity was observed for ursolic acid with IC(50) of 2.5 and 6.5 μg/ml respectively on Tbb BSF and Tbb PF. The inhibitory activity on a glycolytic enzyme of T. brucei, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was also evaluated for betulinic acid, olenaolic acid, ursolic acid, phytol, α-ionone and β-ionone. The three triterpenic acids and β-ionone showed inhibitory activities on GAPDH with oleanolic acid being the most active with an inhibition of 72.63% at 20 μg/ml. This paper reports for the first time the composition and antitrypanosomal activity of the essential oil of Keetia leucantha. Several of its constituents and three triterpenic acids present in the dichloromethane leaves extract showed a higher antitrypanosomal activity on bloodstream forms of Tbb as compared to procyclic forms

  14. Identification of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells

    Directory of Open Access Journals (Sweden)

    Nadarajah Vishna

    2010-11-01

    Full Text Available Abstract Background Bacillus thuringiensis (Bt, an ubiquitous gram-positive spore-forming bacterium forms parasporal proteins during the stationary phase of its growth. Recent findings of selective human cancer cell-killing activity in non-insecticidal Bt isolates resulted in a new category of Bt parasporal protein called parasporin. However, little is known about the receptor molecules that bind parasporins and the mechanism of anti-cancer activity. A Malaysian Bt isolate, designated Bt18 produces parasporal protein that exhibit preferential cytotoxic activity for human leukaemic T cells (CEM-SS but is non-cytotoxic to normal T cells or other cancer cell lines such as human cervical cancer (HeLa, human breast cancer (MCF-7 and colon cancer (HT-29 suggesting properties similar to parasporin. In this study we aim to identify the binding protein for Bt18 in human leukaemic T cells. Methods Bt18 parasporal protein was separated using Mono Q anion exchange column attached to a HPLC system and antibody was raised against the purified 68-kDa parasporal protein. Receptor binding assay was used to detect the binding protein for Bt18 parasporal protein in CEM-SS cells and the identified protein was sent for N-terminal sequencing. NCBI protein BLAST was used to analyse the protein sequence. Double immunofluorescence staining techniques was applied to localise Bt18 and binding protein on CEM-SS cell. Results Anion exchange separation of Bt18 parasporal protein yielded a 68-kDa parasporal protein with specific cytotoxic activity. Polyclonal IgG (anti-Bt18 for the 68-kDa parasporal protein was successfully raised and purified. Receptor binding assay showed that Bt18 parasporal protein bound to a 36-kDa protein from the CEM-SS cells lysate. N-terminal amino acid sequence of the 36-kDa protein was GKVKVGVNGFGRIGG. NCBI protein BLAST revealed that the binding protein was Glyceraldehyde-3-phosphate dehydrogenase (GAPDH. Double immunofluorescence staining showed

  15. 顶复门原虫3-磷酸甘油醛脱氢酶功能及其应用研究进展%Research Advances on the Function and Applization of Glyceraldehydes-3-phosphate Dehydrogenase in Apicomplexa

    Institute of Scientific and Technical Information of China (English)

    廖申权; 戚南山; 吴彩艳; 吕敏娜; 袁建丰; 余劲术; 孙铭飞

    2012-01-01

    Glycolysis exists in various organisms. It is the major energetic process in apicomplexan parasites. Glyceralde-hyde-3-phosphate dehydrogenase (GAPDH) plays an important role in glycolysis,which closely related to the survival of parasites. GAPDH is proposed to be a potential target for antiparasitic drugs. This review will focus on glycolysis and the genetic analysis,mechanism and application of glyceraldehydes-3-phosphate dehydrogenase in Apicomplexa.%糖酵解途径广泛存在于各类生物中,是顶复门原虫的主要供能方式.3-磷酸甘油醛脱氢酶是糖酵解途径的重要酶,与顶复门原虫的生存密切相关,可以作为抗寄生虫药物研发的重要靶标.文章主要从顶复门原虫糖酵解途径、3-磷酸甘油醛脱氢酶的基因分析、作用机理及应用等方面进行综述.

  16. A phylogenetic mosaic plastid proteome and unusual plastid-targeting signals in the green-colored dinoflagellate Lepidodinium chlorophorum

    Directory of Open Access Journals (Sweden)

    Inagaki Yuji

    2010-06-01

    Full Text Available Abstract Background Plastid replacements through secondary endosymbioses include massive transfer of genes from the endosymbiont to the host nucleus and require a new targeting system to enable transport of the plastid-targeted proteins across 3-4 plastid membranes. The dinoflagellates are the only eukaryotic lineage that has been shown to have undergone several plastid replacement events, and this group is thus highly relevant for studying the processes involved in plastid evolution. In this study, we analyzed the phylogenetic origin and N-terminal extensions of plastid-targeted proteins from Lepidodinium chlorophorum, a member of the only dinoflagellate genus that harbors a green secondary plastid rather than the red algal-derived, peridinin-containing plastid usually found in photosynthetic dinoflagellates. Results We sequenced 4,746 randomly picked clones from a L. chlorophorum cDNA library. 22 of the assembled genes were identified as genes encoding proteins functioning in plastids. Some of these were of green algal origin. This confirms that genes have been transferred from the plastid to the host nucleus of L. chlorophorum and indicates that the plastid is fully integrated as an organelle in the host. Other nuclear-encoded plastid-targeted protein genes, however, are clearly not of green algal origin, but have been derived from a number of different algal groups, including dinoflagellates, streptophytes, heterokonts, and red algae. The characteristics of N-terminal plastid-targeting peptides of all of these genes are substantially different from those found in peridinin-containing dinoflagellates and green algae. Conclusions L. chlorophorum expresses plastid-targeted proteins with a range of different origins, which probably arose through endosymbiotic gene transfer (EGT and horizontal gene transfer (HGT. The N-terminal extension of the genes is different from the extensions found in green alga and other dinoflagellates (peridinin- and

  17. Inactivation of glyceraldehyde-3-phosphate dehydrogenase by fumarate in diabetes: formation of S-(2-succinyl)cysteine, a novel chemical modification of protein and possible biomarker of mitochondrial stress.

    Science.gov (United States)

    Blatnik, Matthew; Frizzell, Norma; Thorpe, Suzanne R; Baynes, John W

    2008-01-01

    (2-succinyl)cysteine (2SC) is formed by a Michael addition reaction of the Krebs cycle intermediate, fumarate, with cysteine residues in protein. We investigated the role of fumarate in chemical modification and inhibition of the sulfhydryl enzyme, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), in vitro and in tissues of diabetic rats. GAPDH was incubated with fumarate in PBS to assess effects of fumarate on enzyme activity in vitro. Sites of 2SC formation were determined by analysis of tryptic peptides by high-performance liquid chromatography-quadrupole/time-of-flight mass spectrometry. 2SC and fumarate in gastrocnemius muscle of control and streptozotocin-induced diabetic rats were measured by liquid chromatography/tandem mass spectrometry and by gas chromatography/mass spectrometry, respectively. GAPDH was isolated from muscle by immunoprecipitation, and sites of modification of GAPDH were determined by mass spectrometry analysis. 2SC was found, both in vitro and in vivo, about equally at active-site Cys-149 and nucleophilic Cys-244. Inactivation of GAPDH by fumarate in vitro correlated with formation of 2SC. In diabetic compared with control rats, fumarate and 2SC concentration increased approximately fivefold, accompanied by an approximately 25% decrease in GAPDH specific activity. The fractional modification of GAPDH by 2SC was significantly increased in diabetic versus control animals, consistent with the decreased specific activity of GAPDH in muscle of diabetic animals. Fumarate contributes to inactivation of GAPDH in diabetes. 2SC may be a useful biomarker of mitochondrial stress in diabetes. Modification of GAPDH and other enzymes and proteins by fumarate may contribute to the metabolic changes underlying the development of diabetes complications.

  18. 青海湖裸鲤三磷酸甘油醛脱氢酶基因的克隆和表达特性%Expression and cloning of two glyceraldehyde 3-phosphate dehydrogenase mRNAs from Gymnocypris przewalskii in Qinghai Lake

    Institute of Scientific and Technical Information of China (English)

    卫福磊; 李长忠; 史建全; 祁得林; 梁健; 谢保胜; 赵兰英; 祁洪芳

    2013-01-01

    Objective Gymnocypris przewalskii (naked carp) , a unique economic fish species distributed in Qinghai Lake and its periphery area on Qinghai-Tibet plateau , plays a key role in the ecosystem composed mainly of fish, birds and meadow. Research concerning Gymnocypris przewalskii biological characteristics and molecular mechanism adapted to hypoxia, low temperature and salinity stress will contribute to discovering the basic regular pattern of vital activity and provide theoretical support to conservation and artificial reproduction of this species. Methods In this study, two complete cDNA sequences of glyceraldehyde-3-phosphate dehydrogenase ( GPDH) paralogue isoforms, which were named as Gp-GAPDHα (JX287372) and Gp-GAPDHβ (JX287373) , respectively, were obtained from the naked carp through reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The transcription levels were determined based on semi-quantitative RT-PCR analysis. Results The transcription levels of Gp-GAPDHα and Gp-GAPDHβ were unstable in different organ tissues and during different periods of embryogenesis. Both two deduced nu-cleotide sequences have an identity of 72% , and show high similarity with GPDH sequences of other species. Most interestingly, Gp-GAPDHa displays a significant difference at different stages of embryogenesis. Conclusion Gp-GAPDHa is unsuitable to be used as a control for the molecular study in embryogenesis, and the functions of the paralogs need to be further confirmed.%目的 开展青海湖裸鲤基础生物学特征和适应低氧、低温、高盐度的分子机理的研究,揭示青海湖裸鲤的基本生命活动规律,为该鱼种的资源保护和人工增殖放流提供理论依据.方法通过RT-PCR和RACE技术,得到了青海湖裸鲤三磷酸甘油醛脱氢酶(Gp-GAPDH)两种旁系同源体的完整编码序列,分别命名为Gp-GAPDHα (JX287372)和Gp-GAPDHβ (JX287373).通过半定量RT-PCR分析Gp-GAPDHα

  19. 内参基因GAPDH在3T3-L1脂肪细胞分化中的表达变化%Change of reference gene glyceraldehyde-3-phosphate dehydrogenase expression during 3T3-L1 adipocyte differentiation

    Institute of Scientific and Technical Information of China (English)

    张娟; 唐红菊; 王晓; 王宁; 邓儒元; 建方方; 刘赟; 李凤英; 周丽斌

    2012-01-01

    目的 观察甘油醛-3-磷酸脱氢酶(GAPDH)在3T3-L1脂肪细胞分化过程中表达水平是否存在变化,并与其他常用的内参基因相比较.方法 以实时定量PCR检测3T3-L1脂肪细胞分化0、1、3、5、7d几种不同常见内参基因的表达是否存在变化,并以Western印迹方法进行证实.结果 (1)内参基因GAPDH和转铁蛋白受体(TFRC)在脂肪细胞分化过程中基因表达水平逐渐明显升高,其中GAPDH mRNA 在脂肪细胞分化1、3、5、7d分别增加5.7、7.6、22.0和24.5倍(均P<0.01),β-actin、α-微管蛋白(α-tubulin)、肽酰脯氨酰异构酶(PIPA)和18S mRNA表达水平未见明显改变;采用实时定量PCR检测脂肪细胞分化的关键转录因子PPARγ2、CCAAT/增强结合蛋白(C/EBP)α和C/EBPβ的表达时,以GAPDH作内参明显低估他们的表达变化;GAPDH蛋白表达也随着脂肪细胞分化逐渐增加,β-actin、α-tubulin蛋白表达未见明显变化;(2)小檗碱明显抑制脂肪细胞分化过程中GAPDH mRNA和蛋白的表达,在脂肪细胞分化5、7d时GAPDH mRNA表达水平分别降低68.1%和66.3%(P<0.05或P<0.01),但小檗碱对其他内参基因的表达无明显改变.结论 GAPDH在3T3-L1脂肪细胞分化过程中表达增加,不适合作为内参.%Objective To observe the change of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene expression during 3T3-L1 adipocyte differentiation as well as other reference gene expressions.Methods The mRNA expressions of several common reference genes were detected by real time-PCR on day 0,1,3,5,and 7 of 3T3-L1 adipocyte differentiation.Western blot was used to confirm the protein expressions of three common reference genes.Results (1) GAPDH and transferrin receptor(TFRC) mRNA expressions were significantly increased during adipocyte differentiation.GAPDH mRNA level was increased by 5.7,7.6,22.0,and 24.5 folds on day 1,3,5,and 7 after induction of adipocyte differentiation,but no apparent changes of

  20. Horizontal transfer of a eukaryotic plastid-targeted protein gene to cyanobacteria

    Directory of Open Access Journals (Sweden)

    Keeling Patrick J

    2007-06-01

    Full Text Available Abstract Background Horizontal or lateral transfer of genetic material between distantly related prokaryotes has been shown to play a major role in the evolution of bacterial and archaeal genomes, but exchange of genes between prokaryotes and eukaryotes is not as well understood. In particular, gene flow from eukaryotes to prokaryotes is rarely documented with strong support, which is unusual since prokaryotic genomes appear to readily accept foreign genes. Results Here, we show that abundant marine cyanobacteria in the related genera Synechococcus and Prochlorococcus acquired a key Calvin cycle/glycolytic enzyme from a eukaryote. Two non-homologous forms of fructose bisphosphate aldolase (FBA are characteristic of eukaryotes and prokaryotes respectively. However, a eukaryotic gene has been inserted immediately upstream of the ancestral prokaryotic gene in several strains (ecotypes of Synechococcus and Prochlorococcus. In one lineage this new gene has replaced the ancestral gene altogether. The eukaryotic gene is most closely related to the plastid-targeted FBA from red algae. This eukaryotic-type FBA once replaced the plastid/cyanobacterial type in photosynthetic eukaryotes, hinting at a possible functional advantage in Calvin cycle reactions. The strains that now possess this eukaryotic FBA are scattered across the tree of Synechococcus and Prochlorococcus, perhaps because the gene has been transferred multiple times among cyanobacteria, or more likely because it has been selectively retained only in certain lineages. Conclusion A gene for plastid-targeted FBA has been transferred from red algae to cyanobacteria, where it has inserted itself beside its non-homologous, functional analogue. Its current distribution in Prochlorococcus and Synechococcus is punctate, suggesting a complex history since its introduction to this group.

  1. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  2. Disparate sequence characteristics of the Erysiphe graminis f.sp. hordei glyceraldehyde-3-phosphate dehydrogenase gene

    DEFF Research Database (Denmark)

    Christiansen, S.K.; Justesen, A.F.; Giese, H.

    1997-01-01

    to be similar for all four genes. The results of the codon-usage analysis suggest that Egh is more flexible than other fungi in the choice of nucleotides at the wobble position. Codon-usage preferences in Egh and barley genes indicate a level of difference which may be exploited to discriminate between fungal...... and plant genes in sequence mixtures. The Egh gpd promoter appears to be superior to that of the Egh beta-tubulin gene (tub2) for driving the E. coli beta-glucuronidase (GUS) gene in transformation experiments....

  3. Glyceraldehyde-3-phosphate dehydrogenase has no control over glycolytic flux in Lactococcus lactis MG1363

    DEFF Research Database (Denmark)

    Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

    2003-01-01

    that the glycolytic flux was unchanged in the mutants overproducing GAPDH. Also, a decrease in the GAPDH activity had very little effect on the growth rate and the glycolytic flux until 25% activity was reached. Below this activity level, the glycolytic flux decreased proportionally with decreasing GAPDH activity....... These data show that GAPDH activity has no control over the glycolytic flux (flux control coefficient = 0.0) at the wild-type enzyme level and that the enzyme is present in excess capacity by a factor of 3 to 4. The early experiments by Poolman and coworkers were performed with cells resuspended in buffer, i...

  4. A new bianthron glycoside as inhibitor of Trypanosoma cruzi glyceraldehyde 3-phosphate dehydrogenase activity

    Energy Technology Data Exchange (ETDEWEB)

    Macedo, Edangelo M.S. de; Silva, Maria G.V. [Universidade Federal do Ceara (UFC), Fortaleza, CE (Brazil). Dept. de Quimica Analitica e Fisico-Quimica; Wiggers, Helton J.; Montanari, Carlos A. [Universidade de Sao Paulo (USP), SP (Brazil). Inst. de Quimica; Braz-Filho, Raimundo [Universidade Estadual do Norte Fluminense, Campos dos Goytacazes, RJ, (Brazil). Setor de Quimica de Produtos Naturais; Andricopulo, Adriano D. [Universidade de Sao Paulo (USP), Sao Carlos SP (Brazil). Inst. de Fisica

    2009-07-01

    A phytochemical investigation of the ethanolic extract of stalks of Senna martiana Benth. (Leguminoseae), native specie of northeast Brazil, resulted in the isolation and spectroscopic characterization of a new bianthrone glycoside, martianine 1 (10,10'-il-chrysophanol-10-oxi- 10,10'-bi-glucosyl). Its identification was established by HRMS, IR and 2D NMR experiments. The evaluation of martianine trypanocidal activity was carried out against gliceraldehyde 3-phosphate dehydrogenase enzyme from Trypanosoma cruzi. Its inhibitory constant (K{sub i}) is in the low micromolar concentration and it was determined by isothermal titration calorimetry to be 27.3 +-2.47 {mu}mol L{sup -1}. The non-competitive mechanism is asserted to be putative of the mode of action martianine displays against T. cruzi GAPDH. Results show that martianine has a great potential to become new lead molecule by inhibiting this key enzyme and for the development of new drugs against Chagas disease. (author)

  5. Characterization of Arabidopsis lines deficient in GAPC-1, a cytosolic NAD-dependent glyceraldehyde-3-phosphate dehydrogenase.

    Science.gov (United States)

    Rius, Sebastián P; Casati, Paula; Iglesias, Alberto A; Gomez-Casati, Diego F

    2008-11-01

    Phosphorylating glyceraldehyde-3-P dehydrogenase (GAPC-1) is a highly conserved cytosolic enzyme that catalyzes the conversion of glyceraldehyde-3-P to 1,3-bis-phosphoglycerate; besides its participation in glycolysis, it is thought to be involved in additional cellular functions. To reach an integrative view on the many roles played by this enzyme, we characterized a homozygous gapc-1 null mutant and an as-GAPC1 line of Arabidopsis (Arabidopsis thaliana). Both mutant plant lines show a delay in growth, morphological alterations in siliques, and low seed number. Embryo development was altered, showing abortions and empty embryonic sacs in basal and apical siliques, respectively. The gapc-1 line shows a decrease in ATP levels and reduced respiratory rate. Furthermore, both lines exhibit a decrease in the expression and activity of aconitase and succinate dehydrogenase and reduced levels of pyruvate and several Krebs cycle intermediates, as well as increased reactive oxygen species levels. Transcriptome analysis of the gapc-1 mutants unveils a differential accumulation of transcripts encoding for enzymes involved in carbon partitioning. According to these studies, some enzymes involved in carbon flux decreased (phosphoenolpyruvate carboxylase, NAD-malic enzyme, glucose-6-P dehydrogenase) or increased (NAD-malate dehydrogenase) their activities compared to the wild-type line. Taken together, our data indicate that a deficiency in the cytosolic GAPC activity results in modifications of carbon flux and mitochondrial dysfunction, leading to an alteration of plant and embryo development with decreased number of seeds, indicating that GAPC-1 is essential for normal fertility in Arabidopsis plants.

  6. Effects of organic solvents on the enzyme activity of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase in calorimetric assays

    DEFF Research Database (Denmark)

    Wiggers, Henrik; Cheleski, J; Zottis, A

    2007-01-01

    .0% for MeOH and up to 7.5% for DMSO. The results show that when GAPDH is assayed in the presence of DMSO (5%, v/v) using the ITC experiment, the enzyme exhibits approximately twofold higher activity than that of GAPDH with no cosolvent added. When MeOH (5%, v/v) is the cosolvent, the GAPDH activity...... is sixfold higher. The favorable effects of the organic solvents on the Michaelis-Menten enzyme-substrate complex formation ensure the consistency of the biological assays, structural integrity of the protein, and reproducibility over the measurement time. The reaction was also kinetically monitored......In drug discovery programs, dimethyl sulfoxide (DMSO) is a standard solvent widely used in biochemical assays. Despite the extensive use and study of enzymes in the presence of organic solvents, for some enzymes the effect of organic solvent is unknown. Macromolecular targets may be affected...

  7. Characterization of Arabidopsis Lines Deficient in GAPC-1, a Cytosolic NAD-Dependent Glyceraldehyde-3-Phosphate Dehydrogenase1[C

    Science.gov (United States)

    Rius, Sebastián P.; Casati, Paula; Iglesias, Alberto A.; Gomez-Casati, Diego F.

    2008-01-01

    Phosphorylating glyceraldehyde-3-P dehydrogenase (GAPC-1) is a highly conserved cytosolic enzyme that catalyzes the conversion of glyceraldehyde-3-P to 1,3-bis-phosphoglycerate; besides its participation in glycolysis, it is thought to be involved in additional cellular functions. To reach an integrative view on the many roles played by this enzyme, we characterized a homozygous gapc-1 null mutant and an as-GAPC1 line of Arabidopsis (Arabidopsis thaliana). Both mutant plant lines show a delay in growth, morphological alterations in siliques, and low seed number. Embryo development was altered, showing abortions and empty embryonic sacs in basal and apical siliques, respectively. The gapc-1 line shows a decrease in ATP levels and reduced respiratory rate. Furthermore, both lines exhibit a decrease in the expression and activity of aconitase and succinate dehydrogenase and reduced levels of pyruvate and several Krebs cycle intermediates, as well as increased reactive oxygen species levels. Transcriptome analysis of the gapc-1 mutants unveils a differential accumulation of transcripts encoding for enzymes involved in carbon partitioning. According to these studies, some enzymes involved in carbon flux decreased (phosphoenolpyruvate carboxylase, NAD-malic enzyme, glucose-6-P dehydrogenase) or increased (NAD-malate dehydrogenase) their activities compared to the wild-type line. Taken together, our data indicate that a deficiency in the cytosolic GAPC activity results in modifications of carbon flux and mitochondrial dysfunction, leading to an alteration of plant and embryo development with decreased number of seeds, indicating that GAPC-1 is essential for normal fertility in Arabidopsis plants. PMID:18820081

  8. Reduction of nuclear encoded enzymes of mitochondrial energy metabolism in cells devoid of mitochondrial DNA

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, Edith E., E-mail: ed.mueller@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Mayr, Johannes A., E-mail: h.mayr@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Zimmermann, Franz A., E-mail: f.zimmermann@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Feichtinger, Rene G., E-mail: r.feichtinger@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Stanger, Olaf, E-mail: o.stanger@rbht.nhs.uk [Department of Cardiac Surgery, Paracelsus Medical University, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Sperl, Wolfgang, E-mail: w.sperl@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria); Kofler, Barbara, E-mail: b.kofler@salk.at [Research Program for Receptor Biochemistry and Tumor Metabolism, Department of Pediatrics, Muellner Hauptstrasse 48, 5020 Salzburg (Austria)

    2012-01-20

    Highlights: Black-Right-Pointing-Pointer We examined OXPHOS and citrate synthase enzyme activities in HEK293 cells devoid of mtDNA. Black-Right-Pointing-Pointer Enzymes partially encoded by mtDNA show reduced activities. Black-Right-Pointing-Pointer Also the entirely nuclear encoded complex II and citrate synthase exhibit reduced activities. Black-Right-Pointing-Pointer Loss of mtDNA induces a feedback mechanism that downregulates complex II and citrate synthase. -- Abstract: Mitochondrial DNA (mtDNA) depletion syndromes are generally associated with reduced activities of oxidative phosphorylation (OXPHOS) enzymes that contain subunits encoded by mtDNA. Conversely, entirely nuclear encoded mitochondrial enzymes in these syndromes, such as the tricarboxylic acid cycle enzyme citrate synthase (CS) and OXPHOS complex II, usually exhibit normal or compensatory enhanced activities. Here we report that a human cell line devoid of mtDNA (HEK293 {rho}{sup 0} cells) has diminished activities of both complex II and CS. This finding indicates the existence of a feedback mechanism in {rho}{sup 0} cells that downregulates the expression of entirely nuclear encoded components of mitochondrial energy metabolism.

  9. Nuclearly encoded splicing factors implicated in RNA splicing in higher plant organelles.

    Science.gov (United States)

    de Longevialle, Andéol Falcon; Small, Ian D; Lurin, Claire

    2010-07-01

    Plant organelles arose from two independent endosymbiosis events. Throughout evolutionary history, tight control of chloroplasts and mitochondria has been gained by the nucleus, which regulates most steps of organelle genome expression and metabolism. In particular, RNA maturation, including RNA splicing, is highly dependent on nuclearly encoded splicing factors. Most introns in organelles are group II introns, whose catalytic mechanism closely resembles that of the nuclear spliceosome. Plant group II introns have lost the ability to self-splice in vivo and require nuclearly encoded proteins as cofactors. Since the first splicing factor was identified in chloroplasts more than 10 years ago, many other proteins have been shown to be involved in splicing of one or more introns in chloroplasts or mitochondria. These new proteins belong to a variety of different families of RNA binding proteins and provide new insights into ribonucleo-protein complexes and RNA splicing machineries in organelles. In this review, we describe how splicing factors, encoded by the nucleus and targeted to the organelles, take part in post-transcriptional steps in higher plant organelle gene expression. We go on to discuss the potential for these factors to regulate organelle gene expression.

  10. A heterogeneous population of nuclear-encoded mitochondrial mRNAs is present in the axons of primary sympathetic neurons.

    Science.gov (United States)

    Aschrafi, Armaz; Kar, Amar N; Gale, Jenna R; Elkahloun, Abdel G; Vargas, Jose Noberto S; Sales, Naomi; Wilson, Gabriel; Tompkins, Miranda; Gioio, Anthony E; Kaplan, Barry B

    2016-09-01

    Mitochondria are enriched in subcellular regions of high energy consumption, such as axons and pre-synaptic nerve endings. Accumulating evidence suggests that mitochondrial maintenance in these distal structural/functional domains of the neuron depends on the "in-situ" translation of nuclear-encoded mitochondrial mRNAs. In support of this notion, we recently provided evidence for the axonal targeting of several nuclear-encoded mRNAs, such as cytochrome c oxidase, subunit 4 (COXIV) and ATP synthase, H+ transporting and mitochondrial Fo complex, subunit C1 (ATP5G1). Furthermore, we showed that axonal trafficking and local translation of these mRNAs plays a critical role in the generation of axonal ATP. Using a global gene expression analysis, this study identified a highly diverse population of nuclear-encoded mRNAs that were enriched in the axon and presynaptic nerve terminals. Among this population of mRNAs, fifty seven were found to be at least two-fold more abundant in distal axons, as compared with the parental cell bodies. Gene ontology analysis of the nuclear-encoded mitochondrial mRNAs suggested functions for these gene products in molecular and biological processes, including but not limited to oxidoreductase and electron carrier activity and proton transport. Based on these results, we postulate that local translation of nuclear-encoded mitochondrial mRNAs present in the axons may play an essential role in local energy production and maintenance of mitochondrial function.

  11. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  12. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Science.gov (United States)

    Knoll, Nadja; Jarick, Ivonne; Volckmar, Anna-Lena; Klingenspor, Martin; Illig, Thomas; Grallert, Harald; Gieger, Christian; Wichmann, Heinz-Erich; Peters, Annette; Hebebrand, Johannes; Scherag, André; Hinney, Anke

    2013-01-01

    There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1) 16 nuclear regulators of mitochondrial genes, (2) 91 genes for oxidative phosphorylation and (3) 966 nuclear-encoded mitochondrial genes). Gene set enrichment analysis (GSEA) showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS) data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents) and a population-based GWAS sample (KORA F4, n = 1,743). A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th) and 95(th) percentile of the set of all gene-wise corrected p-values) as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th) percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50) = 0.0103). This finding was not confirmed in the trios (p(GSEA,50) = 0.5991), but in KORA (p(GSEA,50) = 0.0398). The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50) = 0.1052, p(MAGENTA,75) = 0.0251). The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  13. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa

    Directory of Open Access Journals (Sweden)

    Grillo Giorgio

    2006-01-01

    Full Text Available Abstract Background Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein as well as useful tools for their extraction and export. Description MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions ready to be used for in silico analysis. Conclusion The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular

  14. An apicoplast localized ubiquitylation system is required for the import of nuclear-encoded plastid proteins.

    Directory of Open Access Journals (Sweden)

    Swati Agrawal

    Full Text Available Apicomplexan parasites are responsible for numerous important human diseases including toxoplasmosis, cryptosporidiosis, and most importantly malaria. There is a constant need for new antimalarials, and one of most keenly pursued drug targets is an ancient algal endosymbiont, the apicoplast. The apicoplast is essential for parasite survival, and several aspects of its metabolism and maintenance have been validated as targets of anti-parasitic drug treatment. Most apicoplast proteins are nuclear encoded and have to be imported into the organelle. Recently, a protein translocon typically required for endoplasmic reticulum associated protein degradation (ERAD has been proposed to act in apicoplast protein import. Here, we show ubiquitylation to be a conserved and essential component of this process. We identify apicoplast localized ubiquitin activating, conjugating and ligating enzymes in Toxoplasma gondii and Plasmodium falciparum and observe biochemical activity by in vitro reconstitution. Using conditional gene ablation and complementation analysis we link this activity to apicoplast protein import and parasite survival. Our studies suggest ubiquitylation to be a mechanistic requirement of apicoplast protein import independent to the proteasomal degradation pathway.

  15. Expression pattern of a nuclear encoded mitochondrial arginine-ornithine translocator gene from Arabidopsis

    Directory of Open Access Journals (Sweden)

    Schneider Anja

    2003-01-01

    Full Text Available Abstract Background Arginine and citrulline serve as nitrogen storage forms, but are also involved in biosynthetic and catabolic pathways. Metabolism of arginine, citrulline and ornithine is distributed between mitochondria and cytosol. For the shuttle of intermediates between cytosol and mitochondria transporters present on the inner mitochondrial membrane are required. Yeast contains a mitochondrial translocator for ornithine and arginine, Ort1p/Arg11p. Ort1p/Arg11p is a member of the mitochondrial carrier family (MCF essential for ornithine export from mitochondria. The yeast arg11 mutant, which is deficient in Ort1p/Arg11p grows poorly on media lacking arginine. Results High-level expression of a nuclear encoded Arabidopsis thaliana homolog (AtmBAC2 of Ort1p/Arg11p was able to suppress the growth deficiency of arg11. RT-PCR analysis demonstrated expression of AtmBAC2 in all tissues with highest levels in flowers. Promoter-GUS fusions showed preferential expression in flowers, i.e. pollen, in the vasculature of siliques and in aborted seeds. Variable expression was observed in leaf vasculature. Induction of the promoter was not observed during the first two weeks in seedlings grown on media containing NH4NO3, arginine or ornithine as sole nitrogen sources. Conclusion AtmBAC2 was isolated as a mitochondrial transporter for arginine in Arabidopsis. The absence of expression in developing seeds and in cotyledons of seedlings indicates that other transporters are responsible for storage and mobilization of arginine in seeds.

  16. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Jandova, Jana; Janda, Jaroslav [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States); Sligh, James E, E-mail: jsligh@azcc.arizona.edu [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States)

    2012-10-15

    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  17. Nuclear encoding of a plastid sigma factor in rice and its tissue- and light-dependent expression.

    Science.gov (United States)

    Tozawa, Y; Tanaka, K; Takahashi, H; Wakasa, K

    1998-01-15

    A full-length cDNA encoding a putative sigma factor for a plastid RNA polymerase was isolated from the higher plant Oryza sativa . The nucleotide sequence of the corresponding nuclear gene, named Os-sigA ( O.sativa sigma A), predicts a polypeptide of 519 amino acids that contains a putative plastid-targeting sequence in its N-terminal region. The predicted mature protein shows extensive sequence homology to bacterial sigma factors, encompassing the conserved regions 1.2, 2.1, 2.2, 2.3, 2.4, 3, 4.1 and 4.2 implicated in binding to -10 promoter elements, promoter melting and interaction with the core RNA polymerase enzyme. RNA blot analysis revealed that the abundance of Os-sigA transcripts was markedly greater in green shoots than in roots or in dark-grown etiolated shoots of rice seedlings. Furthermore, exposure of dark-grown etiolated seedlings to light resulted in a rapid increase in the amount of Os-sigA mRNA in the shoot. These observations suggest that regulation of expression of the nuclear gene for this putative plastid RNA polymerase sigmafactor by light contributes to light-dependent transcriptional regulation of plastid genes.

  18. Proteome analysis of a Lactococcus lactis strain overexpressing gapA suggests that the gene product is an auxiliary glyceraldehyde 3-phosphate dehydrogenase

    DEFF Research Database (Denmark)

    Willemoes, Martin; Kilstrup, Mogens; Roepstorff, P.;

    2002-01-01

    strain that overexpessed the gapA gene derived from MG1363 upon nisin induction. Compared to the wild-type, the overexpressing strain had a 3.4-fold elevated level of specific GAPDH activity when grown in the presence of nisin. In both MG 1363 and the gapA overexpressing strain the GAPDH activity...

  19. COVER FIGURE in Nucleic Acids Research (Volume 39, Issue 9) entitled "The involvement of the nuclear-encoded human 2'-phosphodiesterase in mitochondrial RNA turnover"

    DEFF Research Database (Denmark)

    Poulsen, Jesper Buchhave

    2011-01-01

    (English) Cover: The involvement of the nuclear-encoded human 2'-phosphodiesterase (2'-PDE) in mitochondrial RNA turnover. The 2'-PDE precursor (upper left corner) gets directed into the mitochondrial matrix by an N-terminal mitochondrial signaling peptide (blue). Inside the matrix, this signalin...

  20. Definition of the nuclear encoded protein composition of bovine heart mitochondrial complex I. Identification of two new subunits.

    Science.gov (United States)

    Carroll, Joe; Shannon, Richard J; Fearnley, Ian M; Walker, John E; Hirst, Judy

    2002-12-27

    Mitochondrial NADH:ubiquinone oxidoreductase (complex I) from bovine heart is a complicated multisubunit, membrane-bound assembly. Seven subunits are encoded by mitochondrial DNA, and the sequences of 36 nuclear encoded subunits have been described. The subunits of complex I and two subcomplexes (Ialpha and Ibeta) were resolved on one- and two-dimensional gels and by reverse-phase high performance liquid chromatography. Mass spectrometric analysis revealed two previously unknown subunits in complex I, named B14.7 and ESSS, one in each subcomplex. Coding sequences for each protein were identified in data bases and were confirmed by cDNA cloning and sequencing. Subunit B14.7 has an acetylated N terminus, no presequence, and contains four potential transmembrane helices. It is homologous to subunit 21.3b from complex I in Neurospora crassa and is related to Tim17, Tim22, and Tim23, which are involved in protein translocation across the inner membrane. Subunit ESSS has a cleaved mitochondrial import sequence and one potential transmembrane helix. A total of 45 different subunits of bovine complex I have now been characterized.

  1. Proteome analysis of a Lactococcus lactis strain overexpressing gapA suggests that the gene product is an auxiliary glyceraldehyde 3-phosphate dehydrogenase

    DEFF Research Database (Denmark)

    Willemoës, Martin; Kilstrup, Mogens; Roepstorff, Peter;

    2002-01-01

    strain that overexpessed the gapA gene derived from MG1363 upon nisin induction. Compared to the wild-type, the overexpressing strain had a 3.4-fold elevated level of specific GAPDH activity when grown in the presence of nisin. In both MG1363 and the gapA overexpressing strain the GAPDH activity...

  2. Induction of the gap-pgk operon encoding glyceraldehyde-3-phosphate dehydrogenase and 3-phosphoglycerate kinase of Xanthobacter flavus requires the LysR-type transcriptional activator CbbR

    NARCIS (Netherlands)

    Meijer, W.G; van den Bergh, E.R E; Smith, L.M

    1996-01-01

    In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence up

  3. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  4. Parallel loss of nuclear-encoded mitochondrial aminoacyl-tRNA synthetases and mtDNA-encoded tRNAs in Cnidaria.

    Science.gov (United States)

    Haen, Karri M; Pett, Walker; Lavrov, Dennis V

    2010-10-01

    Unlike most animal mitochondrial (mt) genomes, which encode a set of 22 transfer RNAs (tRNAs) sufficient for mt protein synthesis, those of cnidarians have only retained one or two tRNA genes. Whether the missing cnidarian mt-tRNA genes relocated outside the main mt chromosome or were lost remains unclear. It is also unknown what impact the loss of tRNA genes had on other components of the mt translational machinery. Here, we explored the nuclear genome of the cnidarian Nematostella vectensis for the presence of mt-tRNA genes and their corresponding mt aminoacyl-tRNA synthetases (mt-aaRS). We detected no candidates for mt-tRNA genes and only two mt-aaRS orthologs. At the same time, we found that all but one cytosolic aaRS appear to be targeted to mitochondria. These results indicate that the loss of mt-tRNAs in Cnidaria is genuine and occurred in parallel with the loss of nuclear-encoded mt-aaRS. Our phylogenetic analyses of individual aaRS revealed that although the nearly total loss of mt-aaRS is rare, aaRS gene deletion and replacement have occurred throughout the evolution of Metazoa.

  5. The nuclear-encoded sigma factor SIG4 directly activates transcription of chloroplast psbA and ycf17 genes in the unicellular red alga Cyanidioschyzon merolae.

    Science.gov (United States)

    Fujii, Gaku; Imamura, Sousuke; Era, Atsuko; Miyagishima, Shin-ya; Hanaoka, Mitsumasa; Tanaka, Kan

    2015-05-01

    The plant organelle chloroplast originated from the endosymbiosis of a cyanobacterial-like photosynthetic bacterium, and still retains its own genome derived from this ancestor. We have been focusing on a unicellular red alga, Cyanidioschyzon merolae, as a model photosynthetic eukaryote. In this study, we analyzed the transcriptional specificity of SIG4, which is one of four nuclear-encoded chloroplast RNA polymerase sigma factors in this alga. Accumulation of the SIG4 protein was observed in response to nitrogen depletion or high light conditions. By comparing the chloroplast transcriptomes under nitrogen depletion and SIG4-overexpressing conditions, we identified several candidate genes as SIG4 targets. Together with the results of chromatin immunoprecipitation analysis, the promoters of the psbA (encoding the D1 protein of the photosystem II reaction center) and ycf17 (encoding a protein of the early light-inducible protein family) genes were shown to be direct activation targets. The phycobilisome (PBS) CpcB protein was decreased by SIG4 overexpression, which suggests the negative involvement of SIG4 in PBS accumulation. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. The Chloroplast Function Database II: a comprehensive collection of homozygous mutants and their phenotypic/genotypic traits for nuclear-encoded chloroplast proteins.

    Science.gov (United States)

    Myouga, Fumiyoshi; Akiyama, Kenji; Tomonaga, Yumi; Kato, Aya; Sato, Yuka; Kobayashi, Megumi; Nagata, Noriko; Sakurai, Tetsuya; Shinozaki, Kazuo

    2013-02-01

    The Chloroplast Function Database has so far offered phenotype information on mutants of the nuclear-encoded chloroplast proteins in Arabidopsis that pertains to >200 phenotypic data sets that were obtained from 1,722 transposon- or T-DNA-tagged lines. Here, we present the development of the second version of the database, which is named the Chloroplast Function Database II and was redesigned to increase the number of mutant characters and new user-friendly tools for data mining and integration. The upgraded database offers information on genome-wide mutant screens for any visible phenotype against 2,495 tagged lines to create a comprehensive homozygous mutant collection. The collection consists of 147 lines with seedling phenotypes and 185 lines for which we could not obtain homozygotes, as well as 1,740 homozygotes with wild-type phenotypes. Besides providing basic information about primer lists that were used for the PCR genotyping of T-DNA-tagged lines and explanations about the preparation of homozygous mutants and phenotype screening, the database includes access to a link between the gene locus and existing publicly available databases. This gives users access to a combined pool of data, enabling them to gain valuable insights into biological processes. In addition, high-resolution images of plastid morphologies of mutants with seedling-specific chloroplast defects as observed with transmission electron microscopy (TEM) are available in the current database. This database is used to compare the phenotypes of visually identifiable mutants with their plastid ultrastructures and to evaluate their potential significance from characteristic patterns of plastid morphology in vivo. Thus, the Chloroplast Function Database II is a useful and comprehensive information resource that can help researchers to connect individual Arabidopsis genes to plastid functions on the basis of phenotype analysis of our tagged mutant collection. It can be freely accessed at http://rarge.psc.riken.jp/chloroplast/.

  7. A hypothesis-driven association study of 28 nuclear-encoded mitochondrial genes with antipsychotic-induced weight gain in schizophrenia.

    Science.gov (United States)

    Gonçalves, Vanessa F; Zai, Clement C; Tiwari, Arun K; Brandl, Eva J; Derkach, Andriy; Meltzer, Herbert Y; Lieberman, Jeffrey A; Müller, Daniel J; Sun, Lei; Kennedy, James L

    2014-05-01

    Mitochondria are the main source of energy for neurons and have a role in many vital neuronal functions. Mitochondrial dysfunction has been described in schizophrenia, and antipsychotics such as clozapine and olanzapine have been associated with differences in gene expression in mitochondria. We investigated the hypothesis that nuclear-encoded mitochondrial genes, particularly those involved in oxidative phosphorylation or involved in oxidative stress, mitochondrial biogenesis, inflammation, and apoptosis, would be associated with antipsychotic-induced weight gain (AIWG). In total, we selected 28 genes and analyzed 60 SNPs (50 are functional), in 283 schizophrenia subjects, treated with atypical medications for up to 14 weeks. Association between AIWG (as measured by the % of weight gain from baseline) and SNP genotypes were tested using linear regression with treatment duration, baseline body weight, and medication type as covariates. We observed a significant association between rs6435326 in the NDUFS1 gene and AIWG in the subset of European patients (N=150, Pcorrected=0.02). The haplotype carrying the risk alleles of rs6435326 and two other SNPs (rs1053517 and rs1801318) in NDUFS1 was also nominally associated with percentage of weight gain (T-C-G vs A-T-A, P=0.005). In addition, stepwise linear regression was performed to select important variables predictive of the outcome, and a gene-gene interaction analysis was carried out. We observed a significant interaction between the TT risk genotype of rs6435326 in NDUFS1 and AG genotype of rs3762883 in COX18 (Pcorrected=0.001). A permutation-based test of all 60 SNPs jointly showed significant association with weight gain (P=0.02). Finally, our replication study of rs6435326, rs1053517 and rs1801318 in NDUFS1 using samples from the Clinical Antipsychotic Trials of Intervention Effectiveness (CATIE) showed that rs1801318 was significantly associated with AIWG (N=200, Pcorrected=0.04), and the three SNPs were

  8. 杜氏盐藻甘油醛-3-磷酸脱氢酶基因启动子驱动氯霉素乙酰转移酶基因的表达及其活性检测%Expression and activity detection of chloramphenicol acetyltransferase gene driven by the glyceraldehyde-3-phosphate dehydrogenase gene of Dunaliella salina

    Institute of Scientific and Technical Information of China (English)

    张小毅; 刘巨源; 邱乐乐; 贾岩龙

    2012-01-01

    目的 为建立稳定高效的盐藻生物反应器寻找合适的内源性启动子驱动表达外源基因.方法 克隆鉴定了盐藻甘油醛-3-磷酸脱氢酶(GAPDH)基因5 ′上游区序列并成功构建由盐藻GAPDH基因启动子驱动的氯霉素乙酰转移酶(CAT)基因表达载体pUC-Gcat.利用构建的表达载体电击转化盐藻并在含有氯霉素的培养基中筛选转化藻株.随机挑选稳定转化的盐藻藻株进行CAT酶联免疫吸附测定分析.结果 获得3株稳定转化的盐藻藻株.聚合酶链式反应鉴定和CAT酶联免疫吸附测定分析结果表明,CAT基因已整合到了转化的盐藻基因组中.结论 本研究所克隆的内源性盐藻GAPDH基因启动子能够驱动CAT基因在盐藻中表达.%Objective To explore expression of foreign gene driven by a strong endogenous promoter in order to construct stable and high-performance bioreactors in Dunaliella salina. Methods In the present study, the upstream sequence of glyceraldehyde phosphate dehydrogenase of Dunaliella salina was cloned and identificated. Using electroporation, the alga was transformed with a plasmid pUC-Ccat containing giyceraldehyde-3-phosphate dehydrogenase ( GAPDH) gene promoter of Du-naliella salina and chloramphenicol acetyltransferase ( CAT) gene as a seletable gene. Using the expression vector, the Dunaliella salina cell was translated and the transformational strain was screened in nutrient medium containing chloramphenicol. The stable transformational strain was selected randomly to undertake CAT enzyme linked immunosorbent assay (ELISA). Results Three stable transformational strain were obtained. The results of polymerase chain reaction and CAT ELISA indicated that the CAT gene had been transferred to the alga. Conclusion The results of this paper suggest that the GAPDH gene promoter can work for genetic transformation of Dunaliella salina.

  9. Simultaneous overexpression of enzymes of the lower part of glycolysis can enhance the fermentative capacity of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Smits, H. P.; Hauf, J.; Muller, S.

    2000-01-01

    Recombinant S. cerevisiae strains, with elevated levels of the enzymes of lower glycolysis (glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate mutase, phosphoglycerate kinase, enolase, pyruvate kinase, pyruvate decarboxylase and alcohol dehydrogenase) were physiologically characterized...

  10. A molecular analysis of the Gelechiidae (Lepidoptera, Gelechioidea) with an interpretative grouping of its taxa

    DEFF Research Database (Denmark)

    Karsholt, Ole; Mutanen, Marko; Lee, Sangmi;

    2013-01-01

    , Isocitrate dehydrogenase, Cytosolic malate dehydrogenase, Glyceraldehyde-3-phosphate dehydrogenase and Carbamoylphosphate synthase domain protein). Fifty-two taxa representing nearly all established subfamilies and tribes of Gelechiidae, and about 10% of described gelechiid genera, in addition to five...

  11. Triosidines: novel Maillard reaction products and cross-links from the reaction of triose sugars with lysine and arginine residues

    National Research Council Canada - National Science Library

    Tessier, Frederic J; Monnier, Vincent M; Sayre, Lawrence M; Kornfield, Julia A

    2003-01-01

    The role of the highly reactive triose sugars glyceraldehyde and glyceraldehyde-3-phosphate in protein cross-linking and other amino acid modifications during the Maillard reaction was investigated...

  12. Dicty_cDB: VSB590 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available lasmid for gene expression in pichia ciferri and transformation method using the same. 125 6e-40 4 AF053300 |AF053300.1 Pichia ciferr...ii glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene

  13. Dicty_cDB: VFC590 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available for gene expression in pichia ciferri and transformation method using the same. ...ciparum glyceraldehyde-3-phosphate dehydrogenase mRNA, complete cds. 78 3e-49 7 BD218177 |BD218177.1 Plasmid

  14. Main: PIIATGAPB [PLACE

    Lifescience Database Archive (English)

    Full Text Available PIIATGAPB S000382 23-Sep-2001 (last modified) kehi PII found in the Arabidopsis thalia...ydrogenase(GADPH) of A.T.; GAPB; glyceraldehyde-3-phosphate dehydrogenase; light-activated transcription; Arabidopsis thaliana TTGGTTTTGATCAAAACCAA ...

  15. Reference: PIATGAPB [PLACE

    Lifescience Database Archive (English)

    Full Text Available PIATGAPB Chan CS, Guo L, Shih MC Promoter analysis of the nuclear gene encoding the... chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana Plant Mol Biol 46: 131-141 (2001) PubMed: 11442054; ...

  16. Main: PIATGAPB [PLACE

    Lifescience Database Archive (English)

    Full Text Available PIATGAPB S000381 23-Aug-2001 (last modified) uchi PI found in the Arabidopsis thalia...drogenase(GADPH) of A.T.; GAPB; glyceraldehyde-3-phosphate dehydrogenase; light-activated transcription; Arabidopsis thaliana GTGATCAC ...

  17. AtSIG6 and other members of the sigma gene family jointly but differentially determine plastid target gene expression in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Sylvia eBock

    2014-11-01

    Full Text Available Plants contain a nuclear gene family for plastid sigma factors, i.e. proteins that associate with the bacterial-type organellar RNA polymerase and confer the ability for correct promoter binding and transcription initiation. Questions that are still unresolved relate to the division of labour among members of the sigma family, both in terms of their range of target genes and their temporal and spatial activity during development. Clues to the in vivo role of individual sigma genes have mainly come from studies of sigma knockout lines. Despite its obvious strengths, however, this strategy does not necessarily trace-down causal relationships between mutant phenotype and a single sigma gene, if other family members act in a redundant and/or compensatory manner. We made efforts to reduce the complexity by genetic crosses of Arabidopsis single mutants (with focus on a chlorophyll-deficient sig6 line to generate double knockout lines. The latter typically had a similar visible phenotype as the parental lines, but tended to be more strongly affected in the transcript patterns of both plastid and sigma genes. Because triple mutants were lethal under our growth conditions, we exploited a strategy of transformation of single and double mutants with RNAi constructs that contained sequences from the unconserved sigma region (UCR. These RNAi/knockout lines phenotypically resembled their parental lines, but were even more strongly affected in their plastid transcript patterns. Expression patterns of sigma genes revealed both similarities and differences compared to the parental lines, with transcripts at reduced or unchanged amounts and others that were found to be present in higher (perhaps compensatory amounts. Together, our results reveal considerable flexibility of gene activity at the levels of both sigma and plastid gene expression. A (still viable basal state seems to be reached, if 2 - 3 of the 6 Arabidopsis sigma genes are functionally compromised.

  18. AtSIG6 and other members of the sigma gene family jointly but differentially determine plastid target gene expression in Arabidopsis thaliana.

    Science.gov (United States)

    Bock, Sylvia; Ortelt, Jennifer; Link, Gerhard

    2014-01-01

    Plants contain a nuclear gene family for plastid sigma factors, i.e., proteins that associate with the "bacterial-type" organellar RNA polymerase and confer the ability for correct promoter binding and transcription initiation. Questions that are still unresolved relate to the "division of labor" among members of the sigma family, both in terms of their range of target genes and their temporal and spatial activity during development. Clues to the in vivo role of individual sigma genes have mainly come from studies of sigma knockout lines. Despite its obvious strengths, however, this strategy does not necessarily trace-down causal relationships between mutant phenotype and a single sigma gene, if other family members act in a redundant and/or compensatory manner. We made efforts to reduce the complexity by genetic crosses of Arabidopsis single mutants (with focus on a chlorophyll-deficient sig6 line) to generate double knockout lines. The latter typically had a similar visible phenotype as the parental lines, but tended to be more strongly affected in the transcript patterns of both plastid and sigma genes. Because triple mutants were lethal under our growth conditions, we exploited a strategy of transformation of single and double mutants with RNAi constructs that contained sequences from the unconserved sigma region (UCR). These RNAi/knockout lines phenotypically resembled their parental lines, but were even more strongly affected in their plastid transcript patterns. Expression patterns of sigma genes revealed both similarities and differences compared to the parental lines, with transcripts at reduced or unchanged amounts and others that were found to be present in higher (perhaps compensatory) amounts. Together, our results reveal considerable flexibility of gene activity at the levels of both sigma and plastid gene expression. A (still viable) "basal state" seems to be reached, if 2-3 of the 6 Arabidopsis sigma genes are functionally compromised.

  19. Downregulation of nuclear-encoded genes of oxidative metabolism in dialyzed chronic kidney disease patients.

    Directory of Open Access Journals (Sweden)

    Gianluigi Zaza

    Full Text Available BACKGROUND: Mitochondria, essential eukaryotic cells organelles defined as the "powerhouse of the cell" because of their ability to produce the vast majority of energy necessary for cellular metabolism, may have a primary role in the oxidative stress-related intracellular machinery associated to chronic kidney disease (CKD. METHODS: To better assess this research assumption, we decided to study the key factors regulating mitochondrial oxidative metabolism in CKD patients in peritoneal dialysis (PD, n = 15 using several bio-molecular methodologies. RESULTS: RT-PCR experiments demonstrate that the expression level of peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PGC-1α and nuclear respiratory factor-1 (NRF-1, two genes primarily involved in mitochondrial biogenesis and functions, were significantly hypo-expressed in peripheral blood mononuclear cells of PD patients compared to healthy subjects (HS, n = 15. Additionally, mRNA levels of several PGC1-α downstream target genes (TFAM, COX6C,COX7C, UQCRH and MCAD were profoundly down-regulated in PD cells. TFAM protein analysis confirmed gene-expression results. High plasmatic concentration of Malondialdehyde found in PD patients, confirmed the contribution of the oxidative stress to these biological effects. Finally, Nuclear factor erythroid-derived 2-like 2 (NRF2 or NFE2L2, a transcription factor for numerous antioxidant/detoxifying enzymes and one of its target genes, superoxide dismutase-2 mitochondrial (SOD2 were up-regulated in PD compared to HS. CONCLUSIONS: Our results revealed, for the first time, that CKD-PD patients' PBMC, through a complex intracellular biochemical machinery, are able to modulate their mitochondrial functions probably in the attempt to reduce oxidative metabolic damage and to turn on a valuable defense cellular strategy against oxidative stress.

  20. Discovery of Nuclear-Encoded Genes for the Neurotoxin Saxitoxin in Dinoflagellates

    OpenAIRE

    Anke Stüken; Orr, Russell J. S.; Ralf Kellmann; Murray, Shauna A.; Neilan, Brett A.; Kjetill S Jakobsen

    2011-01-01

    Saxitoxin is a potent neurotoxin that occurs in aquatic environments worldwide. Ingestion of vector species can lead to paralytic shellfish poisoning, a severe human illness that may lead to paralysis and death. In freshwaters, the toxin is produced by prokaryotic cyanobacteria; in marine waters, it is associated with eukaryotic dinoflagellates. However, several studies suggest that saxitoxin is not produced by dinoflagellates themselves, but by co-cultured bacteria. Here, we show that genes ...

  1. Reconstruction of Family-Level Phylogenetic Relationships within Demospongiae (Porifera) Using Nuclear Encoded Housekeeping Genes

    Science.gov (United States)

    Hill, Malcolm S.; Hill, April L.; Lopez, Jose; Peterson, Kevin J.; Pomponi, Shirley; Diaz, Maria C.; Thacker, Robert W.; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C.; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E.; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A.; di Stefano, Michael; Tarver, James E.; Collins, Allen G.

    2013-01-01

    Background Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. Methodology/Principal Findings We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosap, Myxospongiaep, Spongillidap, Haploscleromorphap (the marine haplosclerids) and Democlaviap. We found conflicting results concerning the relationships of Keratosap and Myxospongiaep to the remaining demosponges, but our results strongly supported a clade of Haploscleromorphap+Spongillidap+Democlaviap. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillidap) are sister to Haploscleromorphap rather than part of Democlaviap. Within Keratosap, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiaep, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlaviap, Tetractinellidap, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlaviap. Within Tetractinellidap, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. Conclusions/Significance These results, using an independent nuclear gene set, confirmed many hypotheses based on ribosomal and/or mitochondrial genes, and they also identified clades with low statistical support or clades that conflicted with traditional morphological classification. Our results will serve as a basis for future exploration of these outstanding questions using more taxon- and gene-rich datasets. PMID:23372644

  2. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

    Science.gov (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

    2013-01-01

    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set, confirmed many hypotheses based on ribosomal and/or mitochondrial genes, and they also identified clades with low statistical support or clades that conflicted with traditional morphological classification. Our results will serve as a basis for future exploration of these outstanding questions using more taxon- and gene-rich datasets.

  3. Sycamore amyloplasts can import and process precursors of nuclear encoded chloroplast proteins.

    Science.gov (United States)

    Strzalka, K; Ngernprasirtsiri, J; Watanabe, A; Akazawa, T

    1987-12-16

    Amyloplasts isolated from white-wild suspension-cultured cells of sycamore (Acer pseudoplatanus L.) are found to import and process the precursor of the small subunit (pS) of ribulose-1,5-bisphosphate carboxylase/oxygenase of spinach, but they lack the ability to form its holoenzyme due to the absence of both the large subunit and its binding-protein. They also import the precursor of the 33-kDa extrinsic protein (p33-kDa) of the O2-evolving complex of Photosystem II from spinach, but process is only to an intermediate form (i33-kDa). Chloroplasts from green-mutant cells of sycamore process p33-kDa to its mature form in this heterologous system. These results suggest that the thylakoid-associated protease responsible for the second processing step of p33-kDa is missing in amyloplasts, possibly due to the absence of thylakoid-membranes. In contrast, the apparent import of the precursor of the light-harvesting chlorophyll a/b-binding apoprotein (pLHCP) from spinach was not detected. Sycamore amyloplasts may lack the ability to import this particular thylakoid-protein, or rapidly degrade the imported molecules in the absence of thylakoid-membranes for their proper insertion.

  4. Discovery of nuclear-encoded genes for the neurotoxin saxitoxin in dinoflagellates.

    Science.gov (United States)

    Stüken, Anke; Orr, Russell J S; Kellmann, Ralf; Murray, Shauna A; Neilan, Brett A; Jakobsen, Kjetill S

    2011-01-01

    Saxitoxin is a potent neurotoxin that occurs in aquatic environments worldwide. Ingestion of vector species can lead to paralytic shellfish poisoning, a severe human illness that may lead to paralysis and death. In freshwaters, the toxin is produced by prokaryotic cyanobacteria; in marine waters, it is associated with eukaryotic dinoflagellates. However, several studies suggest that saxitoxin is not produced by dinoflagellates themselves, but by co-cultured bacteria. Here, we show that genes required for saxitoxin synthesis are encoded in the nuclear genomes of dinoflagellates. We sequenced >1.2×10(6) mRNA transcripts from the two saxitoxin-producing dinoflagellate strains Alexandrium fundyense CCMP1719 and A. minutum CCMP113 using high-throughput sequencing technology. In addition, we used in silico transcriptome analyses, RACE, qPCR and conventional PCR coupled with Sanger sequencing. These approaches successfully identified genes required for saxitoxin-synthesis in the two transcriptomes. We focused on sxtA, the unique starting gene of saxitoxin synthesis, and show that the dinoflagellate transcripts of sxtA have the same domain structure as the cyanobacterial sxtA genes. But, in contrast to the bacterial homologs, the dinoflagellate transcripts are monocistronic, have a higher GC content, occur in multiple copies, contain typical dinoflagellate spliced-leader sequences and eukaryotic polyA-tails. Further, we investigated 28 saxitoxin-producing and non-producing dinoflagellate strains from six different genera for the presence of genomic sxtA homologs. Our results show very good agreement between the presence of sxtA and saxitoxin-synthesis, except in three strains of A. tamarense, for which we amplified sxtA, but did not detect the toxin. Our work opens for possibilities to develop molecular tools to detect saxitoxin-producing dinoflagellates in the environment.

  5. Sequence and expression characteristics of a nuclear-encoded chloroplast sigma factor from mustard (Sinapis alba).

    Science.gov (United States)

    Kestermann, M; Neukirchen, S; Kloppstech, K; Link, G

    1998-06-01

    Plant chloroplasts contain transcription factors that functionally resemble bacterial sigma factors. We have cloned the full-length cDNA from mustard (Sinapis alba) for a 53 kDa derived polypeptide that contains similarity to regions 1.2-4.2 of sigma70-type factors. The amino acid sequence at the N-terminus has characteristics of a chloroplast transit peptide. An in vitro synthesized polypeptide containing this region was shown to be imported into the chloroplast and processed. The recombinant factor lacking the N-terminal extension was expressed in Escherichia coli and purified. It confers the ability on E.coli core RNA polymerase to bind specifically to a DNA fragment that contains the chloroplast psbA promoter. Transcription of the psbA template by E.coli core enzyme in the presence of recombinant SIG1 results in enhanced formation of transcripts of the size expected for correct initiation at the in vivo start site. Together, these data suggest that the mature protein acts as one of the chloroplast transcription factors in mustard. RNA gel blot hybridization reveals a transcript at approximately 1.8 kb, which is more abundant in light-grown than in dark-grown mustard seedlings.

  6. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

    Directory of Open Access Journals (Sweden)

    Malcolm S Hill

    Full Text Available BACKGROUND: Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. METHODOLOGY/PRINCIPAL FINDINGS: We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida. CONCLUSIONS/SIGNIFICANCE: These results, using an independent nuclear gene set, confirmed many hypotheses based on ribosomal and/or mitochondrial genes, and they also identified clades with low statistical support or clades that conflicted with traditional morphological classification. Our results will serve as a basis for future exploration of these outstanding questions using more taxon- and gene-rich datasets.

  7. Reference: 434 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available tián P et al. 2006 Aug. Plant Mol. Biol. 61(6):945-57. Non-phosphorylating glyceraldehyde- 3-phosphate dehyd...rogenase (NP-GAPDH) is a conserved cytosolic protein found in higher plants. In photosynthetic cells, the en...ignificantly, cytosolic phosphorylating (NAD-dependent) glyceraldehyde-3-phosphat...e dehydrogenase mRNA levels are induced in the mutant, which correlates with an increase in enzyme activity....h an increase in NADPH concentration. Moreover, increased ROS levels were measured in the mutant plants. Dow

  8. Quasi-periodicity in the autonomous glycolytic system

    Institute of Scientific and Technical Information of China (English)

    GAO Qingyu; ZHANG Lu; ZHANG Xing; WANG Jichang

    2005-01-01

    This study predicts that quasi-periodic oscilla-tions could exist in a detailed model of glycolysis that is ana-lyzed in an autonomous system. In addition to period-dou- bling, quasi-periodic and period-adding bifurcation, a new stationary branch, which lies in between the thermodynamic and flow branches, is also uncovered in the glycolytic reac-tion system. Results presented in this study illustrate that the Michaelis constant (K4GAP) of glyceraldehyde 3-phosphate dehydrogenase for glyceraldehyde 3-phosphate has great influences on glycolytic oscillations, in which increasing K4GAP widens the range of flow rate over which quasi-peri- odic oscillations exist.

  9. Mutation in the novel nuclear-encoded mitochondrial protein CHCHD10 in a family with autosomal dominant mitochondrial myopathy.

    Science.gov (United States)

    Ajroud-Driss, Senda; Fecto, Faisal; Ajroud, Kaouther; Lalani, Irfan; Calvo, Sarah E; Mootha, Vamsi K; Deng, Han-Xiang; Siddique, Nailah; Tahmoush, Albert J; Heiman-Patterson, Terry D; Siddique, Teepu

    2015-01-01

    Mitochondrial myopathies belong to a larger group of systemic diseases caused by morphological or biochemical abnormalities of mitochondria. Mitochondrial disorders can be caused by mutations in either the mitochondrial or nuclear genome. Only 5% of all mitochondrial disorders are autosomal dominant. We analyzed DNA from members of the previously reported Puerto Rican kindred with an autosomal dominant mitochondrial myopathy (Heimann-Patterson et al. 1997). Linkage analysis suggested a putative locus on the pericentric region of the long arm of chromosome 22 (22q11). Using the tools of integrative genomics, we established chromosome 22 open reading frame 16 (C22orf16) (later designated as CHCHD10) as the only high-scoring mitochondrial candidate gene in our minimal candidate region. Sequence analysis revealed a double-missense mutation (R15S and G58R) in cis in CHCHD10 which encodes a coiled coil-helix-coiled coil-helix protein of unknown function. These two mutations completely co-segregated with the disease phenotype and were absent in 1,481 Caucasian and 80 Hispanic (including 32 Puerto Rican) controls. Expression profiling showed that CHCHD10 is enriched in skeletal muscle. Mitochondrial localization of the CHCHD10 protein was confirmed using immunofluorescence in cells expressing either wild-type or mutant CHCHD10. We found that the expression of the G58R, but not the R15S, mutation induced mitochondrial fragmentation. Our findings identify a novel gene causing mitochondrial myopathy, thereby expanding the spectrum of mitochondrial myopathies caused by nuclear genes. Our findings also suggest a role for CHCHD10 in the morphologic remodeling of the mitochondria.

  10. Selective enrichment and sequencing of whole mitochondrial genomes in the presence of nuclear encoded mitochondrial pseudogenes (numts.

    Directory of Open Access Journals (Sweden)

    Jonci N Wolff

    Full Text Available Numts are an integral component of many eukaryote genomes offering a snapshot of the evolutionary process that led from the incorporation of an α-proteobacterium into a larger eukaryotic cell some 1.8 billion years ago. Although numt sequence can be harnessed as molecular marker, these sequences often remain unidentified and are mistaken for genuine mtDNA leading to erroneous interpretation of mtDNA data sets. It is therefore indispensable that during the process of amplifying and sequencing mitochondrial genes, preventive measures are taken to ensure the exclusion of numts to guarantee the recovery of genuine mtDNA. This applies to mtDNA analyses in general but especially to studies where mtDNAs are sequenced de novo as the launch pad for subsequent mtDNA-based research. By using a combination of dilution series and nested rolling circle amplification (RCA, we present a novel strategy to selectively amplify mtDNA and exclude the amplification of numt sequence. We have successfully applied this strategy to de novo sequence the mtDNA of the Black Field Cricket Teleogryllus commodus, a species known to contain numts. Aligning our assembled sequence to the reference genome of Teleogryllus emma (GenBank EU557269.1 led to the identification of a numt sequence in the reference sequence. This unexpected result further highlights the need of a reliable and accessible strategy to eliminate this source of error.

  11. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: the DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther;

    2009-01-01

    ). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome...

  12. Immunogenicity of nuclear-encoded LTB:ST fusion protein from Escherichia coli expressed in tobacco plants.

    Science.gov (United States)

    Rosales-Mendoza, Sergio; Soria-Guerra, Ruth E; Moreno-Fierros, Leticia; Govea-Alonso, Dania O; Herrera-Díaz, Areli; Korban, Schuyler S; Alpuche-Solís, Ángel G

    2011-06-01

    Enterotoxigenic Escherichia coli (ETEC) is one of the main causative agents of diarrhea in infants and for travelers. Inclusion of a heat-stable (ST) toxin into vaccine formulations is mandatory as most ETEC strains can produce both heat-labile (LT) and ST enterotoxins. In this study, a genetic fusion gene encoding for an LTB:ST protein has been constructed and transferred into tobacco via Agrobacterium tumefaciens-mediated transformation. Transgenic tobacco plants carrying the LTB:ST gene are then subjected to GM1-ELISA revealing that the LTB:ST has assembled into pentamers and displays antigenic determinants from both LTB and ST. Protein accumulation of up to 0.05% total soluble protein is detected. Subsequently, mucosal and systemic humoral responses are elicited in mice orally dosed with transgenic tobacco leaves. This has suggested that the plant-derived LTB:ST is immunogenic via the oral route. These findings are critical for the development of a plant-based vaccine capable of eliciting broader protection against ETEC and targeting both LTB and ST. Features of this platform in comparison to transplastomic approaches are discussed.

  13. GenBank blastx search result: AK103922 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK103922 001-013-B10 M66862.1 Salmonella sp. (group IV, strain RKS 3015, isolate CDC2584-68/deep forest anim...al/Canal zone/1968) glyceraldehyde-3-phosphate dehydrogenase gene, partial cds.|BCT BCT 3e-67 +3 ...

