A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders
International Nuclear Information System (INIS)
Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon
2010-01-01
Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.
Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan
2018-01-01
Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.
A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders
Energy Technology Data Exchange (ETDEWEB)
Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)
2010-08-07
Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.
Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina
2011-10-15
4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.
Nuclear RNA sequencing of the mouse erythroid cell transcriptome.
Directory of Open Access Journals (Sweden)
Jennifer A Mitchell
Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.
Ha, Ae Wha; Kim, Woo Kyoung
2017-06-01
Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.
International Nuclear Information System (INIS)
Watanabe, T.; Oishi, M.
1987-01-01
A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed
Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D
2014-10-01
This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D
2010-04-01
The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.
Directory of Open Access Journals (Sweden)
Heung Bum Lee
2012-06-01
Full Text Available Reactive oxygen species (ROS play a crucial role in the pathogenesis of acute and chronic respiratory diseases. Antioxidants have been found to ameliorate airway inflammation and hyperresponsiveness in animal models employing short-term exposure to allergen. However, little data are available on the effect of antioxidants on airway remodeling and signaling pathways in chronic asthma. In the present study, we used a long-term exposure murine model of allergic airway disease to evaluate the effects of an antioxidant, l-2-oxothiazolidine-4-carboxylic acid (OTC or α-lipoic acid (LA on airway remodeling, focusing on the ROS-related hypoxia-inducible signaling. Long-term challenge of ovalbumin (OVA increased ROS production, airway inflammation, and airway hyperresponsiveness, and developed features of airway remodeling such as excessive mucus secretion, subepithelial fibrosis, and thickening of the peribronchial smooth muscle layer. Administration of OTC or LA reduced these features of asthma, including airway remodeling, which was accompanied by suppression of transforming growth factor-β1, vascular endothelial growth factor, and T-helper 2 cytokines. In addition, OVA-induced activation of nuclear factor-κB (NF-κB, nuclear factor erythroid 2p45-related factor-2 (Nrf2, hypoxia-inducible factor (HIF-1α, and HIF-2α was reduced by OTC or LA. Our results also showed that OTC or LA down-regulated phosphoinositide 3-kinase activity and decreased phosphorylation of p38 mitogen-activated protein kinase but not extracellular signal-regulated kinase 1/2 or c-Jun N-terminal kinase. These findings demonstrate that OTC and LA can inhibit activation of NF-κB, Nrf2, and HIF, leading to attenuate allergen-induced airway remodeling.
Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique
2017-07-11
Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Alessandro Di Tullio
2017-07-01
Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.
Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie
2017-09-01
Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S
2012-01-01
Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited
Directory of Open Access Journals (Sweden)
Anna Hammer
2017-12-01
Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata
2016-09-01
Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.
Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu
2012-08-01
Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral
Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.
Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A
2004-10-01
A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.
Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.
2016-01-01
Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578
Studies of globin gene expression in differentiating erythroid cells
International Nuclear Information System (INIS)
Sullivan, T.D.
1985-01-01
The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation
Gao, Wenqi; Xiao, Changyi; Hu, Jun; Chen, Biaoxin; Wang, Chunyan; Cui, Bangping; Deng, Pengyi; Yang, Jian; Deng, Zhifang
2018-04-18
Qing brick tea (QBT), traditional and popular beverage for Chinese people, is an important post-fermentation dark tea. Our present study was performed to investigate the ameliorative effects of QBT aqueous extract on metabolic syndrome (Mets) in monosodium glutamate-induced obese mice and the potential mechanisms. Monosodium glutamate-induced obese mice were used to evaluate the anti-Mets effects of QBT. Content levels of malonaldehyde (MDA), reactive oxygen species (ROS) and protein carbonylation, antioxidant enzyme activities of superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), glutathione reductase (GR) in the skeletal muscle were assessed by commercial kits, respectively. Western blot and Q-PCR were used to detect the expressions of Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) signaling pathway and downstream antioxidant factors. In addition, activity of AKT signaling and expression of glucose transporter type 4 (GLUT4) in the skeletal muscle were investigated by western blot. QBT treatment limited gain of body weight, waistline and LEE index, improved insulin resistance and glucose intolerance, reduced lipid level in MSG mice. Content levels of MDA, ROS and protein carbonylation in skeletal muscle of QBT group were significantly improved compared to those of MSG mice. The antioxidant enzyme activities of SOD, GPx, CAT, and GR were increased in skeletal muscle of MSG mice intervened with QBT. After 20-week QBT treatment, Nrf2 signaling pathway and downstream antioxidant factors were both increased in the skeletal muscle. In addition, QBT treatment improved insulin signaling by preferentially augmenting AKT signaling, as well as increased the protein expression of GLUT4 in the skeletal muscle. Our results showed that QBT intake was effective in protecting monosodium glutamate-induced obese mice against metabolic syndrome and involved in the Nrf2 signaling pathway in the skeletal muscle. Copyright © 2018
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
International Nuclear Information System (INIS)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun
2012-01-01
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
Energy Technology Data Exchange (ETDEWEB)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2012-11-15
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele
2014-01-01
Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.
Energy Technology Data Exchange (ETDEWEB)
Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca
2013-07-15
Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.
International Nuclear Information System (INIS)
Lo, Raymond; Matthews, Jason
2013-01-01
Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.
Directory of Open Access Journals (Sweden)
Annalisa LoGerfo
2014-01-01
Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.
Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong
2016-04-01
Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could
A hanging drop culture method to study terminal erythroid differentiation.
Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak
2005-10-01
To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.
PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.
Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C
2017-05-01
Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.
Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin
2018-01-01
Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.
Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan
2016-01-01
Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.
International Nuclear Information System (INIS)
Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia
2016-01-01
Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating
Energy Technology Data Exchange (ETDEWEB)
Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)
2016-08-01
Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria
2017-10-20
The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.
Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.
Directory of Open Access Journals (Sweden)
Abigail A Lamikanra
2009-12-01
Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that
Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.
2011-01-01
Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418
Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation
International Nuclear Information System (INIS)
Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella
2010-01-01
Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment
DEFF Research Database (Denmark)
Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio
2015-01-01
Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...
Chatterjee, Anwesha; Ronghe, Amruta; Singh, Bhupendra; Bhat, Nimee K; Chen, Jie; Bhat, Hari K
2014-12-01
The objective of the present study was to characterize the role of resveratrol (Res) and vitamin C (VC) in prevention of estrogen-induced breast cancer through regulation of cap "n"collar (CNC) b-zip transcription factors. Human breast epithelial cell line MCF-10A was treated with 17β-estradiol (E2) and VC or Res with or without E2. mRNA and protein expression levels of CNC b-zip transcription factors nuclear factor erythroid 2-related factor 1 (Nrf1), nuclear factor erythroid 2 related factor 2 (Nrf2), nuclear factor erythroid 2 related factor 3 (Nrf3), and Nrf2-regulated antioxidant enzymes superoxide dismutase 3 (SOD3) and quinone oxidoreductase 1 (NQO1) were quantified. The treatment with E2 suppressed, whereas VC and Res prevented E2-mediated decrease in the expression levels of SOD3, NQO1, Nrf2 mRNA, and protein in MCF-10A cells. The treatment with E2, Res, or VC significantly increased mRNA and protein expression levels of Nrf1. 17β-Estradiol treatment significantly increased but VC or Res decreased Nrf3 mRNA and protein expression levels. Our studies demonstrate that estrogen-induced breast cancer might be prevented through upregulation of antioxidant enzymes via Nrf-dependent pathways. © 2014 Wiley Periodicals, Inc.
Ghosh, Debolina; LeVault, Kelsey R; Brewer, Gregory J
2014-01-01
To determine whether glutathione (GSH) loss or increased reactive oxygen species (ROS) are more important to neuron loss, aging, and Alzheimer's disease (AD), we stressed or boosted GSH levels in neurons isolated from aging 3xTg-AD neurons compared with those from age-matched nontransgenic (non-Tg) neurons. Here, using titrating with buthionine sulfoximine, an inhibitor of γ-glutamyl cysteine synthetase (GCL), we observed that GSH depletion increased neuronal death of 3xTg-AD cultured neurons at increasing rates across the age span, whereas non-Tg neurons were resistant to GSH depletion until old age. Remarkably, the rate of neuron loss with ROS did not increase in old age and was the same for both genotypes, which indicates that cognitive deficits in the AD model were not caused by ROS. Therefore, we targeted for neuroprotection activation of the redox sensitive transcription factor, nuclear erythroid-related factor 2 (Nrf2) by 18 alpha glycyrrhetinic acid to stimulate GSH synthesis through GCL. This balanced stimulation of a number of redox enzymes restored the lower levels of Nrf2 and GCL seen in 3xTg-AD neurons compared with those of non-Tg neurons and promoted translocation of Nrf2 to the nucleus. By combining the Nrf2 activator together with the NADH precursor, nicotinamide, we increased neuron survival against amyloid beta stress in an additive manner. These stress tests and neuroprotective treatments suggest that the redox environment is more important for neuron survival than ROS. The dual neuroprotective treatment with nicotinamide and an Nrf2 inducer indicates that these age-related and AD-related changes are reversible. Copyright © 2014 Elsevier Inc. All rights reserved.
Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang
2017-07-01
Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.
Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F
2018-06-15
In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.
Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.
Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali
2017-03-01
Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.
Acute erythroid neoplastic proliferations. A biological study based on 62 patients.
Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad
2002-02-01
The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was
Directory of Open Access Journals (Sweden)
Deepti Jain
2015-06-01
Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.
Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.
2010-01-01
Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494
TMEM14C is required for erythroid mitochondrial heme metabolism.
Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H
2014-10-01
The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.
Energy Technology Data Exchange (ETDEWEB)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.
International Nuclear Information System (INIS)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-01-01
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation
Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.
Enhancement of erythroid colony growth in culture by hemin
International Nuclear Information System (INIS)
Porter, P.N.; Meints, R.H.; Mesner, K.
1979-01-01
Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)
International Nuclear Information System (INIS)
Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P
2013-01-01
Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository
Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells
International Nuclear Information System (INIS)
Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.
1987-01-01
The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes
Shyu, Yu-Chiau; Lee, Tung-Liang; Chen, Xin; Hsu, Pang-Hung; Wen, Shau-Ching; Liaw, Yi-Wei; Lu, Chi-Huan; Hsu, Po-Yen; Lu, Mu-Jie; Hwang, JauLang; Tsai, Ming-Daw; Hwang, Ming-Jing; Chen, Jim-Ray; Shen, Che-Kun James
2014-02-24
Erythropoiesis is a highly regulated process during which BFU-E are differentiated into RBCs through CFU-E, Pro-E, PolyCh-E, OrthoCh-E, and reticulocyte stages. Uniquely, most erythroid-specific genes are activated during the Pro-E to Baso-E transition. We show that a wave of nuclear import of the erythroid-specific transcription factor EKLF occurs during the Pro-E to Baso-E transition. We further demonstrate that this wave results from a series of finely tuned events, including timed activation of PKCθ, phosphorylation of EKLF at S68 by P-PKCθ(S676), and sumoylation of EKLF at K74. The latter EKLF modifications modulate its interactions with a cytoplasmic ankyrin-repeat-protein FOE and importinβ1, respectively. The role of FOE in the control of EKLF nuclear import is further supported by analysis of the subcellular distribution patterns of EKLF in FOE-knockout mice. This study reveals the regulatory mechanisms of the nuclear import of EKLF, which may also be utilized in the nuclear import of other factors. Copyright © 2014 Elsevier Inc. All rights reserved.
Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells
International Nuclear Information System (INIS)
Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)
Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells
Energy Technology Data Exchange (ETDEWEB)
Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna
2017-01-01
are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark
Energy Technology Data Exchange (ETDEWEB)
Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)
2009-12-11
The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.
International Nuclear Information System (INIS)
Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.
2009-01-01
The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.
International Nuclear Information System (INIS)
Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.
1982-01-01
Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)
Ma, Y F; Wu, Z H; Gao, M; Loor, J J
2018-03-21
The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2
Bmi-1 Regulates Extensive Erythroid Self-Renewal
Directory of Open Access Journals (Sweden)
Ah Ram Kim
2015-06-01
Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.
Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A
1998-06-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and
Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun
1998-01-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited
Nuclear alpha spectrin: Critical roles in DNA interstrand cross-link repair and genomic stability
Lambert, Muriel W
2016-01-01
Non-erythroid alpha spectrin (?IISp) is a structural protein which we have shown is present in the nucleus of human cells. It interacts with a number of nuclear proteins such as actin, lamin, emerin, chromatin remodeling factors, and DNA repair proteins. ?IISp?s interaction with DNA repair proteins has been extensively studied. We have demonstrated that nuclear ?IISp is critical in DNA interstrand cross-link (ICL) repair in S phase, in both genomic (non-telomeric) and telomeric DNA, and in ma...
Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.
Directory of Open Access Journals (Sweden)
Eyayu Belay
Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.
Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming
2017-05-01
Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.
Czech Academy of Sciences Publication Activity Database
Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.
2007-01-01
Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007
von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.
1999-01-01
Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors
Directory of Open Access Journals (Sweden)
Ryo Kurita
Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.
Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M
2014-05-13
Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.
THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA
DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
1994-01-01
Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using
Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice
Directory of Open Access Journals (Sweden)
Ibrahim Mansur
2016-01-01
Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.
International Nuclear Information System (INIS)
Porter, P.N.; Ogawa, M.
1982-01-01
Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture
Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm
2015-01-01
Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.
Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit
2015-01-01
We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632
Directory of Open Access Journals (Sweden)
Ruth Merkle
2016-08-01
Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in
Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan
2015-12-01
Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.
Saha, Debarchana; Koli, Swanand; Reddy, Kudumula Venkata Rami
2017-06-01
Hemoglobin (Hb), a major protein involved in transport of oxygen (O 2 ), is expressed by erythroid lineages. Until recently, it was not known whether non-erythroid cells express Hb. The objective was to evaluate the expression and functional significance of Hb-α and Hb-β in human primary vaginal epithelial cells (hPVECs) and decipher downstream signaling. RT-PCR, qRT-PCR, flow cytometry, Western blot, immunofluorescence were used to evaluate the expression of Hb-α, Hb-β, and nuclear factor E2-related factor-2(Nrf2) after hydrogen peroxide (H 2 O 2 ) induction. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay were used to determine the binding efficiency of Nrf2 on the Hb-α promoter. Stimulation of hPVECs and human vaginal epithelial cell line, VK2/E6E7 with H 2 O 2 augmented the expression of Hb-α, Hb-β, Nrf2, heme oxygenase-1 (HO-1), and reactive oxygen species (ROS). Treatment of these cells with Nrf2 inhibitor, trigonelline (Trig) inhibited Hb-α and Hb-β expressions. Hb-α and Hb-β overexpression downregulated H 2 O 2 -induced ROS. The presence of Nrf2 binding domain was demonstrated within Hb-α promoter. The results revealed for the first time that Hb-α and Hb-β were induced by oxidative stress through the activation of Nrf2. Overexpression of Hb-α and Hb-β ameliorated H 2 O 2 -induced oxidative stress, indicating one of the possible mechanism(s) to protect hPVECS from oxidative stress. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Jian-Guo Ren
2010-09-01
Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel
A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review
Directory of Open Access Journals (Sweden)
Pablo Manresa
2017-12-01
Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.
MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B
Directory of Open Access Journals (Sweden)
Dongsheng Wang
2018-03-01
Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.
Defining the Minimal Factors Required for Erythropoiesis through Direct Lineage Conversion
Directory of Open Access Journals (Sweden)
Sandra Capellera-Garcia
2016-06-01
Full Text Available Erythroid cell commitment and differentiation proceed through activation of a lineage-restricted transcriptional network orchestrated by a group of well characterized genes. However, the minimal set of factors necessary for instructing red blood cell (RBC development remains undefined. We employed a screen for transcription factors allowing direct lineage reprograming from fibroblasts to induced erythroid progenitors/precursors (iEPs. We show that Gata1, Tal1, Lmo2, and c-Myc (GTLM can rapidly convert murine and human fibroblasts directly to iEPs. The transcriptional signature of murine iEPs resembled mainly that of primitive erythroid progenitors in the yolk sac, whereas addition of Klf1 or Myb to the GTLM cocktail resulted in iEPs with a more adult-type globin expression pattern. Our results demonstrate that direct lineage conversion is a suitable platform for defining and studying the core factors inducing the different waves of erythroid development.
Directory of Open Access Journals (Sweden)
Ikuta T
2013-12-01
Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to
Directory of Open Access Journals (Sweden)
Shlomi Toobiak
Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.
Directory of Open Access Journals (Sweden)
Schmidt Enrico K
2004-05-01
Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.
Directory of Open Access Journals (Sweden)
Zita Garate
2015-12-01
Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.
von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.
2001-01-01
Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal
Energy Technology Data Exchange (ETDEWEB)
Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu
2013-08-01
Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.
Energy Technology Data Exchange (ETDEWEB)
Krauss, Sharon Wald; Lo, Annie J.; Short, Sarah A.; Koury, MarkJ.; Mohandas, Narla; Chasis, Joel Anne
2005-04-06
Enucleation, a rare feature of mammalian differentiation, occurs in three cell types: erythroblasts, lens epithelium and keratinocytes. Previous investigations suggest that caspase activation functions in lens epithelial and keratinocyte enucleation, as well as in early erythropoiesis encompassing BFU-E differentiation to proerythroblast. To determine whether caspase activation contributes to later erythropoiesis and whether nuclear substructures other than chromatin reorganize, we analyzed distributions of nuclear subcompartment proteins and assayed for caspase-induced cleavage of subcompartmental target proteins in mouse erythroblasts. We found that patterns of lamin B in the filamentous network interacting with both the nuclear envelope and DNA, nuclear matrix protein NuMA, and splicing factors Sm and SC35 persisted during nuclear condensation, consistent with effective transcription of genes expressed late in differentiation. Thus nuclear reorganization prior to enucleation is selective, allowing maintenance of critical transcriptional processes independent of extensive chromosomal reorganization. Consistent with these data, we found no evidence for caspase-induced cleavage of major nuclear subcompartment proteins during late erythropoiesis, in contrast to what has been observed in early erythropoiesis and in lens epithelial and keratinocyte differentiation. These findings imply that nuclear condensation and extrusion during terminal erythroid differentiation involve novel mechanisms that do not entail major activation of apoptotic machinery.
Directory of Open Access Journals (Sweden)
Laurie A Steiner
Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.
Fusion of ZMYND8 and RELA genes in acute erythroid leukemia
DEFF Research Database (Denmark)
Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim
2013-01-01
Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...
Parvovirus B19 integration into human CD36+ erythroid progenitor cells.
Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik
2017-11-01
The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.
Erythroid cells in vitro: from developmental biology to blood transfusion products.
Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni
2009-07-01
Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.
Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T
1987-02-01
The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.
Reduction of erythroid progenitors in protein-energy malnutrition.
Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio
2007-02-01
Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.
Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.
Sherazi, Syed Furqan Haider; Butt, Zeeshan
2012-09-01
AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.
International Nuclear Information System (INIS)
Gardner, L.C.; Cox, T.M.
1988-01-01
Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation
Sahin, K; Orhan, C; Tuzcu, M; Sahin, N; Hayirli, A; Bilgili, S; Kucuk, O
2016-05-01
This study was conducted to evaluate the effects of dietary lycopene supplementation on growth performance, antioxidant status, and muscle nuclear transcription factor [Kelch like-ECH-associated protein 1 (Keap1) and (erythroid-derived 2)-like 2 (Nrf2)] expressions in broiler chickens exposed to heat stress (HS). A total of 180 one-day-old male broiler chicks (Ross 308) were assigned randomly to one of 2×3 factorially arranged treatments: two housing temperatures (22°C for 24 h/d; thermoneutral, TN or 34°C for 8 h/d HS) and three dietary lycopene levels (0, 200, or 400 mg/kg). Each treatment consisted of three replicates of 10 birds. Birds were reared to 42 d of age. Heat stress caused reductions in feed intake and weight gain by 12.2 and 20.7% and increased feed efficiency by 10.8% (Plycopene level improved performance in both environments. Birds reared under the HS environment had lower serum and muscle lycopene concentration (0.34 vs. 0.50 μg/mL and 2.80 vs. 2.13 μg/g), activities of superoxide dismutase (151 vs. 126 U/mL and 131 vs. 155 U/mg protein), glutathione peroxidase (184 vs. 154 U/mL and 1.39 vs. 1.74 U/mg protein), and higher malondialdehyde (MDA) concentration (0.53 vs. 0.83 μg/mL and 0.78 vs. 0.45 μg/ mg protein) than birds reared under the TN environment. Changes in levels of lycopene and MDA and activities of enzymes in serum and muscle varied by the environmental temperature as dietary lycopene level increased. Moreover, increasing dietary lycopene level suppressed muscle Keap1 expression and enhanced muscle Nrf2 expression, which had increased by 150% and decreased by 40%, respectively in response to HS. In conclusion, lycopene supplementation alleviates adverse effects of HS on performance through modulating expressions of stress-related nuclear transcription factors. © 2016 Poultry Science Association Inc.
Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M
1981-01-01
Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...
Detection of trans-acting factors for hemoglobin switching by cell fusions
International Nuclear Information System (INIS)
Broyles, R.H.; Palmer, J.C.; Smith, D.J.; Ramseyer, T.H.
1986-01-01
The authors have devised protocols for chemically fusing erythroid cells from amphibians of different developmental stages, so that we may study the short-term effects of trans-acting factors on globin gene expression. The authors are performing both homospecifc (Rana x Rana) and heterospecific (Rana x Xenopus) fusions; and they are detecting the expression of specific globin genes with selective radioactive labeling ( 35 S-methionine is incorporated only into adult globins), polyacrylamide gel electrophoresis, monospecific antisera, and cDNA probes that are species-and developmental stage-specific. Their results indicate that: (1) there are factors in tadpole erythroblasts that can reactivate adult Hb synthesis in mature, synthetically-inactive adult RBCs; (2) there are factors in tadpole erythroblasts that can reactivate tadpole globin genes in adult RBCs; and (3) there are factors in adult erythroid cells that apparently activate adult globin genes in tadpole RBCs. These results suggests that erythroid cells from animals of different developmental stages possess different sets of globin gene-specific trans-acting factors which can be studied with a system that exhibits normal developmental Hb switching
International Nuclear Information System (INIS)
Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru
2004-01-01
The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells
Human factors in nuclear power plants
International Nuclear Information System (INIS)
Swain, A.D.
1981-01-01
This report describes some of the human factors problems in nuclear power plants and the technology that can be employed to reduce those problems. Many of the changes to improve the human factors in existing plants are inexpensive, and the expected gain in human reliability is substantial. The human factors technology is well-established and there are practitioners in most countries that have nuclear power plants. (orig.) [de
Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G
1996-01-01
Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.
Factors affecting nuclear development
International Nuclear Information System (INIS)
Stevens, G.H.; Girouard, P.
1995-01-01
Among the factors affecting nuclear development, some depend more or less on public authorities, but many are out of public authorities control (foreign policies, market and deregulation, socials and environmental impacts, public opinion). As far as possible, the following study tries to identify those factors. (D.L.). 2 photos
Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.
Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired
Power peaking nuclear reliability factors
International Nuclear Information System (INIS)
Hassan, H.A.; Pegram, J.W.; Mays, C.W.; Romano, J.J.; Woods, J.J.; Warren, H.D.
1977-11-01
The Calculational Nuclear Reliability Factor (CNRF) assigned to the limiting power density calculated in reactor design has been determined. The CNRF is presented as a function of the relative power density of the fuel assembly and its radial local. In addition, the Measurement Nuclear Reliability Factor (MNRF) for the measured peak hot pellet power in the core has been evaluated. This MNRF is also presented as a function of the relative power density and radial local within the fuel assembly
Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan
2015-01-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...
International Nuclear Information System (INIS)
Evans, T.; Reitman, M.; Felsenfeld, G.
1988-01-01
The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites
Surface sensitivity of nuclear-knock-out form factors
International Nuclear Information System (INIS)
Fratamico, G.
1984-01-01
A numerical calculation has been performed to investigate the sensitivity of nuclear-knock-out form factors to nuclear-surface behaviour of bound-state wave functions. The result of our investigation suggests that one can extract the bound-state behaviour at the surface from experimental information on nuclear-knock-out form factors
Human factors in nuclear power plant operations
International Nuclear Information System (INIS)
Swain, A.D.
1980-08-01
This report describes some of the human factors problems in nuclear power plants and the technology that can be employed to reduce those problems. Many of the changes to improve the human factors in existing plants are inexpensive, and the expected gain in human reliability is substantial. The human factors technology is well-established and there are practitioners in most countries that have nuclear power plants
Bardoxolone methyl in type 2 diabetes and stage 4 chronic kidney disease
DEFF Research Database (Denmark)
de Zeeuw, Dick; Akizawa, Tadao; Audhya, Paul
2013-01-01
Although inhibitors of the renin-angiotensin-aldosterone system can slow the progression of diabetic kidney disease, the residual risk is high. Whether nuclear 1 factor (erythroid-derived 2)-related factor 2 activators further reduce this risk is unknown....
Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu
2018-04-01
During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.
Human factors in nuclear power plants
International Nuclear Information System (INIS)
Pack, R.W.
1978-01-01
The Electric Power Research Institute has started research in human factors in nuclear power plants. One project, completed in March 1977, reviewed human factors problems in operating power plants and produced a report evaluating those problems. A second project developed computer programs for evaluating operator performance on training simulators. A third project is developing and evaluating control-room design approaches. A fourth project is reviewing human factors problems associated with power-plant maintainability and instrumentation and control technician activities. Human factors engineering is an interdisciplinary specialty concerned with influencing the design of equipment systems, facilities, and operational environments to promote safe, efficient, and reliable operator performance. The Electric Power Research Institute (EPRI) has undertaken four projects studying the application of human factors engineering principles to nuclear power plants. (author)
Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage
Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.
2013-01-01
Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...
Importance of human factors on nuclear installations safety
International Nuclear Information System (INIS)
Caruso, G.J.
1990-01-01
Actually, installations safety and, in particular the nuclear installations infer a strong incidence in human factors related to the design and operation of such installations. In general, the experience aims to that the most important accidents have happened as result of the components' failures combination and human failures in the operation of safety systems. Human factors in the nuclear installations may be divided into two areas: economy and human reliability. Human factors treatments for the safety evaluation of the nuclear installations allow to diagnose the weak points of man-machine interaction. (Author) [es
Expression of assayable residual stem cell damage in erythroid differentiation
International Nuclear Information System (INIS)
Huebner, G.E.; Miller, M.E.; Cronkite, E.P.
1985-01-01
In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)
Human factor problem in nuclear power generation
International Nuclear Information System (INIS)
Yoshino, Kenji; Fujimoto, Junzo
1999-01-01
Since a nuclear power plant accident at Threemile Island in U.S.A. occurred in March, 1979, twenty years have passed. After the accident, the human factor problem became focussed in nuclear power, to succeed its research at present. For direct reason of human error, most of factors at individual level or work operation level are often listed at their center. Then, it is natural that studies on design of a machine or apparatus suitable for various human functions and abilities and on improvement of relationship between 'human being and machine' and 'human being and working environment' are important in future. Here was, as first, described on outlines of the human factor problem in a nuclear power plant developed at a chance of past important accident, and then was described on educational training for its countermeasure. At last, some concrete researching results obtained by human factor research were introduced. (G.K.)
Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S
2015-07-01
Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.
Ulu, Ramazan; Gozel, Nevzat; Tuzcu, Mehmet; Orhan, Cemal; Yiğit, İrem Pembegül; Dogukan, Ayhan; Telceken, Hafize; Üçer, Özlem; Kemeç, Zeki; Kaman, Dilara; Juturu, Vijaya; Sahin, Kazim
2018-05-31
In the present study, we evaluated the effects of M. pruriens administration on metabolic parameters, oxidative stress and kidney nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and nuclear factor (erythroid-derived 2)-like 2 (Nrf2) signaling pathways in high-fructose fed rats. Male rats (n = 28) were divided into 4 groups as control, M. pruriens, fructose, and M. pruriens plus fructose. All rats were fed a standard diet supplemented or no supplemented with M. pruriens (200 mg/kg/d by gavage). Fructose was given in drinking water for 8 weeks. High fructose consumption led to an increase in the serum level of glucose, triglyceride, urea and renal malondialdehyde (MDA) levels. Although M. pruriens treatment reduced triglyceride and MDA levels, it did not affect other parameters. M. pruriens supplementation significantly decreased the expression of NF-ҡB and decreased expression of Nrf2 and HO-1 proteins in the kidney. This study showed that the adverse effects of high fructose were alleviated by M. pruriens supplementation via modulation of the expression of kidney nuclear transcription factors in rats fed high fructose diet. Copyright © 2018 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Lambers Heerspink, Hiddo J; Chertow, Glenn M; Akizawa, Tadao
2013-01-01
Type 2 diabetes mellitus (T2DM) is the most important contributing cause of end-stage renal disease (ESRD) worldwide. Bardoxolone methyl, a nuclear factor-erythroid-2-related factor 2 activator, augments estimated glomerular filtration. The Bardoxolone methyl EvAluation in patients with Chronic...
Human factors in nuclear safety oversight
International Nuclear Information System (INIS)
Taylor, K.
1989-01-01
The mission of the nuclear safety oversight function at the Savannah River Plant is to enhance the process and nuclear safety of site facilities. One of the major goals surrounding this mission is the reduction of human error. It is for this reason that several human factors engineers are assigned to the Operations assessment Group of the Facility Safety Evaluation Section (FSES). The initial task of the human factors contingent was the design and implementation of a site wide root cause analysis program. The intent of this system is to determine the most prevalent sources of human error in facility operations and to assist in determining where the limited human factors resources should be focused. In this paper the strategy used to educate the organization about the field of human factors is described. Creating an awareness of the importance of human factors engineering in all facets of design, operation, and maintenance is considered to be an important step in reducing the rate of human error
Tumour Necrosis Factor-alpha and Nuclear Factor-kappa B Gene Variants in Sepsis.
Acar, Leyla; Atalan, Nazan; Karagedik, E Hande; Ergen, Arzu
2018-01-20
The humoral system is activated and various cytokines are released due to infections in tissues and traumatic damage. Nuclear factor-kappa B dimers are encoded by nuclear factor-kappa B genes and regulate transcription of several crucial proteins of inflammation such as tumour necrosis factor-alpha. To investigate the possible effect of polymorphisms on tumour necrosis factor-alpha serum levels with clinical and prognostic parameters of sepsis by determining the nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A) gene polymorphisms and tumour necrosis factor-alpha serum levels. Case-control study. Seventy-two patients with sepsis and 104 healthy controls were included in the study. In order to determine the polymorphisms of nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A), polymerase chain reaction-restriction fragment length polymorphism analysis was performed and serum tumour necrosis factor-alpha levels were determined using an enzyme-linked immunosorbent assay. We observed no significant differences in tumour necrosis factor-alpha serum levels between the study groups. In the patient group, an increase in the tumour necrosis factor-alpha serum levels in patients carrying the tumour necrosis factor-alpha (-308 G/A) A allele compared to those without the A allele was found to be statistically significant. Additionally, an increase in the tumour necrosis factor-alpha serum levels in patients carrying tumour necrosis factor-alpha (-308 G/A) AA genotype compared with patients carrying the AG or GG genotypes was statistically significant. No significant differences were found in these 2 polymorphisms between the patient and control groups (p>0.05). Our results showed the AA genotype and the A allele of the tumour necrosis factor-alpha (-308 G/A) polymorphism may be used as a predictor of elevated tumour necrosis factor-alpha levels in patients with sepsis.
Human Factor on Gravelines Nuclear Power Plants
International Nuclear Information System (INIS)
Duboc, Gerard
1998-01-01
In a first part, the documents describes the commitments by EDF nuclear power plan operations to demands made by the Safety Authority regarding actions in the field of human factors (concerns expressed by the Authority, in-depth analysis, positions on different points raised by the Authority). In a second part, it presents the various actions undertaken in the Gravelines nuclear power station regarding human factors: creation of an 'operator club' (mission and objectives, methods and means, first meetings, tracking file), development of risk analysis strategy, setting up of a human factor engineering mission and example of action in case of a significant event
International Nuclear Information System (INIS)
Li Tianshu
2013-01-01
Based on years of knowledge in nuclear safety supervision and experience of investigating and dealing with violation events in repair welding of DFHM, this paper analyzes major faults in manufacturing and maintaining activities of nuclear safety equipment in relation to human and organizational factors. It could be deducted that human and organizational factors has definitely become key features in the development of nuclear energy and technology. Some feasible measures to reinforce supervision on nuclear safety equipment activities have also been proposed. (author)
The significance of human factors in nuclear activities
International Nuclear Information System (INIS)
Weil, L.; Berg, H.P.
1999-01-01
Human factors is an aspect increasingly investigated in the last few years in efforts and programmes for enhancing the operational safety of nuclear systems. Methodology has been elaborated for analysis and evaluation of human reliability, or development of instruments supporting the decisions to be taken by the operators at the man-control room interface of nuclear installations, as well as initial approaches to introduce organisational factors which may influence the man-machine function allocation, and thus are an element of the safety culture concept. The significance of human factors in nuclear activities, as well as activities at the national and international level for optimisation of the man-machine interface and the man-organisation interface are discussed. (orig./CB) [de
Cino, E.A.; Wong-ekkabut, J.; Karttunen, M.E.J.; Choy, W.-Y.
2011-01-01
Intrinsically disordered proteins (IDPs) are abundant in cells and have central roles in protein-protein interaction networks. Interactions between the IDP Prothymosin alpha (ProTa) and the Neh2 domain of Nuclear factor erythroid 2-related factor 2 (Nrf2), with a common binding partner, Kelch-like
ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN
Directory of Open Access Journals (Sweden)
Marco Gabbianelli
2009-11-01
In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF. In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.
Human factors in nuclear power plants
International Nuclear Information System (INIS)
Hennig, J.; Bohr, E.
1976-04-01
This annotated bibliography is a first attempt to give a survey of the kind of literature which is relevant for the ergonomic working conditions in nuclear power plants. Such a survey seems to be useful in view of the fact that the 'factor human being' comes recently more and more to the fore in nuclear power plants. In this context, the necessity is often pointed out to systematically include our knowledge of the performance capacity and limits of human beings when designing the working conditions for the personnel of nuclear power plants. For this reason, the bibliography is so much intended for the ergonomics experts as for the experts of nuclear engineering. (orig./LN) [de
The human factor in the nuclear industry
International Nuclear Information System (INIS)
Colas, Armand
1998-01-01
After having evoked the progressive reduction and stabilization of significant incidents occurring every year in French nuclear power plants, and the challenges faced by nuclear energy (loss of public confidence, loss of competitiveness), and then outlined the importance of safety to overcome these challenges, the author comments EDF's approach to the human factor. He first highlights the importance of information and communication towards the population. He briefly discusses the meaning of human factors for the nuclear industry, sometimes perceived as the contribution people to the company's safety and performance. He comments the evolution observed in the perception of human error in different industrial or technical environments and situations, and outlines what is at stake to reduce the production of faults and organize a 'hunt for latent defects'
Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.
Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem
2016-12-01
In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.
Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle
International Nuclear Information System (INIS)
Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella
2012-01-01
Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.
Factor of radioactive waste on nuclear power program
International Nuclear Information System (INIS)
Syed Abdul Malik Syed Zain
2009-01-01
Global warming phenomena and rising oil prices have brought the excitement of open space use of nuclear power. Arguments in favor of this technology range in terms of more environmentally friendly, energy diversification and cost efficiency has prompted the government to widen the choice of nuclear power be considered as a serious alternative. Despite the attractive factors to the use of these powers, there are also factors that stem from the continued development of nuclear power. These include the factor of safety, security, security of fuel supply, and public attention is often associated with radioactive waste management. This article attempts to debate specific to radioactive waste management factors that impact on public acceptance of a country's nuclear power program, especially in Malaysia. Starting from the absence of radioactive waste management policy to model uncertainty of the landfill and complications in selecting a repository site shows the basic infrastructure is still lacking. In addition, previous experience handling thorium waste has not reached a final settlement after several years of implementation. It reinforced the perception about the level of public confidence in the competence and attitude of local workers who are not very encouraging to pursue this advanced.
Factors influencing chemical durability of nuclear waste glasses
International Nuclear Information System (INIS)
Feng, Xiangdong; Bates, J.K.
1993-01-01
A short summary is given of our studies on the major factors that affect the chemical durability of nuclear waste glasses. These factors include glass composition, solution composition, SA/V (ratio of glass surface area to the volume of solution), radiation, and colloidal formation. These investigations have enabled us to gain a better understanding of the chemical durability of nuclear waste glasses and to accumulate.a data base for modeling the long-term durability of waste glass, which will be used in the risk assessment of nuclear waste disposal. This knowledge gained also enhances our ability to formulate optimal waste glass compositions
Human and organizational factors in nuclear safety
International Nuclear Information System (INIS)
Garcia, A.; Barrientos, M.; Gil, B.
2015-01-01
Nuclear installations are socio technical systems where human and organizational factors, in both utilities and regulators, have a significant impact on safety. Three Mile Island (TMI) accident, original of several initiatives in the human factors field, nevertheless became a lost opportunity to timely acquire lessons related to the upper tiers of the system. Nowadays, Spanish nuclear installations have integrated in their processes specialists and activities in human and organizational factors, promoted by the licensees After many years of hard work, Spanish installations have achieved a better position to face new challenges, such as those posed by Fukushima. With this experience, only technology-centered action plan would not be acceptable, turning this accident in yet another lost opportunity. (Author)
PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia
DEFF Research Database (Denmark)
Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta
2004-01-01
markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...
Uranium, a factor limiting nuclear energy?
International Nuclear Information System (INIS)
Ohnemus, J.
2006-01-01
Nuclear power has been back as a topic of public debate since early this year. A special subject under discussion is the extension of nuclear power plant life. Hardly had it been on the agenda, when interested parties announced that this step was impossible because uranium reserves were no longer sufficient. A variety of terms are being used in this discussion without their meaning being taken into account: stocks, resources, and reserves. To clarify the situation, this article outlines important aspects of short and long term uranium supplies, and analyzes their meaning. Here are some of the most important issues under consideration: - For what period of time is there really enough uranium? - Is uranium becoming the limiting factor in the use of nuclear power? - Is uranium really a 'sustainable' energy resource? - Will higher prices extend the range? - What is the influence of the price of uranium on the cost of electricity generation? Among other results, it is found that comprehensive sources of low-price uranium and nuclear fuels are, or can be made, available worldwide. Consequently, the 'range' is beyond the time frames currently mentioned, also as a function of technological factors, i.e. reaching several hundred years. It is also important to note that nuclear power - ensures greater independence of volatile imported sources, - guarantees reliably low electricity prices, - has a huge potential of environmental protection, and - is a clean source of energy. (orig.)
Uranium, a factor limiting nuclear energy?
International Nuclear Information System (INIS)
2006-01-01
Nuclear power has been back as a topic of public debate since early this year. A special subject under discussion is the extension of nuclear power plant life. Hardly had it been on the agenda, when interested parties announced that this step was impossible because uranium reserves were no longer sufficient. A variety of terms are being used in this discussion without their meaning being taken into account: stocks, resources, and reserves. To clarify the situation, this article outlines important aspects of short and long term uranium supplies, and analyzes their meaning. Here are some of the most important issues under consideration: - For what period of time is there really enough uranium? - Is uranium becoming the limiting factor in the use of nuclear power? - Is uranium really a 'sustainable' energy resource? - Will higher prices extend the range? - What is the influence of the price of uranium on the cost of electricity generation? Among other results, it is found that comprehensive sources of low-price uranium and nuclear fuels are, or can be made, available worldwide. Consequently, the 'range' is beyond the time frames currently mentioned, also as a function of technological factors, i.e. reaching several hundred years. It is also important to note that nuclear power - ensures greater independence of volatile imported sources, - guarantees reliably low electricity prices, - has a huge potential of environmental protection, and - is a clean source of energy. (orig./GL)
Development of human factors engineering guide for nuclear power project
International Nuclear Information System (INIS)
Wu Dangshi; Sheng Jufang
1997-01-01
'THE PRACTICAL GUIDE FOR APPLICATION OF HUMAN FACTORS ENGINEERING TO NUCLEAR POWER PROJECT (First Draft, in Chinese)', which was developed under a research program sponsored by National Nuclear Safety Administration (NNSA) is described briefly. It is hoped that more conscious, more systematical and more comprehensive application of Human Factors Engineering to the nuclear power projects from the preliminary feasibility studies up to the commercial operation will benefit the safe, efficient and economical operations of nuclear power plants in China
U.S. Nuclear Regulatory Commission human factors program plan
International Nuclear Information System (INIS)
1986-04-01
The purpose of the U.S. Nuclear Regulatory Commission (NRC) Human Factors Program Plan is to ensure that proper consideration is given to human factors in the design and operation of nuclear facilities. This revised plan addresses human factors issues related to the operation of nuclear power plants (NPPs). The three issues of concern are (1) the activities planned to provide the technical bases to resolve the remaining tasks related to human factors as described in NUREG-0660, The NRC Action Plan Developed as a Result of the TMI-2 Accident, and NUREG-0737, Clarification of TMI Action Plan Requirements; (2) the need to address the additional human factors efforts that were identified during implementation of the Action Plan; and (3) the actual fulfillment of those developmental activities specified in Revision 1 of this plan. The plan represents a systematic approach for addressing high priority human factors concerns important to NPP safety in FY 1986 through 1987
International Nuclear Information System (INIS)
Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.
1991-01-01
These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase
Let-7 microRNAs are developmentally regulated in circulating human erythroid cells
Directory of Open Access Journals (Sweden)
Reed Christopher
2009-11-01
Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.
Directory of Open Access Journals (Sweden)
Gloria Bua
Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells
Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio
2016-01-01
The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771
US Nuclear Regulatory Commission human-factors program plan
International Nuclear Information System (INIS)
1983-08-01
The purpose of the NRC Human Factors Program Plan is to ensure that proper consideration is given to human factors in the design, operation, and maintenance of nuclear facilities. This initial plan addresses nuclear power plants (NPP) and describes (1) the technical assistance and research activities planned to provide the technical bases for the resolution of the remaining human factors related tasks described in NUREG-0660, The NRC Action Plan Developed as a Result of the TMI-2 Accident, and NUREG-0737, Clarification of TMI Action Plan Requirements, and (2) the additional human factors efforts identified during implementation of the Action Plan that should receive NRC attention. The plan represents a systematic and comprehensive approach for addressing human factors concerns important to NPP safety in the FY-83 through FY-85 time frame
Organizational factors in nuclear safety
International Nuclear Information System (INIS)
Wilpert, Bernhard
2000-01-01
The overall picture of factors which contributed to the event presents a panorama of a NPP where organizational and managerial characteristics were intricately intertwined and emerged as crucial for a general deterioration of the plant's capabilities to continually correct its deficiencies and optimize its operations. In the following author shall attempt to first cover various important efforts to modeling organizational factors relevant to safety. The second part of my presentation will offer an attempt towards an integrative model. The third part concludes with an agenda for research and practice. Most of the twelve different approaches above attempt to consider safety relevant organizational factors by way of pragmatic classifications. Together with their sub-categories we can count close to 160 different factors on various levels of abstraction. This is tantamount to say that most approaches lack systematic theoretical underpinnings. Thus then arises the question whether we need to develop a generic model, which promises to encompass these three major approaches altogether. Practical issues emerge particularly in the domain of organizational development, i.e. the goal oriented efforts to change the structures and the functioning of nuclear operations in such a way that the desired outputs in terms safety and reliability result in a sustained fashion. Again, these practical concerns are intimately related to developments and advances in theory and methodology. Only a close cooperation among scientists from various disciplines and of practitioners holds the promise of adequately understanding and use of organizational factors in future improving the safety record of nuclear industry worldwide. (S.Y.)
The Nuclear Energy Factor In Indian Politics
Directory of Open Access Journals (Sweden)
A. A. Boyko
2017-01-01
Full Text Available Nuclear energy is a key branch of the world power system. The nuclear energy development is viewed by India as one of the ways to resolve the problem of the energy supply. In 2008 the country gained more opportunities for developing nuclear power sector and solving the national power deficit problem after NSG lifted restrictions on nuclear trade. This resulted in foreign companies emerging on the Indian nuclear market. In 2011 after the major emergency at Fukushima Daiichi Nuclear Power Plant in Japan India faced numerous anti-nuclear protests backed by NGOs, including those with foreign funding, and political parties. The article deals with the question of the political role this anti-nuclear opposition plays in India. According to some researchers the protests are organized by the competitors in order to compromise the business of a Russian company Rosatom in India. However, such demonstrations are spread throughout the country and directed against the competitors of Rosatom as well. The article comes to conclusion that the protests are just a reflection of the political fights in India where nuclear energy is a significant political factor.
Clinical validation of nuclear factor kappa B expression in invasive breast cancer.
Agrawal, Anil Kumar; Pielka, Ewa; Lipinski, Artur; Jelen, Michal; Kielan, Wojciech; Agrawal, Siddarth
2018-01-01
Breast cancer is the most commonly diagnosed cancer in Polish women. The expression of transcription nuclear factor kappa B, a key inducer of inflammatory response promoting carcinogenesis and cancer progression in breast cancer, is not well-established. We assessed the nuclear factor kappa B expression in a total of 119 invasive breast carcinomas and 25 healthy control samples and correlated this expression pattern with several clinical and pathologic parameters including histologic type and grade, tumor size, lymph node status, estrogen receptor status, and progesterone receptor status. The data used for the analysis were derived from medical records. An immunohistochemical analysis of nuclear factor kappa B, estrogen receptor, and progesterone receptor was carried out and evaluation of stainings was performed. The expression of nuclear factor kappa B was significantly higher than that in the corresponding healthy control samples. No statistical difference was demonstrated in nuclear factor kappa B expression in relation to age, menopausal status, lymph node status, tumor size and location, grade and histologic type of tumor, and hormonal status (estrogen receptor and progesterone receptor). Nuclear factor kappa B is significantly overexpressed in invasive breast cancer tissues. Although nuclear factor kappa B status does not correlate with clinicopathological findings, it might provide important additional information on prognosis and become a promising object for targeted therapy.
Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S
2015-11-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.
Uranium - a factor limiting nuclear energy?
International Nuclear Information System (INIS)
Ohnemus, J.
2006-01-01
Nuclear power has been back as a topic of public debate since early this year. A special subject under discussion is the extension of nuclear power plant life. Hardly had it been on the agenda, when interested parties announced that this st ep was impossible because uranium reserves were no longer sufficient. A variety of terms are being used in this discussion without their meaning being taken int o account: stocks, resources, and reserves. To clarify the situation, this artic le outlines important aspects of short and long term uranium supplies, and analy zes their meaning. Here are some of the most important issues under consideration: - For what period of time is there really enough uranium? - Is uranium becoming the limiting factor in the use of nuclear power? - Is uranium really a 'sustainable' energy resource? - Will higher prices extend the range? - What is the in fluence of the price of uranium on the cost of electricity generation? Among oth er results, it is found that comprehensive sources of low-price uranium and nucl ear fuels are, or can be made, available worldwide. Consequently, the 'range' is beyond the time frames currently mentioned, also as a function of technological factors, i.e. reaching several hundred years. It is also important to note that nuclear power - ensures greater independence of volatile imported sources, - guarantees reliably low electricity prices, - has a huge potential of environmental protection, and - is a clean source of energy. (orig.)
Prospective identification of erythroid elements in cultured peripheral blood.
Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P
1999-04-01
We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.
Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow
International Nuclear Information System (INIS)
Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.
1976-01-01
The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors
Separating form factor and nuclear model effects in quasielastic neutrino-nucleus scattering
Wieske, Joseph
2017-09-01
When studying neutrino oscillations an understanding of charged current quasielastic (CCQE) neutrino-nucleus scattering is imperative. This interaction depends on a nuclear model as well as knowledge of form factors. In the past, CCQE data from the MiniBooNE experiment was analyzed assuming the Relativistic Fermi Gas (RFG) nuclear model, an axial dipole form factor in, and using the the z-expansion for the axial form factor in. We present the first analysis that combines a non-RFG nuclear model, in particular the Correlated Fermi Gas nuclear model (CFG) of, and the z expansion for the axial form factor. This will allow us to separate form factor and nuclear model effects in CCQE scattering. This project was supported through the Wayne State University REU program under NSF Grant PHY-1460853 and by the DOE Grant DE-SC0007983.
Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio
2016-07-15
Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.
[Update on the biology of heme synthesis in erythroid cells].
Fujiwara, Tohru; Harigae, Hideo
2015-02-01
Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.
Directory of Open Access Journals (Sweden)
Ali Dehghanifard
2012-07-01
Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.
Human factor analysis and preventive countermeasures in nuclear power plant
International Nuclear Information System (INIS)
Li Ye
2010-01-01
Based on the human error analysis theory and the characteristics of maintenance in a nuclear power plant, human factors of maintenance in NPP are divided into three different areas: human, technology, and organization. Which is defined as individual factors, including psychological factors, physiological characteristics, health status, level of knowledge and interpersonal skills; The technical factors including technology, equipment, tools, working order, etc.; The organizational factors including management, information exchange, education, working environment, team building and leadership management,etc The analysis found that organizational factors can directly or indirectly affect the behavior of staff and technical factors, is the most basic human error factor. Based on this nuclear power plant to reduce human error and measures the response. (authors)
Nuclear modification factor using Tsallis non-extensive statistics
Energy Technology Data Exchange (ETDEWEB)
Tripathy, Sushanta; Garg, Prakhar; Kumar, Prateek; Sahoo, Raghunath [Indian Institute of Technology Indore, Discipline of Physics, School of Basic Sciences, Simrol (India); Bhattacharyya, Trambak; Cleymans, Jean [University of Cape Town, UCT-CERN Research Centre and Department of Physics, Rondebosch (South Africa)
2016-09-15
The nuclear modification factor is derived using Tsallis non-extensive statistics in relaxation time approximation. The variation of the nuclear modification factor with transverse momentum for different values of the non-extensive parameter, q, is also observed. The experimental data from RHIC and LHC are analysed in the framework of Tsallis non-extensive statistics in a relaxation time approximation. It is shown that the proposed approach explains the R{sub AA} of all particles over a wide range of transverse momentum but does not seem to describe the rise in R{sub AA} at very high transverse momenta. (orig.)
Geologic factors in nuclear waste disposal
International Nuclear Information System (INIS)
Towse, D.
1978-07-01
The study of geosciences and their relation to nuclear waste disposal and management entails analyzing the hydrology, chemistry, and geometry of the nuclear waste migration process. Hydrologic effects are determined by analyzing the porosity and permeability (natural and induced) of rock as well as pressures and gradients, dispersion, and aquifer length of the system. Chemistry parameters include radionuclide retardation factors and waste dissolution rate. Geometric parameters (i.e., parameters with dimension) evaluated include repository layer thickness, fracture zone area, tunnel length, and aquifer length. The above parameters act as natural barriers or controls to nuclear waste migration, and are evaluated in three potential geologic media: salt, shale, and crystalline rock deposits. Parametric values are assigned that correspond to many existing situations. These values, in addition to other important inputs, are lumped as a hydrology input into a computer simulation program used to model and calculate nuclear waste migration from the repository to the biosphere, and potential individual and population dose and radiation effects. These results are preliminary and show trends only; they do not represent an actual risk analysis
Walker, Aisha L.; Ofori-Acquah, Solomon
2016-01-01
The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...
US Nuclear Regulatory Commission Human Factors Program Plan. Revision 1
International Nuclear Information System (INIS)
1984-09-01
The purpose of the NRC Human Factors Program Plan (NUREG-0985) is to ensure that proper consideration is given to human factors in the design, operation, and maintenance of nuclear facilities. This revised plan addresses nuclear power plants (NPPs) and describes (1) the technical assistance and research activities planned to provide the technical bases for the resolution of the remaining human factors related tasks described in NUREG-0660, THE NRC Action Plan developed as a result of the TMI-2 Accident, and NUREG-0737, Clarification of TMI Action Plan Requirements; (2) the additional human factors efforts identified during implementation of the Action Plan that should receive NRC attention; (3) conduct of developmental activities specified in NUREG-0985 during FY-83; and (4) the impact of Section 306 of the Nuclear Waste Policy Act of 1982, PL 97-425. The plan represents a systematic and comprehensive approach for addressing human factors concerns important to NPP safety in the FY-84 through FY-86 time frame
Human factors methods in DOE nuclear facilities
International Nuclear Information System (INIS)
Bennett, C.T.; Banks, W.W.; Waters, R.J.
1993-01-01
The US Department of Energy (DOE) is in the process of developing a series of guidelines for the use of human factors standards, procedures, and methods to be used in nuclear facilities. This paper discusses the philosophy and process being used to develop a DOE human factors methods handbook to be used during the design cycle. The following sections will discuss: (1) basic justification for the project; (2) human factors design objectives and goals; and (3) role of human factors engineering (HFE) in the design cycle
Nuclear modification factor for J/ψ production in nucleus-nucleus collisions
International Nuclear Information System (INIS)
Xu Xiaoming; Zhou Jie
2011-01-01
The STAR Collaboration has offered an eminent nuclear modification factor of J/ψ at high p T and midrapidity produced in Cu-Cu collisions at √ s NN= 200 GeV. Recalling a prediction, we can understand that the feature of high-p T nuclear modification factor is related to cc produced by 2 → 1 and 2 → 2 partonic processes in deconfined matter, particularly in the prethermal stage and to the recombination of c and c-bar. The nuclear modification factor at high p T is sensitive to the earliest form of deconfined matter that does not have a temperature.(authors)
Research of human factor in nuclear power plants
International Nuclear Information System (INIS)
Nopp, I.
1983-01-01
The question is discussed of the study of the human factor with regard to the reliability of nuclear power plant operation. The reliability of the human factor is the result of the functional fitness, motivation, working conditions and working regime of personnel. (J.B.)
von Lindern, Marieke; Schmidt, Uwe; Beug, Hartmut
2004-01-01
Erythropoietin (Epo) and stem cell factor (SCF) are essential factors in the control of survival, expansion and differentiation of erythroid progenitors. Upon activation, their receptors, the EpoR and c-Kit, initiate multiple signalling pathways that control many cellular processes. To control
DEFF Research Database (Denmark)
Järås, Marcus; Johnels, Petra; Agerstam, Helena
2009-01-01
OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...
Human factor engineering applied to nuclear power plant design
International Nuclear Information System (INIS)
Manrique, A.; Valdivia, J.C.; Jimenez, A.
2001-01-01
For the design and construction of new nuclear power plants as well as for maintenance and operation of the existing ones new man-machine interface designs and modifications are been produced. For these new designs Human Factor Engineering must be applied the same as for any other traditional engineering discipline. Advantages of implementing adequate Human Factor Engineering techniques in the design of nuclear reactors have become not only a fact recognized by the majority of engineers and operators but also an explicit requirement regulated and mandatory for the new designs of the so called advanced reactors. Additionally, the big saving achieved by a nuclear power plant having an operating methodology which significantly decreases the risk of operating errors makes it necessary and almost vital its implementation. The first step for this is preparing a plan to incorporate all the Human Factor Engineering principles and developing an integral design of the Instrumentation and Control and Man-machine interface systems. (author)
Nuclear energy - stabilising factor in the world economy
International Nuclear Information System (INIS)
Legassov, V.; Feoktistov, L.; Kouzmine, I.
1986-01-01
One of the most important factors for international stability is the development of the economy, reducing the risk of local armed conflicts which could escalate into world-wide nuclear war. Economic progress which plays such a vital part is in turn heavily dependent on energy supplies. The article takes a brief look at the role of nuclear power in this context. (B.M.S.)
Human Factors in Nuclear Reactor Accidents
International Nuclear Information System (INIS)
Mustafa, M.E.
2016-01-01
While many people would blame nature for the disaster of the “Fukushima Daiichi” accident, experts considered this accident to be also a human-induced disaster. This confirmed the importance of human errors which have been getting a growing interest in the nuclear field after the Three Mile Island accident. Personnel play an important role in design, operation, maintenance, planning, and management. The interface between machine and man is known as a human factor. In the present work, the human factors that have to be considered were discussed. The effect of the control room configuration and equipment design effect on the human behavior was also discussed. Precise reviewing of person’s qualifications and experience was focused. Insufficient training has been a major cause of human error in the nuclear field. The effective training issues were introduced. Avoiding complicated operational processes and non responsive management systems was stressed. Distinguishing between the procedures for normal and emergency operations was emphasised. It was stated that human error during maintenance and testing activities could cause a serious accident. This is because safety systems do not cover much more risk probabilities in the maintenance and testing activities like they do in the normal operation. In nuclear industry, the need for a classification and identification of human errors has been well recognised. As a result of this, human reliability must be assessed. These errors are analyzed by a probabilistic safety assessment which deals with errors in reading, listening and implementing procedures but not with cognitive errors. Much efforts must be accomplished to consider cognitive errors in the probabilistic safety assessment. The ways of collecting human factor data were surveyed. The methods for identifying safe designs, helping decision makers to predict how proposed or current policies will affect safety, and comprehensive understanding of the relationship
Review of EPRI Nuclear Human Factors Program
International Nuclear Information System (INIS)
Hanes, L.F.; O'Brien, J.F.
1996-01-01
The Electric Power Research Institute (EPRI) Human Factors Program, which is part of the EPRI Nuclear Power Group, was established in 1975. Over the years, the Program has changed emphasis based on the shifting priorities and needs of the commercial nuclear power industry. The Program has produced many important products that provide significant safety and economic benefits for EPRI member utilities. This presentation will provide a brief history of the Program and products. Current projects and products that have been released recently will be mentioned
Nuclear Regulatory Commission Human Factors Program Plan. Revision 2
International Nuclear Information System (INIS)
1986-04-01
This document is the Second Annual Revision to the NRC Human Factors Program Plan. The first edition was published in August 1983. Revision 1 was published in July of 1984. Purpose of the NRC Human Factors Program is to ensure that proper consideration is given to human factors in the design and operation of nuclear power plants. This document describes the plans of the Office of Nuclear Reactor Regulation to address high priority human factors concerns of importance to reactor safety in FY 1986 and FY 1987. Revision 2 of the plan incorporates recent Commission decisions and policies bearing on the human factors aspects of reactor safety regulation. With a few exceptions, the principal changes from prior editions reflect a shift from developing new requirements to staff evaluation of industry progress in resolving human factors issues. The plan addresses seven major program elements: (1) Training, (2) Licensing Examinations, (3) Procedures, (4) Man-Machine Interface, (5) Staffing and Qualifications, (6) Management and Organization, and (7) Human Performance
Personality Factors and Nuclear Power Plant Operators: Initial License Success
DeVita-Cochrane, Cynthia
Commercial nuclear power utilities are under pressure to effectively recruit and retain licensed reactor operators in light of poor candidate training completion rates and recent candidate failures on the Nuclear Regulatory Commission (NRC) license exam. One candidate failure can cost a utility over $400,000, making the successful licensing of new operators a critical path to operational excellence. This study was designed to discover if the NEO-PI-3, a 5-factor measure of personality, could improve selection in nuclear utilities by identifying personality factors that predict license candidate success. Two large U.S. commercial nuclear power corporations provided potential participant contact information and candidate results on the 2014 NRC exam from their nuclear power units nation-wide. License candidates who participated (n = 75) completed the NEO-PI-3 personality test and results were compared to 3 outcomes on the NRC exam: written exam, simulated operating exam, and overall exam result. Significant correlations were found between several personality factors and both written and operating exam outcomes on the NRC exam. Further, a regression analysis indicated that personality factors, particularly Conscientiousness, predicted simulated operating exam scores. The results of this study may be used to support the use of the NEO-PI-3 to improve operator selection as an addition to the current selection protocol. Positive social change implications from this study include support for the use of a personality measure by utilities to improve their return-on-investment in candidates and by individual candidates to avoid career failures. The results of this study may also positively impact the public by supporting the safe and reliable operation of commercial nuclear power utilities in the United States.
Quality management in the nuclear industry: the human factor
International Nuclear Information System (INIS)
1990-01-01
In the nuclear industry it is vital to understand the 'human factor' with regard to plant performance and plant safety. A proper management system ensures that personnel perform their duties correctly. 'Quality Management in the Nuclear Industry: the Human Factor', was a conference organized by the Institution of Mechanical Engineers in October 1990. The conference covered a wide range of topics on an international level including: standards, licensing and regulatory procedures; selection assessment and training of personnel; feedback from experience of good practice and of deviations; management and support of personnel performance; modelling and evaluation of human factors. The papers presented at the conference are contained in this volume. All twenty papers are indexed separately. (author)
Directory of Open Access Journals (Sweden)
Kei Kohno
Full Text Available Erythroid abnormalities including anemia and polycythemia are often observed in the general clinical setting. Because recent studies reported that adiponectin negatively affects hematopoiesis, we performed a prospective observational study to assess the relationship between anemia and adiponectin, as well as other parameters, in 1029 Japanese subjects (477 men and 552 women 40 years of age and older. Body measurements, blood tests, and nutrition intake studies were performed at baseline, and 5 to 7 years later (follow-up. Hemoglobin (Hb and hematocrit (Hct levels in men with high serum adiponectin levels were lower at follow-up than at baseline. Multiple regression analysis showed that age, body mass index, adiponectin, and glutamic-pyruvic transaminase were significantly associated with erythroid-related variables (red blood cells, Hb, and Hct in both men and women (P <0.05. In a logistic regression analysis, adiponectin, fasting blood glucose, and β-natriuretic peptide were significant risk factors for anemia in men, and blood urea nitrogen and amylase were significant risk factors in women. Physical features and nutrient intake were not risk factors for anemia. Our study demonstrates, both clinically and epidemiologically, that a high serum adiponectin level decreases the amounts of erythroid-related variables and is a risk factor for anemia in Japanese men.
International Nuclear Information System (INIS)
Hopkins, C.O.; Snyder, H.L.; Price, H.E.; Hornick, R.J.; Mackie, R.R.; Smillie, R.J.; Sugarman, R.C.
1982-08-01
This comprehensive long-range human factors plan for nuclear reactor regulation was developed by a Study Group of the Human Factors Society, Inc. This Study Group was selected by the Executive Council of the Society to provide a balanced, experienced human factors perspective to the applications of human factors scientific and engineering knowledge to nuclear power generation. The report is presented in three volumes. Volume 1 contains an Executive Summary of the 18-month effort and its conclusions. Volume 2 summarizes all known nuclear-related human factors activities, evaluates these activities wherever adequate information is available, and describes the recommended long-range (10-year) plan for human factors in regulation. Volume 3 elaborates upon each of the human factors issues and areas of recommended human factors involvement contained in the plan, and discusses the logic that led to the recommendations
Human factors guidelines for nuclear power plant applications
International Nuclear Information System (INIS)
Ketchel, J.
1993-01-01
In 1989, Waters et al. reported to the Human Factors Society on developing human factors criteria for a new reactor plant. They correctly indicated that much of the guidance documentation in human factors engineering has derived from MIL-STD-1472 and its antecedents. Guidelines for human-computer interface have sprung primarily from the Smith and Mosier compendium and its source documents. NUREG-0700, which is currently being updated, was developed by the US Nuclear Regulatory Commission (NRC) as a general evaluation guide for inspecting control rooms. In addition, the Electric Power Research Institute, Institute of Nuclear Power Operations, US Department of Energy, the NRC, and others have published a number of specialized documents on a range of subjects. The number of guidelines and standards has grown in the past few years to an impressive number, including those published by international organizations and professional societies. This paper provides an update on current efforts to provide appropriate guidance for the power industry and, perhaps more importantly, offers a perspective on how users should think about using the available materials and what else is needed. The Electric Power Research Institute (EPRI) continues to be one of the principal participants in providing guidance to the utilities. Human factors guidelines is indeed a timely topic, currently of great interest to EPRI's constituents and to designers of new and upgraded nuclear power plants (NPMs) in the Advanced Light Water Reactor and the Instrumentation and Control Upgrade Initiative programs
Human factors design guidelines for maintainability of Department of Energy nuclear facilities
Energy Technology Data Exchange (ETDEWEB)
Bongarra, J.P. Jr.; VanCott, H.P.; Pain, R.F.; Peterson, L.R.; Wallace, R.I.
1985-06-18
Intent of these guidelines is to provide design and design review teams of DOE nuclear facilities with human factors principles to enhance the design and aid in the inspection of DOE nuclear facilities, systems, and equipment. These guidelines are concerned with design features of DOE nuclear facilities which can potentially affect preventive and corrective maintenance of systems within DOE nuclear facilities. Maintenance includes inspecting, checking, troubleshooting, adjusting, replacing, repairing, and servicing activities. Other factors which influence maintainability such as repair and maintenance suport facilities, maintenance information, and various aspects of the environment are also addressed.
Human factors design guidelines for maintainability of Department of Energy nuclear facilities
International Nuclear Information System (INIS)
Bongarra, J.P. Jr.; VanCott, H.P.; Pain, R.F.; Peterson, L.R.; Wallace, R.I.
1985-01-01
Intent of these guidelines is to provide design and design review teams of DOE nuclear facilities with human factors principles to enhance the design and aid in the inspection of DOE nuclear facilities, systems, and equipment. These guidelines are concerned with design features of DOE nuclear facilities which can potentially affect preventive and corrective maintenance of systems within DOE nuclear facilities. Maintenance includes inspecting, checking, troubleshooting, adjusting, replacing, repairing, and servicing activities. Other factors which influence maintainability such as repair and maintenance suport facilities, maintenance information, and various aspects of the environment are also addressed
Sadvakassova, Gulzhakhan; Dobocan, Monica C; Difalco, Marcos R; Congote, Luis F
2009-09-01
The matrix protein thrombospondin-4 has an acidic amphipathic C-terminal peptide (C21) which stimulates erythroid cell proliferation. Here we show that C21 stimulates red cell formation in anemic mice in vivo. In vitro experiments indicated that the peptide-mediated increase of erythroid colony formation in cultures of human CD34+ hematopoietic progenitor cells was possible only under continuous presence of erythropoietin. In the absence of this cytokine, C21 stimulated exclusively myeloid colony formation. Therefore, the peptide is not a specific erythroid differentiation factor. In fact, it is mitogenic in non-erythroid cells, such as skin fibroblasts and kidney epithelial cells. In erythroleukemic TF-1 cells, it actually decreased the production of the erythroid differentiation marker glycophorin A. C21-affinity chromatography revealed regulator of differentiation 1 (ROD1) as a major C21-binding protein. ROD1 is the hematopoietic cell paralog of polypyrimidine tract binding proteins (PTBs), RNA splice regulators which regulate differentiation by repressing tissue-specific exons. ROD1 binding to C21 was strongly inhibited by synthetic RNAs in the order poly A > poly U > poly G = poly C and was weakly inhibited by a synthetic phosphorylated peptide mimicking the C-terminal domain of RNA polymerase II. Cellular overexpression or knockdown experiments of ROD1 suggest a role for this protein in the mitogenic activity of C21. Since the nuclear proteins ROD1 and PTBs regulate differentiation at a posttranscriptional level and there is a fast nuclear uptake of C21, we put forward the idea that the peptide is internalized, goes to the nucleus and maintains cells in a proliferative state by supporting ROD1-mediated inhibition of differentiation.
Directory of Open Access Journals (Sweden)
Josephine Wesely
2017-01-01
Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.
Key Factors for Nuclear Being Economic after Fukushima
Energy Technology Data Exchange (ETDEWEB)
Roh, Myung Sub; Park, Seo Yeon [KEPCO International Nuclear Graduate School, Ulju (Korea, Republic of)
2012-05-15
It is hard to overstate the importance of electricity to the standard of living and the quality of life in a country. Electricity demand grows with population and with the changing nature, level and composition of economic and social activity. Civilization, industrialization and urbanization are, of course, key factors. It, historically, has shown that each major nuclear accident has caused a re-examination of the risk of nuclear power leading to more stringent safety requirement and higher costs. The Fukushima accident and its likely impact on future nuclear power development are difficult to foresee. The accident was a tragedy for the people affected and seriously undermined public confidence in the safety of nuclear power. A number of countries announced reviews of their programs, some took steps toward phasing out nuclear power entirely, and others reemphasized their expansion plans. The Korean nuclear community is carry out many ambitious projects for last three decades continuously and facing the another challenges relating to the future nuclear power economics and difficulty in financing new investment. In order to meet the above economic objective, it is strongly recommended that great emphasis should be placed on maintaining the nuclear economics without jeopardizing safety such as design simplification, standardization, shortening of construction period, increased availability, etc
Key Factors for Nuclear Being Economic after Fukushima
International Nuclear Information System (INIS)
Roh, Myung Sub; Park, Seo Yeon
2012-01-01
It is hard to overstate the importance of electricity to the standard of living and the quality of life in a country. Electricity demand grows with population and with the changing nature, level and composition of economic and social activity. Civilization, industrialization and urbanization are, of course, key factors. It, historically, has shown that each major nuclear accident has caused a re-examination of the risk of nuclear power leading to more stringent safety requirement and higher costs. The Fukushima accident and its likely impact on future nuclear power development are difficult to foresee. The accident was a tragedy for the people affected and seriously undermined public confidence in the safety of nuclear power. A number of countries announced reviews of their programs, some took steps toward phasing out nuclear power entirely, and others reemphasized their expansion plans. The Korean nuclear community is carry out many ambitious projects for last three decades continuously and facing the another challenges relating to the future nuclear power economics and difficulty in financing new investment. In order to meet the above economic objective, it is strongly recommended that great emphasis should be placed on maintaining the nuclear economics without jeopardizing safety such as design simplification, standardization, shortening of construction period, increased availability, etc
International Nuclear Information System (INIS)
Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.
1986-01-01
Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells
Human factors aspects of advanced instrumentation in the nuclear industry
International Nuclear Information System (INIS)
Carter, R.J.
1989-01-01
An important consideration in regards to the use of advanced instrumentation in the nuclear industry is the interface between the instrumentation system and the human. A survey, oriented towards identifying the human factors aspects of digital instrumentation, was conducted at a number of United States (US) and Canadian nuclear vendors and utilities. Human factors issues, subsumed under the categories of computer-generated displays, controls, organizational support, training, and related topics were identified. 20 refs., 2 tabs
Factor Analysis and Framework Development for Incorporating Public Trust on Nuclear Safety issues
Energy Technology Data Exchange (ETDEWEB)
Cho, Seongkyung; Lee, Gyebong [The Myongji Univ., Seoul (Korea, Republic of); Lee, Gihyung; Lee, Gyehwi; Jeong, Jina [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)
2014-05-15
The Korea Institute of Nuclear Safety (KINS), a regulatory expert organization in charge of nuclear safety in Korea, realized that a more fundamental and systematic analysis of activities is needed to actively meet the greater variety of concerns people have and increase the reliability of the results of regulation. Nuclear safety, a highly specialized field, has previously been discussed primarily from the viewpoint of the engineers who deal with the technology, but now 'public trust in nuclear safety' has to be viewed from the standpoint of the general public and from the socio-cultural perspective. Specific measures must be taken to examine which factors affect public trust and how we can secure and reproduce those factors to gain it. Also, an efficient system for incorporating public trust in nuclear safety must be established. In this study, various case studies were examined to identify the factors that affect public trust in nuclear safety. First, nuclear safety laws and information disclosure systems of major countries were examined by investigating data and conducting in-depth interviews. To explore a public framework concerning nuclear safety, big data of social media were analyzed. Also, Q methodology was used to analyze the risk schemata of the opinion leaders living in areas near nuclear power plants. Several surveys were conducted to analyze the amount of trust the public had in nuclear safety as well as their awareness of nuclear safety issues. Based on these analyses, factors affecting public trust in nuclear safety were extracted, and measures to build systems incorporating public trust in nuclear safety were proposed. This study addresses the public trust in nuclear safety on condition that the safety is ensured technically and mechanically.
Factor Analysis and Framework Development for Incorporating Public Trust on Nuclear Safety issues
International Nuclear Information System (INIS)
Cho, Seongkyung; Lee, Gyebong; Lee, Gihyung; Lee, Gyehwi; Jeong, Jina
2014-01-01
The Korea Institute of Nuclear Safety (KINS), a regulatory expert organization in charge of nuclear safety in Korea, realized that a more fundamental and systematic analysis of activities is needed to actively meet the greater variety of concerns people have and increase the reliability of the results of regulation. Nuclear safety, a highly specialized field, has previously been discussed primarily from the viewpoint of the engineers who deal with the technology, but now 'public trust in nuclear safety' has to be viewed from the standpoint of the general public and from the socio-cultural perspective. Specific measures must be taken to examine which factors affect public trust and how we can secure and reproduce those factors to gain it. Also, an efficient system for incorporating public trust in nuclear safety must be established. In this study, various case studies were examined to identify the factors that affect public trust in nuclear safety. First, nuclear safety laws and information disclosure systems of major countries were examined by investigating data and conducting in-depth interviews. To explore a public framework concerning nuclear safety, big data of social media were analyzed. Also, Q methodology was used to analyze the risk schemata of the opinion leaders living in areas near nuclear power plants. Several surveys were conducted to analyze the amount of trust the public had in nuclear safety as well as their awareness of nuclear safety issues. Based on these analyses, factors affecting public trust in nuclear safety were extracted, and measures to build systems incorporating public trust in nuclear safety were proposed. This study addresses the public trust in nuclear safety on condition that the safety is ensured technically and mechanically
The human factor and organization to support nuclear power plant operators
International Nuclear Information System (INIS)
Naumov, V.I.
1993-01-01
Analysis reveals three basic factors which affect the safety of nuclear power reactors: (1) Internal physical properties of the reactor which provide self protection under breakdown and accident conditions; (2) The reliability of technical systems which provide monitoring, control, accident prevention, heat release, and localization of hazardous products during accidents; (3) Reliability of the reactor control personnel. The last of these factors is usually called the human factor. From published data, this factor makes a large contribution to the downtime and accident statistics at nuclear power plants: from 30 to 80% in various countries. Today the importance of the human factor in operating a nuclear power units is rather well recognized. Current ideas on how to increase the reliability of a human operator are reflected in IAEA recommendations and domestic official documents. The concept of 'a culture of safety' is introduced. Basic types of actions to increase the reliability of personnel who control a nuclear reactor are discussed, including: (1) The qualifying and psychological selection and the training of candidates on the operator's obligations. (2) The automation of routine operations which do not require the operator's intellect. (3) Perfecting the work place, information input to the operator, and the organization of the controls
Energy Technology Data Exchange (ETDEWEB)
Williams, Larissa M., E-mail: lwillia2@bates.edu [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Lago, Briony A., E-mail: lagoba@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); McArthur, Andrew G., E-mail: mcarthua@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Raphenya, Amogelang R., E-mail: raphenar@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Pray, Nicholas, E-mail: pray.nicholas@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); Saleem, Nabil, E-mail: nabilsaleem@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Salas, Sophia, E-mail: sophia.salas2@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Paulson, Katherine, E-mail: krpaulson@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Mangar, Roshni S., E-mail: rmangar@coa.edu [The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); College of the Atlantic, 105 Eden Street, Bar Harbor, ME 04609 (United States); and others
2016-11-15
Highlights: • Nfe2 is involved in erythropoiesis in zebrafish. • Nfe2 is a novel regulator of pro-oxidant induced oxidative stress. • Embryos mount a molecularly unique oxidative stress response compared to larvae. • Nfe2 regulates a wide-variety of genes beyond erythropoiesis. - Abstract: Development is a complex and well-defined process characterized by rapid cell proliferation and apoptosis. At this stage in life, a developmentally young organism is more sensitive to toxicants as compared to an adult. In response to pro-oxidant exposure, members of the Cap’n’Collar (CNC) basic leucine zipper (b-ZIP) transcription factor family (including Nfe2 and Nfe2-related factors, Nrfs) activate the expression of genes whose protein products contribute to reduced toxicity. Here, we studied the role of the CNC protein, Nfe2, in the developmental response to pro-oxidant exposure in the zebrafish (Danio rerio). Following acute waterborne exposures to diquat or tert-buytlhydroperoxide (tBOOH) at one of three developmental stages, wildtype (WT) and nfe2 knockout (KO) embryos and larvae were morphologically scored and their transcriptomes sequenced. Early in development, KO animals suffered from hypochromia that was made more severe through exposure to pro-oxidants; this phenotype in the KO may be linked to decreased expression of alas2, a gene involved in heme synthesis. WT and KO eleutheroembryos and larvae were phenotypically equally affected by exposure to pro-oxidants, where tBOOH caused more pronounced phenotypes as compared to diquat. Comparing diquat and tBOOH exposed embryos relative to the WT untreated control, a greater number of genes were up-regulated in the tBOOH condition as compared to diquat (tBOOH: 304 vs diquat: 148), including those commonly found to be differentially regulated in the vertebrate oxidative stress response (OSR) (e.g. hsp70.2, txn1, and gsr). When comparing WT and KO across all treatments and times, there were 1170 genes that were
Directory of Open Access Journals (Sweden)
Pascariello Caterina
2008-05-01
Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of
International Nuclear Information System (INIS)
Hopkins, C.O.; Snyder, H.L.; Price, H.E.; Hornick, R.J.; Mackie, R.R.; Smillie, R.J.; Sugarman, R.C.
1982-08-01
This comprehensive long-range human factors plan for nuclear reactor regulation was developed by a Study Group of the Human Factors Society, Inc. This Study Group was selected by the Executive Council of the Society to provide a balanced, experienced human factors perspective to the applications of human factors scientific and engineering knowledge to nuclear power generation. The report is presented in three volumes. Volume 1 contains an Executive Summary of the 18-month effort and its conclusions. Volume 2 summarizes all known nuclear-related human factors activities, evaluates these activities wherever adequate information is available, and describes the recommended long-range (10-year) plan for human factors in regulation. Volume 3 elaborates upon each of the human factors issues and areas of recommended human factors involvement contained in the plan, and discusses the logic that led to the recommendations
Energy Technology Data Exchange (ETDEWEB)
Komatsu, Tetsuro [Microbiologie Fondamentale et Pathogénicité, MFP CNRS UMR 5234, Université de Bordeaux, Bordeaux 33076 (France); Department of Infection Biology, Faculty of Medicine, University of Tsukuba, Tsukuba 305-8575 (Japan); Will, Hans [Department of Tumor Biology, University Hospital Hamburg-Eppendorf, 20246 Hamburg (Germany); Nagata, Kyosuke [Department of Infection Biology, Faculty of Medicine, University of Tsukuba, Tsukuba 305-8575 (Japan); Wodrich, Harald, E-mail: harald.wodrich@u-bordeaux.fr [Microbiologie Fondamentale et Pathogénicité, MFP CNRS UMR 5234, Université de Bordeaux, Bordeaux 33076 (France)
2016-04-22
Recent studies involving several viral systems have highlighted the importance of cellular intrinsic defense mechanisms through nuclear antiviral proteins that restrict viral propagation. These factors include among others components of PML nuclear bodies, the nuclear DNA sensor IFI16, and a potential restriction factor PHF13/SPOC1. For several nuclear replicating DNA viruses, it was shown that these factors sense and target viral genomes immediately upon nuclear import. In contrast to the anticipated view, we recently found that incoming adenoviral genomes are not targeted by PML nuclear bodies. Here we further explored cellular responses against adenoviral infection by focusing on specific conditions as well as additional nuclear antiviral factors. In line with our previous findings, we show that neither interferon treatment nor the use of specific isoforms of PML nuclear body components results in co-localization between incoming adenoviral genomes and the subnuclear domains. Furthermore, our imaging analyses indicated that neither IFI16 nor PHF13/SPOC1 are likely to target incoming adenoviral genomes. Thus our findings suggest that incoming adenoviral genomes may be able to escape from a large repertoire of nuclear antiviral mechanisms, providing a rationale for the efficient initiation of lytic replication cycle. - Highlights: • Host nuclear antiviral factors were analyzed upon adenovirus genome delivery. • Interferon treatments fail to permit PML nuclear bodies to target adenoviral genomes. • Neither Sp100A nor B targets adenoviral genomes despite potentially opposite roles. • The nuclear DNA sensor IFI16 does not target incoming adenoviral genomes. • PHF13/SPOC1 targets neither incoming adenoviral genomes nor genome-bound protein VII.
International Nuclear Information System (INIS)
Komatsu, Tetsuro; Will, Hans; Nagata, Kyosuke; Wodrich, Harald
2016-01-01
Recent studies involving several viral systems have highlighted the importance of cellular intrinsic defense mechanisms through nuclear antiviral proteins that restrict viral propagation. These factors include among others components of PML nuclear bodies, the nuclear DNA sensor IFI16, and a potential restriction factor PHF13/SPOC1. For several nuclear replicating DNA viruses, it was shown that these factors sense and target viral genomes immediately upon nuclear import. In contrast to the anticipated view, we recently found that incoming adenoviral genomes are not targeted by PML nuclear bodies. Here we further explored cellular responses against adenoviral infection by focusing on specific conditions as well as additional nuclear antiviral factors. In line with our previous findings, we show that neither interferon treatment nor the use of specific isoforms of PML nuclear body components results in co-localization between incoming adenoviral genomes and the subnuclear domains. Furthermore, our imaging analyses indicated that neither IFI16 nor PHF13/SPOC1 are likely to target incoming adenoviral genomes. Thus our findings suggest that incoming adenoviral genomes may be able to escape from a large repertoire of nuclear antiviral mechanisms, providing a rationale for the efficient initiation of lytic replication cycle. - Highlights: • Host nuclear antiviral factors were analyzed upon adenovirus genome delivery. • Interferon treatments fail to permit PML nuclear bodies to target adenoviral genomes. • Neither Sp100A nor B targets adenoviral genomes despite potentially opposite roles. • The nuclear DNA sensor IFI16 does not target incoming adenoviral genomes. • PHF13/SPOC1 targets neither incoming adenoviral genomes nor genome-bound protein VII.
Availability improvement factors at Taipower's nuclear power plant system
International Nuclear Information System (INIS)
Chen, J.H.
1985-01-01
Sufficient electricity to meet the needs of a growing industrial economy, is one of the most important factors in the total economic development of a nation. Currently, nuclear power is considered one of the most economical and available sources of energy. To keep pace with Taiwan's rapid economic development, while also observing our government's policy of diversifying the requirements for imported forms of energy, Taiwan Power Company has embarked upon an ambitious of nuclear power plant construction. This paper discusses the improvement of Taiwan's nuclear power plants. At the present time, Taipower has completed three nuclear power plants. Two of these are located in northern Taiwan, along the East China Sea, while the third is on the southern tip of Taiwan, bordering the South China Sea. These three plants, each with two nuclear generating units, comprise a total nuclear generating capacity of 5144 MWe
Capacity factor of nuclear power stations in Japan in fiscal year 1984
International Nuclear Information System (INIS)
Agawa, Takashi
1985-01-01
In Japan presently a total of 28 nuclear power plants are in operation with aggregate capacity 20,561 MW, 22 % of the total power generation. Around 1975 there occurred such as stress corrosion cracking and to repair them much time was consumed, leading to the low capacity factor. With such troubles removed, in fiscal 1984, the capacity factor on average of the nuclear power stations is 73.9 %, the highest so far. Contributing to this are long period of the continuous operation, short period of the periodical inspection and increase in the in-operation capacity factor. Contents are the following : construction state of nuclear power stations, operation state in fiscal 1984, causes leading to the high capacity factor, future directions. (Mori, K.)
Modulation of proteostasis by transcription factor NRF2 and impact in neurodegenerative diseases
Directory of Open Access Journals (Sweden)
Marta Pajares
2017-04-01
Full Text Available Neurodegenerative diseases are linked to the accumulation of specific protein aggregates, suggesting an intimate connection between injured brain and loss of proteostasis. Proteostasis refers to all the processes by which cells control the abundance and folding of the proteome thanks to a wide network that integrates the regulation of signaling pathways, gene expression and protein degradation systems. This review attempts to summarize the most relevant findings about the transcriptional modulation of proteostasis exerted by the transcription factor NRF2 (nuclear factor (erythroid-derived 2-like 2. NRF2 has been classically considered as the master regulator of the antioxidant cell response, although it is currently emerging as a key component of the transduction machinery to maintain proteostasis. As we will discuss, NRF2 could be envisioned as a hub that compiles emergency signals derived from misfolded protein accumulation in order to build a coordinated and perdurable transcriptional response. This is achieved by functions of NRF2 related to the control of genes involved in the maintenance of the endoplasmic reticulum physiology, the proteasome and autophagy.
Nuclear safety and human factors: the French factory of expertise
International Nuclear Information System (INIS)
Rolina, G.
2009-01-01
The French regulation of the nuclear safety is based on the maintaining of a deep technical dialogue between the nuclear safety authority, the I.R.S.N. (Institute of radiation protection and nuclear safety) and the nuclear operators. This type of risk management is called 'french coking' by the Anglo-Saxons, followers of stricter regulatory approach, more readable by the civil society. This technical dialogue is not without quality, especially in the field of human and organizational factors where it allows to improve the know how situation that stays incomplete. (N.C.)
The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice
International Nuclear Information System (INIS)
Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.
1981-01-01
The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)
Human factor in the process of nuclear power development
International Nuclear Information System (INIS)
Enenkl, V.
The building up of nuclear power requires the training not only of personnel but of the whole population as well. Professional workers in nuclear power facilities production and personnel operating the equipment of nuclear power plants must be on a high technical and managerial level. The important quality of such personnel is their reliability and responsibility. The human factor influences the level, quality and thereby also the service-life of the machines and equipment and their operation. The improvement of the quality of work in nuclear power production depends on upgrading the scientific and technical level of workers and personnel, their training, in-service education and the raising of the social standing. (B.H.)
Correction factors for photon spectrometry in nuclear parameters study
International Nuclear Information System (INIS)
Patrao, Karla Cristina de Souza
2004-10-01
The goal of this work was the determination, using metrologic severity, the factors of correction for coincidences XX, Xγ and γγ and the factors of transference of efficiency for use in gamma spectrometry. On this way, it was carried through by determination of nuclear parameters of a nuclide used in medicine diagnostic ( 201 Tl) and the standardization of two environmental samples, of regular and irregular geometry, proceeding from the residual (ashes and slag) from the nuclear industry. The results shows that this adopted methodology is valid, and it allows its application for many different nuclides, including complex decay schema nuclides, using only photons spectrometry techniques on semiconductor detectors. (author)
Directory of Open Access Journals (Sweden)
Sreoshi Chatterjee
Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.
Statistical factors affecting the success of nuclear operations
International Nuclear Information System (INIS)
Sunder, S.; Stephenson, J.R.; Hochman, D.
1999-01-01
In this article, the authors present a statistical analysis to determine the operational, financial, technical, and managerial factors that most significantly affect the success of nuclear operations. The study analyzes data for over 70 nuclear plants and 40 operating companies over a period of five years in order to draw conclusions that they hope will be of interest to utility companies and public utility commissions as they seek ways to improve rates of success in nuclear operations. Some of these conclusions will not be surprising--for example, that older plants have heavier maintenance requirements--but others are less intuitive. For instance, the observation that operators of fewer plants have lower costs suggests that any experience curve benefits associated with managing multiple nuclear facilities is overshadowed by the logistic problems of multiple facilities. After presenting a brief history of nuclear power in America, the authors outline the motivations of the study and the methodology of their analysis. They end the article with the results of the study and discuss some of the managerial implications of these findings
Comparison of different methods for erythroid differentiation in the K562 cell line.
Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein
2016-08-01
To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.
A report on human factors in nuclear safety
International Nuclear Information System (INIS)
1983-03-01
Following the Three Mile Island incident of 1979, studies were undertaken by the Atomic Energy Control Board (AECB), in-house and through outside consultants, to address the role of human factors in the regulatory process. This report by the Advisory Committee on Nuclear Safety (ACNS) comments briefly on these studies and offers suggestions which would promote a more formal treatment of human factors by the AECB
Human factors engineering applied to Control Centre Design of a research nuclear reactor
Energy Technology Data Exchange (ETDEWEB)
Farias, Larissa P. de; Santos, Isaac J.A. Luquetti dos; Carvalho, Paulo V.R., E-mail: larissapfarias@ymail.com [Instituto de Engenharia Nuclear (DENN/SEESC/IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Lab, de Usabilidade e Confiabilidade Humana; Monteiro, Beany G. [Universidade Federal do Rio Janeiro (UFRJ), Rio Janeiro, RJ (Brazil). Departamento de Desenho Industrial
2017-07-01
The Human Factors Engineering (HFE) program is an essential aspect for the design of nuclear installations. The overall aim of the HFE program is the improvement of the operational reliability and safety of plant operation. The HFE program main purpose is to ensure that human factor practices are incorporated into the plant design, emphasizing man-machine interface issues and design improvement of the nuclear reactor Control Centre. The Control Centre of nuclear reactor is a combination of control rooms, control suites and local control stations, which are functionally connected and located on the reactor site. The objective of this paper is to present a design approach for the Control Centre of a nuclear reactor used to produce radioisotopes and for nuclear research, including human factor issues. The design approach is based on participatory design principles, using human factor standards, ergonomic guidelines, and the participation of a multidisciplinary team during all design phases. Using the information gathered, an initial sketch 3D of the Control Centre was developed. (author)
Human factors engineering applied to Control Centre Design of a research nuclear reactor
International Nuclear Information System (INIS)
Farias, Larissa P. de; Santos, Isaac J.A. Luquetti dos; Carvalho, Paulo V.R.; Monteiro, Beany G.
2017-01-01
The Human Factors Engineering (HFE) program is an essential aspect for the design of nuclear installations. The overall aim of the HFE program is the improvement of the operational reliability and safety of plant operation. The HFE program main purpose is to ensure that human factor practices are incorporated into the plant design, emphasizing man-machine interface issues and design improvement of the nuclear reactor Control Centre. The Control Centre of nuclear reactor is a combination of control rooms, control suites and local control stations, which are functionally connected and located on the reactor site. The objective of this paper is to present a design approach for the Control Centre of a nuclear reactor used to produce radioisotopes and for nuclear research, including human factor issues. The design approach is based on participatory design principles, using human factor standards, ergonomic guidelines, and the participation of a multidisciplinary team during all design phases. Using the information gathered, an initial sketch 3D of the Control Centre was developed. (author)
Human factors engineering plan for reviewing nuclear plant modernization programs
International Nuclear Information System (INIS)
O'Hara, John; Higgins, James
2004-12-01
The Swedish Nuclear Power Inspectorate reviews the human factors engineering (HFE) aspects of nuclear power plants (NPPs) involved in the modernization of the plant systems and control rooms. The purpose of a HFE review is to help ensure personnel and public safety by verifying that accepted HFE practices and guidelines are incorporated into the program and nuclear power plant design. Such a review helps to ensure the HFE aspects of an NPP are developed, designed, and evaluated on the basis of a structured top-down system analysis using accepted HFE principles. The review addresses eleven HFE elements: HFE Program Management, Operating Experience Review, Functional Requirements Analysis and Allocation, Task Analysis, Staffing, Human Reliability Analysis, Human-System Interface Design, Procedure Development, Training Program Development, Human Factors Verification and Validation, and Design Implementation
Human factors engineering plan for reviewing nuclear plant modernization programs
Energy Technology Data Exchange (ETDEWEB)
O' Hara, John; Higgins, James [Brookhaven National Laboratory, Upton, NY (United States)
2004-12-01
The Swedish Nuclear Power Inspectorate reviews the human factors engineering (HFE) aspects of nuclear power plants (NPPs) involved in the modernization of the plant systems and control rooms. The purpose of a HFE review is to help ensure personnel and public safety by verifying that accepted HFE practices and guidelines are incorporated into the program and nuclear power plant design. Such a review helps to ensure the HFE aspects of an NPP are developed, designed, and evaluated on the basis of a structured top-down system analysis using accepted HFE principles. The review addresses eleven HFE elements: HFE Program Management, Operating Experience Review, Functional Requirements Analysis and Allocation, Task Analysis, Staffing, Human Reliability Analysis, Human-System Interface Design, Procedure Development, Training Program Development, Human Factors Verification and Validation, and Design Implementation.
Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.
Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong
2017-02-03
Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.
International Nuclear Information System (INIS)
Joksimovich, V.; Orvis, D.D.
1997-01-01
There are four nuclear safety imperatives or ''4Ms'': machine (hardware, design, QA/QC), milieux (operating conditions, environment, natural phenomena), man (human reliability) and management (organizational and management influences). Nuclear safety evaluations as well as evolution of its most powerful tool, Probabilistic Safety Assessment (PSA), followed chronologically the 4M constituents. The nuclear industry worldwide, and the nuclear safety regulators in particular, have been preoccupied with the first M almost to the point of obsession with belated and only intuitive interest in the third and fourth M (human dimension). Human factors or economics in the nuclear industry was an afterthought. Human reliability was essentially born in the aftermath of the Three Mile Island (TMI) accident. Impact of organizational factors on nuclear safety is only in the early stages of R and D. This paper describes some of the concepts being pursued by APG to link organizational factors and safety culture to Human Reliability Analysis (HRA) and to integrate such into probabilistic safety assessment (PSA), e.g. [APG, 1993]. (author). 11 refs, 4 figs, 1 tab
Directory of Open Access Journals (Sweden)
Biaoru Li
Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34
A regulatory perspective on human factors in nuclear power
International Nuclear Information System (INIS)
Whitfield, D.
1987-01-01
This paper sets out the approaches being taken by the United Kingdom Nuclear Installations Inspectorate (NII) to monitoring the application of human factors principles and practice in the UK industry. The role of NII is outlined, the development of human factors concerns is reviewed, the assessment of the Sizewell 'B' safety case is presented as a particular example, and pertinent future developments in the human factors discipline are proposed. (author)
Transcription factors: normal and malignant development of blood cells
National Research Council Canada - National Science Library
Ravid, Katya; Licht, Jonathan
2001-01-01
... and the Development of the Erythroid Lineage James J. Bieker 71 II TRANSCRIPTION FACTORS AND THE MYELOID LINEAGE 85 6 RUNX1(AML1) and CBFB: Genes Required for the Development of All Definitive Hematopoietic Lineages 87 Nancy A. Speck and Elaine Dzierzak 7 PU.1 and the Development of the Myeloid Lineage Daniel G. Tenen 103 vvi CONTENTS 8 CCAAT/Enhancer-...
Factors which could limit the nuclear fuel cycle development
International Nuclear Information System (INIS)
Pecqueur, M.; Barre, B.