  14. Experimental determination of control of glycolysis in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Andersen, Heidi Winterberg; Solem, Christian

    2002-01-01

    ), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), pyruvate kinase (PYK) and lactate dehydrogenase (LDH) are shown to have no significant control on the glycolytic flux in exponentially growing cells of L. lactis MG1363. Introduction of an uncoupled ATPase activity results in uncoupling of glycolysis from biomass...

  15. In vitro antifungal susceptibility and molecular identity of 99 clinical isolates of the opportunistic fungal genus Curvularia

    NARCIS (Netherlands)

    Cunha, da K.C.; Sutton, D.A.; Fothergill, A.W.; Gené, J.; Cano, J.; Madrid, H.; Hoog, de G.S.; Crous, P.W.; Guarro, J.

    2013-01-01

    The in vitro antifungal susceptibility of a set of 99 clinical isolates of Curvularia was tested against 9 drugs using a reference microdilution method. The isolates had been identified previously to species level by comparing their ITS rDNA and glyceraldehyde-3-phosphate dehydrogenase gene sequence

  16. Main: TBOXATGAPB [PLACE

    Lifescience Database Archive (English)

    Full Text Available TBOXATGAPB S000383 23-Aug-2001 (last modified) uchi Tbox found in the Arabidopsis thaliana (A.T.) GAPB...ions in the Tbox resulted in reductions of light-activated gene transcription; GAPB encodes the B subunit of... chloroplast glyceraldehyde-3-phosphate dehydrogenase(GADPH) of A.T.; GAPB; glyce

  17. Multilocus phylogeny and MALDI-TOF analysis of the plant pathogenic species Alternaria dauci and relatives

    DEFF Research Database (Denmark)

    Brun, Sophie; Madrid, Hugo; Gerrits Van Den Ende, Bert

    2013-01-01

    -Assisted Laser Desorption Ionisation Time of Flight (MALDI-TOF) profiling of proteins. Phylogenetic analyses were performed on three loci, i.e., the internal transcribed spacer (ITS) region of rRNA, and the glyceraldehyde-3-phosphate dehydrogenase (gpd) and Alternaria major antigen (Alt a 1) genes. Phylogenetic...

  18. Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Kirby, James; Dietzel, Kevin L.; Wichmann, Gale;

    2016-01-01

    Isoprenoids are used in many commercial applications and much work has gone into engineering microbial hosts for their production. Isoprenoids are produced either from acetyl-CoA via the mevalonate pathway or from pyruvate and glyceraldehyde 3-phosphate via the 1-deoxy-D-xylulose 5-phosphate (DXP...

  19. Dicty_cDB: AFI703 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available hod using the same. 137 2e-43 3 AR411837 |AR411837.1 Sequence 5 from patent US 6638735. 137 2e-43 3 AF053300 |AF053300.1 Pichia cifer...rii glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene, complete cds. 137 2e-43

  20. GAPDH as a control gene to estimate genome copy number in Great Tits, with cross-amplification in Blue Tits

    NARCIS (Netherlands)

    Atema, E.; Van Oers, K.; Verhulst, S.

    2013-01-01

    Estimating the number of genome copies in a tissue sample can serve various purposes. For example, such an estimate serves as scaling variable when measuring telomeres with quantitative PCR. We describe the primer development and evaluation for the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) ge

  1. GAPDH as a control gene to estimate genome copy number in Great Tits, with cross-amplification in Blue Tits

    NARCIS (Netherlands)

    Atema, Els; van Oers, Kees; Verhulst, Simon

    2013-01-01

    Estimating the number of genome copies in a tissue sample can serve various purposes. For example, such an estimate serves as a scaling variable when measuring telomeres with quantitative PCR. We describe the primer development and evaluation for the glyceraldehyde-3-phosphate dehydrogenase (GAPDH)

  2. Microbial production of 3-hydroxypropionic acid

    DEFF Research Database (Denmark)

    2014-01-01

    A yeast cell havinga reduced level of activity of NAD dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has at least one exogenous gene encoding NADP dependent GAPDH and/or has up-regulation of at least one endogenous gene expressing NADP dependent GAPDH, wherein combined expression of t...

  3. Reference: PIIATGAPB [PLACE

    Lifescience Database Archive (English)

    Full Text Available PIIATGAPB Chan CS, Guo L, Shih MC Promoter analysis of the nuclear gene encoding th...e chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana Plant Mol Biol 46: 131-141 (2001) PubMed: 11442054; ...

  4. Zymomonas with improved xylose utilization

    Science.gov (United States)

    Viitanen, Paul V [West Chester, PA; Tao, Luan [Havertown, PA; Zhang, Yuying [New Hope, PA; Caimi, Perry G [Kennett Square, PA; McCutchen, Carol M [Wilmington, DE; McCole, Laura [East Fallowfield, PA; Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Lakewood, CO; Franden, Mary Ann [Centennial, CO

    2011-08-16

    Strains of Zymomonas were engineered by introducing a chimeric xylose isomerase gene that contains a mutant promoter of the Z. mobilis glyceraldehyde-3-phosphate dehydrogenase gene. The promoter directs increased expression of xylose isomerase, and when the strain is in addition engineered for expression of xylulokinase, transaldolase and transketolase, improved utilization of xylose is obtained.

  5. Bipolaris oryzae, a novel fungal opportunist causing keratitis

    NARCIS (Netherlands)

    Al-Hatmi, Abdullah

    2015-01-01

    We report a case of mycotic keratitis caused by Bipolaris oryzae with predisposing trauma from a foreign body. The fungus was identified by sequencing the internal transcribed spacer (ITS) region, translation elongation factor 1α (TEF1) gene and partial glyceraldehyde-3-phosphate dehydrogenase (GPDH

  6. Identification and expression of fructose-1,6-bisphosphate aldolase genes and their relations to oil content in developing seeds of tea oil tree (Camellia oleifera)

    Science.gov (United States)

    Tea oil tree (Camellia oleifera, Co) provides a fine edible oil source in China. Tea oil from the seeds is very beneficial to human health. Fructose-1,6-bisphosphate aldolase (FBA) hydrolyzes fructose-1,6-bisphosphate into dihydroxyacetone phosphate and glyceraldehyde 3-phosphate, two critical metab...

  7. Evolution and host specificity in the ectomycorrhizal genus Leccinum

    NARCIS (Netherlands)

    Bakker, den H.C.; Zuccarello, G.C.; Kuyper, T.W.; Noordeloos, M.E.

    2004-01-01

    Species of the ectomycorrhizal genus Leccinum are generally considered to be host specialists. We determined the phylogenetic relationships between species of Leccinum from Europe and North America based on second internal transcribed spacer (ITS2) and glyceraldehyde 3-phosphate dehydrogenase (Gapdh

  8. Comparative genomic studies suggest that the cyanobacterial endosymbionts of the amoeba Paulinella chromatophora possess an import apparatus for nuclear-encoded proteins.

    Science.gov (United States)

    Bodył, A; Mackiewicz, P; Stiller, J W

    2010-07-01

    Plastids evolved from free-living cyanobacteria through a process of primary endosymbiosis. The most widely accepted hypothesis derives three ancient lineages of primary plastids, i.e. those of glaucophytes, red algae and green plants, from a single cyanobacterial endosymbiosis. This hypothesis was originally predicated on the assumption that transformations of endosymbionts into organelles must be exceptionally rare because of the difficulty in establishing efficient protein trafficking between a host cell and incipient organelle. It turns out, however, that highly integrated endosymbiotic associations are more common than once thought. Among them is the amoeba Paulinella chromatophora, which harbours independently acquired cyanobacterial endosymbionts functioning as plastids. Sequencing of the Paulinella endosymbiont genome revealed an absence of essential genes for protein trafficking, suggesting their residence in the host nucleus and import of protein products back into the endosymbiont. To investigate this hypothesis, we searched the Paulinella endosymbiont genome for homologues of higher plant translocon proteins that form the import apparatus in two-membrane envelopes of primary plastids. We found homologues of Toc12, Tic21 and Tic32, but genes for other key translocon proteins (e.g. Omp85/Toc75 and Tic20) were missing. We propose that these missing genes were transferred to the Paulinella nucleus and their products are imported and integrated into the endosymbiont envelope membranes, thereby creating an effective protein import apparatus. We further suggest that other bacterial/cyanobacterial endosymbionts found in protists, plants and animals could have evolved efficient protein import systems independently and, therefore, reached the status of true cellular organelles.

  9. COVER FIGURE in Nucleic Acids Research (Volume 39, Issue 9) entitled "The involvement of the nuclear-encoded human 2'-phosphodiesterase in mitochondrial RNA turnover"

    DEFF Research Database (Denmark)

    Poulsen, Jesper Buchhave

    2011-01-01

    peptide is cleaved-off (see magnification in lower left corner), and the 2'-PDE folded to generate a catalytically active protein actively degrading RNA (see magnification in upper right corner). Liberated ribonucleotide monophosphate products (A, G, C and U) are indicated by color-coded boxes...

  10. Blue-light mediated accumulation of nuclear-encoded transcripts coding for proteins of the thylakoid membrane is absent in the phytochrome-deficient aurea mutant of tomato.

    Science.gov (United States)

    Oelmüller, R; Kendrick, R E; Briggs, W R

    1989-08-01

    Polyclonal antibodies against pea phytochrome detect 2 protein bands (about 116 and 120 kDa) on blots of crude protein extracts and protein of microsomal preparations of dark-grown tomato seedlings. Both protein bands are undetectable in Western blots of the aurea mutant extracts. Neither protein band is detectable after isogenic wild-type seedlings are illuminated with 3 h of red light, either in the crude extract or in the membrane fraction of the irradiated seedlings; this result is consistent with the hypothesis that both bands are phytochrome. When dark-grown wild-type seedlings are illuminated with 3 h of red light or blue light against a red light background, the transcript levels for chlorophyll a/b-binding proteins of photosystem I and II, plastocyanin, and the subunit II of photosystem I increase. In all cases, the same fluence rate of blue light is much more effective than red light alone, a result that indicates the involvement of a blue/UV-A light photoreceptor in addition to the involvement of the far-red-absorbing form of phytochrome, Pfr. The aurea mutant responds neither to red light nor to blue light. Thus, no Pfr-independent induction of the four transcripts by a blue/UV-A light photoreceptor can be measured in the aurea mutant.

  11. Prenatal copper deficiency in rat dams causes persistent reduction in nuclear-encoded cytochrome c oxidase subunits in cardiac mitochrondria of the first generation

    Science.gov (United States)

    Previous studies have shown that the offspring of rat dams having low copper (Cu) intake during pregnancy and lactation experience a deficiency in cardiac cytochrome c oxidase (CCO) after postnatal day 10. The present study was undertaken to determine the relative influences of pre-and postnatal Cu ...

  12. The majority of total nuclear-encoded non-ribosomal RNA in a human cell is 'dark matter' un-annotated RNA

    Directory of Open Access Journals (Sweden)

    Milos Patrice

    2010-12-01

    Full Text Available Abstract Background Discovery that the transcriptional output of the human genome is far more complex than predicted by the current set of protein-coding annotations and that most RNAs produced do not appear to encode proteins has transformed our understanding of genome complexity and suggests new paradigms of genome regulation. However, the fraction of all cellular RNA whose function we do not understand and the fraction of the genome that is utilized to produce that RNA remain controversial. This is not simply a bookkeeping issue because the degree to which this un-annotated transcription is present has important implications with respect to its biologic function and to the general architecture of genome regulation. For example, efforts to elucidate how non-coding RNAs (ncRNAs regulate genome function will be compromised if that class of RNAs is dismissed as simply 'transcriptional noise'. Results We show that the relative mass of RNA whose function and/or structure we do not understand (the so called 'dark matter' RNAs, as a proportion of all non-ribosomal, non-mitochondrial human RNA (mt-RNA, can be greater than that of protein-encoding transcripts. This observation is obscured in studies that focus only on polyA-selected RNA, a method that enriches for protein coding RNAs and at the same time discards the vast majority of RNA prior to analysis. We further show the presence of a large number of very long, abundantly-transcribed regions (100's of kb in intergenic space and further show that expression of these regions is associated with neoplastic transformation. These overlap some regions found previously in normal human embryonic tissues and raises an interesting hypothesis as to the function of these ncRNAs in both early development and neoplastic transformation. Conclusions We conclude that 'dark matter' RNA can constitute the majority of non-ribosomal, non-mitochondrial-RNA and a significant fraction arises from numerous very long, intergenic transcribed regions that could be involved in neoplastic transformation.

  13. A novel nuclear-encoded mitochondrial poly(A polymerase PAPD1 is a potential candidate gene for the extreme obesity related phenotypes in mammals

    Directory of Open Access Journals (Sweden)

    Qianjun Xiao, Xiao-Lin Wu, Jennifer J. Michal, Jerry J. Reeves, Jan R. Busboom, Gary H. Thorgaard, Zhihua Jiang

    2006-01-01

    Full Text Available People with obesity, especially extreme obesity, are at risk for many health problems. However, the responsible genes remain unknown in >95% of severe obesity cases. Our previous genome-wide scan of Wagyu x Limousin F2 cattle crosses with extreme phenotypes revealed a molecular marker significantly associated with intramuscular fat deposition. Characterization of this marker showed that it is orthologous to the human gene KIAA1462 located on HSA10p11.23, where a major quantitative trait locus for morbid obesity has been reported. The newly identified mitochondrial poly(A polymerase associated domain containing 1 (PAPD1 gene, which is located near this marker, is particularly interesting because the polymerase is required for the polyadenylation and stabilization of mammalian mitochondrial mRNAs. In the present study, both cDNA and genomic DNA sequences were annotated for the bovine PAPD1 gene and ten genetic markers were detected in the promoter and exon 1 region. Among seven markers assayed on ~ 250 Wagyu x Limousin F2 animals, two single nucleotide polymorphisms (SNPs in the promoter region were significantly associated with intramuscular fat (P<0.05. However, there was a significant interaction (P<0.05 between a third SNP, which causes an amino acid change in coding exon 1, and each of these two promoter SNPs on intramuscular fat deposition. In particular, the differences between double heterozygous animals at two polymorphic sites and the slim genotype animals exceeded 2.3 standard deviations for the trait in both cases. Our study provides evidence for a new mechanism – the involvement of compound heterosis in extreme obesity, which warrants further examination.

  14. Reduced expression of nuclear-encoded genes involved in mitochondrial oxidative metabolism in skeletal muscle of insulin-resistant women with polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Skov, Vibe; Glintborg, Dorte; Knudsen, Steen

    2007-01-01

    Insulin resistance in skeletal muscle is a major risk factor for the development of type 2 diabetes in women with polycystic ovary syndrome (PCOS). In patients with type 2 diabetes, insulin resistance in skeletal muscle is associated with abnormalities in insulin signaling, fatty acid metabolism...... of metabolically characterized PCOS patients (n = 16) and healthy control subjects (n = 13) using two different approaches for global pathway analysis: gene set enrichment analysis (GSEA 1.0) and gene map annotator and pathway profiler (GenMAPP 2.0). We demonstrate that impaired insulin-stimulated total, oxidative...... mitochondrial oxidative metabolism, which is, in part, mediated by reduced PGC-1alpha levels. These abnormalities may contribute to the increased risk of type 2 diabetes observed in women with PCOS....

  15. ON THE IDENTITY OF KARLODINIUM VENEFICUM AND DESCRIPTION OF KARLODINIUM ARMIGER SP. NOV. (DINOPHYCEAE), BASED ON LIGHT AND ELECTRON MICROSCOPY, NUCLEAR-ENCODED LSU RDNA, AND PIGMENT COMPOSITION

    DEFF Research Database (Denmark)

    Bergholtz, Trine; Daugbjerg, Niels; Moestrup, Øjvind

    2006-01-01

    . The culture used by Ballantine to describe Gymnodinium veneficum Ballantine (Plymouth 103) was examined by light and electron microscopy and by partial LSU rDNA. Ultrastructurally, it proved identical to K. micrum (cultures Plymouth 207 and K. Tangen KT-77D, the latter also known as K-0522), and in LSU...

  16. Antimicrobial properties and death-inducing mechanisms of saccharomycin, a biocide secreted by Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Branco, Patrícia; Francisco, Diana; Monteiro, Margarida

    2017-01-01

    We recently found that Saccharomyces cerevisiae (strain CCMI 885) secretes antimicrobial peptides (AMPs) derived from the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH) that are active against various wine-related yeast and bacteria. Here, we show that several other S. cerevis......We recently found that Saccharomyces cerevisiae (strain CCMI 885) secretes antimicrobial peptides (AMPs) derived from the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH) that are active against various wine-related yeast and bacteria. Here, we show that several other S....... cerevisiae strains also secrete natural biocide fractions during alcoholic fermentation, although at different levels, which correlates with the antagonistic effect exerted against non-Saccharomyces yeasts. We, therefore, term this biocide saccharomycin. The native AMPs were purified by gel...... species during alcoholic fermentations....

  17. Rice ubiquitin ligase EL5 prevents root meristematic cell death under high nitrogen conditions and interacts with a cytosolic GAPDH.

    Science.gov (United States)

    Nishizawa, Yoko; Mochizuki, Susumu; Koiwai, Hanae; Kondo, Katsuhiko; Kishimoto, Kyutaro; Katoh, Etsuko; Minami, Eiichi

    2015-01-01

    Root formation in rice transformants overexpressing mutated EL5 (mEL5) was severely inhibited because of meristematic cell death. Cell death was caused by nitrogen sources, particularly nitrate forms, in the culture medium. Nitrite treatment increased the cytokinin contents in roots, but mEL5 contained more cytokinins than non-transformants. Transcriptome profiling showed overlaps between nitrite-responsive genes in non-transformants and genes with altered expression in untreated mEL5. These results indicate that impairment of EL5 function activates nitrogen signaling despite the absence of a nitrogen source. Physical interaction between the EL5 C-terminal region and a cytosolic glyceraldehyde-3-phosphate dehydrogenase, OsGapC2, was demonstrated in vitro and in vivo. Elucidation of the role of glyceraldehyde-3-phosphate dehydrogenase in oxidative cell death in plants is expected in future.

  18. One-pot microbial synthesis of 2'-deoxyribonucleoside from glucose, acetaldehyde, and a nucleobase.

    Science.gov (United States)

    Horinouchi, Nobuyuki; Ogawa, Jun; Kawano, Takako; Sakai, Takafumi; Saito, Kyota; Matsumoto, Seiichiro; Sasaki, Mie; Mikami, Yoichi; Shimizu, Sakayu

    2006-06-01

    A one-pot enzymatic synthesis of 2'-deoxyribonucleoside from glucose, acetaldehyde, and a nucleobase was established. Glycolysis by baker's yeast (Saccharomyces cerevisiae) generated ATP which was used to produce D: -glyceraldehyde 3-phosphate production from glucose via fructose 1,6-diphosphate. The D: -glyceraldehyde 3-phosphate produced was transformed to 2'-deoxyribonucleoside via 2-deoxyribose 5-phosphate and then 2-deoxyribose 1-phosphate in the presence of acetaldehyde and a nucleobase by deoxyriboaldolase, phosphopentomutase expressed in Escherichia coli, and a commercial nucleoside phosphorylase. About 33 mM 2'-deoxyinosine was produced from 600 mM glucose, 333 mM acetaldehyde and 100 mM adenine in 24 h. 2'-Deoxyinosine was produced from adenine due to the adenosine deaminase activity of E. coli transformants.

  19. Proteomic Analysis of Prostate Cancer Field Effect

    Science.gov (United States)

    2011-02-01

    EH-domain containing 2 [Homo sapiens] isocitrate dehydrogenase 2 (NADP+), mitochondrial precursor [Homo sapiens] myosin, heavy polypeptide 9, non...dihydropyrimidinase-like 3 [Homo sapiens] isocitrate dehydrogenase 1 (NADP+), soluble [Homo sapiens] catenin (cadherin-associated protein), beta 1, 88kDa [Homo...propeptide [Homo sapiens] heat shock 70kDa protein 1 A [Homo sapiens] glyceraldehyde-3-phosphate dehydrogenase [Homo sapiens] haptoglobin [Homo

  20. Enhancing T3 and cAMP responsive gene participation in the thermogenic regulation of fuel oxidation pathways

    OpenAIRE

    2010-01-01

    OBJECTIVE: We sought to identify glycolysis, glycogenolysis, lipolysis, Krebs cycle, respiratory chain, and oxidative phosphorylation enzymes simultaneously regulated by T3 and cAMP. MATERIALS AND METHODS: We performed in silico analysis of 56 promoters to search for cis-cAMP (CREB) and cis-thyroid (TRE) response elements, considering UCP1, SERCA2 and glyceraldehyde 3-phosphate dehydrogenase as reference. Only regulatory regions with prior in vitro validation were selected. RESULTS: 29/56 enz...

  1. Penicillium chrysogenum as a model system for studying cellular effects of methylglyoxal

    OpenAIRE

    Scheckhuber, Christian Q.

    2015-01-01

    Background α-oxoaldehydes are formed as toxic by-products during metabolic activity. The biologically most important compound of this class, methylglyoxal, results from spontaneous phosphate elimination from dihydroxyacetone phosphate and glyceraldehyde 3-phosphate which are intermediate glycolysis products. Methylglyoxal-mediated modification of lipids, nucleic acids and proteins is known to lead to the formation of advanced glycation end products. These modifications contribute to the aetio...

  2. Nuclear GAPDH: changing the fate of Müller cells in diabetes

    OpenAIRE

    Jayaguru, Prathiba; Mohr, Susanne

    2012-01-01

    Müller cells, the primary glial cells are a crucial component of the retinal tissue performing a wide range of functions including maintaining the blood-retinal barrier. Several studies suggest that diabetes leads to Müller cell dysfunction and loss. The pathophysiology of hyperglycemia-induced cellular injury of Müller cells remains only poorly understood. Recently, the concept that translocation of the predominantly cytosolic glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH...

  3. Phylogenetic Status of an Unrecorded Species of Curvularia, C. spicifera, Based on Current Classification System of Curvularia and Bipolaris Group Using Multi Loci.

    Science.gov (United States)

    Jeon, Sun Jeong; Nguyen, Thi Thuong Thuong; Lee, Hyang Burm

    2015-09-01

    A seed-borne fungus, Curvularia sp. EML-KWD01, was isolated from an indigenous wheat seed by standard blotter method. This fungus was characterized based on the morphological characteristics and molecular phylogenetic analysis. Phylogenetic status of the fungus was determined using sequences of three loci: rDNA internal transcribed spacer, large ribosomal subunit, and glyceraldehyde 3-phosphate dehydrogenase gene. Multi loci sequencing analysis revealed that this fungus was Curvularia spicifera within Curvularia group 2 of family Pleosporaceae.

  4. Cytokine mRNA Expression in Lesions in Cats with Chronic Gingivostomatitis

    OpenAIRE

    Harley, R.; Helps, C. R.; Harbour, D. A.; Gruffydd-Jones, T.J.; Day, M J

    1999-01-01

    Semiquantitative reverse transcription-PCR assays were developed to measure feline interleukin-2 (IL-2), IL-4, IL-5, IL-6, IL-10, and IL-12 (p35 & p40); gamma interferon (IFN-γ); and glyceraldehyde-3-phosphate dehydrogenase mRNA concentrations in biopsies of feline oral mucosa. Biopsies were collected from 30 cats with chronic gingivostomatitis (diseased) prior to each cat receiving one of four treatments. In 23 cases replicate biopsies were collected 3 months after tr...

  5. First Report of Anthracnose Caused by Colletotrichum fioriniae on Chinese Matrimony Vine in Korea

    Science.gov (United States)

    Oo, May Moe; Tweneboah, Solomon

    2016-01-01

    A fungus, Colletotrichum fioriniae, was isolated for the first time from fruits of Chinese matrimony vine (Lycium chinense Mill.) in Korea. It was classified as C. fioriniae based on the morphological characteristics and nucleotide sequence of glyceraldehyde-3-phosphate-dehydrogenase and β-tubulin. To the best of our knowledge, this is the first report of C. fioriniae causing anthracnose of Chinese matrimony vine in Korea. PMID:28154492

  6. Diversity and enzymatic profiling of halotolerant micromycetes from Sebkha El Melah, a Saharan salt flat in Southern Tunisia

    OpenAIRE

    Atef Jaouani; Mohamed Neifar; Valeria Prigione; Amani Ayari; Imed Sbissi; Sonia Ben Amor; Seifeddine Ben Tekaya; Giovanna Cristina Varese; Ameur Cherif; Maher Gtari

    2014-01-01

    Twenty-one moderately halotolerant fungi have been isolated from sample ashes collected from Sebkha El Melah, a Saharan salt flat located in southern Tunisia. Based on morphology and sequence inference from the internal transcribed spacer regions, 28S rRNA gene and other specific genes such as β-tubulin, actin, calmodulin, and glyceraldehyde-3-phosphate dehydrogenase, the isolates were found to be distributed over 15 taxa belonging to 6 genera of Ascomycetes: Cladosporium (n = 3), Alternaria ...

  7. Artificial and natural thermostabilization of subunit enzymes. Do they have similar mechanism?

    Science.gov (United States)

    Trubetskoy, V S; Torchilin, V P

    1985-01-01

    Rabbit skeletal muscle glyceraldehyde-3-phosphate dehydrogenase was stabilized by intramolecular intersubunit crosslinking with diimidoesters. Half-inactivation temperature for optimal cross-linker-treated enzyme preparation increased by 11 degrees C. Stabilization effect correlated with the content of crosslinked fractions in enzyme preparation, as proved by SDS gel-electrophoresis. It is proposed that artificial crosslinks stabilize the enzyme in a similar fashion to salt bridges in the thermophilic bacteria enzymes, i.e. preventing dissociation into inactive subunits.

  8. First Report of Anthracnose Caused by Colletotrichum fioriniae on Chinese Matrimony Vine in Korea.

    Science.gov (United States)

    Oo, May Moe; Tweneboah, Solomon; Oh, Sang-Keun

    2016-12-01

    A fungus, Colletotrichum fioriniae, was isolated for the first time from fruits of Chinese matrimony vine (Lycium chinense Mill.) in Korea. It was classified as C. fioriniae based on the morphological characteristics and nucleotide sequence of glyceraldehyde-3-phosphate-dehydrogenase and β-tubulin. To the best of our knowledge, this is the first report of C. fioriniae causing anthracnose of Chinese matrimony vine in Korea.

  9. Methylation of chloroplast DNA does not affect viability and maternal inheritance in tobacco and may provide a strategy towards transgene containment

    Science.gov (United States)

    Jaffé, Benjamin; Kovács, Katalin; Andras, Calin; Bódi, Zsuzsanna; Liu, Zheng

    2008-01-01

    We report the integration of a type II restriction-methylase, mFokI, into the tobacco chloroplast genome and we demonstrate that the introduced enzyme effectively directs the methylation of its target sequence in vivo and does not affect maternal inheritance. We further report the transformation of tobacco with an E. coli dcm methylase targeted to plastids and we demonstrate efficient cytosine methylation of the plastid genome. Both adenosine methylation of FokI sites and cytosine methylation of dcm sites appeared phenotypically neutral. The ability to tolerate such plastid genome methylation is a pre-requisite for a proposed plant transgene containment system. In such a system, a chloroplast located, maternally inherited restriction methylase would provide protection from a nuclear-encoded, plastid targeted restriction endonuclease. As plastids are not paternally inherited in most crop species, pollen from such plants would carry the endonuclease transgene but not the corresponding methylase; the consequence of this should be containment of all nuclear transgenes, as pollination will only be viable in crosses to the appropriate transplastomic maternal background. PMID:18536921

  10. Complex Ancestries of Isoprenoid Synthesis in Dinoflagellates.

    Science.gov (United States)

    Bentlage, Bastian; Rogers, Travis S; Bachvaroff, Tsvetan R; Delwiche, Charles F

    2016-01-01

    Isoprenoid metabolism occupies a central position in the anabolic metabolism of all living cells. In plastid-bearing organisms, two pathways may be present for de novo isoprenoid synthesis, the cytosolic mevalonate pathway (MVA) and nuclear-encoded, plastid-targeted nonmevalonate pathway (DOXP). Using transcriptomic data we find that dinoflagellates apparently make exclusive use of the DOXP pathway. Using phylogenetic analyses of all DOXP genes we inferred the evolutionary origins of DOXP genes in dinoflagellates. Plastid replacements led to a DOXP pathway of multiple evolutionary origins. Dinoflagellates commonly referred to as dinotoms due to their relatively recent acquisition of a diatom plastid, express two completely redundant DOXP pathways. Dinoflagellates with a tertiary plastid of haptophyte origin, by contrast, express a hybrid pathway of dual evolutionary origin. Here, changes in the targeting motif of signal/transit peptide likely allow for targeting the new plastid by the proteins of core isoprenoid metabolism proteins. Parasitic dinoflagellates of the Amoebophyra species complex appear to have lost the DOXP pathway, suggesting that they may rely on their host for sterol synthesis.

  11. Sperm motility under exposure of hydrogen dioxide

    Directory of Open Access Journals (Sweden)

    V. V. Evdokimov

    2015-01-01

    Full Text Available The paper contains research data on the effect of low concentrations of hydrogen dioxide on human sperm motility and specific enzyme activity of sperms of glyceraldehyde-3-phosphate dehydrogenase. It is shown that incubation of sperms with hydrogen dioxide in a low concentration leads to a change and motility in sperm and activity of sperm enzyme. Intensity of observed effect depended on the concentration of hydrogen dioxide: active mobility increased by 17–19 % and the total mobility – 11 %. Motility changes in sperms were accompanied by increased activity of glyceraldehyde-3-phosphate dehydrogenase by 24 %, in normozoospermia response was higher than in pathozoospermia and also depended on the concentration of hydrogen dioxide. The use of sperm analyzer enabled revealing changes in the diapason of different speeds of the active fraction of sperm, which have been observed in the first 15 min of incubation with hydrogen dioxide. A possible mechanism of action of the detected effect is discussed. Reactive oxygen species easily oxidize enzyme for glyceraldehyde-3-phosphate dehydrogenase of sperms, which leads to a loss of sperm motility, for example, in varicocele. Initially low enzyme activity in varicocele (pathozoospermia may be associated with the suppression of sperm antioxidant defense. Addition of low concentrations of hydrogen dioxide into sperm samples leads to an increase in the concentration of reduced glutathione in a cell. Increase of sperm motility in this case can serve as an indicator of normal operation of the cellular antioxidant defense system. Obtained experimental results provide a background for their introduction into clinical practice in the program of assisted reproductive technologies. 

  12. Sperm motility under exposure of hydrogen dioxide

    Directory of Open Access Journals (Sweden)

    V. V. Evdokimov

    2015-04-01

    Full Text Available The paper contains research data on the effect of low concentrations of hydrogen dioxide on human sperm motility and specific enzyme activity of sperms of glyceraldehyde-3-phosphate dehydrogenase. It is shown that incubation of sperms with hydrogen dioxide in a low concentration leads to a change and motility in sperm and activity of sperm enzyme. Intensity of observed effect depended on the concentration of hydrogen dioxide: active mobility increased by 17–19 % and the total mobility – 11 %. Motility changes in sperms were accompanied by increased activity of glyceraldehyde-3-phosphate dehydrogenase by 24 %, in normozoospermia response was higher than in pathozoospermia and also depended on the concentration of hydrogen dioxide. The use of sperm analyzer enabled revealing changes in the diapason of different speeds of the active fraction of sperm, which have been observed in the first 15 min of incubation with hydrogen dioxide. A possible mechanism of action of the detected effect is discussed. Reactive oxygen species easily oxidize enzyme for glyceraldehyde-3-phosphate dehydrogenase of sperms, which leads to a loss of sperm motility, for example, in varicocele. Initially low enzyme activity in varicocele (pathozoospermia may be associated with the suppression of sperm antioxidant defense. Addition of low concentrations of hydrogen dioxide into sperm samples leads to an increase in the concentration of reduced glutathione in a cell. Increase of sperm motility in this case can serve as an indicator of normal operation of the cellular antioxidant defense system. Obtained experimental results provide a background for their introduction into clinical practice in the program of assisted reproductive technologies. 

  13. Pregnancy Vaccination with Gold Glyco-Nanoparticles Carrying Listeria monocytogenes Peptides Protects against Listeriosis and Brain- and Cutaneous-Associated Morbidities

    Directory of Open Access Journals (Sweden)

    Ricardo Calderón-Gonzalez

    2016-08-01

    Full Text Available Listeriosis is a fatal infection for fetuses and newborns with two clinical main morbidities in the neonatal period, meningitis and diffused cutaneous lesions. In this study, we vaccinated pregnant females with two gold glyconanoparticles (GNP loaded with two peptides, listeriolysin peptide 91–99 (LLO91–99 or glyceraldehyde-3-phosphate dehydrogenase 1–22 peptide (GAPDH1–22. Neonates born to vaccinated mothers were free of bacteria and healthy, while non-vaccinated mice presented clear brain affections and cutaneous diminishment of melanocytes. Therefore, these nanoparticle vaccines are effective measures to offer pregnant mothers at high risk of listeriosis interesting therapies that cross the placenta.

  14. Total protein or high-abundance protein: Which offers the best loading control for Western blotting?

    Science.gov (United States)

    Thacker, Jonathan S; Yeung, Derrick H; Staines, W Richard; Mielke, John G

    2016-03-01

    Western blotting routinely involves a control for variability in the amount of protein across immunoblot lanes. Normalizing a target signal to one found for an abundantly expressed protein is widely regarded as a reliable loading control; however, this approach is being increasingly questioned. As a result, we compared blotting for two high-abundance proteins (actin and glyceraldehyde 3-phosphate dehydrogenase [GAPDH]) and two total protein membrane staining methods (Ponceau and Coomassie Brilliant Blue) to determine the best control for loading variability. We found that Ponceau staining optimally balanced accuracy and precision, and we suggest that this approach be considered as an alternative to normalizing with a high-abundance protein.

  15. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells

    DEFF Research Database (Denmark)

    Yang, Hsiao Yin; Vonk, Lucienne A.; Licht, Ruud;

    2014-01-01

    application. In the current study, we selected two synthetic transfection reagents, a cationic lipid-based commercial reagent Lipofectamine RNAiMAX and polyethylenimine (PEI), and two naturally-derived transfection reagents, namely the polysaccharides chitosan (98% deacetylation) and hyaluronic acid (20......% amidation), for siRNA delivery into primary mesenchymal cells including nucleus pulposus cells, articular chondrocytes and mesenchymal stem cells (MSCs). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous model gene to evaluate the extent of silencing by 20 nM or 200 nM siRNA at day...

  16. Phenotypical and Genotypical Properties of an Arcanobacterium pluranimalium Strain Isolated from a Juvenile Giraffe (Giraffa camelopardalis reticulata

    Directory of Open Access Journals (Sweden)

    Karin Risse

    2014-01-01

    Full Text Available The present study was designed to characterize phenotypically and genotypically an Arcanobacterium pluranimalium strain (A. pluranimalium 4868 following necropsy from a juvenile giraffe. The species identity could be confirmed by phenotypical investigations and by MALDI-TOF MS analysis, by sequencing the 16S rDNA, pluranimaliumlysin encoding gene pla, and glyceraldehyde-3-phosphate dehydrogenase encoding gene gap with sequence similarities to A. pluranimalium reference strain DSM 13483T of 99.2%, 89.9%, and 99.1%, respectively. To our knowledge, the present study is the first phenotypic and genotypic characterization of an A. pluranimalium strain isolated from a giraffe.

  17. Affi-gel blue treatment simplifies the protein composition of sarcoplasmic reticulum vesicles.

    Science.gov (United States)

    Papp, S; Dux, L; Martonosi, A

    1986-04-01

    Sarcoplasmic reticulum vesicles isolated by conventional techniques usually contain, in addition to the recognized sarcoplasmic reticulum components, several other proteins (phosphorylase, myosin, glyceraldehyde-3-phosphate dehydrogenase, etc.) in variable amounts; these proteins complicate the interpretation of chemical modification data. Incubation of sarcoplasmic reticulum vesicles with Affi-Gel blue particles for 1-4 h at 2 degrees C, followed by sedimentation of the Affi-Gel in a clinical centrifuge, simplifies the protein composition by selective adsorption of the accessory proteins, and improves the consistency of the preparations. The Affi-Gel blue treatment is recommended as part of the standard procedure for the isolation of sarcoplasmic reticulum vesicles.

  18. Two-dimensional electrophoresis and characterization of antigens from Paracoccidioides brasiliensis.

    Science.gov (United States)

    da Fonseca, C A; Jesuino, R S; Felipe, M S; Cunha, D A; Brito, W A; Soares, C M

    2001-06-01

    Paracoccidioides brasiliensis is a fungal pathogen of humans. To identify antigens from P. brasiliensis we fractionated a crude preparation of proteins from the fungus and detected the IgG reactive proteins by immunoblot assays of yeast cellular extracts with sera of patients with paracoccidioidomycosis (PCM). We identified and characterized six new antigens by amino acid sequencing and homology search analyses with other proteins deposited in a database. The newly characterized antigens were highly homologous to catalase, fructose-1,6-biphosphate aldolase (aldolase), glyceraldehyde-3-phosphate dehydrogenase, malate dehydrogenase and triosephosphate isomerase from several sources. The characterized antigens presented preferential synthesis in yeast cells, the host fungus phase.

  19. Targets of 3-bromopyruvate, a new, energy depleting, anticancer agent.

    Science.gov (United States)

    Dell'Antone, Paolo

    2009-11-01

    3-bromopyruvate (3-BrPA), a pyruvate analog recently proposed as a possible anticancer drug, was investigated in relation to its capacity to inhibit energy production in fractions obtained from normal cells (rat hepatocytes) and in isolated rat thymocytes . Findings were that main targets of the drug were glyceraldehyde 3-phosphate dehydrogenase, and not hexokinase as suggested for hepatoma cells, and succinate -driven ATP synthesis. Consistently with the above findings, in the normal cells studied (thymocytes ) the drug elicited an important fall in ATP levels. The significance of the present findings in concern with a possible therapeutic usefulness of the drug is discussed.

  20. Bipolaris oryzae, a novel fungal opportunist causing keratitis.

    Science.gov (United States)

    Wang, Luxia; Al-Hatmi, Abdullah M S; Lai, Xuwen; Peng, Lianghong; Yang, Chuanhong; Lai, Huangwen; Li, Jianxun; Meis, Jacques F; de Hoog, G Sybren; Zhuo, Chao; Chen, Min

    2016-05-01

    We report a case of mycotic keratitis caused by Bipolaris oryzae with predisposing trauma from a foreign body. The fungus was identified by sequencing the internal transcribed spacer region, translation elongation factor 1α (TEF1) gene, and partial glyceraldehyde-3-phosphate dehydrogenase (GPDH) gene, and the species identity was confirmed on the basis of its characteristic conidial phenotype. The patient was treated with surgical intervention and antifungal agents, including intravenous fluconazole (FLC), oral itraconazole, topical 0.15% amphotericin B eye drops, and 0.5% FLC eye drops. To our knowledge, this is the first report of mycotic keratitis caused by B. oryzae worldwide.

  1. NMR Structure of rALF-Pm3, an Anti-Lipopolysaccharide Factor from Shrimp: Model of the Possible Lipid A-Binding Site

    OpenAIRE

    Yang, Yinshan; Boze, Helene; Chemardin, Patrick; Padilla, Andre; Moulin, Guy; Tassanakajon, Anchalee; Pugniere, Martine; Roquet, Francoise; Destoumieux Garzon, Delphine; Gueguen, Yannick; Bachere, Evelyne; Aumelas, Andre

    2009-01-01

    The anti-lipopolysaccharide factor ALF-Pm3 is a 98-residue protein identified in hemocytes from the black tiger shrimp Penaeus monodon. It was expressed in Pichia pastoris from the constitutive glyceraldehyde-3-phosphate dehydrogenase promoter as a folded and N-15 uniformly labeled rALF-Pm3 protein. Its 3D structure was established by NMR and consists of three alpha-helices packed against a four-stranded beta-sheet. The C-34-C-55 disulfide bond was shown to be essential for the structure stab...

  2. A theoretical study of the molecular mechanism of the GAPDH Trypanosoma cruzi enzyme involving iodoacetate inhibitor

    Science.gov (United States)

    Carneiro, Agnaldo Silva; Lameira, Jerônimo; Alves, Cláudio Nahum

    2011-10-01

    The glyceraldehyde-3-phosphate dehydrogenase enzyme (GAPDH) is an important biological target for the development of new chemotherapeutic agents against Chagas disease. In this Letter, the inhibition mechanism of GAPDH involving iodoacetate (IAA) inhibitor was studied using the hybrid quantum mechanical/molecular mechanical (QM/MM) approach and molecular dynamic simulations. Analysis of the potential energy surface and potential of mean force show that the covalent attachment of IAA inhibitor to the active site of the enzyme occurs as a concerted process. In addition, the energy terms decomposition shows that NAD+ plays an important role in stabilization of the reagents and transition state.

  3. Evolution of RLSB, a nuclear-encoded S1 domain RNA binding protein associated with post-transcriptional regulation of plastid-encoded rbcL mRNA in vascular plants.

    Science.gov (United States)

    Yerramsetty, Pradeep; Stata, Matt; Siford, Rebecca; Sage, Tammy L; Sage, Rowan F; Wong, Gane Ka-Shu; Albert, Victor A; Berry, James O

    2016-06-29

    RLSB, an S-1 domain RNA binding protein of Arabidopsis, selectively binds rbcL mRNA and co-localizes with Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) within chloroplasts of C3 and C4 plants. Previous studies using both Arabidopsis (C3) and maize (C4) suggest RLSB homologs are post-transcriptional regulators of plastid-encoded rbcL mRNA. While RLSB accumulates in all Arabidopsis leaf chlorenchyma cells, in C4 leaves RLSB-like proteins accumulate only within Rubisco-containing bundle sheath chloroplasts of Kranz-type species, and only within central compartment chloroplasts in the single cell C4 plant Bienertia. Our recent evidence implicates this mRNA binding protein as a primary determinant of rbcL expression, cellular localization/compartmentalization, and photosynthetic function in all multicellular green plants. This study addresses the hypothesis that RLSB is a highly conserved Rubisco regulatory factor that occurs in the chloroplasts all higher plants. Phylogenetic analysis has identified RLSB orthologs and paralogs in all major plant groups, from ancient liverworts to recent angiosperms. RLSB homologs were also identified in algae of the division Charophyta, a lineage closely related to land plants. RLSB-like sequences were not identified in any other algae, suggesting that it may be specific to the evolutionary line leading to land plants. The RLSB family occurs in single copy across most angiosperms, although a few species with two copies were identified, seemingly randomly distributed throughout the various taxa, although perhaps correlating in some cases with known ancient whole genome duplications. Monocots of the order Poales (Poaceae and Cyperaceae) were found to contain two copies, designated here as RLSB-a and RLSB-b, with only RLSB-a implicated in the regulation of rbcL across the maize developmental gradient. Analysis of microsynteny in angiosperms revealed high levels of conservation across eudicot species and for both paralogs in grasses, highlighting the possible importance of maintaining this gene and its surrounding genomic regions. Findings presented here indicate that the RLSB family originated as a unique gene in land plant evolution, perhaps in the common ancestor of charophytes and higher plants. Purifying selection has maintained this as a highly conserved single- or two-copy gene across most extant species, with several conserved gene duplications. Together with previous findings, this study suggests that RLSB has been sustained as an important regulatory protein throughout the course of land plant evolution. While only RLSB-a has been directly implicated in rbcL regulation in maize, RLSB-b could have an overlapping function in the co-regulation of rbcL, or may have diverged as a regulator of one or more other plastid-encoded mRNAs. This analysis confirms that RLSB is an important and unique photosynthetic regulatory protein that has been continuously expressed in land plants as they emerged and diversified from their ancient common ancestor.

  4. The plastid outer envelope – a highly dynamic interface between plastid and cytoplasm

    Directory of Open Access Journals (Sweden)

    Frederique eBreuers

    2011-12-01

    Full Text Available Plastids are the defining organelles of all photosynthetic eukaryotes. They are the site of photosynthesis and of a large number of other essential metabolic pathways, such as fatty acid and amino acid biosyntheses, sulfur and nitrogen assimilation, and aromatic and terpenoid compound production, to mention only a few examples. The metabolism of plastids is heavily intertwined and connected with that of the surrounding cytosol, thus causing massive traffic of metabolic precursors, intermediates, and products. Two layers of biological membranes that are called the inner (IE and the outer (OE plastid envelope membranes bound the plastids of Archaeplastida. While the IE is generally accepted as the osmo-regulatory barrier between cytosol and stroma, the OE was considered to represent an unspecific molecular sieve, permeable for molecules of up to 10 kDa. However, after the discovery of small substrate-specific pores in the OE, this view has come under scrutiny. In addition to controlling metabolic fluxes between plastid and cytosol, the OE is also crucial for protein import into the chloroplast. It contains the receptors and translocation channel of the TOC complex that is required for the canonical post-translational import of nuclear-encoded, plastid-targeted proteins. Further, the OE is a metabolically active compartment of the chloroplast, being involved in, e.g., fatty acid metabolism and membrane lipid production. Also, recent findings hint on the OE as a defense platform against several biotic and abiotic stress conditions, such as cold acclimation, freezing tolerance, and phosphate deprivation. Moreover, dynamic non-covalent interactions between the OE and the endomembrane system are thought to play important roles in lipid and non-canonical protein trafficking between plastid and endoplasmatic reticulum (ER. While proteomics and bioinformatics has provided us with comprehensive but still incomplete information on proteins localized in the

  5. Precise precursor rebalancing for isoprenoids production by fine control of gapA expression in Escherichia coli.

    Science.gov (United States)

    Jung, Juyoung; Lim, Jae Hyung; Kim, Se Yeon; Im, Dae-Kyun; Seok, Joo Yeon; Lee, Seung-Jae V; Oh, Min-Kyu; Jung, Gyoo Yeol

    2016-11-01

    Biosynthesis of isoprenoids via the 1-deoxy-D-xylulose-5-phosphate (DXP) pathway requires equimolar glyceraldehyde 3-phosphate and pyruvate to divert carbon flux toward the products of interest. Here, we demonstrate that precursor balancing is one of the critical steps for the production of isoprenoids in Escherichia coli. First, the implementation of the synthetic lycopene production pathway as a model system and the amplification of the native DXP pathway were accomplished using synthetic constitutive promoters and redesigned 5'-untranslated regions (5'-UTRs). Next, fine-controlled precursor balancing was investigated by tuning phosphoenolpyruvate synthase (PpsA) or glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The results showed that tuning-down of gapA improved the specific lycopene content by 45% compared to the overexpression of ppsA. The specific lycopene content in the strains with down-regulated gapA increased by 97% compared to that in the parental strain. Our results indicate that gapA is the best target for precursor balancing to increase biosynthesis of isoprenoids.

  6. Carbohydrate metabolism of Xylella fastidiosa: Detection of glycolytic and pentose phosphate pathway enzymes and cloning and expression of the enolase gene

    Directory of Open Access Journals (Sweden)

    Facincani Agda Paula

    2003-01-01

    Full Text Available The objective of this work was to assess the functionality of the glycolytic pathways in the bacterium Xylella fastidiosa. To this effect, the enzymes phosphoglucose isomerase, aldolase, glyceraldehyde-3-phosphate dehydrogenase and pyruvate kinase of the glycolytic pathway, and glucose 6-phosphate dehydrogenase of the Entner-Doudoroff pathway were studied, followed by cloning and expression studies of the enolase gene and determination of its activity. These studies showed that X. fastidiosa does not use the glycolytic pathway to metabolize carbohydrates, which explains the increased duplication time of this phytopatogen. Recombinant enolase was expressed as inclusion bodies and solubilized with urea (most efficient extractor, Triton X-100, and TCA. Enolase extracted from X. fastidiosa and from chicken muscle and liver is irreversibly inactivated by urea. The purification of enolase was partial and resulted in a low yield. No enzymatic activity was detected for either recombinant and native enolases, aldolase, and glyceraldehyde-3-phosphate dehydrogenase, suggesting that X. fastidiosa uses the Entner-Doudoroff pathway to produce pyruvate. Evidence is presented supporting the idea that the regulation of genes and the presence of isoforms with regulation patterns might make it difficult to understand the metabolism of carbohydrates in X. fastidiosa.

  7. Mechanisms involved in the inhibition of glycolysis by cyanide and antimycin A in Candida albicans and its reversal by hydrogen peroxide. A common feature in Candida species.

    Science.gov (United States)

    Peña, Antonio; Sánchez, Norma Silvia; González-López, Omar; Calahorra, Martha

    2015-12-01

    In Candida albicans, cyanide and antimycin A inhibited K(+) transport, not only with ethanol-O2 as the substrate, but also with glucose. The reason for this was that they inhibited not only respiration, but also fermentation, decreasing ATP production. Measurements of oxygen levels in cell suspensions allowed identification of the electron pathways involved. NADH fluorescence levels increased in the presence of the inhibitors, indirectly indicating lower levels of NAD(+) and so pointing to glyceraldehyde-3-phosphate dehydrogenase as the limiting step responsible for the inhibition of glycolysis, which was confirmed by the levels of glycolytic intermediaries. The cyanide effect could be reversed by hydrogen peroxide, mainly due to an activity by which H2O2 can be reduced by electrons flowing from NADH through a pathway that can be inhibited by antimycin A, and appears to be a cytochrome c peroxidase. Therefore, the inhibition of glycolysis by the respiratory inhibitors seems to be due to the decreased availability of NAD(+), resulting in a decreased activity of glyceraldehyde-3-phosphate dehydrogenase. Compartmentalization of pyridine nucleotides in favor of the mitochondria can contribute to explaining the low fermentation capacity of C. albicans. Similar results were obtained with three C. albicans strains, Candida dubliniensis and, to a lower degree, Candida parapsilosis.

  8. Structural and biochemical characterization of a recombinant triosephosphate isomerase from Rhipicephalus (Boophilus) microplus.

    Science.gov (United States)

    Moraes, Jorge; Arreola, Rodrigo; Cabrera, Nallely; Saramago, Luiz; Freitas, Daniela; Masuda, Aoi; da Silva Vaz, Itabajara; Tuena de Gomez-Puyou, Marietta; Perez-Montfort, Ruy; Gomez-Puyou, Armando; Logullo, Carlos

    2011-06-01

    Triosephosphate isomerase (TIM) is an enzyme with a role in glycolysis and gluconeogenesis by catalyzing the interconversion between glyceraldehyde 3-phosphate and dihydroxyacetone phosphate. This enzyme has been used as a target in endoparasite drug development. In this work we cloned, expressed, purified and studied kinetic and structural characteristics of TIM from tick embryos, Rhipicephalus (Boophilus) microplus (BmTIM). The Km and Vmax of the recombinant BmTIM with glyceraldehyde 3-phosphate as substrate, were 0.47 mM and 6031 μmol min⁻¹ mg protein⁻¹, respectively. The resolution of the diffracted crystal was estimated to be 2.4 Å and the overall data showed that BmTIM is similar to other reported dimeric TIMs. However, we found that, in comparison to other TIMs, BmTIM has the highest content of cysteine residues (nine cysteine residues per monomer). Only two cysteines could make disulfide bonds in monomers of BmTIM. Furthermore, BmTIM was highly sensitive to the action of the thiol reagents dithionitrobenzoic acid and methyl methane thiosulfonate, suggesting that there are five cysteines exposed in each dimer and that these residues could be employed in the development of species-specific inhibitors.

  9. Structural and biochemical characterization of a recombinant triosephosphate isomerase from Rhipicephalus (Boophilus) microplus

    Energy Technology Data Exchange (ETDEWEB)

    Moraes, Jorge; Arreola, Rodrigo; Cabrera, Nallely; Saramago, Luiz; Freitas, Daniela; Masuda, Aoi; da Silva Vaz Jr., Itabajara; Tuena de Gomez-Puyou, Marietta; Perez-Montfort, Ruy; Gomez-Puyou, Armando; Logullo, Carlos (UNICAMP); (UFRGS-Brazil); (UNAM-Mexico)

    2012-02-06

    Triosephosphate isomerase (TIM) is an enzyme with a role in glycolysis and gluconeogenesis by catalyzing the interconversion between glyceraldehyde 3-phosphate and dihydroxyacetone phosphate. This enzyme has been used as a target in endoparasite drug development. In this work we cloned, expressed, purified and studied kinetic and structural characteristics of TIM from tick embryos, Rhipicephalus (Boophilus) microplus (BmTIM). The Km and Vmax of the recombinant BmTIM with glyceraldehyde 3-phosphate as substrate, were 0.47 mM and 6031 {micro}mol min{sup -1} mg protein{sup -1}, respectively. The resolution of the diffracted crystal was estimated to be 2.4 {angstrom} and the overall data showed that BmTIM is similar to other reported dimeric TIMs. However, we found that, in comparison to other TIMs, BmTIM has the highest content of cysteine residues (nine cysteine residues per monomer). Only two cysteines could make disulfide bonds in monomers of BmTIM. Furthermore, BmTIM was highly sensitive to the action of the thiol reagents dithionitrobenzoic acid and methyl methane thiosulfonate, suggesting that there are five cysteines exposed in each dimer and that these residues could be employed in the development of species-specific inhibitors.

  10. Direct interaction between GluR2 and GAPDH regulates AMPAR-mediated excitotoxicity

    Directory of Open Access Journals (Sweden)

    Wang Min

    2012-04-01

    Full Text Available Abstract Over-activation of AMPARs (α−amino-3-hydroxy-5-methylisoxazole-4-propionic acid subtype glutamate receptors is implicated in excitotoxic neuronal death associated with acute brain insults, such as ischemic stroke. However, the specific molecular mechanism by which AMPARs, especially the calcium-impermeable AMPARs, induce neuronal death remains poorly understood. Here we report the identification of a previously unrecognized molecular pathway involving a direct protein-protein interaction that underlies GluR2-containing AMPAR-mediated excitotoxicity. Agonist stimulation of AMPARs promotes GluR2/GAPDH (glyceraldehyde-3-phosphate dehydrogenase complex formation and subsequent internalization. Disruption of GluR2/GAPDH interaction by administration of an interfering peptide prevents AMPAR-mediated excitotoxicity and protects against damage induced by oxygen-glucose deprivation (OGD, an in vitro model of brain ischemia.

  11. Genetic polymorphism and its potential relation to environmental stress in five populations of the European flounder Platichthys flesus, along the French Atlantic coast.

    Science.gov (United States)

    Marchand, J; Evrard, E; Guinand, B; Cachot, J; Quiniou, L; Laroche, J

    2010-08-01

    In this study, new DNA markers were explored for the flounder Platichthys flesus. cDNA and genomic sequences of the genes encoding the glyceraldehyde-3-phosphate-deshydrogenase (GAPDH), the cytosolic creatine kinase (CK), the prostaglandin D synthase (PGDS) and the betaine homocysteine methyltransferase (BHMT) were characterized. The tumour suppressor p53 gene structure was already described. A PCR-SSCP (Single Strand Conformation Polymorphism) analysis was finally conducted to study the genetic polymorphism of different populations of flounders collected along the French Atlantic coast. Four highly contaminated French estuaries (Seine, Vilaine, Loire and Gironde) were sampled and compared to a reference estuary (Ster) to explore possible selective effect of the environment on specific allelic frequencies. Our results showed that two loci p53 and PGDS, could be potential markers of chemical stress: p53A allele frequency increased in contaminated systems compared to the reference system. In the Vilaine estuary, PGDS polymorphism could be related to pesticide stress.

  12. Standard loading controls are not reliable for Western blot quantification across brain development or in pathological conditions.

    Science.gov (United States)

    Goasdoue, Kate; Awabdy, Doreen; Bjorkman, Stella Tracey; Miller, Stephanie

    2016-02-01

    A frequently utilized method of data quantification in Western blot analysis is comparison of the protein of interest with a house keeping gene or control protein. Commonly used proteins include β-actin, glyceraldehyde 3 phosphate dehydrogenase (GAPDH), and α-tubulin. Various reliability issues have been raised when using this technique for data analysis-particularly when investigating protein expression changes during development and in disease states. In this study, we have demonstrated that β-actin, GAPDH, and α-tubulin are not appropriate controls in the study of development and hypoxic-ischemic induced damage in the piglet brain. We have also shown that using an in-house pooled standard, loaded on all blots is a reliable method for controlling interassay variability and data normalization in protein expression analysis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Hemoglobin interacting proteins and implications of spectrin hemoglobin interaction.

    Science.gov (United States)

    Basu, Avik; Chakrabarti, Abhijit

    2015-10-14

    In this report we have analyzed interacting partners of hemoglobin inside erythrocyte and sought possible implications of hemoglobin-spectrin interaction. Our list of identified cytosolic hemoglobin interacting proteins includes redox regulators like peroxiredoxin-2, Cu-Zn superoxide dismutase, catalase, aldehyde dehydrogenase-1, flavin reductase and chaperones like HSP70, α-hemoglobin stabilizing protein. Others include metabolic enzymes like carbonic anhydrase-1, selenium binding protein-1, purine nucleoside phosphorylase and nucleoside diphosphate kinase. Additionally, various membrane proteins like α and β spectrin, ankyrin, band3, protein4.1, actin and glyceraldehyde 3 phosphate dehydrogenase have been shown to interact with hemoglobin. Our result indicates that major membrane skeleton protein spectrin, that also has a chaperone like activity, helps to fold the unstable alpha-globin chains in vitro. Taken together our results could provide insight into a protein network evolved around hemoglobin molecule inside erythrocyte that may add a new perspective in understanding the hemoglobin function and homeostasis.

  14. Signaling Crosstalk: A Live in Situ Analysis of the Temporal and Spatial Regulation of Key Pathways in Human Breast Cancer Progression

    Science.gov (United States)

    2007-05-01

    flavoprotein beta-subunit P38117 27.8 8.25 1598 0.12 Sepiapterin reductase DJW121003_009 P35270 28.0 8.25 1630 0.09 Isocitrate dehydrogenase [NAD...P07741 19.5 5.79 Aldose reductase P15121 35.7 6.55 Annexin A1 P04083 38.6 6.64 Glyceraldehyde 3-phosphate dehydrogenase P04406 35.9 8.58 Annexin A2...sulfur subunit P47985 29.7 8.55 1858 0.22 3-hydroxyacyl-CoA dehydrogenase type II DJW121003_010 Q99714 26.9 7.65 Electron transfer

  15. Nucleus-encoded mRNAs for chloroplast proteins GapA, PetA, and PsbO are trans-spliced in the flagellate Euglena gracilis irrespective of light and plastid function.

    Science.gov (United States)

    Mateášiková-Kováčová, Bianka; Vesteg, Matej; Drahovská, Hana; Záhonová, Kristína; Vacula, Rostislav; Krajčovič, Juraj

    2012-01-01

    Euglena gracilis is a fresh-water flagellate possessing secondary chloroplasts of green algal origin. In contrast with organisms possessing primary plastids, mRNA levels of nucleus-encoded genes for chloroplast proteins in E. gracilis depend on neither light nor plastid function. However, it remains unknown, if all these mRNAs are trans-spliced and possess spliced leader sequence at the 5'-end and if trans-splicing depends on light or functional plastids. This study revealed that polyadenylated mRNAs encoding the chloroplast proteins glyceraldehyde-3-phosphate dehydrogenase (GapA), cytochrome f (PetA), and subunit O of photosystem II (PsbO) are trans-spliced irrespective of light or plastid function.

  16. Triose phosphate isomerase from the coelacanth. An approach to the rapid determination of an amino acid sequence with small amounts of material.

    Science.gov (United States)

    Kolb, E; Harris, J I; Bridgen, J

    1974-02-01

    The preparation and purification of cyanogen bromide fragments from [(14)C]carboxymethylated coelacanth triose phosphate isomerase is presented. The automated sequencing of these fragments, the lysine-blocked tryptic peptides derived from them, and also of the intact protein, is described. Combination with results from manual sequence analysis has given the 247-residue amino acid sequence of coelacanth triose phosphate isomerase in 4 months, by using 100mg of enzyme. (Two small adjacent peptides were placed by homology with the rabbit enzyme.) Comparison of this sequence with that of the rabbit muscle enzyme shows that 207 (84%) of the residues are identical. This slow rate of evolutionary change (corresponding to two amino acid substitutions per 100 residues per 100 million years) is similar to that found for glyceraldehyde 3-phosphate dehydrogenase. The reliability of sequence information obtained by automated methods is discussed.

  17. T-13910 DNA variant associated with lactase persistence interacts with Oct-1 and stimulates lactase promoter activity in vitro

    DEFF Research Database (Denmark)

    Lewinsky, Rikke H.; Jensen, Tine Gro Kleinert; Møller, Jette

    2005-01-01

    Two phenotypes exist in the human population with regard to expression of lactase in adults. Lactase non-persistence (adult-type hypolactasia and lactose intolerance) is characterized by a decline in the expression of lactase-phlorizin hydrolase (LPH) after weaning. In contrast, lactase......-persistent individuals have a high LPH throughout their lifespan. Lactase persistence and non-persistence are associated with a T/C polymorphism at position -13,910 upstream the lactase gene. A nuclear factor binds more strongly to the T-13,910 variant associated with lactase persistence than the C-13,910 variant...... associated with lactase non-persistence. Oct-1 and glyceraldehyde-3-phosphate dehydrogenase were co-purified by DNA affinity purification using the sequence of the T-13,910 variant. Supershift analyses show that Oct-1 binds directly to the T-13,910 variant, and we suggest that GAPDH is co-purified due...

  18. AcEST: DK947243 [AcEST

    Lifescience Database Archive (English)

    Full Text Available BlastX Result : Swiss-Prot sp_hit_id A6Q0K5 Definition sp|A6Q0K5|CP12_CHLRE Calvin cycle protein CP12 OS=Chl...one Score E Sequences producing significant alignments: (bits) Value sp|A6Q0K5|CP12_CHLRE Calvin cycle prote... sp|P12859|G3PB_PEA Glyceraldehyde-3-phosphate dehydrogenase B, c... 32 1.2 >sp|A6Q0K5|CP12_CHLRE Calvin cyc... OS=Physcomit... 57 6e-07 tr|A1YQX6|A1YQX6_VOLCA Calvin cycle protein CP12 OS=Volvox carte... 57 6e-07 tr|Q9

  19. Proteomic Analysis of the Response of Liangyoupeijiu (Super High-Yield Hybrid Rice) Seedlings to Cold Stress

    Institute of Scientific and Technical Information of China (English)

    Ping-Fang Yang; Xiao-Juan Li; Yu Liang; Yu-Xiang Jing; Shi-Hua Shen; Ting-Yun Kuang

    2006-01-01

    Liangyoupeijiu is a super high-yield hybrid rice. Despite its advantages with respect to yield and grain quality, it is sensitive to cold, which keeps it from being widely cultivated. We subjected Liangyoupeijiu seedlings to 4 ℃ cold treatment, then extracted the leaf proteins. After 2-D gel electrophoresis separation and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis, a series of differentially displayed proteins were identified. Some metabolism-associated proteins were found among the downregulated proteins, such as carbamoyl phosphate synthetase, transketolase 1, dihydrolipoamide dehydrogenase and glyceraldehyde 3-phosphate dehydrogenase. The upregulated proteins included both stress-resistance proteins such as nucleoside diphosphate kinase Ⅰ and proteins that are negative for rice growth, such as FtsH-like protein, plastid fusion and/or translocation factor (Pftf) and actin. Our results indicate that cold may inhibit Liangyoupeijiu growth through decreasing metabolic activity and damaging cell structure.

  20. Dysfunctional oxidative phosphorylation makes malignant melanoma cells addicted to glycolysis driven by the (V600E)BRAF oncogene

    DEFF Research Database (Denmark)

    Hall, Arnaldur; Meyle, Kathrine Damm; Lange, Marina Krarup

    2013-01-01

    basis for this addiction is largely unknown. Here we provide evidence for a metabolic rationale behind the addiction to (V600E)BRAF in two malignant melanoma cell lines. Both cell lines display a striking addiction to glycolysis due to underlying dysfunction of oxidative phosphorylation (OXPHOS......). Notably, even minor reductions in glycolytic activity lead to increased OXPHOS activity (reversed Warburg effect), however the mitochondria are unable to sustain ATP production. We show that (V600E)BRAF upholds the activity of glycolysis and therefore the addiction to glycolysis de facto becomes...... an addiction to (V600E)BRAF. Finally, the senescence response associated with inhibition of (V600E)BRAF is rescued by overexpression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), providing direct evidence that oncogene addiction rests on a metabolic foundation....

  1. Protein expression of sensory and motor nerves: Two-dimensional gel electrophoresis and mass spectrometry.

    Science.gov (United States)

    Ren, Zhiwu; Wang, Yu; Peng, Jiang; Zhang, Li; Xu, Wenjing; Liang, Xiangdang; Zhao, Qing; Lu, Shibi

    2012-02-15

    The present study utilized samples from bilateral motor branches of the femoral nerve, as well as saphenous nerves, ventral roots, and dorsal roots of the spinal cord, to detect differential protein expression using two-dimensional gel electrophoresis and nano ultra-high performance liquid chromatography electrospray ionization mass spectrometry tandem mass spectrometry techniques. A mass spectrum was identified using the Mascot search. Results revealed differential expression of 11 proteins, including transgelin, Ig kappa chain precursor, plasma glutathione peroxidase precursor, an unnamed protein product (gi|55628), glyceraldehyde-3-phosphate dehydrogenase-like protein, lactoylglutathione lyase, adenylate kinase isozyme 1, two unnamed proteins products (gi|55628 and gi|1334163), and poly(rC)-binding protein 1 in motor and sensory nerves. Results suggested that these proteins played roles in specific nerve regeneration following peripheral nerve injury and served as specific markers for motor and sensory nerves.

  2. Protein expression of sensory and motor nerves Two-dimensional gel electrophoresis and mass spectrometry

    Institute of Scientific and Technical Information of China (English)

    Zhiwu Ren; Yu Wang; Jiang Peng; Li Zhang; Wenjing Xu; Xiangdang Liang; Qing Zhao; Shibi Lu

    2012-01-01

    The present study utilized samples from bilateral motor branches of the femoral nerve, as well as saphenous nerves, ventral roots, and dorsal roots of the spinal cord, to detect differential protein expression using two-dimensional gel electrophoresis and nano ultra-high performance liquid chromatography electrospray ionization mass spectrometry tandem mass spectrometry techniques. A mass spectrum was identified using the Mascot search. Results revealed differential expression of 11 proteins, including transgelin, Ig kappa chain precursor, plasma glutathione peroxidase precursor, an unnamed protein product (gi|55628), glyceraldehyde-3-phosphate dehydrogenase-like protein, lactoylglutathione lyase, adenylate kinase isozyme 1, two unnamed proteins products (gi|55628 and gi|1334163), and poly(rC)-binding protein 1 in motor and sensory nerves. Results suggested that these proteins played roles in specific nerve regeneration following peripheral nerve injury and served as specific markers for motor and sensory nerves.