1977-01-01
The nuclear fuel cycle is a most important industry for the energy future of the world. It has also a leading part as regards the physical continuity of energy supply of the countries engaged in the nuclear field. The development of this industry is subject to the economic or political constraints involved by the availability of raw materials, technologies or production means. The various limiting factors which could affect the different stages of the fuel cycle are linked with the technical, economic and financial aspects, with the impact on the environment, nuclear safety, risks of non-pacific uses and proliferation of arms. Interesting to note is also the correlation between the fuel cycle development and the problems of energy independence and security of nuclear programs. As a conclusion, the nuclear fuel cycle industry is confronted to difficulties due to its extremely rapid growth (doubling time 5 years) which only few heavy industries have encountered for long periods. It is more over submitted to the political and safety constraints always linked with nuclear matters. The task is therefore a difficult one. But the objective is worth-while since it is a condition to the development of nuclear industry [fr
on skin keratinocytes by nuclear factor-kappa B
African Journals Online (AJOL)
DR. NJ TONUKARI
2012-06-21
Jun 21, 2012 ... Effects of advanced glycation end-products (AGEs) on ... AGE levels, nuclear factor-kappa B (NF-κB) localization and cell viability were measured in vivo. ..... and related alteration in NF-κB activity, we treated normal cells by ...
Deletion of hepatocyte nuclear factor-1-beta in an infant with prune belly syndrome.
Haeri, Sina; Devers, Patricia L; Kaiser-Rogers, Kathleen A; Moylan, Vincent J; Torchia, Beth S; Horton, Amanda L; Wolfe, Honor M; Aylsworth, Arthur S
2010-08-01
Prune belly syndrome is a rare congenital disorder characterized by deficiency of abdominal wall muscles, cryptorchidism, and urinary tract anomalies. We have had the opportunity to study a baby with prune belly syndrome associated with an apparently de novo 1.3-megabase interstitial 17q12 microdeletion that includes the hepatocyte nuclear factor-1-beta gene at 17q12. One previous patient, an adult, has been reported with prune belly syndrome and a hepatocyte nuclear factor-1-beta microdeletion. Hepatocyte nuclear factor-1-beta is a widely expressed transcription factor that regulates tissue-specific gene expression and is expressed in numerous tissues including mesonephric duct derivatives, the renal tubule of the metanephros, and the developing prostate of the mouse. Mutations in hepatocyte nuclear factor-1-beta cause the "renal cysts and diabetes syndrome," isolated renal cystic dysplasia, and a variety of other malformations. Based on its expression pattern and the observation of two affected cases, we propose that haploinsufficiency of hepatocyte nuclear factor-1-beta may be causally related to the production of the prune belly syndrome phenotype through a mechanism of prostatic and ureteral hypoplasia that results in severe obstructive uropathy with urinary tract and abdominal distension. Copyright Thieme Medical Publishers.
Economic benefits of power factor correction at a nuclear facility
International Nuclear Information System (INIS)
Boger, R.M.; Dalos, W.; Juguilon, M.E.
1986-01-01
The economic benefits of correcting poor power factor at an operating nuclear facility are shown. A project approach for achieving rapid return of investment without disrupting plant availability is described. Examples of technical problems associated with using capacitors for power factor correction are presented
International Nuclear Information System (INIS)
Jeong, Kwan Seong; Lee, Dong Gyu; Jung, Chong Hun; Lee, Kune Woo
2006-01-01
The estimated decommissioning cost of nuclear research reactor is calculated by applying a unit cost factor-based engineering cost calculation method on which classification of decommissioning works fitted with the features and specifications of decommissioning objects and establishment of composition factors are based. Decommissioning cost of nuclear research reactor is composed of labor cost, equipment and materials cost. Labor cost of decommissioning costs in decommissioning works are calculated on the basis of working time consumed in decommissioning objects. In this paper, the unit cost factors and work difficulty factors which are needed to calculate the labor cost in estimating decommissioning cost of nuclear research reactor are derived and figured out.
Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki
2011-06-01
Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.
Human factors in the Canadian nuclear industry: future needs
International Nuclear Information System (INIS)
Harrison, F.
2008-01-01
Currently the industry is facing refurbishment and new builds. At present most licensees in Canada do not have sufficient numbers of Human Factors staff. As a result, the activities of the CNSC are too often focused on providing guidance regarding the application of Human Factors, in addition to reviewing work submitted by the licensee. Greater efficiencies for both the licensee and the CNSC could be realized if licensee staff had greater Human Factors expertise. Strategies for developing Human Factors expertise should be explored through cooperative partnerships with universities, which could be encouraged to include Human Factors courses specific to nuclear. (author)
Factors affecting the next generation of nuclear power
International Nuclear Information System (INIS)
Remick, F.J.
1990-01-01
For both financial, environmental and health reasons, and because of external and internal factors affecting this nation's energy supply, nuclear power will likely play a part in supplying this nation's energy in the coming decades. I believe this to be true for some other parts of the world as well. Even some severe critics of the nuclear power industry and the NRC might agree with me on this point. Increasing concern with the environmental consequences of the burning of fossil fuels has led some former opponents of the use of nuclear power to balance anew the risks and benefits of nuclear power and to modify to some degree their former opposition. A related concern with the adequacy of the energy supply is leading others to modify their positions. According to analyses done by the U.S. Department of Energy, after 1994 the United States will no longer be able to assure all its citizens a reliable supply of electricity. Already, many areas of the country are in need of additional electric capacity. In both Sweden and Switzerland, similar concerns have led to the adoption by many of more compromising positions. Some critics of nuclear power may in the end still reject it as an alternative, but, with the increased pressures on the environment and on our energy supply, nuclear power is an alternative which cannot be rejected without the most serious consideration. This should be, I believe, a point of consensus among us. In sum, there is a future for nuclear power in the sense that there is a use for it
Factors affecting the next generation of nuclear power
Energy Technology Data Exchange (ETDEWEB)
Remick, F J [Nuclear Regulatory Commission, Washington, DC (United States)
1990-07-01
For both financial, environmental and health reasons, and because of external and internal factors affecting this nation's energy supply, nuclear power will likely play a part in supplying this nation's energy in the coming decades. I believe this to be true for some other parts of the world as well. Even some severe critics of the nuclear power industry and the NRC might agree with me on this point. Increasing concern with the environmental consequences of the burning of fossil fuels has led some former opponents of the use of nuclear power to balance anew the risks and benefits of nuclear power and to modify to some degree their former opposition. A related concern with the adequacy of the energy supply is leading others to modify their positions. According to analyses done by the U.S. Department of Energy, after 1994 the United States will no longer be able to assure all its citizens a reliable supply of electricity. Already, many areas of the country are in need of additional electric capacity. In both Sweden and Switzerland, similar concerns have led to the adoption by many of more compromising positions. Some critics of nuclear power may in the end still reject it as an alternative, but, with the increased pressures on the environment and on our energy supply, nuclear power is an alternative which cannot be rejected without the most serious consideration. This should be, I believe, a point of consensus among us. In sum, there is a future for nuclear power in the sense that there is a use for it.
Overall analysis of the cost key factors for the nuclear energy
International Nuclear Information System (INIS)
Caero, M.
1996-01-01
In 1995, 25,8 % of the world electricity consumption was of nuclear origin, while in the EU this figure is increased up to 50,6 %. In order to maintain and even to increase its share in the electricity generation, Nuclear Energy needs to achieve a good economic performance as a base load source when compared with its competitors, basically coal and gas fired plants. Fossil-fired generation costs have declined over the past ten years, mainly due to lower fossil fuel prices. This factor together with the recently observed tendency of higher discount rates to be applied are challenging the attractiveness of the nuclear energy. Nuclear energy is a capital intensive option. Taken into account extensive standardization programs has been established aiming at cost reductions as well as to increase efficiency of nuclear energy utilization, among their main purposes. Externalities play an important role, as they are already internalized in nuclear generation costs. This is not true for many existing coal-fired plants. Even a great uncertainly exists on greenhouse gas effects. Also decisions on greenhouse gas control and their impact on carbonaceous fuel generation costs cannot be clearly predicted, even in the immediate future. Macroeconomic factors like employment, competitiveness, energy conservation, energy availability, energy demand control, etc are positively influenced by the use of nuclear energy. A sustainable economic development cannot be achieved only relying on fossil fuel generation. As a wrap up sustainable development demands nuclear energy in order to cover the future objectives of energy availability, environmental control and energy cost control. (author)
Nuclear-polarization correction to the bound-electron g factor in heavy hydrogenlike ions
Nefiodov, A. V.; Plunien, G.; Soff, G.
2002-01-01
The influence of nuclear polarization on the bound-electron $g$ factor in heavy hydrogenlike ions is investigated. Numerical calculations are performed for the K- and L-shell electrons taking into account the dominant virtual nuclear excitations. This determines the ultimate limit for tests of QED utilizing measurements of the bound-electron $g$ factor in highly charged ions.
Nuclear-polarization correction to the bound-electron g factor in heavy hydrogenlike ions.
Nefiodov, A V; Plunien, G; Soff, G
2002-08-19
The influence of nuclear polarization on the bound-electron g factor in heavy hydrogenlike ions is investigated. Numerical calculations are performed for the K- and L-shell electrons taking into account the dominant virtual nuclear excitations. This determines the ultimate limit for tests of QED utilizing measurements of the bound-electron g factor in highly charged ions.
Main factors affecting the fixing work about nuclear engineering and its discussion
International Nuclear Information System (INIS)
Zhang Zhihua; Liu Yaoguan; Qian Dazhi; Liu Hangang; Xu Xianqi; Deng Yue
2010-01-01
Main factors to the impact of the fixing work about nuclear engineering such as project design, construction, plan program, document, preparation, order, locale management, surveillance, quality assurance system and so on were presented. These factors were analyzed and discussed in this paper. Some measures and suggestions were put forward to accelerate construction fixing plan and insure good quality. We wish provide some references and help for someone engaged with construction of nuclear engineering. (authors)
Pak, Jhang Ho; Son, Woo Chan; Seo, Sang-Beom; Hong, Sung-Jong; Sohn, Woon-Mok; Na, Byoung-Kuk; Kim, Tong-Soo
2016-10-01
Clonorchis sinensis is a carcinogenic human liver fluke. Its infection promotes persistent oxidative stress and chronic inflammation environments in the bile duct and surrounding liver tissues owing to direct contact with worms and their excretory-secretory products (ESPs), provoking epithelial hyperplasia, periductal fibrosis, and cholangiocarcinogenesis. We examined the reciprocal regulation of two ESP-induced redox-active proteins, NF-κB and peroxiredoxin 6 (Prdx6), during C. sinensis infection. Prdx6 overexpression suppressed intracellular free-radical generation by inhibiting NADPH oxidase2 and inducible nitric oxide synthase activation in the ESP-treated cholangiocarcinoma cells, substantially attenuating NF-κB-mediated inflammation. NF-κB overexpression decreased Prdx6 transcription levels by binding to two κB sites within the promoter. This transcriptional repression was compensated for by other ESP-induced redox-active transcription factors, including erythroid 2-related factor 2 (Nrf2), hypoxia inducible factor 1α (HIF1α), and CCAAT/enhancer-binding protein β (C/EBPβ). Distribution of immunoreactive Prdx6 and NF-κB was distinct in the early stages of infection in mouse livers but shared concomitant localization in the later stages. The intensity and extent of their immunoreactive staining in infected mouse livers are proportional to lesion severity and infection duration. The constitutive elevations of Prdx6 and NF-κB during C. sinensis infection may be associated with more severe persistent hepatobiliary abnormalities mediated by clonorchiasis. Copyright © 2016 Elsevier Inc. All rights reserved.
Overview of factors affecting the leachability of nuclear waste forms
International Nuclear Information System (INIS)
Stone, J.A.
1980-01-01
An overview of various factors that affect the leachability of nuclear waste forms is presented. The factors affect primarily the leaching system (temperature, for example), the leachant (pH, for example), or the solid being leached (surface condition, for example). A qualitative understanding exists of the major factors affecting leaching, but further studies are needed to establish leaching mechanisms and develop predictive models. 67 refs
International Nuclear Information System (INIS)
Tobón-Velasco, Julio C.; Limón-Pacheco, Jorge H.; Orozco-Ibarra, Marisol; Macías-Silva, Marina; Vázquez-Victorio, Genaro; Cuevas, Elvis; Ali, Syed F.
2013-01-01
6-Hydroxydopamine (6-OHDA) is a neurotoxin that generates an experimental model of Parkinson's disease in rodents and is commonly employed to induce a lesion in dopaminergic pathways. The characterization of those molecular mechanisms linked to 6-OHDA-induced early toxicity is needed to better understand the cellular events further leading to neurodegeneration. The present work explored how 6-OHDA triggers early downstream signaling pathways that activate neurotoxicity in the rat striatum. Mitochondrial function, caspases-dependent apoptosis, kinases signaling (Akt, ERK 1/2, SAP/JNK and p38) and crosstalk between nuclear factor kappa B (NF-κB) and nuclear factor-erythroid-2-related factor 2 (Nrf2) were evaluated at early times post-lesion. We found that 6-OHDA initiates cell damage via mitochondrial complex I inhibition, cytochrome c and apoptosis-inducing factor (AIF) release, as well as activation of caspases 9 and 3 to induce apoptosis, kinase signaling modulation and NF-κB-mediated inflammatory responses, accompanied by inhibition of antioxidant systems regulated by the Nrf2 pathway. Our results suggest that kinases SAP/JNK and p38 up-regulation may play a role in the early stages of 6-OHDA toxicity to trigger intrinsic pathways for apoptosis and enhanced NF-κB activation. In turn, these cellular events inhibit the activation of cytoprotective mechanisms, thereby leading to a condition of general damage
The human factor in the organisation and regulation of nuclear safety
International Nuclear Information System (INIS)
Bordes, F.; Savagner, J.-M.; Snanoudj, G.
1981-10-01
The TMI accident has brought to light the importance of the human factor in the safe operation of complex installations such as nuclear power plants. On this basis, the paper outlines the institutional framework for nuclear safety in France and reports on EDF practices in human resources management as well as in the improvement of working premises (control rooms) to optimize human behaviour in accident conditions. Finally, the interaction of labour laws on nuclear law in connection with safety is described. (NEA) [fr
A Study on the Allowable Safety Factor of Cut-Slopes for Nuclear Facilities
Energy Technology Data Exchange (ETDEWEB)
Kim, Myung Soo; Yee, Eric [KEPCO International Nuclear Graduate School, Ulsan (Korea, Republic of)
2015-10-15
In this study, the issues of allowable safety factor design criteria for cut-slopes in nuclear facilities is derived through case analysis, a proposed construction work slope design criteria that provides relatively detailed conditions can be applied in case of the dry season and some unclear parts of slope design criteria be modified in case of the rainy season. This safety factor can be further subdivided into two; normal and earthquake factors, a factor of 1.5 is applied for normal conditions and a factor of 1.2 is applied for seismic conditions. This safety factor takes into consideration the effect of ground water and rainfall conditions. However, no criteria for the case of cut-slope in nuclear facilities and its response to seismic conditions is clearly defined, this can cause uncertainty in design. Therefore, this paper investigates the allowable safety factor for cut-slopes in nuclear facilities, reviews conditions of both local and international cut-slope models and finally suggests an alternative method of analysis. It is expected that the new design criteria adequately ensures the stability of the cut-slope to reflect clear conditions for both the supervising and design engineers.
International Nuclear Information System (INIS)
Sato, Renato Cesar; Zouain, Desiree Moraes
2012-01-01
To identify and evaluate latent variables (variables that are not directly observed) for adopting and using nuclear technologies in diagnosis and treatment of chronic diseases. The measurement and management of these latent factors are important for health care due to complexities of the sector. Methods: An exploratory factor analysis study was conducted among 52 physicians practicing in the areas of Cardiology, Neurology and Oncology in the State of Sao Paulo who agreed to participate in the study between 2009 and 2010. Data were collected using an attitude measurement questionnaire, and analyzed according to the principal component method with Varimax rotation. Results: The component matrix after factor rotation showed three elucidative groups arranged according to demand for nuclear technology: clinical factors, structural factors, and technological factors. Clinical factors included questionnaire answers referring to medical history, previous interventions, complexity and chronicity of the disease. Structural factors included patient age, physician's practice area, and payment ability. Technological factors included prospective growth in the use of nuclear technology and availability of services. Conclusions: The clinical factors group dimension identified in the study included patient history, prior interventions, and complexity and chronicity of the disease. This dimension is the main motivating for adopting nuclear technology in diagnosis and treatment of chronic diseases. (author)
Human factor engineering applied to nuclear power plant design
International Nuclear Information System (INIS)
Manrique, A.; Valdivia, J.C.
2007-01-01
Advantages of implementing adequate Human Factor Engineering techniques in the design of nuclear reactors have become not only a fact recognized by the majority of engineers and operators but also an explicit requirement regulated and mandatory for the new designs of the so called advanced reactors. The first step for this is preparing a plan to incorporate all the Human Factor Engineering principles and developing an integral design of the Instrumentation and Control and Man-machine interface systems. Such a plan should state: -) Activities to be performed, and -) Creation of a Human Factor Engineering team adequately qualified. The Human Factor Engineering team is an integral part of the design team and is strongly linked to the engineering organizations but simultaneously has independence to act and is free to evaluate designs and propose changes in order to enhance human behavior. TECNATOM S.A. (a Spanish company) has been a part of the Design and Human Factor Engineering Team and has collaborated in the design of an advanced Nuclear Power Plant, developing methodologies and further implementing those methodologies in the design of the plant systems through the development of the plant systems operational analysis and of the man-machine interface design. The methodologies developed are made up of the following plans: -) Human Factor Engineering implementation in the Man-Machine Interface design; -) Plant System Functional Requirement Analysis; -) Allocation of Functions to man/machine; -) Task Analysis; -) Human-System Interface design; -) Control Room Verification and -) Validation
Human factor in the problem of Russian nuclear industry safety
International Nuclear Information System (INIS)
Abramova, V.
2002-01-01
The approach to human factor definition, considered in the paper, consists of recognition of as many as possible factors for developing a complete list of factors, which have influence on mistakes or successful work of NPP personnel. Safety culture is considered as the main factor. The enhancement in nuclear power industry includes an optimization of organizational structures and development of personnel safety attitudes. The organizational factors, as possible root causes for human errors, need to be identified, assessed and improved. The organizational activities taken in Russia are presented
Organisational factors. Their definition and influence on nuclear safety. Final report
International Nuclear Information System (INIS)
Baumont, G.; Wahlstroem, B.; Sola, R.; Williams, J.; Frischknecht, A.; Wilpert, B.; Rollenhagen, C.
2000-12-01
The importance of organisational factors in the operational safety and efficiency of nuclear power plants (NPP) has been recognised by many organisations around the world. Despite this recognition, however, there are as yet very few methods by which organisational factors can be systematically assessed and improved. The majority of research efforts applied so far have tended to be modest and scattered. The ORFA project was created as a remedy to these problems. The objective of the project is to create a better understanding of how organisation and management factors influence nuclear safety. A key scientific objective of the project is to identify components of a theoretical framework, which would help in understanding the relationships between organisational factors and nuclear safety. Three work packages were planned. First, a review of literature listed out the identified factors and methods for assessing them. Then, a draft version of the present report was prepared to clarify the environment context and the main issues of the topics. This draft was discussed at the ORFA seminar in Madrid 21-22 October 1999. During the seminar views and comments were collected on preliminary results of the project. Finally, this information has been integrated in the present and other reports and will be used to give further guidance to the European Commission in the development of forthcoming research programmes in the field. The project has addressed nuclear safety taking a broad perspective, which reflected and took into account the views of senior NPP management and regulators. The questions discussed during the project have been: how can organisational factors be included in safety assessments, how can good and bad operational practices be identified, which methods can be used for detecting weak signals of deteriorating performance, how should incidents be analysed with respect to organisational factors to give the largest learning benefit, how can data on organisational
International Nuclear Information System (INIS)
Yang Hualong; Liu Yanzi; Jia Ming; Huang Weijun
2014-01-01
In order to prevent or reduce human error and ensure the safe operation of nuclear power plants, control device should be verified from the perspective of human factors engineering (HFE). The domestic and international human factors engineering guidelines about nuclear power plant controller were considered, the verification criterion and method of human factors engineering for nuclear power plant controller were discussed and the application examples were provided for reference in this paper. The results show that the appropriate verification criterion and method should be selected to ensure the objectivity and accuracy of the conclusion. (authors)
Di Fabio, Francesco; Shrier, Ian; Bégin, Louis R; Gordon, Philip H
2008-12-01
Several retrospective studies, including our previous investigation, have shown a prognostic value of nuclear shape factor in colorectal carcinomas. This prospective study was designed to assess the reliability of nuclear shape factor determined by nuclear morphometry and to confirm its prognostic value. Ninety-eight patients who underwent colorectal carcinoma resection were prospectively enrolled. Measurement of nuclear shape factor was performed by using a computer-based image analysis system. Nuclear shape factor was defined as the degree of circularity of the nucleus (1.0 for a perfect circle and values by American Joint Committee on Cancer stage were: 0.73 (0.07) in Stage I, 0.74 (0.06) in Stage II, and 0.75 (0.05) in Stage III carcinomas (P = 0.78, ANOVA). The intraobserver agreement was poor for observer A (r = 0.28) and practically nonexistent for observer B (r = -0.004, Pearson correlation). The intraclass coefficient for interobserver agreement was practically nonexistent. No significant association between nuclear shape factor and ten-year survival was found. Our prospective results, as opposed to our previous retrospective results, suggest that the reliability for nuclear shape factor morphometric analysis is very poor. We failed to confirm a prognostic value for nuclear shape factor in colorectal carcinoma.
Evidence for site-specific occupancy of the mitochondrial genome by nuclear transcription factors.
Directory of Open Access Journals (Sweden)
Georgi K Marinov
Full Text Available Mitochondria contain their own circular genome, with mitochondria-specific transcription and replication systems and corresponding regulatory proteins. All of these proteins are encoded in the nuclear genome and are post-translationally imported into mitochondria. In addition, several nuclear transcription factors have been reported to act in mitochondria, but there has been no comprehensive mapping of their occupancy patterns and it is not clear how many other factors may also be found in mitochondria. Here we address these questions by using ChIP-seq data from the ENCODE, mouseENCODE and modENCODE consortia for 151 human, 31 mouse and 35 C. elegans factors. We identified 8 human and 3 mouse transcription factors with strong localized enrichment over the mitochondrial genome that was usually associated with the corresponding recognition sequence motif. Notably, these sites of occupancy are often the sites with highest ChIP-seq signal intensity within both the nuclear and mitochondrial genomes and are thus best explained as true binding events to mitochondrial DNA, which exist in high copy number in each cell. We corroborated these findings by immunocytochemical staining evidence for mitochondrial localization. However, we were unable to find clear evidence for mitochondrial binding in ENCODE and other publicly available ChIP-seq data for most factors previously reported to localize there. As the first global analysis of nuclear transcription factors binding in mitochondria, this work opens the door to future studies that probe the functional significance of the phenomenon.
International Nuclear Information System (INIS)
Mehmood, Rashid; Yasuhara, Noriko; Oe, Souichi; Nagai, Masahiro; Yoneda, Yoshihiro
2009-01-01
The transition from undifferentiated pluripotent cells to terminally differentiated neurons is coordinated by a repertoire of transcription factors. NeuroD1 is a type II basic helix loop helix (bHLH) transcription factor that plays critical roles in neuronal differentiation and maintenance in the central nervous system. Its dimerization with E47, a type I bHLH transcription factor, leads to the transcriptional regulation of target genes. Mounting evidence suggests that regulating the localization of transcription factors contributes to the regulation of their activity during development as defects in their localization underlie a variety of developmental disorders. In this study, we attempted to understand the nuclear import mannerisms of NeuroD1 and E47. We found that the nuclear import of NeuroD1 and E47 is energy-dependent and involves the Ran-mediated pathway. Herein, we demonstrate that NeuroD1 and E47 can dimerize inside the cytoplasm before their nuclear import. Moreover, this dimerization promotes nuclear import as the nuclear accumulation of NeuroD1 was enhanced in the presence of E47 in an in vitro nuclear import assay, and NLS-deficient NeuroD1 was successfully imported into the nucleus upon E47 overexpression. NeuroD1 also had a similar effect on the nuclear accumulation of NLS-deficient E47. These findings suggest a novel role for dimerization that may promote, at least partially, the nuclear import of transcription factors allowing them to function efficiently in the nucleus.
Regression analysis of nuclear plant capacity factors
International Nuclear Information System (INIS)
Stocks, K.J.; Faulkner, J.I.
1980-07-01
Operating data on all commercial nuclear power plants of the PWR, HWR, BWR and GCR types in the Western World are analysed statistically to determine whether the explanatory variables size, year of operation, vintage and reactor supplier are significant in accounting for the variation in capacity factor. The results are compared with a number of previous studies which analysed only United States reactors. The possibility of specification errors affecting the results is also examined. Although, in general, the variables considered are statistically significant, they explain only a small portion of the variation in the capacity factor. The equations thus obtained should certainly not be used to predict the lifetime performance of future large reactors
International Nuclear Information System (INIS)
Kimura, Hiroshi; Suzuki, Atsuyuki; Furuta, Kazuo
2003-01-01
The purpose of this research is to clarify how psychological factors' impact on public acceptance of nuclear energy varies with where they live and their degree of knowledge. For this purpose, we carried out questionnaire survey about nuclear energy at three urban areas and two nuclear power plant siting areas. After collecting data, we applied factor analysis to the data, and found four factors which construct cognitive structure of nuclear energy. Using multiple regression analysis, we evaluated the impact of the four factors on two issues: the decision for or against nuclear policy and the reaction to nuclear power plant siting, and compared changes of the impact by where respondents live and their degree of knowledge. Consequently, we found that the impact of all four factors on the two issues varies with where respondents live. We also found that the impact of respondents' degree of knowledge to four factors varies with where they live. (author)
International Nuclear Information System (INIS)
Seminara, J.L.; Seidenstein, S.; Eckert, S.K.; Smith, D.L.
1979-11-01
Human factors engineering is an interdisciplinary specialty concerned with influencing the design of equipment systems, facilities, and operational environments to promote safe, efficient, and reliable operator performance. Human factors approaches were applied in the design of representative nuclear power plant control panels. First, methods for upgrading existing operational control panels were examined. Then, based on detailed human factors analyses of operator information and control requirements, designs of reactor, feedwater, and turbine-generator control panels were developed to improve the operator-control board interface, thereby reducing the potential for operator errors. In addition to examining present-generation concepts, human factors aspects of advanced systems and of hybrid combinations of advanced and conventional designs were investigated. Special attention was given to warning system designs. Also, a survey was conducted among control board designers to (1) develop an overview of design practices in the industry, and (2) establish appropriate measures leading to a more systematic concern for human factors in control board design
Organizational factors and nuclear power plant safety
International Nuclear Information System (INIS)
Haber, S.B.
1995-01-01
There are many organizations in our society that depend on human performance to avoid incidents involving significant adverse consequences. As our culture and technology have become more sophisticated, the management of risk on a broad basis has become more and more critical. The safe operation of military facilities, chemical plants, airlines, and mass transit, to name a few, are substantially dependent on the performance of the organizations that operate those facilities. The nuclear power industry has, within the past 15 years, increased the attention given to the influence of human performance in the safe operation of nuclear power plants (NPP). While NPPs have been designed through engineering disciplines to intercept and mitigate events that could cause adverse consequences, it has been clear from various safety-related incidents that human performance also plays a dominant role in preventing accidents. Initial efforts following the 1979 Three Mile Island incident focused primarily on ergonomic factors (e.g., the best design of control rooms for maximum performance). Greater attention was subsequently directed towards cognitive processes involved in the use of NPP decision support systems and decision making in general, personnel functions such as selection systems, and the influence of work scheduling and planning on employees' performance. Although each of these approaches has contributed to increasing the safety of NPPS, during the last few years, there has been a growing awareness that particular attention must be paid to how organizational processes affect NPP personnel performance, and thus, plant safety. The direct importance of organizational factors on safety performance in the NPP has been well-documented in the reports on the Three Mile Island and Chernobyl accidents as well as numerous other events, especially as evaluated by the U.S. Nuclear Regulatory Commission (NRC)
Study of greenhouse gases emission factor for nuclear power chain of China
International Nuclear Information System (INIS)
Ma Zhonghai; Pan Ziqiang; Xie Jianlun; Xiu Binglin
2001-01-01
The Greenhouse Gases Emission Factor (GGEF) for nuclear power chain of China is calculated based on Life Cycle Analysis method and the definition of full energy chain. There is no greenhouse gases released directly from nuclear power plant. The greenhouse gases emission from nuclear power plant is mainly from coal-fired electricity supply to nuclear power plant for its normal operation and the production of construction materials those are used in the nuclear power plant. The total GGEF of nuclear power chain in China is 13.71 g-co 2 /kWh. It is necessary to regulate un-rational power source mix and to use the energy sources in rational way for reducing the greenhouse gas effect. Nuclear power for electricity generation is one of effective ways to reduce greenhouse gases emission and retard the greenhouse effect
Directory of Open Access Journals (Sweden)
Kirtan Nautiyal
2015-01-01
Full Text Available Refractoriness to growth factor therapy is commonly associated with inferior outcome in patients with low-risk myelodysplastic syndrome (LR-MDS who require treatment for cytopenias. However, the mechanisms leading to refractoriness are unknown. Here we describe a clinically depressed 74-year-old male with refractory cytopenia with multilineage dysplasia (RCMD and documented growth factor refractory anemia after erythropoeisis stimulating agent (ESA therapy, who attained transfusion and growth factor independence after the addition of sertraline to his medication regimen. Our case demonstrates hematological improvement-erythroid (HI-E in growth factor refractory, low risk MDS and highlights a potential mechanistic link between common inflammatory diseases and LR-MDS.
Negative transcriptional regulation of mitochondrial transcription factor A (TFAM) by nuclear TFAM
International Nuclear Information System (INIS)
Lee, Eun Jin; Kang, Young Cheol; Park, Wook-Ha; Jeong, Jae Hoon; Pak, Youngmi Kim
2014-01-01
Highlights: • TFAM localizes in nuclei and mitochondria of neuronal cells. • Nuclear TFAM does not bind the Tfam promoter. • Nuclear TFAM reduced the Tfam promoter activity via suppressing NRF-1 activity. • A novel self-negative feedback regulation of Tfam gene expression is explored. • FAM may play different roles depending on its subcellular localizations. - Abstract: The nuclear DNA-encoded mitochondrial transcription factor A (TFAM) is synthesized in cytoplasm and transported into mitochondria. TFAM enhances both transcription and replication of mitochondrial DNA. It is unclear, however, whether TFAM plays a role in regulating nuclear gene expression. Here, we demonstrated that TFAM was localized to the nucleus and mitochondria by immunostaining, subcellular fractionation, and TFAM-green fluorescent protein hybrid protein studies. In HT22 hippocampal neuronal cells, human TFAM (hTFAM) overexpression suppressed human Tfam promoter-mediated luciferase activity in a dose-dependent manner. The mitochondria targeting sequence-deficient hTFAM also repressed Tfam promoter activity to the same degree as hTFAM. It indicated that nuclear hTFAM suppressed Tfam expression without modulating mitochondrial activity. The repression required for nuclear respiratory factor-1 (NRF-1), but hTFAM did not bind to the NRF-1 binding site of its promoter. TFAM was co-immunoprecipitated with NRF-1. Taken together, we suggest that nuclear TFAM down-regulate its own gene expression as a NRF-1 repressor, showing that TFAM may play different roles depending on its subcellular localizations
Kaur, Gurpreet; Delluc-Clavieres, Aurelie; Poon, Ivan K H; Forwood, Jade K; Glover, Dominic J; Jans, David A
2010-08-15
The HMG (high-mobility group)-box-containing chromatin-remodelling factor SRY (sex-determining region on the Y chromosome) plays a key role in sex determination. Its role in the nucleus is critically dependent on two NLSs (nuclear localization signals) that flank its HMG domain: the C-terminally located 'beta-NLS' that mediates nuclear transport through Impbeta1 (importin beta1) and the N-terminally located 'CaM-NLS' which is known to recognize the calcium-binding protein CaM (calmodulin). In the present study, we examined a number of missense mutations in the SRY CaM-NLS from human XY sex-reversed females for the first time, showing that they result in significantly reduced nuclear localization of GFP (green fluorescent protein)-SRY fusion proteins in transfected cells compared with wild-type. The CaM antagonist CDZ (calmidazolium chloride) was found to significantly reduce wild-type SRY nuclear accumulation, indicating dependence of SRY nuclear import on CaM. Intriguingly, the CaM-NLS mutants were all resistant to CDZ's effects, implying a loss of interaction with CaM, which was confirmed by direct binding experiments. CaM-binding/resultant nuclear accumulation was the only property of SRY found to be impaired by two of the CaM-NLS mutations, implying that inhibition of CaM-dependent nuclear import is the basis of sex reversal in these cases. Importantly, the CaM-NLS is conserved in other HMG-box-domain-containing proteins such as SOX-2, -9, -10 and HMGN1, all of which were found for the first time to rely on CaM for optimal nuclear localization. CaM-dependent nuclear translocation is thus a common mechanism for this family of important transcription factors.
Generation of a Nrf2 homozygous knockout human embryonic stem cell line using CRISPR/Cas9
Directory of Open Access Journals (Sweden)
So-Jung Kim
2017-03-01
Full Text Available Nuclear factor erythroid 2-related factor 2 (NFE2L2 or Nrf2 is a well-known transcription factor that regulates the expression of a large number of anti-oxidant genes in mammalian cells (J.H. Kim et al., 2014. Here, we generated a homozygous Nrf2 knockout human embryonic stem cell (hESC line, H9Nrf2KO-A13, using the CRISPR/Cas9 genome editing method. The Nrf2 homozygous knockout H9 cell line maintains pluripotency, differentiation potential into three germ layers, and a normal karyotype.
Directory of Open Access Journals (Sweden)
Jiafei Xi
2013-01-01
Full Text Available In vitro models of human erythropoiesis are useful in studying the mechanisms of erythroid differentiation in normal and pathological conditions. Here we describe an erythroid liquid culture system starting from cord blood derived hematopoietic stem cells (HSCs. HSCs were cultured for more than 50 days in erythroid differentiation conditions and resulted in a more than 109-fold expansion within 50 days under optimal conditions. Homogeneous erythroid cells were characterized by cell morphology, flow cytometry, and hematopoietic colony assays. Furthermore, terminal erythroid maturation was improved by cosculturing with human fetal liver stromal cells. Cocultured erythroid cells underwent multiple maturation events, including decrease in size, increase in glycophorin A expression, and nuclear condensation. This process resulted in extrusion of the pycnotic nuclei in up to 80% of the cells. Importantly, they possessed the capacity to express the adult definitive β-globin chain upon further maturation. We also show that the oxygen equilibrium curves of the cord blood-differentiated red blood cells (RBCs are comparable to normal RBCs. The large number and purity of erythroid cells and RBCs produced from cord blood make this method useful for fundamental research in erythroid development, and they also provide a basis for future production of available RBCs for transfusion.
Nuclear Factor-kappaB in Autoimmunity: Man and Mouse.
Miraghazadeh, Bahar; Cook, Matthew C
2018-01-01
NF-κB (nuclear factor-kappa B) is a transcription complex crucial for host defense mediated by innate and adaptive immunity, where canonical NF-κB signaling, mediated by nuclear translocation of RelA, c-Rel, and p50, is important for immune cell activation, differentiation, and survival. Non-canonical signaling mediated by nuclear translocation of p52 and RelB contributes to lymphocyte maturation and survival and is also crucial for lymphoid organogenesis. We outline NF-κB signaling and regulation, then summarize important molecular contributions of NF-κB to mechanisms of self-tolerance. We relate these mechanisms to autoimmune phenotypes described in what is now a substantial catalog of immune defects conferred by mutations in NF-κB pathways in mouse models. Finally, we describe Mendelian autoimmune syndromes arising from human NF-κB mutations, and speculate on implications for understanding sporadic autoimmune disease.
Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.
Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio
2017-07-15
Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.
What factors facilitate regulatory competence in supervising the safety of nuclear technology?
International Nuclear Information System (INIS)
Mishar, Marina
2012-01-01
The proposed utilization of nuclear energy for electricity generation as the alternative energy source requires Atomic Energy Licensing Board (AELB), the Malaysian nuclear regulatory body taking key role in supervising the safety of the program. This study looked into factors influencing the competency of current AELB human resource as technical competency has been identified as one of the main contributors to the success of a civil nuclear power program. The four quadrant competency model developed by International Atomic Energy Agency was utilized as the required competency. A comprehensive study on 81 personnel from five states in different geographic regions of the country were carried out to investigate the impact of six factors related to competency (educational level, years of working experience, trainings attended, participation in technical committees, numbers of technical papers written and number of technical presentation presented) on four dependent measures in the areas of regulatory competency (legal basis, technical disciplines, regulatory practices and personal and interpersonal effectiveness). Multiple regression (method enter) identified factors that had significant contribution to level of competency while stepwise regression resulted in identifying predictors to enhance competencies. Results were mixed but each of the independent factors is a predictor to different competencies. This study had identified the best predictors that could significantly contribute to the enhancement of regulatory. (author)
Organizational factors and reoccurrence protection on the JCO nuclear critical accident
International Nuclear Information System (INIS)
Takano, Kenichi
2000-01-01
A nuclear critical accident formed at a nuclear fuel conversion factory in Tokai-mura on September, 1999 became gradually clear not to be a simple human error formed at a level of workmen but to be an organizational error or accident relating to various organizational factors. As a nuclear power facility adopts a depth protection system fundamentally, a large accident with serious danger would not form only by a single trouble and a human error and unless some factors overlaps. By reviewing recent serious accidents and troubles, all of them seem to have a keyword of 'organizational factor'. In the JCO accident, there are some organizational factors such as a climate deviating from a manual, insufficient and loose check against change of procedure, reduction of operators from a reason of profit priority, attitude on priority of working efficiency, and so forth, which are partially common to the Chernobyl accident. Recently, accidents and troubles impossible to make them a cause of simple human error by a person but to have to say an organizational error, have increased. This trend seems to depend upon not only complication and scale-up of technology system but also graduate change of social and management systems operating them. Therefore, it seems to be necessary to introduce a concept of depth protection (multiple protection) in order to keep its reliability and safety when complicating and scaling-up of system. (G.K.)
Energy Technology Data Exchange (ETDEWEB)
Yang, Bin [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Li, Wei [Department of Gerontology, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Zheng, Qichang [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Qin, Tao [Department of Hepatobiliary Pancreatic Surgery, People' s Hospital of Zhengzhou University, School of Medicine, Zhengzhou University, Zhengzhou 450003 (China); Wang, Kun; Li, Jinjin; Guo, Bing; Yu, Qihong; Wu, Yuzhe; Gao, Yang; Cheng, Xiang; Hu, Shaobo; Kumar, Stanley Naveen [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Liu, Sanguang, E-mail: sanguang1998@sina.com [Department of Hepatobiliary Surgery, The Second Hospital, Hebei Medical University, Shijiazhuang 050000 (China); Song, Zifang, E-mail: zsong@hust.edu.cn [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China)
2015-07-17
Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negative effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation.
International Nuclear Information System (INIS)
Yang, Bin; Li, Wei; Zheng, Qichang; Qin, Tao; Wang, Kun; Li, Jinjin; Guo, Bing; Yu, Qihong; Wu, Yuzhe; Gao, Yang; Cheng, Xiang; Hu, Shaobo; Kumar, Stanley Naveen; Liu, Sanguang; Song, Zifang
2015-01-01
Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negative effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation
Establishing a value chain for human factors in nuclear power plantcontrol room modernization
Energy Technology Data Exchange (ETDEWEB)
Joe, Jeffrey Clark [Idaho National Laboratory; Thomas, Kenneth David [Idaho National Laboratory; Boring, Ronald Laurids [Idaho National Laboratory
2015-07-01
Commercial nuclear power plants in the United States (U.S.) have operated reliably and efficiently for decades. With the life extensions of plants now being planned for operation beyond their original operating licenses, there are opportunities to achieve even greater efficiencies, while maintaining high operational reliabilities, with strategic, risk- and economically-informed, upgrades to plant systems and infrastructure. The U.S. Department of Energy’s Light Water Reactor Sustainability (LWRS) program supports the commercial nuclear industry’s modernization efforts through research and development (R&D) activities across many areas to help establish the technical and economic bases for modernization activities. The Advanced Instrumentation, Information, and Control Systems Technologies pathway is one R&D focus area for the LWRS program, and has researchers at Idaho National Laboratory working with select utility partners to use human factors and instrumentation and controls R&D to help modernize the plant’s main control room. However, some in the nuclear industry have not been as enthusiastic about using human factors R&D to inform life extension decision making. Part of the reason for this may stem from uncertainty decision-makers have regarding how human factors fits into the value chain for nuclear power plant control room modernization. This paper reviews past work that has attempted to demonstrate the value of human factors, and then describes the value chain concept, how it applies to control room modernization, and then makes a case for how and why human factors is an essential link in the modernization value chain.
International Nuclear Information System (INIS)
Choi, Y.H.; Chung, Y.K.; Park, Y.W.; Lee, J.B.
1997-01-01
The purpose of this study is to develop new Z-factors to evaluate the behavior of a circumferential surface crack in nuclear pipe. Z-factor is a load multiplier used in the Z-factor method, which is one of the ASME Code Sec. XI's recommendations for the estimation of a surface crack in nuclear pipe. It has been reported that the load carrying capacities predicted from the current ASME Code Z-factors, are not well in agreement with the experimental results for nuclear pipes with a surface crack. In this study, new Z-factors for ferritic base metal, ferritic submerged arc welding (SAW) weld metal, austenitic base metal, and austenitic SAW weld metal are obtained by use of the surface crack for thin pipe (SC.TNP) method based on GE/EPRI method. The desirability of both the SC.TNP method and the new Z-factors is examined using the results from 48 pipe fracture experiments for nuclear pipes with a circumferential surface crack. The results show that the SC.TNP method is good for describing the circumferential surface crack behavior and the new Z-factors are well in agreement with the measured Z-factors for both ferritic and austenitic pipes. (orig.)
The human factor in operating nuclear power plants during crisis situations
International Nuclear Information System (INIS)
Schnauder, H.; Smidt, D.
1981-10-01
Human factors in nuclear power plant operation are a main part of safety analyses. A considerable reduction in the influence of human factors has been obtained through ergonomic control room design, automation, clearly formulated operating manuals, and appropriate personnel education and training. These precautions are directed primarily at skill- and rule-based behaviour and are intended for normal operation and design accidents. In addition, one can construct an area of uncommon and very rare events where a partial failure of the safety systems is assumed. This is an area of knowledge-based behaviour. This report describes and assesses the present situation in German nuclear power plants. Recommendations for further research activity are made and, as a main result, for improvements in knowledge-based behaviour. (orig.) [de
b-jet tagged nuclear modification factors in heavy ion collisions with CMS
Jung, Kurt
2014-01-01
The energy loss of jets in heavy-ion collisions is expected to depend on the flavor of the fragmenting parton. Thus, measurements of jet quenching as a function of flavor place powerful constraints on the thermodynamical and transport properties of the hot and dense medium. Measurements of the nuclear modification factors of the heavy-flavor-tagged jets in both PbPb and pPb collisions can quantify such energy loss effects. Specifically, pPb measurements provide crucial insights into the behavior of the cold nuclear matter effect, which is required to fully understand the hot and dense medium effects on jets in PbPb collisions. In this talk, we present the b-jet spectra and the first measurement of the nuclear modification factors as a function of transverse momentum and pseudorapidity, using the high statistics pp, pPb and PbPb data taken in 2011 and 2013.
Engineering factors influencing Corbicula fouling in nuclear-service water systems
International Nuclear Information System (INIS)
Henager, C.H.; Johnson, K.I.; Page, T.L.
1983-06-01
Corbicula fouling is a continuing problem in nuclear-service water systems. More knowledge of biological and engineering factors is needed to develop effective detection and control methods. A data base on Corbicula fouling was compiled from nuclear and non-nuclear power stations and industries using raw water. This data base was used in an analysis to identify systems and components which are conducive to fouling by Corbicula. Bounds on several engineering parameters such as velocity and temperature which support Corbicula growth are given. Service water systems found in BWR and PWR reactors are listed and those that show fouling are identified. Possible safety implications of Corbicula fouling are discussed for specific service water systems. Several effective control methods in current use include backflushing with heated water, centrifugal strainers, and continuous chlorination during spawning seasons
Economic Conditions and Factors Affecting New Nuclear Power Deployment
Energy Technology Data Exchange (ETDEWEB)
Harrison, Thomas J [ORNL
2014-10-01
This report documents work performed in support of the US Department of Energy Office of Nuclear Energy’s Advanced Small Modular Reactor (AdvSMR) program. The report presents information and results from economic analyses to describe current electricity market conditions and those key factors that may impact the deployment of AdvSMRs or any other new nuclear power plants. Thus, this report serves as a reference document for DOE as it moves forward with its plans to develop advanced reactors, including AdvSMRs. For the purpose of this analysis, information on electricity markets and nuclear power plant operating costs will be combined to examine the current state of the nuclear industry and the process required to successfully move forward with new nuclear power in general and AdvSMRs in particular. The current electricity market is generally unfavorable to new nuclear construction, especially in deregulated markets with heavy competition from natural gas and subsidized renewables. The successful and profitable operation of a nuclear power plant (or any power plant) requires the rate at which the electricity is sold to be sufficiently greater than the cost to operate. The wholesale rates in most US markets have settled into values that provide profits for most operating nuclear power plants but are too low to support the added cost of capital recovery for new nuclear construction. There is a strong geographic dependence on the wholesale rate, with some markets currently able to support new nuclear construction. However, there is also a strong geographic dependence on pronuclear public opinion; the areas where power prices are high tend to have unfavorable views on the construction of new nuclear power plants. The use of government-backed incentives, such as subsidies, can help provide a margin to help justify construction projects that otherwise may not seem viable. Similarly, low interest rates for the project will also add a positive margin to the economic
Major factors influencing craft productivity in nuclear power plant construction
International Nuclear Information System (INIS)
Borcherding, J.D.; Sebastian, S.J.
1980-01-01
This paper reports on a research study whose objective was to determine the most influential factors adversely affecting craft productivity in nuclear power plant construction from the perspective of the tradesmen employed at the sites. Data were collected through the use of a questionnaire survey and group interview sessions, predominantly with workmen, at six nuclear power plant construction projects. Craftsmen were chosen as the major data base because of their awareness of how their time would actually be spent on the project. Topics considered include the factors influencing craft productivity, material availability, redoing work, crew interfacing, overcrowded work areas, instruction time, inspection delays, craft turnover, craft absenteeism, foreman changes, foreman incompetence, engineering design lead time, comprehensive scheduling of the design function, the responsibility of the utility, value engineering, plant standardization, the effective utilization of the planning and scheduling system, and the labor-management committee
Safety review for human factors engineering and control rooms of nuclear power plants
International Nuclear Information System (INIS)
Yang Mengzhuo
1998-01-01
Safety review for human factors engineering and control rooms of nuclear power plants (NPP) is in a forward position of science and technology, which began at American TMI severe accident and had been implemented in China. The importance and the significance of the safety review are expounded, the requirements of its scope and profundity are explained in detail. In addition, the situation of the technical document system for nuclear safety regulation on human factors engineering and control rooms of NPP in China is introduced briefly, on which the safety review is based
Human factors design review guidelines for advanced nuclear control room technologies
International Nuclear Information System (INIS)
O'Hara, J.; Brown, W.; Granda, T.; Baker, C.
1991-01-01
Advanced control rooms (ACRs) for future nuclear power plants are being designed utilizing computer-based technologies. The US Nuclear Regulatory Commission reviews the human engineering aspects of such control rooms to ensure that they are designed to good human factors engineering principles and that operator performance and reliability are appropriately supported in order to protect public health and safety. This paper describes the rationale, general approach, and initial development of an NRC Advanced Control Room Design Review Guideline. 20 refs., 1 fig
Factors influencing the decommissioning of large-scale nuclear plants
International Nuclear Information System (INIS)
Large, J.H.
1988-01-01
The decision-making process involving the decommissioning of the UK graphite moderated, gas-cooled nuclear power stations is complex. There are timing, engineering, waste disposal, cost and lost generation capacity factors to consider and the overall decision of when and how to proceed with decommissioning may include political and public tolerance dimensions. For the final stage of decommissioning the nuclear industry could either completely dismantle the reactor island leaving a green-field site or, alternatively, the reactor island could be maintained indefinitely with additional super- and substructure containment. At this time the first of these options, or deferred decommissioning, prevails and with this the nuclear industry has expressed considerable confidence that the technology required will become available with passing time, that acceptable radioactive waste disposal methods and facilities will be available and that the eventual costs of decommissioning will not escalate without restraint. If the deferred decommissioning strategy is wrong and it is not possible to completely dismantle the reactor islands a century into the future, then it may be too late to effect sufficient longer term containment to maintain the reactor hulks in a reliable condition. With respect to the final decommissioning of large-scale nuclear plant, it is concluded that the nuclear industry does not know quite how to do it, when it will be attempted and when it will be completed, and they do not know how much it will eventually cost. (author)
A HUMAN FACTORS META MODEL FOR U.S. NUCLEAR POWER PLANT CONTROL ROOM MODERNIZATION
Energy Technology Data Exchange (ETDEWEB)
Joe, Jeffrey C.
2017-03-01
Over the last several years, the United States (U.S.) Department of Energy (DOE) has sponsored human factors research and development (R&D) and human factors engineering (HFE) activities through its Light Water Reactor Sustainability (LWRS) program to modernize the main control rooms (MCR) of commercial nuclear power plants (NPP). Idaho National Laboratory (INL), in partnership with numerous commercial nuclear utilities, has conducted some of this R&D to enable the life extension of NPPs (i.e., provide the technical basis for the long-term reliability, productivity, safety, and security of U.S. NPPs). From these activities performed to date, a human factors meta model for U.S. NPP control room modernization can now be formulated. This paper discusses this emergent HFE meta model for NPP control room modernization, with the goal of providing an integrated high level roadmap and guidance on how to perform human factors R&D and HFE for those in the U.S. nuclear industry that are engaging in the process of upgrading their MCRs.
Survey and evaluation of mutations in the human KLF1 transcription unit.
Gnanapragasam, Merlin Nithya; Crispino, John D; Ali, Abdullah M; Weinberg, Rona; Hoffman, Ronald; Raza, Azra; Bieker, James J
2018-04-26
Erythroid Krüppel-like Factor (EKLF/KLF1) is an erythroid-enriched transcription factor that plays a global role in all aspects of erythropoiesis, including cell cycle control and differentiation. We queried whether its mutation might play a role in red cell malignancies by genomic sequencing of the KLF1 transcription unit in cell lines, erythroid neoplasms, dysplastic disorders, and leukemia. In addition, we queried published databases from a number of varied sources. In all cases we only found changes in commonly notated SNPs. Our results suggest that if there are mutations in KLF1 associated with erythroid malignancies, they are exceedingly rare.
International Nuclear Information System (INIS)
2002-05-01
The Technical Committee Meeting (TCM) was held in Vienna on 8-10 November 1999; it was organized by the International Atomic Energy Agency and attended by 26 participants from 16 Member States. The purpose of the meeting was to exchange information among experts on the back end fuel cycle strategies adopted by Member States; to identify key factors determining the long-term back end fuel cycle strategies; and to assess the applicability of these factors to future nuclear systems. Issues associated with the back end fuel cycle supporting a country's nuclear power programme are technical, economic, institutional and political. This TCM provided an opportunity to address these issues and their impacts to the back end fuel cycles, as well as to identify and assess factors affecting the back end fuel cycle strategies. The discussion was organized ib the following topical sessions: the nuclear fuel cycle; spent fuel management; waste management and repository; plutonium management. This document contains a summary of the meeting and 22 individual papers presented by participants. Each of the papers was indexed separately
Energy Technology Data Exchange (ETDEWEB)
NONE
2002-05-01
The Technical Committee Meeting (TCM) was held in Vienna on 8-10 November 1999; it was organized by the International Atomic Energy Agency and attended by 26 participants from 16 Member States. The purpose of the meeting was to exchange information among experts on the back end fuel cycle strategies adopted by Member States; to identify key factors determining the long-term back end fuel cycle strategies; and to assess the applicability of these factors to future nuclear systems. Issues associated with the back end fuel cycle supporting a country's nuclear power programme are technical, economic, institutional and political. This TCM provided an opportunity to address these issues and their impacts to the back end fuel cycles, as well as to identify and assess factors affecting the back end fuel cycle strategies. The discussion was organized ib the following topical sessions: the nuclear fuel cycle; spent fuel management; waste management and repository; plutonium management. This document contains a summary of the meeting and 22 individual papers presented by participants. Each of the papers was indexed separately.
Human-factor operating concept for Borssele Nuclear Power Station
International Nuclear Information System (INIS)
Wieman, J.L.
1995-01-01
The safety level in the operation of a reactor is determined basically by human beings. The Borssele Nuclear Power Station has carried out measures for improving the man-machine interface through training and operating instructions for the shift personnel. The retrofitting of control technology relevant to safety engineering should avoid operating instructions which can cause potential failures. A safety study has shown that the remaining risk following all retrofitting measures remains dependent to the extent of 80% on human factors and that human factors as a whole have a positive effect on reactor safety. (orig.) [de
Jafarzadeh, Abdollah; Nemati, Maryam; Rezayati, Mohammad Taghi; Nabizadeh, Mansooreh; Ebrahimi, Medhi
2013-07-01
H. pylori infection has been associated with some autoimmune disorders. The aim of this study was to evaluate the serum concentrations of rheumatoid factor and anti-nuclear antibodies in H. pylori-infected peptic ulcer patients, H. pylori-infected asymptomatic carriers and a healthy control group. A Total of 100 H. pylori-infected peptic ulcer patients, 65 asymptomatic carriers and 30 healthy H. pylori-negative subjects (as a control group) were enrolled into study. Serum samples of participants tested for the levels of rheumatoid factor and anti-nuclear antibodies by use of ELISA. The mean serum levels of rheumatoid factor and anti-nuclear antibodies in peptic ulcer group was significantly higher in comparison to the control group (ppeptic ulcer patients and asymptomatic carriers groups regarding the mean serum levels of rheumatoid factor and anti-nuclear antibodies. The mean serum levels of rheumatoid factor in men with peptic ulcer was significantly higher compared to the group of healthy men (ppeptic ulcer patients or asymptomatic carriers groups, the mean serum levels of rheumatoid factor was higher than that in healthy women, but the differences were not statistically significant. Also, no significant differences were observed between men and women with peptic ulcer, asymptomatic carriers control groups based on the serum levels of anti-nuclear antibodies. The results showed higher serum levels of rheumatoid factor and anti-nuclear antibodies in H. pylori-infected patients with peptic ulcer disease which represent the H. pylori-related immune disturbance in these patients. Additional follow-up studies are necessary to clarify the clinical significance of these autoantibodies in patients with H. pylori infection.
International Nuclear Information System (INIS)
2001-01-01
In co-operation with the OECD Nuclear Energy Agency (NEA), the Halden Reactor Project organised a Summer School on ''Safe Operation of Nuclear Power Plants: Impacts of Human and Organisational Factors and Emerging Technologies'' in the period August 27-August 31, 2001. The Summer School was intended for scientists, engineers and technicians working for nuclear installations, engineering companies, industry and members of universities and research institutes, who wanted to broaden their nuclear background by getting acquainted with Man-Technology-Organisation-related subjects and issues. The Summer School should also serve to transfer knowledge to the ''young generation'' in the nuclear field. The following presentations were given: (1) Overview of the Nuclear Community and Current issues, (2) The Elements of Safety Culture; Evaluation of Events, (3) Quality Management (QM), (4) Probabilistic Risk Assessment (PSA), (5) Human Behaviour from the Viewpoint of Industrial Psychology, (6) Technical tour of the Halden Project Experimental Facilities, (7) Human Factors in Control Room Design, (8) Computerised Operator Support Systems (COSSs) and (9) Artificial Intelligence; a new Approach. Most of the contributions are overhead figures from spoken lectures
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-07-01
In co-operation with the OECD Nuclear Energy Agency (NEA), the Halden Reactor Project organised a Summer School on ''Safe Operation of Nuclear Power Plants: Impacts of Human and Organisational Factors and Emerging Technologies'' in the period August 27-August 31, 2001. The Summer School was intended for scientists, engineers and technicians working for nuclear installations, engineering companies, industry and members of universities and research institutes, who wanted to broaden their nuclear background by getting acquainted with Man-Technology-Organisation-related subjects and issues. The Summer School should also serve to transfer knowledge to the ''young generation'' in the nuclear field. The following presentations were given: (1) Overview of the Nuclear Community and Current issues, (2) The Elements of Safety Culture; Evaluation of Events, (3) Quality Management (QM), (4) Probabilistic Risk Assessment (PSA), (5) Human Behaviour from the Viewpoint of Industrial Psychology, (6) Technical tour of the Halden Project Experimental Facilities, (7) Human Factors in Control Room Design, (8) Computerised Operator Support Systems (COSSs) and (9) Artificial Intelligence; a new Approach. Most of the contributions are overhead figures from spoken lectures.
Studies on human factors in nuclear power plants
International Nuclear Information System (INIS)
Tsukuda, H.; Miyaoka, S.
1988-01-01
In order to raise the reliability and safety of nuclear power plants to the highest possible level, improvements to the mechanical system alone are not sufficient. Human factors must be systematically analysed and the causes and mechanisms of human error clarified to allow the development of countermeasures that will reduce error as much as possible. The paper introduces research in two areas, fundamental clarification of human behavioural, physiological and psychological characteristics to aid in the development of preventive measures for reducing error, and studies involving analysis of actual cases of accidents and failures related to man along with development of countermeasures to prevent the recurrence of such cases. The paper especially considers the latter area. The Human Performance Evaluation System (HPES) developed by the Institute of Nuclear Power Operations (INPO) in the USA was applied on a trial basis to 31 recent accidents and failures at Japanese nuclear power plants. The effectiveness of and possible improvement to HPES were considered. Also, cases that were not directly linked to accidents or failures were analysed using a method developed independently in Japan using data collected from a survey of approximately 3,000 power plant personnel. Fundamental research on human behaviour, physiology and psychology are also introduced. (author). 4 figs
Public opinion factors regarding nuclear power
Energy Technology Data Exchange (ETDEWEB)
Benson, B.
1991-12-31
This paper is an effort to identify, as comprehensively as possible, public concerns about nuclear power, and to assess, where possible, the relative importance of these concerns as they relate to government regulation of and policy towards nuclear power. It is based on some two dozen in-depth interviews with key communicators representing the nuclear power industry, the environmental community, and government, as well as on the parallel efforts in our research project: (1) review of federal court case law, (2) a selective examination of the Nuclear Regulatory Commission (NRC) administrative process, and (3) the preceding George Mason University research project in this series. The paper synthesizes our findings about public attitudes towards nuclear power as expressed through federal court case law, NRC administrative law, public opinion surveys, and direct personal interviews. In so doing, we describe the public opinion environment in which the nuclear regulatory process must operate. Our premise is that public opinion ultimately underlies the approaches government agencies take towards regulating nuclear power, and that, to the degree that the nuclear power industry`s practices are aligned with public opinion, a more favorable regulatory climate is possible.
Public opinion factors regarding nuclear power
Energy Technology Data Exchange (ETDEWEB)
Benson, B.
1991-01-01
This paper is an effort to identify, as comprehensively as possible, public concerns about nuclear power, and to assess, where possible, the relative importance of these concerns as they relate to government regulation of and policy towards nuclear power. It is based on some two dozen in-depth interviews with key communicators representing the nuclear power industry, the environmental community, and government, as well as on the parallel efforts in our research project: (1) review of federal court case law, (2) a selective examination of the Nuclear Regulatory Commission (NRC) administrative process, and (3) the preceding George Mason University research project in this series. The paper synthesizes our findings about public attitudes towards nuclear power as expressed through federal court case law, NRC administrative law, public opinion surveys, and direct personal interviews. In so doing, we describe the public opinion environment in which the nuclear regulatory process must operate. Our premise is that public opinion ultimately underlies the approaches government agencies take towards regulating nuclear power, and that, to the degree that the nuclear power industry's practices are aligned with public opinion, a more favorable regulatory climate is possible.
Public opinion factors regarding nuclear power
International Nuclear Information System (INIS)
Benson, B.
1991-01-01
This paper is an effort to identify, as comprehensively as possible, public concerns about nuclear power, and to assess, where possible, the relative importance of these concerns as they relate to government regulation of and policy towards nuclear power. It is based on some two dozen in-depth interviews with key communicators representing the nuclear power industry, the environmental community, and government, as well as on the parallel efforts in our research project: (1) review of federal court case law, (2) a selective examination of the Nuclear Regulatory Commission (NRC) administrative process, and (3) the preceding George Mason University research project in this series. The paper synthesizes our findings about public attitudes towards nuclear power as expressed through federal court case law, NRC administrative law, public opinion surveys, and direct personal interviews. In so doing, we describe the public opinion environment in which the nuclear regulatory process must operate. Our premise is that public opinion ultimately underlies the approaches government agencies take towards regulating nuclear power, and that, to the degree that the nuclear power industry's practices are aligned with public opinion, a more favorable regulatory climate is possible
Phan, N T; Cabot, P J; Wallwork, B D; Cervin, A U; Panizza, B J
2015-07-01
Chronic rhinosinusitis is characterised by persistent inflammation of the sinonasal mucosa. Multiple pathophysiological mechanisms are likely to exist. Previous research has focused predominantly on T-helper type cytokines to highlight the inflammatory mechanisms. However, proteins such as nuclear factor kappa B and transforming growth factor beta are increasingly recognised to have important roles in sinonasal inflammation and tissue remodelling. This review article explores the roles of T-helper type cytokines, nuclear factor kappa B and transforming growth factor beta in the pathophysiological mechanisms of chronic rhinosinusitis. An understanding of these mechanisms will allow for better identification and classification of chronic rhinosinusitis endotypes, and, ultimately, improved therapeutic strategies.
Human factors in maintenance: Development and research in Swedish nuclear power plants
International Nuclear Information System (INIS)
Salo, I.; Svensson, Ola
2001-11-01
The present report investigated previously completed, ongoing, and planned research and development projects focusing human factors and maintenance work carried out at Swedish nuclear power plants and SKI. In addition, needs for future research and development works were also investigated. Participants from all nuclear power plants and SKI were included in the study. Participants responded to a set of questions in an interview. The interviews also generated a list of future research and development projects
Human factors in maintenance: development and research in Swedish nuclear power plants
International Nuclear Information System (INIS)
Salo, I.; Svenson, O.
2001-11-01
The report investigated previously completed, ongoing, and planned research and development projects focusing human factors and maintenance work carried out at Swedish nuclear power plants and SKI. In addition, needs for future research and development works were also investigated. Participants from all nuclear power plants and SKI were included in the study. Participants responded to a set of questions in an interview. The interviews also generated a list of future research and development projects. (au)
Human factors in maintenance: Development and research in Swedish nuclear power plants
Energy Technology Data Exchange (ETDEWEB)
Salo, I. [Lund Univ. (Sweden). Dept. of Psychology; Svensson, Ola [Stockholm Univ. (Sweden). Dept. of Psychology
2001-11-01
The present report investigated previously completed, ongoing, and planned research and development projects focusing human factors and maintenance work carried out at Swedish nuclear power plants and SKI. In addition, needs for future research and development works were also investigated. Participants from all nuclear power plants and SKI were included in the study. Participants responded to a set of questions in an interview. The interviews also generated a list of future research and development projects.
Transferring aviation human factors technology to the nuclear power industry
International Nuclear Information System (INIS)
Montemerlo, M.D.
1981-01-01
The purpose of this paper is to demonstrate the availability of aviation safety technology and research on problems which are sufficiently similar to those faced by the nuclear power industry that an agressive effort to adapt and transfer that technology and research is warranted. Because of time and space constraints, the scope of this paper is reduced from a discussion of all of aviation safety technology to the human factors of air carrier safety. This area was selected not only because of similarities in the human factors challenges shared by both industries (e.g. selection, training, evaluation, certification, etc.) but because experience in aviation has clearly demonstrated that human error contributes to a substantially greater proportion of accidents and incidents than does equipment failure. The Congress of the United States has placed a great deal of emphasis on investigating and solving human factors problems in aviation. A number of recent examples of this interest and of the resulting actions are described. The opinions of prominent aviation organizations as to the human factors problems most in need of research are presented, along with indications of where technology transfer to the nuclear power industry may be viable. The areas covered include: fatigue, crew size, information transfer, resource management, safety data-bases, the role of automation, voice and data recording systems, crew distractions, the management of safety regulatory agencies, equipment recertification, team training, crew work-load, behavioural factors, human factors of equipment design, medical problems, toxicological factors, the use of simulators for training and certification, determining the causes of human errors, the politics of systems improvement, and importance of both safety and public perception of safety if the industry is to be viable. (author)
UNC Nuclear Industries' human-factored approach to the operating or maintenance procedure
International Nuclear Information System (INIS)
Nelson, A.A.; Clark, J.E.
1982-01-01
The development of Human Factors Engineering (HFE) and UNC Nuclear Industries' (UNC) commitment to minimizing the potential for human error in the performance of operating or maintenance procedures have lead to a procedure upgrade program. Human-factored procedures were developed using information from many sources including, but not limited to, operators, a human factors specialist, engineers and supervisors. This has resulted in the Job Performance Aid (JPA). This paper presents UNC's approach to providing human-factored operating and maintenance procedures
Factors determining the UK's back-end nuclear fuel cycle strategy and future nuclear systems
International Nuclear Information System (INIS)
Dunn, M.J.; Ainsworth, Z.E.
2002-01-01
Nuclear generating capacity in the UK is static with no units currently under construction. The AGRs and the UK's only PWR, Sizewell B, are operated by British Energy Generation Ltd (BEGL) and British Energy Generation (UK) Ltd (BEG(UK)L), who are subsidiaries of British Energy plc (BE) which was privatised in July 1996. Ownership of the Magnox stations, which were excluded from this privatisation, has now been transferred to BNFL.Government policy on spent fuel management in the UK is that it is for the owners of the spent fuel to decide on the appropriate spent fuel management options, based on their own commercial judgement, subject to meeting the necessary regulatory requirements. The main factors which have predominantly determined UK utility decisions on spent fuel management, to date, have been based on the technical considerations of the spent fuel characteristics, economic attractiveness of the options and at reactor site spent fuel storage capacities. To date, reprocessing has been the dominant form of spent fuel treatment in the UK. Spent fuel storage facilities consist of a mixture of at-reactor stores and large, centralised ponds associated with the reprocessing activities which take place at the Sellafield site. BEGL and BEG(UK)L have contracts for the lifetime arisings of AGR fuel which allow for all AGR spent fuel to be sent to Sellafield for reprocessing or long-term storage. The prompt reprocessing of all Magnox fuel will continue, and spent PWR fuel will continue to be stored at the reactor site in the short to medium term. It is likely that a combination of factors, which are discussed later in this paper, will continue to affect back-end nuclear fuel cycle strategy and future nuclear systems. (author)
Battelle's human factors program for the US Nuclear Regulatory Commission
International Nuclear Information System (INIS)
Shikiar, R.
1983-10-01
Battelle has been involved in a programmatic effort of technical assistance to the Division of Human Factors Safety of the NRC. This program involves the efforts of over 75 professionals engaged in over 20 projects. These projects span the areas of human factors engineering, procedures, examinations, training, staffing and qualifications, and utility management and organization. All of these bear, one way or another, on the role of operators in nuclear power plants. This programmatic effort can be viewed as part of an integrative approach to system safety
International Nuclear Information System (INIS)
Takahashi, Akinori; Obata, Yuuki; Fukumoto, Yasunori; Nakayama, Yuji; Kasahara, Kousuke; Kuga, Takahisa; Higashiyama, Yukihiro; Saito, Takashi; Yokoyama, Kazunari K.; Yamaguchi, Naoto
2009-01-01
Src-family kinases (SFKs), which participate in various signaling events, are found at not only the plasma membrane but also several subcellular compartments, including the nucleus. Nuclear structural changes are frequently observed during transcription, cell differentiation, senescence, tumorigenesis, and cell cycle. However, little is known about signal transduction in the alteration of chromatin texture. Here, we develop a pixel imaging method for quantitatively evaluating chromatin structural changes. Growth factor stimulation increases euchromatic hypocondensation and concomitant heterochromatic hypercondensation in G 1 phase, and the levels reach a plateau by 30 min, sustain for at least 5 h and return to the basal levels after 24 h. Serum-activated SFKs in the nucleus were more frequently detected in the euchromatin areas than the heterochromatin areas. Nuclear expression of kinase-active SFKs, but not unrelated Syk kinase, drastically increases both euchromatinization and heterochromatinization in a manner dependent on the levels of nuclear tyrosine phosphorylation. However, growth factor stimulation does not induce chromatin structural changes in SYF cells lacking SFKs, and reintroduction of one SFK member into SYF cells can, albeit insufficiently, induce chromatin structural changes. These results suggest that nuclear tyrosine phosphorylation by SFKs plays an important role in chromatin structural changes upon growth factor stimulation.
International Nuclear Information System (INIS)
Gao Feng; Liu Yanzi; Sun Yongbin
2014-01-01
The design of nuclear power plant control room system is a process of improvement with the implementation of human factor engineering theory and guidance. The method of implementation human factor engineering principles into the nuclear power plant control room system design and improvement was discussed in this paper. It is recommended that comprehensive address should be done from control room system function, human machine interface, digital procedure, control room layout and environment design based on the human factor engineering theory and experience. The main issues which should be paid more attention during the control room system design and improvement also were addressed in this paper, and then advices and notices for the design and improvement of the nuclear power plant control room system were afforded. (authors)
Fermi liquid, clustering, and structure factor in dilute warm nuclear matter
Röpke, G.; Voskresensky, D. N.; Kryukov, I. A.; Blaschke, D.
2018-02-01
Properties of nuclear systems at subsaturation densities can be obtained from different approaches. We demonstrate the use of the density autocorrelation function which is related to the isothermal compressibility and, after integration, to the equation of state. This way we connect the Landau Fermi liquid theory well elaborated in nuclear physics with the approaches to dilute nuclear matter describing cluster formation. A quantum statistical approach is presented, based on the cluster decomposition of the polarization function. The fundamental quantity to be calculated is the dynamic structure factor. Comparing with the Landau Fermi liquid theory which is reproduced in lowest approximation, the account of bound state formation and continuum correlations gives the correct low-density result as described by the second virial coefficient and by the mass action law (nuclear statistical equilibrium). Going to higher densities, the inclusion of medium effects is more involved compared with other quantum statistical approaches, but the relation to the Landau Fermi liquid theory gives a promising approach to describe not only thermodynamic but also collective excitations and non-equilibrium properties of nuclear systems in a wide region of the phase diagram.
International Nuclear Information System (INIS)
Simard, R.L.
1977-01-01
The Council on Economic Priorities (CEP) has assembled capacity factor data on most U.S. nuclear and coal-fired units in operation, performed a regression analysis upon capacity factor as a function of intrinsic unit variables such as size and age, and attempted a comparison of the economics of typical nuclear and coal-fired units using the resultant fitted-capacity factors. The report points out inadequacies in the CEP data base, the lack of predictive value in the results of the regression analysis, and inconsistencies in the economic evaluation of nuclear and coal-fired units
Mechanism governing heme synthesis reveals a GATA factor/heme circuit that controls differentiation.
Tanimura, Nobuyuki; Miller, Eli; Igarashi, Kazuhiko; Yang, David; Burstyn, Judith N; Dewey, Colin N; Bresnick, Emery H
2016-02-01
Metal ion-containing macromolecules have fundamental roles in essentially all biological processes throughout the evolutionary tree. For example, iron-containing heme is a cofactor in enzyme catalysis and electron transfer and an essential hemoglobin constituent. To meet the intense demand for hemoglobin assembly in red blood cells, the cell type-specific factor GATA-1 activates transcription of Alas2, encoding the rate-limiting enzyme in heme biosynthesis, 5-aminolevulinic acid synthase-2 (ALAS-2). Using genetic editing to unravel mechanisms governing heme biosynthesis, we discovered a GATA factor- and heme-dependent circuit that establishes the erythroid cell transcriptome. CRISPR/Cas9-mediated ablation of two Alas2 intronic cis elements strongly reduces GATA-1-induced Alas2 transcription, heme biosynthesis, and surprisingly, GATA-1 regulation of other vital constituents of the erythroid cell transcriptome. Bypassing ALAS-2 function in Alas2 cis element-mutant cells by providing its catalytic product 5-aminolevulinic acid rescues heme biosynthesis and the GATA-1-dependent genetic network. Heme amplifies GATA-1 function by downregulating the heme-sensing transcriptional repressor Bach1 and via a Bach1-insensitive mechanism. Through this dual mechanism, heme and a master regulator collaborate to orchestrate a cell type-specific transcriptional program that promotes cellular differentiation. © 2015 The Authors.
Nuclear exclusion of transcription factors associated with apoptosis in developing nervous tissue
Directory of Open Access Journals (Sweden)
R. Linden
1999-07-01
Full Text Available Programmed cell death in the form of apoptosis involves a network of metabolic events and may be triggered by a variety of stimuli in distinct cells. The nervous system contains several neuron and glial cell types, and developmental events are strongly dependent on selective cell interactions. Retinal explants have been used as a model to investigate apoptosis in nervous tissue. This preparation maintains the structural complexity and cell interactions similar to the retina in situ, and contains cells in all stages of development. We review the finding of nuclear exclusion of several transcription factors during apoptosis in retinal cells. The data reviewed in this paper suggest a link between apoptosis and a failure in the nucleo-cytoplasmic partition of transcription factors. It is argued that the nuclear exclusion of transcription factors may be an integral component of apoptosis both in the nervous system and in other types of cells and tissues.
Systems approach to the study of brain damage in the very preterm newborn
Leviton, Alan; Gressens, Pierre; Wolkenhauer, Olaf; Dammann, Olaf
2015-01-01
Background: A systems approach to the study of brain damage in very preterm newborns has been lacking. Methods: In this perspective piece, we offer encephalopathy of prematurity as an example of the complexity and interrelatedness of brain-damaging molecular processes that can be initiated inflammatory phenomena. Results: Using three transcription factors, nuclear factor-kappa B (NF-κB), Notch-1, and nuclear factor erythroid 2 related factor 2 (NRF2), we show the inter-connectedness of signaling pathways activated by some antecedents of encephalopathy of prematurity. Conclusions: We hope that as biomarkers of exposures and processes leading to brain damage in the most immature newborns become more readily available, those who apply a systems approach to the study of neuroscience can be persuaded to study the pathogenesis of brain disorders in the very preterm newborn. PMID:25926780
Human factors review of nuclear power plant control room design. Final report
International Nuclear Information System (INIS)
Seminara, J.L.; Gonzalez, W.R.; Parsons, S.O.
1976-11-01
The human factors aspects of five representative nuclear power plant control rooms were evaluated using such methods as a checklist guided observation system, structured interviews with operators and trainers, direct observations of operator behavior, task analyses and procedure evaluation, and historical error analyses. The human factors aspects of design practices are illustrated, and many improvements in current practices are suggested. The study recommends that a detailed set of applicable human factors standards be developed to stimulate a uniform and systematic concern for human factors in design considerations
International Nuclear Information System (INIS)
Kwan-Seong Jeong; Dong-Gyu Lee; Chong-Hun Jung; Kune-Woo Lee
2007-01-01
Available in abstract form only. Full text of publication follows: The uncertainties of decommissioning costs increase high due to several conditions. Decommissioning cost estimation depends on the complexity of nuclear installations, its site-specific physical and radiological inventories. Therefore, the decommissioning costs of nuclear research facilities must be estimated in accordance with the detailed sub-tasks and resources by the tasks of decommissioning activities. By selecting the classified activities and resources, costs are calculated by the items and then the total costs of all decommissioning activities are reshuffled to match with its usage and objectives. And the decommissioning cost of nuclear research facilities is calculated by applying a unit cost factor method on which classification of decommissioning works fitted with the features and specifications of decommissioning objects and establishment of composition factors are based. Decommissioning costs of nuclear research facilities are composed of labor cost, equipment and materials cost. Of these three categorical costs, the calculation of labor costs are very important because decommissioning activities mainly depend on labor force. Labor costs in decommissioning activities are calculated on the basis of working time consumed in decommissioning objects and works. The working times are figured out of unit cost factors and work difficulty factors. Finally, labor costs are figured out by using these factors as parameters of calculation. The accuracy of decommissioning cost estimation results is much higher compared to the real decommissioning works. (authors)
Directory of Open Access Journals (Sweden)
Nikolai V. Kuznetsov
2017-10-01
Full Text Available Abstract Background The Wiskott–Aldrich syndrome protein (WASp family of actin-nucleating factors are present in the cytoplasm and in the nucleus. The role of nuclear WASp for T cell development remains incompletely defined. Methods We performed WASp chromatin immunoprecipitation and deep sequencing (ChIP-seq in thymocytes and spleen CD4+ T cells. Results WASp was enriched at genic and intergenic regions and associated with the transcription start sites of protein-coding genes. Thymocytes and spleen CD4+ T cells showed 15 common WASp-interacting genes, including the gene encoding T cell factor (TCF12. WASp KO thymocytes had reduced nuclear TCF12 whereas thymocytes expressing constitutively active WASpL272P and WASpI296T had increased nuclear TCF12, suggesting that regulated WASp activity controlled nuclear TCF12. We identify a putative DNA element enriched in WASp ChIP-seq samples identical to a TCF1-binding site and we show that WASp directly interacted with TCF1 in the nucleus. Conclusions These data place nuclear WASp in proximity with TCF1 and TCF12, essential factors for T cell development.
Nuclear medicine - factors influencing the choice and use of radionuclides in diagnosis and therapy
International Nuclear Information System (INIS)
Anon.
1983-01-01
This report addresses the many factors which influence the choice of the proper radiopharmaceutical drug product for the diagnosis or treatment of a specific disease or condition in a human subject. The Report examines the historical factors that influence the choice of radionuclides, the factors that influence the localization of radionuclides in tissues, the factors that influence the choice of instruments, and include an evaluation of the nuclear medicine procedures that could be selected and their clinical usefulness. In examining these factors the desirable characteristics of the radiopharmaceutical drug products of the measurement systems are identified. The methods of dose determination and the assumptions used in determination of dose are developed. There is also a section on radiation effects. A chapter on guidelines for procedures in nuclear medicine and some general and specific recommendations for protection of patients conclude the body of the text
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-07-01
In co-operation with the OECD Nuclear Energy Agency (NEA), the Halden Reactor Project organised a Summer School on ''Safe Operation of Nuclear Power Plants: Impacts of Human and Organisational Factors and Emerging Technologies'' in the period August 27-August 31, 2001. The Summer School was intended for scientists, engineers and technicians working for nuclear installations, engineering companies, industry and members of universities and research institutes, who wanted to broaden their nuclear background by getting acquainted with Man-Technology-Organisation-related subjects and issues. The Summer School should also serve to transfer knowledge to the ''young generation'' in the nuclear field. The following presentations were given: (1) Overview of the Nuclear Community and Current issues, (2) The Elements of Safety Culture; Evaluation of Events, (3) Quality Management (QM), (4) Probabilistic Risk Assessment (PSA), (5) Human Behaviour from the Viewpoint of Industrial Psychology, (6) Technical tour of the Halden Project Experimental Facilities, (7) Human Factors in Control Room Design, (8) Computerised Operator Support Systems (COSSs) and (9) Artificial Intelligence; a new Approach. Most of the contributions are overhead figures from spoken lectures.
Nuclear Power and Resource Efficiency—A Proposal for a Revised Primary Energy Factor
Directory of Open Access Journals (Sweden)
Ola Eriksson
2017-06-01
Full Text Available Measuring resource efficiency can be achieved using different methods, of which primary energy demand is commonly used. The primary energy factor (PEF is a figure describing how much energy from primary resources is being used per unit of energy delivered. The PEF for nuclear power is typically 3, which refers to thermal energy released from fission in relation to electricity generated. Fuel losses are not accounted for. However; nuclear waste represents an energy loss, as current plans for nuclear waste management mostly include final disposal. Based on a literature review and mathematical calculations of the power-to-fuel ratio for nuclear power, PEF values for the open nuclear fuel cycle (NFC option of nuclear power and different power mixes are calculated. These calculations indicate that a more correct PEF for nuclear power would be 60 (range 32–88; for electricity in Sweden (41% nuclear power PEF would change from 1.8 to 25.5, and the average PEF for electricity in the European Union (EU would change from 2.5 to 18. The results illustrate the poor resource efficiency of nuclear power, which paves the way for the fourth generation of nuclear power and illustrates the policy implication of using PEFs which are inconsistent with current waste management plans.
Inhibitors of nuclear factor kappa B cause apoptosis in cultured macrophages
Directory of Open Access Journals (Sweden)
E. E. Mannick
1997-01-01
Full Text Available The precise role of the transcription factor nuclear factor kappa B (NF- κB in the regulation of cell survival and cell death is still unresolved and may depend on cell type and position in the cell cycle. The aim of this study was to determine if three pharmacologic inhibitors of NF-κB, pyrrolidine dithiocarbamate, N-tosyl-L-lysl chloromethyl ketone and calpain I inhibitor, induce apoptosis in a murine macrophage cell line (RAW 264.7 at doses similar to those required for NF-κB inhibition. We found that each of the three inhibitors resulted in a dose- and time-dependent increase in morphologic indices of apoptosis in unstimulated, LPS-stimulated and TNF-stimulated cells. Lethal doses were consistent with those required for NF- κB inhibition. We conclude that nuclear NF-κB activation may represent an important survival mechanism in macrophages.
Directory of Open Access Journals (Sweden)
Jozef Madzo
2014-01-01
Full Text Available Hematopoietic stem cell differentiation involves the silencing of self-renewal genes and induction of a specific transcriptional program. Identification of multiple covalent cytosine modifications raises the question of how these derivatized bases influence stem cell commitment. Using a replicative primary human hematopoietic stem/progenitor cell differentiation system, we demonstrate dynamic changes of 5-hydroxymethylcytosine (5-hmC during stem cell commitment and differentiation to the erythroid lineage. Genomic loci that maintain or gain 5-hmC density throughout erythroid differentiation contain binding sites for erythroid transcription factors and several factors not previously recognized as erythroid-specific factors. The functional importance of 5-hmC was demonstrated by impaired erythroid differentiation, with augmentation of myeloid potential, and disrupted 5-hmC patterning in leukemia patient-derived CD34+ stem/early progenitor cells with TET methylcytosine dioxygenase 2 (TET2 mutations. Thus, chemical conjugation and affinity purification of 5-hmC-enriched sequences followed by sequencing serve as resources for deciphering functional implications for gene expression during stem cell commitment and differentiation along a particular lineage.
International Nuclear Information System (INIS)
Madden, V.J.
1990-01-01
The staff and simulators of utility's nuclear training function are being utilized in support of a wide range of human factor related activities. In addition to work on man machines interface review, operating procedures, operator support system and VDU format design and validation for the Magnox and AGR series of nuclear power plants, support is also being provided to the PWR Project Team through staff who have undergone extensive and comprehensive overseas PWR training programs. This paper discusses how recent initiatives in connection with a survey on operator stress and the possible use of psychometric testing in support of the selection of reactor desk engineers are also being supported
Human factors considerations for expert systems in the nuclear industry
International Nuclear Information System (INIS)
Nelson, W.R.
1988-01-01
This paper discusses the general human factors issues relative to the development and implementation of expert systems for the nuclear industry. It summarizes the relevant research that addresses these issues, and identifies those areas that need the most effort for success. Since much of the prominent work for the application of expert systems has focused on computerized aids for decision making in emergencies, this paper draws from this area for its examples. This area tends to highlight the issues because of the safety-critical nature of the application. The same issues, however, are relevant to other applications of expert systems in the nuclear industry as well, even though the consequences of failure may not be as dramatic
Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y
2016-04-01
The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Factors affecting economic performance of nuclear power projects in the USA and abroad
International Nuclear Information System (INIS)
Braun, C.
1988-01-01
Trends in nuclear power economics in the USA, as well as in other large power programmes, are reviewed in this paper. The current US coal/nuclear economic situation, the implications for operating cost improvements and the potential for the introduction of new low-cost nuclear units are discussed. The average economic advantage of nuclear over coal plants has been significantly eroded over the last four years, though the rate of decline has recently slowed. Discussion of an average plant's performance indices is always imprecise, given the wide distribution of the costs data. However, several nuclear power plants can be identified whose total generation costs in 1985 were less than coal units' variable costs or total generation expenses. It is concluded that the impact of new, low-cost plants on improving the overall US nuclear/coal economics will require a long time to make itself felt. In the near term the most cost effective methods for improving US nuclear power economics are a reduction in operating expenses and an increase in average plant capacity factors. (author). 9 refs, 9 figs
International Nuclear Information System (INIS)
Eisgruber, H.
1996-01-01
Both operating results and human factors studies show that man is able to meet the requirements in this working environment. Hence the degree of human reliability required by the design basis of nuclear power plants is ensured. This means: - Nuclear technology for electricity generation is justifiable from the human factors point of view. - The chief opponent is not right in saying that man is not able to cope with the risks and challenges brought about by nuclear technology applications. The human factors concept for optimisation or configuration of the man-machine systems represents an additional endeavor on the part of nuclear power plant operators within the framework of their responsibilities. Human factors analyses meet with good response by the personnel, as analysis results and clarification of causes of accident scenarios contribute to relieve the personnel (exoneration) and find ways for remedial action. (orig./DG) [de
International Nuclear Information System (INIS)
Lin, C.-L.; Leu, Steve; Lu, M.-C.; Ouyang Pin
2004-01-01
Pre-mRNA splicing takes place within a dynamic ribonucleoprotein particle called the spliceosome and occurs in an ordered pathway. Although it is known that spliceosome consists of five small nuclear RNAs and at least 50 proteins, little is known about how the interaction among the proteins changes during splicing. Here we identify that SR-cyp, a Moca family of nuclear cyclophilin, interacts and colocalizes with nuclear pinin (pnn), a SR-related protein involving in pre-mRNA splicing. Nuclear pnn interacts with SR-cyp via its C-terminal RS domain. Upon SR-cyp over-expression, however, the subnuclear distribution of nuclear pnn is altered, resulting in its redistribution from nuclear speckles to a diffuse nucleoplasmic form. The diffuse subnuclear distribution of nuclear pnn is not due to epitope masking, accelerated protein turnover or post-translational modification. Furthermore, we find that SR-cyp regulates the subnuclear distribution of other SR family proteins, including SC35 and SRm300, in a similar manner as it does on nuclear pnn. This result is significant because it suggests that SR-cyp plays a general role in modulating the distribution pattern of SR-like and SR proteins, similar to that of Clk (cdc2-like kinase)/STY on SR family splicing factors. SR-cyp might direct its effect via either alteration of protein folding/conformation or of protein-protein interaction and thus may add another control level of regulation of SR family proteins and modification of their functions
Importance of nuclear station load factor in applied ro energy policies
International Nuclear Information System (INIS)
Gomes, Daniel de Souza
2015-01-01
Load factor is the ration between the energy produced by a station and the energy it would have produced running at maximum power. The factor intends for all types of commercial reactors. Nuclear plants continuously provide over 11% of the world's electricity. The reactors for which data were available generated 618.7 TWh of electricity in 2014. Typical load factor was around 75% in worldwide during the first quarter of 2015. In this manner, it obtained from an average, three-monthly or yearly. The regular load factor of the reactors in operation was around 56% in 1970. While, in 1980's decade, we have an increase to 63%, the same situation occurred in next the decade and suffering increasing to 73%. Currently, the load factor reaches 78%. Accidents are seasonal factors, with the occurrence of reduction of power generation plants. In 2015 in January, there are over 437 operable commercial reactors in 31 countries, with over 377,728 MWe of full capacity. In Brazil, total capacity is 1901 MWe, with around 2.8% of electricity energy consumed. The primary objective of this study was to find a forecast model that express the evolution of the load factor in the next years. In recent years occur an extensive development of pressurized water reactors in Asia. The periodicity of seasonal effects on the performance of nuclear power plants due to aging. However, the impact of plant age depended on new technologies that allow the growth of the performance. The accident of Fukushima was an inflection point for energy policies. The event produced a trend that reduced the load in the world. (author)
Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y
2016-01-01
Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.
Directory of Open Access Journals (Sweden)
Gracielle Vieira Ramos
2018-01-01
Full Text Available Background. The present study aimed to analyze the effects of physical training on an antioxidant canonical pathway and metalloproteinases activity in diaphragm muscle in a model of cigarette smoke-induced chronic obstructive pulmonary disease (COPD. Methods. Male mice were randomized into control, smoke, exercise, and exercise + smoke groups, which were maintained in trial period of 24 weeks. Gene expression of kelch-like ECH-associated protein 1; nuclear factor erythroid-2 like 2; and heme-oxygenase1 by polymerase chain reaction was performed. Metalloproteinases 2 and 9 activities were analyzed by zymography. Exercise capacity was evaluated by treadmill exercise test before and after the protocol. Results. Aerobic training inhibited diaphragm muscle wasting induced by cigarette smoke exposure. This inhibition was associated with improved aerobic capacity in those animals that were submitted to 24 weeks of aerobic training, when compared to the control and smoke groups, which were not submitted to training. The aerobic training also downregulated the increase of matrix metalloproteinases (MMP-2 and MMP-9 and upregulated antioxidant genes, such as nuclear factor erythroid-2 like 2 (NRF2 and heme-oxygenase1 (HMOX1, in exercise + smoke group compared to smoke group. Conclusions. Treadmill aerobic training protects diaphragm muscle wasting induced by cigarette smoke exposure involving upregulation of antioxidant genes and downregulation of matrix metalloproteinases.
A human factors data bank for French nuclear power plants
International Nuclear Information System (INIS)
Villemeur, A.; Mosneron-Dupin, F.; Bouissou, M.; Meslin, T.
1986-01-01
CONFUCIUS is a computerized data bank developed by Electricite de France to study human factors in nuclear power plants. A detailed and homogeneous grouping of described operation and maintenance errors as well as of performance times is possible with CONFUCIUS. It also incorporates a selection of statistical treatment softwares. Readily usable and modifiable, the system can easily evolve. It allows a wide range of applications (safety analysis, event analysis, training, human factors engineering, probabilistic analysis). Data derived from the analysis of significant events reported in power plants and from the analysis of simulator tests are used as inputs into this data bank
Wong, Mei Mei; Chen, Yikuan; Margariti, Andriani; Winkler, Bernhard; Campagnolo, Paola; Potter, Claire; Hu, Yanhua; Xu, Qingbo
2014-03-01
Vascular lineage differentiation of stem/progenitor cells can contribute to both tissue repair and exacerbation of vascular diseases such as in vein grafts. The role of macrophages in controlling vascular progenitor differentiation is largely unknown and may play an important role in graft development. This study aims to identify the role of macrophages in vascular stem/progenitor cell differentiation and thereafter elucidate the mechanisms that are involved in the macrophage- mediated process. We provide in vitro evidence that macrophages can induce endothelial cell (EC) differentiation of the stem/progenitor cells while simultaneously inhibiting their smooth muscle cell differentiation. Mechanistically, both effects were mediated by macrophage-derived tumor necrosis factor-α (TNF-α) via TNF-α receptor 1 and canonical nuclear factor-κB activation. Although the overexpression of p65 enhanced EC (or attenuated smooth muscle cell) differentiation, p65 or TNF-α receptor 1 knockdown using lentiviral short hairpin RNA inhibited EC (or rescued smooth muscle cell) differentiation in response to TNF-α. Furthermore, TNF-α-mediated EC differentiation was driven by direct binding of nuclear factor-κB (p65) to specific VE-cadherin promoter sequences. Subsequent experiments using an ex vivo decellularized vessel scaffold confirmed an increase in the number of ECs and reduction in smooth muscle cell marker expression in the presence of TNF-α. The lack of TNF-α in a knockout mouse model of vein graft decreased endothelialization and significantly increased thrombosis formation. Our study highlights the role of macrophages in directing vascular stem/progenitor cell lineage commitment through TNF-α-mediated TNF-α receptor 1 and nuclear factor-κB activation that is likely required for endothelial repair in vascular diseases such as vein graft.
Human factors in nuclear power plant operation
International Nuclear Information System (INIS)
Sabri, Z.A.; Husseiny, A.A.
1980-01-01
An extensive effort is being devoted to developing a comprehensive human factor program that encompasses establishment of a data base for human error prediction using past operation experience in commercial nuclear power plants. Some of the main results of such an effort are reported including data retrieval and classification systems which have been developed to assist in estimation of operator error rates. Also, statistical methods are developed to relate operator error data to reactor type, age, and specific technical design features. Results reported in this paper are based on an analysis of LER's covering a six-year period for LWR's. Developments presently include a computer data management program, statistical model, and detailed error taxonomy
Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway
Directory of Open Access Journals (Sweden)
Michelle R. Campbell
2013-01-01
Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.
Critical factors supporting the confidence in U.S. nuclear power industries
International Nuclear Information System (INIS)
Yoshida, Tomoaki
2004-01-01
The risk informed regulation in U.S. is summarized and factors supporting the confidence in U.S. nuclear power industries are thought to be helpful to our country for improving the state of nuclear power industries. In U.S., on the basis of clear Regulatory Guide, an entrepreneur constructs and practices corrective action of nonconformance. A regulatory commission submitted by the nation watches their movements. The movements related to regulatory are opened to the people and they make a thousand preparations for the rule to make correct the insufficient part. These above system get good results in U.S. It is important in Japan that we are not going to get away with anything on the system satisfied above conditions and practice. The risk informed regulation, effectiveness of risk informed regulation supporting conditions, a part of NRC (Nuclear Regulatory Commission) and entrepreneur are described. (S.Y.)
ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN
Directory of Open Access Journals (Sweden)
Ugo Testa
2009-06-01
Full Text Available
In humans the switch from fetal to adult hemoglobin (HbF→ HbA takes place in the perinatal and postnatal period, determining the progressive replacement of HbF with HbA synthesis ( i.e., the relative HbF content in red blood cells decreases from 80-90% to <1%. In spite of more than twenty years of intensive investigations on this classic model, the molecular mechanisms regulating the Hb switching, as well as HbF synthesis in adults, has been only in part elucidated. In adult life, the residual HbF, restricted to F cell compartment, may be reactivated up to 10-20% of total Hb synthesis in various conditions associated with “stress erythropoiesis”: this reactivation represented until now an interesting model of partial Hb switch reverse with important therapeutic implications in patients with hemoglobinopathies, and particularly in -thalassemia.
In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF.
In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.