  3. Zinc disrupts central carbon metabolism and capsule biosynthesis in Streptococcus pyogenes.

    Science.gov (United States)

    Ong, Cheryl-lynn Y; Walker, Mark J; McEwan, Alastair G

    2015-06-01

    Neutrophils release free zinc to eliminate the phagocytosed bacterial pathogen Streptococcus pyogenes (Group A Streptococcus; GAS). In this study, we investigated the mechanisms underpinning zinc toxicity towards this human pathogen, responsible for diseases ranging from pharyngitis and impetigo, to severe invasive infections. Using the globally-disseminated M1T1 GAS strain, we demonstrate that zinc stress impairs glucose metabolism through the inhibition of the glycolytic enzymes phosphofructokinase and glyceraldehyde-3-phosphate dehydrogenase. In the presence of zinc, a metabolic shift to the tagatose-6-phosphate pathway allows conversion of D-galactose to dihydroxyacetone phosphate and glyceraldehyde phosphate, partially bypassing impaired glycolytic enzymes to generate pyruvate. Additionally, zinc inhibition of phosphoglucomutase results in decreased capsule biosynthesis. These data indicate that zinc exerts it toxicity via mechanisms that inhibit both GAS central carbon metabolism and virulence pathways.

  4. Impact of expression of EMP enzymes on glucose metabolism in Zymomonas mobilis.

    Science.gov (United States)

    Chen, Rachel Ruizhen; Agrawal, Manoj; Mao, Zichao

    2013-06-01

    Zymomonas mobilis is the only known microorganism that utilizes the Entner-Doudoroff (ED) pathway anaerobically. In this work, we investigated whether the overexpression of a phosphofructokinase (PFK), the only missing Embden-Meyerhof-Parnas (EMP) pathway enzyme, could establish the pathway in this organism. Introduction of a pyrophosphate-dependent PFK, along with co-expression of homologous fructose-1,6-bisphosphate aldolase and triosephosphate isomerase, did not result in an EMP flux to any appreciable level. However, the metabolism of glucose was impacted significantly. Eight percent of glucose was metabolized to form a new metabolite, dihydroxyacetone. Reducing flux through the ED pathway by as much as 40 % through antisense of a key enzyme, ED aldolase, did not result in a fully functional EMP pathway, suggesting that the ED pathway, especially the lower arm, downstream from glyceraldehyde-3-phosphate, is very rigid, possibly due to redox balance.

  5. Use of pan-hemoplasma PCR for screening horses highly exposed to tick bites from southern Brazil

    Directory of Open Access Journals (Sweden)

    Thállitha Samih Wischral Jayme Vieira

    2015-02-01

    Full Text Available Mycoplasma sp. are hemotropic bacteria of red blood cells and the causative agent of hemoplasmosis. Diagnosis of infection is reached by polymerase chain reaction (PCR and real-time PCR (qPCR of the 16S RNA gene of this bacteria. The aim of this study was to screen horses for Mycoplasma sp. Infection using a pan-hemoplasma SYBR green qPCR assay. A total of 198 blood samples from horses were collected, DNA extracted and pan-hemoplasma qPCR performed. All samples were negative by qPCR. To verify the presence of amplifiable DNA, PCR for glyceraldehyde-3-phosphate dehydrogenase gene was performed on all samples. This study was part of an active surveillance program, which is critical for monitoring animal health status, particularly in horses.

  6. Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

    DEFF Research Database (Denmark)

    Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata

    2000-01-01

    The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...... to a 104-kDa band in addition to the expected 36-kDa band. The protein reacting at 104 kDa is a M. hominis protein with either an epitope similar to one on GAPDH, or it is an immunoglobulin binding protein...

  7. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells

    DEFF Research Database (Denmark)

    Yang, Hsiao Yin; Vonk, Lucienne A.; Licht, Ruud

    2014-01-01

    The application of RNA interference (RNAi) has great therapeutic potential for degenerative diseases of cartilaginous tissues by means of fine tuning the phenotype of cells used for regeneration. However, possible non-specific effects of transfection per se might be relevant for future clinical......% amidation), for siRNA delivery into primary mesenchymal cells including nucleus pulposus cells, articular chondrocytes and mesenchymal stem cells (MSCs). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous model gene to evaluate the extent of silencing by 20 nM or 200 nM siRNA at day...... 3 and day 6 post-transfection. In addition to silencing efficiency, non-specific effects such as cytotoxicity, change in DNA content and differentiation potential of cells were evaluated. Among the four transfection reagents, the commercial liposome-based agent was the most efficient reagent for si...

  8. Acetyl Eburicoic Acid from Laetiporus sulphureus var. miniatus Suppresses Inflammation in Murine Macrophage RAW 264.7 Cells.

    Science.gov (United States)

    Saba, Evelyn; Son, Youngmin; Jeon, Bo Ra; Kim, Seong-Eun; Lee, In-Kyoung; Yun, Bong-Sik; Rhee, Man Hee

    2015-06-01

    The basidiomycete Laetiporus sulphureus var. miniatus belongs to the Aphyllophorales, Polyporaceae, and grows on the needleleaf tree. The fruiting bodies of Laetiporus species are known to produce N-methylated tyramine derivatives, polysaccharides, and various lanostane triterpenoids. As part of our ongoing effort to discover biologically active compounds from wood-rotting fungi, an anti-inflammatory triterpene, LSM-H7, has been isolated from the fruiting body of L. sulphureus var. miniatus and identified as acetyl eburicoic acid. LSM-H7 dose-dependently inhibited the NO production in RAW 264.7 cells without any cytotoxicity at the tested concentrations. Furthermore it suppressed the production of proinflammatory cytokines, mainly inducible nitric oxide synthase, cyclooxygenase-2, interleukin (IL)-1β, IL-6 and tumor necrosis factor α, when compared with glyceraldehyde 3-phosphate dehydrogenase. These data suggest that LSM-H7 is a crucial component for the anti-inflammatory activity of L. sulphureus var. miniatus.

  9. White Spot Syndrome Virus infection in Penaeus monodon is facilitated by housekeeping molecules

    Indian Academy of Sciences (India)

    Vinayak Biradar; Santosh Narwade; Mandar Paingankar; Deepti Deobagkar

    2013-12-01

    White Spot Syndrome Virus (WSSV) is a major pathogen in shrimp aquaculture, and its rampant spread has resulted in great economic loss. Identification of host cellular proteins interacting with WSSV will help in unravelling the repertoire of host proteins involved in WSSV infection. In this study, we have employed one-dimensional and two-dimension virus overlay protein binding assay (VOPBA) followed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) to identify the host proteins of Penaeus monodon that could interact with WSSV. The VOPBA results suggest that WSSV interacted with housekeeping proteins such as heat shock protein 70, ATP synthase subunit , phosphopyruvate hydratase, allergen Pen m 2, glyceraldehyde-3-phosphate dehydrogenase, sarcoplasmic calcium-binding protein, actin and 14-3-3-like protein. Our findings suggest that WSSV exploits an array of housekeeping proteins for its transmission and propagation in P. monodon.

  10. Achieving high throughput sequencing of a cDNA library utilizing an alternative protocol for the bench top next-generation sequencing system.

    Science.gov (United States)

    Wan, Minxi; Faruq, Junaid; Rosenberg, Julian N; Xia, Jinlan; Oyler, George A; Betenbaugh, Michael J

    2013-02-15

    The development of next-generation sequencing (NGS) technologies has provided novel tools for genome analysis and expression profiling. A high throughput cDNA sequencing method using a bench top next-generation sequencing system, GS Junior, is now available. Here, we used an alternative protocol to the standard method for generating the cDNA library. This protocol can decrease the number of processing steps to manipulate RNA when constructing a cDNA library from an RNA sample, and does not require mRNA isolation from total RNA. Thus it can decrease the risk of RNA degradation and the cost for preparing a cDNA library. Also, the efficiency of sequencing data obtained with this approach is comparable to the standard method as verified by sequencing characteristics and expression levels of the reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

  11. Heterologous expression of Saccharomyces cerevisiae MPR1 gene confers tolerance to ethanol and L: -azetidine-2-carboxylic acid in Hansenula polymorpha.

    Science.gov (United States)

    Ishchuk, Olena P; Abbas, Charles A; Sibirny, Andriy A

    2010-02-01

    Hansenula polymorpha is a naturally xylose-fermenting yeast; however, both its ethanol yield from xylose and ethanol resistance have to be improved before this organism can be used for industrial high-temperature simultaneous saccharification and fermentation of lignocellulosic materials. In the current research, we checked if the expression of the Saccharomyces cerevisiae MPR1 gene encoding N-acetyltransferase can increase the ethanol tolerance of H. polymorpha. The S. cerevisiae MPR1 gene was cloned in the H. polymorpha expression vector under the control of the H. polymorpha strong constitutive promoter of the glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH). H. polymorpha recombinant strains harboring 1-3 copies of the S. cerevisiae MPR1 gene showed enhanced tolerance to L: -azetidine-2-carboxylic acid and ethanol. The obtained results suggest that the expression of the S. cerevisiae MPR1 gene in H. polymorpha can be a useful approach in the construction of H. polymorpha strains with improved ethanol resistance.

  12. 甘油醛-3-磷酸脱氢酶的应用进展

    Institute of Scientific and Technical Information of China (English)

    禹淞文; 李清明

    2014-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a key enzyme in glycolysis reactions, studies have found that the enzyme is a multifunctional protein, except as a key enzyme involved in energy metabolism, glycolysis, etc. But it also has to promote cell protein apoptosis, restoration functions DNA, regulate histone. Therefore, further excavation and master enzyme function is important.%甘油醛-3-磷酸脱氢酶(GAPDH)是糖酵解反应中的关键酶,研究发现该酶是一种多功能蛋白,除作为关键酶参与糖酵解等能量代谢外,其蛋白还具有修复DNA、调节组蛋白、促进细胞凋亡等多种功能,进一步挖掘和掌握该酶的功能具有重要意义。

  13. Stereoselective reactivity of the SH groups of yeast glyceraldehydephosphate dehydrogenase in the allosteric T and R states.

    Science.gov (United States)

    Eisele, B; Wallenfels, K

    1968-07-01

    Yeast glyceraldehyde-3-phosphate dehydrogenase as a typical SH enzyme is inactivated by the antipodes of a-iodopropionic acid and its amide at different rates. The apoenzyme reacts faster with the D(+) antipode of the free a-iodopropionic acid (k(D)/k(L) = 6.8) and the L(-) antipode of the amide (k(L)/k(D) = 3). On addition of NAD(+) the stereoselectivity of the SH group towards a-iodopropionic acid is inverted, that towards the amide is enlarged, the rate relationships depending on the NAD(+) concentration.The results were interpreted by the assumption, that the allosteric T state of the enzyme reacts most rapidly with the D(+) antipodes, whereas the R state favours the L(-) antipodes of the alkylation reagents. The dependence of the reaction rates on the NAD(+) concentration could be fitted to the allosteric function of state R.

  14. Approaches to post-testicular contraception

    Institute of Scientific and Technical Information of China (English)

    TrevorGCooper; CHYeung

    1999-01-01

    The induction of infertility in males of several species through epididymal interference is more difficult to achieve by reduction of the amounts of epididymal secretions (eg a-glucosidase, L-camifine) or immunological interference with secreted proteins (eg D/E, P34H, P26h) than by direct actions of drugs on sperm function (eg inhibition of glyceraldehyde 3-phosphate dehydrogenase by chloro-compounds). The latter approach holds promise for mankind ashuman spelm are susceptible to glycolytic inhibition. Future contraceptive developments may arise from production of targeted inhibitors, research on the displacement of sperm proteins in the epididymis and interference with sperm plasma membrane ion channels. ( As/an J Androf 1999 Jun ; 1 : 29 - 36 )

  15. Effect of glycolysis inhibition on mitochondrial function in rat brain.

    Science.gov (United States)

    Cano-Ramírez, D; Torres-Vargas, C E; Guerrero-Castillo, S; Uribe-Carvajal, S; Hernández-Pando, R; Pedraza-Chaverri, J; Orozco-Ibarra, M

    2012-05-01

    Inhibition of the glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase enhances the neural vulnerability to excitotoxicity both in vivo and in vitro through an unknown mechanism possibly related to mitochondrial failure. However, as the effect of glycolysis inhibition on mitochondrial function in brain has not been studied, the aim of the present work was to evaluate the effect of glycolysis inhibition induced by iodoacetate on mitochondrial function and oxidative stress in brain. Mitochondria were isolated from brain cortex, striatum and cerebellum of rats treated systemically with iodoacetate (25 mg/kg/day for 3 days). Oxygen consumption, ATP synthesis, transmembrane potential, reactive oxygen species production, lipoperoxidation, glutathione levels, and aconitase activity were assessed. Oxygen consumption and aconitase activity decreased in the brain cortex and striatum, showing that glycolysis inhibition did not trigger severe mitochondrial impairment, but a slight mitochondrial malfunction and oxidative stress were present.

  16. Ulocladium cantlous sp. nov. isolated from northwestern China: its morphology and molecular phylogenetic position.

    Science.gov (United States)

    Wang, Yong; Pei, Yun-Fei; O'Neill, Nichole R; Zhang, Xiu-Guo

    2010-01-01

    A new species of Ulocladium was isolated from diseased leaves from two Cucumis sp. growing in Sinkiang and Gansu provinces of China. Conidia were isolated from necrotic leaves and used to establish single-spore pure cultures. Conidia were harvested from cultures 7 d after incubation for morphological comparisons. The morphology of this species resembles that of U. botrytis and U. consortiale. However it is distinguished from these two species by the sizes of obovoid to broadly ellipsoidal conidia and longer conidiophores. A taxonomic description of U. cantlous, comparison with related species in this genus, and a species phylogeny based on the partial nucleotide sequence of the glyceraldehyde-3-phosphate dehydrogenase (gpd) gene and the Alternaria alternata major allergen (Alt a 1) gene are provided.

  17. Identification of novel GAPDH-derived antimicrobial peptides secreted by Saccharomyces cerevisiae and involved in wine microbial interactions

    DEFF Research Database (Denmark)

    Branco, Patrícia; Francisco, Diana; Chambon, Christophe

    2014-01-01

    a wide variety of wine-related yeasts (e.g. Dekkera bruxellensis) and bacteria (e.g. Oenococcus oeni). Mass spectrometry analyses revealed that these AMPs correspond to fragments of the S. cerevisiae glyceraldehyde 3-phosphate dehydrogenase (GAPDH) protein. The involvement of GAPDH-derived peptides...... in wine microbial interactions was further sustained by results obtained in mixed cultures performed with S. cerevisiae single mutants deleted in each of the GAPDH codifying genes (TDH1-3) and also with a S. cerevisiae mutant deleted in the YCA1 gene, which codifies the apoptosis-involved enzyme...... metacaspase. These findings are discussed in the context of wine microbial interactions, biopreservation potential and the role of GAPDH in the defence system of S. cerevisiae....

  18. AcEST: DK955050 [AcEST

    Lifescience Database Archive (English)

    Full Text Available TST39A01NGRL0022_B03 600 Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0022_B0...3. 5' end sequence. DK955050 CL85Contig1 Show DK955050 Clone id TST39A01NGRL0022_B03 Library TST39 Length 60...0 Definition Adiantum capillus-veneris mRNA. clone: TST39A01NGRL0022_B03. 5' end sequence. Accession DK955050...nd PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= DK955050...ogenase A,... 193 6e-49 sp|P50362|G3PA_CHLRE Glyceraldehyde-3-phosphate dehydrogenase A,... 184 2e-46 sp|P12

  19. Enzymes in Glycolysis and the Citric Acid Cycle in the Yeast and Mycelial Forms of Paracoccidioides brasiliensis

    Science.gov (United States)

    Kanetsuna, Fuminori; Carbonell, Luis M.

    1966-01-01

    Kanetsuna, Fuminori (Instituto Venezolano de Investigaciones Cientificas, Caracas, Venezuela), and Luis M. Carbonell. Enzymes in glycolysis and the citric acid cycle in the yeast and mycelial forms of Paracoccidioides brasiliensis. J. Bacteriol. 92:1315–1320. 1966.—Enzymatic activities in glycolysis, the hexose monophosphate shunt, and the citric acid cycle in cell-free extracts of the yeast and mycelial forms of Paracoccidioides brasiliensis were examined comparatively. Both forms have the enzymes of these pathways. Activities of glucose-6-phosphate dehydrogenase and malic dehydrogenase of the mycelial form were higher than those of the yeast form. Another 15 enzymatic activities of the mycelial form were lower than those of the yeast form. The activity of glyceraldehyde-3-phosphate dehydrogenase showed the most marked difference between the two forms, its activity in the mycelial form being about 20% of that in the yeast form. PMID:5924267

  20. Terpenoids and Their Biosynthesis in Cyanobacteria

    Directory of Open Access Journals (Sweden)

    Bagmi Pattanaik

    2015-01-01

    Full Text Available Terpenoids, or isoprenoids, are a family of compounds with great structural diversity which are essential for all living organisms. In cyanobacteria, they are synthesized from the methylerythritol-phosphate (MEP pathway, using glyceraldehyde 3-phosphate and pyruvate produced by photosynthesis as substrates. The products of the MEP pathway are the isomeric five-carbon compounds isopentenyl diphosphate and dimethylallyl diphosphate, which in turn form the basic building blocks for formation of all terpenoids. Many terpenoid compounds have useful properties and are of interest in the fields of pharmaceuticals and nutrition, and even potentially as future biofuels. The MEP pathway, its function and regulation, and the subsequent formation of terpenoids have not been fully elucidated in cyanobacteria, despite its relevance for biotechnological applications. In this review, we summarize the present knowledge about cyanobacterial terpenoid biosynthesis, both regarding the native metabolism and regarding metabolic engineering of cyanobacteria for heterologous production of non-native terpenoids.

  1. Induction of heat shock proteins DnaK, GroEL, and GroES by salt stress in Lactococcus lactis

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Jacobsen, Susanne; Hammer, Karin

    1997-01-01

    laboratory strain MG1363, which was originally derived from a dairy strain, After two-dimensional separation of proteins, the DnaK, GroEL, and GroES heat shock proteins, the HrcA (Orf1) heat shack repressor, and the glycolytic enzymes pyruvate kinase, glyceral-dehyde-3-phosphate dehydrogenase......, and phosphoglycerate kinase were identified by a combination of Western blotting and direct N-terminal amino acid sequencing of proteins from the gels, Of 400 to 500 visible proteins, 17 were induced more than twofold during heat stress, Two classes of heat stress proteins were identified from their temporal induction...... proteins exhibited a gradual increase in the rate of synthesis after the onset of stress, Unlike other organisms, all salt stress-induced proteins in L. lactis were also subjected to heat stress induction. DnaK, GroEL, and GroES showed similar temporal patterns of induction during salt stress, resembling...

  2. Dicty_cDB: CFG167 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available DNA clone NF077B10DT 5', mRNA sequence. 44 3e-18 5 BU495005 |BU495005.1 PfESToab82g05.y1 Plasmodium falciparum 3D7 asexual...YDROGENASE ;, mRNA sequence. 72 4e-17 3 BU496632 |BU496632.1 PfESToab52g07.y1 Plasmodium falciparum 3D7 asexual...-3-PHOSPHATE DEHYDROGENASE ;, mRNA sequence. 72 5e-17 3 BI670607 |BI670607.1 PfESToaa02a07.y1 Plasmodium falciparum 3D7 asexual...1 Plasmodium falciparum 3D7 asexual cDNA Plasmodium falciparum cDNA 5' similar to TR:O96369 O96369 GLYCERALD...EHYDE-3-PHOSPHATE DEHYDROGENASE ;, mRNA sequence. 72 7e-17 3 BI815601 |BI815601.1 PfESToaa30e06.y1 Plasmodium falciparum 3D7 asexual

  3. Separation of Binding Protein of Celangulin V from the Midgut of Mythimna separata Walker by Affinity Chromatography

    Directory of Open Access Journals (Sweden)

    Lina Lu

    2015-05-01

    Full Text Available Celangulin V, an insecticidal compound isolated from the root bark of Chinese bittersweet, can affect the digestive system of insects. However, the mechanism of how Celangulin V induces a series of symptoms is still unknown. In this study, affinity chromatography was conducted through coupling of Celangulin V-6-aminoacetic acid ester to the CNBr-activated Sepharose 4B. SDS-PAGE was used to analyze the collected fraction eluted by Celangulin V. Eight binding proteins (Zinc finger protein, Thioredoxin peroxidase (TPx, Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, SUMO E3 ligase RanBP2, Transmembrane protein 1, Actin, APN and V-ATPase were obtained and identified by LC/Q-TOF-MS from the midgut of Mythimna separata larvae. The potential of these proteins to serve as target proteins involved in the insecticidal activity of Celangulin V is discussed.

  4. Characterisation of the Mucor circinelloides regulated promoter gpd1P

    DEFF Research Database (Denmark)

    Larsen, G.G.; Appel, K.F.; Wolff, A.M.;

    2004-01-01

    The promoter of the Mucor circinelloides gpd1 gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd1P) was recently cloned and used for the production of recombinant proteins, such as the Aspergillus niger glucose oxidase 1 (GOX). This represents the first example of the application...... of a strong and regulated promoter from this fungus for recombinant protein production. The original 741-bp gpd1P promoter fragment conferred hexose-dependent expression of GOX in M. circinelloides. To understand the regulatory mechanisms involved in gpd1P-driven expression and to develop improved promoter...... or a 361-bp derivative. Expression levels for the 361-bp derivative were high and comparable, regardless of the carbon source used. This promoter represents a useful derivative for constitutive heterologous gene expression in M. circinelloides....

  5. Changes in cod muscle proteins during frozen storage revealed by proteome analysis and multivariate data analysis

    DEFF Research Database (Denmark)

    Kjærsgård, Inger Vibeke Holst; Nørrelykke, M.R.; Jessen, Flemming

    2006-01-01

    Multivariate data analysis has been combined with proteomics to enhance the recovery of information from 2-DE of cod muscle proteins during different storage conditions. Proteins were extracted according to 11 different storage conditions and samples were resolved by 2-DE. Data generated by 2-DE...... was subjected to principal component analysis (PCA) and discriminant partial least squares regression (DPLSR). Applying PCA to 2-DE data revealed the samples to form groups according to frozen storage time, whereas differences due to different storage temperatures or chilled storage in modified atmosphere...... light chain 1, 2 and 3, triose-phosphate isomerase, glyceraldehyde-3-phosphate dehydrogenase, aldolase A and two ?-actin fragments, and a nuclease diphosphate kinase B fragment to change in concentration, during frozen storage. Application of proteomics, multivariate data analysis and MS/MS to analyse...

  6. Analysis of the stability of housekeeping gene expression in the left cardiac ventricle of rats submitted to chronic intermittent hypoxia

    Directory of Open Access Journals (Sweden)

    Guilherme Silva Julian

    Full Text Available ABSTRACT Obstructive sleep apnea (OSA has been associated with oxidative stress and various cardiovascular consequences, such as increased cardiovascular disease risk. Quantitative real-time PCR is frequently employed to assess changes in gene expression in experimental models. In this study, we analyzed the effects of chronic intermittent hypoxia (an experimental model of OSA on housekeeping gene expression in the left cardiac ventricle of rats. Analyses via four different approaches-use of the geNorm, BestKeeper, and NormFinder algorithms; and 2−ΔCt (threshold cycle data analysis-produced similar results: all genes were found to be suitable for use, glyceraldehyde-3-phosphate dehydrogenase and 18S being classified as the most and the least stable, respectively. The use of more than one housekeeping gene is strongly advised.

  7. A Reduction in Age-Enhanced Gluconeogenesis Extends Lifespan

    Science.gov (United States)

    Hachinohe, Mayumi; Yamane, Midori; Akazawa, Daiki; Ohsawa, Kazuhiro; Ohno, Mayumi; Terashita, Yuzu; Masumoto, Hiroshi

    2013-01-01

    The regulation of energy metabolism, such as calorie restriction (CR), is a major determinant of cellular longevity. Although augmented gluconeogenesis is known to occur in aged yeast cells, the role of enhanced gluconeogenesis in aged cells remains undefined. Here, we show that age-enhanced gluconeogenesis is suppressed by the deletion of the tdh2 gene, which encodes glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a protein that is involved in both glycolysis and gluconeogenesis in yeast cells. The deletion of TDH2 restores the chronological lifespan of cells with deletions of both the HST3 and HST4 genes, which encode yeast sirtuins, and represses the activation of gluconeogenesis. Furthermore, the tdh2 gene deletion can extend the replicative lifespan in a CR pathway-dependent manner. These findings demonstrate that the repression of enhanced gluconeogenesis effectively extends the cellular lifespan. PMID:23342062

  8. A reduction in age-enhanced gluconeogenesis extends lifespan.

    Directory of Open Access Journals (Sweden)

    Mayumi Hachinohe

    Full Text Available The regulation of energy metabolism, such as calorie restriction (CR, is a major determinant of cellular longevity. Although augmented gluconeogenesis is known to occur in aged yeast cells, the role of enhanced gluconeogenesis in aged cells remains undefined. Here, we show that age-enhanced gluconeogenesis is suppressed by the deletion of the tdh2 gene, which encodes glyceraldehyde-3-phosphate dehydrogenase (GAPDH, a protein that is involved in both glycolysis and gluconeogenesis in yeast cells. The deletion of TDH2 restores the chronological lifespan of cells with deletions of both the HST3 and HST4 genes, which encode yeast sirtuins, and represses the activation of gluconeogenesis. Furthermore, the tdh2 gene deletion can extend the replicative lifespan in a CR pathway-dependent manner. These findings demonstrate that the repression of enhanced gluconeogenesis effectively extends the cellular lifespan.

  9. Proteome analysis of soybean leaves, hypocotyls and roots under salt stress

    Directory of Open Access Journals (Sweden)

    Nanjo Yohei

    2010-03-01

    Full Text Available Abstract Background Salinity is one of the most widespread agricultural problems in arid and semi-arid regions that makes fields unproductive, and soil salinization is a serious problem in the entire world. To determine the effects of salt stress on soybean seedlings, a proteomic technique was used. Results Soybean plants were exposed to 0, 20, 40, or 80 mM NaCl for one week. The effect of treatment at 20 mM NaCl on plant growth was not severe, at 80 mM NaCl was lethal, and at 40 mM NaCl was significant but not lethal. Based on these results, proteins were extracted from the leaves, hypocotyls and roots of soybean treated with 40 mM NaCl. Nineteen, 22 and 14 proteins out of 340, 330 and 235 proteins in the leaves, hypocotyls and roots, respectively, were up- and down-regulated by NaCl treatment. In leaves, hypocotyls and roots, metabolism related proteins were mainly down-regulated with NaCl treatment. Glyceraldehyde-3-phosphate dehydrogenase was down-regulated in the leaf/hypocotyls, and fructokinase 2 was down-regulated in the hypocotyls/root with NaCl treatment. Stem 31 kDa glycoprotein precursor was up-regulated in all three organs with NaCl treatment. Glyceraldehyde-3-phosphate dehydrogenase was specifically down-regulated at the RNA and protein levels by salt stress. Conclusion These results suggest that metabolism related proteins play a role in each organ in the adaptation to saline conditions.

  10. Changes in the contents of metabolites and enzyme activities in rice plants responding to Rhizoctonia solani Kuhn infection: activation of glycolysis and connection to phenylpropanoid pathway.

    Science.gov (United States)

    Mutuku, J Musembi; Nose, Akihiro

    2012-06-01

    Rhizoctonia solani Kuhn causes sheath blight disease in rice, and genetic resistance against it is the most desirable characteristic. Current improvement efforts are based on analysis of polygenic quantitative trait loci (QTLs), but interpretation is limited by the lack of information on the changes in metabolic pathways. Our previous studies linked activation of the glycolytic pathway to enhanced generation of lignin in the phenylpropanoid pathway. The current studies investigated the regulation of glycolysis by examining the time course of changes in enzymatic activities and metabolite contents. The results showed that the activities of all glycolytic enzymes as well as fructose-6-phosphate (F-6-P), fructose-1,6-bisphosphate (F-1,6-P(2)), dihydroxyacetone phosphate (DHAP), glyceraldehyde-3-phosphate (GAP), 3-phosphoglycerate (3-PG), phosphoenolpyruvate (PEP) and pyruvate contents increased. These results combined with our previous findings that the expression of phosphoglucomutase (PGM), triosephosphate isomerase (TPI), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), enolase and pyruvate kinase (PK) increased after infection suggested that the additional establishment of glycolysis in the cytosol compartment occurred after infection. Further evidence for this was our recent findings that the increase in expression of the 6-phosphofructokinase (PFK) plastid isozyme Os06g05860 was accompanied by an increase in expression of three cytosolic PFK isozymes, i.e. Os01g09570, Os01g53680 and Os04g39420, as well as pyrophosphate-dependent phosphofrucokinase (PFP) isozymes Os08g25720 (α-subunit) and Os06g13810 (β-subunit) in infected rice plants of the resistant line. The results also showed that the reactions catalysed by PFK/PFP, aldolase, GAPDH + phosphoglycerate kinase (PGK) and PK in leaf sheaths of R. solani-infected rice plants were non-equilibrium reactions in vivo. This study showed that PGM, phosphoglucose isomerase (PGI), TPI and phosphoglycerate mutase (PGmu

  11. Accelerated cellular senescence phenotype of GAPDH-depleted human lung carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Phadke, Manali; Krynetskaia, Natalia [Temple University School of Pharmacy, Philadelphia, PA 19140 (United States); Mishra, Anurag [Jayne Haines Center for Pharmacogenomics, Temple University School of Pharmacy, Philadelphia, PA 19140 (United States); Krynetskiy, Evgeny, E-mail: ekrynets@temple.edu [Temple University School of Pharmacy, Philadelphia, PA 19140 (United States); Jayne Haines Center for Pharmacogenomics, Temple University School of Pharmacy, Philadelphia, PA 19140 (United States)

    2011-07-29

    Highlights: {yields} We examined the effect of glyceraldehyde 3-phosphate (GAPDH) depletion on proliferation of human carcinoma A549 cells. {yields} GAPDH depletion induces accelerated senescence in tumor cells via AMPK network, in the absence of DNA damage. {yields} Metabolic and genetic rescue experiments indicate that GAPDH has regulatory functions linking energy metabolism and cell cycle. {yields} Induction of senescence in LKB1-deficient lung cancer cells via GAPDH depletion suggests a novel strategy to control tumor cell proliferation. -- Abstract: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is a pivotal glycolytic enzyme, and a signaling molecule which acts at the interface between stress factors and the cellular apoptotic machinery. Earlier, we found that knockdown of GAPDH in human carcinoma cell lines resulted in cell proliferation arrest and chemoresistance to S phase-specific cytotoxic agents. To elucidate the mechanism by which GAPDH depletion arrests cell proliferation, we examined the effect of GAPDH knockdown on human carcinoma cells A549. Our results show that GAPDH-depleted cells establish senescence phenotype, as revealed by proliferation arrest, changes in morphology, SA-{beta}-galactosidase staining, and more than 2-fold up-regulation of senescence-associated genes DEC1 and GLB1. Accelerated senescence following GAPDH depletion results from compromised glycolysis and energy crisis leading to the sustained AMPK activation via phosphorylation of {alpha} subunit at Thr172. Our findings demonstrate that GAPDH depletion switches human tumor cells to senescent phenotype via AMPK network, in the absence of DNA damage. Rescue experiments using metabolic and genetic models confirmed that GAPDH has important regulatory functions linking the energy metabolism and the cell cycle networks. Induction of senescence in LKB1-deficient non-small cell lung cancer cells via GAPDH depletion suggests a novel strategy to control tumor cell proliferation.

  12. Target gene approaches: Gene expression in Daphnia magna exposed to predator-borne kairomones or to microcystin-producing and microcystin-free Microcystis aeruginosa

    Directory of Open Access Journals (Sweden)

    Courts Cornelius

    2009-11-01

    Full Text Available Abstract Background Two major biological stressors of freshwater zooplankton of the genus Daphnia are predation and fluctuations in food quality. Here we use kairomones released from a planktivorous fish (Leucaspius delineatus and from an invertebrate predator (larvae of Chaoborus flavicans to simulate predation pressure; a microcystin-producing culture of the cyanobacterium Microcystis aeruginosa and a microcystin-deficient mutant are used to investigate effects of low food quality. Real-time quantitative polymerase chain reaction (QPCR allows quantification of the impact of biotic stressors on differential gene activity. The draft genome sequence for Daphnia pulex facilitates the use of candidate genes by precisely identifying orthologs to functionally characterized genes in other model species. This information is obtained by constructing phylogenetic trees of candidate genes with the knowledge that the Daphnia genome is composed of many expanded gene families. Results We evaluated seven candidate reference genes for QPCR in Daphnia magna after exposure to kairomones. As a robust approach, a combination normalisation factor (NF was calculated based on the geometric mean of three of these seven reference genes: glyceraldehyde-3-phosphate dehydrogenase, TATA-box binding protein and succinate dehydrogenase. Using this NF, expression of the target genes actin and alpha-tubulin were revealed to be unchanged in the presence of the tested kairomones. The presence of fish kairomone up-regulated one gene (cyclophilin involved in the folding of proteins, whereas Chaoborus kairomone down-regulated the same gene. We evaluated the same set of candidate reference genes for QPCR in Daphnia magna after exposure to a microcystin-producing and a microcystin-free strain of the cyanobacterium Microcystis aeruginosa. The NF was calculated based on the reference genes 18S ribosomal RNA, alpha-tubulin and TATA-box binding protein. We found glyceraldehyde-3

  13. Proteomic analysis of effluents from perfused human heart for transplantation: identification of potential biomarkers for ischemic heart damage

    Directory of Open Access Journals (Sweden)

    Li Hong

    2012-03-01

    Full Text Available Abstract Background Biomarkers released from the heart at early stage of ischemia are very important to diagnosis of ischemic heart disease and salvage myocytes from death. Known specific markers for blood tests including CK-MB, cardiac troponin T (cTnT and cardiac troponin I (cTnI are released after the onset of significant necrosis instead of early ischemia. Thus, they are not good biomarkers to diagnose myocardial injury before necrosis happens. Therefore, in this study, we performed proteomic analysis on effluents from perfused human hearts of donors at different ischemic time. Results After global ischemia for 0 min, 30 min and 60 min at 4°C, effluents from five perfused hearts were analyzed respectively, by High performance liquid chromatography-Chip-Mass spectrometry (HPLC-Chip-MS system. Total 196 highly reliable proteins were identified. 107 proteins were identified at the beginning of ischemia, 174 and 175 proteins at ischemic 30 min and ischemic 60 min, respectively. With the exception of cardiac troponin I and T, all known biomarkers for myocardial ischemia were detected in our study. However, there were four glycolytic enzymes and two targets of matrix metalloproteinase released significantly from the heart when ischemic time was increasing. These proteins were L-lactate dehydrogenase B(LDHB, glyceraldehyde-3-phosphate dehydrogenase, glucose-6-phosphate isomerase (GPI, phosphoglycerate mutase 2 (PGAM2, gelsolin and isoform 8 of titin. PGAM2, LDHB and titin were measured with enzyme-linked immunosorbent assays kits. The mean concentrations of LDHB and PGAM2 in samples showed an increasing trend when ischemic time was extending. In addition, 33% identified proteins are involved in metabolism. Protein to protein interaction network analysis showed glycolytic enzymes, such as isoform alpha-enolase of alpha-enolase, isoform 1 of triosephosphate isomerase and glyceraldehyde-3-phosphate dehydrogenase, had more connections than other

  14. Assessment of CcpA-mediated catabolite control of gene expression in Bacillus cereus ATCC 14579

    Directory of Open Access Journals (Sweden)

    Buist Girbe

    2008-04-01

    Full Text Available Abstract Background The catabolite control protein CcpA is a transcriptional regulator conserved in many Gram-positives, controlling the efficiency of glucose metabolism. Here we studied the role of Bacillus cereus ATCC 14579 CcpA in regulation of metabolic pathways and expression of enterotoxin genes by comparative transcriptome analysis of the wild-type and a ccpA-deletion strain. Results Comparative analysis revealed the growth performance and glucose consumption rates to be lower in the B. cereus ATCC 14579 ccpA deletion strain than in the wild-type. In exponentially grown cells, the expression of glycolytic genes, including a non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase that mediates conversion of D-glyceraldehyde 3-phosphate to 3-phospho-D-glycerate in one single step, was down-regulated and expression of gluconeogenic genes and genes encoding the citric acid cycle was up-regulated in the B. cereus ccpA deletion strain. Furthermore, putative CRE-sites, that act as binding sites for CcpA, were identified to be present for these genes. These results indicate CcpA to be involved in the regulation of glucose metabolism, thereby optimizing the efficiency of glucose catabolism. Other genes of which the expression was affected by ccpA deletion and for which putative CRE-sites could be identified, included genes with an annotated function in the catabolism of ribose, histidine and possibly fucose/arabinose and aspartate. Notably, expression of the operons encoding non-hemolytic enterotoxin (Nhe and hemolytic enterotoxin (Hbl was affected by ccpA deletion, and putative CRE-sites were identified, which suggests catabolite repression of the enterotoxin operons to be CcpA-dependent. Conclusion The catabolite control protein CcpA in B. cereus ATCC 14579 is involved in optimizing the catabolism of glucose with concomitant repression of gluconeogenesis and alternative metabolic pathways. Furthermore, the results point to metabolic control

  15. A gene cluster for biosynthesis of the sesquiterpenoid antibiotic pentalenolactone in Streptomyces avermitilis.

    Science.gov (United States)

    Tetzlaff, Charles N; You, Zheng; Cane, David E; Takamatsu, Satoshi; Omura, Satoshi; Ikeda, Haruo

    2006-05-16

    Streptomyces avermitilis, an industrial organism responsible for the production of the anthelminthic avermectins, harbors a 13.4 kb gene cluster containing 13 unidirectionally transcribed open reading frames corresponding to the apparent biosynthetic operon for the sesquiterpene antibiotic pentalenolactone. The advanced intermediate pentalenolactone F, along with the shunt metabolite pentalenic acid, could be isolated from cultures of S. avermitilis, thereby establishing that the pentalenolactone biosynthetic pathway is functional in S. avermitilis. Deletion of the entire 13.4 kb cluster from S. avermitilis abolished formation of pentalenolactone metabolites, while transfer of the intact cluster to the pentalenolactone nonproducer Streptomyces lividans 1326 resulted in production of pentalenic acid. Direct evidence for the biochemical function of the individual biosynthetic genes came from expression of the ptlA gene (SAV2998) in Escherichia coli. Assay of the resultant protein established that PtlA is a pentalenene synthase, catalyzing the cyclization of farnesyl diphosphate to pentalenene, the parent hydrocarbon of the pentalenolactone family of metabolites. The most upstream gene in the cluster, gap1 (SAV2990), was shown to correspond to the pentalenolactone resistance gene, based on expression in E. coli and demonstration that the resulting glyceraldehyde-3-phosphate dehydrogenase, the normal target of pentalenolactone, was insensitive to the antibiotic. Furthermore, a second GAPDH isozyme (gap2, SAV6296) has been expressed in E. coli and shown to be inactivated by pentalenolactone.

  16. Succination of proteins in diabetes.

    Science.gov (United States)

    Frizzell, Norma; Lima, Maria; Baynes, John W

    2011-01-01

    Cysteine is arguably the most reactive amino acid in protein. A wide range of cysteine derivatives is formed in vivo, resulting from oxidation, nitrosation, alkylation and acylation reactions. This review describes succination of proteins, an irreversible chemical modification of cysteine by the Krebs cycle intermediate, fumarate, yielding S-(2-succinyl)cysteine (2SC). Intracellular fumarate concentration and succination of proteins are increased by hyperpolarization of the inner mitochondrial membrane and develop in concert with mitochondrial and oxidative stress in diabetes. Increased succination of glyceraldehyde-3-phosphate dehydrogenase explains the loss in specific activity of this enzyme in muscle of streptozotocin-diabetic rats and increased succination of adiponectin may explain the decreased secretion of adiponectin from adipose tissue in type 2 diabetes. In addition to GAPDH and adiponectin, other succinated proteins identified in adipocytes include cytoskeletal proteins (tubulin, actin) and chaperone proteins in the endoplasmic reticulum. Succination of adipocyte protein in vitro is inhibited by uncouplers of oxidative phosphorylation and by inhibitors of ER stress. 2SC serves as a biomarker of mitochondrial stress and recent studies suggest that succination is the mechanistic link between mitochondrial and ER stress in diabetes.

  17. Phylogenetic analysis of the Trypanosoma genus based on the heat-shock protein 70 gene.

    Science.gov (United States)

    Fraga, Jorge; Fernández-Calienes, Aymé; Montalvo, Ana Margarita; Maes, Ilse; Deborggraeve, Stijn; Büscher, Philippe; Dujardin, Jean-Claude; Van der Auwera, Gert

    2016-09-01

    Trypanosome evolution was so far essentially studied on the basis of phylogenetic analyses of small subunit ribosomal RNA (SSU-rRNA) and glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH) genes. We used for the first time the 70kDa heat-shock protein gene (hsp70) to investigate the phylogenetic relationships among 11 Trypanosoma species on the basis of 1380 nucleotides from 76 sequences corresponding to 65 strains. We also constructed a phylogeny based on combined datasets of SSU-rDNA, gGAPDH and hsp70 sequences. The obtained clusters can be correlated with the sections and subgenus classifications of mammal-infecting trypanosomes except for Trypanosoma theileri and Trypanosoma rangeli. Our analysis supports the classification of Trypanosoma species into clades rather than in sections and subgenera, some of which being polyphyletic. Nine clades were recognized: Trypanosoma carassi, Trypanosoma congolense, Trypanosoma cruzi, Trypanosoma grayi, Trypanosoma lewisi, T. rangeli, T. theileri, Trypanosoma vivax and Trypanozoon. These results are consistent with existing knowledge of the genus' phylogeny. Within the T. cruzi clade, three groups of T. cruzi discrete typing units could be clearly distinguished, corresponding to TcI, TcIII, and TcII+V+VI, while support for TcIV was lacking. Phylogenetic analyses based on hsp70 demonstrated that this molecular marker can be applied for discriminating most of the Trypanosoma species and clades.

  18. Differential protein levels and post-translational modifications in spinal cord injury of the rat.

    Science.gov (United States)

    Afjehi-Sadat, Leila; Brejnikow, Mika; Kang, Sung Ung; Vishwanath, Vinay; Walder, Nadja; Herkner, Kurt; Redl, Heinz; Lubec, Gert

    2010-03-05

    Although changes in protein expression in spinal cord injury (SCI) would be of pivotal interest, information so far is limited. It was therefore the aim of the study to determine protein levels and post-translational modifications in the early phase following SCI in the rat. SCI was induced in Sprague-Dawley rats and sham operated rats served as controls. A gel-based proteomic approach using two-dimensional gel electrophoresis followed by quantification with specific software and subsequent identification of differentially expressed proteins by nano-ESI-LC-MS/MS was applied. Proteins of several pathways and cascades were dysregulated in SCI: 14-3-3 epsilon protein, dynein light chain 1, and tubulin beta-5 chain showed higher levels in SCI, whereas adenylyl cyclase associated protein 1, dihydropyrimidinase-related protein 2, F-actin capping protein subunit beta, glyceraldehyde-3-phosphate dehydrogenase, stress-induced phosphoprotein 1 and transthyretin showed lower levels in the injured tissue. Post-translational modifications indicated free oxygen radical attack on proteins in SCI. The occurrence of stress is indicated by deranged stress-induced phosphoprotein 1 and signaling abnormalities are reflected by adenylyl cyclase-associated protein 1 and 14-3-3 epsilon protein. The findings propose the involvement of the corresponding cascades and challenge further work into aberrant signaling and oxidative stress in SCI, which may form the basis for experimental intervention for spinal cord trauma.

  19. Stromal cells positively and negatively modulate the growth of cancer cells: stimulation via the PGE2-TNFα-IL-6 pathway and inhibition via secreted GAPDH-E-cadherin interaction.

    Science.gov (United States)

    Kawada, Manabu; Inoue, Hiroyuki; Ohba, Shun-ichi; Yoshida, Junjiro; Masuda, Tohru; Yamasaki, Manabu; Usami, Ihomi; Sakamoto, Shuichi; Abe, Hikaru; Watanabe, Takumi; Yamori, Takao; Shibasaki, Masakatsu; Nomoto, Akio

    2015-01-01

    Fibroblast-like stromal cells modulate cancer cells through secreted factors and adhesion, but those factors are not fully understood. Here, we have identified critical stromal factors that modulate cancer growth positively and negatively. Using a cell co-culture system, we found that gastric stromal cells secreted IL-6 as a growth and survival factor for gastric cancer cells. Moreover, gastric cancer cells secreted PGE2 and TNFα that stimulated IL-6 secretion by the stromal cells. Furthermore, we found that stromal cells secreted glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Extracellular GAPDH, or its N-terminal domain, inhibited gastric cancer cell growth, a finding confirmed in other cell systems. GAPDH bound to E-cadherin and downregulated the mTOR-p70S6 kinase pathway. These results demonstrate that stromal cells could regulate cancer cell growth through the balance of these secreted factors. We propose that negative regulation of cancer growth using GAPDH could be a new anti-cancer strategy.

  20. Urinary mRNA for the Diagnosis of Renal Allograft Rejection: The Issue of Normalization.

    Science.gov (United States)

    Galichon, P; Amrouche, L; Hertig, A; Brocheriou, I; Rabant, M; Xu-Dubois, Y-C; Ouali, N; Dahan, K; Morin, L; Terzi, F; Rondeau, E; Anglicheau, D

    2016-05-27

    Urinary messenger RNA (mRNA) quantification is a promising method for noninvasive diagnosis of renal allograft rejection (AR), but the quantification of mRNAs in urine remains challenging due to degradation. RNA normalization may be warranted to overcome these issues, but the strategies of gene normalization have been poorly evaluated. Herein, we address this issue in a case-control study of 108 urine samples collected at time of allograft biopsy in kidney recipients with (n = 52) or without (n = 56) AR by comparing the diagnostic value of IP-10 and CD3ε mRNAs-two biomarkers of AR-after normalization by the total amount of RNA, normalization by one of the three widely used reference RNAs-18S, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and Hypoxanthine-guanine phosphoribosyltransferase (HPRT)-or normalization using uroplakin 1A (UPK) mRNA as a possible urine-specific reference mRNA. Our results show that normalization based on the total quantity of RNA is not substantially improved by additional normalization and may even be worsened with some classical reference genes that are overexpressed during rejection. However, considering that normalization by a reference gene is necessary to ensure polymerase chain reaction (PCR) quality and reproducibility and to suppress the effect of RNA degradation, we suggest that GAPDH and UPK1A are preferable to 18S or HPRT RNA.

  1. Identification and selection of normalization controls for quantitative transcript analysis in Blumeria graminis.

    Science.gov (United States)

    Pennington, Helen G; Li, Linhan; Spanu, Pietro D

    2016-05-01

    The investigation of obligate biotrophic pathogens, for example Blumeria graminis, presents a number of challenges. The sensitivity of many assays is reduced because of the presence of host material. Furthermore, the fungal structures inside and outside of the plant possess very different characteristics. Normalization genes are used in quantitative real-time polymerase chain reaction (qPCR) to compensate for changes as a result of the quantity and quality of template material. Such genes are used as references against which genes of interest are compared, enabling true quantification. Here, we identified six potential B. graminis and five barley genes for qPCR normalization. The relative changes in abundance of the transcripts were assayed across an infection time course in barley epidermis, in B. graminis epiphytic structures and haustoria. The B. graminis glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin (ACT) and histone 3 (H3) genes and the barley GAPDH, ubiquitin (UBI) and α-tubulin 2B (TUBA2B) genes were optimal normalization controls for qPCR during the infection cycle. These genes were then used for normalization in the quantification of the members of a Candidate Secreted Effector Protein (CSEP) family 21, a conidia-specific gene and barley genes encoding putative interactors of CSEP0064. The analysis demonstrates the importance of identifying which reference genes are appropriate for each investigation.

  2. Glycolytic enzyme activity is essential for domestic cat (Felis catus) and cheetah (Acinonyx jubatus) sperm motility and viability in a sugar-free medium.

    Science.gov (United States)

    Terrell, Kimberly A; Wildt, David E; Anthony, Nicola M; Bavister, Barry D; Leibo, S P; Penfold, Linda M; Marker, Laurie L; Crosier, Adrienne E

    2011-06-01

    We have previously reported a lack of glucose uptake in domestic cat and cheetah spermatozoa, despite observing that these cells produce lactate at rates that correlate positively with sperm function. To elucidate the role of glycolysis in felid sperm energy production, we conducted a comparative study in the domestic cat and cheetah, with the hypothesis that sperm motility and viability are maintained in both species in the absence of glycolytic metabolism and are fueled by endogenous substrates. Washed ejaculates were incubated in chemically defined medium in the presence/absence of glucose and pyruvate. A second set of ejaculates was exposed to a chemical inhibitor of either lactate dehydrogenase (sodium oxamate) or glyceraldehyde-3-phosphate dehydrogenase (alpha-chlorohydrin). Sperm function (motility and acrosomal integrity) and lactate production were assessed, and a subset of spermatozoa was assayed for intracellular glycogen. In both the cat and cheetah, sperm function was maintained without exogenous substrates and following lactate dehydrogenase inhibition. Lactate production occurred in the absence of exogenous hexoses, but only if pyruvate was present. Intracellular glycogen was not detected in spermatozoa from either species. Unexpectedly, glycolytic inhibition by alpha-chlorohydrin resulted in an immediate decline in sperm motility, particularly in the domestic cat. Collectively, our findings reveal an essential role of the glycolytic pathway in felid spermatozoa that is unrelated to hexose metabolism or lactate formation. Instead, glycolytic enzyme activity could be required for the metabolism of endogenous lipid-derived glycerol, with fatty acid oxidation providing the primary energy source in felid spermatozoa.

  3. Exercise induced stress in horses: Selection of the most stable reference genes for quantitative RT-PCR normalization

    Directory of Open Access Journals (Sweden)

    Silvestrelli Maurizio

    2008-05-01

    Full Text Available Abstract Background Adequate stress response is a critical factor during athlete horses' training and is central to our capacity to obtain better performances while safeguarding animal welfare. In order to investigate the molecular mechanisms underlying this process, several studies have been conducted that take advantage of microarray and quantitative real-time PCR (qRT-PCR technologies to analyse the expression of candidate genes involved in the cellular stress response. Appropriate application of qRT-PCR, however, requires the use of reference genes whose level of expression is not affected by the test, by general physiological conditions or by inter-individual variability. Results The expression of nine potential reference genes was evaluated in lymphocytes of ten endurance horses during strenuous exercise. These genes were tested by qRT-PCR and ranked according to the stability of their expression using three different methods (implemented in geNorm, NormFinder and BestKeeper. Succinate dehydrogenase complex subunit A (SDHA and hypoxanthine phosphoribosyltransferase (HPRT always ranked as the two most stably expressed genes. On the other hand, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, transferrin receptor (TFRC and ribosomal protein L32 (RPL32 were constantly classified as the less reliable controls. Conclusion This study underlines the importance of a careful selection of reference genes for qRT-PCR studies of exercise induced stress in horses. Our results, based on different algorithms and analytical procedures, clearly indicate SDHA and HPRT as the most stable reference genes of our pool.

  4. Cy5 total protein normalization in Western blot analysis.

    Science.gov (United States)

    Hagner-McWhirter, Åsa; Laurin, Ylva; Larsson, Anita; Bjerneld, Erik J; Rönn, Ola

    2015-10-01

    Western blotting is a widely used method for analyzing specific target proteins in complex protein samples. Housekeeping proteins are often used for normalization to correct for uneven sample loads, but these require careful validation since expression levels may vary with cell type and treatment. We present a new, more reliable method for normalization using Cy5-prelabeled total protein as a loading control. We used a prelabeling protocol based on Cy5 N-hydroxysuccinimide ester labeling that produces a linear signal response. We obtained a low coefficient of variation (CV) of 7% between the ratio of extracellular signal-regulated kinase (ERK1/2) target to Cy5 total protein control signals over the whole loading range from 2.5 to 20.0μg of Chinese hamster ovary cell lysate protein. Corresponding experiments using actin or tubulin as controls for normalization resulted in CVs of 13 and 18%, respectively. Glyceraldehyde-3-phosphate dehydrogenase did not produce a proportional signal and was not suitable for normalization in these cells. A comparison of ERK1/2 signals from labeled and unlabeled samples showed that Cy5 prelabeling did not affect antibody binding. By using total protein normalization we analyzed PP2A and Smad2/3 levels with high confidence. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Interactions of surface-displayed glycolytic enzymes of Mycoplasma pneumoniae with components of the human extracellular matrix.

    Science.gov (United States)

    Gründel, Anne; Jacobs, Enno; Dumke, Roger

    2016-12-01

    Mycoplasma pneumoniae is a major cause of community-acquired respiratory infections worldwide. Due to the strongly reduced genome, the number of virulence factors expressed by this cell wall-less pathogen is limited. To further understand the processes during host colonization, we investigated the interactions of the previously confirmed surface-located glycolytic enzymes of M. pneumoniae (pyruvate dehydrogenase A-C [PdhA-C], glyceraldehyde-3-phosphate dehydrogenase [GapA], lactate dehydrogenase [Ldh], phosphoglycerate mutase [Pgm], pyruvate kinase [Pyk] and transketolase [Tkt]) to the human extracellular matrix (ECM) proteins fibrinogen (Fn), fibronectin (Fc), lactoferrin (Lf), laminin (Ln) and vitronectin (Vc), respectively. Concentration-dependent interactions between Fn and Vc and all eight recombinant proteins derived from glycolytic enzymes, between Ln and PdhB-C, GapA, Ldh, Pgm, Pyk and Tkt, between Lf and PdhA-C, GapA and Pyk, and between Fc and PdhC and GapA were demonstrated. In most cases, these associations are significantly influenced by ionic forces and by polyclonal sera against recombinant proteins. In immunoblotting, the complex of human plasminogen, activator (tissue-type or urokinase plasminogen activator) and glycolytic enzyme was not able to degrade Fc, Lf and Ln, respectively. In contrast, degradation of Vc was confirmed in the presence of all eight enzymes tested. Our data suggest that the multifaceted associations of surface-localized glycolytic enzymes play a potential role in the adhesion and invasion processes during infection of human respiratory mucosa by M. pneumoniae.

  6. Bypassing hazard of housekeeping genes: Their evaluation in rat granule neurons treated with cerebrospinal fluid of Multiple Sclerosis subjects

    Directory of Open Access Journals (Sweden)

    Deepali eMathur

    2015-09-01

    Full Text Available Gene expression studies employing real-time PCR has become an intrinsic part of biomedical research. Appropriate normalization of target gene transcript(s based on stably expressed housekeeping genes is crucial in individual experimental conditions to obtain accurate results. In multiple sclerosis (MS, several gene expression studies have been undertaken, however, the suitability of housekeeping genes to express stably in this disease is not yet explored. Recent research suggests that their expression level may vary under different experimental conditions. Hence it is indispensible to evaluate their expression stability to accurately normalize target gene transcripts. The present study aims to evaluate the expression stability of seven housekeeping genes in rat granule neurons treated with cerebrospinal fluid of MS patients. The selected reference genes were quantified by real time PCR and their expression stability was assessed using GeNorm and NormFinder algorithms. Both methods reported transferrin receptor (Tfrc and microglobulin beta-2 (B2m the most stable genes whereas beta-actin (ActB and glyceraldehyde-3-phosphate-dehydrogenase (Gapdh the most fluctuated ones. Altogether our data demonstrate the significance of pre-validation of housekeeping genes for accurate normalization and indicates Tfrc and B2m as best endogenous controls in MS. ActB and Gapdh are not recommended in gene expression studies related to the current one.

  7. Aging, proteotoxicity, mitochondria, glycation, NAD+ and carnosine: possible inter-relationships and resolution of the oxygen paradox

    Directory of Open Access Journals (Sweden)

    Alan R Hipkiss

    2010-03-01

    Full Text Available It is suggested that NAD+ availability strongly affects cellular aging and organism lifespan: low NAD+ availability increases intracellular levels of glycolytic triose phosphates (glyceraldehyde-3-phosphate and dihydroxyacetone-phosphate which, if not further metabolized, decompose spontaneously into methylglyoxal (MG, a glycating agent and source of protein and mitochondrial dysfunction and reactive oxygen species (ROS. MG-damaged proteins and other aberrant polypeptides can induce ROS generation, promote mitochondrial dysfunction and inhibit proteasomal activity. Upregulation of mitogenesis and mitochondrial activity by increased aerobic exercise, or dietary manipulation, helps to maintain NAD+ availability and thereby decreases MG-induced proteotoxicity. These proposals can explain the apparent paradox whereby aging is seemingly caused by increased ROS-mediated macromolecular damage but is ameliorated by increased aerobic activity. It is also suggested that increasing mitochondrial activity decreases ROS generation, while excess numbers of inactive mitochondria are deleterious due to increased ROS generation. The muscle- and brain-associated dipeptide, carnosine, is an intracellular buffer which can delay senescence in cultured human fibroblasts and delay aging in senescence-accelerated mice. Carnosine’s ability to react with MG and possibly other deleterious carbonyl compounds, and scavenge various ROS, may account for its protective ability towards ischemia and ageing.

  8. Structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Michalska, Karolina [Midwest Center for Structural Genomics, Biosciences Division, Argonne National Laboratory (United States); Cuff, Marianne E. [Midwest Center for Structural Genomics, Biosciences Division, Argonne National Laboratory (United States); Structural Biology Center, Biosciences Division, Argonne National Laboratory (United States); Tesar, Christine; Feldmann, Brian [Midwest Center for Structural Genomics, Biosciences Division, Argonne National Laboratory (United States); Joachimiak, Andrzej, E-mail: andrzejj@anl.gov [Midwest Center for Structural Genomics, Biosciences Division, Argonne National Laboratory (United States); Structural Biology Center, Biosciences Division, Argonne National Laboratory (United States); Department of Biochemistry and Molecular Biology, University of Chicago (United States)

    2011-08-01

    The crystal structure of 2-oxo-3-deoxygalactonate kinase from the De Ley–Doudoroff pathway of galactose metabolism has been determined at 2.1 Å resolution. In most organisms, efficient d-galactose utilization requires the highly conserved Leloir pathway that converts d-galactose to d-glucose 1-phosphate. However, in some bacterial and fungal species alternative routes of d-galactose assimilation have been identified. In the so-called De Ley–Doudoroff pathway, d-galactose is metabolized into pyruvate and d-glyceraldehyde 3-phosphate in five consecutive reactions carried out by specific enzymes. The penultimate step in this pathway involves the phosphorylation of 2-oxo-3-deoxygalactonate to 2-oxo-3-deoxygalactonate 6-phosphate catalyzed by 2-oxo-3-deoxygalactonate kinase, with ATP serving as a phosphoryl-group donor. Here, a crystal structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae determined at 2.1 Å resolution is reported, the first structure of an enzyme from the De Ley–Doudoroff pathway. Structural comparison indicates that the enzyme belongs to the ASKHA (acetate and sugar kinases/hsc70/actin) family of phosphotransferases. The protein is composed of two α/β domains, each of which contains a core common to all family members. Additional elements introduced between conserved structural motifs define the unique features of 2-oxo-3-deoxygalactonate kinase and possibly determine the biological function of the protein.

  9. Synthesis and chemical and biological comparison of nitroxyl- and nitric oxide-releasing diazeniumdiolate-based aspirin derivatives.

    Science.gov (United States)

    Basudhar, Debashree; Bharadwaj, Gaurav; Cheng, Robert Y; Jain, Sarthak; Shi, Sa; Heinecke, Julie L; Holland, Ryan J; Ridnour, Lisa A; Caceres, Viviane M; Spadari-Bratfisch, Regina C; Paolocci, Nazareno; Velázquez-Martínez, Carlos A; Wink, David A; Miranda, Katrina M

    2013-10-24

    Structural modifications of nonsteroidal anti-inflammatory drugs (NSAIDs) have successfully reduced the side effect of gastrointestinal ulceration without affecting anti-inflammatory activity, but they may increase the risk of myocardial infarction with chronic use. The fact that nitroxyl (HNO) reduces platelet aggregation, preconditions against myocardial infarction, and enhances contractility led us to synthesize a diazeniumdiolate-based HNO-releasing aspirin and to compare it to an NO-releasing analogue. Here, the decomposition mechanisms are described for these compounds. In addition to protection against stomach ulceration, these prodrugs exhibited significantly enhanced cytotoxcity compared to either aspirin or the parent diazeniumdiolate toward nonsmall cell lung carcinoma cells (A549), but they were not appreciably toxic toward endothelial cells (HUVECs). The HNO-NSAID prodrug inhibited cylcooxgenase-2 and glyceraldehyde 3-phosphate dehydrogenase activity and triggered significant sarcomere shortening on murine ventricular myocytes compared to control. Together, these anti-inflammatory, antineoplasic, and contractile properties suggest the potential of HNO-NSAIDs in the treatment of inflammation, cancer, or heart failure.

  10. Synthesis and Chemical and Biological Comparison of Nitroxyl and Nitric Oxide Releasing Diazeniumdiolate-based Aspirin Derivatives

    Science.gov (United States)

    Basudhar, Debashree; Bharadwaj, Gaurav; Cheng, Robert Y.; Jain, Sarthak; Shi, Sa; Heinecke, Julie L.; Holland, Ryan J.; Ridnour, Lisa A.; Caceres, Viviane M.; Spadari-Bratfisch, Regina C.; Paolocci, Nazareno; Velázquez-Martínez, Carlos A.; Wink, David A.; Miranda, Katrina M.

    2013-01-01

    Structural modifications of non-steroidal anti-inflammatory drugs (NSAIDs) have successfully reduced the side effect of gastrointestinal ulceration without affecting anti-inflammatory activity, but may increase risk of myocardial infarction with chronic use. That nitroxyl (HNO) reduces platelet aggregation, preconditions against myocardial infarction and enhances contractility led us to synthesize a diazeniumdiolate-based HNO releasing aspirin and to compare it to an NO-releasing analogue. Here, the decomposition mechanisms are described for these compounds. In addition to protection against stomach ulceration, these prodrugs also exhibited significantly enhanced cytotoxcity compared to either aspirin or the parent diazeniumdiolate toward non-small cell lung carcinoma cells (A549) but were not appreciably toxic toward endothelial cells (HUVECs). The HNO-NSAID prodrug inhibited cylcooxgenase-2 and glyceraldehyde 3-phosphate dehydrogenase activity and triggered significant sarcomere shortening compared to control on murine ventricular myocytes. Together, these anti-inflammatory, anti-neoplasic and contractile properties suggest the potential of HNO-NSAIDs in the treatment of inflammation, cancer or heart failure. PMID:24102516

  11. Multifaceted roles of metabolic enzymes of the Paracoccidioides species complex

    Directory of Open Access Journals (Sweden)

    Caroline Maria Marcos

    2014-12-01

    Full Text Available Paracoccidioides species are dimorphic fungi, and are the etiologic agents of paracoccidioidomycosis (PCM, a serious disease of multiple organs. The large number of tissues colonized by this fungus suggests the presence of a variety of surface molecules involved in adhesion. A surprising finding is that the majority of enzymes in the glycolytic pathway, tricarboxylic acid (TCA cycle and glyoxylate cycle in Paracoccidioides spp. has adhesive properties that aid in the interaction with the host extracellular matrix, and so act as ‘moonlighting’ proteins. Moonlighting proteins have multiple functions and add another dimension to cellular complexity, while benefiting cells in several ways. This phenomenon occurs in both eukaryotes and prokaryotes. For example, moonlighting proteins from the glycolytic pathway or TCA cycle can play roles in bacterial pathogens, either by acting as proteins secreted in a conventional pathway or not and/or as cell surface component that facilitate adhesion or adherence . This review outlines the multifuncionality exposed by a variety of Paracoccidioides spp. enzymes including aconitase, aldolase, glyceraldehyde-3-phosphate dehydrogenase, isocitrate lyase, malate synthase, triose phosphate isomerase, fumarase and enolase. The roles that moonlighting activities play in the virulence characteristics of this fungus and several other human pathogens during their interactions with the host are discussed.

  12. Sida rhomboidea. Roxb Leaf Extract Down-Regulates Expression of PPARγ2 and Leptin Genes in High Fat Diet Fed C57BL/6J Mice and Retards in Vitro 3T3L1 Pre-Adipocyte Differentiation

    Directory of Open Access Journals (Sweden)

    A. V. Ramachandran

    2011-07-01

    Full Text Available Sida rhomboidea. Roxb leaf extract (SRLE is being used by the populace of North-East India to alleviate symptoms of diabetes and obesity. We have previously reported its hypolipidemic and anti-diabetic properties. In this study, we report the effect of SRLE on (i in vivo modulation of genes controlling high fat diet (HFD induced obesity and (ii in vitro 3T3L1 pre-adipocyte differentiation and leptin release. Supplementation with SRLE significantly prevented HFD induced increment in bodyweight, plasma lipids and leptin, visceral adiposity and adipocyte hypertrophy. Also, SRLE supplementation reduced food intake, down regulated PPARγ2, SREBP1c, FAS and LEP expressions and up-regulated CPT-1 in epididymal adipose tissue compared to obese mice. In vitro adipogenesis of 3T3L1 pre-adipocytes was significantly retarded in the presence of SRLE extract. Also decreased triglyceride accumulation, leptin release and glyceraldehyde-3-Phosphate dehydrogenase activity along with higher glycerol release without significant alteration of viability of 3T3L1 pre-adipocytes, was recorded. Our findings suggest that prevention of HFD induced visceral adiposity is primarily by down regulation of PPARγ2 and leptin gene expression coupled with attenuation of food intake in C57BL/6J mice. SRLE induced prevention of pre-adipocytes differentiation, and leptin release further substantiated these findings and scientifically validates the potential application of SRLE as a therapeutic agent against obesity.

  13. RNA binding protein Pub1p regulates glycerol production and stress tolerance by controlling Gpd1p activity during winemaking.

    Science.gov (United States)

    Orozco, Helena; Sepúlveda, Ana; Picazo, Cecilia; Matallana, Emilia; Aranda, Agustín

    2016-06-01

    Glycerol is a key yeast metabolite in winemaking because it contributes to improve the organoleptic properties of wine. It is also a cellular protective molecule that enhances the tolerance of yeasts to osmotic stress and promotes longevity. Thus, its production increases by genetic manipulation, which is of biotechnological and basic interest. Glycerol is produced by diverting glycolytic glyceraldehyde-3-phosphate through the action of glycerol-3-phosphate dehydrogenase (coded by genes GPD1 and GPD2). Here, we demonstrate that RNA-binding protein Pub1p regulates glycerol production by controlling Gpd1p activity. Its deletion does not alter GPD1 mRNA levels, but protein levels and enzymatic activity increase, which explains the higher intracellular glycerol concentration and greater tolerance to osmotic stress of the pub1∆ mutant. PUB1 deletion also enhances the activity of nicotinamidase, a longevity-promoting enzyme. Both enzymatic activities are partially located in peroxisomes, and we detected peroxisome formation during wine fermentation. The role of Pub1p in life span control depends on nutrient conditions and is related with the TOR pathway, and a major connection between RNA metabolism and the nutrient signaling response is established.

  14. An aryl-alcohol oxidase of Pleurotus sapidus: heterologous expression, characterization, and application in a 2-enzyme system.