Role of zinc finger structure in nuclear localization of transcription factor Sp1
International Nuclear Information System (INIS)
Ito, Tatsuo; Azumano, Makiko; Uwatoko, Chisana; Itoh, Kohji; Kuwahara, Jun
2009-01-01
Transcription factor Sp1 is localized in the nucleus and regulates gene expression. Our previous study demonstrated that the carboxyl terminal region of Sp1 containing 3-zinc finger region as DNA binding domain can also serve as nuclear localization signal (NLS). However, the nuclear transport mechanism of Sp1 has not been well understood. In this study, we performed a gene expression study on mutant Sp1 genes causing a set of amino acid substitutions in zinc finger domains to elucidate nuclear import activity. Nuclear localization of the GFP-fused mutant Sp1 proteins bearing concomitant substitutions in the first and third zinc fingers was highly inhibited. These mutant Sp1 proteins had also lost the binding ability as to the GC box sequence. The results suggest that the overall tertiary structure formed by the three zinc fingers is essential for nuclear localization of Sp1 as well as dispersed basic amino acids within the zinc fingers region.
Factors affecting the cost and competitiveness of nuclear electricity
International Nuclear Information System (INIS)
Bertel, E.; Stevens, G.H.
1996-01-01
The general context in which are carried out the investment choices of the electric sector has evolved in a significant way during these last years and the changes are to a certain extent irreversible. Economic globalization, deregulation of the electricity market, privatisation of electricity producers, and increasing awareness of environmental issues are modifying the policy-making landscape and the criteria and priorities of decision-makers in the power sector. Competitiveness remains a cornerstone for evaluating and choosing alternative technologies in the process of planning and decision-making for electricity system expansion or power plant replacement. Nevertheless, the production costs analysis inserts factors which were not taking before into account as for instance social impacts, health and environmental effects. These new approaches better reveal the total costs of the different production means. They will certainly lead to different choices than those based on the whole comparison of direct costs supported by producers. The economic studies carried out by the Nuclear Energy Agency of the OECD (NEA) cover all the preceding aspects and give objective information on the competitiveness of nuclear electricity. The nuclear industry has today the necessary means to take up the challenges of the electricity new markets. (O.M.)
Myelodysplastic syndromes: histopathology as prognostic factor
Directory of Open Access Journals (Sweden)
Romeo Maura
2001-01-01
Full Text Available Bone marrow biopsy allows evaluation of cellularity, abnormal localization of immature precursors and fibrosis in myelodysplastic syndrome. It has been considered important to make diagnosis and prognosis of this disorder. The object of this study evaluated the influence of histopathological parameters, such as cellularity, erythroid/myeloid ratio, abnormal localization of immature precursors and marrow fibrosis, on survival of myelodysplastic syndrome patients. Forty-six patients, admitted from April 1985 to June 1998, and diagnosed as being myelodysplastic syndrome according to French-American-British criteria, were selected. There were 20 males and 26 females, with median age of 61 years. Forty-six bone marrow smears and 36 trephine biopsies were reviewed. Mean survival of hypocellular cases was 64.8 months and of hyper and normocellular cases was 31.8 months. Patients with predominance of erythroid hyperplasia had mean survival of 50.8 months, greater than those with predominance of myeloid hyperplasia (20.3 months. There was no statistical difference in survival of patients with or without abnormal localization of immature precursors and with or without marrow fibrosis. Bone marrow biopsy is a useful tool for the identification of parameters that influence prognosis in myelodysplastic syndrome. Hypocellularity and erythroid hyperplasia were correlated with longer survival while myeloid hyperplasia with poorer survival.
Basic factors to forecast maintenance cost and failure processes for nuclear power plants
International Nuclear Information System (INIS)
Popova, Elmira; Yu, Wei; Kee, Ernie; Sun, Alice; Richards, Drew; Grantom, Rick
2006-01-01
Two types of maintenance interventions are usually administered at nuclear power plants: planned and corrective. The cost incurred includes the labor (manpower) cost, cost for new parts, or emergency order of expensive items. At the plant management level there is a budgeted amount of money to be spent every year for such operations. It is very important to have a good forecast for this cost since unexpected events can trigger it to a very high level. In this research we present a statistical factor model to forecast the maintenance cost for the incoming month. One of the factors is the expected number of unplanned (due to failure) maintenance interventions. We introduce a Bayesian model for the failure rate of the equipment, which is input to the cost forecasting model. The importance of equipment reliability and prediction in the commercial nuclear power plant is presented along with applicable governmental and industry organization requirements. A detailed statistical analysis is performed on a set of maintenance cost and failure data gathered at the South Texas Project Nuclear Operating Company (STPNOC) in Bay City, Texas, USA
Orphan nuclear receptor TR4 and fibroblast growth factor 1 in metabolism
Liu, Weilin
2016-01-01
Metabolic homeostasis is achieved, in part, through the coordinated activities of members of the Nuclear Receptor (NR) family, a superfamily of ligand-modulated transcription factors (TFs) that mediate responses to a wide range of lipophilic signaling molecules including lipids, steroids, retinoids,
Modulation of Nrf2 by Olive Oil and Wine Polyphenols and Neuroprotection
Directory of Open Access Journals (Sweden)
Miriam Martínez-Huélamo
2017-09-01
Full Text Available Strong adherence to a Mediterranean diet is associated with improved cognitive function and a lower prevalence of mild cognitive impairment. Olive oil and red wine are rich sources of polyphenols which are responsible in part for the beneficial effects on cognitive functioning. Polyphenols induce endogenous antioxidant defense mechanisms by modulating transcription factors such as the nuclear factor (erythroid-derived 2-like 2 (Nrf2. This review discusses the scientific data supporting the modulating effect of olive oil and red wine polyphenols on Nrf2 expression, and the potential health benefits associated with cognitive functioning.
International Nuclear Information System (INIS)
Jiang Jianjun; Zhang Li; Wang Yiqun; Zhang Kun; Peng Yuyuan; Zhou Cheng
2012-01-01
Facing the shortcomings of the traditional cognitive factors and cognitive model, this paper presents a Bayesian networks cognitive reliability model by taking the main control room as a reference background and human factors as the key points. The model mainly analyzes the cognitive reliability affected by the human factors, and for the cognitive node and influence factors corresponding to cognitive node, a series of methods and function formulas to compute the node cognitive reliability is proposed. The model and corresponding methods can be applied to the evaluation of cognitive process for the nuclear power plant operators and have a certain significance for the prevention of safety accidents in nuclear power plants. (authors)
Human Factors Engineering Review Model for advanced nuclear power reactors
International Nuclear Information System (INIS)
O'Hara, J.; Higgins, J.; Goodman, C.; Galletti, G.: Eckenrode, R.
1993-01-01
One of the major issues to emerge from the initial design reviews under the certification process was that detailed human-systems interface (HSI) design information was not available for staff review. To address the lack of design detail issue. The Nuclear Regulatory Commission (NRC) is performing the design certification reviews based on a design process plan which describes the human factors engineering (HFE) program elements that are necessary and sufficient to develop an acceptable detailed design specification. Since the review of a design process is unprecedented in the nuclear industry. The criteria for review are not addressed by current regulations or guidance documents and. therefore, had to be developed. Thus, an HFE Program Review Model was developed. This paper will describe the model's rationale, scope, objectives, development, general characteristics. and application
International Nuclear Information System (INIS)
Song Chenning; Hou Gangling; Zhou Guoliang
2014-01-01
Ultimate compressive bearing capacity, influenced factors and its rules of nuclear RC containment are key problems of safety assessment, accident treatment and structure design, etc. Ultimate compressive bearing capacity of nuclear RC containment is shown by concrete damaged plasticity model and steel double liner model of ABAQUS. The study shows that the concrete of nuclear RC containment cylinder wall becomes plastic when the internal pressure is up to 0.87 MPa, the maximum tensile strain of steel liner exceeds 3000 × 10 6 and nuclear RC containment reaches ultimate status when the internal pressure is up to 1.02 MPa. The result shows that nuclear RC containment is in elastic condition under the design internal pressure and the bearing capacity meets requirement. Prestress and steel liner play key parts in the ultimate internal pressure and failure mode of nuclear RC containment. The study results have value for the analysis of ultimate compressive bearing capacity, structure design and safety assessment. (authors)
International Nuclear Information System (INIS)
Seminara, J.L.; Parsons, S.O.
1979-11-01
An earlier review of the control rooms of operating nuclear power plants identified many design problems having potential for degrading operator performance. As a result, the formal application of human factors principles was found to be needed. This report demonstrates the use of human factors in the design of power plant control rooms. The approaches shown in the report can be applied to operating power plants, as well as to those in the design stage. This study documents human factors techniques required to provide a sustained concern for the man-machine interface from control room concept definition to system implementation
Key Response Planning Factors for the Aftermath of Nuclear Terrorism
Energy Technology Data Exchange (ETDEWEB)
Buddemeier, B R; Dillon, M B
2009-01-21
Despite hundreds of above-ground nuclear tests and data gathered from Hiroshima and Nagasaki, the effects of a ground-level, low-yield nuclear detonation in a modern urban environment are still the subject of considerable scientific debate. Extensive review of nuclear weapon effects studies and discussions with nuclear weapon effects experts from various federal agencies, national laboratories, and technical organizations have identified key issues and bounded some of the unknowns required to support response planning for a low-yield, ground-level nuclear detonation in a modern U.S. city. This study, which is focused primarily upon the hazards posed by radioactive fallout, used detailed fallout predictions from the advanced suite of three-dimensional (3-D) meteorology and plume/fallout models developed at Lawrence Livermore National Laboratory (LLNL), including extensive global Key Response Planning Factors for the Aftermath of Nuclear Terrorism geographical and real-time meteorological databases to support model calculations. This 3-D modeling system provides detailed simulations that account for complex meteorology and terrain effects. The results of initial modeling and analysis were presented to federal, state, and local working groups to obtain critical, broad-based review and feedback on strategy and messaging. This effort involved a diverse set of communities, including New York City, National Capitol Regions, Charlotte, Houston, Portland, and Los Angeles. The largest potential for reducing casualties during the post-detonation response phase comes from reducing exposure to fallout radiation. This can be accomplished through early, adequate sheltering followed by informed, delayed evacuation.B The response challenges to a nuclear detonation must be solved through multiple approaches of public education, planning, and rapid response actions. Because the successful response will require extensive coordination of a large number of organizations, supplemented by
Human factors review of nuclear power plant control room design. Summary report
International Nuclear Information System (INIS)
Seminara, J.L.; Gonzalez, W.R.; Parsons, S.O.
1976-11-01
Human factors engineering is an interdisciplinary specialty concerned with influencing the design of equipment systems, facilities, and operational environments to promote safe, efficient, and reliable operator performance. The human factors aspects of five representative nuclear power plant control rooms were evaluated using such methods as a checklist-guided observation system, structured interviews with operators and trainers, direct observations of operator behavior, task analyses and procedure evaluation, and historical error analyses. The human factors aspects of design practices are illustrated, and many improvements in current practices are suggested. The study recommends that a detailed set of applicable human factors standards be developed to stimulate a uniform and systematic concern for human factors in design considerations
Human factor as nuclear safety element
International Nuclear Information System (INIS)
Valeca, S.C.; Preda, M.; Valeca, M.; Ana, E. M.; Popescu, D.
2008-01-01
National nuclear power system is based on western technology, it covers almost 20% from national need and could be briefly described by: - Safety and economic performances of Cernavoda NPP Unit 1; - Reduced influence on environment, population and workers; - Excellent ranking (place 4) among CANDU units from all over the world. Also, the national nuclear power system plays a major role in Romanian power policy accomplishment: - Energy safety and independence assurance; - Decrease of production of greenhouse effect gases; - Preserve the stability and adequacy of energy cost. 'Nuclear Safety' concept covers all the activities resulting from nuclear fuel cycle. By taking into account the international experience, the related activities are estimated to last around 70 years in Romania: - 10 years for site description and selection, design, manufacturing and commissioning activities; - 40 years for Nuclear Power Plant operation, maintenance and modernization activities; - 20 years for preservation and decommissioning activities. The above mentioned activities requires human resources, qualified and specialized in the following areas: - research and development; - equipment design, manufacturing and operation; - components construction and assembly, operation and maintenance. (authors)
FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia
International Nuclear Information System (INIS)
Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K
2011-01-01
The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6
International Nuclear Information System (INIS)
Thonneau, P.F.; Rachou, E.; Ducot, B.; Multigner, L.; Velez de la Calle, J.P.; Le Martelot, M.T.
1998-01-01
Very few studies have investigated the possible effects of environmental radiation and heat exposure on male reproductive function. We conducted a case control study to evaluate the various infertility risk factors in the military population of the french town of Brest to investigate an apparently high incidence of infertility in couples in which the man may have been exposed to occupational nuclear radiation. These findings suggest that in addition to well known medical factors, 'potential' exposure to heat or nuclear radiation could also be risk factors for infertility. (N.C.)
Lee, Myoung-Jae; Jung, Young-Dae
2017-01-01
The quantum shielding effects on the nuclear fusion reaction process are investigated in quantum plasmas. The closed expression of the classical turning point for the Gamow penetration factor in quantum plasmas is obtained by the Lambert W-function. The closed expressions of the Gamow penetration factor and the cross section for the nuclear fusion reaction in quantum plasmas are obtained as functions of the plasmon energy and the relative kinetic energy by using the effective interaction potential with the WKB analysis. It is shown that the influence of quantum screening suppresses the Sommerfeld reaction factor. It is also shown that the Gamow penetration factor increases with an increase of the plasmon energy. It is also shown that the quantum shielding effect enhances the deuterium formation by the proton-proton reaction in quantum plasmas. In addition, it is found that the energy dependences on the reaction cross section and the Gamow penetration factor are more significant in high plasmon-energy domains.
Nrf2 and Redox Status in Prediabetic and Diabetic Patients
Directory of Open Access Journals (Sweden)
Angélica S. Jiménez-Osorio
2014-11-01
Full Text Available The redox status associated with nuclear factor erythroid 2-related factor-2 (Nrf2 was evaluated in prediabetic and diabetic subjects. Total antioxidant status (TAS in plasma and erythrocytes, glutathione (GSH and malondialdehyde (MDA content and activity of antioxidant enzymes were measured as redox status markers in 259 controls, 111 prediabetics and 186 diabetic type 2 subjects. Nrf2 was measured in nuclear extract fractions from peripheral blood mononuclear cells (PBMC. Nrf2 levels were lower in prediabetic and diabetic patients. TAS, GSH and activity of glutamate cysteine ligase were lower in diabetic subjects. An increase of MDA and superoxide dismutase activity was found in diabetic subjects. These results suggest that low levels of Nrf2 are involved in the development of oxidative stress and redox status disbalance in diabetic patients.
International Nuclear Information System (INIS)
Brenk, H.D.; Vogt, K.J.
1977-01-01
An evaluation of the environmental impact of nuclear plants according to paragraph 45 of the Radiation Protection Directive of the Federal Republic of Germany requires the calculation of dose conversion factors indicating the correlation between the contaminated medium and individual radiation exposure. The present study is to be conceived as a contribution to discussion on this subject. For the determination of radiation exposure caused by the waste air of nuclear plants, models are being specified for computing the dose conversion factors for the external exposure pathways of β-submersion, γ-submersion and γ-radiation from contaminated ground as well as the internal exposure pathways of inhalation and ingestion, which further elaborate and improve the models previously applied, especially as far as the ingestion pathway is concerned, which distinguishes between 6 major food categories. The computer models are applied to those radionuclides which are significan for nuclear emitters, in particular nuclear light-water power stations. The results obtained for the individual exposure pathways and affected organs are specified in the form of tables. For this purpose, calculations were first of all carried out for the so-called 'reference man'. The results can be transferred to population groups with different consumption habits (e.g. vegetarians) by the application of correction factors. The models are capable of being extended with a view to covering other age groups. (orig.) [de
Research and development on the human factors technologies for nuclear power plants in Korea
International Nuclear Information System (INIS)
Sim, B.S.; Lee, J.W.; Cheon, S.W.
1996-01-01
This paper introduces our research project on the development of human factors technologies for nuclear power plants in Korea. The project is divided into two sub-projects. The first sub-project is the development of human factors experimental evaluation techniques, which aims to develop the techniques for experimental design, experimental measurement and data collection/analysis, and to construct an integrated test facility (ITF) suitable for the experimental evaluation of man-machine interfaces (MMIs) at an advanced control room. The second is the development of human behavior analysis techniques, which has two research areas: one is the development of a task simulation analyzer and the other is human error case studies for nuclear power plants. (author)
DEFF Research Database (Denmark)
Schiødt, I; Jensen, Charlotte Harken; Kjaersgaard, E
2000-01-01
In order to improve prediction of hematopoietic recovery, we conducted a pilot study, analyzing the significance of growth factor receptor expression in autografts as well as endogenous growth factor levels in blood before, during and after stem cell transplantation. Three early acting (stem cell......-CSF receptor positive, CD34+ progenitor cells were measured by flow cytometry in the leukapheresis product used for transplantation in a subgroup of 15 patients (NHL, n = 8, MM, n = 7). Three factors were identified as having a significant impact on platelet recovery. First, the level of Tpo in blood...... at the time of the nadir (day +7). Second, the percentage of re-infused thrombopoietin receptor positive progenitors and finally, the percentage of Flt3 receptor positive progenitors. On the other hand, none of the analyzed factors significantly predicted myeloid or erythroid recovery. These findings need...
Factors relevant to the sealing of nuclear facilities
International Nuclear Information System (INIS)
1991-05-01
This report reviews and summaries the factors to be considered in the design, construction and surveillance of confinement structures for damaged nuclear facilities. General engineering, design and environmental considerations are included, both from the standpoint of the mitigation of near-term effects by virtue of interim confinement, and from the standpoint of the acceptability of the structure for long-term confinement. Factors which influence optimization of the design and the construction sequence are reviewed, including the nature of the accident, natural conditions of the site, and thermal and radiation effects. Safety criteria are presented from the standpoint of regulatory requirements, radiological consequences, and monitoring/surveillance requirements for both interim and long-term confinement. Methodologies related to concrete fabrication technology and other construction techniques appropriate for building confinement structures are discussed. Long-term considerations relative to the future of the site for in-place storage/disposal of the waste, and possible future reuse of the site are also included
Tohidnezhad, Mersedeh; Wruck, Christoph-Jan; Slowik, Alexander; Kweider, Nisreen; Beckmann, Rainer; Bayer, Andreas; Houben, Astrid; Brandenburg, Lars-Ove; Varoga, Deike; Sönmez, Tolga-Taha; Stoffel, Marcus; Jahr, Holger; Lippross, Sebastian; Pufe, Thomas
2014-08-01
Oxidative stress can impair fracture healing. To protect against oxidative damage, a system of detoxifying and antioxidative enzymes works to reduce the cellular stress. The transcription of these enzymes is regulated by antioxidant response element (ARE). The nuclear factor (erythroid-derived 2)-like2 (Nrf2) plays a major role in transcriptional activation of ARE-driven genes. Recently it has been shown that vascular endothelial growth factor (VEGF) prevents oxidative damage via activation of the Nrf2 pathway in vitro. Platelet-released growth factor (PRGF) is a mixture of autologous proteins and growth factors, prepared from a determined volume of platelet-rich plasma (PRP). It has already used to enhance fracture healing in vitro. The aim of the present study was to elucidate if platelets can lead to upregulation of VEGF and if platelets can regulate the activity of Nrf2-ARE system in primary human osteoblast (hOB) and in osteoblast-like cell line (SAOS-2). Platelets and PRGF were obtained from healthy human donors. HOB and SAOS-2 osteosarcoma cell line were used. The ARE activity was analysed using a dual luciferase reporter assay system. We used Western blot to detect the nuclear accumulation of Nrf2 and the amount of cytosolic antioxidant Thioredoxin Reductase-1 (TXNRD-1), Heme Oxygenase-1 (HO-1) and NAD(P)H quinine oxidoreductase-1 (NQO1). Gene expression analysis was performed by real-time RT PCR. ELISA was used for the quantification of growth factors. The activity of ARE was increased in the presence of PRGF up to 50%. Western blotting demonstrated enhanced nuclear accumulation of Nrf2. This was followed by an increase in the protein expression of the aforementioned downstream targets of Nrf2. Real-time RT PCR data showed an upregulation in the gene expression of the VEGF after PRGF treatment. This was confirmed by ELISA, where the treatment with PRGF induced the protein level of VEGF in both cells. These results provide a new insight into PRGF's mode of
Directory of Open Access Journals (Sweden)
Allen C T Teng
Full Text Available Interferon regulatory factor 2 binding protein 2 (IRF2BP2 is a muscle-enriched transcription factor required to activate vascular endothelial growth factor-A (VEGFA expression in muscle. IRF2BP2 is found in the nucleus of cardiac and skeletal muscle cells. During the process of skeletal muscle differentiation, some IRF2BP2 becomes relocated to the cytoplasm, although the functional significance of this relocation and the mechanisms that control nucleocytoplasmic localization of IRF2BP2 are not yet known.Here, by fusing IRF2BP2 to green fluorescent protein and testing a series of deletion and site-directed mutagenesis constructs, we mapped the nuclear localization signal (NLS to an evolutionarily conserved sequence (354ARKRKPSP(361 in IRF2BP2. This sequence corresponds to a classical nuclear localization motif bearing positively charged arginine and lysine residues. Substitution of arginine and lysine with negatively charged aspartic acid residues blocked nuclear localization. However, these residues were not sufficient because nuclear targeting of IRF2BP2 also required phosphorylation of serine 360 (S360. Many large-scale phosphopeptide proteomic studies had reported previously that serine 360 of IRF2BP2 is phosphorylated in numerous human cell types. Alanine substitution at this site abolished IRF2BP2 nuclear localization in C(2C(12 myoblasts and CV1 cells. In contrast, substituting serine 360 with aspartic acid forced nuclear retention and prevented cytoplasmic redistribution in differentiated C(2C(12 muscle cells. As for the effects of these mutations on VEGFA promoter activity, the S360A mutation interfered with VEGFA activation, as expected. Surprisingly, the S360D mutation also interfered with VEGFA activation, suggesting that this mutation, while enforcing nuclear entry, may disrupt an essential activation function of IRF2BP2.Nuclear localization of IRF2BP2 depends on phosphorylation near a conserved NLS. Changes in phosphorylation status
IRSN-ANCCLI partnership. Organizational and human factors in nuclear safety - April 2014
International Nuclear Information System (INIS)
Jeffroy, Francois; Garron, Joel; Mercel, Philippe; Compagnat, Gilles; Gaucher, Eric; Gaillard, Pierre; Fanchini, Henri; Jacquemont, Vincent
2013-06-01
The contributions (Power Point presentations) of this seminar first address the history of the taking into account of organizational and human factors until the Fukushima accident (history of their taking into account in nuclear safety expertise in France, history of the development of policy of organizational and human factors by an operator). The next contributions discuss the main issues regarding these factors after Fukushima: report by a work-group, work performed by the the Comite d'Orientation sur les Facteurs Sociaux, Organisationnels et Humains (Committee of orientation on social, organizational and human factors). The third session addresses the implication of stakeholders in expertise on these factors: analysis of organizational and human factors by a local information commission or by a CHSCT (committee of hygiene, safety and working conditions)
Energy Technology Data Exchange (ETDEWEB)
German, S.; Silla, I.; Navajas, J.
2014-07-01
Previous research supports the importance of organizational factors on safety in high reliability organizations. This study aims to determine the impact of those factors in the Spanish nuclear sector. Particularly, this study focuses on examining the role of performance indicators, organizational culture, organizational factors, and organizational context. With that purpose, an electronic survey addressed to experts from the Spanish nuclear sector was carried out. Results showed that performance indicators are well-known among industry experts and are perceived as useful for improving performance. Behavioural norms that influence safety and some relevant factors that promote problem identification were identified. Additionally, findings suggested that organizational context must be taken into account to better understand the role of organizational culture. Moreover, industry experts pointed out organizational factors to be improved: organizational communication processes within the organization, positive reinforcement, and field supervisors practices. Finally, findings supported the influence of organizational context on safety. It is noteworthy the role of the social impact of international events (e.g., Chernobyl...), the relationship with the regulator and the legislative and governmental framework. (Author)
Transcriptional control of megakaryocyte development.
Goldfarb, A N
2007-10-15
Megakaryocytes are highly specialized cells that arise from a bipotent megakaryocytic-erythroid progenitor (MEP). This developmental leap requires coordinated activation of megakaryocyte-specific genes, radical changes in cell cycle properties, and active prevention of erythroid differentiation. These programs result from upregulation of megakaryocyte-selective transcription factors, downregulation of erythroid-selective transcription factors and ongoing mediation of common erythro-megakaryocytic transcription factors. Unlike most developmental programs, no single lineage-unique family of master regulators exerts executive control over the megakaryocytic plan. Rather, an assemblage of non-unique factors and signals converge to determine lineage and differentiation. In human megakaryopoiesis, hereditary disorders of platelet production have confirmed contributions from three distinct transcription factor families. Murine models have extended this repertoire to include multiple additional factors. At a mechanistic level, the means by which these non-unique factors collaborate in the establishment of a perfectly unique cell type remains a central question.
International Nuclear Information System (INIS)
2009-01-01
Nuclear power plant modifications may be needed for a number of different reasons. These include physical ageing of plant systems, structures and components; obsolescence in hardware and software; feedback from operating experience; and opportunities for improved plant safety, reliability or capability. However, experience has also shown that weaknesses in the design and/or implementation of modifications can present significant challenges to plant safety. They can also have a considerable impact on the commercial performance of the plant. It is therefore important that the plant modification process reflect a recognition of the potential impact of human errors and that it incorporate suitable measures to minimise the potential for such errors. In this context, the NEA Committee on the Safety of Nuclear Installations (CSNI) and its Working Group on Human and Organisational Factors organised an international workshop in 2003 to discuss the role of human and organisational performance in the nuclear plant modification process. This technical opinion paper represents the consensus of specialists in human and organisational factors (HOF) in the NEA member countries on commendable practices and approaches to dealing with nuclear plant modifications. It considers factors that should be taken into account when developing a modification process and identifies some lessons learnt from application of the process. The paper should be of particular interest of nuclear safety regulators and nuclear power plant operators. (author)
Directory of Open Access Journals (Sweden)
Kai-Hsin Chang
2011-01-01
Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.
The need and direction of a human factors research program for the nuclear power industry
International Nuclear Information System (INIS)
Blackman, H.S.; Meyer, O.R.; Nelson, W.R.
1986-01-01
It is axiomatic that the need for a human factors program in the nuclear power industry must be based upon an examination of the process of nuclear energy production and the role that the human plays in this process. It has been pointed out by others that a large number of incidents in technology based industries can be attributed to human error, thereby demonstrating the need to understand the human in interacting with complex processes. But an emphasis upon human ''error'' is a negative approach and can be non-productive, particularly when the ''correct'' human action has not been clearly defined prior to the incident. Some industries have expended great resources in a positive attempt to maximize the performance of the human in critical roles, e.g., the man-in-space program, the commercial airlines industry, deep-sea exploration. Central to this issue of human factors in nuclear power is the question of the role that the human plays in reducing the risk of the total system. If, as in other areas of application, the nuclear industry can make substantial improvements in the performance of humans, one needs to know how much risk is really reduced
Lifescience Database Archive (English)
Full Text Available 17349209 Nuclear factor-kappaB: activation and regulation during toll-like receptorsignaling. Carmody...uclear factor-kappaB: activation and regulation during toll-like receptorsignaling. Authors Carmody
A preliminary study on related factors of mental health in nuclear power plant operators
International Nuclear Information System (INIS)
Dai Tingting; Liu Yulong; Li Yuan; Liao Haihong; Qiu Mengyue; Bian Huahui; Chen Weibo; Liu Chunfeng
2012-01-01
Objective: To explore the status of nuclear power plant operators in mental health and its correlation with emotional stability, liveliness, anxiety and urgency. Methods: 255 male operators were randomly selected from three nuclear power bases, meanwhile 61 undergraduates were used as control group. The mental health and neurobehavioral evaluation system of Chinese nuclear power plant operators was developed by Second Affiliated Hospital of Soochow University, which was used to assess mental health of the subjects. The scores of mental health personality factors were recorded, together with four main personality factors including emotional stability, liveliness, anxiety and urgency. Results: The score of lie was lower than 8 which showed all inspected groups were normal. 1.57% (4/255) operators had psychological disorders, 3.92% (10/255) had poor mental health, 27.84% (71/255) had general mental health, 66.7% (170/255) had excellent mental health, whereas 9.84% (6/61) for control group had psychological disorders. Obvious difference was observed in the final scores between the nuclear power plant operators and control group. The former gained higher scores on mental health,emotional stability,and lower scores on anxiety and urgency (t=3.437, 4.423, -2.493, -2.093, P<0.05). Both groups aged over 27 years and with length of service over 5 years were awarded higher scores on mental health, emotional stability (t=2.585, 2.349; t=2.606, 2.947, P<0.05), lower scores on anxiety and urgency (t=-3.407, -2.138; t=- 2.941, -2.256, P<0.05). The mental health was positively correlated with emotional stability and liveliness (r=0.721, 0.650, P<0.05), but negatively correlated with anxiety and urgency (r=-0.809, -0.693, P<0.05). Conclusions: The majority of nuclear power plant operators had excellent psychological quality, but some factors should be paid more attention, such as different ages and length of service time. (authors)
Development of safety factors to be used for evaluation of cracked nuclear components
International Nuclear Information System (INIS)
Brickstad, B.; Bergman, M.
1996-10-01
A modified concept for safety evaluation is introduced which separately accounts for the failure mechanisms fracture and plastic collapse. For application on nuclear components a set of safety factors are also proposed that retain the safety margins expressed in ASME, section III and XI. By performing comparative studies of the acceptance levels for surface cracks in pipes and a pressure vessel, it is shown that some of the anomalies connected with the old safety procedures are removed. It is the authors belief that the outlined safety evaluation procedure has the capability of treating cracks in a consistent way and that the procedure together with the proposed safety factors fulfill the basic safety requirements for nuclear components. Hopefully, it is possible in the near future to develop a probabilistic safety assessment procedure in Sweden, which enables a systematic treatment of uncertainties in the involved data. 14 refs
Directory of Open Access Journals (Sweden)
Ken Shirato
2018-01-01
Full Text Available Ultraviolet (UV irradiation induces proinflammatory responses in skin cells, including dermal fibroblasts, accelerating premature skin aging (photoaging. ETAS 50, a standardized extract from the Asparagus officinalis stem, is a novel and unique functional food that suppresses proinflammatory responses of hydrogen peroxide-stimulated skin fibroblasts and interleukin- (IL- 1β-stimulated hepatocytes. To elucidate its antiphotoaging potencies, we examined whether ETAS 50 treatment after UV-B irradiation attenuates proinflammatory responses of normal human dermal fibroblasts (NHDFs. UV-B-irradiated NHDFs showed reduced levels of the cytosolic inhibitor of nuclear factor-κB α (IκBα protein and increased levels of nuclear p65 protein. The nuclear factor-κB nuclear translocation inhibitor JSH-23 abolished UV-B irradiation-induced IL-1β mRNA expression, indicating that p65 regulates transcriptional induction. ETAS 50 also markedly suppressed UV-B irradiation-induced increases in IL-1β mRNA levels. Immunofluorescence analysis revealed that ETAS 50 retained p65 in the cytosol after UV-B irradiation. Western blotting also showed that ETAS 50 suppressed the UV-B irradiation-induced increases in nuclear p65 protein. Moreover, ETAS 50 clearly suppressed UV-B irradiation-induced distribution of importin-α protein levels in the nucleus without recovering cytosolic IκBα protein levels. These results suggest that ETAS 50 exerts anti-inflammatory effects on UV-B-irradiated NHDFs by suppressing the nuclear import machinery of p65. Therefore, ETAS 50 may prevent photoaging by suppressing UV irradiation-induced proinflammatory responses of dermal fibroblasts.
International Nuclear Information System (INIS)
Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.
1987-01-01
To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)
Prescribing safety, negotiating expertise. Building of nuclear safety human factors expertise
International Nuclear Information System (INIS)
Rolina, Gregory
2008-01-01
This Ph.D thesis is dedicated to a specific type of expertise, the safety of nuclear installations in the field of human and organisational factors. Empirical work is at the foundation of this thesis: the monitoring of experts 'in action', allowed a detailed reconstruction of three cases they were examining. The analysis, at the core of which lies the definition of what an efficient expertise can be, emphasizes the incompleteness of the knowledge that links together the nuclear facilities' organisational characteristics and their safety. This leads us to identify the expert's three ranges of actions (rhetorical, cognitive, operative). Defined from objectives and constraints likely to influence the expert's behaviour, those three ranges each require specific skills. A conception of expertise based on these ranges seems adaptable to other sectors and allows an enrichment of models of expertise cited in literature. Historical elements from French institutions of nuclear safety are also called upon to take into consideration some of the determinants of the expertise; its efficiency relies on the upholding of a continuous dialogue between the regulators (the experts and the control authority) and the regulated (the operators). This type of historically inherited regulation makes up a specificity of the French system of external control of nuclear risks. (author) [fr
International Nuclear Information System (INIS)
Kim, Dae-Ho; Lee, Yong-Hee; Lee, Jung-Woon
2008-01-01
The purpose of this study is to assess the organizational types and the job stress factors that affect procedure-based job performances in nuclear power plants. We derived 24 organizational factors affecting job stress level in nuclear power plants from the job stress analysis models developed by NIOSH, JDI, and IOR. Considering the safety characteristics in the operating tasks of nuclear power plants, we identified the job contents and characteristics through the analyses of job assignments that appeared in the organizational chart and the results of an activity-based costing. By using questionnaire surveys and structured interviews with the plant personnel and expert panels, we assessed 70 jobs among the 777 jobs managed officially in accordance with the procedures. They consist of the representative jobs of each department and are directly related to safety. We utilized the organizational personality type indicators to characterize the personality types of each organization in nuclear power plants. (author)
Effects of different ligands on epidermal growth factor receptor (EGFR) nuclear translocation
International Nuclear Information System (INIS)
Faria, Jerusa A.Q.A.; Andrade, Carolina de; Goes, Alfredo M.; Rodrigues, Michele A.; Gomes, Dawidson A.
2016-01-01
The epidermal growth factor receptor (EGFR) is activated through binding to specific ligands and generates signals for proliferation, differentiation, migration, and cell survival. Recent data show the role of nuclear EGFR in tumors. Although many EGFR ligands are upregulated in cancers, little is known about their effects on EGFR nuclear translocation. We have compared the effects of six EGFR ligands (EGF, HB-EGF, TGF-α, β-Cellulin, amphiregulin, and epiregulin) on nuclear translocation of EGFR, receptor phosphorylation, migration, and proliferation. Cell fractionation and confocal immunofluorescence detected EGFR in the nucleus after EGF, HB-EGF, TGF-α and β-Cellulin stimulation in a dose-dependent manner. In contrast, amphiregulin and epiregulin did not generate nuclear translocation of EGFR. EGF, HB-EGF, TGF-α and β-Cellulin showed correlations between a higher rate of wound closure and increased phosphorylation of residues in the carboxy-terminus of EGFR, compared to amphiregulin and epiregulin. The data indicate that EGFR is translocated to the nucleus after stimulation with EGF, HB-EGF, TGF-α and β-Cellulin, and that these ligands are related to increased phosphorylation of EGFR tyrosine residues, inducing migration of SkHep-1 cells. - Highlights: • EGF, HB-EGF, TGF-α, β-Cellulin are involved in the EGFR nuclear translocation. • Amphiregulin and epiregulin did not promote nuclear translocation of EGFR. • EGF, HB-EGF, TGF-α and β-Cellulin have a role in SkHep-1 cells migration. • EGFR ligands associated with better prognosis don't stimulate EGFR translocation.
Effects of different ligands on epidermal growth factor receptor (EGFR) nuclear translocation
Energy Technology Data Exchange (ETDEWEB)
Faria, Jerusa A.Q.A.; Andrade, Carolina de; Goes, Alfredo M. [Department of Biochemistry and Immunology, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, Belo Horizonte, MG, 31270-901 (Brazil); Rodrigues, Michele A. [Department of Biochemistry and Immunology, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, Belo Horizonte, MG, 31270-901 (Brazil); Department of General Pathology, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, Belo Horizonte, MG, 31270-901 (Brazil); Gomes, Dawidson A., E-mail: dawidson@ufmg.br [Department of Biochemistry and Immunology, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, Belo Horizonte, MG, 31270-901 (Brazil)
2016-09-09
The epidermal growth factor receptor (EGFR) is activated through binding to specific ligands and generates signals for proliferation, differentiation, migration, and cell survival. Recent data show the role of nuclear EGFR in tumors. Although many EGFR ligands are upregulated in cancers, little is known about their effects on EGFR nuclear translocation. We have compared the effects of six EGFR ligands (EGF, HB-EGF, TGF-α, β-Cellulin, amphiregulin, and epiregulin) on nuclear translocation of EGFR, receptor phosphorylation, migration, and proliferation. Cell fractionation and confocal immunofluorescence detected EGFR in the nucleus after EGF, HB-EGF, TGF-α and β-Cellulin stimulation in a dose-dependent manner. In contrast, amphiregulin and epiregulin did not generate nuclear translocation of EGFR. EGF, HB-EGF, TGF-α and β-Cellulin showed correlations between a higher rate of wound closure and increased phosphorylation of residues in the carboxy-terminus of EGFR, compared to amphiregulin and epiregulin. The data indicate that EGFR is translocated to the nucleus after stimulation with EGF, HB-EGF, TGF-α and β-Cellulin, and that these ligands are related to increased phosphorylation of EGFR tyrosine residues, inducing migration of SkHep-1 cells. - Highlights: • EGF, HB-EGF, TGF-α, β-Cellulin are involved in the EGFR nuclear translocation. • Amphiregulin and epiregulin did not promote nuclear translocation of EGFR. • EGF, HB-EGF, TGF-α and β-Cellulin have a role in SkHep-1 cells migration. • EGFR ligands associated with better prognosis don't stimulate EGFR translocation.
International Nuclear Information System (INIS)
Wang Liu; Zheng Aihua; Yi Ling; Xu Chongren; Ding Mingxiao; Deng Hongkui
2004-01-01
Nuclear reprogramming is critical for animal cloning and stem cell creation through nuclear transfer, which requires extensive remodeling of chromosomal architecture involving dramatic changes in chromatin-binding proteins. To understand the mechanism of nuclear reprogramming, it is critical to identify chromatin-binding factors specify the reprogramming process. In this report, we have developed a high-throughput selection method, based on T7 phage display and chromatin immunoprecipitation, to isolate chromatin-binding factors expressed in mouse embryonic stem cells using primary mouse embryonic fibroblast chromatin. Seven chromatin-binding proteins have been isolated by this method. We have also isolated several chromatin-binding proteins involved in hepatocyte differentiation. Our method provides a powerful tool to rapidly and selectively identify chromatin-binding proteins. The method can be used to study epigenetic modification of chromatin during nuclear reprogramming, cell differentiation, and transdifferentiation
The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.
Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A
2010-10-28
Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.
Energy Technology Data Exchange (ETDEWEB)
Brett W Carlsen; Brent W Dixon; Urairisa Pathanapirom; Eric Schneider; Bethany L. Smith; Timothy M. AUlt; Allen G. Croff; Steven L. Krahn
2013-08-01
The Department of Energy Office of Nuclear Energy’s Fuel Cycle Technologies program is preparing to evaluate several proposed nuclear fuel cycle options to help guide and prioritize Fuel Cycle Technology research and development. Metrics are being developed to assess performance against nine evaluation criteria that will be used to assess relevant impacts resulting from all phases of the fuel cycle. This report focuses on four specific environmental metrics. • land use • water use • CO2 emissions • radiological Dose to workers Impacts associated with the processes in the front-end of the nuclear fuel cycle, mining through enrichment and deconversion of DUF6 are summarized from FCRD-FCO-2012-000124, Revision 1. Impact estimates are developed within this report for the remaining phases of the nuclear fuel cycle. These phases include fuel fabrication, reactor construction and operations, fuel reprocessing, and storage, transport, and disposal of associated used fuel and radioactive wastes. Impact estimates for each of the phases of the nuclear fuel cycle are given as impact factors normalized per unit process throughput or output. These impact factors can then be re-scaled against the appropriate mass flows to provide estimates for a wide range of potential fuel cycles. A companion report, FCRD-FCO-2013-000213, applies the impact factors to estimate and provide a comparative evaluation of 40 fuel cycles under consideration relative to these four environmental metrics.
International Nuclear Information System (INIS)
Vasconcelos, Vanderley de; Silva, Eliane Magalhaes Pereira da; Costa, Antonio Carlos Lopes da; Reis, Sergio Carneiro dos
2009-01-01
Nuclear energy has an important engineering legacy to share with the conventional industry. Much of the development of the tools related to safety, reliability, risk management, and human factors are associated with nuclear plant processes, mainly because the public concern about nuclear power generation. Despite the close association between these subjects, there are some important different approaches. The reliability engineering approach uses several techniques to minimize the component failures that cause the failure of the complex systems. These techniques include, for instance, redundancy, diversity, standby sparing, safety factors, and reliability centered maintenance. On the other hand system safety is primarily concerned with hazard management, that is, the identification, evaluation and control of hazards. Rather than just look at failure rates or engineering strengths, system safety would examine the interactions among system components. The events that cause accidents may be complex combinations of component failures, faulty maintenance, design errors, human actions, or actuation of instrumentation and control. Then, system safety deals with a broader spectrum of risk management, including: ergonomics, legal requirements, quality control, public acceptance, political considerations, and many other non-technical influences. Taking care of these subjects individually can compromise the completeness of the analysis and the measures associated with both risk reduction, and safety and reliability increasing. Analyzing together the engineering systems and controls of a nuclear facility, their management systems and operational procedures, and the human factors engineering, many benefits can be realized. This paper proposes an integration of these issues based on the application of systems theory. (author)
Energy Technology Data Exchange (ETDEWEB)
Vasconcelos, Vanderley de; Silva, Eliane Magalhaes Pereira da; Costa, Antonio Carlos Lopes da; Reis, Sergio Carneiro dos [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: vasconv@cdtn.br, e-mail: silvaem@cdtn.br, e-mail: aclc@cdtn.br, e-mail: reissc@cdtn.br
2009-07-01
Nuclear energy has an important engineering legacy to share with the conventional industry. Much of the development of the tools related to safety, reliability, risk management, and human factors are associated with nuclear plant processes, mainly because the public concern about nuclear power generation. Despite the close association between these subjects, there are some important different approaches. The reliability engineering approach uses several techniques to minimize the component failures that cause the failure of the complex systems. These techniques include, for instance, redundancy, diversity, standby sparing, safety factors, and reliability centered maintenance. On the other hand system safety is primarily concerned with hazard management, that is, the identification, evaluation and control of hazards. Rather than just look at failure rates or engineering strengths, system safety would examine the interactions among system components. The events that cause accidents may be complex combinations of component failures, faulty maintenance, design errors, human actions, or actuation of instrumentation and control. Then, system safety deals with a broader spectrum of risk management, including: ergonomics, legal requirements, quality control, public acceptance, political considerations, and many other non-technical influences. Taking care of these subjects individually can compromise the completeness of the analysis and the measures associated with both risk reduction, and safety and reliability increasing. Analyzing together the engineering systems and controls of a nuclear facility, their management systems and operational procedures, and the human factors engineering, many benefits can be realized. This paper proposes an integration of these issues based on the application of systems theory. (author)
The Regulatory Role of Nuclear Factor Kappa B in the Heart of Hereditary Hypertriglyceridemic Rat
Czech Academy of Sciences Publication Activity Database
Vranková, S.; Barta, A.; Klimentová, J.; Dovinová, I.; Líšková, Silvia; Dobešová, Zdenka; Pecháňová, O.; Kuneš, Jaroslav; Zicha, Josef
2016-01-01
Roč. 2016, č. 2016 (2016), s. 9814038 ISSN 1942-0900 R&D Projects: GA MZd(CZ) NV15-25396A Institutional support: RVO:67985823 Keywords : nuclear factor-kB * nitric oxide * reactive oxygen species * heart * hereditary hypertriglyceridemic rats Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery Impact factor: 4.593, year: 2016
Human factors in nuclear power plants
International Nuclear Information System (INIS)
Bohr, E.; Hennig, J.; Preuss, W.; Thau, G.
1977-01-01
This report describes the results of a study on the functions of operating and maintenance personnel in nuclear power plants. Since an effective power plant design must take into systematic account the possibilities and limitations of the human element, the basic aim of the study was to identify what the human operators are required to do and how they achieve it. Information was acquired by direct observation and by interviews as well as by evaluation of written documents (e.g. incident reports, procedures manuals, work regulations) and of working conditions (e.g. equipment and workplace design). A literature search and evaluation carried out within the scope of this study has been published as a separate document. The main part of the report is devoted to discussions and conclusions on selected areas of potential improvements. The topics include control room design, factors of the physical environment including radiation, problems of maintainability, design of written documents, problems in communicating information, design and control of tasks, placement and training. A separate section deals with problems of recording human errors. (orig.) [de
Nuclear accidents and safety measures of domestic nuclear power plants
International Nuclear Information System (INIS)
Song Zurong; Che Shuwei; Pan Xiang
2012-01-01
Based on the design standards for the safety of nuclear and radiation in nuclear power plants, the three accidents in the history of nuclear power are analyzed. And the main factors for these accidents are found out, that is, human factors and unpredicted natural calamity. By combining the design and operation parameters of domestic nuclear plants, the same accidents are studied and some necessary preventive schemes are put forward. In the security operation technology of domestic nuclear power plants nowadays, accidents caused by human factors can by prevented completely. But the safety standards have to be reconsidered for the unpredicted neutral disasters. How to reduce the hazard of nuclear radiation and leakage to the level that can be accepted by the government and public when accidents occur under extreme conditions during construction and operation of nuclear power plants must be considered adequately. (authors)
International Nuclear Information System (INIS)
Ruostetsaari, I.
2002-01-01
According to the Nuclear Energy Act the government's Decision in Principle (DiP) on the nuclear waste disposal needs to be ratified by Parliament. The DiP was ratified by general consent (159-3) on 18 May 2001. How we can explain this parliamentary consensus taking account that the previous DiP concerning construction of a new nuclear power plant was overruled in 1993 and the public debate on nuclear power is still pronounced. The explanation can be sought, together with the institutional arrangements, from two sources; on one hand from the Finnish political culture, i.e., traditional and inherited ways of decision-makers to make decisions and citizens' ways to react to those decisions, and on the other hand, from current contextual factors linking to nuclear waste management. (authors)
Zheng, Xing-Wu; Kudaravalli, Rama; Russell, Theresa T; DiMichele, Donna M; Gibb, Constance; Russell, J Eric; Margaritis, Paris; Pollak, Eleanor S
2011-10-01
Severe coagulant factor VII (FVII) deficiency in postpubertal dizygotic twin males results from two point mutations in the FVII gene, a promoter region T→C transition at -60 and a His-to-Arg substitution at amino acid 348; both mutations prevent persistence of plasma functional FVII. This report documents longitudinal laboratory measurements from infancy to adulthood of FVII coagulant activity (FVII:C) in the twin FVII-deficient patients; it also details specific biochemical analyses of the -60 T→C mutation. The results revealed FVII:C levels of less than 1% in infancy that remain severely decreased through puberty and into adulthood. In-vitro analyses utilizing hepatocyte nuclear factor 4α (HNF4α) co-transfection and a chromatin immunoprecipitation assay indicate that the -60 T→C mutation severely diminishes functional interaction between the FVII promoter and transcription factor HNF4α. The importance of interaction between the FVII gene and HNF4α in normal FVII expression provides an in-vivo illustration of the regulated expression of an autosomal gene encoding a coagulation protein. The constancy of FVII:C and peripubertal patient symptomatology reported here illustrates androgen-independent expression in contrast to expression with an analogous mutation in the promoter region of the gene encoding coagulation FIX.
International Nuclear Information System (INIS)
Lee, Y. H.; Lee, J. Y.
2003-01-01
Human factors have been well known as one of the key factors to the system effectiveness as well as the efficiency and safety of nuclear power plants(NPPs). Human factors engineering(HFE) are included in periodic safety review(PSR) on the existing NPPs and the formal safety assessment for the new ones. However, HFE for NPPs is still neither popular in practice nor concrete in methodology. Especially, the human factors guidelines, which are the most frequent form of human factors engineering in practice, reveal the limitations in their applications. We discuss the limitations and their casual factors found in human factors guidelines in order to lesson the workload of HFE practitioners and to improve the applicability of human factors guidelines. According to the purposes and the phases of HFE for NPPs, more selective items and specified criteria should be prepared carefully in the human factors guidelines for the each HFE applications in practice. These finding on the human factors guidelines can be transferred to the other HFE application field, such as military, aviation, telecommunication, HCI, and product safety
Energy Technology Data Exchange (ETDEWEB)
Galan, S.F. [Dpto. de Inteligencia Artificial, E.T.S.I. Informatica (UNED), Juan del Rosal, 16, 28040 Madrid (Spain)]. E-mail: seve@dia.uned.es; Mosleh, A. [2100A Marie Mount Hall, Materials and Nuclear Engineering Department, University of Maryland, College Park, MD 20742 (United States)]. E-mail: mosleh@umd.edu; Izquierdo, J.M. [Area de Modelado y Simulacion, Consejo de Seguridad Nuclear, Justo Dorado, 11, 28040 Madrid (Spain)]. E-mail: jmir@csn.es
2007-08-15
The {omega}-factor approach is a method that explicitly incorporates organizational factors into Probabilistic safety assessment of nuclear power plants. Bayesian networks (BNs) are the underlying formalism used in this approach. They have a structural part formed by a graph whose nodes represent organizational variables, and a parametric part that consists of conditional probabilities, each of them quantifying organizational influences between one variable and its parents in the graph. The aim of this paper is twofold. First, we discuss some important limitations of current procedures in the {omega}-factor approach for either assessing conditional probabilities from experts or estimating them from data. We illustrate the discussion with an example that uses data from Licensee Events Reports of nuclear power plants for the estimation task. Second, we introduce significant improvements in the way BNs for the {omega}-factor approach can be constructed, so that parameter acquisition becomes easier and more intuitive. The improvements are based on the use of noisy-OR gates as model of multicausal interaction between each BN node and its parents.
International Nuclear Information System (INIS)
Galan, S.F.; Mosleh, A.; Izquierdo, J.M.
2007-01-01
The ω-factor approach is a method that explicitly incorporates organizational factors into Probabilistic safety assessment of nuclear power plants. Bayesian networks (BNs) are the underlying formalism used in this approach. They have a structural part formed by a graph whose nodes represent organizational variables, and a parametric part that consists of conditional probabilities, each of them quantifying organizational influences between one variable and its parents in the graph. The aim of this paper is twofold. First, we discuss some important limitations of current procedures in the ω-factor approach for either assessing conditional probabilities from experts or estimating them from data. We illustrate the discussion with an example that uses data from Licensee Events Reports of nuclear power plants for the estimation task. Second, we introduce significant improvements in the way BNs for the ω-factor approach can be constructed, so that parameter acquisition becomes easier and more intuitive. The improvements are based on the use of noisy-OR gates as model of multicausal interaction between each BN node and its parents
Testing collinear factorization and nuclear parton distributions with pA collisions at the LHC
Energy Technology Data Exchange (ETDEWEB)
Quiroga-Arias, Paloma [Departamento de Fisica de PartIculas and IGFAE, Universidade de Santiago de Compostela 15706 Santiago de Compostela (Spain); Milhano, Jose Guilherme [CENTRA, Departamento de Fisica, Instituto Superior Tecnico (IST), Av. Rovisco Pais 1, P-1049-001 Lisboa (Portugal); Wiedemann, Urs Achim, E-mail: pquiroga@fpaxpl.usc.es [Physics Department, Theory Unit, CERN, CH-1211 Geneve 23 (Switzerland)
2011-01-01
Global perturbative QCD analyses, based on large data sets from electron-proton and hadron collider experiments, provide tight constraints on the parton distribution function (PDF) in the proton. The extension of these analyses to nuclear parton distributions (nPDF) has attracted much interest in recent years. nPDFs are needed as benchmarks for the characterization of hot QCD matter in nucleus-nucleus collisions, and attract further interest since they may show novel signatures of non- linear density-dependent QCD evolution. However, it is not known from first principles whether the factorization of long-range phenomena into process-independent parton distribution, which underlies global PDF extractions for the proton, extends to nuclear effects. As a consequence, assessing the reliability of nPDFs for benchmark calculations goes beyond testing the numerical accuracy of their extraction and requires phenomenological tests of the factorization assumption. Here we argue that a proton-nucleus collision program at the LHC would provide a set of measurements allowing for unprecedented tests of the factorization assumption underlying global nPDF fits.
International Nuclear Information System (INIS)
Lee, Yong Hee; Park, Jae Chang; Cheon, Se Woo; Jung, Kwang Tae; Baek, Seung Min; Han, Seung; Park, Hee Suk; Son, Ki Chang; Kim, Jung Man; Jung Yung Woo
1999-11-01
This report describe a technical transfer under the title of ''A formal design verification and validation on the human factors of a computerized information system in nuclear power plants''. Human factors requirements for the information system designs are extracted from various regulatory and industrial standards and guidelines, and interpreted into a more specific procedures and checklists for verifying the satisfaction of those requirements. A formalized implementation plan is established for human factors verification and validation of a computerized information system in nuclear power plants. Additionally, a Computer support system, named as DIMS-web (design Issue Management System), is developed based upon web internet environment so as to enhance the implementation of the human factors activities. DIMS-Web has three maine functions: supporting requirements review, tracking design issues, and management if issues screening evaluation. DIMS-Web shows its benefits in practice through a trial application to the design review of CFMS for YGN nuclear unit 5 and 6. (author)
Energy Technology Data Exchange (ETDEWEB)
Lee, Yong Hee; Park, Jae Chang; Cheon, Se Woo; Jung, Kwang Tae; Baek, Seung Min; Han, Seung; Park, Hee Suk; Son, Ki Chang; Kim, Jung Man; Jung Yung Woo
1999-11-01
This report describe a technical transfer under the title of ''A formal design verification and validation on the human factors of a computerized information system in nuclear power plants''. Human factors requirements for the information system designs are extracted from various regulatory and industrial standards and guidelines, and interpreted into a more specific procedures and checklists for verifying the satisfaction of those requirements. A formalized implementation plan is established for human factors verification and validation of a computerized information system in nuclear power plants. Additionally, a Computer support system, named as DIMS-web (design Issue Management System), is developed based upon web internet environment so as to enhance the implementation of the human factors activities. DIMS-Web has three maine functions: supporting requirements review, tracking design issues, and management if issues screening evaluation. DIMS-Web shows its benefits in practice through a trial application to the design review of CFMS for YGN nuclear unit 5 and 6. (author)
International Nuclear Information System (INIS)
German, S.; Silla, I.; Navajas, J.
2014-01-01
Previous research supports the importance of organizational factors on safety in high reliability organizations. This study aims to determine the impact of those factors in the Spanish nuclear sector. Particularly, this study focuses on examining the role of performance indicators, organizational culture, organizational factors, and organizational context. With that purpose, an electronic survey addressed to experts from the Spanish nuclear sector was carried out. Results showed that performance indicators are well-known among industry experts and are perceived as useful for improving performance. Behavioural norms that influence safety and some relevant factors that promote problem identification were identified. Additionally, findings suggested that organizational context must be taken into account to better understand the role of organizational culture. Moreover, industry experts pointed out organizational factors to be improved: organizational communication processes within the organization, positive reinforcement, and field supervisors practices. Finally, findings supported the influence of organizational context on safety. It is noteworthy the role of the social impact of international events (e.g., Chernobyl...), the relationship with the regulator and the legislative and governmental framework. (Author)
A nuclear free southeast Asia - the China factor
International Nuclear Information System (INIS)
Malik, J.M.
1989-01-01
It is estimated that the principal nuclear threat to Southeast Asia comes from nuclear weapons stored by the two superpowers in their respective bases and their targeting of each other's bases. Calls for the creation of a nuclear weapons free zone in Southeast Asia (SEANFZ) poses a number of problems to China because of the perceived negative impact of such zones on Chinese security interests, force deployment and strategic doctrine. Hence, it is argued that China is unlikely to support a nuclear free zone treaty which only embraces the Asean states because it would lead to unilateral disarmament on the part of pro-western countries while leaving Indochinese states and the Soviet Union. However, if the proposed SEANFZ treaty resembles the South Pacific Nuclear Free Zone treaty, which allow the transit of nuclear-armed vessels, China could be expected to support it. ills
Expression of the transcription factor Evi-1 in human erythroleukemia cell lines and in leukemias.
Fontenay-Roupie, M; Bouscary, D; Melle, J; Viguié, F; Picard, F; Guesnu, M; Dreyfus, F
1997-02-01
The Evi-1 proto-oncogene is a zinc finger DNA binding protein. Although activation of the Evi-1 gene has been associated with chromosomal rearrangements of the 3q25-q28 region, ectopic expression of Evi-1 could also be observed in acute myelogenous leukemias and myelodysplastic syndromes without cytogenetic abnormalities of the 3q26 locus. In this study, human erythroleukemic cell lines were screened for the expression of Evi-1 mRNA by northern blotting. Evi-1 was expressed in all the erythroid cell lines, whether undifferentiated (K 562, HEL, LAMA 84) or exhibiting spontaneous terminal erythroid differentiation (KU 812, JK-1). Evi-1 mRNA levels were constant or elevated in hemoglobin-synthesizing KU 812 or K 562 cells in response to erythropoietin or hemin treatment, respectively. In human acute myeloblastic leukemias (AML), 11/30 expressed Evi-1 by RT-PCR. Among these cases, 4/6 erythroleukemias without abnormalities of the 3q25-q28 region were found positive. The presence of acidophilic erythroblasts (15-47% of bone marrow cells) accounted for the existence of a terminal erythroid differentiation in all Evi-1-positive AML M6, whereas one negative case was poorly differentiated and referred to as AML M6 variant. These results suggest that Evi-1 mRNA expression can coexist with erythroid differentiation.
Anti-inflammatory Activity of Epimedium brevicornu Maxim Ethanol Extract.
Huang, Shan; Meng, Ning; Chang, Bingquan; Quan, Xianghua; Yuan, RuiYing; Li, Bin
2018-04-05
Epimedium brevicornu Maxim has been used as a traditional herbal drug in China. In this study, the anti-inflammatory effects of E. brevicornu Maxim ethanol extract (EBME) were investigated in RAW264.7 macrophages and mice challenged with lipopolysaccharide (LPS). Results showed that EBME attenuated inflammation by decreasing the production of several proinflammatory mediators, such as nitric oxide (NO), prostaglandin (PG) E 2 , inducible nitric oxide synthase, and cyclooxygenase-2, in LPS-stimulated RAW264.7 macrophages. EBME increased the expression of heme oxygenase-1 (HO-1) and promoted the nuclear translocation of nuclear factor erythroid 2-related factor 2. The inhibitory effects of EBME on LPS-stimulated NO and PGE 2 expression were partially reversed by HO-1 inhibitor. EBME also elicited an anti-inflammatory effect by inhibiting the production of tumor necrosis factor-α, interleukin (IL)-1β, and IL-6 in LPS-induced peritonitis. Therefore, EBME exhibited anti-inflammatory effects in vitro and in vivo.
Human factor analysis and preventive countermeasures of maintenance in nuclear power plant
International Nuclear Information System (INIS)
Zhang Li; Hu Chao
2008-01-01
Based on the human error analysis theory and the characteristics of maintenance in a nuclear power plant, human factors of maintenance in NPP are divided into three different areas: human, technology, and organization, in which human refers to the individual factors, mainly including psychological quality, physiological characteristic, state of health, knowledge, skill level, and interpersonal relationship. Technology includes the maintenance technology, maintenance strategy, maintenance tool, maintenance interface, maintenance regulation, and work environment. Organization includes task arrangement, information communication, training, personnel external environment, team construction, and leadership. The analysis also reveals that the organization factors, which can indirectly influence personnel performance, are the primary initiators of human error. Based on these, some countermeasures are brought forward in order to reduce human errors. (authors)
International Nuclear Information System (INIS)
1988-01-01
The decommissioning and decontamination of nuclear facilities is a topic of great interest to many Member States of the International Atomic Energy Agency (IAEA) because of the large number of older nuclear facilities which are or soon will be retired from service. To assist in the development of the required decommissioning expertise, the IAEA is developing reports and recommendations which will eventually form an integrated information base covering in a systematic way the wide range of topics associated with decommissioning. This information is required so that Member States can decommission their nuclear facilities in a safe, timely and cost effective manner and the IAEA can effectively respond to requests for assistance. One area which warrants more detailed analyses is an assessment of the factors important to the recycling or reuse of components arising from the refurbishment or decommissioning of nuclear plants, the topic of the present report. The document provides an up to date review of the engineering, social, scientific and administrative factors relevant to the safe recycling or reuse of components arising from decommissioning or refurbishment of nuclear facilities. This report should be of interest to owners, operators, policy makers and regulators involved with nuclear facilities, especially those in developing countries. Refs, figs and tabs
Yun, Jeong H; Morrow, Jarrett; Owen, Caroline A; Qiu, Weiliang; Glass, Kimberly; Lao, Taotao; Jiang, Zhiqiang; Perrella, Mark A; Silverman, Edwin K; Zhou, Xiaobo; Hersh, Craig P
2017-07-01
Although cigarette smoke (CS) is the primary risk factor for chronic obstructive pulmonary disease (COPD), the underlying molecular mechanisms for the significant variability in developing COPD in response to CS are incompletely understood. We performed lung gene expression profiling of two different wild-type murine strains (C57BL/6 and NZW/LacJ) and two genetic models with mutations in COPD genome-wide association study genes (HHIP and FAM13A) after 6 months of chronic CS exposure and compared the results to human COPD lung tissues. We identified gene expression patterns that correlate with severity of emphysema in murine and human lungs. Xenobiotic metabolism and nuclear erythroid 2-related factor 2-mediated oxidative stress response were commonly regulated molecular response patterns in C57BL/6, Hhip +/- , and Fam13a -/- murine strains exposed chronically to CS. The CS-resistant Fam13a -/- mouse and NZW/LacJ strain revealed gene expression response pattern differences. The Fam13a -/- strain diverged in gene expression compared with C57BL/6 control only after CS exposure. However, the NZW/LacJ strain had a unique baseline expression pattern, enriched for nuclear erythroid 2-related factor 2-mediated oxidative stress response and xenobiotic metabolism, and converged to a gene expression pattern similar to the more susceptible wild-type C57BL/6 after CS exposure. These results suggest that distinct molecular pathways may account for resistance to emphysema. Surprisingly, there were few genes commonly modulated in mice and humans. Our study suggests that gene expression responses to CS may be largely species and model dependent, yet shared pathways could provide biologically significant insights underlying individual susceptibility to CS.
Testing collinear factorization and nuclear parton distributions with pA collisions at the LHC
Quiroga-Arias, Paloma; Wiedemann, Urs Achim
2011-01-01
Global perturbative QCD analyses, based on large data sets from electron-proton and hadron collider experiments, provide tight constraints on the parton distribution function (PDF) in the proton. The extension of these analyses to nuclear parton distributions (nPDF) has attracted much interest in recent years. nPDFs are needed as benchmarks for the characterization of hot QCD matter in nucleus-nucleus collisions, and attract further interest since they may show novel signatures of non- linear density-dependent QCD evolution. However, it is not known from first principles whether the factorization of long-range phenomena into process-independent parton distribution, which underlies global PDF extractions for the proton, extends to nuclear effects. As a consequence, assessing the reliability of nPDFs for benchmark calculations goes beyond testing the numerical accuracy of their extraction and requires phenomenological tests of the factorization assumption. Here we argue that a proton-nucleus collision program a...
Human Factors Considerations in New Nuclear Power Plants: Detailed Analysis.
Energy Technology Data Exchange (ETDEWEB)
OHara,J.; Higgins, J.; Brown, W.; Fink, R.
2008-02-14
This Nuclear Regulatory Commission (NRC) sponsored study has identified human-performance issues in new and advanced nuclear power plants. To identify the issues, current industry developments and trends were evaluated in the areas of reactor technology, instrumentation and control technology, human-system integration technology, and human factors engineering (HFE) methods and tools. The issues were organized into seven high-level HFE topic areas: Role of Personnel and Automation, Staffing and Training, Normal Operations Management, Disturbance and Emergency Management, Maintenance and Change Management, Plant Design and Construction, and HFE Methods and Tools. The issues where then prioritized into four categories using a 'Phenomena Identification and Ranking Table' methodology based on evaluations provided by 14 independent subject matter experts. The subject matter experts were knowledgeable in a variety of disciplines. Vendors, utilities, research organizations and regulators all participated. Twenty issues were categorized into the top priority category. This Brookhaven National Laboratory (BNL) technical report provides the detailed methodology, issue analysis, and results. A summary of the results of this study can be found in NUREG/CR-6947. The research performed for this project has identified a large number of human-performance issues for new control stations and new nuclear power plant designs. The information gathered in this project can serve as input to the development of a long-term strategy and plan for addressing human performance in these areas through regulatory research. Addressing human-performance issues will provide the technical basis from which regulatory review guidance can be developed to meet these challenges. The availability of this review guidance will help set clear expectations for how the NRC staff will evaluate new designs, reduce regulatory uncertainty, and provide a well-defined path to new nuclear power plant
Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.
2015-01-01
Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726
Lifescience Database Archive (English)
Full Text Available 15361242 Manipulation of mitogen-activated protein kinase/nuclear factor-kappaB-sig...mmunol Rev. 2004 Oct;201:191-205. (.png) (.svg) (.html) (.csml) Show Manipulation of mitogen-activated prote... gondii infection. PubmedID 15361242 Title Manipulation of mitogen-activated protein kinase/nuclear factor-k
Platelet-derived growth factor induces phosphorylation of a 64-kDa nuclear protein
International Nuclear Information System (INIS)
Shawver, L.K.; Pierce, G.F.; Kawahara, R.S.; Deuel, T.F.
1989-01-01
The platelet-derived growth factor (PDGF) stimulated the phosphorylation of a nuclear protein of 64 kDa (pp64) in nuclei of nontransformed normal rat kidney (NRK) cells. Low levels of phosphorylation of pp64 were observed in nuclei of serum-starved NRK cells. Fetal calf serum (FCS), PDGF, and homodimeric v-sis and PDGF A-chain protein enhanced the incorporation of 32P into pp64 over 4-fold within 30 min and over 8-fold within 2 h of exposure of NRK cells to the growth factors. In contrast, constitutive phosphorylation of 32P-labeled pp64 in nuclei of NRK cells transformed by the simian sarcoma virus (SSV) was high and only minimally stimulated by PDGF and FCS. 32P-Labeled pp64 was isolated from nuclei of PDGF-stimulated nontransformed NRK cells; the 32P of pp64 was labile in 1 M KOH, and pp64 was not significantly recognized by anti-phosphotyrosine antisera, suggesting that the PDGF-induced phosphorylation of pp64 occurred on serine or on threonine residues. However, pp64 from SSV-transformed NRK cell nuclei was significantly stable to base hydrolysis and was immunoprecipitated with anti-phosphotyrosine antisera, suggesting that pp64 from SSV-transformed cell nuclei is phosphorylated also on tyrosine. FCS, PDGF, and PDGF A- and B-chain homodimers thus stimulate the rapid time-dependent phosphorylation of a 64-kDa nuclear protein shortly after stimulation of responsive cells. The growth factor-stimulated phosphorylation of pp64 and the constitutive high levels of pp64 phosphorylation in cells transformed by SSV suggest important roles for pp64 and perhaps regulated nuclear protein kinases and phosphatases in cell division and proliferation
International Nuclear Information System (INIS)
Grecco, Claudio H.S.; Santos, Isaac J.A.L.; Mol, Antonio C.A.; Carvalho, Paulo V.R.; Silva, Antonio C.F.; Ferreira, Francisco J.O.; Dutra, Marco A.M.
2007-01-01
The Virtual Reality (VR) is an advanced computer interface technology that allows the user to internet or to explore a three-dimensional environment through the computer, as was part of the virtual world. This technology presents great applicability in the most diverse areas of the human knowledge. This paper presents a study on the use of the VR as tool for human factors requirements evaluation in design of the nuclear reactors control desks. Moreover, this paper presents a case study: a virtual model of the control desk, developed using virtual reality technology to be used in the human factors requirements evaluation. This case study was developed in the Virtual Reality Laboratory at IEN, and understands the stereo visualization of the Argonauta research nuclear reactor control desk for a static ergonomic evaluation using check-lists, in accordance to the standards and human factors nuclear international guides (IEC 1771, NUREG-0700). (author)
Energy Technology Data Exchange (ETDEWEB)
Grecco, Claudio H.S.; Santos, Isaac J.A.L.; Mol, Antonio C.A.; Carvalho, Paulo V.R.; Silva, Antonio C.F.; Ferreira, Francisco J.O.; Dutra, Marco A.M. [Instituto de Engenharia Nuclear (IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil)]. E-mail: grecco@ien.gov.br; luquetti@ien.gov.br; mol@ien.gov.br; paulov@ien.gov.br; tonico@ien.gov.br; fferreira@ien.gov.br; dutra@ien.gov.br
2007-07-01
The Virtual Reality (VR) is an advanced computer interface technology that allows the user to internet or to explore a three-dimensional environment through the computer, as was part of the virtual world. This technology presents great applicability in the most diverse areas of the human knowledge. This paper presents a study on the use of the VR as tool for human factors requirements evaluation in design of the nuclear reactors control desks. Moreover, this paper presents a case study: a virtual model of the control desk, developed using virtual reality technology to be used in the human factors requirements evaluation. This case study was developed in the Virtual Reality Laboratory at IEN, and understands the stereo visualization of the Argonauta research nuclear reactor control desk for a static ergonomic evaluation using check-lists, in accordance to the standards and human factors nuclear international guides (IEC 1771, NUREG-0700). (author)
Review of human factors R and D in the nuclear power industry
International Nuclear Information System (INIS)
Parris, H.L.
1986-01-01
The history of human factors (HF) R and D in the nuclear power industry can clearly be divided into two phases: pre- and post-Three Mile Island (TMI). Pre-TMI, most people in the industry were unfamiliar with the discipline and its contributions to military and space system designs, and the number of HF professionals involved with nuclear power could essentially be counted on the fingers of two hands. Consequently, there was little research into the improvement of plant man/machine interfaces. The picture changed dramatically in the aftermath of TMI as investigation after investigation pointed to deficiencies in the operator/control room interface, training, procedures, communications, and organizational effectiveness. This paper first outlines pre-TMI events, then examines the post-TMI scenario, and concludes with summary observations and suggestions for future efforts
Thyroid hormone and retinoic acid nuclear receptors: specific ligand-activated transcription factors
International Nuclear Information System (INIS)
Brtko, J.
1998-01-01
Transcriptional regulation by both the thyroid hormone and the vitamin A-derived 'retinoid hormones' is a critical component in controlling many aspects of higher vertebrate development and metabolism. Their functions are mediated by nuclear receptors, which comprise a large super-family of ligand-inducible transcription factors. Both the thyroid hormone and the retinoids are involved in a complex arrangement of physiological and development responses in many tissues of higher vertebrates. The functions of 3,5,3'-triiodothyronine (T 3 ), the thyromimetically active metabolite of thyroxine as well as all-trans retinoic acid, the biologically active vitamin A metabolite are mediated by nuclear receptor proteins that are members of the steroid/thyroid/retinoid hormone receptor family. The functions of all members of the receptor super family are discussed. (authors)
Quality factors quantification/assurance for software related to safety in nuclear power plants
International Nuclear Information System (INIS)
Nunez McLeod, J.E.; Rivera, S.S.
1997-01-01
Quality assurance plan is needed to guarantee the software quality. The use of such a plan involves activities that should take place all along the life cycle, and which can be evaluated using the so called quality factors. This is due to the fact that the quality itself cannot be measured, but some of its manifestations can be used for this purpose. In the present work, a methodology to quantify a set of quality factors is proposed, for software based systems to be used in safety related areas in nuclear power plants. (author) [es
FTZ-Factor1 and Fushi tarazu interact via conserved nuclear receptor and coactivator motifs
Schwartz, Carol J.E.; Sampson, Heidi M.; Hlousek, Daniela; Percival-Smith, Anthony; Copeland, John W.R.; Simmonds, Andrew J.; Krause, Henry M.
2001-01-01
To activate transcription, most nuclear receptor proteins require coactivators that bind to their ligand-binding domains (LBDs). The Drosophila FTZ-Factor1 (FTZ-F1) protein is a conserved member of the nuclear receptor superfamily, but was previously thought to lack an AF2 motif, a motif that is required for ligand and coactivator binding. Here we show that FTZ-F1 does have an AF2 motif and that it is required to bind a coactivator, the homeodomain-containing protein Fushi tarazu (FTZ). We also show that FTZ contains an AF2-interacting nuclear receptor box, the first to be found in a homeodomain protein. Both interaction motifs are shown to be necessary for physical interactions in vitro and for functional interactions in developing embryos. These unexpected findings have important implications for the conserved homologs of the two proteins. PMID:11157757
Directory of Open Access Journals (Sweden)
Christopher Terranova
Full Text Available Genetic studies have placed the Fgfr1 gene at the top of major ontogenic pathways that enable gastrulation, tissue development and organogenesis. Using genome-wide sequencing and loss and gain of function experiments the present investigation reveals a mechanism that underlies global and direct gene regulation by the nuclear form of FGFR1, ensuring that pluripotent Embryonic Stem Cells differentiate into Neuronal Cells in response to Retinoic Acid. Nuclear FGFR1, both alone and with its partner nuclear receptors RXR and Nur77, targets thousands of active genes and controls the expression of pluripotency, homeobox, neuronal and mesodermal genes. Nuclear FGFR1 targets genes in developmental pathways represented by Wnt/β-catenin, CREB, BMP, the cell cycle and cancer-related TP53 pathway, neuroectodermal and mesodermal programing networks, axonal growth and synaptic plasticity pathways. Nuclear FGFR1 targets the consensus sequences of transcription factors known to engage CREB-binding protein, a common coregulator of transcription and established binding partner of nuclear FGFR1. This investigation reveals the role of nuclear FGFR1 as a global genomic programmer of cell, neural and muscle development.
Mondal, Nandan Kumar; Saha, Hirak; Mukherjee, Bidisha; Tyagi, Neetu; Ray, Manas Ranjan
2018-01-24
The study was carried out to examine whether chronic exposure to smoke during daily household cooking with biomass fuel (BMF) elicits changes in airway cytology and expressions of Nrf2 (nuclear factor erythroid 2 [NF-E2]-related factor 2 [Nrf2]), Keap1 (Kelch-like erythroid-cell-derived protein with CNC homology [ECH]-associated protein 1), and NQO1 (NAD(P)H:quinone oxidoreductase 1) proteins in the airways. For this, 282 BMF-using women (median age 34 year) and 236 age-matched women who cooked with liquefied petroleum gas (LPG) were enrolled. Particulate matter with diameters of LPG. Compared with LPG users, BMF users had 32% more leukocytes in circulation and their sputa were 1.4-times more cellular with significant increase in absolute number of neutrophils, lymphocytes, eosinophils, and alveolar macrophages, suggesting airway inflammation. ROS generation was 1.5-times higher in blood neutrophils and 34% higher in sputum cells of BMF users while erythrocyte SOD was 31% lower and plasma catalase was relatively unchanged, suggesting oxidative stress. In BMF users, Keap1 expression was reduced, the percentage of AEC with nuclear expression of Nrf2 was two- to three-times more, and NQO1 level in sputum cell lysate was two-times higher than that of LPG users. In conclusion, cooking with BMF was associated with Nrf2 activation and elevated NQO1 protein level in the airways. The changes may be adaptive cellular response to counteract biomass smoke-elicited oxidative stress and inflammation-related tissue injury in the airways.
Energy Technology Data Exchange (ETDEWEB)
Baek, Jong Min; Park, Sun-Hyang; Cheon, Yoon-Hee; Ahn, Sung-Jun [Department of Anatomy, School of Medicine, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Lee, Myeung Su [Division of Rheumatology, Department of Internal Medicine, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Imaging Science-based Lung and Bone Diseases Research Center, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Institute for Skeletal Disease, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Oh, Jaemin, E-mail: jmoh@wku.ac.kr [Department of Anatomy, School of Medicine, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Imaging Science-based Lung and Bone Diseases Research Center, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Institute for Skeletal Disease, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Kim, Ju-Young, E-mail: kimjy1014@gmail.com [Imaging Science-based Lung and Bone Diseases Research Center, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of)
2015-05-29
Esculetin exerts various biological effects on anti-oxidation, anti-tumors, and anti-inflammation. However, the involvement of esculetin in the bone metabolism process, particularly osteoclast differentiation has not yet been investigated. In the present study, we first confirmed the inhibitory effect of esculetin on receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclast formation. We then revealed the relationship between esculetin and the expression of osteoclast-specific molecules to elucidate its underlying mechanisms. Esculetin interfered with the expression of c-Fos and nuclear factor of activated T cell c1 (NFATc1) both at the mRNA and protein level with no involvement in osteoclast-associated early signaling pathways, suppressing the expression of various transcription factors exclusively expressed in osteoclasts such as tartrate-resistant acid phosphatase (Trap), osteoclast-associated receptor (Oscar), dendritic cell-specific transmembrane protein (Dcstamp), osteoclast stimulatory transmembrane protein (Ocstamp), cathepsin K, αvβ3 integrin, and calcitonin receptor (Ctr). Additionally, esculetin inhibited the formation of filamentous actin (F-actin) ring-positive osteoclasts during osteoclast differentiation. However, the development of F-actin structures and subsequent bone resorbing activity of mature osteoclasts, which are observed in osteoclast/osteoblast co-culture systems were not affected by esculetin. Taken together, our results indicate for the first time that esculetin inhibits RANKL-mediated osteoclastogenesis via direct suppression of c-Fos and NFATc1 expression and exerts an inhibitory effect on actin ring formation during osteoclastogenesis. - Highlights: • We first investigated the effects of esculetin on osteoclast differentiation and function. • Our data demonstrate for the first time that esculetin can suppress osteoclastogenesis in vitro. • Esculetin acts as an inhibitor of c-Fos and NFATc1 activation.
Experimental realization of Shor's quantum factoring algorithm using nuclear magnetic resonance.
Vandersypen, L M; Steffen, M; Breyta, G; Yannoni, C S; Sherwood, M H; Chuang, I L
The number of steps any classical computer requires in order to find the prime factors of an l-digit integer N increases exponentially with l, at least using algorithms known at present. Factoring large integers is therefore conjectured to be intractable classically, an observation underlying the security of widely used cryptographic codes. Quantum computers, however, could factor integers in only polynomial time, using Shor's quantum factoring algorithm. Although important for the study of quantum computers, experimental demonstration of this algorithm has proved elusive. Here we report an implementation of the simplest instance of Shor's algorithm: factorization of N = 15 (whose prime factors are 3 and 5). We use seven spin-1/2 nuclei in a molecule as quantum bits, which can be manipulated with room temperature liquid-state nuclear magnetic resonance techniques. This method of using nuclei to store quantum information is in principle scalable to systems containing many quantum bits, but such scalability is not implied by the present work. The significance of our work lies in the demonstration of experimental and theoretical techniques for precise control and modelling of complex quantum computers. In particular, we present a simple, parameter-free but predictive model of decoherence effects in our system.
Natural product-derived pharmacological modulators of Nrf2/ARE pathway for chronic diseases.
Kumar, Hemant; Kim, In-Su; More, Sandeep Vasant; Kim, Byung-Wook; Choi, Dong-Kug
2014-01-01
Covering: 2000 to 2013. Oxidative stress is the central component of chronic diseases. The nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2/ARE) pathway is vital in the up-regulation of cytoprotective genes and enzymes in response to oxidative stress and treatment with certain dietary phytochemicals. Herein, we classify bioactive compounds derived from natural products that are Nrf2/ARE pathway activators and recapitulate the molecular mechanisms for inducing Nrf2 to provide favorable effects in experimental models of chronic diseases. Moreover, pharmacological inhibition of Nrf2 signalling has emerged as promising strategy against multi-drug resistance thereby improving the treatment efficacy. We have also enlisted natural product-derived inhibitors of Nrf2/ARE pathway.
Human and social factors in the transportation of nuclear wastes
International Nuclear Information System (INIS)
Freudenburg, W.R.
1991-01-01
The main body of this report is a broad-based examination of human and social factors in the transportation of nuclear wastes. It deals with pair interested problems that, while familiar to the social science community, appear to have received little attention from the risk assessment community to data: The human and social attenuation of risk estimates, and the organizational amplification of risks. Second, given the special opportunities for learning that are presented by the recent Alaska oil spill, in particular, the Appendix to this report examines the issue of organizational foresight in the context of the Exxon oil spill
A.G. Elefanty (Andrew); M. Antoniou (Michael); N. Custodio; M. Carmo-Fonseca; F.G. Grosveld (Frank)
1996-01-01
textabstractThe nuclear distribution of GATA transcription factors in murine haemopoietic cells was examined by indirect immunofluorescence. Specific bright foci of GATA-1 fluorescence were observed in erythroleukaemia cells and primary murine erythroblasts and megakaryocytes, in addition to diffuse
Nuclear issues in the Asia-Pacific region: socio-political factors
International Nuclear Information System (INIS)
Tanaka, Y.
1984-01-01
This paper explores the prospect of peaceful use of nuclear power in the Asia-Pacific region, criteria for judging the acceptability of nuclear electric power in the region, and alternative worldviews on the basis of which a regional nuclear order should be established. First, current nuclear power issues in Japan are discussed. Secondly, the Asia-Pacific countries are classified according to their stages of civil nuclear development, Thirdly, the acceptability of civil nuclear power in the region is discussed, using nuclear nonproliferation, safety, and public acceptance as three major criteria. Fourthly, conflicts of interest that cut across North/South, East/West, nuclear/non-nuclear, and nuclear weapons states/non-nuclear weapons states boundaries are discussed. Lastly,it is proposed that an international forum be convened of all the countries concerned with nuclear issues in the region. Several major objectives of this forum are suggested, including construction of a rational model for a solution for non-zero-sum gain to everyone regarding use of nuclear power in the region. (author)
An Adenovirus DNA Replication Factor, but Not Incoming Genome Complexes, Targets PML Nuclear Bodies.
Komatsu, Tetsuro; Nagata, Kyosuke; Wodrich, Harald
2016-02-01
Promyelocytic leukemia protein nuclear bodies (PML-NBs) are subnuclear domains implicated in cellular antiviral responses. Despite the antiviral activity, several nuclear replicating DNA viruses use the domains as deposition sites for the incoming viral genomes and/or as sites for viral DNA replication, suggesting that PML-NBs are functionally relevant during early viral infection to establish productive replication. Although PML-NBs and their components have also been implicated in the adenoviral life cycle, it remains unclear whether incoming adenoviral genome complexes target PML-NBs. Here we show using immunofluorescence and live-cell imaging analyses that incoming adenovirus genome complexes neither localize at nor recruit components of PML-NBs during early phases of infection. We further show that the viral DNA binding protein (DBP), an early expressed viral gene and essential DNA replication factor, independently targets PML-NBs. We show that DBP oligomerization is required to selectively recruit the PML-NB components Sp100 and USP7. Depletion experiments suggest that the absence of one PML-NB component might not affect the recruitment of other components toward DBP oligomers. Thus, our findings suggest a model in which an adenoviral DNA replication factor, but not incoming viral genome complexes, targets and modulates PML-NBs to support a conducive state for viral DNA replication and argue against a generalized concept that PML-NBs target incoming viral genomes. The immediate fate upon nuclear delivery of genomes of incoming DNA viruses is largely unclear. Early reports suggested that incoming genomes of herpesviruses are targeted and repressed by PML-NBs immediately upon nuclear import. Genome localization and/or viral DNA replication has also been observed at PML-NBs for other DNA viruses. Thus, it was suggested that PML-NBs may immediately sense and target nuclear viral genomes and hence serve as sites for deposition of incoming viral genomes and
The Security of Russia's Nuclear Arsenal: The Human Factor
International Nuclear Information System (INIS)
Ball, D.Y.
1999-01-01
Assertions by the Russian military that all of their nuclear weapons are secure against theft and that nuclear units within the military are somehow insulated from the problems plaguing the Russian military should not be accepted uncritically. Accordingly, we should not give unwarranted credence to the pronouncements of military figures like Cal.-Gen. Igor Valynkin, Chief of the Defense Ministry's 12th Main Directorate, which oversees the country's nuclear arsenal. He contends that ''Russian nuclear weapons are under reliable supervision'' and that ''talk about the unreliability of our control over nuclear weapons has only one pragmatic goal--to convince international society that the country is incapable of maintaining nuclear safety and to introduce international oversight over those weapons, as it is done, for example, in Iraq.'' While the comparison to Iraq is preposterous, many analysts might agree with Valynkin's sanguine appraisal of the security of Russia's nuclear weapons. In contrast, I argue that the numerous difficulties confronting the military as a whole should cause concern in the West over the security of the Russian nuclear arsenal
Nuclear Modification Factor RpA of b jets in pPb collisions
CMS Collaboration
2014-01-01
We present a measurement of the nuclear modification factor $R_{\\mathrm{pA}}^{\\mathrm{PYTHIA}}$ of b jets in proton-lead collisions from CMS. Jets from b-quark fragmentations are found by exploiting the long lifetime of the b-quark through tagging methods using distributions of the secondary vertex displacement. From these, b-jet cross-sections are calculated and compared to a pp cross-section obtained from a PYTHIA simulation. The $R_{\\mathrm{pA}}^{\\mathrm{PYTHIA}}$ is consistent with unity within systematic uncertainties and may show slight enhancement due to cold nuclear matter effects for a wide range in pseudorapidity. These effects are qualitatively consistent with the observed value for the inclusive jet $R_{\\mathrm{pA}}$. We use 35 nb$^{-1}$ of proton-lead data collected during the 2013 heavy-ion run at the LHC.
International Nuclear Information System (INIS)
Price, D.C.
1989-01-01
The spleen is a sinusoidal vascular filter that is an integral part of the reticuloendothelial system and is the largest single lymphoid organ in the body. Thus it has important scavenging and immunologic functions in humans. It is also a site for normal hematopoiesis in humans during the third to sixth months of gestation. Solenic hematopoiesis does occur normally in adult animals of other species (for instance, mouse, rat, rabbit), but it is seen postnatally in humans only when they have certain hematologic disorders such as myelofibrosis with myeloid metaplasia and severe hemolytic anemias. In its role as a reticuloendothelial organ the adult human spleen serves as a vascular scavenger. Arterial blood filters through a network of arterioles, cords, and sinuses in a closed system that requires the blood cells to be pliable and brings them into intimate contact with macrophages suspended on the reticulin stroma of the cords. Erythrocyte culling and pitting functions as described by Crosby result in a transient retention of immature circulating erythroid cells until residual intracellular nuclear fragments have been extruded. The increased risk for overwhelming infection in children and adults whose spleen have been removed for reasons other than acute trauma would appear to be caused by the loss of both its phagocytic and its immunologic (antibody-producing) contributions to the monitoring of the circulating blood. This paper reports that the ability of the spleen to phagocytose intravascular foreign particles and to recognize and destroy damaged erythrocytes is the basis for the current use of radiopharmaceuticals in spleen scintigraphy
Factors in public perception of nuclear energy
International Nuclear Information System (INIS)
Hore-Lacy, I.
1999-01-01
Public communication about nuclear energy needs to relate to the cultural undercurrents which determine how people perceive the environment. The paper discusses some of these and suggests ways of responding to them. It also outlines major ethical considerations relevant to uranium mining and nuclear energy and communication about both and shows that competent discourse about values is fundamental
International Nuclear Information System (INIS)
Hartley, C.S.; Levy, I.S.; Fecht, B.A.
1984-04-01
The Pacific Northwest Laboratory has completed a project to identify human factors deficiencies in safety-significant control stations outside the control room of a nuclear power plant and to determine whether NUREG-0700, Guidelines for Control Room Design Reviews, would be sufficient for reviewing those local control stations (LCSs). The project accomplished this task by first, reviewing existing data pertaining to human factors deficiencies in LCSs involved in significant safety actions; second, surveying LCSs environments and design features at several operating nuclear power plants; and third, assessing the results of that survey relative to the contents of NUREG-0700
International Nuclear Information System (INIS)
Ma Zhonghai; Pan Ziqiang; He Huimin
1999-01-01
The Greenhouse Gas Emission for coal power chain in China is analyzed in detail and comprehensively by using the Life Cycle Analysis method. The Greenhouse Gas Emission Factors (GGEF) in each link and for the total power chain are calculated. The total GGEF for coal power chain is 1302.3 gCO 2 /kWh, about 40 times more than that for nuclear power chain. And consequently greenhouse effect could not be aggravated further by nuclear power. The energy strategy for nuclear power development is one of reality ways to retard the greenhouse effect, put resources into rational use and protect environment
Takeda, Akiko; Sarma, Nayan J; Abdul-Nabi, Anmaar M; Yaseen, Nabeel R
2010-05-21
NUP98 is a nucleoporin that plays complex roles in the nucleocytoplasmic trafficking of macromolecules. Rearrangements of the NUP98 gene in human leukemia result in the expression of numerous fusion oncoproteins whose effect on nucleocytoplasmic trafficking is poorly understood. The present study was undertaken to determine the effects of leukemogenic NUP98 fusion proteins on CRM1-mediated nuclear export. NUP98-HOXA9, a prototypic NUP98 fusion, inhibited the nuclear export of two known CRM1 substrates: mutated cytoplasmic nucleophosmin and HIV-1 Rev. In vitro binding assays revealed that NUP98-HOXA9 binds CRM1 through the FG repeat motif in a Ran-GTP-dependent manner similar to but stronger than the interaction between CRM1 and its export substrates. Two NUP98 fusions, NUP98-HOXA9 and NUP98-DDX10, whose fusion partners are structurally and functionally unrelated, interacted with endogenous CRM1 in myeloid cells as shown by co-immunoprecipitation. These leukemogenic NUP98 fusion proteins interacted with CRM1, Ran, and the nucleoporin NUP214 in a manner fundamentally different from that of wild-type NUP98. NUP98-HOXA9 and NUP98-DDX10 formed characteristic aggregates within the nuclei of a myeloid cell line and primary human CD34+ cells and caused aberrant localization of CRM1 to these aggregates. These NUP98 fusions caused nuclear accumulation of two transcription factors, NFAT and NFkappaB, that are regulated by CRM1-mediated export. The nuclear entrapment of NFAT and NFkappaB correlated with enhanced transcription from promoters responsive to these transcription factors. Taken together, the results suggest a new mechanism by which NUP98 fusions dysregulate transcription and cause leukemia, namely, inhibition of CRM1-mediated nuclear export with aberrant nuclear retention of transcriptional regulators.
Directory of Open Access Journals (Sweden)
Nelli Roininen
2017-01-01
Full Text Available Although validated predictive factors for breast cancer chemoresistance are scarce, there is emerging evidence that the induction of certain redox-regulating enzymes may contribute to a poor chemotherapy effect. We investigated the possible association between chemoresistance and cellular redox state regulation in patients undergoing neoadjuvant chemotherapy (NACT for breast cancer. In total, 53 women with primarily inoperable or inflammatory breast cancer who were treated with NACT were included in the study. Pre-NACT core needle biopsies and postoperative tumor samples were immunohistochemically stained for nuclear factor erythroid 2-related factor 2 (Nrf2, Kelch-like ECH-associated protein 1 (Keap1, thioredoxin (Trx, and peroxiredoxin I (Prx I. The expression of all studied markers increased during NACT. Higher pre-NACT nuclear Prx I expression predicted smaller size of a resected tumor (p=0.00052; r=−0.550, and higher pre-NACT cytoplasmic Prx I expression predicted a lower amount of evacuated nodal metastasis (p=0.0024; r=−0.472. Pre-NACT nuclear Trx expression and pre-NACT nuclear Keap1 expression had only a minor prognostic significance as separate factors, but when they were combined, low expression for both antibodies before NACT predicted dismal disease-free survival (log-rank p=0.0030. Our results suggest that redox-regulating enzymes may serve as potential prognostic factors in primarily inoperable breast cancer patients.
The human factor data management system of Daya Bay Nuclear Power Station
International Nuclear Information System (INIS)
Zhang Li; Zhang Ning; Guo Jianbing; Huang Weigang; Zhu Minhong; Wang Jin
1999-12-01
The collection, analysis and quantification of human factor data are very important parts of human reliability analysis and probabilistic risk assessment. Therefore various human databases have been created. But a human data management system with the functions of data collection, classification, analysis, computation and forecast is scarcely seen at home and abroad. So the authors have developed the human data management system of Daya Bay Nuclear Power Station. The system includes three modules and four databases. The authors firstly set forth some basic problems on the human factor data, which are concerned during the development of the system. Then the structure and function of the system are described. In view of the important role of human factor databases in the system, the authors also discuss the structure problems of the data in the databases in detail
Choi, Yun-Hee; McNally, Brian T; Igarashi, Peter
2013-07-01
Hepatocyte nuclear factor-1β (HNF-1β) is an epithelial tissue-specific transcription factor that regulates gene expression in the kidney, liver, pancreas, intestine, and other organs. Mutations of HNF-1β in humans produce renal cysts and congenital kidney anomalies. Here, we identify the LIM-domain protein zyxin as a novel binding partner of HNF-1β in renal epithelial cells. Zyxin shuttles to the nucleus where it colocalizes with HNF-1β. Immunoprecipitation of zyxin in leptomycin B-treated cells results in coprecipitation of HNF-1β. The protein interaction requires the second LIM domain of zyxin and two distinct domains of HNF-1β. Overexpression of zyxin stimulates the transcriptional activity of HNF-1β, whereas small interfering RNA silencing of zyxin inhibits HNF-1β-dependent transcription. Epidermal growth factor (EGF) induces translocation of zyxin into the nucleus and stimulates HNF-1β-dependent promoter activity. The EGF-mediated nuclear translocation of zyxin requires activation of Akt. Expression of dominant-negative mutant HNF-1β, knockdown of zyxin, or inhibition of Akt inhibits EGF-stimulated cell migration. These findings reveal a novel pathway by which extracellular signals are transmitted to the nucleus to regulate the activity of a transcription factor that is essential for renal epithelial differentiation.