    Science.gov (United States)

    Galperin, Ilya; Javeed, Aysha; Luig, Hanno; Lochnit, Günter; Rühl, Martin

    2016-09-01

    Aryl-alcohol oxidases (AAOs) are enzymes supporting the degradation of lignin by fungal derived class II peroxidases produced by white-rot fungi. AAOs are able to generate H2O2 as a by-product via oxidation of an aryl-alcohol into its correspondent aldehyde. In this study, an AAO was heterologously expressed in a basidiomycete host for the first time. The gene for an AAO of the white-rot fungus Pleurotus sapidus, a close relative to the oyster mushroom Pleurotus ostreatus, was cloned into an expression vector and put under control of the promotor of the glyceraldehyde-3-phosphate dehydrogenase gene 2 (gpdII) of the button mushroom Agaricus bisporus. The expression vector was transformed into the model basidiomycete Coprinopsis cinerea, and several positive transformants were obtained. The best producing transformants were grown in shake-flasks and in a stirred tank reactor reaching enzymatic activities of up to 125 U L(-1) using veratryl alcohol as a substrate. The purified AAO was biochemically characterized and compared to the previously described native and recombinant AAOs from other Pleurotus species. In addition, a two-enzyme system comprising a dye-decolorizing peroxidase (DyP) from Mycetinis scorodonius and the P. sapidus AAO was successfully employed to bleach the anthraquinone dye Reactive Blue 5.

  15. β-Glucan synthase gene overexpression and β-glucans overproduction in Pleurotus ostreatus using promoter swapping.

    Directory of Open Access Journals (Sweden)

    Ran Chai

    Full Text Available Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR, and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi.

  16. Methylglyoxal reduces mitochondrial potential and activates Bax and caspase-3 in neurons: Implications for Alzheimer's disease.

    Science.gov (United States)

    Tajes, Marta; Eraso-Pichot, Abel; Rubio-Moscardó, Fanny; Guivernau, Biuse; Bosch-Morató, Mònica; Valls-Comamala, Victòria; Muñoz, Francisco J

    2014-09-19

    Alzheimer's disease (AD) is characterized by the oxidative stress generated from amyloid β-peptide (Aβ) aggregates. It produces protein nitrotyrosination, after the reaction with nitric oxide to form peroxynitrite, being triosephosphate isomerase (TPI) one of the most affected proteins. TPI is a glycolytic enzyme that catalyzes the interconversion between glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP). Methylglyoxal (MG) is a by-product of TPI activity whose production is triggered when TPI is nitrotyrosinated. MG is harmful to cells because it glycates proteins. Here we found protein glycation when human neuroblastoma cells were treated with Aβ. Moreover glycation was also observed when neuroblastoma cells overexpressed mutated TPI where Tyr165 or Tyr209, the two tyrosines close to the catalytic center, were changed by Phe in order to mimic the effect of nitrotyrosination. The pathological relevance of these findings was studied by challenging cells with Aβ oligomers and MG. A significant decrease in mitochondrial transmembrane potential, one of the first apoptotic events, was obtained. Therefore, increasing concentrations of MG were assayed searching for MG effect in neuronal apoptosis. We found a decrease of the protective Bcl2 and an increase of the proapoptotic caspase-3 and Bax levels. Our results suggest that MG is triggering apoptosis in neurons and it would play a key role in AD neurodegeneration.

  17. Overexpression of the riboflavin biosynthetic pathway in Pichia pastoris

    Directory of Open Access Journals (Sweden)

    Mattanovich Diethard

    2008-07-01

    Full Text Available Abstract Background High cell density cultures of Pichia pastoris grown on methanol tend to develop yellow colored supernatants, attributed to the release of free flavins. The potential of P. pastoris for flavin overproduction is therefore given, but not pronounced when the yeast is grown on glucose. The aim of this study is to characterize the relative regulatory impact of each riboflavin synthesis gene. Deeper insight into pathway control and the potential of deregulation is established by overexpression of the single genes as well as a combined deregulation of up to all six riboflavin synthesis genes. Results Overexpression of the first gene of the riboflavin biosynthetic pathway (RIB1 is already sufficient to obtain yellow colonies and the accumulation of riboflavin in the supernatant of shake flask cultures growing on glucose. Sequential deregulation of all the genes, by exchange of their native promoter with the strong and constitutive glyceraldehyde-3-phosphate dehydrogenase promoter (PGAP increases the riboflavin accumulation significantly. Conclusion The regulation of the pathway is distributed over more than one gene. High cell density cultivations of a P. pastoris strain overexpressing all six RIB genes allow the accumulation of 175 mg/L riboflavin in the supernatant. The basis for rational engineering of riboflavin production in P. pastoris has thus been established.

  18. Chemiluminescent Detection for Estimating Relative Copy Numbers of Porcine Endogenous Retrovirus Proviruses from Chinese Minipigs Based on Magnetic Nanoparticles.

    Science.gov (United States)

    Yang, Haowen; Liu, Ming; Zhou, Bingcong; Deng, Yan; He, Nongyue; Jiang, Hesheng; Guo, Yafen; Lan, Ganqiu; Jiang, Qinyang; Yang, Xiurong; Li, Zhiyang

    2016-06-01

    Chinese Bama minipigs could be potential donors for the supply of xenografts because they are genetically stable, highly inbred, and inexpensive. However, porcine endogenous retrovirus (PERV) is commonly integrated in pig genomes and could cause a cross-species infection by xenotransplantation. For screening out the pigs with low copy numbers of PERV proviruses, we have developed a novel semiquantitative analysis approach based on magnetic nanoparticles (MNPs) and chemiluminescence (CL) for estimating relative copy numbers (RCNs) of PERV proviruses in Chinese Bama minipigs. The CL intensities of PERV proviruses and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were respectively determined with this method, and the RCNs of PERV proviruses were calculated by the equation: RCN of PERV provirus = CL intensity of PERV provirus/CL intensity of GAPDH. The results showed that PERVs were integrated in the genomes of Bama minipigs at different copy numbers, and the copy numbers of PERV-C subtype were greatly low. Two Bama minipigs with low copy numbers of PERV proviruses were detected out and could be considered as xenograft donor candidates. Although only semiquantitation can be achieved, this approach has potential for screening out safe and suitable pig donors for xenotransplantation.

  19. Metabolism of lactose by Clostridium thermolacticum growing in continuous culture.

    Science.gov (United States)

    Collet, Christophe; Girbal, Laurence; Péringer, Paul; Schwitzguébel, Jean-Paul; Soucaille, Philippe

    2006-06-01

    The objective of the present study was to characterize the metabolism of Clostridium thermolacticum, a thermophilic anaerobic bacterium, growing continuously on lactose (10 g l(-1)) and to determine the enzymes involved in the pathways leading to the formation of the fermentation products. Biomass and metabolites concentration were measured at steady-state for different dilution rates, from 0.013 to 0.19 h(-1). Acetate, ethanol, hydrogen and carbon dioxide were produced at all dilution rates, whereas lactate was detected only for dilution rates below 0.06 h(-1). The presence of several key enzymes involved in lactose metabolism, including beta-galactosidase, glyceraldehyde-3-phosphate dehydrogenase, pyruvate:ferredoxin oxidoreductase, acetate kinase, ethanol dehydrogenase and lactate dehydrogenase, was demonstrated. Finally, the intracellular level of NADH, NAD+, ATP and ADP was also measured for different dilution rates. The production of ethanol and lactate appeared to be linked with the re-oxidation of NADH produced during glycolysis, whereas hydrogen produced should come from reduced ferredoxin generated during pyruvate decarboxylation. To produce more hydrogen or more acetate from lactose, it thus appears that an efficient H2 removal system should be used, based on a physical (membrane) or a biological approach, respectively, by cultivating C. thermolacticum with efficient H2 scavenging and acetate producing microorganisms.

  20. The Quantified Level of Circulating Prostate Stem Cell Antigen mRNA relative to GAPDH Level Is a Clinically Significant Indictor for Predicting Biochemical Recurrence in Prostate Cancer Patients after Radical Prostatectomy

    Directory of Open Access Journals (Sweden)

    Sung Han Kim

    2015-01-01

    Full Text Available The study quantified the relative absolute PSCA level in relation to the glyceraldehyde 3-phosphate dehydrogenase (GAPDH level in the peripheral blood of 478 hormone-naive prostate cancer (PC patients who underwent radical prostatectomy from 2005 to 2012 and evaluated its prognostic significance as a risk factor for predicting biochemical recurrence (BCR, compared to known parameters. Nested real-time polymerase chain reaction (RT-PCR and gel electrophoresis detected PSCA levels and measured the PSCA/GAPDH ratio. Clinicopathological data from the institutional database were examined to determine the adequate cut-off level to predict postoperative BCR. A total of 110 patients had a positive PSCA result (23.0% via RT-PCR (mean blood ratio 1.1 ± 0.4. The BCR was significantly higher in the PSCA-positive detection group (p=0.009. A multivariate model was created to show that a PSCA/GAPDH ratio between 1.0 and 1.5 (HR 12.722, clinical T2c stage (HR 0.104, preoperative PSA (HR 1.225, extraprostatic capsule extension (HR 0.006, lymph node dissection (HR 16.437, and positive resection margin (HR 27.453 were significant predictive factors for BCR (p<0.05. The study showed successful quantification of PSCA with its significance for BCR-related risk factor; however, further studies are needed to confirm its clinical predictive value.

  1. Identification and evaluation of suitable reference genes for gene expression studies in the whitefly Bemisia tabaci (Asia I) by reverse transcription quantitative realtime PCR.

    Science.gov (United States)

    Collins, Carl; Patel, Mitulkumar V; Colvin, John; Bailey, David; Seal, Susan

    2014-05-02

    This study presents a reliable method for performing reverse transcription quantitative realtime PCR (RT-qPCR) to measure gene expression in the whitefly Bemisia tabaci (Asia I) (Gennadius) (Hemiptera: Aleyrodidae), utilising suitable reference genes for data normalisation. We identified orthologs of commonly used reference genes (actin (ACT), cyclophilin 1 (CYP1), elongation factor 1α (EF1A), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), ribosomal protein L13a (RPL13A), and α-tubulin (TUB1A)), measured the levels of their transcripts by RT-qPCR during development and in response to thermal stress, and evaluated their suitability as endogenous controls using geNorm, BestKeeper, and NormFinder programs. Overall, TUB1A, RPL13A, and CYP1 were the most stable reference genes during B. tabaci development, and TUB1A, GAPDH, and RPL13A were the most stable reference genes in the context of thermal stress. An analysis of the effects of reference gene choice on the transcript profile of a developmentally-regulated gene encoding vitellogenin demonstrated the importance of selecting the correct endogenous controls for RT-qPCR studies. We propose the use of TUB1A, RPL13A, and CYP1 as endogenous controls for transcript profiling studies of B. tabaci development, whereas the combination of TUB1A, GAPDH, and RPL13A should be employed for studies into thermal stress. The data pre- sented here will assist future transcript profiling studies in whiteflies.

  2. Hydrogen sulfide and nitric oxide metabolites in the blood of free-ranging brown bears and their potential roles in hibernation.

    Science.gov (United States)

    Revsbech, Inge G; Shen, Xinggui; Chakravarti, Ritu; Jensen, Frank B; Thiel, Bonnie; Evans, Alina L; Kindberg, Jonas; Fröbert, Ole; Stuehr, Dennis J; Kevil, Christopher G; Fago, Angela

    2014-08-01

    During winter hibernation, brown bears (Ursus arctos) lie in dens for half a year without eating while their basal metabolism is largely suppressed. To understand the underlying mechanisms of metabolic depression in hibernation, we measured type and content of blood metabolites of two ubiquitous inhibitors of mitochondrial respiration, hydrogen sulfide (H2S) and nitric oxide (NO), in winter-hibernating and summer-active free-ranging Scandinavian brown bears. We found that levels of sulfide metabolites were overall similar in summer-active and hibernating bears but their composition in the plasma differed significantly, with a decrease in bound sulfane sulfur in hibernation. High levels of unbound free sulfide correlated with high levels of cysteine (Cys) and with low levels of bound sulfane sulfur, indicating that during hibernation H2S, in addition to being formed enzymatically from the substrate Cys, may also be regenerated from its oxidation products, including thiosulfate and polysulfides. In the absence of any dietary intake, this shift in the mode of H2S synthesis would help preserve free Cys for synthesis of glutathione (GSH), a major antioxidant found at high levels in the red blood cells of hibernating bears. In contrast, circulating nitrite and erythrocytic S-nitrosation of glyceraldehyde-3-phosphate dehydrogenase, taken as markers of NO metabolism, did not change appreciably. Our findings reveal that remodeling of H2S metabolism and enhanced intracellular GSH levels are hallmarks of the aerobic metabolic suppression of hibernating bears.

  3. Multiple targets of salicylic acid and its derivatives in plants and animals

    Directory of Open Access Journals (Sweden)

    Daniel F. Klessig

    2016-05-01

    Full Text Available Salicylic acid (SA is a critical plant hormone that is involved in many processes, including seed germination, root initiation, stomatal closure, floral induction, thermogenesis, and response to abiotic and biotic stresses. Its central role in plant immunity, although extensively studied, is still only partially understood. Classical biochemical approaches and, more recently, genome-wide high-throughput screens have identified more than two dozen plant SA-binding proteins (SABPs, as well as multiple candidates that have yet to be characterized. Some of these proteins bind SA with high affinity, while the affinity others exhibit is low. Given that SA levels vary greatly even within a particular plant species depending on subcellular location, tissue type, developmental stage, and with respect to both time and location after an environmental stimulus such as infection, the presence of SABPs exhibiting a wide range of affinities for SA may provide great flexibility and multiple mechanisms through which SA can act. SA and its derivatives, both natural and synthetic, also have multiple targets in animals/humans. Interestingly, many of these proteins, like their plant counterparts, are associated with immunity or disease development. Two recently identified SABPs, High Mobility Group Box protein (HMGB and Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH, are critical proteins that not only serve key structural or metabolic functions, but also play prominent roles in disease responses in both kingdoms.

  4. Quantitative proteomic analysis of the effects of a GalNAc/Man-specific lectin CSL on yeast cells by label-free LC-MS.

    Science.gov (United States)

    Liu, Shuai; Li, Linge; Tong, Changqing; Zhao, Qiancheng; Lukyanov, Pavel A; Chernikov, Oleg V; Li, Wei

    2016-04-01

    A Ca(2+)-dependent GalNAc/Man-specific lectin (CSL) from Cyclina sinensis was isolated, and its stimulatory action was characterized in yeast. CSL showed a potent effect on the production of ethanol by Saccharomyces cerevisiae. In this work, the changes in the protein expression profiles of S. cerevisiae after 24h of incubation with CSL were analyzed using label-free quantitative proteomics. A total of 1410 proteins were identified, but only 117 proteins showed significant differences in normalized volume (p<0.05). Among the latter proteins, 24 proteins were up-regulated, and 93 were down-regulated. Analysis of the proteome revealed that CSL triggered changes in the concentrations of some enzymes, such as increased expression of hexokinase, glyceraldehyde 3-phosphate dehydrogenase and enolase and decreased expression of dihydrolipoamide dehydrogenase and aldehyde dehydrogenase. These results indicate that CSL can cause some changes in the metabolic pathway involved in ethanol synthesis in S. cerevisiae. These data may help us understand the stimulatory mechanism of lectin in the fermentation process.

  5. Effects of oxygen and photosynthesis carbon cycle reactions on kinetics of P700 redox transients in cyanobacterium Arthrospira platensis cells.

    Science.gov (United States)

    Bolychevtseva, Yu V; Terekhova, I V; Roegner, M; Karapetyan, N V

    2007-03-01

    Effects of oxygen and photosynthesis and respiration inhibitors on the electron transport in photosystem I (PSI) of the cyanobacterium Arthrospira platensis cells were studied. Redox transients of P700 were induced by illumination at 730 nm and monitored as kinetics of the absorption changes at 810 nm; to block electron influx from PSII, the measurements were performed in the presence of 30 microM 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU). Inhibitors of terminal oxidases (potassium cyanide and pentachlorophenol) insignificantly influenced the fast oxidation of P700 under aerobic conditions, whereas removal of oxygen significantly decelerated the accumulation of P700(+). In the absence of oxygen the slow oxidation of P700 observed on the first illumination was accelerated on each subsequent illumination, suggesting an activation of the carbon cycle enzymes. Under the same conditions, pentachlorophenol (an uncoupler) markedly accelerated the P700 photooxidation. Under anaerobic conditions, potassium cyanide (an inhibitor of carbon dioxide assimilation) failed to influence the kinetics of redox transients of P700, whereas iodoacetamide (an inhibitor of NADP(H)-glyceraldehyde-3-phosphate dehydrogenase) completely prevented the photooxidation of P700. Thus, the fast photooxidation of P700 in the A. platensis cells under aerobic conditions in the presence of DCMU was caused by electron transport from PSI onto oxygen, and complicated transient changes in the P700 photooxidation kinetics under anaerobic conditions (in the presence of DCMU) were due to involvement of NADP+ generated during the reducing phase of the carbon cycle.

  6. Properties of an Arcanobacterium haemolyticum strain isolated from a donkey.

    Science.gov (United States)

    Sammra, Osama; Balbutskaya, Anna; Nagib, Samy; Alber, Jörg; Lämmler, Christoph; Abdulmawjood, Amir; Timke, Markus; Kostrzewa, Markus; Prenger-Berninghoff, Ellen

    2014-01-01

    The present study was designed to characterize phenotypically and genotypically an Arcanobacterium haemolyticum strain (A. haemolyticum P646) isolated from a purulent nasal discharge of a donkey. A. haemolyticum P646 showed, compared to sheep blood, an enhanced hemolytic reaction on rabbit blood agar, a synergistic CAMP-like reaction with Streptococcus agalactiae and Rhodococcus equi as indicator strains, a reverse CAMP reaction in the zone of Staphylococcus aureus beta-hemolysin and the typical biochemical properties of this species. The species identity could be confirmed by MALDI-TOF MS analysis, by sequencing the 16S rDNA and glyceraldehyde-3-phosphate dehydrogenase encoding gene gap and by amplification of A. haemolyticum specific parts of 16S-23S rDNA intergenic spacer region and 23S rDNA. A. haemolyticum P646 and the reference strain A. haemolyticum DSM 20595 were further characterized by amplification of the putative virulence genes encoding arcanolysin, phospholipase D, hemolysin A, CAMP factor family protein, a collagen binding protein and two neuraminidases which were present for A. haemolyticum DSM 20595. A. haemolyticum P646 showed a comparable gene spectrum but was negative for the genes encoding collagen binding protein and neuraminidase H. To our knowledge, the present study is the first phenotypic and genotypic characterization of an A. haemolyticum strain isolated from a donkey.

  7. Induction of protective immune responses against schistosomiasis using functionally active cysteine peptidases

    Science.gov (United States)

    El Ridi, Rashika; Tallima, Hatem; Dalton, John P.; Donnelly, Sheila

    2014-01-01

    Each year schistosomiasis afflicts up to 600 million people in 74 tropical and sub-tropical countries, predominantly in the developing world. Yet we depend on a single drug, praziquantel, for its treatment and control. There is no vaccine available but one is urgently needed especially since praziquantel-resistant parasites are likely to emerge at some time in the future. The disease is caused by several worm species of the genus Schistosoma. These express several classes of papain-like cysteine peptidases, cathepsins B and L, in various tissues but particularly in their gastrodermis where they employ them as digestive enzymes. We have shown that sub-cutaneous injection of recombinant and functionally active Schistosoma mansoni cathepsin B1 (SmCB1), or a cathepsin L from a related parasite Fasciola hepatica (FhCL1), elicits highly significant protection (up to 73%) against an experimental challenge worm infection in murine models of schistosomiasis. The immune modulating properties of this subcutaneous injection can boost protection levels (up to 83%) when combined with other S. mansoni vaccine candidates, glyceraldehyde 3-phosphate dehydrogenase (SG3PDH) and peroxiredoxin (PRX-MAP). Here, we discuss these data in the context of the parasite’s biology and development, and provide putative mechanism by which the native-like cysteine peptidase induce protective immune responses. PMID:24847355

  8. Differential proteins of the optic ganglion in octopus vulgaris under methanol stress revealed using proteomics.

    Science.gov (United States)

    Huang, Lin; Huang, Qing-Yu; Chen, Hai-Bin; Huang, Fu-Sheng; Huang, He-Qing

    2011-10-01

    An analytical approach using the two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) technique separated the proteome from the optic ganglia of Octopus vulgaris (OVOG). Approximately 600 protein spots were detected from the extraction when applying 150 μg protein to a 2D-PAGE gel in the pH range 5.0-8.0. Compared to the control, significant changes of 18 protein spots were observed in OVOG under the stress of native seawater containing 2% methanol for 72 h. Among these spots, we found that eight were down-regulated and ten were up-regulated in the gels, which were further identified using both peptide mass fingerprinting and database searches. Significant proteins such as glyceraldehyde-3-phosphate dehydrogenase, alpha subunit of succinyl-CoA synthetase, alcohol dehydrogenase, and long-chain specific acyl-CoA dehydrogenase were up-regulated proteins, whereas putative ABC transporter was a down -regulated protein. These differential proteins at the level of subcellular localization were further classified using LOCtree software with a hierarchical system of support vector machines. We found that most of the differential proteins in the gel could be identified as mitochondrial proteins, suggesting that these protective or marker proteins might help to prevent methanol poisoning via the mitochondria in the optical ganglia. The results indicated that both beta-tubulin and beta-actin were potential biomarkers as up-regulated proteins for monitoring methanol toxicosis associated with fish foods such as octopus and shark.

  9. A molecular analysis of the Gelechiidae (Lepidoptera, Gelechioidea) with an interpretative grouping of its taxa

    DEFF Research Database (Denmark)

    Karsholt, Ole; Mutanen, Marko; Lee, Sangmi

    2013-01-01

    We re-examine the higher level phylogeny and evolutionary affinities of the family Gelechiidae (Lepidoptera: Gelechioidea) based on DNA sequence data for one mitochondrial gene (cytochrome c oxidase subunit I ) and seven nuclear genes (Elongation Factor-1α, wingless, Ribosomal protein S5, Isocitr......We re-examine the higher level phylogeny and evolutionary affinities of the family Gelechiidae (Lepidoptera: Gelechioidea) based on DNA sequence data for one mitochondrial gene (cytochrome c oxidase subunit I ) and seven nuclear genes (Elongation Factor-1α, wingless, Ribosomal protein S5......, Isocitrate dehydrogenase, Cytosolic malate dehydrogenase, Glyceraldehyde-3-phosphate dehydrogenase and Carbamoylphosphate synthase domain protein). Fifty-two taxa representing nearly all established subfamilies and tribes of Gelechiidae, and about 10% of described gelechiid genera, in addition to five......, Palumbina Rondani and Polyhymno Chambers. Gelechiidae display a wide array of life-history strategies, but the diversity in patterns of larval mode of life has direct phylogenetic correlation only below subfamily level, suggesting multiple origins and/or frequent reversals for traits such as external...

  10. Omigapil ameliorates the pathology of muscle dystrophy caused by laminin-alpha2 deficiency.

    Science.gov (United States)

    Erb, Michael; Meinen, Sarina; Barzaghi, Patrizia; Sumanovski, Lazar T; Courdier-Früh, Isabelle; Rüegg, Markus A; Meier, Thomas

    2009-12-01

    Laminin alpha2-deficient congenital muscular dystrophy, called MDC1A, is a rare, devastating genetic disease characterized by severe neonatal hypotonia ("floppy infant syndrome"), peripheral neuropathy, inability to stand or walk, respiratory distress, and premature death in early life. Transgenic overexpression of the apoptosis inhibitor protein BCL-2, or deletion of the proapoptotic Bax gene in a mouse model for MDC1A prolongs survival and mitigates pathology, indicating that apoptotic events are involved in the pathology. Here we demonstrate that the proapoptotic glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-Siah1-CBP/p300-p53 pathway is activated in a mouse model for MDC1A. Moreover, we show that omigapil, which inhibits GAPDH-Siah1-mediated apoptosis, ameliorates several pathological hallmarks in the MDC1A mouse model. Specifically, we demonstrate that treatment with omigapil inhibits apoptosis in muscle, reduces body weight loss and skeletal deformation, increases locomotive activity, and protects from early mortality. These data qualify omigapil, which is in late phase of clinical development for human use, as a drug candidate for the treatment of MDC1A.

  11. GAPDH--a recruits a plant virus movement protein to cortical virus replication complexes to facilitate viral cell-to-cell movement.

    Directory of Open Access Journals (Sweden)

    Masanori Kaido

    2014-11-01

    Full Text Available The formation of virus movement protein (MP-containing punctate structures on the cortical endoplasmic reticulum is required for efficient intercellular movement of Red clover necrotic mosaic virus (RCNMV, a bipartite positive-strand RNA plant virus. We found that these cortical punctate structures constitute a viral replication complex (VRC in addition to the previously reported aggregate structures that formed adjacent to the nucleus. We identified host proteins that interacted with RCNMV MP in virus-infected Nicotiana benthamiana leaves using a tandem affinity purification method followed by mass spectrometry. One of these host proteins was glyceraldehyde 3-phosphate dehydrogenase-A (NbGAPDH-A, which is a component of the Calvin-Benson cycle in chloroplasts. Virus-induced gene silencing of NbGAPDH-A reduced RCNMV multiplication in the inoculated leaves, but not in the single cells, thereby suggesting that GAPDH-A plays a positive role in cell-to-cell movement of RCNMV. The fusion protein of NbGAPDH-A and green fluorescent protein localized exclusively to the chloroplasts. In the presence of RCNMV RNA1, however, the protein localized to the cortical VRC as well as the chloroplasts. Bimolecular fluorescence complementation assay and GST pulldown assay confirmed in vivo and in vitro interactions, respectively, between the MP and NbGAPDH-A. Furthermore, gene silencing of NbGAPDH-A inhibited MP localization to the cortical VRC. We discuss the possible roles of NbGAPDH-A in the RCNMV movement process.

  12. Electrically assisted delivery of macromolecules into the corneal epithelium.

    Science.gov (United States)

    Hao, Jinsong; Li, S Kevin; Liu, Chia-Yang; Kao, Winston W Y

    2009-12-01

    Electrically assisted delivery is noninvasive and has been investigated in a number of ocular drug delivery studies. The objectives of this study were to examine the feasibility of electrically assisted delivery of macromolecules such as small interfering RNA (siRNA) into the corneal epithelium, to optimize the iontophoresis and electroporation methods, and to study the mechanisms of corneal iontophoresis for macromolecules. Anodal and cathodal iontophoresis, electroporation and their combinations were the methods examined with mice in vivo. Cyanine 3 (Cy3)-labeled glyceraldehyde-3-phosphate dehydrogenase (GAPDH) siRNA and fluorescein isothiocyanate (FITC)-labeled dextran of different molecular weights (4-70 kDa) were the macromolecules studied. Microscopy and histology after cryostat sectioning were used to analyze and compare the delivery of the macromolecules to the cornea. Iontophoresis was effective in delivering siRNA and dextran up to 70 kDa into the cornea. The electroporation method studied was less effective than that of iontophoresis. Although both iontophoresis and electroporation alone can deliver the macromolecules into the cornea, these methods alone were not as effective as the combination of iontophoresis and electroporation (iontophoresis followed by electroporation). The significant enhancement of dextran delivery in anodal iontophoresis suggests that electroosmosis can be a significant flux-enhancing mechanism during corneal iontophoresis. These results illustrate the feasibility of electrically assisted delivery of macromolecules such as siRNA into the cornea.

  13. Effects of mutation of 2,3-butanediol formation pathway on glycerol metabolism and 1,3-propanediol production by Klebsiella pneumoniae J2B.

    Science.gov (United States)

    Kumar, Vinod; Durgapal, Meetu; Sankaranarayanan, Mugesh; Somasundar, Ashok; Rathnasingh, Chelladurai; Song, HyoHak; Seung, Doyoung; Park, Sunghoon

    2016-08-01

    The current study investigates the impact of mutation of 2,3-butanediol (BDO) formation pathway on glycerol metabolism and 1,3-propanediol (PDO) production by lactate dehydrogenase deficient mutant of Klebsiella pneumoniae J2B. To this end, BDO pathway genes, budA, budB, budC and budO (whole-bud operon), were deleted from K. pneumoniae J2B ΔldhA and the mutants were studied for glycerol metabolism and alcohols (PDO, BDO) production. ΔbudO-mutant-only could completely abolish BDO production, but with reductions in cell growth and PDO production. By modifying the culture medium, the ΔbudO mutant could recover its performance on the flask scale. However, in bioreactor experiments, the ΔbudO mutant accumulated a significant amount of pyruvate (>73mM) in the late phase and PDO production stopped concomitantly. Glycolytic intermediates of glycerol, especially glyceraldehyde-3-phosphate (G3P) was highly inhibitory to glycerol dehydratase (GDHt); its accumulation, followed by pyruvate accumulation, was assumed to be responsible for the ΔbudO mutant's low PDO production.

  14. Characterisation of Potential Antidiabetic-Related Proteins from Pleurotus pulmonarius (Fr. Quél. (Grey Oyster Mushroom by MALDI-TOF/TOF Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Nurul Azwa Abd. Wahab

    2014-01-01

    Full Text Available Pleurotus pulmonarius has been reported to have a potent remedial effect on diabetic property and considered to be an alternative for type 2 diabetes mellitus treatment. This study aimed to investigate the antidiabetic properties of ammonium sulphate precipitated protein fractions from P. pulmonarius basidiocarps. Preliminary results demonstrated that 30% (NH42SO4 precipitated fraction (F30 inhibited Saccharomyces cerevisiae α-glucosidase activity (24.18%, and 100% (NH42SO4 precipitated fraction (F100 inhibited porcine pancreatic α-amylase activity (41.80%. Following RP-HPLC purification, peak 3 from F30 fraction demonstrated inhibition towards α-glucosidase at the same time with meagre inhibition towards α-amylase activity. Characterisation of proteins using MALDI-TOF/TOF MS demonstrated the presence of four different proteins, which could be implicated in the regulation of blood glucose level via various mechanisms. Therefore, this study revealed the presence of four antidiabetic-related proteins which are profilin-like protein, glyceraldehyde-3-phosphate dehydrogenase-like protein, trehalose phosphorylase-like (TP-like protein, and catalase-like protein. Hence, P. pulmonarius basidiocarps have high potential in lowering blood glucose level, reducing insulin resistance and vascular complications.

  15. Overexpression of FOXO3, MYD88, and GAPDH Identified by Suppression Subtractive Hybridization in Esophageal Cancer Is Associated with Autophagy.

    Science.gov (United States)

    Soltany-Rezaee-Rad, Mohammad; Mottaghi-Dastjerdi, Negar; Setayesh, Neda; Roshandel, Gholamreza; Ebrahimifard, Farzaneh; Sepehrizadeh, Zargham

    2014-01-01

    To find genes involved in tumorigenesis and the development of esophageal cancer, the suppression subtractive hybridization (SSH) method was used to identify genes that are overexpressed in esophageal cancer tissues compared to normal esophageal tissues. In our SSH library, the forkhead box O3 (FOXO3), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and myeloid differentiation primary response 88 (MYD88) genes were the most highly upregulated genes, and they were selected for further studies because of their potential role in the induction of autophagy. Upregulation of these genes was also observed in clinical samples using qRT-PCR. In addition, coexpression analysis of the autophagy-related genes Beclin1, ATG12, Gabarapl, PIK3C3, and LC3 demonstrated a significant correlation between the differentially overexpressed genes and autophagy. Autophagy is an important mechanism in tumorigenesis and the development of chemoresistance in cancer cells. The upregulation of FOXO3, GAPDH, and MYD88 variants in esophageal cancer suggests a role for autophagy and provides new insight into the biology of esophageal cancer. We propose that FOXO3, GAPDH, and MYD88 are novel targets for combating autophagy in esophageal cancer.

  16. Overexpression of FOXO3, MYD88, and GAPDH Identified by Suppression Subtractive Hybridization in Esophageal Cancer Is Associated with Autophagy

    Directory of Open Access Journals (Sweden)

    Mohammad Soltany-Rezaee-Rad

    2014-01-01

    Full Text Available To find genes involved in tumorigenesis and the development of esophageal cancer, the suppression subtractive hybridization (SSH method was used to identify genes that are overexpressed in esophageal cancer tissues compared to normal esophageal tissues. In our SSH library, the forkhead box O3 (FOXO3, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, and myeloid differentiation primary response 88 (MYD88 genes were the most highly upregulated genes, and they were selected for further studies because of their potential role in the induction of autophagy. Upregulation of these genes was also observed in clinical samples using qRT-PCR. In addition, coexpression analysis of the autophagy-related genes Beclin1, ATG12, Gabarapl, PIK3C3, and LC3 demonstrated a significant correlation between the differentially overexpressed genes and autophagy. Autophagy is an important mechanism in tumorigenesis and the development of chemoresistance in cancer cells. The upregulation of FOXO3, GAPDH, and MYD88 variants in esophageal cancer suggests a role for autophagy and provides new insight into the biology of esophageal cancer. We propose that FOXO3, GAPDH, and MYD88 are novel targets for combating autophagy in esophageal cancer.

  17. [Evaluation of reference genes for quantitative real-time PCR normalization in cotton bollworm, Helicoverna armigera].

    Science.gov (United States)

    Chandra, G Sharath; Asokan, R; Manamohan, M; Kumar, N K K; Sita, T

    2014-01-01

    Reverse-transcription quantitative real-time PCR (RT-qPCR), a sensitive technique is being extensively employed in quantification of gene expression. However this requires normalization with suitable reference gene (RG) which is crucial in minimizing inter sample variations. Information regarding suitable RG is scarce in general and more so in insects, including the cotton bollworm, Helicoverpa armigera, an economically important pest. In management of this pest RNA interference (RNAi), is perceived as a potential tool, which is achieved by double-stranded RNA (dsRNA) delivery. These studies demand accurate quantification of gene silencing. In this study we assessed the suitability of five RGs viz. β-actin (ACTB), 18S rRNA (18S), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-tubulin (TUB) and elongation fator-1-alfa (EF1-α) for gene expression studies in dsRNA treatment and across different developmental stages of H. armigera and ranked using geNorm, NormFinder and BestKeeper software programs. Data analysis revealed that best ranked RGs were varied in dsRNA treatment and in developmental stages. Under dsRNA treatment, 18S and GAPDH were more stable whereas, TUB and GAPDH were more stable across developmental stages. We also demonstrate that inappropriate selection of RG led to erroneous estimation of the target gene, chymotrypsin, expression. These results facilitate accurate quantification of gene expression in H. armigera.

  18. Redox Sensitivities of Global Cellular Cysteine Residues under Reductive and Oxidative Stress.

    Science.gov (United States)

    Araki, Kazutaka; Kusano, Hidewo; Sasaki, Naoyuki; Tanaka, Riko; Hatta, Tomohisa; Fukui, Kazuhiko; Natsume, Tohru

    2016-08-01

    The protein cysteine residue is one of the amino acids most susceptible to oxidative modifications, frequently caused by oxidative stress. Several applications have enabled cysteine-targeted proteomics analysis with simultaneous detection and quantitation. In this study, we employed a quantitative approach using a set of iodoacetyl-based cysteine reactive isobaric tags (iodoTMT) and evaluated the transient cellular oxidation ratio of free and reversibly modified cysteine thiols under DTT and hydrogen peroxide (H2O2) treatments. DTT treatment (1 mM for 5 min) reduced most cysteine thiols, irrespective of their cellular localizations. It also caused some unique oxidative shifts, including for peroxiredoxin 2 (PRDX2), uroporphyrinogen decarboxylase (UROD), and thioredoxin (TXN), proteins reportedly affected by cellular reactive oxygen species production. Modest H2O2 treatment (50 μM for 5 min) did not cause global oxidations but instead had apparently reductive effects. Moreover, with H2O2, significant oxidative shifts were observed only in redox active proteins, like PRDX2, peroxiredoxin 1 (PRDX1), TXN, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Overall, our quantitative data illustrated both H2O2- and reduction-mediated cellular responses, whereby while redox homeostasis is maintained, highly reactive thiols can potentiate the specific, rapid cellular signaling to counteract acute redox stress.

  19. Production of extracellular biopolymers and identification of intracellular proteins and Rhizobium tropici.

    Science.gov (United States)

    Oliveira, José; Figueiredo, Marcia; Silva, Marcia; Malta, Marília; Vendruscolo, Claire; Almeida, Hélio

    2012-12-01

    The objective of this study was to identify species of rhizobia (from the IPA 403 and IPA 49 isolates), to assess the physico-chemical characteristics of the biopolymers produced by these rhizobia and to determine the soluble intracellular proteins that are present in these rhizobia. The polysaccharides containing acetyl and pyruvic acid groups that were produced by different strains that had been cultivated in yeast extract mannitol (YEM) medium for 132, 144, and 168 h were evaluated for yield, viscosity, and concentration. Based on the analysis of their partial 16S rDNA sequences, both isolates were identified as Rhizobium tropici. The polymers produced in liquid YEM medium were recovered, dried and weighed to determine culture yield. Soluble intracellular proteins were identified through the techniques of 2D-PAGE and mass spectrometry for cultures that were cultivated for 168 h. The largest biopolymer yield and the highest viscosity and concentration of acetyl and pyruvic acids were obtained from the IPA 403 isolate after 168 h of culture. The proteins that were identified for the CIAT 899 isolate included elongation factor TU, a chaperone; GroE/GroEs and a putative glycosyltransferase, all of which catalyze the production of polysaccharides. For the IPA 403 strain, dinitrogenase and nitrogenase iron proteins were found. In the IPA 49 strain, glyceraldehyde-3-phosphate dehydrogenase was found along with two other proteins, the beta subunit of an electron-transferring flavoprotein and a dehydrogenase.

  20. Myeloperoxidase catalyzes the conjugation of serotonin to thiols via free radicals and tryptamine-4,5-dione.

    Science.gov (United States)

    Kato, Yoji; Peskin, Alexander V; Dickerhof, Nina; Harwood, D Tim; Kettle, Anthony J

    2012-11-19

    Serotonin (5-hydroxytryptamine; 5HT) is a favorable substrate for myeloperoxidase and is likely to be oxidized by this heme enzyme during inflammation. In this study, we have investigated how serotonin becomes conjugated to amino acid residues and proteins when it is oxidized by myeloperoxidase. 5HT formed three adducts with N-acetylcysteine (NAC) when it was incubated with myeloperoxidase, xanthine oxidase, and acetaldehyde. One of the adducts was identified as 5HT-NAC, and the others were conjugates of NAC and tryptamine-4,5-dione (TD). There was no evidence for coupling of oxidized serotonin to amine residues. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was exposed to 5HT with the enzymatic system or synthetic TD. Both caused a loss of thiols on GAPDH and covalent attachment of quinones derived from TD to the protein. Biotin-labeled 5HT was used instead of 5HT to confirm the conjugation of 5HT to GAPDH. It was incorporated into the GAPDH when oxidized by myeloperoxidase. Analysis of tryptic peptides of human GAPDH by liquid chromatography with mass spectrometry revealed that an adduct of TD was formed with the peptide containing Cys(152) and Cys(156). Our results indicate that myeloperoxidase can oxidize serotonin to species that form adducts with low molecular weight thiols and cysteine residues in proteins. Low molecular weight conjugates will redox cycle and fuel oxidative stress. Conjugation of serotonin to proteins will affect their function and may provide useful biomarkers of serotonin oxidation during inflammatory events.

  1. Inhibition of NF-kB 1 (NF-kBp50 by RNA interference in chicken macrophage HD11 cell line challenged with Salmonella enteritidis

    Directory of Open Access Journals (Sweden)

    Hsin-I Chiang

    2009-01-01

    Full Text Available The NF-kB pathway plays an important role in regulating the immunity response in animals. In this study, small interfering RNAs (siRNA were used to specifically inhibit NF-kB 1 expression and to elucidate the role of NF-kB in the signal transduction pathway of the Salmonella challenge in the chicken HD11 cell line. The cells were transfected with either NF-kB 1 siRNA, glyceraldehyde 3-phosphate dehydrogenase siRNA (positive control or the negative control siRNA for 24 h, followed by Salmonella enteritidis (SE challenge or non-challenge for 1 h and 4 h. Eight candidate genes related to the signal pathway of SE challenge were selected to examine the effect of NF-kB 1 inhibition on their expressions by mRNA quantification. The results showed that, with a 36% inhibition of NF-kB 1 expression, gene expression of both Toll-like receptor (TLR 4 and interleukin (IL-6 was consistently and significantly increased at both 1 h and 4 h following SE challenge, whereas the gene expression of MyD88 and IL-1β was increased at 1 h and 4 h, respectively. These findings suggest a likely inhibitory regulation by NF-kB 1, and could lay the foundation for studying the gene network of the innate immune response of SE infection in chickens.

  2. A Microchip for Integrated Single-Cell Gene Expression Profiling and Genotoxicity Detection

    Directory of Open Access Journals (Sweden)

    Hui Dong

    2016-09-01

    Full Text Available Microfluidics-based single-cell study is an emerging approach in personalized treatment or precision medicine studies. Single-cell gene expression holds a potential to provide treatment selections with maximized efficacy to help cancer patients based on a genetic understanding of their disease. This work presents a multi-layer microchip for single-cell multiplexed gene expression profiling and genotoxicity detection. Treated by three drug reagents (i.e., methyl methanesulfonate, docetaxel and colchicine with varied concentrations and time lengths, individual human cancer cells (MDA-MB-231 are lysed on-chip, and the released mRNA templates are captured and reversely transcribed into single strand DNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, cyclin-dependent kinase inhibitor 1A (CDKN1A, and aurora kinase A (AURKA genes from single cells are amplified and real-time quantified through multiplex polymerase chain reaction. The microchip is capable of integrating all steps of single-cell multiplexed gene expression profiling, and providing precision detection of drug induced genotoxic stress. Throughput has been set to be 18, and can be further increased following the same approach. Numerical simulation of on-chip single cell trapping and heat transfer has been employed to evaluate the chip design and operation.

  3. Comparative sequence analysis of CP12, a small protein involved in the formation of a Calvin cycle complex in photosynthetic organisms.

    Science.gov (United States)

    Groben, René; Kaloudas, Dimitrios; Raines, Christine A; Offmann, Bernard; Maberly, Stephen C; Gontero, Brigitte

    2010-03-01

    CP12, a small intrinsically unstructured protein, plays an important role in the regulation of the Calvin cycle by forming a complex with phosphoribulokinase (PRK) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). An extensive search in databases revealed 129 protein sequences from, higher plants, mosses and liverworts, different groups of eukaryotic algae and cyanobacteria. CP12 was identified throughout the Plantae, apart from in the Prasinophyceae. Within the Chromalveolata, two putative CP12 proteins have been found in the genomes of the diatom Thalassiosira pseudonana and the haptophyte Emiliania huxleyi, but specific searches in further chromalveolate genomes or EST datasets did not reveal any CP12 sequences in other Prymnesiophyceae, Dinophyceae or Pelagophyceae. A species from the Euglenophyceae within the Excavata also appeared to lack CP12. Phylogenetic analysis showed a clear separation into a number of higher taxonomic clades and among different forms of CP12 in higher plants. Cyanobacteria, Chlorophyceae, Rhodophyta and Glaucophyceae, Bryophyta, and the CP12-3 forms in higher plants all form separate clades. The degree of disorder of CP12 was higher in higher plants than in the eukaryotic algae and cyanobacteria apart from the green algal class Mesostigmatophyceae, which is ancestral to the streptophytes. This suggests that CP12 has evolved to become more flexible and possibly take on more general roles. Different features of the CP12 sequences in the different taxonomic groups and their potential functions and interactions in the Calvin cycle are discussed.

  4. Isolation and compositional analysis of a CP12-associated complex of calvin cycle enzymes from Nicotiana tabacum.

    Science.gov (United States)

    Carmo-Silva, A Elizabete; Marri, Lucia; Sparla, Francesca; Salvucci, Michael E

    2011-06-01

    Two Calvin Cycle enzymes, NAD(P)-dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) form a multiprotein complex with CP12, a small intrinsically-unstructured protein. Under oxidizing conditions, association with CP12 confers redox-sensitivity to the otherwise redox-insensitive A isoform of GAPDH (GapA) and provides an additional level of down-regulation to the redox-regulated PRK. To determine if CP12-mediated regulation is specific for GAPDH and PRK in vivo, a high molecular weight complex containing CP12 was isolated from tobacco chloroplasts and leaves and its protein composition was characterized. Gel electrophoresis and immunoblot analyses after separation of stromal proteins by size fractionation verified that the GAPDH (both isoforms) and PRK co-migrated with CP12 in dark- but not light-adapted chloroplasts. Nano-liquid-chromatography-mass-spectrometry of the isolated complex identified only CP12, GAPDH and PRK. Since nearly all of the CP12 from darkened chloroplasts migrates with GADPH and PRK as a high molecular mass species, these data indicate that the tight association of tobacco CP12 with GAPDH and PRK is specific and involves no other Calvin Cycle enzymes.

  5. The Calvin cycle inevitably produces sugar-derived reactive carbonyl methylglyoxal during photosynthesis: a potential cause of plant diabetes.

    Science.gov (United States)

    Takagi, Daisuke; Inoue, Hironori; Odawara, Mizue; Shimakawa, Ginga; Miyake, Chikahiro

    2014-02-01

    Sugar-derived reactive carbonyls (RCs), including methylglyoxal (MG), are aggressive by-products of oxidative stress known to impair the functions of multiple proteins. These advanced glycation end-products accumulate in patients with diabetes mellitus and cause major complications, including arteriosclerosis and cardiac insufficiency. In the glycolytic pathway, the equilibration reactions between dihydroxyacetone phosphate and glyceraldehyde 3-phosphate (GAP) have recently been shown to generate MG as a by-product. Because plants produce vast amounts of sugars and support the same reaction in the Calvin cycle, we hypothesized that MG also accumulates in chloroplasts. Incubating isolated chloroplasts with excess 3-phosphoglycerate (3-PGA) as the GAP precursor drove the equilibration reaction toward MG production. The rate of oxygen (O2) evolution was used as an index of 3-PGA-mediated photosynthesis. The 3-PGA- and time-dependent accumulation of MG in chloroplasts was confirmed by HPLC. In addition, MG production increased with an increase in light intensity. We also observed a positive linear relationship between the rates of MG production and O2 evolution (R = 0.88; P Calvin cycle and that sugar-derived RC production is inevitable during photosynthesis. Furthermore, we found that MG production is enhanced under high-CO2 conditions in illuminated wheat leaves.

  6. Phosphoribulokinase from Chlamydomonas reinhardtii: a Benson-Calvin cycle enzyme enslaved to its cysteine residues.

    Science.gov (United States)

    Thieulin-Pardo, Gabriel; Remy, Thérèse; Lignon, Sabrina; Lebrun, Régine; Gontero, Brigitte

    2015-04-01

    Phosphoribulokinase (PRK) in the green alga Chlamydomonas reinhardtii is a finely regulated and well-studied enzyme of the Benson-Calvin cycle. PRK can form a complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and the small chloroplast protein CP12. This study aimed to determine the molecular determinants on PRK involved in the complex and the mechanism of action of a recently described novel regulation of PRK that involves glutathionylation. A combination of mass spectrometry, mutagenesis and activity analyses showed that Cys16, besides its role as the binding site of ATP, was also the site for S-glutathionylation. Previous kinetic analysis of the C55S mutant showed that in the oxidized inactive form of PRK, this residue formed a disulfide bridge with the Cys16 residue. This is the only bridge reported for PRK in the literature. Our data show for the first time that a disulfide bridge between Cys243 and Cys249 on PRK is required to form the PRK-GAPDH-CP12 complex. These results uncover a new mechanism for the PRK-GAPDH-CP12 formation involving a thiol disulfide exchange reaction with CP12 and identify Cys16 of PRK as a target of glutathionylation acting against oxidative stress. Although Cys16 is the key residue involved in binding ATP and acting as a defense against oxidative damage, the formation of the algal ternary complex requires the formation of another disulfide bridge on PRK involving Cys243 and Cys249.

  7. Immunoelectron microscopy for locating calvin cycle enzymes in the thylakoids of synechocystis 6803.

    Science.gov (United States)

    Agarwal, Rachna; Ortleb, Stefan; Sainis, Jayashree Krishna; Melzer, Michael

    2009-01-01

    Unicellular cyanobacteria Synechocystis 6803 were fixed using high-pressure freezing (HPF) and freeze substitution without any chemical cross-linkers. Immunoelectron microscopy of these cells showed that five sequential enzymes of the Calvin cycle (phosphoriboisomerase, phosphoribulokinase, ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO), 3-phosphoglyceratekinase and glyceraldehyde-3-phosphate dehydrogenase) and the catalytic portion of the chloroplast H+-ATP synthase (CF1) are located adjacent to the thylakoid membranes. Cell-free extracts of Synechocystis were processed by ultracentrifugation to isolate thylakoid fractions sedimenting at 40,000, 90,000, and 150,000 g. Among these, the 150,000-g fraction showed the highest linked activity of the above five sequential Calvin cycle enzymes and also the highest coordinated activity of light and dark reactions as assessed by ribose-5-phosphate (R-5-P) +ADP dependent CO2 fixation. Immunogold labeling of this membrane fraction confirmed the presence of the above five enzymes as well as the catalytic portion of the CF1 ATP synthase. Notably, the protein A-gold labeling of the thylakoids was observed without use of chemical cross-linkers and in spite of the normal washing steps used during standard immunolabeling. The results showed that soluble Calvin cycle enzymes might be organized along the thylakoid membranes.

  8. CP12-mediated protection of Calvin-Benson cycle enzymes from oxidative stress.

    Science.gov (United States)

    Marri, Lucia; Thieulin-Pardo, Gabriel; Lebrun, Régine; Puppo, Rémy; Zaffagnini, Mirko; Trost, Paolo; Gontero, Brigitte; Sparla, Francesca

    2014-02-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) are two energy-consuming enzymes of the Calvin-Benson cycle, whose regulation is crucial for the global balance of the photosynthetic process under different environmental conditions. In oxygen phototrophs, GAPDH and PRK regulation involves the redox-sensitive protein CP12. In the dark, oxidized chloroplast thioredoxins trigger the formation of a GAPDH/CP12/PRK complex in which both enzyme activities are down-regulated. In this report, we show that free GAPDH (A4-isoform) and PRK are also inhibited by oxidants like H2O2, GSSG and GSNO. Both in the land plant Arabidopsis thaliana and in the green microalga Chlamydomonas reinhardtii, both enzymes can be glutathionylated as shown by biotinylated-GSSG assay and MALDI-ToF mass spectrometry. CP12 is not glutathionylated but homodisulfides are formed upon oxidant treatments. In Arabidopsis but not in Chlamydomonas, the interaction between oxidized CP12 and GAPDH provides full protection from oxidative damage. In both organisms, preformed GAPDH/CP12/PRK complexes are protected from GSSG or GSNO oxidation, and in Arabidopsis also from H2O2 treatment. Overall, the results suggest that the role of CP12 in oxygen phototrophs needs to be extended beyond light/dark regulation, and include protection of enzymes belonging to Calvin-Benson cycle from oxidative stress.

  9. Hierarchy in pentose sugar metabolism in Clostridium acetobutylicum.

    Science.gov (United States)

    Aristilde, Ludmilla; Lewis, Ian A; Park, Junyoung O; Rabinowitz, Joshua D

    2015-02-01

    Bacterial metabolism of polysaccharides from plant detritus into acids and solvents is an essential component of the terrestrial carbon cycle. Understanding the underlying metabolic pathways can also contribute to improved production of biofuels. Using a metabolomics approach involving liquid chromatography-mass spectrometry, we investigated the metabolism of mixtures of the cellulosic hexose sugar (glucose) and hemicellulosic pentose sugars (xylose and arabinose) in the anaerobic soil bacterium Clostridium acetobutylicum. Simultaneous feeding of stable isotope-labeled glucose and unlabeled xylose or arabinose revealed that,as expected, glucose was preferentially used as the carbon source. Assimilated pentose sugars accumulated in pentose phosphate pathway (PPP) intermediates with minimal flux into glycolysis. Simultaneous feeding of xylose and arabinose revealed an unexpected hierarchy among the pentose sugars, with arabinose utilized preferentially over xylose. The phosphoketolase pathway (PKP) provides an alternative route of pentose catabolism in C. acetobutylicum that directly converts xylulose-5-phosphate into acetyl-phosphate and glyceraldehyde-3-phosphate, bypassing most of the PPP. When feeding the mixture of pentose sugars, the labeling patterns of lower glycolytic intermediates indicated more flux through the PKP than through the PPP and upper glycolysis, and this was confirmed by quantitative flux modeling. Consistent with direct acetyl-phosphate production from the PKP, growth on the pentose mixture resulted in enhanced acetate excretion. Taken collectively, these findings reveal two hierarchies in clostridial pentose metabolism: xylose is subordinate to arabinose, and the PPP is used less than the PKP.

  10. Inhibition of lactate production in rat brain extracts and synaptosomes by 3-[4-(reduced 3-pyridine aldehyde-adenine dinucleotide)]-pyruvate.

    Science.gov (United States)

    Cooper, A J; Lai, J C; Coleman, A E; Pulsinelli, W A

    1987-06-01

    In basic solutions, pyruvate enolizes and reacts (through its 3-carbon) with the 4-carbon of the nicotinamide ring of NAD+, yielding an NAD-pyruvate adduct in which the nicotinamide ring is in the reduced form. This adduct is a strong inhibitor of lactate dehydrogenase, presumably because it binds simultaneously to the NADH and pyruvate sites. The potency of the inhibition, however, is muted by the adduct's tendency to cyclize to a lactam. We prepared solutions of the pyruvate adduct of NAD+ and of NAD+ analogues in which the -C(O)NH2 of NAD+ was replaced with -C(S)NH2, -C(O)CH3, and -C(O)H. Of the four, only the last analogue, 3-[4-(reduced 3-pyridine aldehyde-adenine dinucleotide)]-pyruvate (RAP) cannot cyclize and it was found to be the most potent inhibitor of beef heart and rat brain lactate dehydrogenases. The inhibitor binds very tightly to the NADH site (Ki approximately 1 nM for the A form). Even at high concentrations (20 microM), RAP had little or no effect on rat brain glyceraldehyde-3-phosphate, pyruvate, alpha-ketoglutarate, isocitrate, soluble and mitochondrial malate, and glutamate dehydrogenases. The glycolytic enzymes, hexokinase and phosphofructokinase, were similarly unaffected. RAP strongly inhibited lactate production from glucose in rat brain extracts but was less effective in inhibiting lactate production from glucose in synaptosomes.

  11. UCP2 inhibition triggers ROS-dependent nuclear translocation of GAPDH and autophagic cell death in pancreatic adenocarcinoma cells.

    Science.gov (United States)

    Dando, Ilaria; Fiorini, Claudia; Pozza, Elisa Dalla; Padroni, Chiara; Costanzo, Chiara; Palmieri, Marta; Donadelli, Massimo

    2013-03-01

    Mitochondrial uncoupling protein 2 (UCP2) can moderate oxidative stress by favoring the influx of protons into the mitochondrial matrix, thus reducing electron leakage from respiratory chain and mitochondrial superoxide production. Here, we demonstrate that UCP2 inhibition by genipin or UCP2 siRNA strongly increases reactive oxygen species (ROS) production inhibiting pancreatic adenocarcinoma cell growth. We also show that UCP2 inhibition triggers ROS-dependent nuclear translocation of the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH), formation of autophagosomes, and the expression of the autophagy marker LC3-II. Consistently, UCP2 over-expression significantly reduces basal autophagy confirming the anti-autophagic role of UCP2. Furthermore, we demonstrate that autophagy induced by UCP2 inhibition determines a ROS-dependent cell death, as indicated by the apoptosis decrease in the presence of the autophagy inhibitors chloroquine (CQ) or 3-methyladenine (3-MA), or the radical scavenger NAC. Intriguingly, the autophagy induced by genipin is able to potentiate the autophagic cell death triggered by gemcitabine, the standard chemotherapeutic drug for pancreatic adenocarcinoma, supporting the development of an anti-cancer therapy based on UCP2 inhibition associated to standard chemotherapy. Our results demonstrate for the first time that UCP2 plays a role in autophagy regulation bringing new insights into mitochondrial uncoupling protein field.

  12. Talaromyces marneffei Genomic, Transcriptomic, Proteomic and Metabolomic Studies Reveal Mechanisms for Environmental Adaptations and Virulence

    Directory of Open Access Journals (Sweden)

    Susanna K. P. Lau

    2017-06-01

    Full Text Available Talaromyces marneffei is a thermally dimorphic fungus causing systemic infections in patients positive for HIV or other immunocompromised statuses. Analysis of its ~28.9 Mb draft genome and additional transcriptomic, proteomic and metabolomic studies revealed mechanisms for environmental adaptations and virulence. Meiotic genes and genes for pheromone receptors, enzymes which process pheromones, and proteins involved in pheromone response pathway are present, indicating its possibility as a heterothallic fungus. Among the 14 Mp1p homologs, only Mp1p is a virulence factor binding a variety of host proteins, fatty acids and lipids. There are 23 polyketide synthase genes, one for melanin and two for mitorubrinic acid/mitorubrinol biosynthesis, which are virulence factors. Another polyketide synthase is for biogenesis of the diffusible red pigment, which consists of amino acid conjugates of monascorubin and rubropunctatin. Novel microRNA-like RNAs (milRNAs and processing proteins are present. The dicer protein, dcl-2, is required for biogenesis of two milRNAs, PM-milR-M1 and PM-milR-M2, which are more highly expressed in hyphal cells. Comparative transcriptomics showed that tandem repeat-containing genes were overexpressed in yeast phase, generating protein polymorphism among cells, evading host’s immunity. Comparative proteomics between yeast and hyphal cells revealed that glyceraldehyde-3-phosphate dehydrogenase, up-regulated in hyphal cells, is an adhesion factor for conidial attachment.

  13. Myofibroblast Upregulators are Elevated in Joint Capsules in Posttraumatic Contractures

    Science.gov (United States)

    Hildebrand, Kevin A.; Zhang, Mei; Hart, David A.

    2010-01-01

    We hypothesized specific growth factors are increased in the elbow capsules of patients with post traumatic elbow contractures. A model of surgically induced joint contracture in rabbit knees was developed to study the growth factor expression in joint contractures. This study demonstrates this model mimics the human condition and analyzes how the growth factor levels decrease with time in rabbit knees with contractures. Reverse transcription polymerase chain reaction was used to measure mRNA levels of transforming growth factor-β1, connective tissue growth factor, ED-A of fibronectin, and α-smooth muscle actin normalized to a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase. In the joint capsules of patients with elbow contractures, mRNA levels were increased for transforming growth factor- β1, connective tissue growth factor, and α-smooth muscle actin. In the joint capsules of rabbit knees with contractures, mRNA levels were increased for transforming growth factor- β1, connective tissue growth factor, ED-A of fibronectin, and α-smooth muscle actin. The mRNA levels for transforming growth factor-β1, connective tissue growth factor, and α-smooth muscle actin decreased with time in rabbit knees. The elevated levels of these myofibroblast up-regulators and fibrogenic growth factors could explain the previously reported increase in myofibroblasts and collagen mRNA levels. The rabbit knee model correlated well with the human post traumatic elbow contractures. PMID:17195814

  14. Development of an expression plasmid and its use in genetic manipulation of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Yu, Xuya; Ji, Sen-Lin; He, Yi-Long; Ren, Meng-Fei; Xu, Jun-Wei

    2014-01-01

    We report the construction of a plasmid, pJW-EXP, designed for the expression of homologous and heterologous genes in Ganoderma lucidum. pJW-EXP was generated from the plasmid pMD19-T by inserting the G. lucidum glyceraldehyde-3-phosphate dehydrogenase gene promoter, the G. lucidum iron-sulfur protein subunit of succinate dehydrogenase gene terminator and the homologous carboxin-resistance gene as selection marker. This expression plasmid can be efficiently transformed into Ganoderma through polyethylene glycol-mediated protoplast transformation. Southern blot analysis showed that most of the integrated DNA appeared as multiple copies in the genome. The applicability of the constructed plasmid was tested by expression of the truncated G. lucidum 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene that encodes the catalytic domain of HMGR. Overexpression of the truncated HMGR gene, which is a key gene in the biosynthetic pathway of the antitumor compounds, ganoderic acids, increased the transcription of the HMGR gene and enhanced ganoderic acid accumulation. pJW-EXP can serve as a useful tool in the genetic improvement and metabolic engineering of Ganoderma.

  15. Evaluation of ST13 gene expression in colorectal cancer patients

    Institute of Scientific and Technical Information of China (English)

    DONG Qing-hua; ZHENG Shu; HU Yue; CHEN Gong-xing; DING Jia-yi

    2005-01-01

    We identified a novel gene ST13 from a subtractive cDNA library of normal intestinal mucosa in 1993, more studies showed that ST13 was a co-chaperone of Hsp70s. Recently we detected the ST13 gene expression in tumor tissue and adjacent normal tissue of the same colorectal cancer patient and investigated ifthe ST13 gene expression might have any prognostic value.Analysis was performed at molecular level by reverse transcfiption-PCR using real-time detection method. We measured two genes simultaneously, ST13 as the target gene and glyceraldehydes-3-phosphate dehydrogenase as a reference gene, in primary colorectal tumor specimens and tumor-adjacent normal mucosa specimens from 50 colorectal cancer patients. The expression levels of the ST13 gene were significantly decreased in primary tumors compared with adjacent mucosa (P<0.05). But there were no significant differences in the expression of ST13 as compared with different Dukes' stage, tumor differentiation grade, invasion depth, lymph node metastasis and disease-specific survival.

  16. Short-term exposure of nontumorigenic human bronchial epithelial cells to carcinogenic chromium(VI) compromises their respiratory capacity and alters their bioenergetic signature.

    Science.gov (United States)

    Cerveira, Joana F; Sánchez-Aragó, María; Urbano, Ana M; Cuezva, José M

    2014-01-01

    Previous studies on the impact of hexavalent chromium [Cr(VI)] on mammalian cell energetics revealed alterations suggestive of a shift to a more fermentative metabolism. Aiming at a more defined understanding of the metabolic effects of Cr(VI) and of their molecular basis, we assessed the impact of a mild Cr(VI) exposure on critical bioenergetic parameters (lactate production, oxygen consumption and intracellular ATP levels). Cells derived from normal human bronchial epithelium (BEAS-2B cell line), the main in vivo target of Cr(VI) carcinogenicity, were subjected for 48 h to 1 μM Cr(VI). We could confirm a shift to a more fermentative metabolism, resulting from the simultaneous inhibition of respiration and stimulation of glycolysis. This shift was accompanied by a decrease in the protein levels of the catalytic subunit (subunit β) of the mitochondrial H(+)-ATP synthase (β-F1-ATPase) and a concomitant marked increase in those of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The corresponding alteration in the β-F1-ATPase/GAPDH protein ratio (viewed as a bioenergetic signature) upon Cr(VI) exposure was in agreement with the observed attenuation of cellular respiration and enhancement of glycolytic flux. Altogether, these results constitute a novel finding in terms of the molecular mechanisms of Cr(VI) effects.

  17. Short-term exposure of nontumorigenic human bronchial epithelial cells to carcinogenic chromium(VI compromises their respiratory capacity and alters their bioenergetic signature

    Directory of Open Access Journals (Sweden)

    Joana F. Cerveira

    2014-01-01

    Full Text Available Previous studies on the impact of hexavalent chromium [Cr(VI] on mammalian cell energetics revealed alterations suggestive of a shift to a more fermentative metabolism. Aiming at a more defined understanding of the metabolic effects of Cr(VI and of their molecular basis, we assessed the impact of a mild Cr(VI exposure on critical bioenergetic parameters (lactate production, oxygen consumption and intracellular ATP levels. Cells derived from normal human bronchial epithelium (BEAS-2B cell line, the main in vivo target of Cr(VI carcinogenicity, were subjected for 48 h to 1 μM Cr(VI. We could confirm a shift to a more fermentative metabolism, resulting from the simultaneous inhibition of respiration and stimulation of glycolysis. This shift was accompanied by a decrease in the protein levels of the catalytic subunit (subunit β of the mitochondrial H+-ATP synthase (β-F1-ATPase and a concomitant marked increase in those of glyceraldehyde-3-phosphate dehydrogenase (GAPDH. The corresponding alteration in the β-F1-ATPase/GAPDH protein ratio (viewed as a bioenergetic signature upon Cr(VI exposure was in agreement with the observed attenuation of cellular respiration and enhancement of glycolytic flux. Altogether, these results constitute a novel finding in terms of the molecular mechanisms of Cr(VI effects.

  18. Sida rhomboidea. Roxb leaf extract down-regulates expression of PPARγ2 and leptin genes in high fat diet fed C57BL/6J Mice and retards in vitro 3T3L1 pre-adipocyte differentiation.

    Science.gov (United States)

    Thounaojam, Menaka C; Jadeja, Ravirajsinh N; Ramani, Umed V; Devkar, Ranjitsinh V; Ramachandran, A V

    2011-01-01

    Sida rhomboidea. Roxb leaf extract (SRLE) is being used by the populace of North-East India to alleviate symptoms of diabetes and obesity. We have previously reported its hypolipidemic and anti-diabetic properties. In this study, we report the effect of SRLE on (i) in vivo modulation of genes controlling high fat diet (HFD) induced obesity and (ii) in vitro 3T3L1 pre-adipocyte differentiation and leptin release. Supplementation with SRLE significantly prevented HFD induced increment in bodyweight, plasma lipids and leptin, visceral adiposity and adipocyte hypertrophy. Also, SRLE supplementation reduced food intake, down regulated PPARγ2, SREBP1c, FAS and LEP expressions and up-regulated CPT-1 in epididymal adipose tissue compared to obese mice. In vitro adipogenesis of 3T3L1 pre-adipocytes was significantly retarded in the presence of SRLE extract. Also decreased triglyceride accumulation, leptin release and glyceraldehyde-3-Phosphate dehydrogenase activity along with higher glycerol release without significant alteration of viability of 3T3L1 pre-adipocytes, was recorded. Our findings suggest that prevention of HFD induced visceral adiposity is primarily by down regulation of PPARγ2 and leptin gene expression coupled with attenuation of food intake in C57BL/6J mice. SRLE induced prevention of pre-adipocytes differentiation, and leptin release further substantiated these findings and scientifically validates the potential application of SRLE as a therapeutic agent against obesity.

  19. Proteomic and transcriptional analysis of interaction between oral microbiota Porphyromonas gingivalis and Streptococcus oralis.

    Science.gov (United States)

    Maeda, Kazuhiko; Nagata, Hideki; Ojima, Miki; Amano, Atsuo

    2015-01-01

    Porphyromonas gingivalis, a major periodontal pathogen, forms biofilm with other oral bacteria such as streptococci. Here, by using shotgun proteomics, we examined the molecular basis of mixed-biofilm formation by P. gingivalis with Streptococcus oralis. We identified a total of 593 bacterial proteins in the biofilm. Compared to the expression profile in the P. gingivalis monobiofilm, the expression of three proteins was induced and that of 31 proteins was suppressed in the mixed biofilm. Additionally, the expression of two S. oralis proteins was increased, while that of two proteins was decreased in the mixed biofilm, as compared to its monotypic profile. mRNA expression analysis of selected genes using a quantitative reverse transcription polymerase chain reaction confirmed the proteomics data, which included overexpression of P. gingivalis FimA and S. oralis glyceraldehyde-3-phosphate dehydrogenase in association with the biofilm. The results also indicated that S. oralis regulates the transcriptional activity of P. gingivalis luxS to influence autoinducer-2-dependent signaling. These findings suggest that several functional molecules are involved in biofilm formation between P. gingivalis and S. oralis.

  20. Analysis of the acute response of Galleria mellonella larvae to potassium nitrate.

    Science.gov (United States)

    Maguire, Ronan; Kunc, Martin; Hyrsl, Pavel; Kavanagh, Kevin

    2017-02-20

    Potassium nitrate (E252) is widely used as a food preservative and has applications in the treatment of high blood pressure however high doses are carcinogenic. Larvae of Galleria mellonella were administered potassium nitrate to establish whether the acute effects in larvae correlated with those evident in mammals. Intra-haemocoel injection of potassium nitrate resulted in a significant increase in the density of circulating haemocytes and a small change in the relative proportions of haemocytes but haemocytes showed a reduced fungicidal ability. Potassium nitrate administration resulted in increased superoxide dismutase activity and in the abundance of a range of proteins associated with mitochondrial function (e.g. mitochondrial aldehyde dehydrogenase, putative mitochondrial Mn superoxide dismutase), metabolism (e.g. triosephosphate isomerase, glyceraldehyde 3 phosphate dehydrogenase) and nitrate metabolism (e.g. aliphatic nitrilase, glutathione S-transferase). A strong correlation exists between the toxicity of a range of food preservatives when tested in G. mellonella larvae and rats. In this work a correlation between the effect of potassium nitrate in larvae and mammals is shown and opens the way to the utilization of insects for studying the in vivo acute and chronic toxicity of xenobiotics.

  1. Distribution and phylogenies of enzymes of the Embden-Meyerhof-Parnas pathway from archaea and hyperthermophilic bacteria support a gluconeogenic origin of metabolism.

    Science.gov (United States)

    Ronimus, Ron S; Morgan, Hugh W

    2003-10-01

    Enzymes of the gluconeogenic/glycolytic pathway (the Embden-Meyerhof-Parnas (EMP) pathway), the reductive tricarboxylic acid cycle, the reductive pentose phosphate cycle and the Entner-Doudoroff pathway are widely distributed and are often considered to be central to the origins of metabolism. In particular, several enzymes of the lower portion of the EMP pathway (the so-called trunk pathway), including triosephosphate isomerase (TPI; EC 5.3.1.1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH; EC 1.2.1.12/13), phosphoglycerate kinase (PGK; EC 2.7.2.3) and enolase (EC 4.2.1.11), are extremely well conserved and universally distributed among the three domains of life. In this paper, the distribution of enzymes of gluconeogenesis/glycolysis in hyperthermophiles--microorganisms that many believe represent the least evolved organisms on the planet--is reviewed. In addition, the phylogenies of the trunk pathway enzymes (TPIs, GAPDHs, PGKs and enolases) are examined. The enzymes catalyzing each of the six-carbon transformations in the upper portion of the EMP pathway, with the possible exception of aldolase, are all derived from multiple gene sequence families. In contrast, single sequence families can account for the archaeal and hyperthermophilic bacterial enzyme activities of the lower portion of the EMP pathway. The universal distribution of the trunk pathway enzymes, in combination with their phylogenies, supports the notion that the EMP pathway evolved in the direction of gluconeogenesis, i.e., from the bottom up.

  2. Distribution and phylogenies of enzymes of the Embden-Meyerhof-Parnas pathway from archaea and hyperthermophilic bacteria support a gluconeogenic origin of metabolism

    Directory of Open Access Journals (Sweden)

    Ron S. Ronimus

    2003-01-01

    Full Text Available Enzymes of the gluconeogenic/glycolytic pathway (the Embden-Meyerhof-Parnas (EMP pathway, the reductive tricarboxylic acid cycle, the reductive pentose phosphate cycle and the Entner-Doudoroff pathway are widely distributed and are often considered to be central to the origins of metabolism. In particular, several enzymes of the lower portion of the EMP pathway (the so-called trunk pathway, including triosephosphate isomerase (TPI; EC 5.3.1.1, glyceraldehyde-3-phosphate dehydrogenase (GAPDH; EC 1.2.1.12/13, phosphoglycerate kinase (PGK; EC 2.7.2.3 and enolase (EC 4.2.1.11, are extremely well conserved and universally distributed among the three domains of life. In this paper, the distribution of enzymes of gluconeogenesis/glycolysis in hyperthermophiles—microorganisms that many believe represent the least evolved organisms on the planet—is reviewed. In addition, the phylogenies of the trunk pathway enzymes (TPIs, GAPDHs, PGKs and enolases are examined. The enzymes catalyzing each of the six-carbon transformations in the upper portion of the EMP pathway, with the possible exception of aldolase, are all derived from multiple gene sequence families. In contrast, single sequence families can account for the archaeal and hyperthermophilic bacterial enzyme activities of the lower portion of the EMP pathway. The universal distribution of the trunk pathway enzymes, in combination with their phylogenies, supports the notion that the EMP pathway evolved in the direction of gluconeogenesis, i.e., from the bottom up.

  3. Sustained and promoter dependent bone morphogenetic protein expression by rat mesenchymal stem cells after BMP-2 transgene electrotransfer

    Directory of Open Access Journals (Sweden)

    E Ferreira

    2012-07-01

    Full Text Available Transplantation of mesenchymal stem cells (MSCs with electrotransferred bone morphogenetic protein-2 (BMP-2 transgene is an attractive therapeutic modality for the treatment of large bone defects: it provides both stem cells with the ability to form bone and an effective bone inducer while avoiding viral gene transfer. The objective of the present study was to determine the influence of the promoter driving the human BMP-2 gene on the level and duration of BMP-2 expression after transgene electrotransfer into rat MSCs. Cytomegalovirus, elongation factor-1α, glyceraldehyde 3-phosphate dehydrogenase, and beta-actin promoters resulted in a BMP-2 secretion rate increase of 11-, 78-, 66- and 36-fold over respective controls, respectively. In contrast, the osteocalcin promoter had predictable weak activity in undifferentiated MSCs but induced the strongest BMP-2 secretion rates in osteoblastically-differentiated MSCs. Regardless of the promoter driving the transgene, a plateau of maximal BMP-2 secretion persisted for at least 21 d after the hBMP-2 gene electrotransfer. The present study demonstrates the feasibility of gene electrotransfer for efficient BMP-2 transgene delivery into MSCs and for a three-week sustained BMP-2 expression. It also provides the first in vitro evidence for a safe alternative to viral methods that permit efficient BMP-2 gene delivery and expression in MSCs but raise safety concerns that are critical when considering clinical applications.

  4. Immunoelectron Microscopy for Locating Calvin Cycle Enzymes in the Thylakoids of Synechocystis 6803

    Institute of Scientific and Technical Information of China (English)

    Rachna Agarwal; Stefan Ortleb; Jayashree Krishna Saini; Michael Melzer

    2009-01-01

    Unicellular cyanobacteria Synechocystis 6803 were fixed using high-pressure freezing (HPF) and freeze substitution without any chemical cross-linkers. Immunoelectron microscopy of these cells showed that five sequential enzymes of the Calvin cycle (phosphoriboisomerase, phosphoribulokinase, ribulose-l,5-bisphosphate carboxylase/oxygenase (RuBisCO), 3-phosphoglyceratekinase and glyceraldehyde-3-phosphate dehydrogenase) and the catalytic portion of the chloroplast H+-ATP synthase (CF1) are located adjacent to the thylakoid membranes. Cell-free extracts of Synechocystis were processed by ultracentrifugation to isolate thylakoid fractions sedimenting at 40 000, 90 000, and 150 000 g.Among these, the 150 000-g fraction showed the highest linked activity of the above five sequential Calvin cycle enzymes and also the highest coordinated activity of light and dark reactions as assessed by ribose-5-phosphate (R-5-P) +ADP dependent CO2 fixation. Immunogold labeling of this membrane fraction confirmed the presence of the above five enzymes as well as the catalytic portion of the CF1 ATP synthase. Notably, the protein A-gold labeling of the thylakoids was observed without use of chemical cross-linkers and in spite of the normal washing steps used during standard immunolabeling. The results showed that soluble Calvin cycle enzymes might be organized along the thylakoid membranes.

  5. Selection of reference genes for analysis of stress-responsive genes after challenge with viruses and temperature changes in the silkworm Bombyx mori.

    Science.gov (United States)

    Guo, Huizhen; Jiang, Liang; Xia, Qingyou

    2016-04-01

    Viruses and high temperature (HT) are the primary threats to silkworms. Changes in the expression of stress-response genes can be measured using quantitative polymerase chain reaction (qPCR) after exposure to viruses or HT. However, appropriate reference genes (RGs) for qPCR data normalization have not been established in this organism. In this study, we summarized the RGs used in the previous silkworm studies after infection with Bombyx mori nucleopolyhedrovirus (BmNPV), B. mori cytoplasmic polyhedrosis virus (BmCPV), or B. mori densovirus (BmDNV) or after HT treatment. The expression levels of these RGs were extracted from silkworm transcriptome data to screen for candidate RGs that were unaffected by the experimental conditions. Actin-1 (A1), actin-3 (A3), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and translation initiation factor 4a (TIF-4A) were selected for further qPCR verification. The results of RNA-seq and qPCR showed that GAPDH and TIF-4A were suitable RGs after BmNPV challenge or HT stress, whereas TIF-4A was an appropriate RG for BmCPV or BmDNV-Z challenge in silkworms. These results suggested that TIF-4A may be the most appropriate RG for gene expression analysis after challenge with viruses or HT in silkworms.

  6. Relationship between Porcine Sperm Motility and Sperm Enzymatic Activity using Paper-based Devices

    Science.gov (United States)

    Matsuura, Koji; Huang, Han-Wei; Chen, Ming-Cheng; Chen, Yu; Cheng, Chao-Min

    2017-04-01

    Mammalian sperm motility has traditionally been analyzed to determine fertility using computer-assisted semen analysis (CASA) systems. To develop low-cost and robust male fertility diagnostics, we created a paper-based MTT assay and used it to estimate motile sperm concentration. When porcine sperm motility was inhibited using sperm enzyme inhibitors for sperm enzymes related to mitochondrial activity and glycolysis, we simultaneously recorded sperm motility and enzymatic reactivity using a portable motility analysis system (iSperm) and a paper-based MTT assay, respectively. When using our paper-based MTT-assay, we calculated the area mean value signal intensity (AMV) to evaluate enzymatic reactivity. Both sperm motility and AMV decreased following treatment with iodoacetamide (IODO) and 3-bromopyruvic acid (3BP), both of which are inhibitors of glycolytic enzymes including glyceraldehyde-3-phosphate dehydrogenase (GAPDH). We found a correlation between recorded motility using iSperm and AMV from our paper-based assay (P Based on this inhibitor study, sperm motility can be estimated using our paper-based MTT-assay.

  7. In vivo Site-Specific Transfection of Naked Plasmid DNA and siRNAs in Mice by Using a Tissue Suction Device

    Science.gov (United States)

    Shimizu, Kazunori; Kawakami, Shigeru; Hayashi, Kouji; Kinoshita, Hideyuki; Kuwahara, Koichiro; Nakao, Kazuwa; Hashida, Mitsuru; Konishi, Satoshi

    2012-01-01

    We have developed an in vivo transfection method for naked plasmid DNA (pDNA) and siRNA in mice by using a tissue suction device. The target tissue was suctioned by a device made of polydimethylsiloxane (PDMS) following the intravenous injection of naked pDNA or siRNA. Transfection of pDNA encoding luciferase was achieved by the suction of the kidney, liver, spleen, and heart, but not the duodenum, skeletal muscle, or stomach. Luciferase expression was specifically observed at the suctioned region of the tissue, and the highest luciferase expression was detected at the surface of the tissue (0.12±0.03 ng/mg protein in mice liver). Luciferase expression levels in the whole liver increased linearly with an increase in the number of times the liver was suctioned. Transfection of siRNA targeting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene significantly suppressed the expression of GAPDH mRNA in the liver. Histological analysis shows that severe damage was not observed in the suctioned livers. Since the suction device can be mounted onto the head of the endoscope, this method is a minimally invasive. These results indicate that the in vivo transfection method developed in this study will be a viable approach for biological research and therapies using nucleic acids. PMID:22844458

  8. Comparative analysis of reference gene stability in human mesenchymal stromal cells during osteogenic differentiation.

    Science.gov (United States)

    Jacobi, Angela; Rauh, Juliane; Bernstein, Peter; Liebers, Cornelia; Zou, Xuenong; Stiehler, Maik

    2013-01-01

    Mesenchymal stromal cells (MSCs) are one of the most frequently used cell sources for tissue engineering strategies. Cultivation of osteogenic MSCs is a prerequisite for cell-based concepts that aim at bone regeneration. Quantitative real time reverse transcription polymerase chain reaction (qRT-PCR) analysis is a commonly used method for the examination of mRNA expression levels. However, data on suitable reference genes for osteogenically cultivated MSCs is scarce. Hence, the aim of the study was to compare the regulation of different potential reference genes in osteogenically stimulated MSCs. Human MSCs were isolated from bone marrow aspirates of N = 6 hematologically healthy individuals, expanded by polystyrene-adherence, and maintained with and without osteogenic supplements for 14 days. Cellular proliferation and osteogenic differentiation were assessed by total DNA quantification, cell-specific alkaline phosphatase (ALP) activity and by qualitative staining for ALP and alizarin red, respectively. mRNA expression levels of N = 32 potential reference genes were quantified using the human Endogenous Control TaqMan® assays. mRNA expression stability was calculated using geNorm. The combined use of the most stable reference genes and DNA-damage-inducible alpha, Pumilio homolog 1, and large ribosomal protein P0 significantly improved gene expression accuracy as compared to the use of the commonly used reference genes beta actin and glyceraldehyde-3-phosphate dehydrogenase during qRT-PCR-based target gene expression analysis of osteogenically stimulated MSCs. © 2013 American Institute of Chemical Engineers.

  9. N-acetyl ornithine deacetylase is a moonlighting protein and is involved in the adaptation of Entamoeba histolytica to nitrosative stress

    Science.gov (United States)

    Shahi, Preeti; Trebicz-Geffen, Meirav; Nagaraja, Shruti; Hertz, Rivka; Alterzon-Baumel, Sharon; Methling, Karen; Lalk, Michael; Mazumder, Mohit; Samudrala, Gourinath; Ankri, Serge

    2016-01-01

    Adaptation of the Entamoeba histolytica parasite to toxic levels of nitric oxide (NO) that are produced by phagocytes may be essential for the establishment of chronic amebiasis and the parasite’s survival in its host. In order to obtain insight into the mechanism of E. histolytica’s adaptation to NO, E. histolytica trophozoites were progressively adapted to increasing concentrations of the NO donor drug, S-nitrosoglutathione (GSNO) up to a concentration of 110 μM. The transcriptome of NO adapted trophozoites (NAT) was investigated by RNA sequencing (RNA-seq). N-acetyl ornithine deacetylase (NAOD) was among the 208 genes that were upregulated in NAT. NAOD catalyzes the deacetylation of N-acetyl-L-ornithine to yield ornithine and acetate. Here, we report that NAOD contributes to the better adaptation of the parasite to nitrosative stress (NS) and that this function does not depend on NAOD catalytic activity. We also demonstrated that glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is detrimental to E. histolytica exposed to NS and that this detrimental effect is neutralized by NAOD or by a catalytically inactive NAOD (mNAOD). These results establish NAOD as a moonlighting protein, and highlight the unexpected role of this metabolic enzyme in the adaptation of the parasite to NS. PMID:27808157

  10. 利用cDNA-AFLP技术研究副溶血弧菌感染下拟穴青蟹的基因差异表达%The differential gene expression of Scylla paramamosain upon Vibrio parahaemolyticus infection by cDNA-AFLP

    Institute of Scientific and Technical Information of China (English)

    李升康; 朱烁; 张昭; 温小波; 李远友

    2012-01-01

    Mud crab Scylla paramamosains is widely cultured in brackish and seawater ponds along the coast of southeast China including Shantou. In recent years, mud crab cultured in Niutianyang reclaiming coastal area of Shantou suffered from serious diseases, especially the bacterial diseases (such as Vibrio parahaemolyticus), which results in high mortality and great economic loss. In present study, V.parahaemolyticus isolated from Shantou Niutianyang crab culture area was injected to 5.paramamosains to study the differential gene expression of the mud crab by cDNA-AFLP technology. Furthermore, 20 fragments that exhibited differential expression were discovered and sequenced. The results show that 6 fragments are homologous to the known functional genes, 5 of which are up-regulated. They are involved in energy metabolism including arginine kinase, phosphoenolpymvate-carboxykinase and glyceraldehydes 3 phosphate dehydrogenase, arginyl-tRNA synthetase involved in transport progress, as well as the chymotrypsin-like proteinase involved in defense response. The other 8 fragments were identified to be unknown function genes. The result here shows that the response of S.paramamosain upon V. parahaemolyticus infection is involved in multiple pathways and needs further investigation.

  11. Trypanosoma cf. varani in an imported ball python (Python reginus) from Ghana.

    Science.gov (United States)

    Sato, Hiroshi; Takano, Ai; Kawabata, Hiroki; Une, Yumi; Watanabe, Haruo; Mukhtar, Maowia M

    2009-08-01

    Peripheral blood from a ball python (Python reginus) imported from Ghana was cultured in Barbour-Stoenner-Kelly (BSK) medium for Borrelia spp. isolation, resulting in the prominent appearance of free, and clusters of, trypanosomes in a variety of morphological forms. The molecular phylogenetic characterization of these cultured trypanosomes, using the small subunit rDNA, indicated that this python was infected with a species closely related to Trypanosoma varani Wenyon, 1908, originally described in the Nile monitor lizard (Varanus niloticus) from Sudan. Furthermore, nucleotide sequences of glycosomal glyceraldehyde-3-phosphate dehydrogenase gene of both isolates showed few differences. Giemsa-stained blood smears, prepared from the infected python 8 mo after the initial observation of trypanosomes in hemoculture, contained trypomastigotes with a broad body and a short, free flagellum; these most closely resembled the original description of T. varani, or T. voltariae Macfie, 1919 recorded in a black-necked spitting cobra (Naja nigricollis) from Ghana. It is highly possible that lizards and snakes could naturally share an identical trypanosome species. Alternatively, lizards and snakes in the same region might have closely related, but distinct, Trypanosoma species as a result of sympatric speciation. From multiple viewpoints, including molecular phylogenetic analyses, reappraisal of trypanosome species from a wide range of reptiles in Africa is needed to clarify the relationship of recorded species, or to unmask unrecorded species.

  12. A proteomic study of rice cultivar TNG67 and its high aroma mutant SA0420.

    Science.gov (United States)

    Lin, Da-Gin; Chou, Szu-Yi; Wang, Arthur Z; Wang, Yi-Wen; Kuo, Shu-Ming; Lai, Chien-Chen; Chen, Liang-Jwu; Wang, Chang-Sheng

    2014-01-01

    Fragrance is a very important economic trait for rice cultivars. To identify the aroma genes in rice, we performed a proteomics analysis of aroma-related proteins between Tainung 67 (TNG67) and its high aroma mutant SA0420. Seventeen of the differentially identified proteins were close related with the aroma phenotype of SA0420. Among them, 9 were found in leaves and 8 were found in grains. One protein (L3) was identified as the chloroplastic glyceraldehyde-3-phosphate dehydrogenase B (OsGAPDHB) which was less abundant in SA0420 than TNG67. Sequence analysis demonstrated that this protein in SA0420 carries a P425S mutation in the C-terminal extension domain, which might hinder the formation of holoenzyme, thereby changing the profile of aroma compounds. The protein profile of OsGAPDHB showed only a weak correlation to its transcription profile. This result indicated that the reduction of OsGAPDHB in SA0420 is regulated by post-translational processes and can only be analyzed by proteomics approach. Transgenic lines suppressing OsGAPDHB through RNAi harbored more fragrance than TNG67 but less than SA0420. With betaine-aldehyde dehydrogenase as the only fragrance gene identified in rice to date, OsGAPDHB may serve as the second protein known to contribute to the aroma phenotype.

  13. Mutations in Escherichia coli aceE and ribB genes allow survival of strains defective in the first step of the isoprenoid biosynthesis pathway.

    Directory of Open Access Journals (Sweden)

    Jordi Perez-Gil

    Full Text Available A functional 2-C-methyl-D-erythritol 4-phosphate (MEP pathway is required for isoprenoid biosynthesis and hence survival in Escherichia coli and most other bacteria. In the first two steps of the pathway, MEP is produced from the central metabolic intermediates pyruvate and glyceraldehyde 3-phosphate via 1-deoxy-D-xylulose 5-phosphate (DXP by the activity of the enzymes DXP synthase (DXS and DXP reductoisomerase (DXR. Because the MEP pathway is absent from humans, it was proposed as a promising new target to develop new antibiotics. However, the lethal phenotype caused by the deletion of DXS or DXR was found to be suppressed with a relatively high efficiency by unidentified mutations. Here we report that several mutations in the unrelated genes aceE and ribB rescue growth of DXS-defective mutants because the encoded enzymes allowed the production of sufficient DXP in vivo. Together, this work unveils the diversity of mechanisms that can evolve in bacteria to circumvent a blockage of the first step of the MEP pathway.

  14. Combination of Entner-Doudoroff pathway with MEP increases isoprene production in engineered Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Huaiwei Liu

    Full Text Available Embden-Meyerhof pathway (EMP in tandem with 2-C-methyl-D-erythritol 4-phosphate pathway (MEP is commonly used for isoprenoid biosynthesis in E. coli. However, this combination has limitations as EMP generates an imbalanced distribution of pyruvate and glyceraldehyde-3-phosphate (G3P. Herein, four glycolytic pathways-EMP, Entner-Doudoroff Pathway (EDP, Pentose Phosphate Pathway (PPP and Dahms pathway were tested as MEP feeding modules for isoprene production. Results revealed the highest isoprene production from EDP containing modules, wherein pyruvate and G3P were generated simultaneously; isoprene titer and yield were more than three and six times higher than those of the EMP module, respectively. Additionally, the PPP module that generates G3P prior to pyruvate was significantly more effective than the Dahms pathway, in which pyruvate production precedes G3P. In terms of precursor generation and energy/reducing-equivalent supply, EDP+PPP was found to be the ideal feeding module for MEP. These findings may launch a new direction for the optimization of MEP-dependent isoprenoid biosynthesis pathways.

  15. Induction of heat shock proteins DnaK, GroEL, and GroES by salt stress in Lactococcus lactis

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Jacobsen, Susanne; Hammer, Karin;

    1997-01-01

    The bacterium Lactococcus lactis has become a model organism in studies of growth physiology and membrane transport, as a result of its simple fermentative metabolism. It is also used as a model for studying the importance of specific genes and functions during lie in excess nutrients, by compari......The bacterium Lactococcus lactis has become a model organism in studies of growth physiology and membrane transport, as a result of its simple fermentative metabolism. It is also used as a model for studying the importance of specific genes and functions during lie in excess nutrients......, by comparison of prototrophic wild-type strains and auxotrophic domesticated (daily) strains. In a study of the capacity of domesticated strains to perform directed responses toward various stress conditions, we have analyzed the heat and salt stress response in the established L,. lactis subsp. cremoris...... laboratory strain MG1363, which was originally derived from a dairy strain, After two-dimensional separation of proteins, the DnaK, GroEL, and GroES heat shock proteins, the HrcA (Orf1) heat shack repressor, and the glycolytic enzymes pyruvate kinase, glyceral-dehyde-3-phosphate dehydrogenase...

  16. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    Science.gov (United States)

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity.

  17. Fast hybridization solution for the detection of immobilized nucleic acids.

    Science.gov (United States)

    Yang, T T; Kain, S R

    1995-03-01

    We have developed a fast hybridization solution, termed ExpressHyb, for the rapid and sensitive detection of nucleic acids immobilized on membrane supports. This solution reduces typical hybridization times of 12-24 h to as little as 1 h while simultaneously increasing the sensitivity of detection in many applications. Using ExpressHyb, human beta-actin mRNA was detected on a human multiple tissue Northern (MTN) blot following a 30-min hybridization, with optimal detection occurring with a 1-h hybridization interval. The moderately abundant human glyceraldehyde-3-phosphate dehydrogenase (G3PDH) mRNA was detected using similar hybridization conditions and yielded improved signal-to-background characteristics relative to overnight hybridizations in conventional solutions. ExpressHyb can be used with either 32P- or digoxigenin-labeled probes and works effectively with both cDNA and oligonucleotide probes. For non-isotopic detection in particular, ExpressHyb reduces the nonspecific background commonly encountered with this technique. In cDNA library screening, ExpressHyb was found to both reduce the time required for effective hybridizations and to increase the number of positive colonies obtained relative to conventional overnight procedures. Taken together, these results illustrate the broad capability of ExpressHyb Hybridization Solution to improve nucleic acid detection in a variety of important techniques.

  18. Protein thiol oxidation and formation of S-glutathionylated cyclophilin A in cells exposed to chloramines and hypochlorous acid.

    Science.gov (United States)

    Stacey, Melissa M; Cuddihy, Sarah L; Hampton, Mark B; Winterbourn, Christine C

    2012-11-01

    Neutrophil oxidants, including the myeloperoxidase products, HOCl and chloramines, have been linked to endothelial dysfunction in inflammatory diseases such as atherosclerosis. As they react preferentially with sulfur centers, thiol proteins are likely to be cellular targets. Our objectives were to establish whether there is selective protein oxidation in vascular endothelial cells treated with HOCl or chloramines, and to identify sensitive proteins. Cells were treated with HOCl, glycine chloramine and monochloramine, reversibly oxidized cysteines were labeled and separated by 1D or 2D SDS-PAGE, and proteins were characterized by mass spectrometry. Selective protein oxidation was observed, with chloramines and HOCl causing more changes than H(2)O(2). Cyclophilin A was one of the most sensitive targets, particularly with glycine chloramine. Cyclophilin A was also oxidized in Jurkat T cells where its identity was confirmed using a knockout cell line. The product was a mixed disulfide with glutathione, with glutathionylation at Cys-161. Glyceraldehyde-3-phosphate dehydrogenase, peroxiredoxins and cofilin were also highly sensitive to HOCl/chloramines. Cyclophilins are becoming recognized as redox regulatory proteins, and glutathionylation is an important mechanism for redox regulation. Cells lacking Cyclophilin A showed more glutathionylation of other proteins than wild-type cells, suggesting that cyclophilin-regulated deglutathionylation could contribute to redox changes in HOCl/chloramine-exposed cells. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Identification of proteins susceptible to thiol oxidation in endothelial cells exposed to hypochlorous acid and N-chloramines.

    Science.gov (United States)

    Summers, Fiona A; Forsman Quigley, Anna; Hawkins, Clare L

    2012-08-24

    Hypochlorous acid (HOCl) is a potent oxidant produced by the enzyme myeloperoxidase, which is released by neutrophils under inflammatory conditions. Although important in the immune system, HOCl can also damage host tissue, which contributes to the development of disease. HOCl reacts readily with free amino groups to form N-chloramines, which also cause damage in vivo, owing to the extracellular release of myeloperoxidase and production of HOCl. HOCl and N-chloramines react readily with cellular thiols, which causes dysfunction via enzyme inactivation and modulation of redox signaling processes. In this study, the ability of HOCl and model N-chloramines produced on histamine and ammonia at inflammatory sites, to oxidize specific thiol-containing proteins in human coronary artery endothelial cells was investigated. Using a proteomics approach with the thiol-specific probe, 5-iodoacetamidofluorescein, we show that several proteins including peptidylprolyl isomerase A (cyclophilin A), protein disulfide isomerase, glyceraldehyde-3-phosphate dehydrogenase and galectin-1 are particularly sensitive to oxidation by HOCl and N-chloramines formed at inflammatory sites. This will contribute to cellular dysfunction and may play a role in inflammatory disease pathogenesis. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Validation of housekeeping genes as an internal control for gene expression studies in Giardia lamblia using quantitative real-time PCR.

    Science.gov (United States)

    Marcial-Quino, Jaime; Fierro, Francisco; De la Mora-De la Mora, Ignacio; Enríquez-Flores, Sergio; Gómez-Manzo, Saúl; Vanoye-Carlo, America; Garcia-Torres, Itzhel; Sierra-Palacios, Edgar; Reyes-Vivas, Horacio

    2016-04-25

    The analysis of transcript levels of specific genes is important for understanding transcriptional regulation and for the characterization of gene function. Real-time quantitative reverse transcriptase PCR (RT-qPCR) has become a powerful tool to quantify gene expression. The objective of this study was to identify reliable housekeeping genes in Giardia lamblia. Twelve genes were selected for this purpose, and their expression was analyzed in the wild type WB strain and in two strains with resistance to nitazoxanide (NTZ) and metronidazole (MTZ), respectively. RefFinder software analysis showed that the expression of the genes is different in the three strains. The integrated data from the four analyses showed that the NADH oxidase (NADH) and aldolase (ALD) genes were the most steadily expressed genes, whereas the glyceraldehyde-3-phosphate dehydrogenase gene was the most unstable. Additionally, the relative expression of seven genes were quantified in the NTZ- and MTZ-resistant strains by RT-qPCR, using the aldolase gene as the internal control, and the results showed a consistent differential pattern of expression in both strains. The housekeeping genes found in this work will facilitate the analysis of mRNA expression levels of other genes of interest in G. lamblia.

  1. Differential dissolved protein expression throughout the life cycle of Giardia lamblia.

    Science.gov (United States)

    Lingdan, Li; Pengtao, Gong; Wenchao, Li; Jianhua, Li; Ju, Yang; Chengwu, Liu; He, Li; Guocai, Zhang; Wenzhi, Ren; Yujiang, Chen; Xichen, Zhang

    2012-12-01

    Giardia lamblia (G. lamblia) has a simple life cycle that alternates between a cyst and a trophozoite, and this parasite is an important human and animal pathogen. To increase our understanding of the molecular basis of the G. lamblia encystment, we have analyzed the soluble proteins expressed by trophozoites and cysts extracted from feces by quantitative proteomic analysis. A total of 63 proteins were identified by isobaric tags for relative and absolute quantitation (iTRAQ) labeling, and were categorized as cytoskeletal proteins, a cell-cycle-specific kinase, metabolic enzymes and stress resistance proteins. Importantly, we demonstrated that the expression of seven proteins differed significantly between trophozoites and cysts. In cysts, the expression of three proteins (one variable surface protein (VSP), ornithine carbamoyltransferase (OTC), β-tubulin) increased, whereas the expression of four proteins (14-3-3 protein, α-tubulin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), protein disulfide isomerase 2 (PDI-2)) decreased significantly when compared with the levels of these proteins in trophozoites. The mRNA expression patterns of four of these proteins (OTC, α-tubulin, GAPDH, VSP) were similar to the expression levels of the proteins. These seven proteins appear to play an important role in the completion of the life cycle of G. lamblia.

  2. Comparison of DNA and RNA extraction methods for mummified tissues.

    Science.gov (United States)

    Konomi, Nami; Lebwohl, Eve; Zhang, David

    2002-12-01

    Nucleic acids extracted from mummified tissues are valuable materials for the study of ancient human beings. Significant difficulty in extracting nucleic acids from mummified tissues has been reported due to chemical modification and degradation. The goal of this study was to determine a method that is more efficient for DNA and RNA extraction from mummified tissues. Twelve mummy specimens were analyzed with 9 different nucleic acid extraction methods, including guanidium thiocyanate (GTC) and proteinase K/detergent based methods prepared in our laboratory or purchased. Glyceraldehyde 3-phosphate dehydrogenase DNA and beta-actin RNA were used as markers for the presence of adequate DNA and RNA, respectively, for PCR and RT-PCR amplification. Our results show that 5 M GTC is more efficient of releasing nucleic acids from mummified tissue than proteinase K/detergent, and phenol/chloroform extraction with an additional chloroform step is more efficient than phenol/chloroform along. We were able to isolate DNAs from all 12 specimens and RNAs from 8 of 12 specimens, and the nucleic acids were sufficient for PCR and RT-PCR analysis. We further tested hepatitis viruses including hepatitis B virus, hepatitis C virus, hepatitis G virus, and TT virus DNA, and fail to detect these viruses in all 12 specimens.

  3. Differential expression of mRNAs encoding the putative inhibin co-receptor (betaglycan) and activin type-I and type-II receptors in preovulatory and prehierarchical follicles of the laying hen ovary.

    Science.gov (United States)

    Lovell, T M; Knight, P G; Gladwell, R T

    2006-02-01

    Ovarian follicle development is primarily regulated by an interplay between the pituitary gonadotrophins, LH and FSH, and ovary-derived steroids. Increasing evidence implicates regulatory roles of transforming growth factor-beta (TGFbeta) superfamily members, including inhibins and activins. The aim of this study was to identify the expression of mRNAs encoding key receptors of the inhibin/activin system in ovarian follicles ranging from 4 mm in diameter to the dominant F1 follicle (approximately 40 mm). Ovaries were collected (n = 16) from mid-sequence hens maintained on a long-day photoschedule (16 h of light:8 h of darkness). All follicles removed were dissected into individual granulosa and thecal layers. RNA was extracted and cDNA synthesized. Real-time quantitative PCR was used to quantify the expression of mRNA encoding betaglycan, activin receptor (ActR) subtypes (type-I, -IIA and -IIB) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH); receptor expression data were normalized to GAPDH expression. Detectable levels of ActRI, -IIA and -IIB and the inhibin co-receptor (betaglycan) expression were found in all granulosa and thecal layers analysed. Granulosa ActRI mRNA peaked (P II activin receptors and betaglycan on granulosa and thecal cells are consistent with a local auto/paracrine role of inhibins and activins in modulating ovarian follicle development, selection and progression in the domestic fowl.

  4. Selection of suitable reference genes for quantitative real-time PCR in apoptosis-induced MCF-7 breast cancer cells.

    Science.gov (United States)

    Ferreira, Eloise; Cronjé, Marianne J

    2012-02-01

    Apoptosis is induced in MCF-7 breast cancer cells following treatment with salicylic acid (20 mM), either in the presence or absence of a heat shock (42°C for 30 min). In order to study the alterations of apoptotic genes with quantitative real-time PCR (qPCR), suitable genes with unchanged expression following the treatments is required for normalizing the gene expression levels. In this study, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin (ACTB), Histone H2A (HIST), constitutively expressed heat shock protein 70 (HSC70) and tyrosine 3-monooxygenase/trytophan 5 monooxygenase activation protein, 14-3-3 (YWHAZ) were evaluated as appropriate reference genes. Analysis of gene expression data with one-way ANOVA, geNorm and NormFinder identified HIST and YWHAZ as the least affected during the induction of apoptosis by the different treatments, and is the most suitable gene-pair for normalization during qPCR analysis in MCF-7 breast cancer cells undergoing apoptosis following treatment with SA and/or HS.

  5. Cadmium and mercury cause an oxidative stress-induced endothelial dysfunction.

    Science.gov (United States)

    Wolf, Matthew B; Baynes, John W

    2007-02-01

    We investigated the ability of cadmium and mercury ions to cause endothelial dysfunction in bovine pulmonary artery endothelial cell monolayers. Exposure of monolayers for 48 h to metal concentrations greater than 3-5 microM produced profound cytotoxicity (increased lactate dehydrogenase leakage), a permeability barrier failure, depletion of glutathione and ATP and almost complete inhibition of the activity of key thiol enzymes, glucose-6-phosphate dehydrogenase (G6PDH) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). In contrast, metal concentrations less than 1-2 microM induced increases in glutathione and thiol-enzyme activities with minimal changes in LDH leakage, barrier function and ATP content. At shorter incubation times (24 h or less), high concentrations of cadmium caused glutathione induction rather than depletion. Thus, oxidative stress and cytotoxicity induced by lower concentrations of the metal ions stimulate compensatory responses, including increased synthesis of glutathione, which presumably preserved the activity of key thiol enzymes, however these responses were not sustainable at higher metal ion concentrations. We conclude, while high concentrations of heavy metals are cytotoxic, lower concentration induce a compensatory protective response, which may explain threshold effects in metal-ion toxicity.

  6. The anti-cancer drug, doxorubicin, causes oxidant stress-induced endothelial dysfunction.

    Science.gov (United States)

    Wolf, Matthew B; Baynes, John W

    2006-02-01

    The anticancer drug doxorubicin (DOX) is toxic to target cells, but also causes endothelial dysfunction and edema, secondary to oxidative stress in the vascular wall. Thus, the mechanism of action of this drug may involve chemotoxicity to both cancer cells and to the endothelium. Indeed, we found that the permeability of monolayers of bovine pulmonary artery endothelial cells (BPAEC) to albumin was increased by approximately 10-fold above control, following 24-h exposure to clinically relevant concentrations of DOX (up to 1 microM). DOX also caused >4-fold increases in lactate dehydrogenase leakage and large decreases in ATP and reduced glutathione (GSH) in BPAECs, which paralleled the increases in endothelial permeability. A large part of the ATP loss could be attributed to DOX-induced hydrogen peroxide production which inhibited key thiol-enzymes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and glucose-6-phosphate dehydrogenase (G6PDH). Depletion of reduced nicotinamide adenine dinucleotide phosphate (NADPH) appeared to be a major factor leading to DOX-induced GSH depletion. At low concentrations, the sulfhydryl reagent, iodoacetate (IA), inhibited GAPDH, caused a decrease in ATP and increased permeability, without inhibiting G6PDH or decreasing GSH. These results, coupled with those of previous work on a related quinone, menadione, suggest that depletion of either GSH or ATP may lead independently to endothelial dysfunction during chemotherapy, contributing to the cardiotoxicity and other systemic side-effects of the drug.

  7. Characterization of citrate utilization in Corynebacterium glutamicum by transcriptome and proteome analysis.

    Science.gov (United States)

    Polen, Tino; Schluesener, Daniela; Poetsch, Ansgar; Bott, Michael; Wendisch, Volker F

    2007-08-01

    Corynebacterium glutamicum grows aerobically on a variety of carbohydrates and organic acids as single or combined sources of carbon and energy. To characterize the citrate utilization in C. glutamicum on a genomewide scale, a comparative analysis was carried out by combining transcriptome and proteome analysis. In cells grown on citrate, transcriptome analysis revealed highest expression changes for two different citrate-uptake systems encoded by citM and tctCBA, whereas genes encoding uptake systems for the glucose- (ptsG), sucrose- (ptsS) and fructose- (ptsF) specific PTS components and permeases for gluconate (gntP) and glutamate (gluC) displayed decreased mRNA levels in citrate-grown cells. This pattern was also observed when cells grown in Luria-Bertani (LB) medium plus citrate were compared with cells grown in LB medium, indicating some kind of catabolite repression. Genes encoding enzymes of the tricarboxylic acid cycle (aconitase, succinyl-CoA synthetase, succinate dehydrogenase and fumarase), malic enzyme, PEP carboxykinase, gluconeogenic glyceraldehyde-3-phosphate dehydrogenase and ATP synthase displayed increased expression in cells grown on citrate. Accordingly, proteome analysis revealed elevated protein levels of these enzymes and showed a good correlation with the mRNA levels. In conclusion, this study revealed the citrate stimulon in C. glutamicum and the regulated central metabolic genes when grown on citrate.

  8. Overexpression of the plg1 gene encoding pectin lyase in Penicillium griseoroseum.

    Science.gov (United States)

    Cardoso, Patrícia Gomes; Ribeiro, João Batista; Teixeira, Janaina Aparecida; de Queiroz, Marisa Vieira; de Araújo, Elza Fernandes

    2008-03-01

    The pectin lyase (PL) is an industrially important enzyme since it is used for maceration and clarification in the process of fruit juice production in food industries. In order to increase the yields of pectin lyase we cloned the plg1 (pectin lyase 1) from Penicillium griseoroseum gene under the control of the strong constitutive promoter of the glyceraldehyde-3-phosphate dehydrogenase gene (gpdA) and the terminator region of the tryptophan synthetase (trpC) gene from Aspergillus nidulans (plasmid pAN52-Plg1) and transformed this construct into the P. griseoroseum strain PG63. One of the pAN52-Plg1 multi-copy transformants (strain 105) grown in culture medium containing glucose or sugar cane juice showed PL activities of 4,804 or 5,202 U ml(-1) respectively, which represented 57- and 132-fold increases. In addition, the apparent specific activity of PL produced by this strain was much higher than the one observed for a commercial pectinase preparation. Evaluation of the extracellular proteins in the culture supernatant of strain 105 by SDS-PAGE showed the presence of a clear and strong band of approximately 40 kDa that probably corresponds to PL. The enzyme yields reported here demonstrate that the system we developed is able to express pectin lyase at levels comparable to, or exceeding, previously reported data.

  9. Effectiveness of a cloning and sequencing exercise on student learning with subsequent publication in the National Center for Biotechnology Information GenBank.

    Science.gov (United States)

    Lau, Joann M; Robinson, David L

    2009-01-01

    With rapid advances in biotechnology and molecular biology, instructors are challenged to not only provide undergraduate students with hands-on experiences in these disciplines but also to engage them in the "real-world" scientific process. Two common topics covered in biotechnology or molecular biology courses are gene-cloning and bioinformatics, but to provide students with a continuous laboratory-based research experience in these techniques is difficult. To meet these challenges, we have partnered with Bio-Rad Laboratories in the development of the "Cloning and Sequencing Explorer Series," which combines wet-lab experiences (e.g., DNA extraction, polymerase chain reaction, ligation, transformation, and restriction digestion) with bioinformatics analysis (e.g., evaluation of DNA sequence quality, sequence editing, Basic Local Alignment Search Tool searches, contig construction, intron identification, and six-frame translation) to produce a sequence publishable in the National Center for Biotechnology Information GenBank. This 6- to 8-wk project-based exercise focuses on a pivotal gene of glycolysis (glyceraldehyde-3-phosphate dehydrogenase), in which students isolate, sequence, and characterize the gene from a plant species or cultivar not yet published in GenBank. Student achievement was evaluated using pre-, mid-, and final-test assessments, as well as with a survey to assess student perceptions. Student confidence with basic laboratory techniques and knowledge of bioinformatics tools were significantly increased upon completion of this hands-on exercise.

  10. Further Evidence of How Unbuffered Starvation at 4°C Influences Listeria monocytogenes EGD-e, HCC23, F2365, and Scott A.

    Science.gov (United States)

    Jarvis, Nathan A; O'Bryan, Corliss A; Martin, Elizabeth M; Ricke, Steven C; Johnson, Michael G; Crandall, Philip G

    2017-10-01

    The soilborne pathogen Listeria monocytogenes frequently contaminates food products and food processing environments and is able to survive desiccation, high osmotic pressures, and starvation. However, little is known about how this pathogen survives starvation at 4°C. This study provides evidence that L. monocytogenes is able to survive total nutrient starvation for 4 weeks. L. monocytogenes strains EGD-e, Scott A, F2365, and HCC23 were starved individually in sterile water. Colony counts declined over 4 weeks, with Scott A declining the most rapidly. Transmission electron microscopy images revealed degradation of starving cell membranes and altered cytosols. Starving cells were subjected to the metabolic inhibitors fluoride, arsenite, 2,4-dinitrophenol, iodoacetate, and cyanide individually. Iodoacetate, which inhibits glyceraldehyde-3-phosphate dehydrogenase, completely reduced cultivable counts below the level of detection compared with the control starving cells; 2,4-dinitrophenol, which dissipates proton motive force, almost completely reduced cultivable counts. These results suggest that L. monocytogenes strains EGD-e, Scott A, F2365, and HCC23 are actively using part of the glycolysis pathway while starving. These results suggest that starving L. monocytogenes cells retain aspects of active metabolism.

  11. Pyruvate remediation of cell stress and genotoxicity induced by haloacetic acid drinking water disinfection by-products.

    Science.gov (United States)

    Dad, Azra; Jeong, Clara H; Pals, Justin A; Wagner, Elizabeth D; Plewa, Michael J

    2013-10-01

    Monohaloacetic acids (monoHAAs) are a major class of drinking water disinfection by-products (DBPs) and are cytotoxic, genotoxic, mutagenic, and teratogenic. We propose a model of toxic action based on monoHAA-mediated inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a target cytosolic enzyme. This model predicts that GAPDH inhibition by the monoHAAs will lead to a severe reduction of cellular ATP levels and repress the generation of pyruvate. A loss of pyruvate will lead to mitochondrial stress and genomic DNA damage. We found a concentration-dependent reduction of ATP in Chinese hamster ovary cells after monoHAA treatment. ATP reduction per pmol monoHAA followed the pattern of iodoacetic acid (IAA) > bromoacetic acid (BAA) > chloroacetic acid (CAA), which is the pattern of potency observed with many toxicological endpoints. Exogenous supplementation with pyruvate enhanced ATP levels and attenuated monoHAA-induced genomic DNA damage as measured with single cell gel electrophoresis. These data were highly correlated with the SN 2 alkylating potentials of the monoHAAs and with the induction of toxicity. The results from this study strongly support the hypothesis that GAPDH inhibition and the possible subsequent generation of reactive oxygen species is linked with the cytotoxicity, genotoxicity, teratogenicity, and neurotoxicity of these DBPs.

  12. Isolation and characterization of an inducible NAD-dependent butyraldehyde dehydrogenase from clostridium acetobutylicum

    Energy Technology Data Exchange (ETDEWEB)

    Schreiber, W.; Duerre, P. [Universitaet Ulm (Germany)

    1996-12-31

    A NAD-dependent butyraldehyde dehydrogenase (BAD) has been purified from C. acetobutylicum DSM 792 and DSM 173 1. This key enzyme of butanol production, catalyzing the conversion of butyryl-CoA to butyraldehyde, was induced shortly before the onset of butanol production and proved to be oxygen-sensitive. A one step purification procedure on reactive green 19 allowed to purify the enzyme to homogeneity. The purified protein was found to be extremely unstable and could only partially be stabilized by addition of mercaptoethanol and storage below -20{degrees}C. The enzyme subunit had a molecular mass of 39.5 kDa. In the reverse reaction (butyryl-CoA-forming) the apparent pH optimum was 9.75 and Vmax was significantly higher with butyraldehyde and propionaldehyde than with acetaldehyde. BAD could also use NADP+, but NAD+ was the preferred coenzyme for the reverse reaction. The N-terminal amino acid sequence of the C. acetobutylicurn DSM 792 protein showed high homology to glyceraldehyde-3-phosphate dehydrogenases (GAP), especially to the protein of C. pasteurianum. Genomic libraries of C. acetobutylicum DSM 792 were screened by hybridization using PCR-generated heterologous probes encoding the gap gene of C. pasteurianum. Sequence analysis of the positive clones revealed high homology, but no identity to the N-terminal amino acid sequence of the butyraldehyde dehydrogenase. Thus, BAD from C. acetobutylicum is distinctly different from other reported aldehyde dehydrogenases with butyraldehyde dehydrogenase activity.

  13. [Relationship between PMI and relative expression of myocardial various RNAs in rats died of different causes].

    Science.gov (United States)

    Lü, Ye-Hui; Zhang, Heng; Pan, Hui; Ma, Kai-Jun; Li, Wen-Can; Chen, Wen-Feng; Jiang, Jie-Qing'; Xue, Ai-Min; Zhang, Ping; Wang, Hui-Jun; Chen, Long

    2014-02-01

    To observe the changes of relative expression of myocardial various RNAs in rats died of different causes and their relationship with PMI. The rat models were established in which the rats were sacrificed by broken neck, asphyxia, and hemorrhagic shock. Total RNAs were extracted from myocardium. The quantitative real time PCR was used to calculate threshold cycle values of RNAs including glyceraldehyde-3-phosphate dehydrogenase (GAPDH), beta-actin, inducible nitric oxide synthase (iNOS), hypoxia-inducible factor-1 (HIF-1), tumor necrosis factor-alpha (TNF-alpha), interleukin-6 (IL-6), and U6 small nuclear RNA (U6 snRNA) and to study the changes of the relative expressions of various indexes with PMI. U6 snRNA with stable expression level could be used as appropriate internal control. In the early PMI, the relative expression of GAPDH, HIF-1, iNOS, TNF-alpha, and IL-6 more characteristically increased in groups of asphyxia and hemorrhagic shock than in group of broken neck, but the quantity of beta-actin decreased in all groups. In the late PMI, all the relative expressions significantly declined in correlation with the degradation of RNA. The characteristic changes of each RNA expression can be used as references to estimate PMI in deaths by different causes.

  14. Integrative transformation system for the metabolic engineering of the sphingoid base-producing yeast Pichia ciferrii.

    Science.gov (United States)

    Bae, Jung-Hoon; Sohn, Jung-Hoon; Park, Chang-Seo; Rhee, Joon-Shick; Choi, Eui-Sung

    2003-02-01

    We have developed an integrative transformation system for metabolic engineering of the tetraacetyl phytosphingosine (TAPS)-secreting yeast Pichia ciferrii. The system uses (i) a mutagenized ribosomal protein L41 gene of P. ciferrii as a dominant selection marker that confer resistance to the antibiotic cycloheximide and (ii) a ribosomal DNA (rDNA) fragment of P. ciferrii as a target for multicopy gene integration into the chromosome. A locus within the nontranscribed region located between 5S and 26S rDNAs was selected as the integration site. A maximum frequency of integrative transformation of approximately 1,350 transformants/ microg of DNA was observed. To improve the de novo synthesis of sphingolipid, the LCB2 gene, encoding a subunit of serine palmitoyltransferase, which catalyzes the first committed step of sphingolipid synthesis, was cloned from P. ciferrii and overexpressed under the control of the P. ciferrii glyceraldehyde-3-phosphate dehydrogenase promoter. After transformation of an LCB2 gene expression cassette, several transformants that contained approximately five to seven copies of transforming DNA in the chromosome and exhibited about 50-fold increase in LCB2 mRNA relative to the wild type were identified. These transformants were observed to produce approximately two times more TAPS than the wild type.

  15. Validation of Housekeeping Genes in the Brains of Rats Submitted to Chronic Intermittent Hypoxia, a Sleep Apnea Model

    Science.gov (United States)

    Julian, Guilherme Silva; de Oliveira, Renato Watanabe; Perry, Juliana Cini; Tufik, Sergio; Chagas, Jair Ribeiro

    2014-01-01

    Obstructive sleep apnea (OSA) is a syndrome characterized by intermittent nocturnal hypoxia, sleep fragmentation, hypercapnia and respiratory effort, and it has been associated with several complications, such as diabetes, hypertension and obesity. Quantitative real-time PCR has been performed in previous OSA-related studies; however, these studies were not validated using proper reference genes. We have examined the effects of chronic intermittent hypoxia (CIH), which is an experimental model mainly of cardiovascular consequences of OSA, on reference genes, including beta-actin, beta-2-microglobulin, glyceraldehyde-3-phosphate dehydrogenase, hypoxanthine guanine phosphoribosyl transferase and eukaryotic 18S rRNA, in different areas of the brain. All stability analyses were performed using the geNorm, Normfinder and BestKeeper software programs. With exception of the 18S rRNA, all of the evaluated genes were shown to be stable following CIH exposure. However, gene stability rankings were dependent on the area of the brain that was analyzed and varied according to the software that was used. This study demonstrated that CIH affects various brain structures differently. With the exception of the 18S rRNA, all of the tested genes are suitable for use as housekeeping genes in expression analyses. PMID:25289636

  16. Validation of reference genes for real-time quantitative RT-PCR studies in Talaromyces marneffei.

    Science.gov (United States)

    Dankai, Wiyada; Pongpom, Monsicha; Vanittanakom, Nongnuch

    2015-11-01

    Talaromyces marneffei (or Penicillium marneffei) is an opportunistic pathogen that can cause disseminated disease in human immunodeficiency virus (HIV)-infected patients, especially in Southeast Asia. T. marneffei is a thermally dimorphic fungus. Typically, T. marneffei has an adaptive morphology. It grows in a filamentous form (mould) at 25°C and can differentiate to produce asexual spores (conidia). In contrast, at 37°C, it grows as yeast cells that divide by fission. This study aimed to validate a quantitative reverse-transcription polymerase chain reaction (qRT-PCR) for gene expression analysis in T. marneffei. Analysis of relative gene expression by qRT-PCR requires normalization of data using a proper reference gene. However, suitable reference genes have not been identified in gene expression studies across different cell types or under different experimental conditions in T. marneffei. In this study, four housekeeping genes were selected for analysis: β-actin (act); glyceraldehyde-3-phosphate dehydrogenase (gapdh); β-tubulin (benA) and 18S rRNA. Two analysis programs; BestKeeper and geNorm software tools were used to validate the expression of the candidate normalized genes. The results indicated that the actin gene was the one which was most stably expressed and was recommended for use as the endogenous control for gene expression analysis of all growth forms in T. marneffei by qRT-PCR under normal and stress conditions.

  17. Selection of reliable reference genes for gene expression studies in Clonostachys rosea 67-1 under sclerotial induction.

    Science.gov (United States)

    Sun, Zhan-Bin; Li, Shi-Dong; Sun, Man-Hong

    2015-07-01

    Reference genes are important to precisely quantify gene expression by real-time PCR. In order to identify stable and reliable expressed genes in mycoparasite Clonostachys rosea in different modes of nutrition, seven commonly used housekeeping genes, 18S rRNA, actin, β-tubulin, elongation factor 1, ubiquitin, ubiquitin-conjugating enzyme and glyceraldehyde-3-phosphate dehydrogenase, from the effective biocontrol isolate C. rosea 67-1 were tested for their expression under sclerotial induction and during vegetative growth on PDA medium. Analysis by three software programs showed that differences existed among the candidates. Elongation factor 1 was most stable; the M value in geNorm, SD value in Bestkeeper and stability value in Normfinder analysis were 0.405, 0.450 and 0.442, respectively, indicating that the gene elongation factor 1 could be used to normalize gene expression in C. rosea in both vegetative growth and parasitic process. By using elongation factor 1, the expression of a serine protease gene, sep, in different conditions was assessed, which was consistent with the transcriptomic data. This research provides an effective method to quantitate expression changes of target genes in C. rosea, and will assist in further investigation of parasitism-related genes of this fungus.

  18. Reference genes selection and relative expression analysis from Shiraia sp. SUPER-H168 productive of hypocrellin.

    Science.gov (United States)

    Deng, Huaxiang; Gao, Ruijie; Liao, Xiangru; Cai, Yujie

    2016-04-10

    Shiraia bambusicola is an essential pharmaceutical fungus due to its production of hypocrellin with antiviral, antidepressant, and antiretroviral properties. Based on suitable reference gene (RG) normalization, gene expression analysis enables the exploitation of significant genes relative to hypocrellin biosynthesis by quantitative real-time polymerase chain reaction. We selected and assessed nine candidate RGs in the presence and absence of hypocrellin biosynthesis using GeNorm and NormFinder algorithms. After stepwise exclusion of unstable genes, GeNorm analysis identified glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and cytochrome oxidase (CyO) as the most stable expression, while NormFinder determined 18S ribosomal RNA (18S rRNA) as the most appropriate candidate gene for normalization. Tubulin (Tub) was observed to be the least stable gene and should be avoided for relative expression analysis. We further analyzed relative expression levels of essential proteins correlative with hypocrellin biosynthesis, including polyketide synthase (PKS), O-methyltransferase (Omef), FAD/FMN-dependent oxidoreductase (FAD), and monooxygenase (Mono). Compared to PKS, Mono kept a similar expression pattern and simulated PKS expression, while FAD remained constantly expressed. Omef presented lower transcript levels and had no relation to PKS expression. These relative expression analyses will pave the way for further interpretation of the hypocrellin biosynthesis pathway.

  19. Validation of housekeeping genes in the brains of rats submitted to chronic intermittent hypoxia, a sleep apnea model.

    Science.gov (United States)

    Julian, Guilherme Silva; de Oliveira, Renato Watanabe; Perry, Juliana Cini; Tufik, Sergio; Chagas, Jair Ribeiro

    2014-01-01

    Obstructive sleep apnea (OSA) is a syndrome characterized by intermittent nocturnal hypoxia, sleep fragmentation, hypercapnia and respiratory effort, and it has been associated with several complications, such as diabetes, hypertension and obesity. Quantitative real-time PCR has been performed in previous OSA-related studies; however, these studies were not validated using proper reference genes. We have examined the effects of chronic intermittent hypoxia (CIH), which is an experimental model mainly of cardiovascular consequences of OSA, on reference genes, including beta-actin, beta-2-microglobulin, glyceraldehyde-3-phosphate dehydrogenase, hypoxanthine guanine phosphoribosyl transferase and eukaryotic 18S rRNA, in different areas of the brain. All stability analyses were performed using the geNorm, Normfinder and BestKeeper software programs. With exception of the 18S rRNA, all of the evaluated genes were shown to be stable following CIH exposure. However, gene stability rankings were dependent on the area of the brain that was analyzed and varied according to the software that was used. This study demonstrated that CIH affects various brain structures differently. With the exception of the 18S rRNA, all of the tested genes are suitable for use as housekeeping genes in expression analyses.

  20. Validation of housekeeping genes in the brains of rats submitted to chronic intermittent hypoxia, a sleep apnea model.

    Directory of Open Access Journals (Sweden)

    Guilherme Silva Julian

    Full Text Available Obstructive sleep apnea (OSA is a syndrome characterized by intermittent nocturnal hypoxia, sleep fragmentation, hypercapnia and respiratory effort, and it has been associated with several complications, such as diabetes, hypertension and obesity. Quantitative real-time PCR has been performed in previous OSA-related studies; however, these studies were not validated using proper reference genes. We have examined the effects of chronic intermittent hypoxia (CIH, which is an experimental model mainly of cardiovascular consequences of OSA, on reference genes, including beta-actin, beta-2-microglobulin, glyceraldehyde-3-phosphate dehydrogenase, hypoxanthine guanine phosphoribosyl transferase and eukaryotic 18S rRNA, in different areas of the brain. All stability analyses were performed using the geNorm, Normfinder and BestKeeper software programs. With exception of the 18S rRNA, all of the evaluated genes were shown to be stable following CIH exposure. However, gene stability rankings were dependent on the area of the brain that was analyzed and varied according to the software that was used. This study demonstrated that CIH affects various brain structures differently. With the exception of the 18S rRNA, all of the tested genes are suitable for use as housekeeping genes in expression analyses.

  1. AIRE-induced apoptosis is associated with nuclear translocation of stress sensor protein GAPDH.

    Science.gov (United States)

    Liiv, Ingrid; Haljasorg, Uku; Kisand, Kai; Maslovskaja, Julia; Laan, Martti; Peterson, Pärt

    2012-06-22

    AIRE (Autoimmune Regulator) has a central role in the transcriptional regulation of self-antigens in medullary thymic epithelial cells, which is necessary for negative selection of autoreactive T cells. Recent data have shown that AIRE can also induce apoptosis, which may be linked to cross-presentation of these self-antigens. Here we studied AIRE-induced apoptosis using AIRE over-expression in a thymic epithelial cell line as well as doxycycline-inducible HEK293 cells. We show that the HSR/CARD domain in AIRE together with a nuclear localization signal is sufficient to induce apoptosis. In the nuclei of AIRE-positive cells, we also found an increased accumulation of a glycolytic enzyme, glyceraldehyde-3-phosphate (GAPDH) reflecting cellular stress and apoptosis. Additionally, AIRE-induced apoptosis was inhibited with an anti-apoptotic agent deprenyl that blocks GAPDH nitrosylation and nuclear translocation. We propose that the AIRE-induced apoptosis pathway is associated with GAPDH nuclear translocation and induction of NO-induced cellular stress in AIRE-expressing cells. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Characterization and Pathogenicity of Alternaria burnsii from Seeds of Cucurbita maxima (Cucurbitaceae) in Bangladesh.

    Science.gov (United States)

    Paul, Narayan Chandra; Deng, Jian Xin; Lee, Hyang Burm; Yu, Seung-Hun

    2015-12-01

    In the course of survey of endophytic fungi from Bangladesh pumpkin seeds in 2011~2012, two strains (CNU111042 and CNU111043) with similar colony characteristics were isolated and characterized by their morphology and by molecular phylogenetic analysis of the internal transcribed spacer, glyceraldehydes-3-phosphate dehydrogenase (gpd), and Alternaria allergen a1 (Alt a1) sequences. Phylogenetic analysis of all three sequences and their combined dataset revealed that the fungus formed a subclade within the A. alternata clade, matching A. burnsi and showing differences with its other closely related Alternaria species, such as A. longipes, A. tomato, and A. tomaticola. Long ellipsoid, obclavate or ovoid beakless conidia, shorter and thinner conidial size (16~60 [90] × 6.5~14 [~16] µm) distinguish this fungus from other related species. These isolates showed more transverse septation (2~11) and less longitudinal septation (0~3) than did other related species. Moreover, the isolate did not produce any diffusible pigment on media. Therefore, our results reveal that the newly recorded fungus from a new host, Cucurbita maxima, is Alternaria burnsii Uppal, Patel & Kamat.

  3. Production of L-lysine on different silage juices using genetically engineered Corynebacterium glutamicum.

    Science.gov (United States)

    Neuner, Andreas; Wagner, Ines; Sieker, Tim; Ulber, Roland; Schneider, Konstantin; Peifer, Susanne; Heinzle, Elmar

    2013-01-20

    Corynebacterium glutamicum, the best established industrial producer organism for lysine was genetically modified to allow the production of lysine on grass and corn silages. The resulting strain C. glutamicum lysC(fbr)dld(Psod)pyc(Psod)malE(Psod)fbp(Psod)gapX(Psod) was based on earlier work (Neuner and Heinzle, 2011). That mutant carries a point mutation in the aspartokinase (lysC) regulatory subunit gene as well as overexpression of D-lactate dehydrogenase (dld), pyruvate carboxylase (pyc) and malic enzyme (malE) using the strong Psod promoter. Here, we additionally overexpressed fructose 1,6-bisphosphatase (fbp) and glyceraldehyde 3-phosphate dehydrogenase (gapX) using the same promoter. The resulting strain grew readily on grass and corn silages with a specific growth rate of 0.35 h⁻¹ and lysine carbon yields of approximately 90 C-mmol (C-mol)⁻¹. Lysine yields were hardly affected by oxygen limitation whereas linear growth was observed under oxygen limiting conditions. Overall, this strain seems very robust with respect to the composition of silage utilizing all quantified low molecular weight substrates, e.g. lactate, glucose, fructose, maltose, quinate, fumarate, glutamate, leucine, isoleucine and alanine.

  4. Type 2 diabetes mellitus: Role of melatonin and oxidative stress.

    Science.gov (United States)

    Zephy, Doddigarla; Ahmad, Jamal

    2015-01-01

    Type 2 diabetes mellitus caused by transfer of susceptible immortal gene from parent to progeny in individuals prone, and/or in contribution of factors such as obesity and physical inactivity results in chronic extracellular hyperglycemia due to insulin resistance or impaired glucose tolerance. Hyperglycemia leads to increased production of superoxide radical in mitochondrial electron transport chain, consequently, inhibit glyceraldehyde-3-phosphate dehydrogenase activity, increase the flux of substrates that direct the expression of genes responsible for activation of polyol, hexosamine, advanced glycation end products and protein kinase-C pathways enzymes. Simultaneously, these pathways add-up free radicals in the body, hamper cell redox state, alter genes of insulin sensitivity and are responsible for the diabetic complications like retinopathy, atherosclerosis, cardiovascular diseases, nephropathy and neuropathy. Experimental evidence suggests that the indoleamine hormone melatonin is capable of influencing in development of diabetic complications by neutralizing the unnecessary production of ROS, protection of beta cells, as they possess low antioxidant potential and normalize redox state in the cell. However, studies reported the beneficial effects of pharmacological supplementation of melatonin in humans but it has not been extensively studied in a multicountric, multicentric which should include all ethnic population.

  5. Pathophysiological roles of peroxynitrite in circulatory shock.

    Science.gov (United States)

    Szabó, Csaba; Módis, Katalin

    2010-09-01

    Peroxynitrite is a reactive oxidant produced from nitric oxide and superoxide, which reacts with proteins, lipids, and DNA, and promotes cytotoxic and proinflammatory responses. Here, we overview the role of peroxynitrite in various forms of circulatory shock. Immunohistochemical and biochemical evidences demonstrate the production of peroxynitrite in various experimental models of endotoxic and hemorrhagic shock both in rodents and in large animals. In addition, biological markers of peroxynitrite have been identified in human tissues after circulatory shock. Peroxynitrite can initiate toxic oxidative reactions in vitro and in vivo. Initiation of lipid peroxidation, direct inhibition of mitochondrial respiratory chain enzymes, inactivation of glyceraldehyde-3-phosphate dehydrogenase, inhibition of membrane Na+/K+ ATPase activity, inactivation of membrane sodium channels, and other oxidative protein modifications contribute to the cytotoxic effect of peroxynitrite. In addition, peroxynitrite is a potent trigger of DNA strand breakage, with subsequent activation of the nuclear enzyme poly(ADP-ribose) polymerase, which promotes cellular energetic collapse and cellular necrosis. Additional actions of peroxynitrite that contribute to the pathogenesis of shock include inactivation of catecholamines and catecholamine receptors (leading to vascular failure) and endothelial and epithelial injury (leading to endothelial and epithelial hyperpermeability and barrier dysfunction), as well as myocyte injury (contributing to loss of cardiac contractile function). Neutralization of peroxynitrite with potent peroxynitrite decomposition catalysts provides cytoprotective and beneficial effects in rodent and large-animal models of circulatory shock.

  6. DNA-enrichment microfluidic chip for chromatin immunoprecipitation.

    Science.gov (United States)

    Oh, Hyun Jik; Park, Joong Yull; Park, Sung Eun; Lee, Bo Yun; Park, Jong Sung; Kim, Suel-Kee; Yoon, Tae Joong; Lee, Sang-Hoon

    2009-04-15

    Chromatin immunoprecipitation (ChIP) is a powerful and widely applied technique for detecting association of individual proteins with specific genomic regions; the technique requires several complex steps and is tedious. In this paper, we develop a microbead-packed microfluidic chip which eliminates most of the laborious, time-consuming, and skill-dependent processes of the ChIP procedure. A computational fluid dynamics model was established to analyze fluidic behavior in a microbead-packed microchannel. With the use of the new chip, a ChIP procedure was performed to purify the GAPDH (glyceraldehyde 3-phosphate dehydrogenase) gene from human embryonic kidney cells (cell line 293). The ChIP capability of the microfluidic chip was evaluated and compared with that of a commercial assay kit; the precipitation performance of both methods was almost identical as shown by quantitative measurement of DNA. However, our chip offers the advantage of low resin volume, and the experimental time is greatly reduced. In addition, our method is less dependent on individual technical skill. Therefore, we expect that our microfluidic chip-based ChIP method will be widely used in DNA-, gene-, and protein-related research and will improve experimental efficiency.

  7. Difference gel electrophoresis (DiGE) identifies differentially expressed proteins in endoscopically-collected pancreatic fluid

    Science.gov (United States)

    Paulo, Joao A.; Lee, Linda S.; Banks, Peter A.; Steen, Hanno; Conwell, Darwin L.