Waraky, Ahmed; Lin, Yingbo; Warsito, Dudi; Haglund, Felix; Aleem, Eiman; Larsson, Olle
2017-11-03
We have previously shown that the insulin-like growth factor 1 receptor (IGF-1R) translocates to the cell nucleus, where it binds to enhancer-like regions and increases gene transcription. Further studies have demonstrated that nuclear IGF-1R (nIGF-1R) physically and functionally interacts with some nuclear proteins, i.e. the lymphoid enhancer-binding factor 1 (Lef1), histone H3, and Brahma-related gene-1 proteins. In this study, we identified the proliferating cell nuclear antigen (PCNA) as a nIGF-1R-binding partner. PCNA is a pivotal component of the replication fork machinery and a main regulator of the DNA damage tolerance (DDT) pathway. We found that IGF-1R interacts with and phosphorylates PCNA in human embryonic stem cells and other cell lines. In vitro MS analysis of PCNA co-incubated with the IGF-1R kinase indicated tyrosine residues 60, 133, and 250 in PCNA as IGF-1R targets, and PCNA phosphorylation was followed by mono- and polyubiquitination. Co-immunoprecipitation experiments suggested that these ubiquitination events may be mediated by DDT-dependent E2/E3 ligases ( e.g. RAD18 and SHPRH/HLTF). Absence of IGF-1R or mutation of Tyr-60, Tyr-133, or Tyr-250 in PCNA abrogated its ubiquitination. Unlike in cells expressing IGF-1R, externally induced DNA damage in IGF-1R-negative cells caused G 1 cell cycle arrest and S phase fork stalling. Taken together, our results suggest a role of IGF-1R in DDT. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.
Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte
2017-07-20
Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.
Organizational/institutional factors affecting performance in the nuclear power industry
International Nuclear Information System (INIS)
Benson, J.L.
1992-01-01
The dramatic macro experiences occurring at Three Mile Island and Chernobyl as well as the cumulative micro experiences represented by sky-rocketing costs and public concerns have demonstrated how the institutionally and organizationally related aspects of the nuclear power industry have dominated and shaped the technical ones. Further, given the relatively stable or evolutionary nature of the technology as it is currently applied, these institutional and organizational factors contain the roots of most of the complications/problems associated with the industry relative to achieving any or all of its future performance objectives (technical, economic, and safety). Some technology transfer was attempted by the author from the field of general systems/cybernetics, which was explicitly aimed at dealing with the organizational/institutional factors, i.e., the problems and issues were approached using principles and methodology substantially different from that typically seen from applications based on the more traditional paradigmic engineering/industrial management orientation
Training and other conditioning factors in nuclear medicine in a developing country
International Nuclear Information System (INIS)
Touya, E.
1986-01-01
The aim of the paper is to discuss the validity of nuclear medicine in 1985, in a developing region, on the basis of certain knowledge of the area and with 20 years' experience of the problem in a small country belonging to that region. An attempt is made to identify the factors which have most significance and the action to take so as to arrive at proposals which would be useful in planning this special field. The effect of the difficult economic situation at the present time in the developing regions on health programmes and policies is discussed. The vital need for promoting and giving impetus to primary medical care is recognized and the obligation to provide secondary and tertiary medical care in the same manner in order to restore health standards is pointed out. It is understood that nuclear medicine may have an impact at the three levels of medical care, and that only those studies which strictly valorize the effectiveness and the cost/benefit and risk/benefit ratios should be encouraged. It is believed that criteria of centralization and critical mass should be met when organizing a nuclear medicine programme. The main items of multipurpose nuclear medicine equipment are determined and there is discussion of the problems involved in training for the nuclear physician, radiopharmacist, hospital physicist, electronics engineer, technician and nurse. Mention is made of the most critical aspects of equipment maintenance, availability of spares, supply of radioisotopes and radiopharmaceuticals, quality control and the individual effectiveness of each service. Reasons are given for the advantage of intervening mainly at the level on instruction and through continuous training courses so as to correct deviations and introduce new policies making for greater effectiveness in utilizing the limited economic resources available. (author)
Setia, Shruti; Sanyal, Sankar Nath
2012-01-01
9,10-Dimethyl benz(a)anthracene (DMBA), when injected intratracheally once at a dose of 20 mg/kg body weight, is found to induce lung cancer in rats. Two nonsteroidal anti-inflammatory drugs (NSAIDs), indomethacin and etoricoxib, are given orally daily as chemopreventive agents at a dose of 0.6 mg/kg body weight and 2 mg/kg body weight, respectively, along with DMBA. Morphologic and histologic analysis revealed the occurence of tumors and intense cellular proliferation in the DMBA-treated animals, whereas no such features were observed in the other groups. Nuclear factor κB, a nuclear transcription factor, and proliferating cell nuclear antigen, a cell proliferation antigen, were studied by immunoblotting and immunohistochemistry and their levels were markedly elevated in the DMBA group compared with the others. Oxidative stress parameters, as studied by the inducible nitric oxide synthase activity, and the levels of reactive oxygen and nitrogen species were found to be suppressed in the DMBA group. Furthermore, fluorescent staining of the isolated lung cells from bronchoalveolar lavage was performed to study apoptosis and alterations in the mitochondrial membrane potential, and the DMBA-induced lung cancer was found to be associated with high inner mitochondrial membrane potential and a suppressed level of apoptosis.
International Nuclear Information System (INIS)
Chen, Gang; He, Cheng; Li, Ling; Lin, An; Zheng, Xiongwei; He, Ellen; Skog, Sven
2013-01-01
Thymidine kinase 1 (TK1) is a proliferation biomarker that has been found useful for prognostication in cancer patients. Here we investigate for the first time the use of TK1 expression as a prognostic factor for patients with premalignant and malignant lesions of the uterine cervix. TK1 expression was determined by immunohistochemistry in cervical lesions (cervical intraepithelial neoplasia (CIN), n = 216; invasive cervical carcinoma, n = 84). TK1 and Ki-67 expressions and pathological/FIGO stages and age were correlated with 5-year survival by Kaplan-Meier, log rank and COX hazard uni- and multivariate analyses. TK1 labeling index (LI) was significantly correlated with CIN grades and invasive cervical carcinoma stages, while TK1 labeling intensity was only correlated to CIN grades. TK1 LI was significantly higher compared with Ki-67 LI. TK1 LI correlated significantly to 5-year survival in patients with invasive cervical carcinoma, particularly nuclear TK1 LI. In a multivariate analysis, nuclear TK1 expression was independent prognostic factor in patients with in situ/invasive cervical carcinoma or in invasive cervical carcinoma alone. Interestingly, in invasive cervical carcinoma patients with advanced tumors, nuclear TK1 expression could identify patients with significantly better survival rates (80%), while Ki-67 could not. Nuclear TK1 expression in early grade CIN predicts risk for progression to malignancy. Nuclear TK1 expression is also a prognostic factor for treatment outcome, particularly in patients with advanced cervical carcinomas. Nuclear TK1 expression is more useful than Ki-67 and pathological/FIGO stages
Chung, Inyoung; Hah, Young-Sool; Ju, SunMi; Kim, Ji-Hye; Yoo, Woong-Sun; Cho, Hee-Young; Yoo, Ji-Myong; Seo, Seong-Wook; Choi, Wan-Sung; Kim, Seong-Jae
2017-07-01
Nuclear factor-kappa B (NF-κB) has been proposed as a therapeutic target for the treatment of cataracts. The authors investigated the relationship between nuclear factor of activated T cells 5 (NFAT5) and NF-κB in ultraviolet B (UVB)-irradiated human lens epithelial (HLE) cells. Human lens epithelial B-3 (HLE-B3) cells were exposed to UVB light at a dose of 10 mJ/cm 2 and then incubated for 24 h. Cell viability was assessed by using the Cell Counting Kit-8 (CCK-8) assay. Gene expression level of NFAT5 was determined using real-time quantitative polymerase chain reaction (qPCR). Protein expression levels of NFAT5, NF-κB p65, and α-smooth muscle actin (α-SMA) and the association of NFAT5 with the NF-κB p65 subunit were measured by Western blot analysis and a co-immunoprecipitation assay, respectively. The cellular distribution of NFAT5 and NF-κB p65 was examined by triple immunofluorescence staining. At 24 h after UVB exposure, cell viability significantly decreased in a dose-dependent manner, and UVB light (15 and 20 mJ/cm 2 ) significantly increased the ROS generation. UVB irradiation increased NFAT5 mRNA and protein levels and increased phosphorylation of NF-κB in HLE-B3 cells. α-SMA protein levels were increased in the irradiated cells. In addition, NFAT5 and NF-κB translocated from the cytoplasm to the nucleus, and binding between the p65 subunit and NFAT5 was increased. Exposure to UVB radiation induces nuclear translocation and stimulates binding between NFAT5 and NF-κB proteins in HLE-B3 cells. These interactions may form part of the biochemical mechanism of cataractogenesis in UVB-irradiated HLECs.
Directory of Open Access Journals (Sweden)
Endoh Hiroshi
2010-02-01
Full Text Available Abstract Background Programmed nuclear death (PND, which is also referred to as nuclear apoptosis, is a remarkable process that occurs in ciliates during sexual reproduction (conjugation. In Tetrahymena thermophila, when the new macronucleus differentiates, the parental macronucleus is selectively eliminated from the cytoplasm of the progeny, concomitant with apoptotic nuclear events. However, the molecular mechanisms underlying these events are not well understood. The parental macronucleus is engulfed by a large autophagosome, which contains numerous mitochondria that have lost their membrane potential. In animals, mitochondrial depolarization precedes apoptotic cell death, which involves DNA fragmentation and subsequent nuclear degradation. Results We focused on the role of mitochondrial apoptosis-inducing factor (AIF during PND in Tetrahymena. The disruption of AIF delays the normal progression of PND, specifically, nuclear condensation and kilobase-size DNA fragmentation. AIF is localized in Tetrahymena mitochondria and is released into the macronucleus prior to nuclear condensation. In addition, AIF associates and co-operates with the mitochondrial DNase to facilitate the degradation of kilobase-size DNA, which is followed by oligonucleosome-size DNA laddering. Conclusions Our results suggest that Tetrahymena AIF plays an important role in the degradation of DNA at an early stage of PND, which supports the notion that the mitochondrion-initiated apoptotic DNA degradation pathway is widely conserved among eukaryotes.
Qin, Jun; He, Yue; Duan, Ming; Luo, Meng
2017-05-01
We explored the effects of Nuclear Factor-E2-related factor 2 (Nrf2) and Heme Oxygenase 1 (HO-1) on splanchnic hemodynamics in portal hypertensive rats. Experimental cirrhosis with portal hypertension was induced by intraperitoneal injection of carbon tetrachloride. The expression of proteins was examined by immunoblotting. Hemodynamic studies were performed by radioactive microspheres. The vascular perfusion system was used to measure the contractile response of mesentery arterioles in rats. Nrf2 expression in the nucleus and HO-1 expression in cytoplasm was significantly enhanced in portal hypertensive rats. Portal pressure, as well as regional blood flow, increased significantly in portal hypertension and can be blocked by tin protoporphyrin IX. The expression of endogenous nitric oxide synthase and vascular endothelial growth factors increased significantly compared to normal rats, while HO-1 inhibition decreased the expression of these proteins significantly. The contractile response of mesenteric arteries decreased in portal hypertension, but can be partially recovered through tin protoporphyrin IX treatment. The expression of Nrf2/HO-1 increased in mesenteric arteries of portal hypertensive rats, which was related to oxidative stress. HO-1was involved in increased portal pressure and anomaly splanchnic hemodynamics in portal hypertensive rats. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Souza, J.A.M. de; Glardon, C.; Schmidt, R.M.
1981-01-01
The main factors in the construction and in the operation of nuclear power plants that affect the final energy generation cost are presented. The structure of the energy generation cost, of the nuclear fuel cost and the total investment are studied. (E.G.) [pt
Potential human factors research relating to modern technology in nuclear power plants
International Nuclear Information System (INIS)
Ketchel, J.; Fink, R.; Hanes, L.; Williges, R.; Williges, B.
1994-01-01
This paper discusses proposed human factors research to address advanced human-machine interface technology in nuclear power plants. It relates to a current EPRI project to identify a prioritized list of specific research issues that could be assessed to improve control room and other user interface areas. The project seeks to bridge the gap between the functional requirements of advanced design initiatives and the human factors research needed to support them. It seeks to identify potential benefits to be expected, as well as potential problems that might be introduced by advanced technology. It provides an organized approach to identifying human factors research needs, information already available, and measures of performance and effectiveness that might be used to assess the value of potential improvements. Those parts of the proposed plan that are subsequently approved by EPRI management and by the utility advisory committee will provide a basis for recommending research priorities
An evaluation of factors affecting the in vitro bioassay for erythropoietin
International Nuclear Information System (INIS)
Dunn, C.D.R.; Napier, J.A.F.
1975-01-01
Two main aspects of the in vitro mouse foetal liver cell assay for erythroid stimulating factor (ESF) in human sera have been investigated. The haem extraction process has been shown to give specific and quantitative recovery of 59 Fe labelled haem from haemoglobin thus confirming that the material assayed in human sera is stimulating the synthesis of this protein. The extraction procedure can be simplified considerably by prior mixing of the reagents without significantly influencing the results. Several serum constituents (citrate, testosterone, B 12 , folic acid and iron) have been investigated over a range of concentrations for possible effects on the cultures. Generally only small effects on haem synthesis were observed. It is concluded that variations in the levels of these factors in sera from treated patients will not produce any significant alterations in the estimated ESF concentrations. (author)
DEFF Research Database (Denmark)
Troelsen, J T; Mitchelmore, C; Sjöström, H
1994-01-01
Lactase-phlorizin hydrolase (LPH) and sucrase-isomaltase (SI) are enterocyte-specific gene products. The identification of regulatory cis-elements in the promoter of these two genes has enabled us to carry out comparative studies of the corresponding intestinal-specific nuclear factors (NF-LPH1...... and SIF1-BP). Electrophoretic mobility shift assays demonstrated that the two nuclear factors compete for binding on the same cis-elements. The molecular size of the DNA binding polypeptide is estimated to be approximately 50 kDa for both factors. In the native form the factors are found as 250 k......Da oligomeric complexes. Based on these results NF-LPH1 and SIF1-BP are suggested to be either identical or closely related molecules....
Model calculating annual mean atmospheric dispersion factor for coastal site of nuclear power plant
Institute of Scientific and Technical Information of China (English)
无
2001-01-01
This paper describes an atmospheric dispersion field experiment performed on the coastal site of nuclear power plant in the east part of China during 1995 to 1996. The three-dimension joint frequency are obtained by hourly observation of wind and temperature on a 100m high tower; the frequency of the “event day of land and sea breezes” are given by observation of surface wind and land and sea breezes; the diffusion parameters are got from measurements of turbulent and wind tunnel simulation test.A new model calculating the annual mean atmospheric dispersion factor for coastal site of nuclear power plant is developed and established.This model considers not only the effect from mixing release and mixed layer but also the effect from the internal boundary layer and variation of diffusion parameters due to the distance from coast.The comparison between results obtained by the new model and current model shows that the ratio of annual mean atmospheric dispersion factor gained by the new model and the current one is about 2.0.
International Nuclear Information System (INIS)
Sone, Yoshie; Ito, Masahiko; Shirakawa, Hideki; Shikano, Tomohide; Takeuchi, Hiroyuki; Kinoshita, Katsuyuki; Miyazaki, Shunichi
2005-01-01
Phospholipase C-zeta (PLCζ), a strong candidate of the egg-activating sperm factor, causes intracellular Ca 2+ oscillations and egg activation, and is subsequently accumulated into the pronucleus (PN), when expressed in mouse eggs by injection of RNA encoding PLCζ. Changes in the localization of expressed PLCζ were investigated by tagging with a fluorescent protein. PLCζ began to translocate into the PN formed at 5-6 h after RNA injection and increased there. Observation in the same embryo revealed that PLCζ in the PN dispersed to the cytoplasm upon nuclear envelope breakdown and translocated again into the nucleus after cleavage. The dynamics was found in the second mitosis as well. When RNA was injected into fertilization-originated 1-cell embryos or blastomere(s) of 2-8-cell embryos, the nuclear localization of expressed PLCζ was recognized in every embryo up to blastocyst. Thus, PLCζ exhibited alternative cytoplasm/nucleus localization during development. This supports the view that the sperm factor could control cell cycle-dependent generation of Ca 2+ oscillations in early embryogenesis
Development of a Pilot Program for Human Factors Management in Operating Nuclear Power plants
International Nuclear Information System (INIS)
Lee, Jung-Woon; Lee, Yong-Hee; Jang, Tong-Il; Kim, Dae-Ho
2007-01-01
The human factors of operating NPPs have been reviewed as a part of Periodic Safety Reviews (PSRs). This human factors PSR covers a wide range of human factors including control room man-machine interfaces (MMIs), procedures, working conditions, qualification, training, information requirements and workload. Korea Atomic Energy Research Institute (KAERI) has performed human factors PSRs from the first PSR for Kori 1. It was determined in 2005 that for a Continuous Operation of the Korean NPPs an enhanced PSR should be performed and issues raised from the PSRs should be resolved. From the results of the PSR for Kori 1, several safety enhancement issues related to human factors were raised. KAERI is working on a resolution of some of the human factors issues for the Korea Hydro and Nuclear Power Co. (KHNP). As a part of the resolution, we are developing a human factors management program (HFMP) for Kori 1. This paper introduces the status of our development of HFMP
Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A
2008-10-01
The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.
International Nuclear Information System (INIS)
Wilpert; Maimer, H.; Miller, R.; Fahlbruch, B.; Leiber, I.; Szameitat, S.; Baggen, R.; Gans, A.; Becker, G.
1998-01-01
The research project 'Implementation and Test of Proposals to integrate Human Factors in Reporting and Causal Analysis in Nuclear Power Plants' ('Implementation and Test', SR 2039/8) is based on two antecedent projects: 'Reporting System' (SR 2039/1) and 'Causal Analysis' (SR 2039/2). The project 'Implementation and Test' conducted various tests and introductory programs in cooperation with different target groups concerning the event analysis methodology 'SOL - Safety through Organizational Learning': Regulators, consultant organizations, union/works councillors and utilities. Thus, SOL was concurrently optimized and [apted for the practice in the German nuclear power industry. SOL was also validated in a German nuclear power plant using a concrete event. Results of the 'Implementation and Test' project demonstrate that SOL is fit to conduct event analyses practicably and economically with appropriate comprehensiveness and depth. SOL facilitates the identification of relevant contributing factors of events. This report concludes with various concrete proposals for the further development of the Program of the Federal Ministry of Environment, Nature Protection and Reactor Safety (BMU) and the Federal Agency of R[iation Protection (BfS) concerning 'The Contribution of Humans to Safety of Nuclear Power Plants'. (orig.) [de
International Nuclear Information System (INIS)
Xu Shoulv; Yao Weida; Dou Yikang; Lin Shaoxuan; Cao Yenan; Zhou Quanfu; Zheng Jiong; Zhang Ming
2009-04-01
In 2001, after 10 years' operation, Qinshan Nuclear Power Plant (Q1) started to carry out periodic safety review (PSR) based on a nuclear safety guideline, Periodic Safety Review for Operational Nuclear Power Plants (HAF0312), issued by National Nuclear Safety Administration of China (NNSA). Entrusted by the owner of Q1, Shanghai Nuclear Engineering Research and Design Institute (SNERDI) implemented reviews of three key safety factors including safety analysis, equipment qualification and ageing. PSR was a challenging work in China at that time and through three years' research and practice, SNERDI summarized a systematic achievement for the review including review methodology, scoping, review contents and implementation steps, etc.. During the process of review for the three safety factors, totally 148 review reports and 341 recommendations for corrections were submitted to Q1. These reports and recommendations have provided guidance for correction actions as follow-up of PSR. This paper focuses on technical aspects to carry out PSR for the above-mentioned three safety factors, including review scoping, contents, methodology and main steps. The review technology and relevant experience can be taken for reference for other NPPs to carry out PSR. (authors)
Directory of Open Access Journals (Sweden)
Arnaud F. Kouam
2017-09-01
Full Text Available Drug-induced liver injury (DILI is a major clinical problem where natural compounds hold promise for its abrogation. Khaya grandifoliola (Meliaceae is used in Cameroonian traditional medicine for the treatment of liver related diseases and has been studied for its hepatoprotective properties. Till date, reports showing the hepatoprotective molecular mechanism of the plant are lacking. The aim of this study was therefore to identify compounds from the plant bearing hepatoprotective activity and the related molecular mechanism by assessing their effects against acetaminophen (APAP-induced hepatotoxicity in normal human liver L-02 cells line. The cells were exposed to APAP (10 mM or co-treated with phytochemical compounds (40 μM over a period of 36 h and, biochemical and molecular parameters assessed. Three known limonoids namely 17-epi-methyl-6-hydroxylangolensate, 7-deacetoxy-7-oxogedunin and deacetoxy-7R-hydroxygedunin were identified. The results of cells viability and membrane integrity, reactive oxygen species generation and lipid membrane peroxidation assays, cellular glutathione content determination as well as expression of cytochrome P450 2E1 demonstrated the protective action of the limonoids. Immunoblotting analysis revealed that limonoids inhibited APAP-induced c-Jun N-terminal Kinase phosphorylation (p-JNK, mitochondrial translocation of p-JNK and Bcl2-associated X Protein, and the release of Apoptosis-inducing Factor into the cytosol. Interestingly, limonoids increased the expression of Mitogen-activated Protein Kinase Phosphatase (Mkp-1, an endogenous inhibitor of JNK phosphorylation and, induced the nuclear translocation of Nuclear Factor Erythroid 2-related Factor-2 (Nrf2 and decreased the expression of Kelch-like ECH-associated Protein-1. The limonoids also reversed the APAP-induced decreased mRNA levels of Catalase, Superoxide Dismutase-1, Glutathione-S-Transferase and Methionine Adenosyltransferase-1A. The obtained results
Human factors evaluation of man-machine interface for periodic safety review of nuclear power plants
International Nuclear Information System (INIS)
Lee, Yong Hee; Lee, Jung Woon; Park, Jae Chang; Hwang, In Koo; Lee, Hyun Cheol; Jang, Tong Il; Ku, Jin Young; Kim, Soo Jin
2004-12-01
This report describes the research results of human factors assessment on the MMI(Man Machine Interface) equipment as part of Periodic Safety Review(PSR) of Nuclear Power Plants(NPPs). As MMI is a key factor among human factors to be reviewed in PSR, we reviewed the MMI components of nuclear power plants in aspect of human factors engineering. The availability, suitability, and effectiveness of the MMI devices were chosen to be reviewed. The MMI devices were investigated through the review of design documents related to the MMI, survey of control panels, evaluation of experts, and experimental assessment. Checklists were used to perform this assessment and record the review results. The items mentioned by the expert comments to review in detail in relation with task procedures were tested by experiments with operators' participation. For some questionable issues arisen during this MMI review, operator workload and possibility of errors in operator actions were analysed. The reviewed MMI devices contain MCR(Main Control Room), SPDS(Safety Parameter Display System), RSP(Remote Shutdown Panel), and the selected LCBs(Local Control Boards) importantly related to safety. As results of the assessments, any significant problem challenging the safety was not found on human factors in the MMI devices. However, several small items to be changed and improved in suitability of MMI devices were discovered. An action plan is recommended to accommodate the suggestions and review comments. It will enhance the plant safety on MMI area
Human factors survey of advanced instrumentation and controls technologies in nuclear plants
International Nuclear Information System (INIS)
Carter, R.J.
1992-01-01
A survey of advanced instrumentation and controls (I ampersand C) technologies and associated human factors issues in the US and Canadian nuclear industries was carried out by a team from Oak Ridge national laboratory to provide background for the development of regulatory policy, criteria, and guides for review of advanced I ampersand C systems as well as human engineering guidelines for evaluating these systems. The survey found those components of the US nuclear industry surveyed to be quite interested in advanced I ampersand C, but very cautious in implementing such systems in nuclear facilities and power plants. The trend in the facilities surveyed is to experiment cautiously when there is an intuitive advantage or short-term payoff. In the control room, the usual practice is direct substitution of digital and microprocessor-based instruments or systems that are functionally identical to the analog instruments or systems being replaced. The most advanced I ampersand C systems were found in the Canadian CANDU plants, where the newest plant has digital system in almost 100% of its control systems and in over 70% of its plant protection system. The hypothesis that properly 'introducing digital systems increases safety' is supported by the Canadian experience. The performance of these digital systems was achieved using an appropriate quality assurance program for the software development. The ability of digital systems to detect impending failures and initiate a fail-safe action, is a significant safety issue that should be of special interest to every US utility as well as to the US Nuclear Regulatory Commission. (orig.)
Sun, Min; Long, Juan; Yi, Yuxin; Xia, Wei
2017-10-28
Insulin-like growth factor-binding protein (IGFBP)-5 is a secreted protein that binds to IGFs and modulates IGF actions, as well as regulates cell proliferation, migration, and apoptosis independent of IGF. Proper cellular localization is critical for the effective function of most signaling molecules. In previous studies, we have shown that the nuclear IGFBP-5 comes from ER-cytosol retro-translocation. In this study, we further investigated the pathway mediating IGFBP-5 nuclear import after it retro-translocation. Importin-α5 was identified as an IGFBP-5-interacting protein with a yeast two-hybrid system, and its interaction with IGFBP-5 was further confirmed by GST pull down and co-immunoprecipitation. Binding affinity of IGFBP-5 and importins were determined by surface plasmon resonance (IGFBP-5/importin-β: K D =2.44e-7, IGFBP-5/importin-α5: K D =3.4e-7). Blocking the importin-α5/importin-β nuclear import pathway using SiRNA or dominant negative impotin-β dramatically inhibited IGFBP-5-EGFP nuclear import, though importin-α5 overexpress does not affect IGFBP-5 nuclear import. Furthermore, nuclear IGFBP-5 was quantified using luciferase report assay. When deleted the IGFBP-5 nuclear localization sequence (NLS), IGFBP-5 ΔNLS loss the ability to translocate into the nucleus and accumulation of IGFBP-5 ΔNLS was visualized in the cytosol. Altogether, our findings provide a substantially evidence showed that the IGFBP-5 nuclear import is mediated by importin-α/importin-β complex, and NLS is critical domain in IGFBP-5 nuclear translocation.
Liby, Karen T; Sporn, Michael B
2012-10-01
We review the rationale for the use of synthetic oleanane triterpenoids (SOs) for prevention and treatment of disease, as well as extensive biological data on this topic resulting from both cell culture and in vivo studies. Emphasis is placed on understanding mechanisms of action. SOs are noncytotoxic drugs with an excellent safety profile. Several hundred SOs have now been synthesized and in vitro have been shown to: 1) suppress inflammation and oxidative stress and therefore be cytoprotective, especially at low nanomolar doses, 2) induce differentiation, and 3) block cell proliferation and induce apoptosis at higher micromolar doses. Animal data on the use of SOs in neurodegenerative diseases and in diseases of the eye, lung, cardiovascular system, liver, gastrointestinal tract, and kidney, as well as in cancer and in metabolic and inflammatory/autoimmune disorders, are reviewed. The importance of the cytoprotective Kelch-like erythroid cell-derived protein with CNC homology-associated protein 1/nuclear factor (erythroid-derived 2)-like 2/antioxidant response element (Keap1/Nrf2/ARE) pathway as a mechanism of action is explained, but interactions with peroxisome proliferator-activated receptor γ (PARPγ), inhibitor of nuclear factor-κB kinase complex (IKK), janus tyrosine kinase/signal transducer and activator of transcription (JAK/STAT), human epidermal growth factor receptor 2 (HER2)/ErbB2/neu, phosphatase and tensin homolog (PTEN), the phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) pathway, mammalian target of rapamycin (mTOR), and the thiol proteome are also described. In these interactions, Michael addition of SOs to reactive cysteine residues in specific molecular targets triggers biological activity. Ultimately, SOs are multifunctional drugs that regulate the activity of entire networks. Recent progress in the earliest clinical trials with 2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oic acid (CDDO) methyl ester (bardoxolone methyl) is also
Energy Technology Data Exchange (ETDEWEB)
Jeong, Kwan-Seong [Korea Atomic Energy Research Institute, 1045 Daedeok-daero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of)], E-mail: ksjeongl@kaeri.re.kr; Lim, Hyeon-Kyo [Chungbuk National University, 410 Sungbong-ro, Heungduk-gu, Cheongju, Chungbuk 361-763 (Korea, Republic of)
2009-10-15
The decommissioning of nuclear facilities must be accomplished according to its structural conditions and radiological characteristics. An effective risk analysis requires basic knowledge about possible risks, characteristics of potential hazards, and comprehensive understanding of the associated cause-effect relationships within a decommissioning for nuclear facilities. The hazards associated with a decommissioning plan are important not only because they may be a direct cause of harm to workers but also because their occurrence may, indirectly, result in increased radiological and non-radiological hazards. Workers need to be protected by eliminating or reducing the radiological and non-radiological hazards that may arise during routine decommissioning activities as well as during accidents. Therefore, to prepare the safety assessment for decommissioning of nuclear facilities, the radiological and non-radiological hazards should be systematically identified and classified. With a semantic differential method of screening factor and risk perception factor, the radiological and non-radiological hazards are screened and identified.
International Nuclear Information System (INIS)
Tokarskaya, Z.B.; Khokhryakov, V.T.; Okladnikova, N.D.; Belyaeva, Z.D.; Zhuntova, G.V.; Fleck, C.M.; Schollnberger, H.; Drozhko, E.G.
1998-01-01
A study is reported which is a continuation of a previous investigation of lung cancer incidence in workers at a nuclear enterprise and its relation to three basic etiological factors: the body burden due to 239 Pu, chronic external gamma irradiation, and smoking. Whereas previously each of the factors was assessed separately, in the present study the attempt was made to assess the interaction of the factors. A statistical analysis of the data revealed that for the following pairs of factors a superposition effect could be seen: external gamma irradiation and 239 Pu body burden; external gamma irradiation and a medium level of smoking; and 239 Pu body burden and a medium level of smoking. (A.K.)
Nuclear energy 1985: Nuclear power as an economic factor of growing importance
International Nuclear Information System (INIS)
Anon.
1985-01-01
Summary of the results of the Technical Sessions and Poster Sessions of the ten Technical Sections: Reactor physics; thermodynamics and fluid dynamics; safety of nuclear facilities; fuel cycle and waste management; fuel elements and fuel element materials; components and component materials; quality assurance; construction and operation of nuclear facilities; fusion technology; energy systems - energy industry; atomic law, radiation protection law, law on the protection against misances, related fields of law. Separate records are available for each paper. (HP) [de
International Nuclear Information System (INIS)
Quintana, E.E.; Tossi, M.H.; Telleria, D.M.
1990-01-01
Collective doses produced during the normal working of the Atucha I Nuclear Power Plant are calculated using annual atmospheric factors. This work studies the behaviour of the dilution factors in different periods of the year in order to fit the calculated dose model applying factors from seasonal, monthly or weekly periods. The Radiation Protection Group of the C.N.E.A. have carried out continuous environmental monitoring in the surroundings of the Atucha I Nuclear Power Plant. These studies include the measurement of air tritium concentration, radionuclide that is found principally as tritiated water vapour. This isotope, normally released by the nuclear power plant was used as a tracer to assess the atmospheric dilution factors. Factors were calculated by two methods: an experimental one, based on environmental measurements of the tritium concentration in the surroundings of the nuclear power plant and another one by applying a theoretical model based on information from the micrometeorological tower located in the mentioned place. To carry out the environmental monitoring, four monitoring stations in the surroundings of the power plant were chosen. Three of them are approximately one kilometer from the plant and the fourth is 7.5 km away, near the city of Lima. To condense and collect the atmospheric water vapour, an overcooling system was used. The measurement was performed by liquid scintillation counting, previous alkaline electrolytical enrichment of the samples. The theoretical model uses hourly values of direction and wind intensity, as well as the atmospheric dispersive properties. Values obtained during the period 1976 to 1988 allowed, applying statistical tests, to validate the theoretical model and to observe seasonal variation of the dilution factors throughout the same year and between different years. Finally, results and graphics are presented showing that the behaviour of the dilution factors in different periods of the year. It is recommended to
Influence factors on etching rate of PET nuclear pore membrane
International Nuclear Information System (INIS)
Zuo Zhenzhong; Wu Zhendong; Liang Haiying; Ju Wei; Chen Dongfeng; Fu Yuanyong; Qu Guopu
2014-01-01
Background: The nuclear pore membrane is a kind of liquid filtration material manufactured by irradiation and chemical etching. Various conditions in etch process have a great influence on etch rate. Purpose: The influence factors of concentration and temperature of etch solution and the irradiation energy of heavy ions on etch rate was studied. Methods: Four layers of PET (polyethylene terephthalate) films were stacked together and were irradiated with 140-MeV 32 S ions at room temperature under vacuum conditions. Utilizing conductivity measurement technique, the electrical current changes through the u:radiated PET film were monitored during etching, from which the breakthrough time and therefore the track etching rate was calculated. Results: The results show that there is an exponential correlation between etch rate and temperature, and a linear correlation between etch rate and concentration. The track etching rate increases linearly with energy loss rate. Empirical formula for the bulk etching rate as a function of etchant concentration and temperature was also established via fitting of measurements. Conclusion: It is concluded that by using 1.6-MeV·u -1 32 S ions, PET nuclear pore membrane with cylindrical pore shape can be prepared at 85℃ with etchant concentration of l mol·L -1 . (authors)
Analysis of chemical factors affecting marine ecosystem around nuclear power plant
International Nuclear Information System (INIS)
Chun, Kwan Sik; Choi, Yoon Dong; Chun, Ki Jeong; Kim, Jin Kyu; Jung, Kyeong Chai; Lee, Yeong Keun; Park, Hyo Kook
1994-06-01
The ecological data of the coastal area of Youngkwang nuclear power plant from 1987 to 1993 were comprehensively analyzed, and various physical and chemical properties of sea water and sediments were measured. Major factors affecting phytoplankton standing crops were suspended substances, nitrate, and silicate. The contents of iron, chromium, copper, and sulfur in sediments sampled from the discharge channel were slightly higher than those in the other areas. In order to qantify the chemical impacts on marine ecosystem, it is desirable that a systematic survey be made through the whole year cycle to assure the consistency and confidence of the related data. (Author)
Katz, D; Niederberger, C; Slaughter, G R; Cooney, A J
1997-10-01
Nuclear receptors, such as those for androgens, estrogens, and progesterones, control many reproductive processes. Proteins with structures similar to these receptors, but for which ligands have not yet been identified, have been termed orphan nuclear receptors. One of these orphans, germ cell nuclear factor (GCNF), has been shown to be germ cell specific in the adult and, therefore, may also participate in the regulation of reproductive functions. In this paper, we examine more closely the expression patterns of GCNF in germ cells to begin to define spatio-temporal domains of its activity. In situ hybridization showed that GCNF messenger RNA (mRNA) is lacking in the testis of hypogonadal mutant mice, which lack developed spermatids, but is present in the wild-type testis. Thus, GCNF is, indeed, germ cell specific in the adult male. Quantitation of the specific in situ hybridization signal in wild-type testis reveals that GCNF mRNA is most abundant in stage VII round spermatids. Similarly, Northern analysis and specific in situ hybridization show that GCNF expression first occurs in testis of 20-day-old mice, when round spermatids first emerge. Therefore, in the male, GCNF expression occurs postmeiotically and may participate in the morphological changes of the maturing spermatids. In contrast, female expression of GCNF is shown in growing oocytes that have not completed the first meiotic division. Thus, GCNF in the female is expressed before the completion of meiosis. Finally, the nature of the two different mRNAs that hybridize to the GCNF complementary DNA was studied. Although both messages contain the DNA binding domain, only the larger message is recognized by a probe from the extreme 3' untranslated region. In situ hybridization with these differential probes demonstrates that both messages are present in growing oocytes. In addition, the coding region and portions of the 3' untranslated region of the GCNF complementary DNA are conserved in the rat.
Lessons Learned from Human Factor Technical Support for Nuclear Power Plants
International Nuclear Information System (INIS)
Jung, Yeon Sub; Song, Tae Young
2011-01-01
NETEC is on the frontier to support Korean nuclear power plants. Requests of service are distributed through web based system. Human factor requests are occasionally posted. This paper analyzes interesting human factors requests/responses serviced, and summarizes the lesson learned. Subjects of the service include man machine interface, equipment label, procedure writing, procedure adherence, BISI, hand switch and alarm tile. Specifically the man machine interface is related to control command generated by acknowledge button, arrangement of switches. Procedure writing is about how to write contingency actions with proper numbering scheme. BISI is analyzed in view of automation level. Alarm tile is about how to handle the common alarm tile originated from local alarm boards. These topics seem to be legacies of past technology. Even though there are still human engineering discrepancies, these have been less evaluated because the topics need knowledge of other field domains
Energy Technology Data Exchange (ETDEWEB)
Thomas Ulrich; Ronald Boring; William Phoenix; Emily Dehority; Tim Whiting; Jonathan Morrell; Rhett Backstrom
2012-08-01
The United States (U.S.) nuclear industry, like similar process control industries, has moved toward upgrading its control rooms. The upgraded control rooms typically feature digital control system (DCS) displays embedded in the panels. These displays gather information from the system and represent that information on a single display surface. In this manner, the DCS combines many previously separate analog indicators and controls into a single digital display, whereby the operators can toggle between multiple windows to monitor and control different aspects of the plant. The design of the DCS depends on the function of the system it monitors, but revolves around presenting the information most germane to an operator at any point in time. DCSs require a carefully designed human system interface. This report centers on redesigning existing DCS displays for an example chemical volume control system (CVCS) at a U.S. nuclear power plant. The crucial nature of the CVCS, which controls coolant levels and boration in the primary system, requires a thorough human factors evaluation of its supporting DCS. The initial digital controls being developed for the DCSs tend to directly mimic the former analog controls. There are, however, unique operator interactions with a digital vs. analog interface, and the differences have not always been carefully factored in the translation of an analog interface to a replacement DCS. To ensure safety, efficiency, and usability of the emerging DCSs, a human factors usability evaluation was conducted on a CVCS DCS currently being used and refined at an existing U.S. nuclear power plant. Subject matter experts from process control engineering, software development, and human factors evaluated the DCS displays to document potential usability issues and propose design recommendations. The evaluation yielded 167 potential usability issues with the DCS. These issues should not be considered operator performance problems but rather opportunities
Naturally Occurring Nrf2 Activators: Potential in Treatment of Liver Injury
Directory of Open Access Journals (Sweden)
Ravirajsinh N. Jadeja
2016-01-01
Full Text Available Oxidative stress plays a major role in acute and chronic liver injury. In hepatocytes, oxidative stress frequently triggers antioxidant response by activating nuclear erythroid 2-related factor 2 (Nrf2, a transcription factor, which upregulates various cytoprotective genes. Thus, Nrf2 is considered a potential therapeutic target to halt liver injury. Several studies indicate that activation of Nrf2 signaling pathway ameliorates liver injury. The hepatoprotective potential of naturally occurring compounds has been investigated in various models of liver injuries. In this review, we comprehensively appraise various phytochemicals that have been assessed for their potential to halt acute and chronic liver injury by enhancing the activation of Nrf2 and have the potential for use in humans.
International Nuclear Information System (INIS)
Fu Geyan; Zhu Qirong
1998-11-01
It is pointed out that the main reason making nuclear power plants reactors leak is the vibration of internals of reactors. The factors which lead the vibration all have randomness and obscureness. The obscure reliability theory is introduced to the vibration system of internals of nuclear power reactor. Based on a quantity of designing and moving data, the obscure factors effecting the vibration reliability of the internals of nuclear power plant reactor are analyzed and the anti-vibration reliability criteria and the evaluating model are given. And the anti-vibration reliability measures are advanced from different quarters of the machine design and building, the thermohydraulics design, the control of reactivity, etc.. They may benefit the theory and practice for building and perfecting the vibration obscure reliability model of the reactor internals
International Nuclear Information System (INIS)
Martinez-Garcia, G.; Gadrat, S.; Crochet, P.
2007-02-01
We investigate the effect of the so-called anomalous baryon/meson enhancement to the nuclear modification factor of non-photonic electrons in Au+Au collisions at √s NN = 200 GeV. It is demonstrated that an enhancement of the charm baryon/meson ratio, as it is observed for non-strange and strange hadrons, can be responsible for a part of the amplitude of the nuclear modification factor of non-photonic electrons. About half of the measured suppression of non-photonic electrons in the 2 - 4 GeV/c p t range can be explained by a charm baryon/meson enhancement of 5. This contribution to the non-photonic electron nuclear modification factor has nothing to do with heavy quark energy loss. (authors)
International Nuclear Information System (INIS)
Adnan, H.; Sulaiman, M.S.; Yusof, M.H.; Ali, I.
2014-01-01
Conclusion: • The primary contribution of this study is to assess the influence of virtual mode as a KM medium in Nuclear Malaysia. • Direct relationship between the researchers and the used of virtual mode in the knowledge sharing process. • Finding reveals that virtual mode contributes significant factors in influencing researchers’ knowledge sharing behaviour. • The findings from the study may be used by the management of Nuclear Malaysia to improve or enhance the capacity of virtual mode provided by the organisation
Human factors and nuclear space technology in long-term exploration
International Nuclear Information System (INIS)
Brown-VanHoozer, S.A.; VanHoozer, W.R.
2000-01-01
Allocation of manual versus automated tasks for operation and maintenance of nuclear power systems in space will be crucial at the onset and at the return of a space flight. Such factors as space adaptation syndrome (SAS), a temporary space motion sickness that has affected 40 to 50% of crew members on past space flights, can result in lost effort ranging from a few hours to a full day. This could have a significant impact on manual performance where high levels of execution are likely to be required in the very early stages of the mission. Other considerations involving higher-level behavioral phenomena such as interpersonal and group processes, individual belief systems, social and motivational factors, and (subjective) cognitive function have received little attention; nevertheless these will be essential elements for success in long-term exploration. Understanding that long-term space flight missions may create groups that become unique societies distinct unto themselves will test current ethical, moral, and social belief systems, requiring one to examine the amalgamation as well as organizational structures for the safety and balance of the crew
Evaluation of response factors for seismic probabilistic safety assessment of nuclear power plants
International Nuclear Information System (INIS)
Ebisawa, K.; Abe, K.; Muramatsu, K.; Itoh, M.; Kohno, K.; Tanaka, T.
1994-01-01
This paper presents a method for evaluating 'response factors' of components in nuclear power plants for use in a seismic probabilistic safety assessment (PSA). The response factor here is a measure of conservatism included in response calculations in seismic design analysis of components and is defined as a ratio of conservative design resonse to actual response. This method has the following characteristic features: (1) The components are classified into several groups based on the differences in their location and in the vibration models used in design response analyses; (2) the response factors are decomposed into subfactors corresponding to the stages of the seismic response analyses in the design practices; (3) the response factors for components are calculated as products of subfactors; (4) the subfactors are expressed either as a single value or as a function of parameters that influence the response of components. This paper describes the outline of this method and results from an application to a sample problem in which response factors were quantified for examples of components selected from the groups. (orig.)
Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.
Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K
2011-10-01
Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.
Esatbeyoglu, Tuba; Obermair, Betina; Dorn, Tabea; Siems, Karsten; Rimbach, Gerald; Birringer, Marc
2017-01-01
Taraxacum officinale, the common dandelion, is a plant of the Asteraceae family, which is used as a food and medical herb. Various secondary plant metabolites such as sesquiterpene lactones, triterpenoids, flavonoids, phenolic acids, coumarins, and steroids have been described to be present in T. officinale. Dandelion may exhibit various health benefits, including antioxidant, anti-inflammatory, and anticarcinogenic properties. We analyzed the leaves and roots of the common dandelion (T. officinale) using high-performance liquid chromatography/mass spectrometry to determine its sesquiterpene lactone composition. The main compound of the leaf extract taraxinic acid β-d-glucopyranosyl ester (1), a sesquiterpene lactone, was isolated and the structure elucidation was conducted by nuclear magnetic resonance spectrometry. The leaf extract and its main compound 1 activated the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) in human hepatocytes more significantly than the root extract. Furthermore, the leaf extract induced the Nrf2 target gene heme oxygenase 1. Overall, present data suggest that compound 1 may be one of the active principles of T. officinale.
Energy Technology Data Exchange (ETDEWEB)
Yang, Chih Wei; Yang, Li Chen [Institute of Nuclear Energy Research, Atomic Energy Council, Longtan (China)
2014-08-15
Most nuclear power plants (NPPs) in the world have an operating life of up to 40 years. The utility should prepare a comprehensive decommissioning plan with purpose to document and to display how decommissioning activities can be safely performed. In the past, most studies related to NPPs decommissioning planning put emphasis on technical issues, little attention have been given to human factors in decommissioning activities. In fact, human factors are a critical factor to successful NPPs decommissioning. NPPs decommissioning will face potential risks. These risks include not only dismantling and moving large equipment but also treating with the radioactive materials. Using information visualization system, such as virtual reality (VR) technology, for staff training can improve decommissioning work safety and economy. Therefore, this study presents a study using VR to solve real world problems in the nuclear plant decommissioning. Then appropriate cases for introducing VR systems are summarized and future prospects are given. This study assesses availability and performance of the work training system by using heuristic evaluation and actual experiment. In the result, block type of radiation visibility was found relatively better both in performance and person's preference than other types. The results presented in this paper illustrate the VR applications a NPP decommissioning perspective.
International Nuclear Information System (INIS)
Yang, Chih Wei; Yang, Li Chen
2014-01-01
Most nuclear power plants (NPPs) in the world have an operating life of up to 40 years. The utility should prepare a comprehensive decommissioning plan with purpose to document and to display how decommissioning activities can be safely performed. In the past, most studies related to NPPs decommissioning planning put emphasis on technical issues, little attention have been given to human factors in decommissioning activities. In fact, human factors are a critical factor to successful NPPs decommissioning. NPPs decommissioning will face potential risks. These risks include not only dismantling and moving large equipment but also treating with the radioactive materials. Using information visualization system, such as virtual reality (VR) technology, for staff training can improve decommissioning work safety and economy. Therefore, this study presents a study using VR to solve real world problems in the nuclear plant decommissioning. Then appropriate cases for introducing VR systems are summarized and future prospects are given. This study assesses availability and performance of the work training system by using heuristic evaluation and actual experiment. In the result, block type of radiation visibility was found relatively better both in performance and person's preference than other types. The results presented in this paper illustrate the VR applications a NPP decommissioning perspective
Nuclear energy an introduction to the concepts, systems, and applications of nuclear processes
Murray, Raymond
2001-01-01
Nuclear Energy, Fifth Edition provides nuclear engineers, plant designers and radiation physicists with a comprehensive overview of nuclear energy and its uses, discusses potential problems and provides an outlook for the futureNew and important trends are discussed including probabilistic safety analysis (PSA), deregulation of the electric power industry to permit competition in the supply of electricity; improvements in performance characteristics of nuclear power plants, such as capacity factor, production costs, and safety factors; storage and disposal of all types of radioactive w
DEFF Research Database (Denmark)
Sap, J; Muñoz, A; Schmitt, J
1989-01-01
Several recent observations, such as the identification of the cellular homologue of the v-erb-A oncogene as a thyroid-hormone receptor, have strongly implicated nuclear oncogenes in transcriptional control mechanisms. The v-erb-A oncogene blocks the differentiation of erythroid cells, and changes...