    2012-01-01

    Alterations in the pancreatic fluid proteome of individuals with chronic pancreatitis may offer insights into the development and progression of the disease. The endoscopic pancreas function test (ePFT) can safely collect large volumes of pancreatic fluid that are potentially amenable to proteomic analyses using difference gel electrophoresis (DiGE) coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS). Pancreatic fluid was collected endoscopically using the ePFT method following secretin stimulation from three individuals with severe chronic pancreatitis and three chronic abdominal pain controls. The fluid was processed to minimize protein degradation and the protein profiles of each cohort, as determined by DiGE and LC-MS/MS, were compared. This DiGE-LC-MS/MS analysis reveals proteins that are differentially expressed in chronic pancreatitis compared to chronic abdominal pain controls. Proteins with higher abundance in pancreatic fluid from chronic pancreatitis individuals include: actin, desmoplankin, alpha-1-antitrypsin, SNC73, and serotransferrin. Those of relatively lower abundance include carboxypeptidase B, lipase, alpha-1-antichymotrypsin, alpha-2-macroglobulin, Arp2/3 subunit 4, glyceraldehyde-3-phosphate dehydrogenase, and protein disulfide isomerase. Endoscopic collection (ePFT) in tandem with DiGE-LC-MS/MS is a suitable approach for pancreatic fluid proteome analysis, however, further optimization of our protocol, as outlined herein, may improve proteome coverage in future analyses. PMID:21792986

  8. Phosphate-responsive promoter of a Pichia pastoris sodium phosphate symporter.

    Science.gov (United States)

    Ahn, Jungoh; Hong, Jiyeon; Park, Myongsoo; Lee, Hyeokweon; Lee, Eungyo; Kim, Chunsuk; Lee, Joohwan; Choi, Eui-sung; Jung, Joon-ki; Lee, Hongweon

    2009-06-01

    To develop a functional phosphate-regulated promoter in Pichia pastoris, a phosphate-responsive gene, PHO89, which encodes a putative sodium (Na(+))-coupled phosphate symporter, was isolated. Sequencing analyses revealed a 1,731-bp open reading frame encoding a 576-amino-acid polypeptide with 12 putative transmembrane domains. The properties of the PHO89 promoter (P(PHO89)) were investigated using a bacterial lipase gene as a reporter in 5-liter jar fermentation experiments. P(PHO89) was tightly regulated by phosphate and was highly activated when the cells were grown in a phosphate-limited external environment. Compared to translation elongation factor 1alpha and the glyceraldehyde-3-phosphate dehydrogenase promoter, P(PHO89) exhibited strong transcriptional activity with higher specific productivity (amount of lipase produced/cell/h). Furthermore, a cost-effective and simple P(PHO89)-based fermentation process was developed for industrial application. These results demonstrate the potential for efficient use of P(PHO89) for controlled production of recombinant proteins in P. pastoris.

  9. Constitutive expression of human pancreatic lipase-related protein 1 in Pichia pastoris.

    Science.gov (United States)

    Aloulou, Ahmed; Grandval, Philippe; De Caro, Josiane; De Caro, Alain; Carrière, Frédéric

    2006-06-01

    High-level constitutive expression of the human pancreatic lipase-related protein 1 (HPLRP1) was achieved using the methylotrophic yeast Pichia pastoris. The HPLRP1 cDNA, including its original leader sequence, was subcloned into the pGAPZB vector and further integrated into the genome of P. pastoris X-33 under the control of the glyceraldehyde 3-phosphate dehydrogenase (GAP) constitutive promoter. A major protein with a molecular mass of 50 kDa was found to be secreted into the culture medium and was identified using anti-HPLRP1 polyclonal antibodies as HPLRP1 recombinant protein. The level of expression reached 100-120 mg of HPLRP1 per liter of culture medium after 40 h, as attested by specific and quantitative enzyme-linked immunosorbent assay. A single cation-exchange chromatography sufficed to obtain a highly purified recombinant HPLRP1 after direct batch adsorption onto S-Sepharose of the HPLRP1 present in the culture medium, at pH 5.5. N-terminal sequencing and mass spectrometry analysis were carried out to monitor the production of the mature protein and to confirm that its signal peptide was properly processed.

  10. Over-expression of GAPDH in human colorectal carcinoma as a preferred target of 3-bromopyruvate propyl ester.

    Science.gov (United States)

    Tang, Zhenjie; Yuan, Shuqiang; Hu, Yumin; Zhang, Hui; Wu, Wenjing; Zeng, Zhaolei; Yang, Jing; Yun, Jingping; Xu, Ruihua; Huang, Peng

    2012-02-01

    It has long been observed that many cancer cells exhibit increased aerobic glycolysis and rely more on this pathway to generate ATP and metabolic intermediates for cell proliferation. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a key enzyme in glycolysis and has been known as a housekeeping molecule. In the present study, we found that GAPDH expression was significantly up-regulated in human colorectal carcinoma tissues compared to the adjacent normal tissues, and also increased in colon cancer cell lines compared to the non-tumor colon mucosa cells in culture. The expression of GAPDH was further elevated in the liver metastatic tissues compared to the original colon cancer tissue of the same patients, suggesting that high expression of GAPDH might play an important role in colon cancer development and metastasis. Importantly, we found that 3-bromopyruvate propyl ester (3-BrOP) preferentially inhibited GAPDH and exhibited potent activity in inducing colon cancer cell death by causing severe depletion of ATP. 3-BrOP at low concentrations (1-10 μM) inhibited GAPDH and a much higher concentration (300 μM) was required to inhibit hexokinase-2. The cytotoxic effect of 3-BrOP was associated with its inhibition of GAPDH, and colon cancer cells with loss of p53 were more sensitive to this compound. Our study suggests that GAPDH may be a potential target for colon cancer therapy.

  11. Transport of 3-bromopyruvate across the human erythrocyte membrane.

    Science.gov (United States)

    Sadowska-Bartosz, Izabela; Soszyński, Mirosław; Ułaszewski, Stanisław; Ko, Young; Bartosz, Grzegorz

    2014-06-01

    3-Bromopyruvic acid (3-BP) is a promising anticancer compound because it is a strong inhibitor of glycolytic enzymes, especially glyceraldehyde 3-phosphate dehydrogenase. The Warburg effect means that malignant cells are much more dependent on glycolysis than normal cells. Potential complications of anticancer therapy with 3-BP are side effects due to its interaction with normal cells, especially erythrocytes. Transport into cells is critical for 3-BP to have intracellular effects. The aim of our study was the kinetic characterization of 3-BP transport into human erythrocytes. 3-BP uptake by erythrocytes was linear within the first 3 min and pH-dependent. The transport rate decreased with increasing pH in the range of 6.0-8.0. The Km and Vm values for 3-BP transport were 0.89 mM and 0.94 mmol/(l cells x min), respectively. The transport was inhibited competitively by pyruvate and significantly inhibited by DIDS, SITS, and 1-cyano-4-hydroxycinnamic acid. Flavonoids also inhibited 3-BP transport: the most potent inhibition was found for luteolin and quercetin.

  12. Anticancer efficacy of the metabolic blocker 3-bromopyruvate: specific molecular targeting.

    Science.gov (United States)

    Ganapathy-Kanniappan, Shanmugasundaram; Kunjithapatham, Rani; Geschwind, Jean-Francois

    2013-01-01

    The anticancer efficacy of the pyruvate analog 3-bromopyruvate has been demonstrated in multiple tumor models. The chief principle underlying the antitumor effects of 3-bromopyruvate is its ability to effectively target the energy metabolism of cancer cells. Biochemically, the glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) has been identified as the primary target of 3-bromopyruvate. Its inhibition results in the depletion of intracellular ATP, causing cell death. Several reports have also demonstrated that in addition to GAPDH inhibition, the induction of cellular stress also contributes to 3-bromopyruvate treatment-dependent apoptosis. Furthermore, recent evidence shows that 3-bromopyruvate is taken up selectively by tumor cells via the monocarboxylate transporters (MCTs) that are frequently overexpressed in cancer cells (for the export of lactate produced during aerobic glycolysis). The preferential uptake of 3-bromopyruvate via MCTs facilitates selective targeting of tumor cells while leaving healthy and non-malignant tissue untouched. Taken together, the specificity of molecular (GAPDH) targeting and selective uptake by tumor cells, underscore the potential of 3-bromopyruvate as a potent and promising anticancer agent. In this review, we highlight the mechanistic characteristics of 3-bromopyruvate and discuss its potential for translation into the clinic.

  13. 3-bromopyruvate inhibits glycolysis, depletes cellular glutathione, and compromises the viability of cultured primary rat astrocytes.

    Science.gov (United States)

    Ehrke, Eric; Arend, Christian; Dringen, Ralf

    2015-07-01

    The pyruvate analogue 3-bromopyruvate (3-BP) is an electrophilic alkylator that is considered a promising anticancer drug because it has been shown to kill cancer cells efficiently while having little toxic effect on nontumor cells. To test for potential adverse effects of 3-BP on brain cells, we exposed cultured primary rat astrocytes to 3-BP and investigated the effects of this compound on cell viability, glucose metabolism, and glutathione (GSH) content. The presence of 3-BP severely compromised cell viability and slowed cellular glucose consumption and lactate production in a time- and concentration-dependent manner, with half-maximal effects observed at about 100 µM 3-BP after 4 hr of incubation. The cellular hexokinase activity was not affected in 3-BP-treated astrocytes, whereas within 30 min after application of 3-BP the activity of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was inhibited, and cellular GSH content was depleted in a concentration-dependent manner, with half-maximal effects observed at about 30 µM 3-BP. The depletion of cellular GSH after exposure to 100 µM 3-BP was not prevented by the presence of 10 mM of the monocarboxylates lactate or pyruvate, suggesting that 3-BP is not taken up into astrocytes predominantly by monocarboxylate transporters. The data suggest that inhibition of glycolysis by inactivation of GAPDH and GSH depletion contributes to the toxicity that was observed for 3-BP-treated cultured astrocytes.

  14. The combination of glycerol metabolic engineering and drug resistance marker-aided genome shuffling to improve very-high-gravity fermentation performances of industrial Saccharomyces cerevisiae.

    Science.gov (United States)

    Wang, Pin-Mei; Zheng, Dao-Qiong; Liu, Tian-Zhe; Tao, Xiang-Lin; Feng, Ming-Guang; Min, Hang; Jiang, Xin-Hang; Wu, Xue-Chang

    2012-03-01

    A challenge associated with the ethanol productivity under very-high-gravity (VHG) conditions, optimizing multi-traits (i.e. byproduct formation and stress tolerance) of industrial yeast strains, is overcome by a combination of metabolic engineering and genome shuffling. First, industrial strain Y12 was deleted with a glycerol exporter Fps1p and hetero-expressed with glyceraldehydes-3-phosphate dehydrogenase, resulting in the modified strain YFG12 with lower glycerol yield. Second, YFG12 was subjected to three rounds of drug resistance marker-aided genome shuffling to increase its ethanol tolerance, and the best shuffled strain TS5 was obtained. Compared with wild strain Y12, shuffled strain TS5 not only decreased glycerol formation by 14.8%, but also increased fermentation rate and ethanol yield by 3.7% and 7.6%, respectively. Moreover, the system of genetic modification and Cre/loxP in aid of three different drug-resistance markers presented in the study significantly improved breeding efficiency and will facilitate the application of breeding technologies in prototrophic industrial microorganisms.

  15. Identification of stable reference genes for quantitative PCR in cells derived from chicken lymphoid organs.

    Science.gov (United States)

    Borowska, D; Rothwell, L; Bailey, R A; Watson, K; Kaiser, P

    2016-02-01

    Quantitative polymerase chain reaction (qPCR) is a powerful technique for quantification of gene expression, especially genes involved in immune responses. Although qPCR is a very efficient and sensitive tool, variations in the enzymatic efficiency, quality of RNA and the presence of inhibitors can lead to errors. Therefore, qPCR needs to be normalised to obtain reliable results and allow comparison. The most common approach is to use reference genes as internal controls in qPCR analyses. In this study, expression of seven genes, including β-actin (ACTB), β-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-glucuronidase (GUSB), TATA box binding protein (TBP), α-tubulin (TUBAT) and 28S ribosomal RNA (r28S), was determined in cells isolated from chicken lymphoid tissues and stimulated with three different mitogens. The stability of the genes was measured using geNorm, NormFinder and BestKeeper software. The results from both geNorm and NormFinder were that the three most stably expressed genes in this panel were TBP, GAPDH and r28S. BestKeeper did not generate clear answers because of the highly heterogeneous sample set. Based on these data we will include TBP in future qPCR normalisation. The study shows the importance of appropriate reference gene normalisation in other tissues before qPCR analysis.

  16. Evaluation of reference genes for real-time PCR studies of Brazilian Somalis sheep infected by gastrointestinal nematodes

    Directory of Open Access Journals (Sweden)

    Lilian Giotto Zaros

    2010-01-01

    Full Text Available Precise normalization with reference genes is necessary, in order to obtain reliable relative expression data in response to gastrointestinal nematode infection. By using sheep from temperate regions as models, three reference genes, viz., ribosomal protein LO (RPLO, glyceraldehyde 3-phosphate dehydrogenase (GAPDH and succinate dehydrogenase complex subunit A (SDHA, were investigated in the abomasum, abomasal lymph nodes and small intestine of Brazilian Somalis sheep, either resistant or susceptible to gastrointestinal nematodes infections. Real time PCR was carried out by using SYBR Green I dye, and gene stability was tested by geNorm. RPLO was an ideal reference gene, since its expression was constant across treatments, presented lower variation, and was ranked as the most stable in abomasum and lymph node tissues. On the other hand, SDHA was the most stable in the small intestine followed by RPLO and GAPDH. These findings demonstrate the importance of correctly choosing reference genes prior to relative quantification. In addition, we determined that reference genes used in sheep from temperate regions, when properly tested, can be applied in animals from tropical regions such as the Brazilian Somalis sheep.

  17. The mRNA and Protein Levels of Tubulin and β-Actin Are Greatly Reduced in the Proximal Duodenum of Mice Relative to the Rest of the Small Intestines.

    Science.gov (United States)

    Yu, Sungsook; Hwang, Hyekyung E; Yun, Nakhyeon; Goldenring, James R; Nam, Ki Taek

    2015-09-01

    To accurately quantify mRNA and protein levels, it is critical to choose appropriate internal standards. As the expression of housekeeping genes is assumed to remain constant, they are often employed to normalize signals to correct for sample-to-sample variations. However, recent studies have documented that β-actin and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression levels change in response to various stimuli during proliferation, activation, and differentiation. We investigated levels of α-, β-, γ-tubulin, β-actin, and GAPDH vary across the gastrointestinal tract of mice. We found that different regions of the small intestines had dramatically different expression profiles, as measured by western blot, quantitative Reverse transcription polymerase chain reaction (RT-PCR), and immunohistochemical staining. These results revealed that the expression levels of tubulins and β-actin were dramatically lower in the proximal duodenum, relative to the rest of the small intestines. These varying levels of housekeeping genes may reflect differences in the activities of specialized tissues and suggest unique requirements for tubulins in these tissue types. We conclude that the use of a single housekeeping gene to normalize gene expression in the gastrointestinal tracts of mice may introduce errors, as measured differences in gene expression may reflect regulation of the internal control rather than the mRNA or protein under investigation.

  18. Proteomics Analysis of Ovarian Cancer Cell Lines and Tissues Reveals Drug Resistance-associated Proteins

    Science.gov (United States)

    CRUZ*, ISA N.; COLEY*, HELEN M.; KRAMER, HOLGER B.; MADHURI, THUMULURU KAVITAH; SAFUWAN, NUR A.M.; ANGELINO, ANA RITA; YANG, MIN

    2016-01-01

    Background: Carboplatin and paclitaxel form the cornerstone of chemotherapy for epithelial ovarian cancer, however, drug resistance to these agents continues to present challenges. Despite extensive research, the mechanisms underlying this resistance remain unclear. Materials and Methods: A 2D-gel proteomics method was used to analyze protein expression levels of three human ovarian cancer cell lines and five biopsy samples. Representative proteins identified were validated via western immunoblotting. Ingenuity pathway analysis revealed metabolomic pathway changes. Results: A total of 189 proteins were identified with restricted criteria. Combined treatment targeting the proteasome-ubiquitin pathway resulted in re-sensitisation of drug-resistant cells. In addition, examination of five surgical biopsies of ovarian tissues revealed α-enolase (ENOA), elongation factor Tu, mitochondrial (EFTU), glyceraldehyde-3-phosphate dehydrogenase (G3P), stress-70 protein, mitochondrial (GRP75), apolipoprotein A-1 (APOA1), peroxiredoxin (PRDX2) and annexin A (ANXA) as candidate biomarkers of drug-resistant disease. Conclusion: Proteomics combined with pathway analysis provided information for an effective combined treatment approach overcoming drug resistance. Analysis of cell lines and tissues revealed potential prognostic biomarkers for ovarian cancer. *These Authors contributed equally to this study. PMID:28031236

  19. Top-down characterization data on the speciation of the Candida albicans immunome in candidemia.

    Science.gov (United States)

    Pitarch, Aida; Nombela, César; Gil, Concha

    2016-03-01

    The characterization of pathogen-specific antigenic proteins at the protein species level is crucial in the development and molecular optimization of novel immunodiagnostics, vaccines or immunotherapeutics for infectious diseases. The major requirements to achieve this molecular level are to obtain 100% sequence coverage and identify all post-translational modifications of each antigenic protein species. In this article, we show nearly complete sequence information for five discrete antigenic species of Candida albicans Tdh3 (glyceraldehyde-3-phosphate dehydrogenase), which have been reported to be differentially recognized both among candidemia patients and between candidemia and control patients. A comprehensive description of the top-down immunoproteomic strategy used for seroprofiling at the C. albicans protein species level in candidemia as well as for the chemical characterization of this immunogenic protein (based on high-resolution 2-DE, Western blotting, peptide mass fingerprinting, tandem mass spectrometry and de novo peptide sequencing) is also provided. The top-down characterization data on the speciation of the C. albicans immunome in candidemia presented here are related to our research article entitled "Seroprofiling at the Candida albicans protein species level unveils an accurate molecular discriminator for candidemia" (Pitarch et al., J. Proteomics, 2015, http://dx.doi.org/10.1016/j.jprot.2015.10.022).

  20. Evaluation of the expression of sperm proteins in normozoospermic and asthenozoospermic men using monoclonal antibodies

    Directory of Open Access Journals (Sweden)

    Jana Capkova

    2016-01-01

    Full Text Available Recent studies have shown that infertility affects estimated 15% of all couples. Male infertility is the primary or contributory cause in 60% of these cases. Consequently, the application of assisted reproduction is increasing. These methods could benefit from an extended evaluation of sperm quality. For this reason, we analyzed sperm proteins from 30 men with normal spermiograms and 30 men with asthenozoospermia. Ejaculates of both groups were tested by flow cytometry (FCM and fluorescence with a set of well-characterized anti-human sperm Hs-monoclonal antibodies (MoAbs, which were generated in our laboratory. No statistically significant differences were found between normospermics and asthenospermics in the expression of the sperm surface protein clusterin, evaluated with Hs-3 MoAb, and semenogelin, evaluated with Hs-9 MoAb. However, FCM revealed quantitative differences in the acrosomal proteins between normozoospermic and asthenozoospermic men, namely, in glyceraldehyde-3-phosphate dehydrogenase, evaluated with Hs-8 MoAb, valosin-containing protein, evaluated with Hs-14 MoAb, and ATP synthase (cAMP-dependent protein kinase II, PRKAR2A, evaluated with MoAb Hs-36. Asthenozoospermic men displayed a highly reduced expression of intra-acrosomal proteins, with a likely decrease in sperm quality, and thus a negative impact on successful reproduction. Asthenozoospermia seems to be a complex disorder involving intra-acrosomal proteins.

  1. Salt stress induces changes in the proteomic profile of micropropagated sugarcane shoots

    Science.gov (United States)

    Reis, Ricardo S.; Heringer, Angelo S.; Rangel, Patricia L.; Santa-Catarina, Claudete; Grativol, Clícia; Veiga, Carlos F. M.; Souza-Filho, Gonçalo A.

    2017-01-01

    Salt stress is one of the most common stresses in agricultural regions worldwide. In particular, sugarcane is affected by salt stress conditions, and no sugarcane cultivar presently show high productivity accompanied by a tolerance to salt stress. Proteomic analysis allows elucidation of the important pathways involved in responses to various abiotic stresses at the biochemical and molecular levels. Thus, this study aimed to analyse the proteomic effects of salt stress in micropropagated shoots of two sugarcane cultivars (CB38-22 and RB855536) using a label-free proteomic approach. The mass spectrometry proteomics data are available via ProteomeXchange with identifier PXD006075. The RB855536 cultivar is more tolerant to salt stress than CB38-22. A quantitative label-free shotgun proteomic analysis identified 1172 non-redundant proteins, and 1160 of these were observed in both cultivars in the presence or absence of NaCl. Compared with CB38-22, the RB855536 cultivar showed a greater abundance of proteins involved in non-enzymatic antioxidant mechanisms, ion transport, and photosynthesis. Some proteins, such as calcium-dependent protein kinase, photosystem I, phospholipase D, and glyceraldehyde-3-phosphate dehydrogenase, were more abundant in the RB855536 cultivar under salt stress. Our results provide new insights into the response of sugarcane to salt stress, and the changes in the abundance of these proteins might be important for the acquisition of ionic and osmotic homeostasis during exposure to salt stress. PMID:28419154

  2. Noninvasive Monitoring of Three-Dimensional Chondrogenic Constructs Using Molecular Beacon Nanosensors.

    Science.gov (United States)

    Tay, Li Min; Wiraja, Christian; Yeo, David C; Wu, Yingnan; Yang, Zheng; Chuah, Yon Jin; Lee, Eng Hin; Kang, Yuejun; Xu, Chenjie

    2017-01-01

    Chondrogenic differentiation of human mesenchymal stem cells (MSCs) in three-dimensional hydrogel holds promise as a method for repairing injured articular cartilage. Given MSC plasticity (its potential to mature into alternative lineages), nondestructive monitoring is critical for the optimization of chondrogenic differentiation conditions and the evaluation of the final product. However, conventional validation/assessments of the differentiation process (i.e., quantitative reverse transcription polymerase chain reaction [qRT-PCR] and histology) are end-point assays requiring disruption of the sample. This report introduces molecular beacon (MB)-based nanosensors to achieve noninvasive monitoring of chondrogenic differentiation. These nanosensors consist of biodegradable poly(lactic-co-glycolic acid) nanoparticles (PLGA NPs) encapsulating MBs to detect Type II Collagen (Col2) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNAs that serve as lineage-specific and housekeeping biomarkers, respectively. The sustainable release of MBs from MB-NPs allows longitudinal monitoring of MSCs undergoing chondrogenic differentiation over a period of 28 days. Dual-colored MB loading ensures accurate assessment of Col2 mRNA expression level, where potential heterogeneity in nanosensor uptake and retention by MSCs are taken into account. When normalized nanosensor signal was compared against qRT-PCR result, a tight correlation was observed (R(2) = 0.9301). Finally, nanosensor usage was compatible with MSC potency with minimal influence on chondrogenic, adipogenic, and osteogenic differentiation.

  3. Unravelling the shape and structural assembly of the photosynthetic GAPDH-CP12-PRK complex from Arabidopsis thaliana by small-angle X-ray scattering analysis.

    Science.gov (United States)

    Del Giudice, Alessandra; Pavel, Nicolae Viorel; Galantini, Luciano; Falini, Giuseppe; Trost, Paolo; Fermani, Simona; Sparla, Francesca

    2015-12-01

    Oxygenic photosynthetic organisms produce sugars through the Calvin-Benson cycle, a metabolism that is tightly linked to the light reactions of photosynthesis and is regulated by different mechanisms, including the formation of protein complexes. Two enzymes of the cycle, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK), form a supramolecular complex with the regulatory protein CP12 with the formula (GAPDH-CP122-PRK)2, in which both enzyme activities are transiently inhibited during the night. Small-angle X-ray scattering analysis performed on both the GAPDH-CP12-PRK complex and its components, GAPDH-CP12 and PRK, from Arabidopsis thaliana showed that (i) PRK has an elongated, bent and screwed shape, (ii) the oxidized N-terminal region of CP12 that is not embedded in the GAPDH-CP12 complex prefers a compact conformation and (iii) the interaction of PRK with the N-terminal region of CP12 favours the approach of two GAPDH tetramers. The interaction between the GAPDH tetramers may contribute to the overall stabilization of the GAPDH-CP12-PRK complex, the structure of which is presented here for the first time.

  4. Evaluation of reference genes for real-time PCR studies of Brazilian Somalis sheep infected by gastrointestinal nematodes

    Science.gov (United States)

    2010-01-01

    Precise normalization with reference genes is necessary, in order to obtain reliable relative expression data in response to gastrointestinal nematode infection. By using sheep from temperate regions as models, three reference genes, viz., ribosomal protein LO (RPLO), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and succinate dehydrogenase complex subunit A (SDHA), were investigated in the abomasum, abomasal lymph nodes and small intestine of Brazilian Somalis sheep, either resistant or susceptible to gastrointestinal nematodes infections. Real time PCR was carried out by using SYBR Green I dye, and gene stability was tested by geNorm. RPLO was an ideal reference gene, since its expression was constant across treatments, presented lower variation, and was ranked as the most stable in abomasum and lymph node tissues. On the other hand, SDHA was the most stable in the small intestine followed by RPLO and GAPDH. These findings demonstrate the importance of correctly choosing reference genes prior to relative quantification. In addition, we determined that reference genes used in sheep from temperate regions, when properly tested, can be applied in animals from tropical regions such as the Brazilian Somalis sheep. PMID:21637421

  5. Dietary TAG source and level affect performance and lipase expression in larval sea bass (Dicentrarchus labrax).

    Science.gov (United States)

    Morais, S; Cahu, C; Zambonino-Lnfante, J L; Robin, J; Rønnestad, I; Dinis, M T; Conceição, L E C

    2004-05-01

    The influence of dietary TAG source (fish oil, triolein, and coconut oil) and level (7.5 and 15% of the diet) on growth, lipase activity, and mRNA level was studied in sea bass larvae, from mouth opening until day 24 and from day 37 to 52. Fish oil and triolein induced better growth in both experiments, this being significant at a higher dietary level. Coconut oil significantly decreased growth at the higher level, possibly as the result of an excessive supply of medium-chain TAG. Growth was not related to lipase specific activity, suggesting a production in excess to dietary needs. Body lipid content was positively related to dietary lipid level and was affected by lipid quality. In addition, larval FA composition generally reflected that of the diet. The source of dietary lipid, but not the quantity, was shown to affect lipase activity significantly. Coconut oil diets induced the highest lipase activity, whereas the effect of fish oil was age dependent-it was similar to coconut oil at day 24 but induced the lowest lipase activity in 52-d-old larvae. The differential lipase response was probably caused by differences in the FA composition of the diet, related to the specificity of lipase toward FA differing in chain length and degree of saturation. No significant differences were found in lipase/glyceraldehyde-3-phosphate dehydrogenase mRNA, which suggests the existence of a posttranscriptional regulation mechanism.

  6. It takes two to tango: defining an essential second active site in pyridoxal 5'-phosphate synthase.

    Directory of Open Access Journals (Sweden)

    Cyril Moccand

    Full Text Available The prevalent de novo biosynthetic pathway of vitamin B6 involves only two enzymes (Pdx1 and Pdx2 that form an ornate multisubunit complex functioning as a glutamine amidotransferase. The synthase subunit, Pdx1, utilizes ribose 5-phosphate and glyceraldehyde 3-phosphate, as well as ammonia derived from the glutaminase activity of Pdx2 to directly form the cofactor vitamer, pyridoxal 5'-phosphate. Given the fact that a single enzyme performs the majority of the chemistry behind this reaction, a complicated mechanism is anticipated. Recently, the individual steps along the reaction co-ordinate are beginning to be unraveled. In particular, the binding of the pentose substrate and the first steps of the reaction have been elucidated but it is not known if the latter part of the chemistry, involving the triose sugar, takes place in the same or a disparate site. Here, we demonstrate through the use of enzyme assays, enzyme kinetics, and mutagenesis studies that indeed a second site is involved in binding the triose sugar and moreover, is the location of the final vitamin product, pyridoxal 5'-phosphate. Furthermore, we show that product release is triggered by the presence of a PLP-dependent enzyme. Finally, we provide evidence that a single arginine residue of the C terminus of Pdx1 is responsible for coordinating co-operativity in this elaborate protein machinery.

  7. N-terminal domain of turkey pancreatic lipase is active on long chain triacylglycerols and stabilized by colipase.

    Directory of Open Access Journals (Sweden)

    Madiha Bou Ali

    Full Text Available The gene encoding the TPL N-terminal domain (N-TPL, fused with a His6-tag, was cloned and expressed in Pichia pastoris, under the control of the glyceraldehyde-3-phosphate dehydrogenase (GAP constitutive promoter. The recombinant protein was successfully expressed and secreted with an expression level of 5 mg/l of culture medium after 2 days of culture. The N-TPL was purified through a one-step Ni-NTA affinity column with a purification factor of approximately 23-fold. The purified N-TPL, with a molecular mass of 35 kDa, had a specific activity of 70 U/mg on tributyrin. Surprisingly, this domain was able to hydrolyse long chain TG with a specific activity of 11 U/mg using olive oil as substrate. This result was confirmed by TLC analysis showing that the N-TPL was able to hydrolyse insoluble substrates as olive oil. N-TPL was unstable at temperatures over 37°C and lost 70% of its activity at acid pH, after 5 min of incubation. The N-TPL exhibited non linear kinetics, indicating its rapid denaturation at the tributyrin-water interface. Colipase increased the N-TPL stability at the lipid-water interface, so the TPL N-terminal domain probably formed functional interactions with colipase despite the absence of the C-terminal domain.

  8. Effects of Formaldehyde Inhalation on Lung of Rats

    Institute of Scientific and Technical Information of China (English)

    YU-HUA YANG; ZHU-GE XI; FU-HUAN CHAO; DAN-FENG YANG

    2005-01-01

    Objective To analyze protein changes in the lung of Wistar rats exposed to gaseous formaldehyde (FA) at 32-37 mg/m3 for 4 h/day for 15 days using proteomics technique. Methods Lung samples were solubilized and separated by two-dimensional electrophoresis (2-DE), and gel patterns were scanned and analyzed for detection of differently expressed protein spots. These protein spots were identified by MALDI-TOF-MS and NCBInr protein database searching. Results Four proteins were altered significantly in 32-37 mg/m3 FA group, with 3 proteins up-regulated, 1 protein down-regulated. The 4 proteins were identified as aldose reductase, LIM protein, glyceraldehyde-3-phosphate dehydrogenase, and chloride intracellular channel 3. Conclusion The four proteins are related to cell proliferation induced by FA and defense reaction of anti-oxidation. Proteomics is a powerful tool in research of environmental health, and has prospects in search for protein markers for disease diagnosis and monitoring.

  9. Inactivation of GAPDH as one mechanism of acrolein toxicity.

    Science.gov (United States)

    Nakamura, Mizuho; Tomitori, Hideyuki; Suzuki, Takehiro; Sakamoto, Akihiko; Terui, Yusuke; Saiki, Ryotaro; Dohmae, Naoshi; Igarashi, Kazuei; Kashiwagi, Keiko

    2013-01-25

    We have recently reported that acrolein is more toxic than reactive oxygen species. Thus, the mechanism of cell toxicity by acrolein was studied using mouse mammary carcinoma FM3A cells. Acrolein-conjugated proteins were separated by gel electrophoresis with subsequent determination of their amino acid sequence, and it was found that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was one of the major acrolein-conjugated proteins in cells. Acrolein interacted with cysteine-150 at the active site of GAPDH, and also with cysteine-282. When cells were treated with 8 μM acrolein, the activity of acrolein-conjugated GAPDH was greatly reduced, and the ATP content in cells was thus significantly reduced. In addition, it was shown that acrolein-conjugated GAPDH translocated to the nucleus, and the level of acetylated GAPDH and the number of TUNEL positive cells was increased, indicating that cell death is enhanced by acrolein-conjugated GAPDH. Inhibition of cell growth by acrolein was partially reversed when the cDNA encoding GAPDH was transformed into cells. These results indicate that inactivation of GAPDH is one mechanism that underlies cell toxicity caused by acrolein.

  10. Papain-Based Vaccination Modulates Schistosoma mansoni Infection-Induced Cytokine Signals.

    Science.gov (United States)

    Abdel Aziz, N; Tallima, H; Hafez, E A; El Ridi, R

    2016-02-01

    We have previously shown that immunization of outbred rodents with cysteine peptidases-based vaccine elicited type 2-biased immune responses associated with consistent and reproducible protection against challenge Schistosoma mansoni. We herein start to elucidate the molecular basis of C57BL/6 mouse resistance to S. mansoni following treatment with the cysteine peptidase, papain. We evaluated the early cytokine signals delivered by epidermal, dermal, and draining lymph node cells of naïve, and S. mansoni -infected mice treated 1 day earlier with 0 or 50 μg papain, or immunized twice with papain only (10 μg/mouse), papain-free recombinant S. mansoni glyceraldehyde 3-phosphate dehydrogenase and 2-Cys peroxiredoxin peptide (10 and 15 μg/mouse, respectively = antigen Mix), or papain-adjuvanted antigen Mix. Schistosoma mansoni infection induced epidermal and lymph node cells to release type 1, type 2 and type 17 cytokines, known to counteract each other. Expectedly, humoral immune responses were negligible until patency. Papain pretreatment or papain-based vaccination diminished or shut off S. mansoni infection early induction of type 1, type 17 and type 2 cytokines except for thymic stromal lymphopoietin and programmed the immune system towards a polarized type 2 immune milieu, associated with highly significant (P < 0.005 - <0.0001) resistance to S. mansoni infection.

  11. Enzymic analysis of NADPH metabolism in beta-lactam-producing Penicillium chrysogenum: presence of a mitochondrial NADPH dehydrogenase.

    Science.gov (United States)

    Harris, Diana M; Diderich, Jasper A; van der Krogt, Zita A; Luttik, Marijke A H; Raamsdonk, Léonie M; Bovenberg, Roel A L; van Gulik, Walter M; van Dijken, Johannes P; Pronk, Jack T

    2006-03-01

    Based on assumed reaction network structures, NADPH availability has been proposed to be a key constraint in beta-lactam production by Penicillium chrysogenum. In this study, NADPH metabolism was investigated in glucose-limited chemostat cultures of an industrial P. chrysogenum strain. Enzyme assays confirmed the NADP(+)-specificity of the dehydrogenases of the pentose-phosphate pathway and the presence of NADP(+)-dependent isocitrate dehydrogenase. Pyruvate decarboxylase/NADP(+)-linked acetaldehyde dehydrogenase and NADP(+)-linked glyceraldehyde-3-phosphate dehydrogenase were not detected. Although the NADPH requirement of penicillin-G-producing chemostat cultures was calculated to be 1.4-1.6-fold higher than that of non-producing cultures, in vitro measured activities of the major NADPH-providing enzymes were the same. Isolated mitochondria showed high rates of antimycin A-sensitive respiration of NADPH, thus indicating the presence of a mitochondrial NADPH dehydrogenase that oxidises cytosolic NADPH. The presence of this enzyme in P. chrysogenum might have important implications for stoichiometric modelling of central carbon metabolism and beta-lactam production and may provide an interesting target for metabolic engineering.

  12. Cascade regulation of PPARγ(2) and C/EBPα signaling pathways by celastrol impairs adipocyte differentiation and stimulates lipolysis in 3T3-L1 adipocytes.

    Science.gov (United States)

    Choi, Seung Kug; Park, Sunmi; Jang, Subin; Cho, Hun Hee; Lee, Siwoo; You, Seungkwon; Kim, Sang-Hyuk; Moon, Hyun-Seuk

    2016-05-01

    Celastrol, a triterpene from the root bark of the Chinese medicinal plant Tripterygium wilfordii, has been shown to exhibit anti-oxidant, anti-inflammatory, anti-cancer and insecticidal activities. Also, it has been demonstrated that celastrol has obesity-controlling effects in diet-induced obesity mice. However, direct evidence that celastrol contributes to the development of adipocyte differentiation and lipolysis has not been fully elucidated. Moreover, no previous studies have evaluated whether celastrol may regulate adipogenic transcriptional markers in adipocytes. In order to address the questions above, we extended previous observations and investigated in vitro celastrol signaling study whether celastrol may regulate differentiation, lipolysis and key adipogenic transcriptional pathways in 3T3-L1 adipocytes. Treatment of celastrol not only inhibited adipocyte differentiation (lipid accumulation, glyceraldehyde-3-phosphate dehydrogenase activity and triglyceride content) but also increased lipolysis (glycerol release and free fatty acid release) in 3T3-L1 adipocytes. In addition, all celastrol-regulated functional activities were controlled by PPARγ(2) and C/EBPα signaling pathways in duration of celastrol's treatment in 3T3-L1 adipocytes. Our initial data from in vitro celastrol signaling studies suggest novel insights into the role of PPARγ(2) and C/EBPα as probable mediators of the action of celastrol in regulating adipocyte differentiation and lipolysis in 3T3-L1 adipocytes. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Glucose Synthesis in a Protein-Based Artificial Photosynthesis System.

    Science.gov (United States)

    Lu, Hao; Yuan, Wenqiao; Zhou, Jack; Chong, Parkson Lee-Gau

    2015-09-01

    The objective of this study was to understand glucose synthesis of a protein-based artificial photosynthesis system affected by operating conditions, including the concentrations of reactants, reaction temperature, and illumination. Results from non-vesicle-based glyceraldehyde-3-phosphate (GAP) and glucose synthesis showed that the initial concentrations of ribulose-1,5-bisphosphate (RuBP) and adenosine triphosphate (ATP), lighting source, and temperature significantly affected glucose synthesis. Higher initial concentrations of RuBP and ATP significantly enhanced GAP synthesis, which was linearly correlated to glucose synthesis, confirming the proper functions of all catalyzing enzymes in the system. White fluorescent light inhibited artificial photosynthesis and reduced glucose synthesis by 79.2 % compared to in the dark. The reaction temperature of 40 °C was optimum, whereas lower or higher temperature reduced glucose synthesis. Glucose synthesis in the vesicle-based artificial photosynthesis system reconstituted with bacteriorhodopsin, F 0 F 1 ATP synthase, and polydimethylsiloxane-methyloxazoline-polydimethylsiloxane triblock copolymer was successfully demonstrated. This system efficiently utilized light-induced ATP to drive glucose synthesis, and 5.2 μg ml(-1) glucose was synthesized in 0.78-ml reaction buffer in 7 h. Light-dependent reactions were found to be the bottleneck of the studied artificial photosynthesis system.

  14. Identification of Colletotrichum isolates from Capsicum chinense in Amazon.

    Science.gov (United States)

    de Oliveira, C V S; Matos, K S; de Albuquerque, D M C; Hanada, R E; da Silva, G F

    2017-06-29

    Chili pepper (Capsicum chinense) is a great economic important culture on the State of Amazonas, and it represents, approximately, a production of 1.9 thousand tons per year. It is one of the hosts of Colletotrichum genus in the North region of Brazil. The aim of the study was to differentiate and to identify isolates of Colletotrichum collected from C. chinense in Amazon. Molecular characterization, using RFLP-PCR, ERIC-PCR and ISSR, was carried out initially for screening of morphologically similar isolates. Furthermore, phylogenetic analyses were performed using combined regions: Actin (ACT), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for the three isolates, INPA 2066, INPA 2286 and INPA 1858, plus superoxide dismutase (SOD2) for INPA 2066. We showed that the molecular markers were able to distinguish the isolates of Colletotrichum studied and these results were confirmed with the phylogenetic analyses, three different occurrences of Colletotrichum species (C. siamense, C. scovillei and C. brevisporum) causing anthracnose in C. chinense in the State of Amazonas. This study represents the first report of the species C. siamense and C. scovillei in this host in Brazil.

  15. Identification and Evaluation of Suitable Reference Genes for Gene Expression Studies in the Whitefly Bemisia tabaci (Asia I) by Reverse Transcription Quantitative Real-Time PCR

    Science.gov (United States)

    Collins, Carl; Patel, Mitulkumar V.; Colvin, John; Bailey, David; Seal, Susan

    2014-01-01

    This study presents a reliable method for performing reverse transcription quantitative real-time PCR (RT-qPCR) to measure gene expression in the whitefly Bemisia tabaci (Asia I) (Gennadius) (Hemiptera: Aleyrodidae), utilising suitable reference genes for data normalisation. We identified orthologs of commonly used reference genes (actin (ACT), cyclophilin 1 (CYP1), elongation factor 1α (EF1A), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), ribosomal protein L13a (RPL13A), and α-tubulin (TUB1A)), measured the levels of their transcripts by RT-qPCR during development and in response to thermal stress, and evaluated their suitability as endogenous controls using geNorm, BestKeeper, and NormFinder programs. Overall, TUB1A, RPL13A, and CYP1 were the most stable reference genes during B. tabaci development, and TUB1A, GAPDH, and RPL13A were the most stable reference genes in the context of thermal stress. An analysis of the effects of reference gene choice on the transcript profile of a developmentally-regulated gene encoding vitellogenin demonstrated the importance of selecting the correct endogenous controls for RT-qPCR studies. We propose the use of TUB1A, RPL13A, and CYP1 as endogenous controls for transcript profiling studies of B. tabaci development, whereas the combination of TUB1A, GAPDH, and RPL13A should be employed for studies into thermal stress. The data presented here will assist future transcript profiling studies in whiteflies. PMID:25373210

  16. Nuclear lipid microdomain as resting place of dexamethasone to impair cell proliferation.

    Science.gov (United States)

    Cataldi, Samuela; Codini, Michela; Cascianelli, Giacomo; Tringali, Sabina; Tringali, Anna Rita; Lazzarini, Andrea; Floridi, Alessandro; Bartoccini, Elisa; Garcia-Gil, Mercedes; Lazzarini, Remo; Ambesi-Impiombato, Francesco Saverio; Curcio, Francesco; Beccari, Tommaso; Albi, Elisabetta

    2014-01-01

    The action of dexamethasone is initiated by, and strictly dependent upon, the interaction of the drug with its receptor followed by its translocation into the nucleus where modulates gene expression. Where the drug localizes at the intranuclear level is not yet known. We aimed to study the localization of the drug in nuclear lipid microdomains rich in sphingomyelin content that anchor active chromatin and act as platform for transcription modulation. The study was performed in non-Hodgkin's T cell human lymphoblastic lymphoma (SUP-T1 cell line). We found that when dexamethasone enters into the nucleus it localizes in nuclear lipid microdomains where influences sphingomyelin metabolism. This is followed after 24 h by a cell cycle block accompanied by the up-regulation of cyclin-dependent kinase inhibitor 1A (CDKN1A), cyclin-dependent kinase inhibitor 1B (CDKN1B), growth arrest and DNA-damage 45A (GADD45A), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes and by the reduction of signal transducer and activator of transcription 3 (STAT3) and phospho signal transducer and activator of transcription 3 (phoshoSTAT3) proteins. After 48 h some cells show morphological changes characteristic of apoptosis while the number of the cells that undergo cell division and express B-cell lymphoma-2 (Bcl-2) is very low. We suggest that the integrity of nuclear lipid microdomains is important for the response to glucocorticoids of cancer cells.

  17. β-Glucan Synthase Gene Overexpression and β-Glucans Overproduction in Pleurotus ostreatus Using Promoter Swapping

    Science.gov (United States)

    Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

    2013-01-01

    Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884

  18. Chronic stress decreases the expression of sympathetic markers in the pineal gland and increases plasma melatonin concentration in rats.

    Science.gov (United States)

    Dagnino-Subiabre, Alexies; Orellana, Juan A; Carmona-Fontaine, Carlos; Montiel, Juan; Díaz-Velíz, Gabriela; Serón-Ferré, María; Wyneken, Ursula; Concha, Miguel L; Aboitiz, Francisco

    2006-06-01

    Chronic stress affects brain areas involved in learning and emotional responses. Although most studies have concentrated on the effect of stress on limbic-related brain structures, in this study we investigated whether chronic stress might induce impairments in diencephalic structures associated with limbic components of the stress response. Specifically, we analyzed the effect of chronic immobilization stress on the expression of sympathetic markers in the rat epithalamic pineal gland by immunohistochemistry and western blot, whereas the plasma melatonin concentration was determined by radioimmunoassay. We found that chronic stress decreased the expression of three sympathetic markers in the pineal gland, tyrosine hydroxylase, the p75 neurotrophin receptor and alpha-tubulin, while the same treatment did not affect the expression of the non-specific sympathetic markers Erk1 and Erk2, and glyceraldehyde-3-phosphate dehydrogenase. Furthermore, these results were correlated with a significant increase in plasma melatonin concentration in stressed rats when compared with control animals. Our findings indicate that stress may impair pineal sympathetic inputs, leading to an abnormal melatonin release that may contribute to environmental maladaptation. In addition, we propose that the pineal gland is a target of glucocorticoid damage during stress.

  19. Proteomic Investigation of Protein Profile Changes and Amino Acid Residue Level Modification in Cooked Lamb Meat: The Effect of Boiling.

    Science.gov (United States)

    Yu, Tzer-Yang; Morton, James D; Clerens, Stefan; Dyer, Jolon M

    2015-10-21

    Hydrothermal treatment (heating in water) is a common method of general food processing and preparation. For red-meat-based foods, boiling is common; however, how the molecular level effects of this treatment correlate to the overall food properties is not yet well-understood. The effects of differing boiling times on lamb meat and the resultant cooking water were here examined through proteomic evaluation. The longer boiling time was found to result in increased protein aggregation involving particularly proteins such as glyceraldehyde-3-phosphate dehydrogenase, as well as truncation in proteins such as in α-actinin-2. Heat-induced protein backbone cleavage was observed adjacent to aspartic acid and asparagine residues. Side-chain modifications of amino acid residues resulting from the heating, including oxidation of phenylalanine and formation of carboxyethyllysine, were characterized in the cooked samples. Actin and myoglobin bands from the cooked meat per se remained visible on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, even after significant cooking time. These proteins were also found to be the major source of observed heat-induced modifications. This study provides new insights into molecular-level modifications occurring in lamb meat proteins during boiling and a protein chemistry basis for better understanding the effect of this common treatment on the nutritional and functional properties of red-meat-based foods.

  20. AIRE-induced apoptosis is associated with nuclear translocation of stress sensor protein GAPDH

    Energy Technology Data Exchange (ETDEWEB)

    Liiv, Ingrid, E-mail: ingrid.liiv@ut.ee [Molecular Pathology, Institute of General and Molecular Pathology, University of Tartu, Tartu (Estonia); Haljasorg, Uku; Kisand, Kai; Maslovskaja, Julia; Laan, Martti; Peterson, Paert [Molecular Pathology, Institute of General and Molecular Pathology, University of Tartu, Tartu (Estonia)

    2012-06-22

    Highlights: Black-Right-Pointing-Pointer AIRE induces apoptosis in epithelial cells. Black-Right-Pointing-Pointer CARD domain of AIRE is sufficient for apoptosis induction. Black-Right-Pointing-Pointer AIRE induced apoptosis involves GAPDH translocation to the nuclei. Black-Right-Pointing-Pointer Deprenyl inhibits AIRE induced apoptosis. -- Abstract: AIRE (Autoimmune Regulator) has a central role in the transcriptional regulation of self-antigens in medullary thymic epithelial cells, which is necessary for negative selection of autoreactive T cells. Recent data have shown that AIRE can also induce apoptosis, which may be linked to cross-presentation of these self-antigens. Here we studied AIRE-induced apoptosis using AIRE over-expression in a thymic epithelial cell line as well as doxycycline-inducible HEK293 cells. We show that the HSR/CARD domain in AIRE together with a nuclear localization signal is sufficient to induce apoptosis. In the nuclei of AIRE-positive cells, we also found an increased accumulation of a glycolytic enzyme, glyceraldehyde-3-phosphate (GAPDH) reflecting cellular stress and apoptosis. Additionally, AIRE-induced apoptosis was inhibited with an anti-apoptotic agent deprenyl that blocks GAPDH nitrosylation and nuclear translocation. We propose that the AIRE-induced apoptosis pathway is associated with GAPDH nuclear translocation and induction of NO-induced cellular stress in AIRE-expressing cells.

  1. Investigation of horizontal gene transfer in poplar/Amanita muscaria ectomycorrhizas.

    Science.gov (United States)

    Zhang, Chi; Hampp, Rüdiger; Nehls, Uwe

    2005-01-01

    Fine roots of forest trees form together with certain soil fungi symbiotic structures (ectomycorrhizas), where fungal hyphae are in intimate contact with plant cells. Due to root cell degeneration, plant DNA is released and could be taken up by the fungus. The possibility that horizontal gene transfer might result in a risk for the environment should be evaluated before a massive release of genetically engineered trees into nature occurs, even though only a few convincing examples of horizontal gene transfer are known. Transgenic poplars containing a construct of the Streptomyces hygroscopicus bar gene under the control of the Cochliobolus heterostrophus GPD (glyceraldehyde-3-phosphate dehydrogenase) promoter were generated by Agrobacterium-mediated transformation. The functionality of this construct in the ectomycorrhizal model fungus Amanita muscaria was previously verified by protoplast-based fungal transformation. 35,000 ectomycorrhizas, formed between transgenic poplars and non-transgenic A. muscaria hyphae, were isolated and transferred to selective agar plates. Putative herbicide-resistant fungal colonies were obtained after the first round of selection. However, none of these colonies survived a transfer onto fresh selection medium, nor did they contain the bar gene, indicating that no horizontal gene transfer from poplar to A. muscaria occurred during symbiosis under axenic conditions. However, since ectomycorrhizas are associated under natural conditions with viruses, bacteria and other fungi, these additional associations should be evaluated in future.

  2. Nucleotide diversity among natural populations of a North American poplar (Populus balsamifera, Salicaceae).

    Science.gov (United States)

    Breen, Amy L; Glenn, Elise; Yeager, Adam; Olson, Matthew S

    2009-01-01

    Poplars (Populus spp.) comprise an important component of circumpolar boreal forest ecosystems and are the model species for tree genomics. In this study, we surveyed genetic variation and population differentiation in three nuclear genes among populations of balsam poplar (Populus balsamifera) in North America. We examined nucleotide sequence variation in alcohol dehydrogenase 1 (Adh1) and glyceraldehyde 3-phosphate dehydrogenase (G3pdh), two well-studied nuclear loci in plants, and abscisic acid insensitivity 1B (ABI1B), a locus coincident with timing of seasonal dormancy in quantitative trait locus (QTL) studies of hybrid poplars. We compared estimates of baseline population genetic parameters for these loci with those obtained in studies of other poplar species, particularly European aspen (Populus tremula). Average pairwise nucleotide diversity (pi(tot) = 0.00216-0.00353) was equivalent to that in Populus trichocarpa, but markedly less than that in P. tremula. Elevated levels of population structure were observed in ABI1B between the northern and southern regions (F(CT) = 0.184, P boreal plant species.

  3. Appropriateness of reference genes for normalizing messenger RNA in mouse 2,4-dinitrobenzene sulfonic acid (DNBS)-induced colitis using quantitative real time PCR

    Science.gov (United States)

    Eissa, Nour; Kermarrec, Laëtitia; Hussein, Hayam; Bernstein, Charles N.; Ghia, Jean-Eric

    2017-01-01

    2,4-Dinitrobenzene sulfonic acid (DNBS)-induced colitis is an experimental model that mimics Crohn’s disease. Appropriateness of reference genes is crucial for RT-qPCR. This is the first study to determine the stability of reference gene expression (RGE) in mice treated with DNBS. DNBS experimental Colitis was induced in male C57BL/6 mice. RNA was extracted from colon tissue and comprehensive analysis of 13 RGE was performed according to predefined criteria. Relative colonic TNF-α and IL-1β mRNA levels were calculated. Colitis significantly altered the stability of mucosal RGE. Commonly used glyceraldehyde-3-phosphate dehydrogenase (Gapdh), β-actin (Actb), or β2-microglobulin (β2m) showed the highest fluctuation within the inflamed and control groups. Conversely, ribosomal protein large P0 (Rplp0), non-POU domain containing (Nono), TATA-box-binding protein (Tbp) and eukaryotic translation elongation factor 2 (Eef2) were not affected by inflammation and were the most stable genes. TNF-α and IL-1β mRNA levels was dependent on the reference gene used and varied from significant when the most stable genes were used to non-significant when the least stable genes were used. The appropriate choice of RGE is critical to guarantee satisfactory normalization of RT-qPCR data when using DNBS-Model. We recommend using Rplp0, Nono, Tbp, Hprt and Eef2 instead of common reference genes. PMID:28186172

  4. Tropheryma whipplei, the agent of Whipple's disease, affects the early to late phagosome transition and survives in a Rab5- and Rab7-positive compartment.

    Directory of Open Access Journals (Sweden)

    Giovanna Mottola

    Full Text Available Tropheryma whipplei, the agent of Whipple's disease, inhibits phago-lysosome biogenesis to create a suitable niche for its survival and replication in macrophages. To understand the mechanism by which it subverts phagosome maturation, we used biochemical and cell biological approaches to purify and characterise the intracellular compartment where Tropheryma whipplei resides using mouse bone-marrow-derived macrophages. We showed that in addition to Lamp-1, the Tropheryma whipplei phagosome is positive for Rab5 and Rab7, two GTPases required for the early to late phagosome transition. Unlike other pathogens, inhibition of PI(3P production was not the mechanism for Rab5 stabilisation at the phagosome. Overexpression of the inactive, GDP-bound form of Rab5 bypassed the pathogen-induced blockade of phago-lysosome biogenesis. This suggests that Tropheryma whipplei blocks the switch from Rab5 to Rab7 by acting on the Rab5 GTPase cycle. A bio-informatic analysis of the Tropheryma whipplei genome revealed a glyceraldehyde-3-phosphate dehydrogenase (GAPDH homologous with the GAPDH of Listeria monocytogenes, and this may be the bacterial protein responsible for blocking Rab5 activity. To our knowledge, Tropheryma whipplei is the first pathogen described to induce a "chimeric" phagosome stably expressing both Rab5 and Rab7, suggesting a novel and specific mechanism for subverting phagosome maturation.

  5. De-regulation of common housekeeping genes in hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    Wurmbach Elisa

    2007-07-01

    Full Text Available Abstract Background Tumorigenesis is associated with changes in gene expression and involves many pathways. Dysregulated genes include "housekeeping" genes that are often used for normalization for quantitative real-time RT-PCR (qPCR, which may lead to unreliable results. This study assessed eight stages of hepatitis C virus (HCV induced hepatocellular carcinoma (HCC to search for appropriate genes for normalization. Results Gene expression profiles using microarrays revealed differential expression of most "housekeeping" genes during the course of HCV-HCC, including glyceraldehyde-3-phosphate dehydrogenase (GAPDH and beta-actin (ACTB, genes frequently used for normalization. QPCR reactions confirmed the regulation of these genes. Using them for normalization had strong effects on the extent of differential expressed genes, leading to misinterpretation of the results. Conclusion As shown here in the case of HCV-induced HCC, the most constantly expressed gene is the arginine/serine-rich splicing factor 4 (SFRS4. The utilization of at least two genes for normalization is robust and advantageous, because they can compensate for slight differences of their expression when not co-regulated. The combination of ribosomal protein large 41 (RPL41 and SFRS4 used for normalization led to very similar results as SFRS4 alone and is a very good choice for reference in this disease as shown on four differentially expressed genes.

  6. Differential responses of the coral host and their algal symbiont to thermal stress.

    Directory of Open Access Journals (Sweden)

    William Leggat

    Full Text Available The success of any symbiosis under stress conditions is dependent upon the responses of both partners to that stress. The coral symbiosis is particularly susceptible to small increases of temperature above the long term summer maxima, which leads to the phenomenon known as coral bleaching, where the intracellular dinoflagellate symbionts are expelled. Here we for the first time used quantitative PCR to simultaneously examine the gene expression response of orthologs of the coral Acropora aspera and their dinoflagellate symbiont Symbiodinium. During an experimental bleaching event significant up-regulation of genes involved in stress response (HSP90 and HSP70 and carbon metabolism (glyceraldehyde-3-phosphate dehydrogenase, α-ketoglutarate dehydrogenase, glycogen synthase and glycogen phosphorylase from the coral host were observed. In contrast in the symbiont, HSP90 expression decreased, while HSP70 levels were increased on only one day, and only the α-ketoglutarate dehydrogenase expression levels were found to increase. In addition the changes seen in expression patterns of the coral host were much larger, up to 10.5 fold, compared to the symbiont response, which in all cases was less than 2-fold. This targeted study of the expression of key metabolic and stress genes demonstrates that the response of the coral and their symbiont vary significantly, also a response in the host transcriptome was observed prior to what has previously been thought to be the temperatures at which thermal stress events occur.

  7. Dynamic requirements for a functional protein hinge.

    Science.gov (United States)

    Kempf, James G; Jung, Ju-Yeon; Ragain, Christina; Sampson, Nicole S; Loria, J Patrick

    2007-04-20

    The enzyme triosephosphate isomerase (TIM) is a model of catalytic efficiency. The 11 residue loop 6 at the TIM active site plays a major role in this enzymatic prowess. The loop moves between open and closed states, which facilitate substrate access and catalysis, respectively. The N and C-terminal hinges of loop 6 control this motion. Here, we detail flexibility requirements for hinges in a comparative solution NMR study of wild-type (WT) TIM and a quintuple mutant (PGG/GGG). The latter contained glycine substitutions in the N-terminal hinge at Val167 and Trp168, which follow the essential Pro166, and in the C-terminal hinge at Lys174, Thr175, and Ala176. Previous work demonstrated that PGG/GGG has a tenfold higher Km value and 10(3)-fold reduced k(cat) relative to WT with either d-glyceraldehyde 3-phosphate or dihyrdroxyacetone phosphate as substrate. Our NMR results explain this in terms of altered loop-6 dynamics in PGG/GGG. In the mutant, loop 6 exhibits conformational heterogeneity with corresponding motional rates hinge design in proteins: structural rigidity is essential for focused motional freedom of active-site loops.

  8. Testing biochemistry revisited: how in vivo metabolism can be understood from in vitro enzyme kinetics.

    Directory of Open Access Journals (Sweden)

    Karen van Eunen

    Full Text Available A decade ago, a team of biochemists including two of us, modeled yeast glycolysis and showed that one of the most studied biochemical pathways could not be quite understood in terms of the kinetic properties of the constituent enzymes as measured in cell extract. Moreover, when the same model was later applied to different experimental steady-state conditions, it often exhibited unrestrained metabolite accumulation.Here we resolve this issue by showing that the results of such ab initio modeling are improved substantially by (i including appropriate allosteric regulation and (ii measuring the enzyme kinetic parameters under conditions that resemble the intracellular environment. The following modifications proved crucial: (i implementation of allosteric regulation of hexokinase and pyruvate kinase, (ii implementation of V(max values measured under conditions that resembled the yeast cytosol, and (iii redetermination of the kinetic parameters of glyceraldehyde-3-phosphate dehydrogenase under physiological conditions.Model predictions and experiments were compared under five different conditions of yeast growth and starvation. When either the original model was used (which lacked important allosteric regulation, or the enzyme parameters were measured under conditions that were, as usual, optimal for high enzyme activity, fructose 1,6-bisphosphate and some other glycolytic intermediates tended to accumulate to unrealistically high concentrations. Combining all adjustments yielded an accurate correspondence between model and experiments for all five steady-state and dynamic conditions. This enhances our understanding of in vivo metabolism in terms of in vitro biochemistry.

  9. Investigation on the Metabolic Regulation of pgi gene knockout Escherichia coli by Enzyme Activities and Intracellular Metabolite Concentrations

    Directory of Open Access Journals (Sweden)

    Nor ‘Aini, A. R.

    2006-01-01

    Full Text Available An integrated analysis of the cell growth characteristics, enzyme activities, intracellular metabolite concentrations was made to investigate the metabolic regulation of pgi gene knockout Escherichia coli based on batch culture and continuous culture which was performed at the dilution rate of 0.2h-1. The enzymatic study identified that pathways of pentose phosphate, ED pathway and glyoxylate shunt were all active in pgi mutant. The glycolysis enzymes i.e glyceraldehyde-3-phosphate dehydrogenase, fructose diphosphatase, pyruvate kinase, triose phosphate isomerase were down regulated implying that the inactivation of pgi gene reduced the carbon flux through glycolytic pathway. Meanwhile, the pentose phosphate pathway was active as a major route for intermediary carbohydrate metabolism instead of glycolysis. The pentose phosphate pathway generates most of the major reducing co-factor NADPH as shown by the increased of NADPH/NADP+ ratio in the mutant when compared with the parent strain. The fermentative enzymes such as acetate kinase and lactate dehydrogenase were down regulated in the mutant. Knockout of pgi gene results in the significant increase in the intracellular concentration of glucose-6-phosphate and decrease in the concentration of oxaloacetate. The slow growth rate of the mutant was assumed to be affected by the accumulation of glucose-6-phosphate and imbalance of NADPH reoxidation.

  10. Engineering a functional 1-deoxy-D-xylulose 5-phosphate (DXP) pathway in Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Kirby, James [Univ. of California, Berkeley, CA (United States). California Institute of Quantitative Biosciences (QB3); Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Dietzel, Kevin L. [Amyris, inc., Emeryville, CA (United States); Wichmann, Gale [Amyris, inc., Emeryville, CA (United States); Chan, Rossana [Univ. of California, Berkeley, CA (United States). California Institute of Quantitative Biosciences (QB3); Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Antipov, Eugene [Amyris, inc., Emeryville, CA (United States); Moss, Nathan [Amyris, inc., Emeryville, CA (United States); Baidoo, Edward E. K. [Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Jackson, Peter [Amyris, inc., Emeryville, CA (United States); Gaucher, Sara P. [Amyris, inc., Emeryville, CA (United States); Gottlieb, Shayin [Amyris, inc., Emeryville, CA (United States); LaBarge, Jeremy [Amyris, inc., Emeryville, CA (United States); Mahatdejkul, Tina [Amyris, inc., Emeryville, CA (United States); Hawkins, Kristy M. [Amyris, inc., Emeryville, CA (United States); Muley, Sheela [Amyris, inc., Emeryville, CA (United States); Newman, Jack D. [Amyris, inc., Emeryville, CA (United States); Liu, Pinghua [Boston Univ., MA (United States). Dept. of Chemistry; Keasling, Jay D. [Univ. of California, Berkeley, CA (United States). California Institute of Quantitative Biosciences (QB3); Joint BioEnergy Inst. (JBEI), Emeryville, CA (United States); Univ. of California, Berkeley, CA (United States). Depts. of Chemical & Biomolecular Engineering and Bioengineering; Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Biological Systems & Engineering Div.; Technical Univ. of Denmark, Hoesholm (Denmark). Novo Nodisk Foundation Center for Biosustainability; Zhao, Lishan [Amyris, inc., Emeryville, CA (United States)

    2016-10-27

    Isoprenoids are made by all free-living organisms and range from essential metabolites like sterols and quinones to more complex compounds like pinene and rubber. They are used in many commercial applications and much work has gone into engineering microbial hosts for their production. Isoprenoids are produced either from acetyl-CoA via the mevalonate pathway or from pyruvate and glyceraldehyde 3-phosphate via the 1-deoxy-D-xylulose 5-phosphate (DXP) pathway. Saccharomyces cerevisiae exclusively utilizes the mevalonate pathway to synthesize native isoprenoids and in fact the alternative DXP pathway has never been found or successfully reconstructed in the eukaryotic cytosol. There are, however, several advantages to isoprenoid synthesis via the DXP pathway, such as a higher theoretical yield, and it has long been a goal to transplant the pathway into yeast. In this work, we investigate and address barriers to DXP pathway functionality in S. cerevisiae using a combination of synthetic biology, biochemistry and metabolomics. We report, for the first time, functional expression of the DXP pathway in S. cerevisiae. Under low aeration conditions, an engineered strain relying solely on the DXP pathway for isoprenoid biosynthesis achieved an endpoint biomass 80% of that of the same strain using the mevalonate pathway.

  11. Identification of novel allergen in edible insect, Gryllus bimaculatus and its cross-reactivity with Macrobrachium spp. allergens.

    Science.gov (United States)

    Srinroch, Chutima; Srisomsap, Chantragan; Chokchaichamnankit, Daranee; Punyarit, Phaibul; Phiriyangkul, Pharima

    2015-10-01

    Edible insects have recently been promoted as a source of protein and have a high nutrition value. Identification of allergens and cross-reactivity between Macrobrachium spp. and the field cricket (Gryllus bimaculatus) is necessary for food safety control and to assist in the diagnosis and therapy of allergy symptoms. Denaturing polyacrylamide gel electrophoresis (SDS-PAGE) was used to separate proteins. Allergens were determined and identified by IgE-immunoblotting with pooled sera from prawn-allergic patients (n=16) and LC-MS/MS. Arginine kinase (AK) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were determined as the important allergens in muscle of Macrobrachium rosenbergii whereas, hemocyanin (HC) was identified as an allergen in Macrobrachium spp. The allergens in Macrobrachium lanchesteri were identified as AK and HC. In addition, hexamerin1B (HEX1B) was identified as a novel and specific allergen in G. bimaculatus. The important allergen in G. bimaculatus and Macrobrachium spp. is AK and was found to cross-react between both species.

  12. fireball/amber: An Efficient Local-Orbital DFT QM/MM Method for Biomolecular Systems.

    Science.gov (United States)

    Mendieta-Moreno, Jesús I; Walker, Ross C; Lewis, James P; Gómez-Puertas, Paulino; Mendieta, Jesús; Ortega, José

    2014-05-13

    In recent years, quantum mechanics/molecular mechanics (QM/MM) methods have become an important computational tool for the study of chemical reactions and other processes in biomolecular systems. In the QM/MM technique, the active region is described by means of QM calculations, while the remainder of the system is described using a MM approach. Because of the complexity of biomolecules and the desire to achieve converged sampling, it is important that the QM method presents a good balance between accuracy and computational efficiency. Here, we report on the implementation of a QM/MM technique that combines a DFT approach specially designed for the study of complex systems using first-principles molecular dynamics simulations (fireball) with the amber force fields and simulation programs. We also present examples of the application of this QM/MM approach to three representative biomolecular systems: the analysis of the effect of electrostatic embedding in the behavior of a salt bridge between an aspartic acid and a lysine residue, a study of the intermediate states for the triosephosphate isomerase catalyzed conversion of dihydroxyacetone phosphate into glyceraldehyde 3-phosphate, and the detailed description, using DFT QM/MM molecular dynamics, of the cleavage of a phosphodiester bond in RNA catalyzed by the enzyme RNase A.

  13. Biochemical and cellular effects of electrophiles present in ambient air samples

    Science.gov (United States)

    Iwamoto, Noriko; Nishiyama, Akira; Eiguren-Fernandez, Arantzazu; Hinds, William; Kumagai, Yoshito; Froines, John R.; Cho, Arthur K.; Shinyashiki, Masaru

    2010-04-01

    Ambient vapor-phase samples collected in Riverside, California had shown that both redox and electrophilic activity were present, with the vapor phase containing higher levels of electrophiles than the particle phase. In this study, the biochemical effects of the vapor-phase electrophiles were examined using the purified thiol proteins, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), protein tyrosine phosphatase 1B (PTP1B) and KELCH-1 like ECH-associated protein 1 (Keap1). The results demonstrated that the thiol proteins were inactivated by the vapor-phase samples through covalent modifications. Next, two cellular responses, epidermal growth factor receptor (EGFR)/mitogen-activated protein (MAP) kinase and NF-E2-related factor 2 (Nrf2), to the ambient vapor-phase samples were assessed in A549 and RAW 264.7 cell lines, respectively. The vapor-phase samples, at non-oxidative concentrations, increased phosphorylation of EGFR, which is negatively regulated by PTP1B, and its downstream MAP kinase, extracellular signal-regulated kinase (ERK)1/2. Activation of Nrf2, which requires Keap1 alkylation, and expression of its downstream proteins were also observed. The electrophilic compounds present in ambient vapor-phase were shown to modify cellular proteins through covalent modification and to activate diverse cellular responses that can lead to inflammatory and adaptive responses.

  14. Multi-sample immunoassay inside optical fiber capillary enabled by evanescent wave detection

    Directory of Open Access Journals (Sweden)

    Chun-Wei Wang

    2016-03-01

    Full Text Available A novel evanescent wave-based (EW microfluidic capillary fiber-optic biosensor (MCFOB has been developed using capillaries as a transducer embedded in a multichannel device to enhance the collection efficiency of the fluorescence signal. The capillary serves dual roles as a waveguide and a container, enabling more straightforward, consistent, and compact biosensor packaging compared to conventional optical fiber biosensors and microfluidic systems. In order to detect multiple samples in one device, the biosensor incorporates a polydimethysiloxane (PDMS multi-channel device, which also serves as cladding for the biosensor. In addition, this biosensor only consumes 10 μl of a sample and does not require hydrofluoric acid etching in the fabrication process. The orientation for signal collection is optimized by comparing the lateral and normal signal directions for detected glyceraldehyde 3-phosphate dehydrogenase (GAPDH. C-reactive protein (CRP is used to validate the MCFOB, and the limit of detection (LOD for CRP in the MCFOB is 1.94 ng/ml (74 pM. Moreover, the real-time measurement is demonstrated to verify that the evanescent wave is the only exciting light source in the MCFOB, which gives the potential for real-time measurement applications.

  15. The multifaceted roles of metabolic enzymes in the Paracoccidioides species complex

    Science.gov (United States)

    Marcos, Caroline M.; de Oliveira, Haroldo C.; da Silva, Julhiany de F.; Assato, Patrícia A.; Fusco-Almeida, Ana M.; Mendes-Giannini, Maria J. S.

    2014-01-01

    Paracoccidioides species are dimorphic fungi and are the etiologic agents of paracoccidioidomycosis, which is a serious disease that involves multiple organs. The many tissues colonized by this fungus suggest a variety of surface molecules involved in adhesion. A surprising finding is that most enzymes in the glycolytic pathway, tricarboxylic acid (TCA) cycle and glyoxylate cycle in Paracoccidioides spp. have adhesive properties that aid in interacting with the host extracellular matrix and thus act as ‘moonlighting’ proteins. Moonlighting proteins have multiple functions, which adds a dimension to cellular complexity and benefit cells in several ways. This phenomenon occurs in both eukaryotes and prokaryotes. For example, moonlighting proteins from the glycolytic pathway or TCA cycle can play a role in bacterial pathogenesis by either acting as proteins secreted in a conventional pathway and/or as cell surface components that facilitate adhesion or adherence. This review outlines the multifunctionality exhibited by many Paracoccidioides spp. enzymes, including aconitase, aldolase, glyceraldehyde-3-phosphate dehydrogenase, isocitrate lyase, malate synthase, triose phosphate isomerase, fumarase, and enolase. We discuss the roles that moonlighting activities play in the virulence characteristics of this fungus and several other human pathogens during their interactions with the host. PMID:25566229

  16. Sex determination using free fetal DNA in early pregnancy: With the approach to sex linked recessive disorders

    Directory of Open Access Journals (Sweden)

    Amir Monfaredan

    2017-03-01

    Full Text Available Introduction: Prenatal diagnosis is testing for detection of diseases or conditions in a fetus or embryo before it is born. Most of prenatal diagnostic (PD techniques are invasive and done in late stages of pregnancy. Using fetal DNA in maternal blood for fetal sex determination in early pregnancy might help in management of X-linked genetic diseases. This study aimed to investigate the accuracy of sex determination using fetal DNA in maternal blood at 8-12 weeks of gestation. Methods: In this cross-sectional study, 30 pregnant women at 8-12 weeks of gestation were enrolled. The sex-determining region Y (SRY gene expression with the internal control (IC glyceraldehyde 3-phosphate dehydrogenase (GAPDH was investigated with quantitative real-time polymerase chain reaction (PCR using specific primers and probes. Results: Accuracy of sex determination with SRY gene expression in 8-12 weeks of pregnancy were 85%, 85%, 90% and 100% respectively. Conclusion: It seems that fetal sex determining using fetal DNA in maternal blood is a reliable method for early stage of pregnancy.

  17. Trypanosoma evansi is alike to Trypanosoma brucei brucei in the subcellular localisation of glycolytic enzymes

    Directory of Open Access Journals (Sweden)

    S Andrea Moreno

    2015-06-01

    Full Text Available Trypanosoma evansi, which causes surra, is descended from Trypanosoma brucei brucei, which causes nagana. Although both parasites are presumed to be metabolically similar, insufficient knowledge of T. evansi precludes a full comparison. Herein, we provide the first report on the subcellular localisation of the glycolytic enzymes in T. evansi, which is a alike to that of the bloodstream form (BSF of T. b. brucei: (i fructose-bisphosphate aldolase, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, hexokinase, phosphofructokinase, glucose-6-phosphate isomerase, phosphoglycerate kinase, triosephosphate isomerase (glycolytic enzymes and glycerol-3-phosphate dehydrogenase (a glycolysis-auxiliary enzyme in glycosomes, (ii enolase, phosphoglycerate mutase, pyruvate kinase (glycolytic enzymes and a GAPDH isoenzyme in the cytosol, (iii malate dehydrogenase in cytosol and (iv glucose-6-phosphate dehydrogenase in both glycosomes and the cytosol. Specific enzymatic activities also suggest that T. evansi is alike to the BSF of T. b. brucei in glycolytic flux, which is much faster than the pentose phosphate pathway flux, and in the involvement of cytosolic GAPDH in the NAD+/NADH balance. These similarities were expected based on the close phylogenetic relationship of both parasites.

  18. Coordination of glycerol utilization and clavulanic acid biosynthesis to improve clavulanic acid production in Streptomyces clavuligerus.

    Science.gov (United States)

    Guo, Dekun; Zhao, Youbao; Yang, Keqian

    2013-07-01

    The glycerol utilization (gyl) operon is involved in clavulanic acid (CA) production by Streptomyces clavuligerus, and possibly supplies the glyceraldehyde-3-phosphate (G3P) precursor for CA biosynthesis. The gyl operon is regulated by GylR and is induced by glycerol. To enhance CA production in S. clavuligerus, an extra copy of ccaR expressed from Pgyl (the gyl promoter) was integrated into the chromosome of S. clavuligerus NRRL 3585. This construct coordinated the transcription of CA biosynthetic pathway genes with expression of the gyl operon. In the transformants carrying the Pgyl-controlled regulatory gene ccaR, CA production was enhanced 3.19-fold in glycerol-enriched batch cultures, relative to the control strain carrying an extra copy of ccaR controlled by its own promoter (PccaR). Consistent with enhanced CA production, the transcription levels of ccaR, ceas2 and claR were significantly up-regulated in the transformants containing Pgyl-controlled ccaR.

  19. Improved polysaccharide production in a submerged culture of Ganoderma lucidum by the heterologous expression of Vitreoscilla hemoglobin gene.

    Science.gov (United States)

    Li, Huan-Jun; Zhang, De-Huai; Yue, Tong-Hui; Jiang, Lu-Xi; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2016-01-10

    Expression of Vitreoscilla hemoglobin (VHb) gene was used to improve polysaccharide production in Ganoderma lucidum. The VHb gene, vgb, under the control of the constitutive glyceraldehyde-3-phosphate dehydrogenase gene promoter was introduced into G. lucidum. The activity of expressed VHb was confirmed by the observation of VHb specific CO-difference spectrum with a maximal absorption at 419 nm for the transformant. The effects of VHb expression on intracellular polysaccharide (IPS) content, extracellular polysaccharide (EPS) production and transcription levels of three genes encoding the enzymes involved in polysaccharide biosynthesis, including phosphoglucomutase (PGM), uridine diphosphate glucose pyrophosphorylase (UGP), and β-1,3-glucan synthase (GLS), were investigated. The maximum IPS content and EPS production in the vgb-bearing G. lucidum were 26.4 mg/100mg dry weight and 0.83 g/L, respectively, which were higher by 30.5% and 88.2% than those of the wild-type strain. The transcription levels of PGM, UGP and GLS were up-regulated by 1.51-, 1.55- and 3.83-fold, respectively, in the vgb-bearing G. lucidum. This work highlights the potential of VHb to enhance G. lucidum polysaccharide production by large scale fermentation.

  20. Critical protein GAPDH and its regulator y mechanisms in cancer cells

    Institute of Scientific and Technical Information of China (English)

    Jin-Ying Zhang; Fan Zhang; Chao-Qun Hong; Armando E Giuliano; Xiao-Jiang Cui; Guang-Ji Zhou; Guo-Jun Zhang; Yu-Kun Cui

    2015-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), initially identified as a glycolytic enzyme and considered as a housekeeping gene, is widely used as an internal control in experiments on proteins, mRNA, and DNA. However, emerging evidence indicates that GAPDH is implicated in diverse functions independent of its role in energy metabolism;the expression status of GAPDH is also deregulated in various cancer cells. One of the most common effects of GAPDH is its inconsistent role in the determination of cancer cell fate. Furthermore, studies have described GAPDH as a regulator of cell death;other studies have suggested that GAPDH participates in tumor progression and serves as a new therapeutic target. However, related regulatory mechanisms of its numerous cellular functions and deregulated expression levels remain unclear. GAPDH is tightly regulated at transcriptional and posttranscriptional levels, which are involved in the regulation of diverse GAPDH functions. Several cancer-related factors, such as insulin, hypoxia inducible factor-1 (HIF-1), p53, nitric oxide (NO), and acetylated histone, not only modulate GAPDH gene expression but also affect protein functions via common pathways. Moreover, posttranslational modiifcations (PTMs) occurring in GAPDH in cancer cells result in new activities unrelated to the original glycolytic function of GAPDH. In this review, recent ifndings related to GAPDH transcriptional regulation and PTMs are summarized. Mechanisms and pathways involved in GAPDH regulation and its different roles in cancer cells are also described.

  1. Transcriptional changes associated with ethanol tolerance in Saccharomyces cerevisiae.

    Science.gov (United States)

    Stanley, Dragana; Chambers, Paul J; Stanley, Grant A; Borneman, Anthony; Fraser, Sarah

    2010-09-01

    Saccharomyces spp. are widely used for ethanol production; however, fermentation productivity is negatively affected by the impact of ethanol accumulation on yeast metabolic rate and viability. This study used microarray and statistical two-way ANOVA analysis to compare and evaluate gene expression profiles of two previously generated ethanol-tolerant mutants, CM1 and SM1, with their parent, Saccharomyces cerevisiae W303-1A, in the presence and absence of ethanol stress. Although sharing the same parentage, the mutants were created differently: SM1 by adaptive evolution involving long-term exposure to ethanol stress and CM1 using chemical mutagenesis followed by adaptive evolution-based screening. Compared to the parent, differences in the expression levels of genes associated with a number of gene ontology categories in the mutants suggest that their improved ethanol stress response is a consequence of increased mitochondrial and NADH oxidation activities, stimulating glycolysis and other energy-yielding pathways. This leads to increased activity of energy-demanding processes associated with the production of proteins and plasma membrane components, which are necessary for acclimation to ethanol stress. It is suggested that a key function of the ethanol stress response is restoration of the NAD(+)/NADH redox balance, which increases glyceraldehyde-3-phosphate dehydrogenase activity, and higher glycolytic flux in the ethanol-stressed cell. Both mutants achieved this by a constitutive increase in carbon flux in the glycerol pathway as a means of increasing NADH oxidation.

  2. Proteomics analysis of antimalarial targets of Garcinia mangostana Linn.

    Institute of Scientific and Technical Information of China (English)

    Wanna Chaijaroenkul; Artitiya Thiengsusuk; Kanchana Rungsihirunrat; Stephen Andrew Ward; Kesara Na-Bangchang

    2014-01-01

    Objective: To investigate possible protein targets for antimalarial activity of Garcinia mangostana Linn. (G. mangostana) (pericarp) in 3D7 Plasmodium falciparum clone using 2-dimensional electrophoresis and liquid chromatography mass-spectrometry (LC/MS/MS). Methods: 3D7 Plasmodium falciparum was exposed to the crude ethanolic extract of G.mangostana Linn. (pericarp) at the concentrations of 12µg/mL (IC50 level: concentration that inhibits parasite growth by 50%) and 30 µg/mL (IC90 level: concentration that inhibits parasite growth by 90%) for 12 h. Parasite proteins were separated by 2-dimensional electrophoresis and identified by LC/MS/MS.Results:At the IC50 concentration, about 82% of the expressed parasite proteins were matched with the control (non-exposed), while at the IC90 concentration, only 15% matched proteins were found. The selected protein spots from parasite exposed to the plant extract at the concentration of 12 µg/mL were identified as enzymes that play role in glycolysis pathway, i.e., phosphoglycerate mutase putative, L-lactate dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase, and fructose-bisphosphate aldolase/phosphoglycerate kinase. The proteosome was found in parasite exposed to 30 µg/mL of the extract.Conclusions:Results suggest that proteins involved in the glycolysis pathway may be the targets for antimalarial activity of G. mangostana Linn. (pericarp).

  3. Proteomics analysis of antimalarial targets of Garcinia mangostana Linn.

    Institute of Scientific and Technical Information of China (English)

    Wanna; Chaijaroenkul; Artitiya; Thiengsusuk; Kanchana; Rungsihirunrat; Stephen; Andrew; Ward; Kesara; Na-Bangchang

    2014-01-01

    Objective:To investigate possible protein targets for antimalarial activity of Garcina mangostana Linn.(G.mangostana)(pericarp)in 3D7 Plasmodium falciparum clone using 2-dimensional electrophoresis and liquid chromatography mass-spectrometry(LC/MS/MS).Methods:3D7 Plasmodium falciparum was exposed to the crude ethanolic extract of G.mangostana Linn.(pericarp)at the concentrations of 12μg/mL(1C50level:concentration that inhibits parasite growth by 50%)and 30μg/mL(1C90level:concentration that inhibits parasite growth by 90%)for 12 h.Parasite proteins were separated by 2-dimensional electrophoresis and identified by LC/MS/MS.Results:At the IC50concentration,about 82%of the expressed parasite proteins were matched with the control(non-exposed),while at the IC90concentration,only 15%matched proteins were found.The selected protein spots from parasite exposed to the plant extract at the concentration of 12μg/mL were identified as eneymes that play role in glycolysis pathway,i.e.,phosphoglyeerate mutase putative,L-lactate dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase,and fruetose-bisphosphate aldolase/phosphoglyeerate kinase.The proteosome was found in parasite exposed to 30μg/mL of the extract.Conclusions:Results suggest that proteins involved in the glycolysis pathway may be the targets for antimalarial activity of G.mangostana Linn.(pericarp).

  4. DNA sequence analysis of herbarium specimens facilitates the revival of Botrytis mali, a postharvest pathogen of apple.

    Science.gov (United States)

    O'Gorman, Daniel T; Sholberg, Peter L; Stokes, Sarah C; Ginns, J

    2008-01-01

    The fungus Botrytis cinerea has been widely accepted as the species responsible for causing gray mold decay of apple, although a second species causing apple decay, B. mali, was reported in 1931. Botrytis mali was validly published in 1931, nevertheless it has always been considered a doubtful species. To study the relationship of Botrytis isolates causing gray mold on apple, DNA sequence analysis was employed. Twenty-eight Botrytis isolates consisting of 10 species were sampled, including two B. mali herbarium specimens from apple originally deposited in 1932. The DNA sequence analysis of the beta-tubulin and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) genes placed the isolates into groupings with defined species boundaries that generally reflected the morphologically based model for Botrytis classification. The B. cinerea isolates from apple and other host plants were placed in a single clade. The B. mali herbarium specimens however always fell well outside that clade. The DNA sequence analysis reported in this study support the initial work by Ruehle (1931) describing the apple pathogen B. mali as a unique species.

  5. Anchorless surface associated glycolytic enzymes from Lactobacillus plantarum 299v bind to epithelial cells and extracellular matrix proteins.

    Science.gov (United States)

    Glenting, Jacob; Beck, Hans Christian; Vrang, Astrid; Riemann, Holger; Ravn, Peter; Hansen, Anne Maria; Antonsson, Martin; Ahrné, Siv; Israelsen, Hans; Madsen, Søren

    2013-06-12

    An important criterion for the selection of a probiotic bacterial strain is its ability to adhere to the mucosal surface. Adhesion is usually mediated by proteins or other components located on the outer cell surface of the bacterium. In the present study we characterized the adhesive properties of two classical intracellular enzymes glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and enolase (ENO) isolated from the outer cell surface of the probiotic bacterium Lactobacillus plantarum 299v. None of the genes encoded signal peptides or cell surface anchoring motifs that could explain their extracellular location on the bacterial surface. The presence of the glycolytic enzymes on the outer surface was verified by western blotting using polyclonal antibodies raised against the specific enzymes. GAPDH and ENO showed a highly specific binding to plasminogen and fibronectin whereas GAPDH but not ENO showed weak binding to mucin. Furthermore, a pH dependent and specific binding of GAPDH and ENO to intestinal epithelial Caco-2 cells at pH 5 but not at pH 7 was demonstrated. The results showed that these glycolytic enzymes could play a role in the adhesion of the probiotic bacterium L. plantarum 299v to the gastrointestinal tract of the host. Finally, a number of probiotic as well non-probiotic Lactobacillus strains were analyzed for the presence of GAPDH and ENO on the outer surface, but no correlation between the extracellular location of these enzymes and the probiotic status of the applied strains was demonstrated.

  6. Selection of suitable endogenous reference genes for qPCR in kidney and hypothalamus of rats under testosterone influence.

    Science.gov (United States)

    Gholami, Khadijeh; Loh, Su Yi; Salleh, Naguib; Lam, Sau Kuen; Hoe, See Ziau

    2017-01-01

    Real-time quantitative PCR (qPCR) is the most reliable and accurate technique for analyses of gene expression. Endogenous reference genes are being used to normalize qPCR data even though their expression may vary under different conditions and in different tissues. Nonetheless, verification of expression of reference genes in selected studied tissue is essential in order to accurately assess the level of expression of target genes of interest. Therefore, in this study, we attempted to examine six commonly used reference genes in order to identify the gene being expressed most constantly under the influence of testosterone in the kidneys and hypothalamus. The reference genes include glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin beta (ACTB), beta-2 microglobulin (B2m), hypoxanthine phosphoribosyltransferase 1 (HPRT), peptidylprolylisomerase A (Ppia) and hydroxymethylbilane synthase (Hmbs). The cycle threshold (Ct) value for each gene was determined and data obtained were analyzed using the software programs NormFinder, geNorm, BestKeeper, and rank aggregation. Results showed that Hmbs and Ppia genes were the most stably expressed in the hypothalamus. Meanwhile, in kidneys, Hmbs and GAPDH appeared to be the most constant genes. In conclusion, variations in expression levels of reference genes occur in kidneys and hypothalamus under similar conditions; thus, it is important to verify reference gene levels in these tissues prior to commencing any studies.

  7. Detection of Restructuring of Transgenic Copy Number of Pichia Engineering Bacteria with Fluorescence Quantitative PCR Method%荧光定量PCR法检测重组毕赤酵母工程菌的外源基因拷贝数

    Institute of Scientific and Technical Information of China (English)

    郭晋霞; 何云凤; 范开

    2016-01-01

    提出了重组毕赤酵母工程菌pPICZ-DT30/GS115基因组中外源基因DT30拷贝数的实时荧光定量PCR方法.该重组工程菌用来表达人胰岛素前体(PI-DT30),其表达量的高低、菌种稳定性对工艺研究及整体项目成本等有重大影响.外源基因拷贝数是检测表达量的一个重要指标.该方法中,利用毕赤酵母的看家基因GAP(Glyceraldehyde-3-phosphate dehydrogenase)为内参,分别建立含GAP基因和DT30基因的双标准曲线.将工程菌基因组进行荧光定量PCR,根据标准曲线和Ct值计算目的基因DT30在重组毕赤酵母工程菌中的拷贝数,结果为7个.

  8. Diversity and Enzymatic Profiling of Halotolerant Micromycetes from Sebkha El Melah, a Saharan Salt Flat in Southern Tunisia

    Directory of Open Access Journals (Sweden)

    Atef Jaouani

    2014-01-01

    Full Text Available Twenty-one moderately halotolerant fungi have been isolated from sample ashes collected from Sebkha El Melah, a Saharan salt flat located in southern Tunisia. Based on morphology and sequence inference from the internal transcribed spacer regions, 28S rRNA gene and other specific genes such as β-tubulin, actin, calmodulin, and glyceraldehyde-3-phosphate dehydrogenase, the isolates were found to be distributed over 15 taxa belonging to 6 genera of Ascomycetes: Cladosporium (n=3, Alternaria (n=4, Aspergillus (n=3, Penicillium (n=5, Ulocladium (n=2, and Engyodontium (n=2. Their tolerance to different concentrations of salt in solid and liquid media was examined. Excepting Cladosporium cladosporioides JA18, all isolates were considered as alkali-halotolerant since they were able to grow in media containing 10% of salt with an initial pH 10. All isolates were resistant to oxidative stresses and low temperature whereas 5 strains belonging to Alternaria, Ulocladium, and Aspergillus genera were able to grow at 45°C. The screening of fungal strains for sets of enzyme production, namely, cellulase (CMCase, amylase, protease, lipase, and laccase, in presence of 10% NaCl, showed a variety of extracellular hydrolytic and oxidative profiles. Protease was the most abundant enzyme produced whereas laccase producers were members of the genus Cladosporium.

  9. Diversity and enzymatic profiling of halotolerant micromycetes from Sebkha El Melah, a Saharan salt flat in southern Tunisia.

    Science.gov (United States)

    Jaouani, Atef; Neifar, Mohamed; Prigione, Valeria; Ayari, Amani; Sbissi, Imed; Ben Amor, Sonia; Ben Tekaya, Seifeddine; Varese, Giovanna Cristina; Cherif, Ameur; Gtari, Maher

    2014-01-01

    Twenty-one moderately halotolerant fungi have been isolated from sample ashes collected from Sebkha El Melah, a Saharan salt flat located in southern Tunisia. Based on morphology and sequence inference from the internal transcribed spacer regions, 28S rRNA gene and other specific genes such as β-tubulin, actin, calmodulin, and glyceraldehyde-3-phosphate dehydrogenase, the isolates were found to be distributed over 15 taxa belonging to 6 genera of Ascomycetes: Cladosporium (n = 3), Alternaria (n = 4), Aspergillus (n = 3), Penicillium (n = 5), Ulocladium (n = 2), and Engyodontium (n = 2). Their tolerance to different concentrations of salt in solid and liquid media was examined. Excepting Cladosporium cladosporioides JA18, all isolates were considered as alkali-halotolerant since they were able to grow in media containing 10% of salt with an initial pH 10. All isolates were resistant to oxidative stresses and low temperature whereas 5 strains belonging to Alternaria, Ulocladium, and Aspergillus genera were able to grow at 45°C. The screening of fungal strains for sets of enzyme production, namely, cellulase (CMCase), amylase, protease, lipase, and laccase, in presence of 10% NaCl, showed a variety of extracellular hydrolytic and oxidative profiles. Protease was the most abundant enzyme produced whereas laccase producers were members of the genus Cladosporium.

  10. Biochemical basis for the biological clock

    Science.gov (United States)

    Morre, D. James; Chueh, Pin-Ju; Pletcher, Jake; Tang, Xiaoyu; Wu, Lian-Ying; Morre, Dorothy M.

    2002-01-01

    NADH oxidases at the external surface of plant and animal cells (ECTO-NOX proteins) exhibit stable and recurring patterns of oscillations with potentially clock-related, entrainable, and temperature-compensated period lengths of 24 min. To determine if ECTO-NOX proteins might represent the ultradian time keepers (pacemakers) of the biological clock, COS cells were transfected with cDNAs encoding tNOX proteins having a period length of 22 min or with C575A or C558A cysteine to alanine replacements having period lengths of 36 or 42 min. Here we demonstrate that such transfectants exhibited 22, 36, or 40 to 42 h circadian patterns in the activity of glyceraldehyde-3-phosphate dehydrogenase, a common clock-regulated protein, in addition to the endogenous 24 h circadian period length. The fact that the expression of a single oscillatory ECTO-NOX protein determines the period length of a circadian biochemical marker (60 X the ECTO-NOX period length) provides compelling evidence that ECTO-NOX proteins are the biochemical ultradian drivers of the cellular biological clock.

  11. β-Glucan synthase gene overexpression and β-glucans overproduction in Pleurotus ostreatus using promoter swapping.

    Science.gov (United States)

    Chai, Ran; Qiu, Cuiwei; Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

    2013-01-01

    Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi.

  12. Homocysteine and copper interact to promote type 5 phosphodiesterase expression in rabbit cavernosal smooth muscle cells

    Institute of Scientific and Technical Information of China (English)

    Matthew Hotston; Jamie Y.Jeremy; Jonathon Bloor; Nick S.Greaves; Raj Persad; Giarmi Angelini; Nilima Shukla

    2008-01-01

    Aim: To study the effects of homocysteine and copper on type 5 phosphodiesterase (PDE5) expression in cavernosal vascular smooth muscle cells (CVSMCs) and to investigate superoxide (O2) derived from nicotinamide adenine dinucleotide phosphate oxidase as homocysteine and copper generate O2, and O2- upregulates PDE5 expression.Methods: CVSMCs derived from rabbit penis were incubated with homocysteine or copper chloride with or without superoxide dismutase (SOD), catalase, sildenafil citrate, or apocynin (nicotinamide adenine dinucleotide phosphate inhibitor) for 16 h. The expression of PDE5 and of glyceraldehyde-3-phosphate dehydrogenase (internal standard) was assessed using Western blot analysis. In parallel, O2 was measured spectrophotometrically. Results: CuCl2alone (up to 10 μmol/L) and homocysteine alone (up to 100 μmol/L) had no effect on O2 formation in CVSMCs compared to controls. In combination, however, homocysteine and CuCl2 arkedly increased O2 formation, an effect blocked by SOD, catalase, apocynin, and sildenafil (1 μmol/L) when co-incubated over the same time course.PDE5 expression was also significantly increased in CVSMCs incubated with homocysteine and CuCl2, compared to controls. This effect was also negated by 16-h co-incubation with SOD, catalase, apocynin and sildenafil. Conclusion:This represents a novel pathogenic mechanism underlying ED, and indicates that the therapeutic actions of prolonged sildenafil use are mediated in part through inhibition of this pathway.

  13. Expression of hypoxia-inducible factors and vascular endothelial growth factor during pregnancy in the feline uterus.

    Science.gov (United States)

    Agaoglu, Ozgecan Korkmaz; Agaoglu, Ali Reha; Guzeloglu, Aydin; Kurar, Ercan; Kayis, Seyit Ali; Ozmen, Ozlem; Schäfer-Somi, Sabine; Aslan, Selim

    2015-07-01

    Hypoxia-inducible factors (HIFs) and vascular endothelial growth factor (VEGF) have critical roles during the development of the fetomaternal unit. The HIFs regulate placentation and vascularization by stimulation of VEGF gene expression. This study aimed to investigate the expression profiles of HIF gene family and VEGF in the cat uterus during pregnancy. Tissue samples of the whole uterine wall were collected after ovariohysterectomy and allocated to the following groups: embryo positive (group 1 [G1], n = 7, 7 days after mating), early pregnancy (group 2 [G2], n = 7, 20 days after mating), mid-pregnancy (group 3 [G3], n = 7, 24 days after mating), late pregnancy (group 4 [G4], n = 7, 30-45 days after mating), and oocyte positive groups (group 5 [G5], n = 7, 7 days after induction of ovulation with GnRH analog). Relative mRNA levels were determined by real-time polymerase chain reaction. As housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase was used. The relative gene expression of HIF1A in G5 was found to be significantly higher than that of other groups (G1, G2, G3, and G4) (P pregnancy and oocyte groups. The expression of HIF3A did not change significantly in any group investigated. These observations suggest that HIFs and VEGF may play a role in the establishment and development of pregnancy.

  14. Stromal Cells Positively and Negatively Modulate the Growth of Cancer Cells: Stimulation via the PGE2-TNFα-IL-6 Pathway and Inhibition via Secreted GAPDH-E-Cadherin Interaction

    Science.gov (United States)

    Kawada, Manabu; Inoue, Hiroyuki; Ohba, Shun-ichi; Yoshida, Junjiro; Masuda, Tohru; Yamasaki, Manabu; Usami, Ihomi; Sakamoto, Shuichi; Abe, Hikaru; Watanabe, Takumi; Yamori, Takao; Shibasaki, Masakatsu; Nomoto, Akio

    2015-01-01

    Fibroblast-like stromal cells modulate cancer cells through secreted factors and adhesion, but those factors are not fully understood. Here, we have identified critical stromal factors that modulate cancer growth positively and negatively. Using a cell co-culture system, we found that gastric stromal cells secreted IL-6 as a growth and survival factor for gastric cancer cells. Moreover, gastric cancer cells secreted PGE2 and TNFα that stimulated IL-6 secretion by the stromal cells. Furthermore, we found that stromal cells secreted glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Extracellular GAPDH, or its N-terminal domain, inhibited gastric cancer cell growth, a finding confirmed in other cell systems. GAPDH bound to E-cadherin and downregulated the mTOR-p70S6 kinase pathway. These results demonstrate that stromal cells could regulate cancer cell growth through the balance of these secreted factors. We propose that negative regulation of cancer growth using GAPDH could be a new anti-cancer strategy. PMID:25785838

  15. Structure of tagatose-1,6-bisphosphate aldolase. Insight into chiral discrimination, mechanism, and specificity of class II aldolases.

    Science.gov (United States)

    Hall, David R; Bond, Charles S; Leonard, Gordon A; Watt, C Ian; Berry, Alan; Hunter, William N

    2002-06-14

    Tagatose-1,6-bisphosphate aldolase (TBPA) is a tetrameric class II aldolase that catalyzes the reversible condensation of dihydroxyacetone phosphate with glyceraldehyde 3-phosphate to produce tagatose 1,6-bisphosphate. The high resolution (1.45 A) crystal structure of the Escherichia coli enzyme, encoded by the agaY gene, complexed with phosphoglycolohydroxamate (PGH) has been determined. Two subunits comprise the asymmetric unit, and a crystallographic 2-fold axis generates the functional tetramer. A complex network of hydrogen bonds position side chains in the active site that is occupied by two cations. An unusual Na+ binding site is created using a pi interaction with Tyr183 in addition to five oxygen ligands. The catalytic Zn2+ is five-coordinate using three histidine nitrogens and two PGH oxygens. Comparisons of TBPA with the related fructose-1,6-bisphosphate aldolase (FBPA) identifies common features with implications for the mechanism. Because the major product of the condensation catalyzed by the enzymes differs in the chirality at a single position, models of FBPA and TBPA with their cognate bisphosphate products provide insight into chiral discrimination by these aldolases. The TBPA active site is more open on one side than FBPA, and this contributes to a less specific enzyme. The availability of more space and a wider range of aldehyde partners used by TBPA together with the highly specific nature of FBPA suggest that TBPA might be a preferred enzyme to modify for use in biotransformation chemistry.

  16. Pathogenesis of Chronic Hyperglycemia: From Reductive Stress to Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Liang-Jun Yan

    2014-01-01

    Full Text Available Chronic overnutrition creates chronic hyperglycemia that can gradually induce insulin resistance and insulin secretion impairment. These disorders, if not intervened, will eventually be followed by appearance of frank diabetes. The mechanisms of this chronic pathogenic process are complex but have been suggested to involve production of reactive oxygen species (ROS and oxidative stress. In this review, I highlight evidence that reductive stress imposed by overflux of NADH through the mitochondrial electron transport chain is the source of oxidative stress, which is based on establishments that more NADH recycling by mitochondrial complex I leads to more electron leakage and thus more ROS production. The elevated levels of both NADH and ROS can inhibit and inactivate glyceraldehyde 3-phosphate dehydrogenase (GAPDH, respectively, resulting in blockage of the glycolytic pathway and accumulation of glycerol 3-phospate and its prior metabolites along the pathway. This accumulation then initiates all those alternative glucose metabolic pathways such as the polyol pathway and the advanced glycation pathways that otherwise are minor and insignificant under euglycemic conditions. Importantly, all these alternative pathways lead to ROS production, thus aggravating cellular oxidative stress. Therefore, reductive stress followed by oxidative stress comprises a major mechanism of hyperglycemia-induced metabolic syndrome.

  17. Inactivation of sll1556 in Synechocystis strain PCC 6803 impairs isoprenoid biosynthesis from pentose phosphate cycle substrates in vitro.

    Science.gov (United States)

    Poliquin, Kelly; Ershov, Yuri V; Cunningham, Francis X; Woreta, Tinsay T; Gantt, R Raymond; Gantt, Elisabeth

    2004-07-01

    In cyanobacteria many compounds, including chlorophylls, carotenoids, and hopanoids, are synthesized from the isoprenoid precursors isopentenyl diphosphate (IPP) and dimethylallyl diphosphate. Isoprenoid biosynthesis in extracts of the cyanobacterium Synechocystis strain PCC 6803 grown under photosynthetic conditions, stimulated by pentose phosphate cycle substrates, does not appear to require methylerythritol phosphate pathway intermediates. The sll1556 gene, distantly related to type 2 IPP isomerase genes, was disrupted by insertion of a Kanr cassette. The mutant was fully viable under photosynthetic conditions although impaired in the utilization of pentose phosphate cycle substrates. Compared to the parental strain the Deltasll1556 mutant (i) is deficient in isoprenoid biosynthesis in vitro with substrates including glyceraldehyde-3-phosphate, fructose-6-phosphate, and glucose-6-phosphate; (ii) has smaller cells (diameter ca. 13% less); (iii) has fewer thylakoids (ca. 30% less); and (iv) has a more extensive fibrous outer wall layer. Isoprenoid biosynthesis is restored with pentose phosphate cycle substrates plus the recombinant Sll1556 protein in the Deltasll1556 supernatant fraction. IPP isomerase activity could not be demonstrated for the purified Sll1556 protein under our in vitro conditions. The reduction of thylakoid area and the effect on outer wall layer components are consistent with an impairment of isoprenoid biosynthesis in the mutant, possibly via hopanoid biosynthesis. Our findings are consistent with an alternate metabolic shunt for biosynthesis of isoprenoids. Copyright 2004 American Society for Microbiology

  18. Spectroscopic investigation of UV irradiated enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Ware, D.L.; Hibbard, L.B. (Spelman College, Atlanta, GA (United States))

    1993-01-01

    Trptophan (Trp) undergoes photolysis when exposed to light in the near UV region. The enzyme systems horse liver alcohol dehydrogenase (HLAD) and glyceraldehyde 3-phosphate dehydrogenase (G3PDH), which contain two and three Trps respectively, were chosen for analysis of Trp photolysis. Aqueous solutions of HLAD and G3PDH were irradiated at either 295 or 335nm with a xenon lamp. Tryptophan fluorescence was monitored at half hour intervals for two hours in the case of HLAD and one hour in the case of G3PDH. The decrease in fluorescence from 295 irradiation was compared to the fluorescence decrease from 335 irradiation and was found to be similar for both the HLAD and G3PDH samples irradiated at 295nm and for both samples irradiated at 335nm. It was found that, for HLAD, the 295 irradiation caused a decrease in fluorescence of 90% as compared to a decrease of only 12% of 335nm. Enzymatic assays were then performed to determine the enzymatic activity before and after irradiation.

  19. Human GAPDH Is a Target of Aspirin's Primary Metabolite Salicylic Acid and Its Derivatives.

    Science.gov (United States)

    Choi, Hyong Woo; Tian, Miaoying; Manohar, Murli; Harraz, Maged M; Park, Sang-Wook; Schroeder, Frank C; Snyder, Solomon H; Klessig, Daniel F

    2015-01-01

    The plant hormone salicylic acid (SA) controls several physiological processes and is a key regulator of multiple levels of plant immunity. To decipher the mechanisms through which SA's multiple physiological effects are mediated, particularly in immunity, two high-throughput screens were developed to identify SA-binding proteins (SABPs). Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH) from plants (Arabidopsis thaliana) was identified in these screens. Similar screens and subsequent analyses using SA analogs, in conjunction with either a photoaffinity labeling technique or surface plasmon resonance-based technology, established that human GAPDH (HsGAPDH) also binds SA. In addition to its central role in glycolysis, HsGAPDH participates in several pathological processes, including viral replication and neuronal cell death. The anti-Parkinson's drug deprenyl has been shown to suppress nuclear translocation of HsGAPDH, an early step in cell death and the resulting cell death induced by the DNA alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine. Here, we demonstrate that SA, which is the primary metabolite of aspirin (acetyl SA) and is likely responsible for many of its pharmacological effects, also suppresses nuclear translocation of HsGAPDH and cell death. Analysis of two synthetic SA derivatives and two classes of compounds from the Chinese medicinal herb Glycyrrhiza foetida (licorice), glycyrrhizin and the SA-derivatives amorfrutins, revealed that they not only appear to bind HsGAPDH more tightly than SA, but also exhibit a greater ability to suppress translocation of HsGAPDH to the nucleus and cell death.

  20. Secretion, purification, and characterisation of barley alpha-amylase produced by heterologous gene expression in Aspergillus niger.

    Science.gov (United States)

    Juge, N; Svensson, B; Williamson, G

    1998-04-01

    Efficient production of recombinant barley alpha-amylase has been achieved in Aspergillus niger. The cDNA encoding alpha-amylase isozyme 1 (AMY1) and its signal peptide was placed under the control of the Aspergillus nidulans glyceraldehyde-3-phosphate dehydrogenase (gpd) promoter and the A. nidulans trpC gene terminator. Secretion yields up to 60 mg/l were obtained in media optimised for alpha-amylase activity and low protease activity. The recombinant AMY1 (reAMY1) was purified to homogeneity and found to be identical to native barley AMY1 with respect to size, pI, and immunoreactivity. N-terminal sequence analysis of the recombinant protein indicated that the endogenous plant signal peptide is correctly processed in A. niger. Electrospray ionisation/mass spectrometry gave a molecular mass for the dominant form of 44,960 Da, in accordance with the loss of the LQRS C-terminal residues; glycosylation apparently did not occur. The activities of recombinant and native barley alpha-amylases are very similar towards insoluble and soluble starch as well as 2-chloro-4-nitrophenol beta-D-maltoheptaoside and amylose (degree of polymerisation = 17). Barley alpha-amylase is the first plant protein efficiently secreted and correctly processed by A. niger using its own signal sequence.

  1. Development of strains of the thermotolerant yeast Hansenula polymorpha capable of alcoholic fermentation of starch and xylan.

    Science.gov (United States)

    Voronovsky, Andriy Y; Rohulya, Olha V; Abbas, Charles A; Sibirny, Andriy A

    2009-01-01

    The thermotolerant yeast Hansenula polymorpha ferments glucose and xylose to ethanol at high temperatures. However, H. polymorpha cannot utilize starchy materials or xylans. Heterologous amylolytic and xylanolytic enzymes have to be expressed in this yeast to provide for utilization and growth on starch and xylan. Genes SWA2 and GAM1 from the yeast Schwanniomyces occidentalis, encoding alpha-amylase and glucoamylase, respectively, were expressed in H. polymorpha. The expression was achieved by integration of the SWA2 and GAM1 genes under the strong constitutive promoter of the H. polymorpha glyceraldehyde-3-phosphate dehydrogenase gene (HpGAP) into H. polymorpha genome. Resulting transformants acquired the ability to grow on a minimal medium containing soluble starch as a sole carbon source. Ethanol production at high-temperature fermentation from starch by the recombinant strains was up to 10 g/L. The XYN2 gene encoding endoxylanase of the fungus Trichoderma reseei was expressed in H. polymorpha. Co-expression of xlnD gene coding for beta-xylosidase of the fungus Aspergillus niger and the XYN2 gene in H. polymorpha was achieved by integration of these genes under control of the HpGAP promoter. Resulting transformants were capable of growth and alcoholic fermentation on a minimal medium supplemented with birchwood xylan as a sole carbon source at 48 degrees C.

  2. Isolation and characterization of a thylakoid membrane module showing partial light and dark reactions.

    Science.gov (United States)

    Dani, Diksha Narhar; Sainis, Jayashree Krishna

    2005-05-15

    A functional thylakoid membrane module of photosynthesis was isolated from cell free extracts of Anacystis nidulans by stepwise sequential ultracentrifugation. The thylakoid membrane fractions sedimenting at 40,000 x g, followed by 90,000 x g and finally at 150,000 x g were collected. These fractions had all the components of electron transport chain, ATP synthase, phycobiliproteins, ferredoxin-NADP reductase but no ferredoxin. Five sequential enzymes of Calvin cycle viz phosphoriboisomerase, phosphoribulokinase, RuBP carboxylase, 3-PGA kinase and glyceraldehyde-3-phosphate dehydrogenase were found to be associated with thylakoid membranes. Among the three different thylakoid fractions, the 150,000 x g fraction showed highest activities of these enzymes and also higher rate of whole chain electron transport activity on chlorophyll basis. An important finding was that the 150,000 x g fraction showed appreciably higher rate of R-5-P+ADP+Pi dependent CO2 fixation in light compared to the other two fractions, indicating the efficiency of this fraction in utilizing ATP for Calvin cycle. This thylakoid membrane fraction represents a fully functional module exhibiting a synchronized system of light and dark reactions of photosynthesis. Most of the components of this module remained together even after sucrose density gradient centrifugation. This is the first report on the isolation of a photosynthetic module involving membrane and soluble proteins.

  3. Trypanosoma cruzi and Leishmania infantum chagasi Infection in Wild Mammals from Maranhão State, Brazil.

    Science.gov (United States)

    da Costa, Andréa Pereira; Costa, Francisco Borges; Soares, Herbert Sousa; Ramirez, Diego Garcia; Mesquita, Eric Takashi Kamakura de Carvalho; Gennari, Solange Maria; Marcili, Arlei

    2015-11-01

    Trypanosoma and Leishmania are obligate parasites that cause important diseases in human and domestic animals. Wild mammals are the natural reservoirs of these parasites, which are transmitted by hematophagous arthropods. The present study aimed to detect the natural occurrence of trypanosomatids through serological diagnosis, PCR of whole blood and blood culture (hemoculture), and phylogenetic relationships using small subunit ribosomal DNA (SSU rDNA), cytochrome b, and glycosomal glyceraldehyde 3-phosphate dehydrogenase (gGAPDH) genes. Samples from 131 wild animals, including rodents, marsupials, and bats, were sampled in six areas in the state of Maranhão, in a transition zone of semiarid climates northeast of the equatorial humid Amazon. Serological analysis for Leishmania (Leishmania) infantum chagasi was performed in opossums by indirect fluorescent antibody test (IFAT), and all animals were serologically negative. Nine positive hemocultures (6.77%) were isolated and cryopreserved and from mammals of the Didelphimorphia and Chiroptera orders and positioned in phylogenies on the basis of sequences from different genes with reference strains of Trypanosoma cruzi marinkellei and T. cruzi. From primary samples (blood and tissues) only one bat, Pteronotus parnellii, was positive to SSU rDNA and gGAPDH genes and grouped with the L. infantum chagasi branch. The studies conducted in Maranhão State provide knowledge of parasite diversity. It is important to determine the presence of trypanosomatids in wild mammals with synanthropic habits.

  4. Proteomic analysis in nitrogen-deprived Isochrysis galbana during lipid accumulation.

    Science.gov (United States)

    Song, Pingping; Li, Ling; Liu, Jianguo

    2013-01-01

    The differentially co-expressed proteins in N-deprived and N-enriched I. galbana were comparatively analyzed by using two dimensional electrophoresis (2-DE) and matrix-assisted laser desorption/ionization-time-of-flight/time-of-flight-mass spectrometry (MALDI-TOF/TOF-MS) with the aim of better understanding lipid metabolism in this oleaginous microalga. Forty-five of the 900 protein spots showed dramatic changes in N-deprived I. galbana compared with the N-enriched cells. Of these, 36 protein spots were analyzed and 27 proteins were successfully identified. The identified proteins were classified into seven groups by their molecular functions, including the proteins related to energy production and transformation, substance metabolism, signal transduction, molecular chaperone, transcription and translation, immune defense and cytoskeleton. These altered proteins slowed cell growth and photosynthesis of I. galbana directly or indirectly, but at the same time increased lipid accumulation. Eight key enzymes involved in lipid metabolism via different pathways were identified as glyceraldehyde-3-phosphate dehydrogenase (GAPDH), phosphoglycerate kinase (PGK), enolase, aspartate aminotransferase (AST), fumarate hydratase (FH), citrate synthase (CS), O-acetyl-serine lyase (OAS-L) and ATP sulfurylase (ATPS). The results suggested that the glycolytic pathway and citrate transport system might be the main routes for lipid anabolism in N-deprived I. galbana, and that the tricarboxylic acid (TCA) cycle, glyoxylate cycle and sulfur assimilation system might be the major pathways involved in lipid catabolism.

  5. Proteomic analysis in nitrogen-deprived Isochrysis galbana during lipid accumulation.

    Directory of Open Access Journals (Sweden)

    Pingping Song

    Full Text Available The differentially co-expressed proteins in N-deprived and N-enriched I. galbana were comparatively analyzed by using two dimensional electrophoresis (2-DE and matrix-assisted laser desorption/ionization-time-of-flight/time-of-flight-mass spectrometry (MALDI-TOF/TOF-MS with the aim of better understanding lipid metabolism in this oleaginous microalga. Forty-five of the 900 protein spots showed dramatic changes in N-deprived I. galbana compared with the N-enriched cells. Of these, 36 protein spots were analyzed and 27 proteins were successfully identified. The identified proteins were classified into seven groups by their molecular functions, including the proteins related to energy production and transformation, substance metabolism, signal transduction, molecular chaperone, transcription and translation, immune defense and cytoskeleton. These altered proteins slowed cell growth and photosynthesis of I. galbana directly or indirectly, but at the same time increased lipid accumulation. Eight key enzymes involved in lipid metabolism via different pathways were identified as glyceraldehyde-3-phosphate dehydrogenase (GAPDH, phosphoglycerate kinase (PGK, enolase, aspartate aminotransferase (AST, fumarate hydratase (FH, citrate synthase (CS, O-acetyl-serine lyase (OAS-L and ATP sulfurylase (ATPS. The results suggested that the glycolytic pathway and citrate transport system might be the main routes for lipid anabolism in N-deprived I. galbana, and that the tricarboxylic acid (TCA cycle, glyoxylate cycle and sulfur assimilation system might be the major pathways involved in lipid catabolism.

  6. Mutations in Escherichia coli aceE and ribB genes allow survival of strains defective in the first step of the isoprenoid biosynthesis pathway.

    Science.gov (United States)

    Perez-Gil, Jordi; Uros, Eva Maria; Sauret-Güeto, Susanna; Lois, L Maria; Kirby, James; Nishimoto, Minobu; Baidoo, Edward E K; Keasling, Jay D; Boronat, Albert; Rodriguez-Concepcion, Manuel

    2012-01-01

    A functional 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway is required for isoprenoid biosynthesis and hence survival in Escherichia coli and most other bacteria. In the first two steps of the pathway, MEP is produced from the central metabolic intermediates pyruvate and glyceraldehyde 3-phosphate via 1-deoxy-D-xylulose 5-phosphate (DXP) by the activity of the enzymes DXP synthase (DXS) and DXP reductoisomerase (DXR). Because the MEP pathway is absent from humans, it was proposed as a promising new target to develop new antibiotics. However, the lethal phenotype caused by the deletion of DXS or DXR was found to be suppressed with a relatively high efficiency by unidentified mutations. Here we report that several mutations in the unrelated genes aceE and ribB rescue growth of DXS-defective mutants because the encoded enzymes allowed the production of sufficient DXP in vivo. Together, this work unveils the diversity of mechanisms that can evolve in bacteria to circumvent a blockage of the first step of the MEP pathway.

  7. Identification of housekeeping genes suitable for gene expression analysis in Jian carp (Cyprinus carpio var. jian).

    Science.gov (United States)

    Tang, Yong-kai; Yu, Ju-hua; Xu, Pao; Li, Jian-lin; Li, Hong-xia; Ren, Hong-tao

    2012-10-01

    Jian carp (Cyprinus carpio var. jian) is an important economic fish species cultured in China. In this report, we performed a systematic analysis to identify an appropriate housekeeping (HK) gene for the study of gene expression in Jian carp. For this purpose, partial DNA sequences of four potential candidate genes (elongation factor 1 alpha (EF-1α), glyceraldehyde-3-phosphate (GAPDH), beta-actin (ACTB), and 18S ribosomal RNA (18S rRNA) were isolated, and their expression levels were studied using RNA extracted from nine tissues (forebrain, hypothalamus, liver, fore-intestine, hind-intestine, ovary, muscle, heart, kidney) in juvenile and adult Jian carp. Gene expression levels were quantified by quantitative real time RT-PCR (qRT-PCR), and expression stability was evaluated by comparing the coefficients of variation (CV) of the Ct values. The results showed that EF-1α was the most suitable HK gene in all tissues of juvenile and adult Jian carp. However, at distinct juvenile and adult developmental stages, there was not a single optimal gene for normalization of expression levels in all tissues. EF-1α was the most stable gene only in forebrain, hypothalamus, liver, heart, and kidney. These results provide data that can be expected to aid gene expression analysis in Jian carp research, but underline the importance of identifying the optimal HK gene for each new experimental paradigm.

  8. Comparison of antigenic proteins from Lactococcus garvieae KG- and KG+ strains that are recognized by olive flounder (Paralichthys olivaceus) antibodies.

    Science.gov (United States)

    Shin, Gee-Wook; Nho, Seong-Won; Park, Seong-Bin; Jang, Ho-Bin; Cha, In-Seok; Ha, Mi-Ae; Kim, Young-Rim; Dalvi, Rishikesh S; Joh, Seong-Joon; Jung, Tae-Sung

    2009-10-20

    Lactococcus garvieae is an important etiological agent of lactococcosis in various fish species including olive flounder (Paralichthys olivaceus). In this study, proteomic and immunoproteomic analyses were employed to compare the antigenic profiles of strains KG9408, MS93003, and NSS9310 strains of L. garvieae. Proteomic analysis using two-dimensional gel electrophoresis (2-DE) revealed differences in five protein spots among the different L. garvieae strains. In immunoproteomic analysis, there was a significant difference in the 2-DE immunoblot profiles of the L. garvieae strains using sera collected from fish surviving infection with either L. garvieae strains KG9408 or NSS9310. These sera reacted with 8 and 7 unique antigenic protein spots, respectively. Heat shock protein (HSP) 70 and DNA-directed RNA polymerase were among the specific antigens recognized by the anti-NSS9310 serum. In addition, the anti-NSS9310 and anti-KG9408 olive flounder sera reacted with 25 common antigenic protein spots of all the L. garvieae strains, which included elongation factor (EF)-Tu, arginine deiminase (AD), inosine-5'-monophosphate dehydrogenase (IMPD), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), phosphomannomutase (PMM), L-lactate dehydrogenase (L-LDH), 6-phosphofructokinase and UDP-galactose 4-epimerase (UDP-galactose). Based on the present results, the 8 antigens recognized by the anti-KG9408 serum and the 25 common antigens recognized by both sera may serve as potential markers for developing an effective vaccine against this bacterium.

  9. Small GTPases and Brucella entry into the endoplasmic reticulum.

    Science.gov (United States)

    de Bolle, Xavier; Letesson, Jean-Jacques; Gorvel, Jean-Pierre

    2012-12-01

    A key determinant for intracellular pathogenic bacteria to ensure their virulence within host cells is their ability to bypass the endocytic pathway and to reach a safe niche of replication. In the case of Brucella, the bacterium targets the ER (endoplasmic reticulum) to create a replicating niche called the BCV (Brucella-containing vacuole). The ER is a suitable strategic place for pathogenic Brucella. Indeed, bacteria can be hidden from host cell defences to persist within the host, and they can take advantage of the membrane reservoir delivered by the ER to replicate. Interaction with the ER leads to the presence on the BCV of the GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and the small GTPase Rab2 known to be located on secretory vesicles that traffic between the ER and the Golgi apparatus. GAPDH and the small GTPase Rab2 controls Brucella replication at late times post-infection. A specific interaction between the human small GTPase Rab2 and a Brucella spp. protein named RicA was identified. Altered kinetics of intracellular trafficking and faster proliferation of the Brucella abortus ΔricA mutant was observed compared with the wild-type strain. RicA is the first reported effector with a proposed function for B. abortus.

  10. Differential proteomics to explore the inhibitory effects of acidic, slightly acidic electrolysed water and sodium hypochlorite solution on Vibrio parahaemolyticus.

    Science.gov (United States)

    Chen, Tai-Yuan; Kuo, Shu-Hao; Chen, Shui-Tein; Hwang, Deng-Fwu

    2016-03-01

    Slightly acidic electrolysed water (SlAEW) and acidic electrolysed water (AEW) have been demonstrated to effectively inactivate food-borne pathogens. However, the underlying mechanism of inactivation remains unknown. Therefore, in this study, a differential proteomic platform was used to investigate the bactericidal mechanism of SlAEW, AEW, and sodium hypochlorite (NaOCl) solutions against Vibrio parahaemolyticus. The upregulated proteins after SlAEW, AEW, and NaOCl treatments were identified as outer membrane proteins K and U. The downregulated proteins after the SlAEW, AEW, and NaOCl treatments were identified as adenylate kinase, phosphoglycerate kinase, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and enolase, all of which are responsible for energy metabolism. Protein synthesis-associated proteins were downregulated and identified as elongation factor Tu and GAPDH. The inhibitory effects of SlAEW and AEW solutions against V. parahaemolyticus may be attributed to the changes in cell membrane permeability, protein synthesis activity, and adenosine triphosphate (ATP) biosynthesis pathways such as glycolysis and ATP replenishment.

  11. Botrytis caroliniana, a new species isolated from blackberry in South Carolina.

    Science.gov (United States)

    Li, Xingpeng; Kerrigan, Julia; Chai, Wenxuan; Schnabel, Guido

    2012-01-01

    Blackberry fruits symptomatic for gray mold were collected from three commercial blackberry fields in northwestern South Carolina. Single-spore isolates were generated and two distinct phenotypes were discovered in each location; one sporulated on PDA and one did not. One isolate of each phenotype and location (six isolates total) were selected for in depth molecular and morphological characterization. Glyceraldehyde-3-phosphate dehydrogenase (G3PDH), heat-shock protein 60 (HSP60) and DNA-dependent RNA polymerase subunit II (RPB2) coding sequence alignment revealed Botrytis cinerea as the sporulating phenotype and a new yet undescribed species as the non-sporulating phenotype. The new Botrytis sp., described herein as Botrytis caroliniana, was most closely related genetically to B. fabiopsis and B. galanthina, the causal agents of gray mold disease of broad bean and snowdrop, respectively. It produces smaller conidia than either B. fabiopsis or B. galanthina, and sequence analysis of genes encoding necrosis and ethylene-inducing proteins (NEPs) also indicated that the Botrytis isolates represent a separate and distinct species. The new species is pathogenic on blackberry fruits and broad bean leaves, which distinguishes it further from B. galanthina. The new species formed white to pale gray colonies with short, tufted aerial mycelium and produced black sclerotia on PDA at 20 C. To our knowledge this is only the third Botrytis species discovered to cause disease on blackberry in the United States.

  12. Multiple Targets of Salicylic Acid and Its Derivatives in Plants and Animals

    Science.gov (United States)

    Klessig, Daniel F.; Tian, Miaoying; Choi, Hyong Woo

    2016-01-01

    Salicylic acid (SA) is a critical plant hormone that is involved in many processes, including seed germination, root initiation, stomatal closure, floral induction, thermogenesis, and response to abiotic and biotic stresses. Its central role in plant immunity, although extensively studied, is still only partially understood. Classical biochemical approaches and, more recently, genome-wide high-throughput screens have identified more than two dozen plant SA-binding proteins (SABPs), as well as multiple candidates that have yet to be characterized. Some of these proteins bind SA with high affinity, while the affinity of others exhibit is low. Given that SA levels vary greatly even within a particular plant species depending on subcellular location, tissue type, developmental stage, and with respect to both time and location after an environmental stimulus such as infection, the presence of SABPs exhibiting a wide range of affinities for SA may provide great flexibility and multiple mechanisms through which SA can act. SA and its derivatives, both natural and synthetic, also have multiple targets in animals/humans. Interestingly, many of these proteins, like their plant counterparts, are associated with immunity or disease development. Two recently identified SABPs, high mobility group box protein and glyceraldehyde 3-phosphate dehydrogenase, are critical proteins that not only serve key structural or metabolic functions but also play prominent roles in disease responses in both kingdoms. PMID:27303403

  13. Biomimicry enhances sequential reactions of tethered glycolytic enzymes, TPI and GAPDHS.

    Directory of Open Access Journals (Sweden)

    Chinatsu Mukai

    Full Text Available Maintaining activity of enzymes tethered to solid interfaces remains a major challenge in developing hybrid organic-inorganic devices. In nature, mammalian spermatozoa have overcome this design challenge by having glycolytic enzymes with specialized targeting domains that enable them to function while tethered to a cytoskeletal element. As a step toward designing a hybrid organic-inorganic ATP-generating system, we implemented a biomimetic site-specific immobilization strategy to tether two glycolytic enzymes representing different functional enzyme families: triose phosphoisomerase (TPI; an isomerase and glyceraldehyde 3-phosphate dehydrogenase (GAPDHS; an oxidoreductase. We then evaluated the activities of these enzymes in comparison to when they were tethered via classical carboxyl-amine crosslinking. Both enzymes show similar surface binding regardless of immobilization method. Remarkably, specific activities for both enzymes were significantly higher when tethered using the biomimetic, site-specific immobilization approach. Using this biomimetic approach, we tethered both enzymes to a single surface and demonstrated their function in series in both forward and reverse directions. Again, the activities in series were significantly higher in both directions when the enzymes were coupled using this biomimetic approach versus carboxyl-amine binding. Our results suggest that biomimetic, site-specific immobilization can provide important functional advantages over chemically specific, but non-oriented attachment, an important strategic insight given the growing interest in recapitulating entire biological pathways on hybrid organic-inorganic devices.

  14. Biomimicry enhances sequential reactions of tethered glycolytic enzymes, TPI and GAPDHS.

    Science.gov (United States)

    Mukai, Chinatsu; Gao, Lizeng; Bergkvist, Magnus; Nelson, Jacquelyn L; Hinchman, Meleana M; Travis, Alexander J

    2013-01-01

    Maintaining activity of enzymes tethered to solid interfaces remains a major challenge in developing hybrid organic-inorganic devices. In nature, mammalian spermatozoa have overcome this design challenge by having glycolytic enzymes with specialized targeting domains that enable them to function while tethered to a cytoskeletal element. As a step toward designing a hybrid organic-inorganic ATP-generating system, we implemented a biomimetic site-specific immobilization strategy to tether two glycolytic enzymes representing different functional enzyme families: triose phosphoisomerase (TPI; an isomerase) and glyceraldehyde 3-phosphate dehydrogenase (GAPDHS; an oxidoreductase). We then evaluated the activities of these enzymes in comparison to when they were tethered via classical carboxyl-amine crosslinking. Both enzymes show similar surface binding regardless of immobilization method. Remarkably, specific activities for both enzymes were significantly higher when tethered using the biomimetic, site-specific immobilization approach. Using this biomimetic approach, we tethered both enzymes to a single surface and demonstrated their function in series in both forward and reverse directions. Again, the activities in series were significantly higher in both directions when the enzymes were coupled using this biomimetic approach versus carboxyl-amine binding. Our results suggest that biomimetic, site-specific immobilization can provide important functional advantages over chemically specific, but non-oriented attachment, an important strategic insight given the growing interest in recapitulating entire biological pathways on hybrid organic-inorganic devices.

  15. Cloning, expression and characterization of a mucin-binding GAPDH from Lactobacillus acidophilus.

    Science.gov (United States)

    Patel, Dhaval K; Shah, Kunal R; Pappachan, Anju; Gupta, Sarita; Singh, Desh Deepak

    2016-10-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a ubiquitous enzyme involved in glycolysis. It is also referred to as a moonlighting protein as it has many diverse functions like regulation of apoptosis, iron homeostasis, cell-matrix interactions, adherence to human colon etc. apart from its principal role in glycolysis. Lactobacilli are lactic acid bacteria which colonize the human gut and confer various health benefits to humans. In the present study, we have cloned, expressed and purified the GAPDH from Lactobacillus acidophilus to get a recombinant product (r-LaGAPDH) and characterized it. Size exclusion chromatography shows that r-LaGAPDH exists as a tetramer in solution and have a mucin binding and hemagglutination activity indicating carbohydrate like binding adhesion mechanism. Fluorescence spectroscopy studies showed an interaction of r-LaGAPDH with mannose, galactose, N-acetylgalactosamine and N-acetylglucosamine with a Kd of 3.6±0.7×10(-3)M, 4.34±0.09×10(-3)M, 4±0.87×10(-3)M and 3.7±0.28×10(-3)M respectively. We hope that this preliminary data will generate more interest in further elucidation of the roles of GAPDH in the adhesion processes of the bacteria.

  16. A Microchip for Integrated Single-Cell Gene Expression Profiling and Genotoxicity Detection

    Science.gov (United States)

    Dong, Hui; Sun, Hao

    2016-01-01

    Microfluidics-based single-cell study is an emerging approach in personalized treatment or precision medicine studies. Single-cell gene expression holds a potential to provide treatment selections with maximized efficacy to help cancer patients based on a genetic understanding of their disease. This work presents a multi-layer microchip for single-cell multiplexed gene expression profiling and genotoxicity detection. Treated by three drug reagents (i.e., methyl methanesulfonate, docetaxel and colchicine) with varied concentrations and time lengths, individual human cancer cells (MDA-MB-231) are lysed on-chip, and the released mRNA templates are captured and reversely transcribed into single strand DNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), cyclin-dependent kinase inhibitor 1A (CDKN1A), and aurora kinase A (AURKA) genes from single cells are amplified and real-time quantified through multiplex polymerase chain reaction. The microchip is capable of integrating all steps of single-cell multiplexed gene expression profiling, and providing precision detection of drug induced genotoxic stress. Throughput has been set to be 18, and can be further increased following the same approach. Numerical simulation of on-chip single cell trapping and heat transfer has been employed to evaluate the chip design and operation. PMID:27649175

  17. Chalcone scaffolds as anti-infective agents: structural and molecular target perspectives.

    Science.gov (United States)

    Mahapatra, Debarshi Kar; Bharti, Sanjay Kumar; Asati, Vivek

    2015-08-28

    In recent years, widespread outbreak of numerous infectious diseases across the globe has created havoc among the population. Particularly, the inhabitants of tropical and sub-tropical regions are mainly affected by these pathogens. Several natural and (semi) synthetic chalcones deserve the credit of being potential anti-infective candidates that inhibit various parasitic, malarial, bacterial, viral, and fungal targets like cruzain-1/2, trypanopain-Tb, trans-sialidase, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), fumarate reductase, falcipain-1/2, β-hematin, topoisomerase-II, plasmepsin-II, lactate dehydrogenase, protein kinases (Pfmrk and PfPK5), and sorbitol-induced hemolysis, DEN-1 NS3, H1N1, HIV (Integrase/Protease), protein tyrosine phosphatase A/B (Ptp-A/B), FtsZ, FAS-II, lactate/isocitrate dehydrogenase, NorA efflux pump, DNA gyrase, fatty acid synthase, chitin synthase, and β-(1,3)-glucan synthase. In this review, a comprehensive study (from Jan. 1982 to May 2015) of the structural features of anti-infective chalcones, their mechanism of actions (MOAs) and structure activity relationships (SARs) have been highlighted. With the knowledge of molecular targets, structural insights and SARs, this review may be helpful for (medicinal) chemists to design more potent, safe, selective and cost effective anti-infective agents.

  18. Expression, purification and preliminary crystallographic studies of human ketohexokinase.

    Science.gov (United States)

    Kozak, M; Hayward, B; Borek, D; Bonthron, D T; Jaskólski, M

    2001-04-01

    Ketohexokinase (KHK; E.C. 2.7.1.3) catalyses the (reversible) phosphorylation of fructose to fructose-1-phosphate. KHK is the first enzyme in a specialized catabolic pathway metabolizing dietary fructose to the glycolytic intermediate glyceraldehyde-3-phosphate. Mutations inactivating KHK underlie the metabolic disorder essential fructosuria. The primary structure of KHK shows no significant homology to other mammalian hexokinases. It is most similar to prokaryotic ribokinases, but catalyses a distinct phosphorylation reaction. Recombinant human KHK has been crystallized in the orthorhombic form (space group P2(1)2(1)2 or P2(1)2(1)2(1)). Single crystals of this polymorph suitable for X-ray diffraction have been obtained by vapour diffusion using 2-propanol and MPD as precipitants (pH 7.5). The crystals have unit-cell parameters a = 93.4, b = 121.5, c = 108.4 A. Diffraction data were collected to 4.3 A resolution. The asymmetric unit contains four protein molecules.

  19. Role of nitric oxide-mediated glutathionylation in neuronal function: potential regulation of energy utilization.

    Science.gov (United States)

    Yap, Li-Peng; Garcia, Jerome V; Han, Derick S; Cadenas, Enrique

    2010-04-28

    Excessive generation of nitric oxide radical (NO*) in neuroinflammation, excitotoxicity and during age-related neurodegenerative disorders entails the localized and concerted increase in nitric oxide synthase(s) expression in glial cells and neurons. The aim of the present study was to assess the biological significance of the impact of NO* on the cell's thiol status with emphasis on S-glutathionylation of targeted proteins. Exposure of primary cortical neurons or astrocytes to increasing flow rates of NO* (0.061-0.25 microM/s) resulted in the following. (i) A decrease in GSH (glutathione) in neurons accompanied by formation of GSNO (S-nitrosoglutathione) and GSSG (glutathione disulfide); neurons were far more sensitive to NO* exposure than astrocytes. (ii) A dose-dependent oxidation of the cellular redox status: the neuron's redox potential increased approximately 42 mV and that of astrocytes approximately 23 mV. A good correlation was observed between cell viability and the cellular redox potential. The higher susceptibility of neurons to NO* can be partly explained by a reduced capacity to recover GSH through lower activities of GSNO and GSSG reductases. (iii) S-glutathionylation of a small subset of proteins, among them GAPDH (glyceraldehyde-3-phosphate dehydrogenase), the S-glutathionylation of which resulted in inhibition of enzyme activity. The quantitative analyses of changes in the cell's thiol potential upon NO* exposure and their consequences for S-glutathionylation are discussed in terms of the distinct redox environment of astrocytes and neurons.