Nuclear energy and nuclear weapons proliferation
International Nuclear Information System (INIS)
1989-01-01
A summary of the report dispatched in the middle of 1978 by the Atlantic Council of United States, organized by North American citizens, is presented. The report considers the relation between the production of nucleoelectric energy and the capacity of proliferation of nuclear weapons. The factors which affect the grade of proliferation risk represented by the use of nuclear energy in the world comparing this risk with the proliferation risks independently of nuclear energy, are examined. (M.C.K.) [pt
Fanconi anemia FANCD2 and FANCI proteins regulate the nuclear dynamics of splicing factors.
Moriel-Carretero, María; Ovejero, Sara; Gérus-Durand, Marie; Vryzas, Dimos; Constantinou, Angelos
2017-12-04
Proteins disabled in the cancer-prone disorder Fanconi anemia (FA) ensure the maintenance of chromosomal stability during DNA replication. FA proteins regulate replication dynamics, coordinate replication-coupled repair of interstrand DNA cross-links, and mitigate conflicts between replication and transcription. Here we show that FANCI and FANCD2 associate with splicing factor 3B1 (SF3B1), a key spliceosomal protein of the U2 small nuclear ribonucleoprotein (U2 snRNP). FANCI is in close proximity to SF3B1 in the nucleoplasm of interphase and mitotic cells. Furthermore, we find that DNA replication stress induces the release of SF3B1 from nuclear speckles in a manner that depends on FANCI and on the activity of the checkpoint kinase ATR. In chromatin, both FANCD2 and FANCI associate with SF3B1, prevent accumulation of postcatalytic intron lariats, and contribute to the timely eviction of splicing factors. We propose that FANCD2 and FANCI contribute to the organization of functional domains in chromatin, ensuring the coordination of DNA replication and cotranscriptional processes. © 2017 Moriel-Carretero et al.
International Nuclear Information System (INIS)
Beith, D.M.; Shoemaker, E.M.; Horn, K.; Boush, D.
1988-01-01
Maintaining human factors conventions/practices that were established during the Detailed Control Design Review (DCRDR), is difficult if Human Factors Engineering (HFE) is not incorporated into the plant modification process. This paper presents the approach used at Carolina Power and Light's nuclear power plants that has successfully incorporated human factors engineering into their plant modification process. An HFE Design Guide or HFE Specification was developed which is used by the design engineers or plant engineering support groups in the preparation of plant modifications
Choosing the nuclear power option: Factors to be considered
International Nuclear Information System (INIS)
1998-01-01
A need was expressed by Member States for guidance on policy issues to be addressed by decision makers considering the introduction of nuclear power programmes. This publication has been prepared by the IAEA, on the basis of past experience with nuclear power programmes in Member States and the current realities of the world nuclear regime, to provide information on political, governmental, economic, financial, technical and safety issues associated with planning and implementing a nuclear power programme. It highlights the main areas in which policies must be developed as well as the roles and responsibilities of the government, the plant owner and the national industry. For those interested in examining some of the issues in more depth, a list of related IAEA publications is provided in the bibliography. It is hoped that this guide will serve a useful purpose in assisting decision makers and governments in Member States considering the introduction of nuclear power programmes
International Nuclear Information System (INIS)
Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir
2014-01-01
Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway
Energy Technology Data Exchange (ETDEWEB)
Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)
2014-07-18
Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.
International Nuclear Information System (INIS)
Tronea, M.; Ciurea, C.
2016-01-01
The paper presents the development of regulatory requirements in the area of human and organizational factors taking account of the lessons learned from major accidents in the nuclear industry and in particular of the factors that contributed to the Fukushima Daiichi accident and the improvement of the regulatory oversight of nuclear safety culture. New requirements have been elaborated by the National Commission for Nuclear Activities Control (CNCAN) on the nuclear safety policy of licencees for nuclear installations, on independent nuclear safety oversight, on safety conscious work environment and on the assessment of nuclear safety culture. The regulatory process for the oversight of nuclear safety culture within licencees’ organizations operating nuclear installations and the associated procedure and guidelines, based on the IAEA Safety Standards, have been developed in 2010-2011. CNCAN has used the 37 IAEA attributes for a strong safety culture, grouped into five areas corresponding to safety culture characteristics, as the basis for its regulatory guidelines providing support to the reviewers and inspectors, in their routine activities, for recognising and gathering information relevant to safety culture. The safety culture oversight process, procedure and guidelines are in process of being reviewed and revised to improve their effectiveness and to align with the current international practices, using lessons learned from the Fukushima Daiichi accident. Starting with July 2014, Romania has a National Strategy for Nuclear Safety and Security, which includes strategic objectives, associated directions for action and concrete actions for promoting nuclear safety culture in all the organizations in the nuclear sector. The progress with the implementation of this strategy with regard to nuclear safety culture is described in the paper. CNCAN started to define its own organizational culture model and identifying the elements that promote and support safety
Respiratory syncytial virus M2-1 protein induces the activation of nuclear factor kappa B
Energy Technology Data Exchange (ETDEWEB)
Reimers, Kerstin [Klinik fuer Plastische, Hand-und Wiederherstellungschirurgie, Podbielskistrasse 380, D-30659 Hannover (Germany); Buchholz, Katja [Institut fuer Medizinische Mikrobiologie, Otto-von-Guericke-Universitaet Magdeburg, Leipzigerstrasse 44, D-39120 Magdeburg (Germany); Werchau, Hermann [Institut fuer Medizinische Mikrobiologie, Otto-von-Guericke-Universitaet Magdeburg, Leipzigerstrasse 44, D-39120 Magdeburg (Germany)
2005-01-20
Respiratory syncytial virus (RSV) induces the production of a number of cytokines and chemokines by activation of nuclear factor kappa B (NF-{kappa}B). The activation of NF-{kappa}B has been shown to depend on viral replication in the infected cells. In this study, we demonstrate that expression of RSV M2-1 protein, a transcriptional processivity and anti-termination factor, is sufficient to activate NF-{kappa}B in A549 cells. Electromobility shift assays show increased NF-{kappa}B complexes in the nuclei of M2-1-expressing cells. M2-1 protein is found in nuclei of M2-1-expressing cells and in RSV-infected cells. Co-immunoprecipitations of nuclear extracts of M2-1-expressing cells and of RSV-infected cells revealed an association of M2-1 with Rel A protein. Furthermore, the activation of NF-{kappa}B depends on the C-terminus of the RSV M2-1 protein, as shown by NF-{kappa}B-induced gene expression of a reporter gene construct.
Hidalgo, María A; Romero, Alex; Figueroa, Jaime; Cortés, Patricia; Concha, Ilona I; Hancke, Juan L; Burgos, Rafael A
2005-01-01
Andrographolide, the major active component from Andrographis paniculata, has shown to possess anti-inflammatory activity. Andrographolide inhibits the expression of several proinflammatory proteins that exhibit a nuclear factor kappa B (NF-κB) binding site in their gene. In the present study, we analyzed the effect of andrographolide on the activation of NF-κB induced by platelet-activating factor (PAF) and N-formyl-methionyl-leucyl-phenylalanine (fMLP) in HL-60 cells differentiated to neutrophils. PAF (100 nM) and fMLP (100 nM) induced activation of NF-κB as determined by degradation of inhibitory factor B α (IκBα) using Western blotting in cytosolic extracts and by binding to DNA using electrophoretic mobility shift assay (EMSA) in nuclear extracts. Andrographolide (5 and 50 μM) inhibited the NF-κB-luciferase activity induced by PAF. However, andrographolide did not reduce phosphorylation of p38 MAPK or ERK1/2 and did not change IκBα degradation induced by PAF and fMLP. Andrographolide reduced the DNA binding of NF-κB in whole cells and in nuclear extracts induced by PAF and fMLP. Andrographolide reduced cyclooxygenase-2 (COX-2) expression induced by PAF and fMLP in HL-60/neutrophils. It is concluded that andrographolide exerts its anti-inflammatory effects by inhibiting NF-κB binding to DNA, and thus reducing the expression of proinflammatory proteins, such as COX-2. PMID:15678086
International Nuclear Information System (INIS)
Hwang, Yong Soo
2005-01-01
In response to the increasing emphasis being placed on the importance of international cooperation as part of global efforts to cope with growing non proliferation, and security concerns in the nuclear field, the Director General of the International Atomic Energy Agency (IAEA), Mohammed Elbaradei, appointed an international group of experts to consider possible multilateral approaches to the nuclear fuel cycle. The mandate of the Expert Group was three fold: · To identify and provide an analysis of issues and options relevant to multilateral approaches to the front and back ends of the nuclear fuel cycle; · To provide an overview of the policy, legal, security, economic, institutional and technological incentives and disincentives for cooperation in multilateral arrangements for the front and back ends of the nuclear fuel cycle; and · To provide a brief review of the historical and current experiences and analyses relating to multilateral fuel cycle arrangements relevant to the work of the Expert Group. The overall purpose was to assess MNAs in the framework of a double objective: strengthening the international nuclear non proliferation regime and making the peaceful uses of nuclear energy more economical and attractive. The Group identifies options for MNAs - options in terms of policy, institutional and legal factors - for those parts of the nuclear fuel cycle of greatest sensitivity from the point of view of proliferation risk. It also reflects the Groups deliberations on the corresponding benefits and disadvantages (pros and cons) of the various options and approaches. Although the Expert Group was able to agree to forward the resulting report to the Director General, it is important to note that the report does not reflect agreement by all of the experts on any of the options, nor a consensus assessment of their respective value. It is intended only to present options for MNAs, and to reflect on the range of considerations which could impact on the
International Nuclear Information System (INIS)
Anon.
1980-01-01
The committee concludes that the nature of the proliferation problem is such that even stopping nuclear power completely could not stop proliferation completely. Countries can acquire nuclear weapons by means independent of commercial nuclear power. It is reasonable to suppose if a country is strongly motivated to acquire nuclear weapons, it will have them by 2010, or soon thereafter, no matter how nuclear power is managed in the meantime. Unilateral and international diplomatic measures to reduce the motivations that lead to proliferation should be high on the foreign policy agenda of the United States. A mimimum antiproliferation prescription for the management of nuclear power is to try to raise the political barriers against proliferation through misuse of nuclear power by strengthening the Non-Proliferation Treaty, and to seek to raise the technological barriers by placing fuel-cycle operations involving weapons-usable material under international control. Any such measures should be considered tactics to slow the spread of nuclear weapons and thus earn time for the exercise of statesmanship. The committee concludes the following about technical factors that should be considered in formulating nuclear policy: (1) rate of growth of electricity use is a primary factor; (2) growth of conventional nuclear power will be limited by producibility of domestic uranium sources; (3) greater contribution of nuclear power beyond 400 GWe past the year 2000 can only be supported by advanced reactor systems; and (4) several different breeder reactors could serve in principle as candidates for an indefinitely sustainable source of energy
Hu, J.; Toki, H.; Wen, W.; Shen, H.
2010-03-01
The role of the form factor and short-range correlation in nuclear matter is studied within the relativistic Hartree-Fock approximation. We take, first, the mean-field approximation for meson fields and obtain the fluctuation terms of mesons to be used for the Fock energies. We introduce form factors in the meson-nucleon coupling vertices to take into account the finite-size effect of the nucleon. We use further the unitary correlation operator method for the treatment of the short-range correlation. The form factors of the size ( Λ ˜ 1.0 -2.0GeV) of the nucleon-nucleon interaction cut down largely the contribution of the ρ -meson in the Fock term. The short-range correlation effect is not large but has a significant effect on the pion and ρ -meson energies in the relativistic Hartree-Fock approximation for nuclear matter.
Quality factors in the life cycle of software oriented to safety systems in nuclear power plants
International Nuclear Information System (INIS)
Nunez McLeod, J.E.; Rivera, S.S.
1997-01-01
The inclusion of software in safety related systems for nuclear power plants, makes it necessary to include the software quality assurance concept. The software quality can be defined as the adjustment degree between the software and the specified requirements and user expectations. To guarantee a certain software quality level it is necessary to make a systematic and planned set of tasks, that constitute a software quality guaranty plan. The application of such a plan involves activities that should be performed all along the software life cycle, and that can be evaluated through the so called quality factors, due to the fact that the quality itself cannot be directly measured, but indirectly as some of it manifestations. In this work, a software life cycle model is proposed, for nuclear power plant safety related systems. A set os software quality factors is also proposed , with its corresponding classification according to the proposed model. (author) [es
International Nuclear Information System (INIS)
Inyushin, V.M.; Yurenkov, V.V.
2001-01-01
Authors notes, that Semipalatinsk test site activity together with other factors changes a water quality. The principal consequence of nuclear tests is build up in new cells by the 'pathogenous' water in plants, animals and human . 'Pathogenous water' is generating at steady changes of electronic strictures (spin performances) at ionizing radiation effect, radionuclides and other factors of nuclear explosions. These factors were did not known to a world-wide science. The second of very important phenomenon of nuclear explosions consequences at the Semipalatinsk test site is reduce of the hydro-plasma in the water sources the Irtysh River basin. This was proved with direct studies microcurrents density in the water as well as analysis of electronic and ionic structures with the plasma-graphic help. The water having the pathogenous memory - building up in the cells - reduces the immune status, negatively reflects on the vital functions, decreasing the resistance to unfavorable effects. It is offered for remediation of the 'pathogenous water' to use the bio-genized water as most adequate one to endogenous water of living cells. Mass usage of the bio-genized water takes out genetic consequences of nuclear explosions and increase of an immunity level. The 'Bio-genization' of the Irtysh River water is concludes a few stages
Measurement and evaluation of human factor training in nuclear power plants
International Nuclear Information System (INIS)
Hamasaki, Kenichi
2006-01-01
The purpose of this study is to measure and evaluate the effectiveness of human factor training aimed at awareness and behavioral changes, conducted by electric power company for the nuclear power plant staff. As the first step, the researcher investigated recent trends in training measurement and evaluation methods in the United States. It was found that many instances of training measurement/evaluation had been reported, and that the ROI model was the mainstream method for such measurement and evaluation. However, there had been no instances reported in which the effectiveness of human factor training for plant staff had been measured. The researcher therefore developed a new questionnaire-type of effectiveness measurement/evaluation method, based on the framework of the ROI model. Two-years of research was then conducted, in which the effectiveness of a human factor training program was measured using the newly developed method. This research revealed that participants' overall satisfaction and knowledge/skill acquisition levels were high. The percentage of participants who demonstrated awareness/behavioral change after returning to the workplace increased from 50% at first measurement to 81% at second measurement. It can therefore be concluded that the effectiveness of the second training is greater than that of the first training. Use of the new effectiveness measurement/evaluation method will enable quantification of human factor training effectiveness and help improve training quality. (author)
Factors affecting the future of nuclear power in OECD Europe
International Nuclear Information System (INIS)
Thompson, S.
1997-01-01
This report provides a brief review of nuclear power in OECD Europe and addresses the prospects for its future over, say, the next quarter century. Most of the data and findings are drawn from studies published by the Nuclear Energy Agency (NEA) of the Organisation for Economic Co-operation and Development (OECD). The NEA is a small agency with a rather modest budget whose 27 members are industrialized countries from North America, Asia and Europe. The Agency works to pool the expertise of our member countries to produce technical, economic and legal work of considerable depth and quality addressing issues of common interest to those countries. Our work covers such fields as nuclear science, nuclear power economics, nuclear safety, radiation protection, waste management and nuclear liability. The studies carried out in the framework of the Agency require fewer resources than would be needed by our member countries if they were to pursue them individually, which is especially important at a time of cut-backs in national programmes in such critical areas as nuclear safety research. (author)
A Study on Human Factors in Maintenance of a Nuclear Power Plant (NPP)
International Nuclear Information System (INIS)
Park, Young Ho; Seong, Poong Hyun
2006-01-01
In human factors research, more attention has been devoted to the operation of a nuclear power plant (NPP) than to their maintenance. However, more NPP incidents are caused by inadequate maintenance rather than by faulty operation. There is a trend in NPP toward introducing digital technology into safety and non-safety systems. This lead to changes of maintenance, and support systems such as diagnosis system, augmentation system and handy terminal will be developed. In this context, it is important to identify tasks of human related to each phase of maintenance and their relation in order to apply those to maintenance. However, there are few researches of human factors in maintenance. This paper studies on framework of cognitive task analysis for developing maintenance support systems
Energy Technology Data Exchange (ETDEWEB)
Sohail, Sabir [Korea Advanced Institute of Science and Technology, Daejeon (Korea, Republic of); Choi, Seong Nam [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)
2013-10-15
In this paper, the legal and regulatory infrastructure available in Pakistan for HFE requirements is assessed, and the methodology for strengthening of legal infrastructure is presented. The regulatory strategy on evaluation of HFE consideration should provide reviewers with guidance on review process. Therefore, the suggested methodology is based on preparation of guidance documents such as checklist, working procedures, S and Gs etc.; incorporation of PRM elements in regulatory system; and finally the development of PRM implementation criteria. Altogether, the scheme provide the enhancement in regulatory infrastructure and also the effective and efficient review process. The Three Mile Island (TMI) accident brought the general consensus among the nuclear community on the integration of human factors engineering (HFE) principles in all phases of nuclear power. This notion has further strengthened after the recent Fukushima nuclear accident. Much effort has been put over to incorporate the lesson learned and continuous technical evolution on HFE to device different standards. The total of 174 ergonomics standards are alone identified by Dul et al. (2004) published by International Organization for Standardization (ISO) and the European Committee for Standardization (CEN) and number of standards and HFE guidelines (S and Gs) are also published by organizations like Institute for Electrical and Electronics Engineering (IEEE), International Electrotechnical Commission (IEC), International Atomic Energy Agency (IAEA), United States Nuclear Regulatory Commission (USNRC), etc. The ambition of effective review on HFE integration in nuclear facility might be accomplished through the development of methodology for systematic implementation of S and Gs. Such kind of methodology would also be beneficial for strengthening the regulatory framework and practices for countries new in the nuclear arena and with small scale nuclear program. The objective of paper is to review the
Hu, Xinyue; Rajesh, Mohanraj; Zhang, Jian; Zhou, Shanshan; Wang, Shudong; Sun, Jian; Tan, Yi; Zheng, Yang; Cai, Lu
2018-05-01
Oxidative stress and inflammation play key roles in the development of diabetic cardiomyopathy (DCM). Dimethyl fumarate (DMF), an FDA approved medicine for relapsing multiple sclerosis, has manifested its antioxidant and anti-inflammatory function mostly in the central nervous system. In this study, we investigated whether DMF could attenuate the development of DCM. Type 1 diabetes mouse model was established using multiple low-dose streptozotocin, and the diabetic mice were treated with DMF (10 mg/kg body weight) for 3 months. Cardiac functions were determined using echocardiography. Oxidative stress, pro-inflammatory cytokines and pro-fibrotic markers were determined with commercially available kits, real-time quantitative PCR or western blot techniques. DCM was characterized by diminished cardiac function, accompanied by oxidative stress and enhanced expression of pro-inflammatory cytokines. Diabetic cardiac tissue exhibited marked fibrosis, revealed by extracellular matrix deposition as determined by Sirius red staining of the myocardial tissues. Furthermore, Nrf2 and its downstream effectors were repressed in diabetic myocardium. On the contrary, diabetic animals treated with DMF exhibited blunted oxidative stress, inflammation, fibrosis and this correlated with Nrf2 activation. Our findings suggest that DMF could potentially thwart diabetes-induced myocardial tissue injury, likely via activation of Nrf2 function, providing firm impetus for future repurposing of DMF in the management of DCM. Copyright © 2018 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Vega C, H. R., E-mail: fermineutron@yahoo.com [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)
2014-08-15
A Subcritical Nuclear Assembly is a device where the nuclear-fission chain reaction is initiated and maintained using an external neutron source. It is a valuable educational and research tool where in a safe way many reactor parameters can be measured. Here, we have used the Wigner-Seitz method in the six-factor formula to calculate the effective multiplication factor of a subcritical nuclear reactor Nuclear Chicago model 9000. This reactor has approximately 2500 kg of natural uranium heterogeneously distributed in slugs. The reactor uses a {sup 239}PuBe neutron source that is located in the center of an hexagonal array. Using Monte Carlo methods, with the MCNP5 code, a three-dimensional model of the subcritical reactor was designed to estimate the effective multiplication factor, the neutron spectra, the total and thermal neutron fluences along the radial and axial axis. With the neutron spectra in two locations outside the reactor the ambient dose equivalent were estimated. (Author)
International Nuclear Information System (INIS)
Vega C, H. R.
2014-08-01
A Subcritical Nuclear Assembly is a device where the nuclear-fission chain reaction is initiated and maintained using an external neutron source. It is a valuable educational and research tool where in a safe way many reactor parameters can be measured. Here, we have used the Wigner-Seitz method in the six-factor formula to calculate the effective multiplication factor of a subcritical nuclear reactor Nuclear Chicago model 9000. This reactor has approximately 2500 kg of natural uranium heterogeneously distributed in slugs. The reactor uses a 239 PuBe neutron source that is located in the center of an hexagonal array. Using Monte Carlo methods, with the MCNP5 code, a three-dimensional model of the subcritical reactor was designed to estimate the effective multiplication factor, the neutron spectra, the total and thermal neutron fluences along the radial and axial axis. With the neutron spectra in two locations outside the reactor the ambient dose equivalent were estimated. (Author)
The Role of Free Radicals in the Aging Brain and Parkinson’s Disease: Convergence and Parallelism
Directory of Open Access Journals (Sweden)
Dong-Kug Choi
2012-08-01
Full Text Available Free radical production and their targeted action on biomolecules have roles in aging and age-related disorders such as Parkinson’s disease (PD. There is an age-associated increase in oxidative damage to the brain, and aging is considered a risk factor for PD. Dopaminergic neurons show linear fallout of 5–10% per decade with aging; however, the rate and intensity of neuronal loss in patients with PD is more marked than that of aging. Here, we enumerate the common link between aging and PD at the cellular level with special reference to oxidative damage caused by free radicals. Oxidative damage includes mitochondrial dysfunction, dopamine auto-oxidation, α-synuclein aggregation, glial cell activation, alterations in calcium signaling, and excess free iron. Moreover, neurons encounter more oxidative stress as a counteracting mechanism with advancing age does not function properly. Alterations in transcriptional activity of various pathways, including nuclear factor erythroid 2-related factor 2, glycogen synthase kinase 3β, mitogen activated protein kinase, nuclear factor kappa B, and reduced activity of superoxide dismutase, catalase and glutathione with aging might be correlated with the increased incidence of PD.
Zhou, Rui-Jun; Ye, Hua; Wang, Feng; Wang, Jun-Long; Xie, Mei-Lin
2017-11-04
Apigenin is a natural flavonoid compound widely distributed in a variety of vegetables, medicinal plants and health foods. This study aimed to examine the protective effect of apigenin against d-galactosamine (D-GalN)/lipopolysaccharide (LPS)-induced mouse liver injury and to investigate the potential biochemical mechanisms. The results showed that after oral administration of apigenin 100-200 mg/kg for 7 days, the levels of serum alanine aminotransferase and aspartate aminotransferase were decreased, and the severity of liver injury was alleviated. Importantly, apigenin pretreatment increased the levels of hepatic nuclear factor erythroid 2-related factor 2 (Nrf-2) and peroxisome proliferator-activated receptor γ (PPARγ) protein expressions as well as superoxide dismutase, catalase, glutathione S-transferase and glutathione reductase activities, decreased the levels of hepatic nuclear factor-κB (NF-κB) protein expression and tumor necrosis factor-α. These findings demonstrated that apigenin could prevent the D-GalN/LPS-induced liver injury in mice, and its mechanisms might be associated with the increments of Nrf-2-mediated antioxidative enzymes and modulation of PPARγ/NF-κB-mediated inflammation. Copyright © 2017 Elsevier Inc. All rights reserved.
Factors that influence a sustainable nuclear waste management policy
International Nuclear Information System (INIS)
Riley, P.
2004-01-01
The predicted increase in world demand for electricity requires that the gift of nuclear energy that has served developed nations must not be wasted. The development of nuclear energy is hampered by the absence of a clear and unequivocal policy regarding the storage and disposal of radioactive waste and is seen by a significant section of the public as a threat to their rights. Public opposition may cause the demise of nuclear electric power in developed nations and proscribe its use in the third world. (author)
Nuclear power and the nuclear fuel cycle
Energy Technology Data Exchange (ETDEWEB)
NONE
1976-07-01
The IAEA is organizing a major conference on nuclear power and the nuclear fuel cycle, which is to be held from 2 to 13 May 1977 in Salzburg, Austria. The programme for the conference was published in the preceding issue of the IAEA Bulletin (Vol.18, No. 3/4). Topics to be covered at the conference include: world energy supply and demand, supply of nuclear fuel and fuel cycle services, radioactivity management (including transport), nuclear safety, public acceptance of nuclear power, safeguarding of nuclear materials, and nuclear power prospects in developing countries. The articles in the section that follows are intended to serve as an introduction to the topics to be discussed at the Salzburg Conference. They deal with the demand for uranium and nuclear fuel cycle services, uranium supplies, a computer simulation of regional fuel cycle centres, nuclear safety codes, management of radioactive wastes, and a pioneering research project on factors that determine public attitudes toward nuclear power. It is planned to present additional background articles, including a review of the world nuclear fuel reprocessing situation and developments in the uranium enrichment industry, in future issues of the Bulletin. (author)
International Nuclear Information System (INIS)
Hu, J.; Toki, H.; Wen, W.; Shen, H.
2010-01-01
The role of the form factor and short-range correlation in nuclear matter is studied within the relativistic Hartree-Fock approximation. We take, first, the mean-field approximation for meson fields and obtain the fluctuation terms of mesons to be used for the Fock energies. We introduce form factors in the meson-nucleon coupling vertices to take into account the finite-size effect of the nucleon. We use further the unitary correlation operator method for the treatment of the short-range correlation. The form factors of the size (Λ∝1.0 -2.0 GeV) of the nucleon-nucleon interaction cut down largely the contribution of the ρ-meson in the Fock term. The short-range correlation effect is not large but has a significant effect on the pion and ρ-meson energies in the relativistic Hartree-Fock approximation for nuclear matter. (orig.)
International Nuclear Information System (INIS)
Park, J. Y.; Park, Y. W.; Park, H.G.
2016-01-01
This study 1) established the standard based on frameworks of safety culture principles that show safety culture promotion goals, 2) analyzed the linkages with the frameworks that were established by analyzing each incident cause and weak point from selected 268 cases(rating over INES grade 1) among 4,088 cases (as of April 1, 2015). The 4,088 cases were selected as a result of database analysis from 702 accidents recorded in accident and rating evaluation reports that were published in the National Nuclear Safety Commission and overseas IRS (International Reporting System for operating Experience), and 3) finally conducted a trend analysis studies with these comprehensive results. From the investigations, followings were concluded. 1) In order to analyze the safety culture, analysis methodology is required. 2) Analytical methodology for building sustainable safety culture promoting a virtuous cycle system was developed 3) Among variety of process input data, 970 domestic and overseas incidents were selected as targets and 502 accidents were classified as safety culture related events by utilizing screen filter of IAEA GS-G-3.5 Appendix I and Framework (Nuclear Safety Culture Base Frame) developed by BEES, Inc. for safety culture analysis method. 4) As a result, complex safety culture influence factors for the one reason which was difficult to separate by conventional methods was able to be analyzed. 5) The cumulative data through the system was results of virtuous trend analysis rather than temporary results. Thus, it could be unique cultural factors of the domestic industry and could derive trend differences for domestic safety culture factors accordingly
Energy Technology Data Exchange (ETDEWEB)
Park, J. Y.; Park, Y. W.; Park, H.G. [KAIST, Daejeon (Korea, Republic of)
2016-05-15
This study 1) established the standard based on frameworks of safety culture principles that show safety culture promotion goals, 2) analyzed the linkages with the frameworks that were established by analyzing each incident cause and weak point from selected 268 cases(rating over INES grade 1) among 4,088 cases (as of April 1, 2015). The 4,088 cases were selected as a result of database analysis from 702 accidents recorded in accident and rating evaluation reports that were published in the National Nuclear Safety Commission and overseas IRS (International Reporting System for operating Experience), and 3) finally conducted a trend analysis studies with these comprehensive results. From the investigations, followings were concluded. 1) In order to analyze the safety culture, analysis methodology is required. 2) Analytical methodology for building sustainable safety culture promoting a virtuous cycle system was developed 3) Among variety of process input data, 970 domestic and overseas incidents were selected as targets and 502 accidents were classified as safety culture related events by utilizing screen filter of IAEA GS-G-3.5 Appendix I and Framework (Nuclear Safety Culture Base Frame) developed by BEES, Inc. for safety culture analysis method. 4) As a result, complex safety culture influence factors for the one reason which was difficult to separate by conventional methods was able to be analyzed. 5) The cumulative data through the system was results of virtuous trend analysis rather than temporary results. Thus, it could be unique cultural factors of the domestic industry and could derive trend differences for domestic safety culture factors accordingly.
Scaling of nuclear modification factors for hadrons and light nuclei
Energy Technology Data Exchange (ETDEWEB)
Zhou, C.S. [Chinese Academy of Sciences, Shanghai Institute of Applied Physics, Shanghai (China); University of Chinese Academy of Sciences, Beijing (China); Ma, Y.G. [Chinese Academy of Sciences, Shanghai Institute of Applied Physics, Shanghai (China); ShanghaiTech University, Shanghai (China); Zhang, S. [Chinese Academy of Sciences, Shanghai Institute of Applied Physics, Shanghai (China)
2016-12-15
The number of constituent quarks (NCQ) scaling for hadrons and the number of constituent nucleons (NCN) scaling for light nuclei are proposed for nuclear modification factors (R{sub cp}) of hadrons and light nuclei, respectively, according to the experimental investigations in relativistic heavy-ion collisions. Based on the coalescence mechanism the scalings are performed for pions and protons at the quark level, and for light nuclei d(anti d) and {sup 3}He at the nucleonic level, respectively, formed in Au+Au and Pb+Pb collisions, and a nice scaling behaviour emerges. The NCQ or NCN scaling law of R{sub cp} can be, respectively, taken as a probe for the quark or nucleon coalescence mechanism for the formation of hadron or light nuclei in relativistic heavy-ion collisions. (orig.)
Study of factors governing US utility nuclear power decisions
International Nuclear Information System (INIS)
1980-05-01
Under DOE contract No. DE-AC02-79ET34009, The S.M. Stoller Corporation has conducted a study of US utility attitudes toward nuclear power. In the course of this study SMSC carried out a utility survey the objectives of which were: (1) to identify and rank in importance the governing considerations in actions taken in the past three years to cancel or defer nuclear projects, and (2) to gain insight into the circumstances and attitudes likely to govern new base-load commitments over the next several years. During the survey, contacts were made at the senior management level with utilities representing approximately half of the country's total electric capacity and two-thirds of its present nuclear commitment. Analysis of the responses led to the conclusion that most, if not all, of the decisions reached by the respondent utilities in the past several years to cancel or defer nuclear projects were triggered by one or a combination of the following four considerations: financial constraints; reduction in expected system load growth; schedule delay in licensing and construction and/or unpredictability; and adverse state government policies or attitudes regarding nuclear power
International Nuclear Information System (INIS)
Ito, Tatsuo; Kitamura, Haruka; Uwatoko, Chisana; Azumano, Makiko; Itoh, Kohji; Kuwahara, Jun
2010-01-01
Research highlights: → Sp1 zinc fingers themselves interact with importin α. → Sp1 zinc finger domains play an essential role as a nuclear localization signal. → Sp1 can be transported into the nucleus in an importin-dependent manner. -- Abstract: Transcription factor Sp1 is localized in the nucleus and regulates the expression of many cellular genes, but the nuclear transport mechanism of Sp1 is not well understood. In this study, we revealed that GST-fused Sp1 protein bound to endogenous importin α in HeLa cells via the Sp1 zinc finger domains, which comprise the DNA binding domain of Sp1. It was found that the Sp1 zinc finger domains directly interacted with a wide range of importin α including the armadillo (arm) repeat domain and the C-terminal acidic domain. Furthermore, it turned out that all three zinc fingers of Sp1 are essential for binding to importin α. Taken together, these results suggest that the Sp1 zinc finger domains play an essential role as a NLS and Sp1 can be transported into the nucleus in an importin-dependent manner even though it possesses no classical NLSs.
Varshavsky, Leonid
2013-01-01
Analysis of external and internal factors influencing significant improvement of economic indicators of US nuclear power stations in the 1990s is carried out. Approaches to modeling dynamics of capacity factors of nuclear power stations are proposed. Comparative analysis of dynamics of capacity factors and occupational radiation exposure for various generations of US nuclear power plants is carried out. Dynamical characteristics of «learning by doing» effects for analyzed indicators are measu...
Morikawa, Kazuya; Shiina, Takashi; Murakami, Shinya; Toyoshima, Yoshinori
2002-03-13
Sigma factor binding proteins are involved in modifying the promoter preferences of the RNA polymerase in bacteria. We found the nuclear encoded protein (SibI) that is transported into chloroplasts and interacts specifically with the region 4 of Sig1 in Arabidopsis. SibI and its homologue, T3K9.5 are novel proteins, which are not homologous to any protein of known function. The expression of sibI was tissue specific, light dependent, and developmentally timed. We suggest the transcriptional regulation by sigma factor binding proteins to function in the plastids of higher plant.
International Nuclear Information System (INIS)
Wilpert, B.; Freitag, M.; Miller, R.
1993-01-01
Goal of the present study is the analysis of human factor aspects in connection with available incident reports obligatorily reported by German nuclear power plants. Based on psychological theories and empirical studies this study develops a classification scheme which permits the identification of foci of erroneous human actions. This classification scheme is applied to a selection of human factor relevant incidents by calculating frequencies of the occurrence of human error categories. The results allow insights into human factor related problem areas. (orig.) [de
Ranger, Ann M.; Gerstenfeld, Louis C.; Wang, Jinxi; Kon, Tamiyo; Bae, Hyunsu; Gravallese, Ellen M.; Glimcher, Melvin J.; Glimcher, Laurie H.
2000-01-01
Nuclear factor of activated T cells (NFAT) transcription factors regulate gene expression in lymphocytes and control cardiac valve formation. Here, we report that NFATp regulates chondrogenesis in the adult animal. In mice lacking NFATp, resident cells in the extraarticular connective tissues spontaneously differentiate to cartilage. These cartilage cells progressively differentiate and the tissue undergoes endochondral ossification, recapitulating the development of endochondral bone. Proliferation of already existing articular cartilage cells also occurs in some older animals. At both sites, neoplastic changes in the cartilage cells occur. Consistent with these data, NFATp expression is regulated in mesenchymal stem cells induced to differentiate along a chondrogenic pathway. Lack of NFATp in articular cartilage cells results in increased expression of cartilage markers, whereas overexpression of NFATp in cartilage cell lines extinguishes the cartilage phenotype. Thus, NFATp is a repressor of cartilage cell growth and differentiation and also has the properties of a tumor suppressor. PMID:10620601
System dynamics modeling of social/political factors in nuclear power plant operations
International Nuclear Information System (INIS)
Hansen, K.F.; Turek, M.G.; Eubanks, C.K.
1995-01-01
The safety and performance of nuclear power plants are a function of many technical factors such as initial design, service and maintenance programs, and utility investment in improvements. Safety and performance are also a function of the social/political influences that affect requirements on personnel, practices and procedures, and resource availability. This paper describes a process for constructing models of the social/political influences on plant operations using the system dynamics technique. The model incorporates representation of internal utility actions and decisions as affected by external factors such as public opinion, intervenor actions, safety and economic regulation, and the financial community. The feedback between external agents and plant performance is explicitly modeled. The resulting model can be used to simulate performance under a variety of different external and internal policy choices. In particular, the model can be used to study means of improving performance in response to externally imposed regulations
Scheblanov, V Y; Sneve, M K; Bobrov, A F
2012-12-01
This paper describes research aimed at improving regulatory supervision of radiation safety during work associated with the management of spent nuclear fuel and radioactive waste at legacy sites in northwest Russia through timely identification of employees presenting unfavourable human factor risk characteristics. The legacy sites of interest include sites of temporary storage now operated by SevRAO on behalf of Rosatom. The sites were previously operational bases for servicing nuclear powered submarines and are now subject to major remediation activities. These activities include hazardous operations for recovery of spent nuclear fuel and radioactive waste from sub-optimal storage conditions. The paper describes the results of analysis of methods, procedures, techniques and informational issues leading to the development of an expert-diagnostic information system for monitoring of workers involved in carrying out the most hazardous operations. The system serves as a tool for human factor and professional reliability risk monitoring and has been tested in practical working environments and implemented as part of regulatory supervision. The work has been carried out by the Burnasyan Federal Medical Biophysical Center, within the framework of the regulatory cooperation programme between the Federal Medical-Biological Agency of Russia and the Norwegian Radiation Protection Authority.
International Nuclear Information System (INIS)
Massen, S. E.; Garistov, V. P.; Grypeos, M. E.
1996-01-01
The effects of nuclear surface fluctuations on harmonic oscillator elastic charge form factor of light nuclei are investigated, simultaneously approximating the short-range correlations through a Jastrow correlation factor. Inclusion of the surface fluctuation effects within this description, by truncating the cluster expansion at the two-body part, is found to improve somewhat the fit to the elastic charge form-factor of 16 O and 40 Ca. However, the convergence of the cluster expansion is expected to deteriorate. An additional finding is that surface-fluctuation correlations produce a drastic change in the asymptotic behaviour of the point-proton form-factor, which now falls off quite slowly (i.e. as const.q -4 ) at large values of the momentum transfer q
Adjustement of Dancoff factor for calculating the cell of fluidized bed nuclear reactor
International Nuclear Information System (INIS)
Borges, V.; Sefidvash, F.
1988-01-01
A new nuclear reactor design based on the fluidized bed concept is under reserch and development. It utilized spherical fuel of slightly enriched zircaloy-clad uranium dioxide fluidized by light water under pressure since the Leopard code has been developed for light water reactor analysis, it was necessary to develop a method to determine the dimensions of the hypothetical fuel rod lattice, which are neutronically equivalent to the spherical fuel pellet lattice. This method is shown to calculate the Dancoff factor correctly. (author) [pt
Feed-Back Regulation of Haemopoiesis
Energy Technology Data Exchange (ETDEWEB)
Feldman, M. [Department of Cell Biology, Weizmann Institute of Science, Rehovoth (Israel)
1968-08-15
Studies ate reported on the feed-back regulation of erythropoiesis by means of the intrasplenic cloning system of haemopoietic cells. Polycythaemia, produced by passive transfusion of synzeneic, allogeneic or xenogeneic red blood cells, inhibited the formation of bone-marrow derived erythroid clones. Polycythaemia also inhibited the formation of erythroid clones of endogenous stem cells. Oxygen overloading was found to be a necessary factor in the suppression of erythroid clone formation: no suppression of erythroid colonies was observed when polycythaemic animals were kept under hypoxic conditions. Erythropoietin, either of exogenous or of endogenous origin, elicited a reformation of erythroid clones in 'suppressed' animals. Studies on the kinetics of reformation of erythroid clones after the administration of erythropoietin suggested that the colony-forming stem cell can replicate a few times in the absence of erythropoietin and the cell progeny thus formed are the target cells for erythropoietin action. If, indeed, the colony-forming cell replicates in the absence of the specific inducer, then the cells thus formed should themselves be stem cells. This was substantiated by demonstrating that the cloning efficiency of spleens of polycythaemic recipients was higher than that of non-polycythaemic animals. Experiments indicating that erythroid clones produced by erythropoietin in polycythaemic animals disappeared after the discontinuance of erythropoietin application demonstrated the distinction between the 'mitogenic' and the 'morphogenetic' effects of erythropoietin. The latter seemed to be operated by an early transcription of RNA for proteins necessary for the complete maturation of the red blood cell, Erythroid clones produced by foetal haemopoietic stem cells seemed to be regulated by a different mechanism from that which controls the formation of bone-marrow derived clones. Clones produced by foetal cells were only partially suppressed in the polycythaemic
Perspectives for nuclear energy
International Nuclear Information System (INIS)
Baugnet, J.-M.; Abderrahim, H.A.; Dekeyser, J.; Meskens, G.
1998-09-01
In Belgium, approximately 60 percent of the produced electricity is generated by nuclear power. At present, nuclear power production tends to stagnate in Europe and North America but is still growing in Asia. The document gives an overview of the present status and the future energy demand with emphasis on electric power. Different evaluation criteria including factors hindering and factors promoting the expansion of nuclear power as well as requirements of new nuclear power plants are discussed. The extension of the lifetime of existing facilities as well as fuel supply are taken into consideration. A comparative assesment of nuclear power with other energy sources is made. The report concludes with estimating the contribution and the role of nuclear power in future energy demand as well as with an overview of future reactors and research and development programmes
Pearson, E.R.; Pruhova, S.; Tack, C.J.J.; Johansen, A.; Castleden, H.A.; Lumb, P.J.; Wierzbicki, A.S.; Clark, P.M.; Lebl, J.; Pedersen, O.; Ellard, S.; Hansen, T.; Hattersley, A.T.
2005-01-01
AIMS/HYPOTHESIS: Heterozygous mutations in the gene of the transcription factor hepatocyte nuclear factor 4alpha (HNF-4alpha) are considered a rare cause of MODY with only 14 mutations reported to date. The description of the phenotype is limited to single families. We investigated the genetics and
Let the sun shine in: mechanisms and potential for therapeutics in skin photodamage.
Wondrak, Georg T
2007-05-01
Photoaging and photocarcinogenesis are the two Janus faces of skin photodamage. Reactivity-based design of prototype agents that antagonize, modulate and reverse the chemistry of skin photodamage holds promise in delivering unprecedented therapeutic benefit. In contrast to structure-based approaches that use selective ligands to target macromolecules, reactivity-based drug discovery uses chemical reagents as therapeutics to target reactive chemical species as key mediators of skin photo-oxidative stress. The following classes of reactivity-based agents for skin photoprotection can be distinguished based on their mechanism of action: direct antagonists of photo-oxidative stress (sunscreens, quenchers of photo-excited states, antioxidants, redox modulators and glycation inhibitors) and skin photo-adaptation inducers (nuclear factor erythroid 2-related factor 2 [Nrf2] activators, heat-shock response inducers and metallothionein inducers).
Energy Technology Data Exchange (ETDEWEB)
Guzey, Vadim; Goeke, Klaus; Siddikov, Marat
2009-01-01
We generalize the leading twist theory of nuclear shadowing and calculate quark and gluon generalized parton distributions (GPDs) of spinless nuclei. We predict very large nuclear shadowing for nuclear GPDs. In the limit of the purely transverse momentum transfer, our nuclear GPDs become impact parameter dependent nuclear parton distributions (PDFs). Nuclear shadowing induces non-trivial correlations between the impact parameter $b$ and the light-cone fraction $x$. We make predictions for the deeply virtual Compton scattering (DVCS) amplitude and the DVCS cross section on $^{208}$Pb at high energies. We calculate the cross section of the Bethe-Heitler (BH) process and address the issue of the extraction of the DVCS signal from the $e A \\to e \\gamma A$ cross section. We find that the $e A \\to e \\gamma A$ differential cross section is dominated by DVCS at the momentum transfer $t$ near the minima of the nuclear form factor. We also find that nuclear shadowing leads
International Nuclear Information System (INIS)
Takagawa, Kenichi; Iida, Hiroyasu
2011-01-01
Imperfect maintenance planning was frequently identified in domestic nuclear power plants. To prevent such an event, we analyzed causal factors in maintenance planning stages and showed the directionality of countermeasures in this study. There is a pragmatic limit in finding the causal factors from the items based on report descriptions. Therefore, the idea of the systemic accident model, which is used to monitor the performance variability in normal circumstances, is taken as a new concept instead of investigating negative factors. As an actual method for analyzing usual activities, cognitive task analysis (CTA) was applied. Persons who experienced various maintenance activities at one electric power company were interviewed about sources related to decision making during maintenance planning, and then usual factors affecting planning were extracted as performance variability factors. The tendency of domestic events was analyzed using the classification item of those factors, and the directionality of countermeasures was shown. The following are critical for preventing imperfect maintenance planning: the persons in charge should fully understand the situation of the equipment for which they are responsible in the work planning and maintenance evaluation stages, and they should definitely understand, for example, the maintenance bases of that equipment. (author)
Single-Cell Network Analysis Identifies DDIT3 as a Nodal Lineage Regulator in Hematopoiesis
Directory of Open Access Journals (Sweden)
Cristina Pina
2015-06-01
Full Text Available We explore cell heterogeneity during spontaneous and transcription-factor-driven commitment for network inference in hematopoiesis. Since individual genes display discrete OFF states or a distribution of ON levels, we compute and combine pairwise gene associations from binary and continuous components of gene expression in single cells. Ddit3 emerges as a regulatory node with positive linkage to erythroid regulators and negative association with myeloid determinants. Ddit3 loss impairs erythroid colony output from multipotent cells, while forcing Ddit3 in granulo-monocytic progenitors (GMPs enhances self-renewal and impedes differentiation. Network analysis of Ddit3-transduced GMPs reveals uncoupling of myeloid networks and strengthening of erythroid linkages. RNA sequencing suggests that Ddit3 acts through development or stabilization of a precursor upstream of GMPs with inherent Meg-E potential. The enrichment of Gata2 target genes in Ddit3-dependent transcriptional responses suggests that Ddit3 functions in an erythroid transcriptional network nucleated by Gata2.
What makes nuclear energy (not) acceptable?
Energy Technology Data Exchange (ETDEWEB)
Turcanu, C.; Perko, T. [Belgian Nuclear Research Centre (SCK-CEN), Mol (Belgium). Society and Policy Support; Kermisch, C. [Universite Libre de Bruxelles (Belgium). Fonds de la Recherche Scientifique
2013-08-15
Higher knowledge has long been hypothesized as leading to better acceptance of nuclear energy, but in the last years other factors such as risk perception and trust in nuclear risk governance were also recognized as key elements. While stakeholder involvement is now fully recognized as a key element for nuclear energy acceptance, there are still questions about the impact of higher knowledge. This paper investigates the relation between knowledge about the nuclear domain, risk perception of nuclear risks, confidence in the management of nuclear technologies, on the one hand, and the attitude towards nuclear energy and opinion about nuclear energy, on the other hand. It also studies the factors that are pleading in favour or against nuclear energy and their relation with the forementioned variables. The study is based on empirical data from a large scale opinion survey in Belgium between 25/05/2011 and 24/06/2011, i.e. the third month after the accident in Fukushima. The sample consisted of 1020 respondents and is representative for the Belgian adult population (18+) with respect to gender, age, region, province, habitat and social class. Our results show that confidence in the safe management of nuclear technologies as well as the perceived strength of the arguments pro/against nuclear are driving factors for people's attitude towards nuclear energy. Higher confidence and stronger adherence to the arguments in favour of nuclear energy lead to higher acceptance. The correlation between knowledge and attitude/opinion towards nuclear energy is statistically significant, but rather low, showing only a weak effect of knowledge on attitudes or opinions about nuclear energy. A weak effect is also observed for risk perception of nuclear risks, lower risk perception leading to a somewhat more positive attitude/opinion about nuclear energy. In the study we also highlight that the main factors seen as pleading in favour or against nuclear energy are the same, both for