  20. Insights into the molecular basis of long-term storage and survival of sperm in the honeybee (Apis mellifera)

    Science.gov (United States)

    Paynter, Ellen; Millar, A. Harvey; Welch, Mat; Baer-Imhoof, Barbara; Cao, Danyang; Baer, Boris

    2017-01-01

    Honeybee males produce ejaculates consisting of large numbers of high quality sperm. Because queens never re-mate after a single mating episode early in life, sperm are stored in a specialised organ for years but the proximate mechanisms underlying this key physiological adaptation are unknown. We quantified energy metabolism in honeybee sperm and show that the glycolytic metabolite glyceraldehyde-3-phosphate (GA3P) is a key substrate for honeybee sperm survival and energy production. This reliance on non-aerobic energy metabolism in stored sperm was further supported by our findings of very low levels of oxygen inside the spermatheca. Expression of GA3P dehydrogenase (GAPDH), the enzyme involved in catabolism of GA3P, was significantly higher in stored compared to ejaculated sperm. Therefore, long-term sperm storage seems facilitated by the maintenance of non-aerobic energy production, the need for only the ATP-producing steps of glycolysis and by avoiding sperm damage resulting from ROS production. We also confirm that honeybee sperm is capable of aerobic metabolism, which predominates in ejaculated sperm while they compete for access to the spermatheca, but is suppressed during storage. Consequently, the remarkable reproductive traits of honeybees are proximately achieved by differential usage of energy production pathways to maximise competitiveness and minimise damage of sperm. PMID:28091518

  1. YvcK of Bacillus subtilis is required for a normal cell shape and for growth on Krebs cycle intermediates and substrates of the pentose phosphate pathway.

    Science.gov (United States)

    Görke, Boris; Foulquier, Elodie; Galinier, Anne

    2005-11-01

    The HPr-like protein Crh has so far been detected only in the bacillus group of bacteria. In Bacillus subtilis, its gene is part of an operon composed of six ORFs, three of which exhibit strong similarity to genes of unknown function present in many bacteria. The promoter of the operon was determined and found to be constitutively active. A deletion analysis revealed that gene yvcK, encoded by this operon, is essential for growth on Krebs cycle intermediates and on carbon sources metabolized via the pentose phosphate pathway. In addition, cells lacking YvcK acquired media-dependent filamentous or L-shape-like aberrant morphologies. The presence of high magnesium concentrations restored normal growth and cell morphology. Furthermore, suppressor mutants cured from these growth defects appeared spontaneously with a high frequency. Such suppressing mutations were identified in a transposon mutagenesis screen and found to reside in seven different loci. Two of them mapped in genes of central carbon metabolism, including zwf, which encodes glucose-6-phosphate dehydrogenase and cggR, the product of which regulates the synthesis of glyceraldehyde-3-phosphate dehydrogenase. All these results suggest that YvcK has an important role in carbon metabolism, probably in gluconeogenesis required for the synthesis of cell wall precursor molecules. Interestingly, the Escherichia coli homologous protein, YbhK, can substitute for YvcK in B. subtilis, suggesting that the two proteins have been functionally conserved in these different bacteria.

  2. S-(2-Succinyl)cysteine: a novel chemical modification of tissue proteins by a Krebs cycle intermediate.

    Science.gov (United States)

    Alderson, Nathan L; Wang, Yuping; Blatnik, Matthew; Frizzell, Norma; Walla, Michael D; Lyons, Timothy J; Alt, Nadja; Carson, James A; Nagai, Ryoji; Thorpe, Suzanne R; Baynes, John W

    2006-06-01

    S-(2-Succinyl)cysteine (2SC) has been identified as a chemical modification in plasma proteins, in the non-mercaptalbumin fraction of human plasma albumin, in human skin collagen, and in rat skeletal muscle proteins and urine. 2SC increases in human skin collagen with age and is increased in muscle protein of diabetic vs. control rats. The concentration of 2SC in skin collagen and muscle protein correlated strongly with that of the advanced glycation/lipoxidation end-product (AGE/ALE), N(epsilon)-(carboxymethyl)lysine (CML). 2SC is formed by a Michael addition reaction of cysteine sulfhydryl groups with fumarate at physiological pH. Fumarate, but not succinate, inactivates the sulfhydryl enzyme, glyceraldehyde-3-phosphate dehydrogenase in vitro, in concert with formation of 2SC. 2SC is the first example of spontaneous chemical modification of protein by a metabolic intermediate in the Krebs cycle. These observations identify fumarate as an endogenous electrophile and suggest a role for fumarate in regulation of metabolism.

  3. Changes in the activities of some membrane-associated enzymes during in vivo ageing of the normal human erythrocyte.

    Science.gov (United States)

    Kadlubowski, M; Agutter, P S

    1977-09-01

    Human erythrocytes from healthy male donors were fractionated with respect to in vivo age by simple centrifugation in order to characterize changes in the functional integrity of the membrane during the life-span of the cell. The three enzymes, Na/K-ATPase, glyceraldehyde-3-phosphate dehydrogenase and NADH-ferricyanide reductase, were found not to change with age, but significant age-dependent decreases were observed in the cases of acetylcholinesterase, phosphoglycerate kinase, purine nucleoside phosphorylase, adenylate kinase, Mg-ATPase and alkaline phosphatase. The possibility that these changes were attributable to mechanisms other than age-related inactivation, such as reticulocyte contamination, differential resealing and crypticity, was investigated. Only the decrease in acetylcholinesterase could be explained wholly in terms of reticulocyte contamination. A decrease in membrane integrity on ageing was observed, which accounted for approximately half the change in alkaline phosphatase and may have contributed to the other enzyme activity changes. This membrane integrity effect masked a real decrease in the highly cryptic NADH-ferricyanide reductase, this decrease being apparent only after total disaggregation of the membrane with nonionic surfactant.

  4. GLUT3 protein and mRNA in autopsy muscle specimens

    Science.gov (United States)

    Stuart, C. A.; Wen, G.; Jiang, J.

    1999-01-01

    GLUT3 is expressed in rat muscle, but this glucose transporter protein has not been identified previously in adult human skeletal muscle. We quantified the rapidity of disappearance of mRNA and protein from human skeletal muscle at room temperature and at 4 degrees C. Fifty percent of the immunologically detectable GLUT3 protein disappeared by 1 hour at 20 degrees C and by 2 hours at 4 degrees C. mRNA for GLUT3 was decreased 50% by 2.2 hours at 20 degrees C and by 24 hours at 4 degrees C. Half of the measurable mRNAs for GLUT4, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), alpha-actin, and beta-myosin disappeared by 0.8 to 2.1 hours at 20 degrees C and by 5.0 to 16.6 hours at 4 degrees C. Previous conclusions that GLUT3 is not expressed in human muscle were likely drawn because of artifacts related to degradation of GLUT3 protein in the specimens prior to study. Because of the rapid degradation of protein and mRNA, autopsy specimens of muscle must be obtained within 6 hours of death, and even then, protein and mRNA data will likely dramatically underestimate their expression in fresh muscle. Some previously published conclusions and recommendations regarding autopsy specimens are not stringent enough to consistently yield useful protein and mRNA.

  5. Metabolic engineering of the carotenoid biosynthetic pathway in the yeast Xanthophyllomyces dendrorhous (Phaffia rhodozyma).

    Science.gov (United States)

    Verdoes, Jan C; Sandmann, Gerhard; Visser, Hans; Diaz, Maria; van Mossel, Minca; van Ooyen, Albert J J

    2003-07-01

    The crtYB locus was used as an integrative platform for the construction of specific carotenoid biosynthetic mutants in the astaxanthin-producing yeast Xanthophyllomyces dendrorhous. The crtYB gene of X. dendrorhous, encoding a chimeric carotenoid biosynthetic enzyme, could be inactivated by both single and double crossover events, resulting in non-carotenoid-producing transformants. In addition, the crtYB gene, linked to either its homologous or a glyceraldehyde-3-phosphate dehydrogenase promoter, was overexpressed in the wild type and a beta-carotene-accumulating mutant of X. dendrorhous. In several transformants containing multiple copies of the crtYB gene, the total carotenoid content was higher than in the control strain. This increase was mainly due to an increase of the beta-carotene and echinone content, whereas the total content of astaxanthin was unaffected or even lower. Overexpression of the phytoene synthase-encoding gene (crtI) had a large impact on the ratio between mono- and bicyclic carotenoids. Furthermore, we showed that in metabolic engineered X. dendrorhous strains, the competition between the enzymes phytoene desaturase and lycopene cyclase for lycopene governs the metabolic flux either via beta-carotene to astaxanthin or via 3,4-didehydrolycopene to 3-hydroxy-3'-4'-didehydro-beta-psi-caroten-4-one (HDCO). The monocylic carotenoid torulene and HDCO, normally produced as minority carotenoids, were the main carotenoids produced in these strains.

  6. Comparison of two methods for RNA extraction from the nucleus pulposus of intervertebral discs.

    Science.gov (United States)

    Gan, M F; Yang, H L; Qian, J L; Wu, C S; Yuan, C X; Li, X F; Zou, J

    2016-06-03

    RNA extraction from the nucleus pulposus of intervertebral discs has been extensively used in orthopedic studies. We compared two methods for extracting RNA from the nucleus pulposus: liquid nitrogen grinding and enzyme digestion. The RNA was detected by agarose gel electrophoresis, and the purity was evaluated by absorbance ratio using a spectrophotometer. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression was assayed by reverse transcription-polymerase chain reaction (RT-PCR). Thirty human lumbar intervertebral discs were used in this study. The liquid nitrogen-grinding method was used for RNA extraction from 15 samples, and the mean RNA concentration was 491.04 ± 44.16 ng/mL. The enzyme digestion method was used on 15 samples, and the mean RNA concentration was 898.42 ± 38.64 ng/mL. The statistical analysis revealed that there was a significant difference in concentration between the different methods. Apparent 28S, 18S, and 5S bands were detectable in RNA extracted using the enzyme digestion method, whereas no 28S or 18S bands were detected in RNA extracted using the liquid nitrogen-grinding method. The GAPDH band was visible, and no non-specific band was detected in the RT-PCR assay by the enzyme digestion method. Therefore, the enzyme digestion method is an efficient and easy method for RNA extraction from the nucleus pulposus of intervertebral discs for further intervertebral disc degeneration-related studies.

  7. Trypanosoma culicavium sp. nov., an avian trypanosome transmitted by Culex mosquitoes.

    Science.gov (United States)

    Votýpka, Jan; Szabová, Jana; Rádrová, Jana; Zídková, Lenka; Svobodová, Milena

    2012-03-01

    A novel avian trypanosome, Trypanosoma culicavium sp. nov., isolated from Culex mosquitoes, is described on the basis of naturally and experimentally infected vectors and bird hosts, localization in the vector, morphological characters and molecular data. This study provides the first comprehensive description of a trypanosome species transmitted by mosquitoes, in which parasites form plugs and rosettes on the stomodeal valve. Trypanosomes occurred as long epimastigotes and short trypomastigotes in vectors and culture and as long trypomastigotes in birds. Transmission of parasites to bird hosts was achieved exclusively by ingestion of experimentally infected Culex mosquito females by canaries (Serinus canaria), but not by Japanese quails (Coturnix japonica), nor by the bite of infected vectors, nor by ingestion of parasites from laboratory cultures. Transmission experiments and the identity of isolates from collared flycatchers (Ficedula albicollis) and Culex mosquitoes suggests that the natural hosts of T. culicavium are insectivorous songbirds (Passeriformes). Phylogenetic analyses of small-subunit rRNA and glycosomal glyceraldehyde-3-phosphate dehydrogenase gene sequences demonstrated that T. culicavium sp. nov. is more related to Trypanosoma corvi than to other avian trypanosomes (e.g. Trypanosoma avium and Trypanosoma bennetti).

  8. Evolutionary insights from bat trypanosomes: morphological, developmental and phylogenetic evidence of a new species, Trypanosoma (Schizotrypanum) erneyi sp. nov., in African bats closely related to Trypanosoma (Schizotrypanum) cruzi and allied species.

    Science.gov (United States)

    Lima, Luciana; Silva, Flávia Maia da; Neves, Luis; Attias, Márcia; Takata, Carmen S A; Campaner, Marta; de Souza, Wanderley; Hamilton, Patrick B; Teixeira, Marta M G

    2012-11-01

    Parasites of the genus Trypanosoma are common in bats and those of the subgenus Schizotrypanum are restricted to bats throughout the world, with the exception of Trypanosoma (Schizotrypanum) cruzi that also infects other mammals and is restricted to the American Continent. We have characterized trypanosome isolates from Molossidae bats captured in Mozambique, Africa. Morphology and behaviour in culture, supported by phylogenetic inferences using SSU (small subunit) rRNA, gGAPDH (glycosomal glyceraldehyde 3-phosphate dehydrogenase) and Cyt b (cytochrome b) genes, allowed to classify the isolates as a new Schizotrypanum species named Trypanosoma (Schizotrypanum) erneyi sp. nov. This is the first report of a Schizotrypanum species from African bats cultured, characterized morphologically and biologically, and positioned in phylogenetic trees. The unprecedented finding of a new species of the subgenus Schizotrypanum from Africa that is closest related to the America-restricted Trypanosoma (Schizotrypanum) cruzi marinkellei and T. cruzi provides new insights into the origin and evolutionary history of T. cruzi and closely related bat trypanosomes. Altogether, data from our study support the hypothesis of an ancestor trypanosome parasite of bats evolving to infect other mammals, even humans, and adapted to transmission by triatomine bugs in the evolutionary history of T. cruzi in the New World.

  9. Trypanosoma evansi is alike to Trypanosoma brucei brucei in the subcellular localisation of glycolytic enzymes.

    Science.gov (United States)

    Moreno, S Andrea; Nava, Mayerly

    2015-06-01

    Trypanosoma evansi, which causes surra, is descended from Trypanosoma brucei brucei, which causes nagana. Although both parasites are presumed to be metabolically similar, insufficient knowledge of T. evansi precludes a full comparison. Herein, we provide the first report on the subcellular localisation of the glycolytic enzymes in T. evansi, which is a alike to that of the bloodstream form (BSF) of T. b. brucei: (i) fructose-bisphosphate aldolase, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hexokinase, phosphofructokinase, glucose-6-phosphate isomerase, phosphoglycerate kinase, triosephosphate isomerase (glycolytic enzymes) and glycerol-3-phosphate dehydrogenase (a glycolysis-auxiliary enzyme) in glycosomes, (ii) enolase, phosphoglycerate mutase, pyruvate kinase (glycolytic enzymes) and a GAPDH isoenzyme in the cytosol, (iii) malate dehydrogenase in cytosol and (iv) glucose-6-phosphate dehydrogenase in both glycosomes and the cytosol. Specific enzymatic activities also suggest that T. evansi is alike to the BSF of T. b. brucei in glycolytic flux, which is much faster than the pentose phosphate pathway flux, and in the involvement of cytosolic GAPDH in the NAD+/NADH balance. These similarities were expected based on the close phylogenetic relationship of both parasites.

  10. A screen for deficiencies in GPI-anchorage of wall glycoproteins in yeast.

    Science.gov (United States)

    Gonzalez, Marlyn; Goddard, Noel; Hicks, Charles; Ovalle, Rafael; Rauceo, Jason M; Jue, Chong K; Lipke, Peter N

    2010-08-01

    Many of the genes and enzymes critical for assembly and biogenesis of yeast cell walls remain unidentified or poorly characterized. Therefore, we designed a high throughput genomic screen for defects in anchoring of GPI-cell wall proteins (GPI-CWPs), based on quantification of a secreted GFP-Sag1p fusion protein. Saccharomyces cerevisiae diploid deletion strains were transformed with a plasmid expressing the fusion protein under a GPD promoter, then GFP fluorescence was determined in culture supernatants after mid-exponential growth. Variability in the amount of fluorescent marker secreted into the medium was reduced by growth at 18 degrees C in buffered defined medium in the presence of sorbitol. Secondary screens included immunoblotting for GFP, fluorescence emission spectra, cell surface fluorescence, and cell integrity. Of 167 mutants deleted for genes affecting cell wall biogenesis or structure, eight showed consistent hyper-secretion of GFP relative to parental strain BY4743: tdh3 (glyceraldehyde-3-phosphate dehydrogenase), gda1 (guanosine diphosphatase), gpi13 and mcd4 (both ethanolamine phosphate-GPI-transferases), kre5 and kre1 (involved in synthesis of beta1,6 glucan), dcw1(implicated in GPI-CWP cross-linking to cell wall glucan), and cwp1 (a major cell wall protein). In addition, deletion of a number of genes caused decreased secretion of GFP. These results elucidate specific roles for specific genes in cell wall biogenesis, including differentiating among paralogous genes.

  11. Single-cell detection of mRNA expression using nanofountain-probe electroporated molecular beacons.

    Science.gov (United States)

    Giraldo-Vela, Juan P; Kang, Wonmo; McNaughton, Rebecca L; Zhang, Xuemei; Wile, Brian M; Tsourkas, Andrew; Bao, Gang; Espinosa, Horacio D

    2015-05-01

    New techniques for single-cell analysis enable new discoveries in gene expression and systems biology. Time-dependent measurements on individual cells are necessary, yet the common single-cell analysis techniques used today require lysing the cell, suspending the cell, or long incubation times for transfection, thereby interfering with the ability to track an individual cell over time. Here a method for detecting mRNA expression in live single cells using molecular beacons that are transfected into single cells by means of nanofountain probe electroporation (NFP-E) is presented. Molecular beacons are oligonucleotides that emit fluorescence upon binding to an mRNA target, rendering them useful for spatial and temporal studies of live cells. The NFP-E is used to transfect a DNA-based beacon that detects glyceraldehyde 3-phosphate dehydrogenase and an RNA-based beacon that detects a sequence cloned in the green fluorescence protein mRNA. It is shown that imaging analysis of transfection and mRNA detection can be performed within seconds after electroporation and without disturbing adhered cells. In addition, it is shown that time-dependent detection of mRNA expression is feasible by transfecting the same single cell at different time points. This technique will be particularly useful for studies of cell differentiation, where several measurements of mRNA expression are required over time.

  12. Validation of reference genes for gene expression studies in the emerald ash borer (Agrilus planipennis)

    Institute of Scientific and Technical Information of China (English)

    Swapna Priya Rajarapu; Praveen Mamidala; Omprakash Mittapalli

    2012-01-01

    The Emerald ash borer (EAB,Agrilus planipennis Fairmaire) an exotic invasive insect pest has killed millions of ash trees (Fraxinus spp.) across North America and threatens billions more.We validated six A.planipennis reference genes (actin,ACT; beta tubulin,β- TUB; glyceraldehyde-3-phosphate dehydrogenase,GAPDH; ribosomal protein,RPL7; translation elongation factor 1α,TEF-1α; and ubiquitin,UBQ) using geNorm,Normfinder and BestKeeper for accurate determination of target messenger RNA levels in gene expression studies.The stability of the six reference genes was evaluated in different larval tissues,developmental stages and two treatments ofA.planipennis using quantitative real-time polymerase chain reaction.Although there was no consistent ranking observed among the reference genes across the samples,the overall analysis revealed TEF-1α as the most stable reference gene.GAPDH and ACT showed least stability for all the samples studied.We conclude that TEF-1α is the most appropriate reference gene for gene expression studies inA.planipennis.Results obtained can be applicable for transcript profiling in other invasive insect pests.Further,these validated reference genes could also serve as the basis for selection of candidate reference genes in any given insect system post-validation.

  13. Colletotrichum incanum sp. nov., a curved-conidial species causing soybean anthracnose in USA.

    Science.gov (United States)

    Yang, Hui-Ching; Haudenshield, James S; Hartman, Glen L

    2014-01-01

    Soybean anthracnose is caused by a number of species of Colletotrichum that as a group represent an important disease that results in significant economic losses. In the current study, Colletotrichum species were isolated from soybean petioles and stems with anthracnose symptoms from soybean fields in Illinois. Multigene sequence phylogenic analysis, combining rDNA internal transcribed spacer, actin, β-tubulin, glyceraldehyde-3-phosphate dehydrogenase and histone H3 gene regions, revealed a group of isolates collected in this study to be distinct from other established Colletotrichum species. This new group was phylogenetically closer to C. liriopes, C. tofieldiae and C. verruculosum than to C. truncatum, another species with curved conidia commonly found on soybean. A representative isolate from this new group was used to examine its morphology, cultural characteristics and pathogenicity to soybean; it was found to differ from C. truncatum in colony culture characteristics and sizes of conidia and appressoria. As a result of the molecular phylogenetic, morphological and pathogenicity analyses, we named this species Colletotrichum incanum. Of the 84 Colletotrichum isolates collected from soybean petioles, 40 were C. incanum, indicating that this species may commonly occur.

  14. Molecular and phenotypic characterization of Colletotrichum species associated with anthracnose disease in peppers from Sichuan Province, China.

    Science.gov (United States)

    Liu, Fangling; Tang, Guiting; Zheng, Xiaojuan; Li, Ying; Sun, Xiaofang; Qi, Xiaobo; Zhou, You; Xu, Jing; Chen, Huabao; Chang, Xiaoli; Zhang, Sirong; Gong, Guoshu

    2016-09-09

    The anthracnose caused by Colletotrichum species is an important disease that primarily causes fruit rot in pepper. Eighty-eight strains representing seven species of Colletotrichum were obtained from rotten pepper fruits in Sichuan Province, China, and characterized according to morphology and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sequence. Fifty-two strains were chosen for identification by phylogenetic analyses of multi-locus sequences, including the nuclear ribosomal internal transcribed spacer (ITS) region and the β-tubulin (TUB2), actin (ACT), calmodulin (CAL) and GAPDH genes. Based on the combined datasets, the 88 strains were identified as Colletotrichum gloeosporioides, C. siamense, C. fructicola, C. truncatum, C. scovillei, and C. brevisporum, and one new species was detected, described as Colletotrichum sichuanensis. Notably, C. siamense and C. scovillei were recorded for the first time as the causes of anthracnose in peppers in China. In addition, with the exception of C. truncatum, this is the first report of all of the other Colletotrichum species studied in pepper from Sichuan. The fungal species were all non-host-specific, as the isolates were able to infect not only Capsicum spp. but also Pyrus pyrifolia in pathogenicity tests. These findings suggest that the fungal species associated with anthracnose in pepper may inoculate other hosts as initial inoculum.

  15. Differential molecular responses of rice and wheat coleoptiles to anoxia reveal novel metabolic adaptations in amino acid metabolism for tissue tolerance.

    Science.gov (United States)

    Shingaki-Wells, Rachel N; Huang, Shaobai; Taylor, Nicolas L; Carroll, Adam J; Zhou, Wenxu; Millar, A Harvey

    2011-08-01

    Rice (Oryza sativa) and wheat (Triticum aestivum) are the most important starch crops in world agriculture. While both germinate with an anatomically similar coleoptile, this tissue defines the early anoxia tolerance of rice and the anoxia intolerance of wheat seedlings. We combined protein and metabolite profiling analysis to compare the differences in response to anoxia between the rice and wheat coleoptiles. Rice coleoptiles responded to anoxia dramatically, not only at the level of protein synthesis but also at the level of altered metabolite pools, while the wheat response to anoxia was slight in comparison. We found significant increases in the abundance of proteins in rice coleoptiles related to protein translation and antioxidant defense and an accumulation of a set of enzymes involved in serine, glycine, and alanine biosynthesis from glyceraldehyde-3-phosphate or pyruvate, which correlates with an observed accumulation of these amino acids in anoxic rice. We show a positive effect on wheat root anoxia tolerance by exogenous addition of these amino acids, indicating that their synthesis could be linked to rice anoxia tolerance. The potential role of amino acid biosynthesis contributing to anoxia tolerance in cells is discussed.

  16. Transcriptomic and proteomic insights of the wine yeast biomass propagation process.

    Science.gov (United States)

    Gómez-Pastor, Rocío; Pérez-Torrado, Roberto; Cabiscol, Elisa; Matallana, Emilia

    2010-11-01

    Transcriptome and proteome profiles have been established for the commercial wine yeast strain T73 during an important industrial process: yeast biomass propagation. The data from both analyses reveal that the metabolic transition from fermentation to respiration is the most critical step in biomass propagation. We identified 177 ORFs and 56 proteins among those most expressed during the process, thus highlighting cell stress response, mitochondrial and carbohydrate metabolism as the most represented functional categories. A direct correlation between mRNA changes and protein abundance was observed for several functional categories such as tricarboxylic acid cycle proteins, heat shock proteins, chaperons and oxidative stress response-related proteins. However, we found no concordance in the transcript and proteomic levels for glycolytic proteins, which is probably due to post-translational modifications increasing the number of protein isoforms, especially at the end of biomass propagation. The correlation between protein abundance and the enzyme activities of alcohol dehydrogenase, pyruvate decarboxylase and glyceraldehyde-3-phosphate dehydrogenase was not affected by these modifications. We suggest post-translational mechanisms during biomass propagation that affect the stability of those proteins that play an important role in the produced biomass' fermentative capacity.

  17. Predatory activity of Myxococcus xanthus outer-membrane vesicles and properties of their hydrolase cargo.

    Science.gov (United States)

    Evans, Alun G L; Davey, Hazel M; Cookson, Alan; Currinn, Heather; Cooke-Fox, Gillian; Stanczyk, Paulina J; Whitworth, David E

    2012-11-01

    The deltaproteobacterium Myxococcus xanthus predates upon members of the soil microbial community by secreting digestive factors and lysing prey cells. Like other Gram-negative bacteria, M. xanthus produces outer membrane vesicles (OMVs), and we show here that M. xanthus OMVs are able to kill Escherichia coli cells. The OMVs of M. xanthus were found to contain active proteases, phosphatases, other hydrolases and secondary metabolites. Alkaline phosphatase activity was found to be almost exclusively associated with OMVs, implying that there is active targeting of phosphatases into OMVs, while other OMV components appear to be packaged passively. The kinetic properties of OMV alkaline phosphatase suggest that there may have been evolutionary adaptation of OMV enzymes to a relatively indiscriminate mode of action, consistent with a role in predation. In addition, the observed regulation of production, and fragility of OMV activity, may protect OMV-producing cells from exploitation by M. xanthus cheating genotypes and/or other competitors. Killing of E. coli by M. xanthus OMVs was enhanced by the addition of a fusogenic enzyme (glyceraldehyde-3-phosphate dehydrogenase; GAPDH), which triggers fusion of vesicles with target membranes within eukaryotic cells. This suggests that the mechanism of prey killing involves OMV fusion with the E. coli outer membrane. M. xanthus secretes GAPDH, which could potentially modulate the fusion of co-secreted OMVs with prey organisms in nature, enhancing their predatory activity.

  18. Gene expression profile of sprinter's muscle.

    Science.gov (United States)

    Yoshioka, M; Tanaka, H; Shono, N; Shindo, M; St-Amand, J

    2007-12-01

    We have characterized the global gene expression profile in left vastus lateralis muscles of sprinters and sedentary men. The gene expression profile was analyzed by using serial analysis of gene expression (SAGE) method. The abundantly expressed transcripts in the sprinter's muscle were mainly involved in contraction and energy metabolism, whereas six transcripts were corresponding to potentially novel transcripts. Thirty-eight transcripts were differentially expressed between the sprinter and sedentary individuals. Moreover, sprinters showed higher expressions of both uncharacterized and potentially novel transcripts. Sprinters also highly expressed seven transcripts, such as glycine-rich protein, myosin heavy polypeptide (MYH) 2, expressed sequence tag similar to (EST) fructose-bisphosphate aldolase 1 isoform A (ALDOA), glyceraldehyde-3-phosphate dehydrogenase and ATP synthase F0 subunit 6. On the other hand, 20 transcripts such as MYH1, tropomyosin 2 and 3, troponin C slow, C2 fast, I slow, T1 slow and T3 fast, myoglobin, creatine kinase, ALDOA, glycogen phosphorylase, cytochrome c oxidase II and III, and NADH dehydrogenase 1 and 2 showed lower expression levels in the sprinters than the sedentary controls. The current study has characterized the global gene expressions in sprinters and identified a number of transcripts that can be subjected to further mechanistic analysis.

  19. Immunoreactive proteins of Bifidobacterium longum ssp. longum CCM 7952 and Bifidobacterium longum ssp. longum CCDM 372 identified by gnotobiotic mono-colonized mice sera, immune rabbit sera and nonimmune human sera.

    Directory of Open Access Journals (Sweden)

    Sabina Górska

    2016-09-01

    Full Text Available The Bifidobacteria show great diversity in the cell surface architecture which may influence the physicochemical properties of the bacterial cell and strain specific properties. The immunomodulatory role of bifidobacteria has been extensively studied, however studies on the immunoreactivity of their protein molecules are very limited. Here, we compared six different methods of protein isolation and purification and we report identification of immunogenic and immunoreactive protein of two human Bifidobacterium longum ssp. longum strains. We evaluated potential immunoreactive properties of proteins employing polyclonal sera obtained from germ free mouse, rabbit and human. The protein yield was isolation method-dependent and the reactivity of proteins detected by SDS-PAGE and Western blotting was heterogeneous and varied between different serum samples. The proteins with the highest immunoreactivity were isolated, purified and have them sequenced. Among the immunoreactive proteins we identified enolase, aspartokinase, pyruvate kinase, DnaK (B. longum ssp. longum CCM 7952 and sugar ABC transporter ATP-binding protein, phosphoglycerate kinase, peptidoglycan synthethase penicillin-binding protein 3, transaldolase, ribosomal proteins and glyceraldehyde 3-phosphate dehydrogenase (B. longum ssp. longum CCDM 372.

  20. Nuclear localization of the mitochondrial factor HIGD1A during metabolic stress.

    Directory of Open Access Journals (Sweden)

    Kurosh Ameri

    Full Text Available Cellular stress responses are frequently governed by the subcellular localization of critical effector proteins. Apoptosis-inducing Factor (AIF or Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH, for example, can translocate from mitochondria to the nucleus, where they modulate apoptotic death pathways. Hypoxia-inducible gene domain 1A (HIGD1A is a mitochondrial protein regulated by Hypoxia-inducible Factor-1α (HIF1α. Here we show that while HIGD1A resides in mitochondria during physiological hypoxia, severe metabolic stress, such as glucose starvation coupled with hypoxia, in addition to DNA damage induced by etoposide, triggers its nuclear accumulation. We show that nuclear localization of HIGD1A overlaps with that of AIF, and is dependent on the presence of BAX and BAK. Furthermore, we show that AIF and HIGD1A physically interact. Additionally, we demonstrate that nuclear HIGD1A is a potential marker of metabolic stress in vivo, frequently observed in diverse pathological states such as myocardial infarction, hypoxic-ischemic encephalopathy (HIE, and different types of cancer. In summary, we demonstrate a novel nuclear localization of HIGD1A that is commonly observed in human disease processes in vivo.

  1. Identification of appropriate reference genes for human mesenchymal stem cell analysis by quantitative real-time PCR.

    Science.gov (United States)

    Li, Xiuying; Yang, Qiwei; Bai, Jinping; Xuan, Yali; Wang, Yimin

    2015-01-01

    Normalization to a reference gene is the method of choice for quantitative reverse transcription-PCR (RT-qPCR) analysis. The stability of reference genes is critical for accurate experimental results and conclusions. We have evaluated the expression stability of eight commonly used reference genes found in four different human mesenchymal stem cells (MSC). Using geNorm, NormFinder and BestKeeper algorithms, we show that beta-2-microglobulin and peptidyl-prolylisomerase A were the optimal reference genes for normalizing RT-qPCR data obtained from MSC, whereas the TATA box binding protein was not suitable due to its extensive variability in expression. Our findings emphasize the significance of validating reference genes for qPCR analyses. We offer a short list of reference genes to use for normalization and recommend some commercially-available software programs as a rapid approach to validate reference genes. We also demonstrate that the two reference genes, β-actin and glyceraldehyde-3-phosphate dehydrogenase, are frequently used are not always successful in many cases.

  2. With Reference to Reference Genes: A Systematic Review of Endogenous Controls in Gene Expression Studies.

    Science.gov (United States)

    Chapman, Joanne R; Waldenström, Jonas

    2015-01-01

    The choice of reference genes that are stably expressed amongst treatment groups is a crucial step in real-time quantitative PCR gene expression studies. Recent guidelines have specified that a minimum of two validated reference genes should be used for normalisation. However, a quantitative review of the literature showed that the average number of reference genes used across all studies was 1.2. Thus, the vast majority of studies continue to use a single gene, with β-actin (ACTB) and/or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) being commonly selected in studies of vertebrate gene expression. Few studies (15%) tested a panel of potential reference genes for stability of expression before using them to normalise data. Amongst studies specifically testing reference gene stability, few found ACTB or GAPDH to be optimal, whereby these genes were significantly less likely to be chosen when larger panels of potential reference genes were screened. Fewer reference genes were tested for stability in non-model organisms, presumably owing to a dearth of available primers in less well characterised species. Furthermore, the experimental conditions under which real-time quantitative PCR analyses were conducted had a large influence on the choice of reference genes, whereby different studies of rat brain tissue showed different reference genes to be the most stable. These results highlight the importance of validating the choice of normalising reference genes before conducting gene expression studies.

  3. Selection of suitable reference genes for quantitative gene expression studies in milk somatic cells of lactating cows (Bos indicus).

    Science.gov (United States)

    Varshney, N; Mohanty, A K; Kumar, S; Kaushik, J K; Dang, A K; Mukesh, M; Mishra, B P; Kataria, R; Kimothi, S P; Mukhopadhyay, T K; Malakar, D; Prakash, B S; Grover, S; Batish, V K

    2012-06-01

    We assessed the suitability of 9 internal control genes (ICG) in milk somatic cells of lactating cows to find suitable reference genes for use in quantitative PCR (qPCR). Eighteen multiparous lactating Sahiwal cows were used, 6 in each of 3 lactation stages: early (25 ± 5 d in milk), mid (160 ± 15 d in milk), and late (275 ± 25 d in milk) lactation. Nine candidate reference genes [glyceraldehyde 3-phosphate dehydrogenase (GAPDH), protein phosphatase 1 regulatory subunit 11 (PPP1R11), β-actin (ACTB), β-2 microglobulin (B2M), 40S ribosomal protein S15a (RPS15A), ubiquitously expressed transcript (UXT), mitochondrial GTPase 1 (MTG1), 18S rRNA (RN18S1), and ubiquitin (UBC)] were evaluated. Three genes, β-casein (CSN2), lactoferrin (LTF), and cathelicidin (CAMP) were chosen as target genes. Very high amplification was observed in 7 ICG and very low level amplification was observed in 2 ICG (UXT and MTG1). Thus, UXT and MTG1 were excluded from further analysis. The qPCR data were analyzed by 2 software packages, geNorm and NormFinder, to determine suitable reference genes, based on their stability and expression. Overall, PPP1R11, ACTB, UBC, and GAPDH were stably expressed among all candidate reference genes. Therefore, these genes could be used as ICG for normalization of qPCR data in milk somatic cells through lactation.

  4. Agrobacterium tumefaciens-mediated transformation of Penicillium expansum PE-12 and its application in molecular breeding.

    Science.gov (United States)

    Zhang, Tian; Qi, Zhen; Wang, Yueyue; Zhang, Fangyuan; Li, Renyong; Yu, Qingsheng; Chen, Xiangbin; Wang, Huojun; Xiong, Xin; Tang, Kexuan

    2013-03-30

    Lipase produced by Penicillium expansum is widely used in laundry detergent and leather industry; however, the absence of an efficient transformation technology sets a major obstacle for further enhancement of its lipase productivity through advanced gene engineering. In this work, Agrobacterium tumefaciens-mediated transformation (ATMT) was investigated for P. expansum PE-12 transformation, using hygromycin phosphotransferase (hph) as a selectable marker gene. As a result, we revealed that the frequency of transformation surpassed 100 transformants/10(5)condida, most of the integrated T-DNA appeared as a single copy at a random position in chromosomal DNA, and all the transformants showed mitotic stability. Facilitated by this newly established method, for the first time, P. expansum PE-12 was genetically engineered to improve the lipase yield, through a homologous expression vector carrying the endogenous lipase gene (PEL) driven by the strong constitutive promoter of the glyceraldehydes-3-phosphate dehydrogenase gene (gpdA) from Aspergillus nidulans. The highest expression level of the engineered strain reached up to 1700 U/mL, nearly 2-fold of the original industrial strain (900 U/mL). Our reproducible ATMT system has not only revealed the great potential of homologous expression-directed genetic engineering, which is more efficient and specific compared to traditional mutagenesis, but also provided new possibilities and perspectives for any other practical applications of P. expansum-related genetic engineering in the future.

  5. Induction of protective immune responses against schistosomiasis using functionally active cysteine peptidases

    Directory of Open Access Journals (Sweden)

    Rashika eEl Ridi

    2014-05-01

    Full Text Available Each year schistosomiasis afflicts up to 600 million people in 74 tropical and sub-tropical countries, predominantly in the developing world. Yet we depend on a single drug, praziquantel, for its treatment and control. There is no vaccine available but one is urgently needed especially since praziquantel-resistant parasites are likely to emerge at some time in the future. The disease is caused by several worm species of the genus Schistosoma. These express several classes of papain-like cysteine peptidases, cathepsins B and L, in various tissues but particularly in their gastrodermis where they employ them as digestive enzymes. We have shown that sub-cutaneous injection of recombinant and functionally active S. mansoni cathepsin B1 (SmCB1, or a cathepsin L from a related parasite Fasciola hepatica (FhCL1, elicits highly significant protection (up to 73% against an experimental challenge worm infection in murine models of schistosomiasis. The immune modulating properties of this subcutaneous injection can boost protection levels (up to 83% when combined with other S. mansoni vaccine candidates, glyceraldehyde 3-phosphate dehydrogenase (SG3PDH and peroxiredoxin (PRX-MAP. This cysteine-treatment can also protect mice from S. haematobium infection. Here, we discuss these data in the context of the parasite’s biology and development, and provide putative mechanism by which the native-like cysteine peptidase induce protective immune responses.

  6. Proteomic analysis of Pteris vittata fronds: two arbuscular mycorrhizal fungi differentially modulate protein expression under arsenic contamination.

    Science.gov (United States)

    Bona, Elisa; Cattaneo, Chiara; Cesaro, Patrizia; Marsano, Francesco; Lingua, Guido; Cavaletto, Maria; Berta, Graziella

    2010-11-01

    Arbuscular mycorrhizae (AM) are the most widespread mutualistic symbioses between the roots of most land plants and a phylum of soil fungi. AM are known to influence plant performance by improving mineral nutrition, protecting against pathogens and enhancing resistance or tolerance to biotic and abiotic stresses. The aim of this study was to investigate the frond proteome of the arsenic hyperaccumulator fern Pteris vittata in plants that had been inoculated with one of the two AM fungi (Glomus mosseae or Gigaspora margarita) with and without arsenic treatment. A protective role for AM fungi colonisation in the absence of arsenic was indicated by the down-regulation of oxidative damage-related proteins. Arsenic treatment of mycorrhizal ferns induced the differential expression of 130 leaf proteins with specific responses in G. mosseae- and Gi. margarita-colonised plants. Up-regulation of multiple forms of glyceraldehyde-3-phosphate dehydrogenase, phosphoglycerate kinase, and enolase, primarily in G. mosseae-inoculated plants, suggests a central role for glycolytic enzymes in arsenic metabolism. Moreover, a putative arsenic transporter, PgPOR29, has been identified as an up-regulated protein by arsenic treatment.

  7. Effect of anaesthetics and dichlorodifluoromethane on the viability of the cells of Escherichia coli and the activities of some of its enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Laverty, D.M.; Fennema, O.

    1985-01-01

    Three anaesthetics (halothane, CF/sub 3/CHClBr; Ethrane, F/sub 2/ HCOF/sub 2/CCHClF; cyclopropane) and one other halogenated, short-chain hydrocarbon (F-12, Cl/sub 2/F/sub 2/C) were tested under various conditions to determine their effects on the viability of cells of Escherichia coli and the activities of some of its enzymes. When any of the test chemicals were applied for 60 min at concentrations slightly in excess of saturation, the number of surviving cells decreased substantially, with halothane being the most biocidal of the four chemicals and F-12 the least. Three enzymes (malate dehydrogenase, MD; NADH dehydrogenase; glyceraldehyde-3-phosphate dehydrogenase, GPD) were tested for activity after treatment of E. coli with the test chemicals. In all instances, GPD was least resistant to inactivation and MD was most resistant. Halothane was most inhibitory followed in order by Ethrane, cyclopropane and F-12. Treatment of E. coli with halothane for 60 min at 23 degrees C and a concentration slightly in excess of saturation, resulted in nearly complete inhibition of all three enzymes.

  8. Metabolomic and mass isotopomer analysis of liver gluconeogenesis and citric acid cycle: II. Heterogeneity of metabolite labeling pattern.

    Science.gov (United States)

    Yang, Lili; Kasumov, Takhar; Kombu, Rajan S; Zhu, Shu-Han; Cendrowski, Andrea V; David, France; Anderson, Vernon E; Kelleher, Joanne K; Brunengraber, Henri

    2008-08-08

    In this second of two companion articles, we compare the mass isotopomer distribution of metabolites of liver gluconeogenesis and citric acid cycle labeled from NaH(13)CO(3) or dimethyl [1,4-(13)C(2)]succinate. The mass isotopomer distribution of intermediates reveals the reversibility of the isocitrate dehydrogenase + aconitase reactions, even in the absence of a source of alpha-ketoglutarate. In addition, in many cases, a number of labeling incompatibilities were found as follows: (i) glucose versus triose phosphates and phosphoenolpyruvate; (ii) differences in the labeling ratios C-4/C-3 of glucose versus (glyceraldehyde 3-phosphate)/(dihydroxyacetone phosphate); and (iii) labeling of citric acid cycle intermediates in tissue versus effluent perfusate. Overall, our data show that gluconeogenic and citric acid cycle intermediates cannot be considered as sets of homogeneously labeled pools. This probably results from the zonation of hepatic metabolism and, in some cases, from differences in the labeling pattern of mitochondrial versus extramitochondrial metabolites. Our data have implications for the use of labeling patterns for the calculation of metabolic rates or fractional syntheses in liver, as well as for modeling liver intermediary metabolism.

  9. Investigation of male infertility using quantitative comparative proteomics.

    Science.gov (United States)

    Légaré, Christine; Droit, Arnaud; Fournier, Frédéric; Bourassa, Sylvie; Force, André; Cloutier, Francine; Tremblay, Roland; Sullivan, Robert

    2014-12-05

    Male factors account for 40% of infertility cases. The identification of differentially expressed proteins on spermatozoa from fertile and infertile men can help in the elucidation of the molecular basis of male infertility. The aim of this study was to compare sperm proteomes from 3 different groups: fertile men, normozoospermic men consulting for infertility, and normozoospermic men with an impaired capacity for fertilization (IVF-failure). We used differential proteomics with isobaric tags for relative and absolute quantitation (iTRAQ) labeling, and LC-MS analysis to identify proteins that are differentially expressed. A total of 348 unique proteins were identified and quantified. The analysis identified 33 proteins that were differentially expressed in the IVF-failure group vs the fertile group. Comparison of the infertile and fertile groups revealed that 18 proteins appeared to be differentially expressed. Four proteins were similarly altered in the IVF-failure and infertile groups: semenogelin 1 (SEMG1), prolactin-induced protein (PIP), glyceraldehyde-3-phosphate dehydrogenase (GAPDHS), and phosphoglycerate kinase 2 (PGK2). These protein markers were selected for validation using multiple reactions monitoring mass spectrometry (MRM-MS) and further confirmed by Western blot analysis. Overall, these results suggest that a panel of proteins may be used as biomarkers for future studies of infertility.

  10. Proteomic analysis of bovine omental, subcutaneous and intramuscular preadipocytes during in vitro adipogenic differentiation.

    Science.gov (United States)

    Rajesh, Ramanna Valmiki; Heo, Gang-Nyung; Park, Mi-Rim; Nam, Jin-Seon; Kim, Nam-Kuk; Yoon, Duhak; Kim, Tae-Hun; Lee, Hyun-Jeong

    2010-09-01

    Given the substantial rise in obesity, depot-specific fat accumulation and its associated diseases like diabetes, it is important to understand the molecular basis of depot-specific adipocyte differentiation. Many studies have successfully exploited the adipocyte differentiation, but most of them were not related to depot-specificity, particularly using freshly isolated primary preadipocytes. Using 2-dimensional polyacrylamide gel electrophoresis coupled with sequencing mass spectrometry, we searched and compared the proteins differentially expressed in undifferentiated and differentiated preadipocytes from bovine omental, subcutaneous and intramuscular adipose depots. Our proteome mapping strategy to identify differentially expressed intracellular proteins during adipogenic conversion revealed 65 different proteins that were found to be common for the three depots. Further, we validated the differential expression for a subset of proteins by immunoblotting analyses. The results demonstrated that many structural proteins were down-regulated during differentiation of preadipocytes from all the depots. Most up-regulated proteins like Ubiquinol-cytochrome-c reductase complex core protein I (UQCRC1), ATP synthase D chain, Superoxide dismutase (SOD), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Sulfotransferase 1A1 (SULT1A1), Carnitine O-palmitoyltransferase 2 (CPT2) and Heat-shock protein beta 1 (HSPB1) across the three depots were found to be associated with lipid metabolism and metabolic activity. Further, all the up-regulated proteins were found to have higher protein expression in omental than subcutaneous or intramuscular depots.

  11. Proteomic identification of age-dependent protein nitration in rat skeletal muscle.

    Science.gov (United States)

    Kanski, Jaroslaw; Alterman, Michail A; Schöneich, Christian

    2003-11-15

    Age-related protein nitration was studied in skeletal muscle of Fisher 344 and Fisher 344/Brown Norway (BN) F1 rats by a proteomic approach. Proteins from young (4 months) and old (24 months) Fisher 344 rats and young (6 months) and old (34 months) Fisher 344/BN F1 animals were separated by 2-D gel electrophoresis. Western blot showed an age-related increase in the nitration of a few specific proteins, which were identified by MALDI-TOF MS and ESI-MS/MS. We identified age-dependent apparent nitration of beta-enolase, alpha-fructose aldolase, and creatine kinase, which perform important functions in muscle energy metabolism, suggesting that the nitration of such key proteins can be, in part, responsible for the decline of muscle motor function of the muscle. Furthermore, we have identified the apparent nitration of succinate dehydrogenase, rab GDP dissociation inhibitor beta (GdI-2), triosephosphate isomerase, troponin I, alpha-crystallin, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

  12. Gold nanoparticles trigger apoptosis and necrosis in lung cancer cells with low intracellular glutathione

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Min [Shandong University, Department of Pharmacology, School of Medicine (China); Gu, Xiaohu [Shandong University, School of Chemistry and Chemical Engineering (China); Zhang, Ke [Shandong University, Department of Pharmacology, School of Medicine (China); Ding, Yi [Shandong University, School of Chemistry and Chemical Engineering (China); Wei, Xinbing; Zhang, Xiumei, E-mail: zhangxm@sdu.edu.cn; Zhao, Yunxue, E-mail: zhaoyunxue@sdu.edu.cn [Shandong University, Department of Pharmacology, School of Medicine (China)

    2013-08-15

    Previously 13 nm gold nanoparticles (GNPs) have been shown to display cytotoxicity to lung cancer cells when l-buthionine-sulfoximine (BSO) was used to decrease the expression of intracellular glutathione (GSH). In this study, we investigated how the GNPs induced cell death at the molecular level. Dual staining with fluorescent annexin V, and propidium iodide was used to discriminate apoptotic and necrotic cell death. We found that GNPs induced apoptosis and necrosis in lung cancer cells with low level of intracellular GSH. The disruption of F-actin and phosphorylation of H2AX induced by GNPs were both associated with apoptosis. The ER stress was caused, mitochondrial membrane potential was disrupted, intracellular calcium was elevated and intracellular caspase-3 was activated by GNPs in lung cancer cells with low intracellular GSH, while cell death could not be prevented by the pan-caspase inhibitor N-benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone. The cells were further examined for caspase-independent death. After GNPs and BSO exposure, apoptosis inducing factor, endonuclease G, and glyceraldehyde-3-phosphate dehydrogenase translocated into the nuclei of apoptotic cells. Receptor-interacting protein 1 kinase inhibitor necrostatin-1 significantly decreased the PI positive cells that were induced by GNPs and BSO. Taken together, our results suggest that multiple modes of cell death are concurrently induced in GNPs-exposed lung cancer cells with low intracellular GSH, including apoptosis and necrosis. These results have important implications for GNPs in anticancer applications.

  13. A proteomic approach for the involvement of the GAPDH in Alzheimer disease in the blood of Moroccan FAD cases.

    Science.gov (United States)

    El Kadmiri, Nadia; Cuardos, Raquel; El Moutawakil, Bouchra; Slassi, Ilham; Avila, Jesus; Nadifi, Sellama; Hachem, Ahmed; Soukri, Abdelaziz

    2014-12-01

    Several articles have highlighted the potential involvement of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in neurodegeneration by showing a non-glycolytic activity of GAPDH specifically in the brains of subjects with Alzheimer's disease (AD). The novel aim of this study was to elucidate the critical role of GAPDH and its interaction with β-amyloid in the blood of Moroccan patients with familial AD (FAD) carrying presenilin mutations and in sporadic late onset AD (LOAD). Our results show a significant decrease in the activity of GAPDH in blood samples from patients with FAD as compared to sporadic cases and healthy controls. The expression level of GAPDH in brain specimens from mutant tau transgenic mice and patients with FAD was unchanged as compared to healthy controls. In contrast, the expression level of GAPDH in blood samples from mutant tau transgenic mice and patients with FAD was decreased as compared to sporadic cases and healthy controls. Moreover, there is an accumulation of β-amyloid aggregates in the blood samples of patients with FAD and an increase in amyloid fibrils in both the blood and brain samples of these patients. Our study adds new insight to previous ones by showing the involvement of GAPDH in AD, which may influence the pathogenesis of this neurodegenerative disease.

  14. An efficient Agrobacterium-mediated transformation method for the edible mushroom Hypsizygus marmoreus.

    Science.gov (United States)

    Zhang, Jin jing; Shi, Liang; Chen, Hui; Sun, Yun qi; Zhao, Ming wen; Ren, Ang; Chen, Ming jie; Wang, Hong; Feng, Zhi yong

    2014-01-01

    Hypsizygus marmoreus is one of the major edible mushrooms in East Asia. As no efficient transformation method, the molecular and genetics studies were hindered. The glyceraldehyde-3-phosphate dehydrogenase (GPD) gene of H. marmoreus was isolated and its promoter was used to drive the hygromycin B phosphotransferase (HPH) and enhanced green fluorescent protein (EGFP) in H. marmoreus. Agrobacterium tumefaciens-mediated transformation (ATMT) was successfully applied in H. marmoreus. The transformation parameters were optimized, and it was found that co-cultivation of bacteria with protoplast at a ratio of 1000:1 at a temperature of 26 °C in medium containing 0.3 mM acetosyringone resulted in the highest transformation efficiency for Agrobacterium strain. Besides, three plasmids, each carrying a different promoter (from H. marmoreus, Ganoderma lucidum and Lentinula edodes) driving the expression of an antibiotic resistance marker, were also tested. The construct carrying the H. marmoreus gpd promoter produced more transformants than other constructs. Our analysis showed that over 85% of the transformants tested remained mitotically stable even after five successive rounds of subculturing. Putative transformants were analyzed for the presence of hph gene by PCR and Southern blot. Meanwhile, the expression of EGFP in H. marmoreus transformants was detected by fluorescence imaging. This ATMT system increases the transformation efficiency of H. marmoreus and may represent a useful tool for molecular genetic studies in this mushroom species.

  15. 实时定量PCR检测SiRNA对SMMC-7721细胞中MK基因表达的抑制作用%Detection of inhibitory effect of SiRNA on MK gene expression of cell line SMMC-7721 with Real-Time PCR

    Institute of Scientific and Technical Information of China (English)

    陈功星

    2007-01-01

    目的 通过实时定量PCR(Real-Time PCR)检测基因表达的mRNA,建立一种直接观察小干扰RNA(SiRNA)抑制目的基因表达的方法.方法 化学设计合成对应于中期因子(midkine,MK)基因表达mRNA的SiRNA,经脂质体转染肝癌细胞株SMMC-7721,一定时间后,提取总RNA,逆转录cDNA,然后用实时定量PCR方法,以3-磷酸甘油醛脱氢酶(glyceraldehyde-3-phosphate dehydrogenase;GAPDH)为内参照定量MK的表达,比较不同组中MK基因mRNA的量.结果 3种SiRNA处理的SMMC-7721细胞中MK基因的表达mRNA明显降低(P<0.01).结论 实时定量PCR方法直接、简便、精确地反映了SiRNA对目的基因表达的抑制作用.

  16. Expression in Arabidopsis of a strawberry linalool synthase gene under the control of the inducible potato P12 promoter

    NARCIS (Netherlands)

    Yang, L.; Mercke, P.; Loon, van J.J.A.; Fang, Zhiyuan; Dicke, M.; Jongsma, M.A.

    2008-01-01

    To investigate the role of inducible linalool in Arabidopsis-insect interactions, the FaNES1 linalool synthase (LIS) cDNA from strawberry with plastid targeting and a synthetic intron (LIS') was placed under the control of the wound inducible proteinase inhibitor 2 (PI2) promoter from potato. The co

  17. Expression in Arabidopsis of a strawberry linalool synthase gene under the control of the inducible potato P12 promoter

    NARCIS (Netherlands)

    Yang, L.; Mercke, P.; Loon, van J.J.A.; Fang, Zhiyuan; Dicke, M.; Jongsma, M.A.

    2008-01-01

    To investigate the role of inducible linalool in Arabidopsis-insect interactions, the FaNES1 linalool synthase (LIS) cDNA from strawberry with plastid targeting and a synthetic intron (LIS') was placed under the control of the wound inducible proteinase inhibitor 2 (PI2) promoter from potato. The co

  18. Expression in Arabidopsis of a strawberry linalool synthase gene under the control of the inducible potato P12 promoter

    NARCIS (Netherlands)

    Yang, L.; Mercke, P.; Loon, van J.J.A.; Fang, Zhiyuan; Dicke, M.; Jongsma, M.A.

    2008-01-01

    To investigate the role of inducible linalool in Arabidopsis-insect interactions, the FaNES1 linalool synthase (LIS) cDNA from strawberry with plastid targeting and a synthetic intron (LIS') was placed under the control of the wound inducible proteinase inhibitor 2 (PI2) promoter from potato. The

  19. Transcrição reversa na determinação da expressão do mRNA para a enzima conversora de angiotensina testicular em animais tratados com zinco Assessment of the reverse transcriptase polymerase chain reaction technique in the determination of the mRNA expression for the testicular angiotensin-converting enzyme in zinc treated rats

    Directory of Open Access Journals (Sweden)

    Gilberto Simeone Henriques

    2005-12-01

    , primer concentration, hybridization temperature and number of denaturation, hybridization and extension cycles were evaluated. For this purpose, samples of testis from Wistar rats fed a zinc containing diet were used to extract total RNA using the phenol-chloroform-isothiocyanate reaction. Stable cDNA was then generated by the reverse transcription reaction. Using specific primers, the gene of interest (testicular isoform of the angiotensin-converting enzyme and the housekeeping gene for the expression of Glyceraldehyde-3-Phosphate Dehydrogenase were amplified. The samples were then submitted to gel eletrophoresis in agarose gel, stained with ethide bromide and visualized in a UV chamber. RESULTS: The results showed that the best reaction conditions for the chain reaction by the testicular isoform polymerase of the angiotensin-converting enzyme and for Glyceraldehyde-3-Phosphate Dehydrogenase were: (1 initial cDNA concentration of 2 µg, (2 primer concentration of 200nM, (3 hybridization temperature between 57.5ºC and 60.1ºC and (4 33 cycles. CONCLUSION: It was concluded that this optimization minimized interference of the technique, contributing to the production of true, comparative data for the testicular angiotensin- converting enzyme gene expression.

  20. l-Lysine production independent of the oxidative pentose phosphate pathway by Corynebacterium glutamicum with the Streptococcus mutans gapN gene.

    Science.gov (United States)

    Takeno, Seiki; Hori, Kazumasa; Ohtani, Sachiko; Mimura, Akinori; Mitsuhashi, Satoshi; Ikeda, Masato

    2016-09-01

    We have recently developed a Corynebacterium glutamicum strain that generates NADPH via the glycolytic pathway by replacing endogenous NAD-dependent glyceraldehyde 3-phosphate dehydrogenase (GapA) with a nonphosphorylating NADP-dependent glyceraldehyde 3-phosphate dehydrogenase (GapN) from Streptococcus mutans. Strain RE2, a suppressor mutant spontaneously isolated for its improved growth on glucose from the engineered strain, was proven to be a high-potential host for l-lysine production (Takeno et al., 2010). In this study, the suppressor mutation was identified to be a point mutation in rho encoding the transcription termination factor Rho. Strain RE2 still showed retarded growth despite the mutation rho696. Our strategy for reconciling improved growth with a high level of l-lysine production was to use GapA together with GapN only in the early growth phase, and subsequently shift this combination-type glycolysis to one that depends only on GapN in the rest of the growth phase. To achieve this, we expressed gapA under the myo-inositol-inducible promoter of iolT1 encoding a myo-inositol transporter in strain RE2. The resulting strain RE2A(iol) was engineered into an l-lysine producer by introduction of a plasmid carrying the desensitized lysC, followed by examination for culture conditions with myo-inositol supplementation. We found that as a higher concentration of myo-inositol was added to the seed culture, the following fermentation period became shorter while maintaining a high level of l-lysine production. This finally reached a fermentation period comparable to that of the control GapA strain, and yielded a 1.5-fold higher production rate compared with strain RE2. The transcript level of gapA, as well as the GapA activity, in the early growth phase increased in proportion to the myo-inositol concentration and then fell to low levels in the subsequent growth phase, indicating that improved growth was a result of increased GapA activity, especially in the

  1. Reference genes to study herbicide stress response in Lolium sp.: up-regulation of P450 genes in plants resistant to acetolactate-synthase inhibitors.

    Directory of Open Access Journals (Sweden)

    Arnaud Duhoux

    Full Text Available Variation in the expression of numerous genes is at the basis of plant response to environmental stresses. Non-target-site-based resistance to herbicides (NTSR, the major threat to grass weed chemical control, is governed by a subset of the genes involved in herbicide stress response. Quantitative PCR assays allowing reliable comparison of gene expression are thus key to identify genes governing NTSR. This work aimed at identifying a set of reference genes with a stable expression to be used as an internal standard for the normalisation of quantitative PCR data in studies investigating NTSR to herbicides inhibiting acetolactate synthase (ALS in the major grass weed Lolium sp. Gene expression stability was assessed in plants resistant or sensitive to two ALS inhibitors, subjected or not to herbicide stress. Using three complementary approaches implemented in the programs BestKeeper, NormFinder and geNorm, cap-binding protein, glyceraldehyde-3-phosphate-dehydrogenase and ubiquitin were identified as the most suitable reference genes. This reference gene set can probably be used to study herbicide response in other weed species. It was used to compare the expression of the genes encoding two herbicide target enzymes (ALS and acetyl-coenzyme A carboxylase and five cytochromes P450 (CYP with potential herbicide-degrading activity between plants resistant or sensitive to ALS inhibitors. Overall, herbicide application enhanced CYP gene expression. Constitutive up-regulation of all CYP genes observed in resistant plants compared to sensitive plants suggested enhanced secondary metabolism in the resistant plants. Comprehensive transcriptome studies associated to gene expression analyses using the reference gene set validated here are required to unravel NTSR genetic determinants.

  2. Extreme phenotypic variation in Cetraria aculeata (lichenized Ascomycota): adaptation or incidental modification?

    Science.gov (United States)

    Pérez-Ortega, Sergio; Fernández-Mendoza, Fernando; Raggio, José; Vivas, Mercedes; Ascaso, Carmen; Sancho, Leopoldo G.; Printzen, Christian; de los Ríos, Asunción

    2012-01-01

    Background and Aims Phenotypic variability is a successful strategy in lichens for colonizing different habitats. Vagrancy has been reported as a specific adaptation for lichens living in steppe habitats around the world. Among the facultatively vagrant species, the cosmopolitan Cetraria aculeata apparently forms extremely modified vagrant thalli in steppe habitats of Central Spain. The aim of this study was to investigate whether these changes are phenotypic plasticity (a single genotype producing different phenotypes), by characterizing the anatomical and ultrastructural changes observed in vagrant morphs, and measuring differences in ecophysiological performance. Methods Specimens of vagrant and attached populations of C. aculeata were collected on the steppes of Central Spain. The fungal internal transcribed spacer (ITS), glyceraldehyde-3-phosphate dehydrogenase (GPD) and the large sub-unit of the mitochondrial ribosomal DNA (mtLSUm), and the algal ITS and actin were studied within a population genetics framework. Semi-thin and ultrathin sections were analysed by means of optical, scanning electron and transmission electron microscopy. Gas exchange and chlorophyll fluorescence were used to compare the physiological performance of both morphs. Key Results and Conclusions Vagrant and attached morphs share multilocus haplotypes which may indicate that they belong to the same species in spite of their completely different anatomy. However, differentiation tests suggested that vagrant specimens do not represent a random sub-set of the surrounding population. The morphological differences were related to anatomical and ultrastructural differences. Large intercalary growth rates of thalli after the loss of the basal–apical thallus polarity may be the cause of the increased growth shown by vagrant specimens. The anatomical and morphological changes lead to greater duration of ecophysiological activity in vagrant specimens. Although the anatomical and physiological

  3. Bone morphogenetic protein-2 functions as a negative regulator in the differentiation of myoblasts, but not as an inducer for the formations of cartilage and bone in mouse embryonic tongue

    Directory of Open Access Journals (Sweden)

    Suzuki Erika

    2011-07-01

    Full Text Available Abstract Background In vitro studies using the myogenic cell line C2C12 demonstrate that bone morphogenetic protein-2 (BMP-2 converts the developmental pathway of C2C12 from a myogenic cell lineage to an osteoblastic cell lineage. Further, in vivo studies using null mutation mice demonstrate that BMPs inhibit the specification of the developmental fate of myogenic progenitor cells. However, the roles of BMPs in the phases of differentiation and maturation in skeletal muscles have yet to be determined. The present study attempts to define the function of BMP-2 in the final stage of differentiation of mouse tongue myoblast. Results Recombinant BMP-2 inhibited the expressions of markers for the differentiation of skeletal muscle cells, such as myogenin, muscle creatine kinase (MCK, and fast myosin heavy chain (fMyHC, whereas BMP-2 siRNA stimulated such markers. Neither the recombinant BMP-2 nor BMP-2 siRNA altered the expressions of markers for the formation of cartilage and bone, such as osteocalcin, alkaline phosphatase (ALP, collagen II, and collagen X. Further, no formation of cartilage and bone was observed in the recombinant BMP-2-treated tongues based on Alizarin red and Alcian blue stainings. Neither recombinant BMP-2 nor BMP-2 siRNA affected the expression of inhibitor of DNA binding/differentiation 1 (Id1. The ratios of chondrogenic and osteogenic markers relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH, a house keeping gene were approximately 1000-fold lower than those of myogenic markers in the cultured tongue. Conclusions BMP-2 functions as a negative regulator for the final differentiation of tongue myoblasts, but not as an inducer for the formation of cartilage and bone in cultured tongue, probably because the genes related to myogenesis are in an activation mode, while the genes related to chondrogenesis and osteogenesis are in a silencing mode.

  4. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

    Directory of Open Access Journals (Sweden)

    Lee Yeon-Su

    2010-05-01

    Full Text Available Abstract Background Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. Methods We assessed the suitability of six possible reference genes, beta-actin (ACTB, glyceraldehydes-3-phosphate dehydrogenase (GAPDH, hypoxanthine phosphoribosyl transferase 1 (HPRT1, beta-2-microglobulin (B2M, ribosomal subunit L29 (RPL29 and 18S ribosomal RNA (18S rRNA in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. Results This RT-qPCR study showed that there are statistically significant (p Conclusion This study validated RPL29 and RPL29-B2M as the best single reference genes and combination, for RT-qPCR analysis of 'all stomach tissues', and B2M and B2M-GAPDH as the best single reference gene and combination, for 'stomach cancer cell lines'. Use of these validated reference genes should provide more exact interpretation of differential gene expressions at transcription level in stomach cancer.

  5. A Co-Opted DEAD-Box RNA helicase enhances tombusvirus plus-strand synthesis.

    Directory of Open Access Journals (Sweden)

    Nikolay Kovalev

    2012-02-01

    Full Text Available Replication of plus-strand RNA viruses depends on recruited host factors that aid several critical steps during replication. In this paper, we show that an essential translation factor, Ded1p DEAD-box RNA helicase of yeast, directly affects replication of Tomato bushy stunt virus (TBSV. To separate the role of Ded1p in viral protein translation from its putative replication function, we utilized a cell-free TBSV replication assay and recombinant Ded1p. The in vitro data show that Ded1p plays a role in enhancing plus-strand synthesis by the viral replicase. We also find that Ded1p is a component of the tombusvirus replicase complex and Ded1p binds to the 3'-end of the viral minus-stranded RNA. The data obtained with wt and ATPase deficient Ded1p mutants support the model that Ded1p unwinds local structures at the 3'-end of the TBSV (-RNA, rendering the RNA compatible for initiation of (+-strand synthesis. Interestingly, we find that Ded1p and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, which is another host factor for TBSV, play non-overlapping functions to enhance (+-strand synthesis. Altogether, the two host factors enhance TBSV replication synergistically by interacting with the viral (-RNA and the replication proteins. In addition, we have developed an in vitro assay for Flock house virus (FHV, a small RNA virus of insects, that also demonstrated positive effect on FHV replicase activity by the added Ded1p helicase. Thus, two small RNA viruses, which do not code for their own helicases, seems to recruit a host RNA helicase to aid their replication in infected cells.

  6. Analysis of the stability of housekeeping gene expression in the left cardiac ventricle of rats submitted to chronic intermittent hypoxia.

    Science.gov (United States)

    Julian, Guilherme Silva; Oliveira, Renato Watanabe de; Tufik, Sergio; Chagas, Jair Ribeiro

    2016-01-01

    Obstructive sleep apnea (OSA) has been associated with oxidative stress and various cardiovascular consequences, such as increased cardiovascular disease risk. Quantitative real-time PCR is frequently employed to assess changes in gene expression in experimental models. In this study, we analyzed the effects of chronic intermittent hypoxia (an experimental model of OSA) on housekeeping gene expression in the left cardiac ventricle of rats. Analyses via four different approaches-use of the geNorm, BestKeeper, and NormFinder algorithms; and 2-ΔCt (threshold cycle) data analysis-produced similar results: all genes were found to be suitable for use, glyceraldehyde-3-phosphate dehydrogenase and 18S being classified as the most and the least stable, respectively. The use of more than one housekeeping gene is strongly advised. RESUMO A apneia obstrutiva do sono (AOS) tem sido associada ao estresse oxidativo e a várias consequências ca