WorldWideScience

Sample records for nuclear factor erythroid

  1. Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway.

    Science.gov (United States)

    Ha, Ae Wha; Kim, Woo Kyoung

    2017-06-01

    Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.

  2. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

    Science.gov (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

    2011-10-15

    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  4. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  5. Nuclear factor erythroid 2-related factor 2 deletion impairs glucose tolerance and exacerbates hyperglycemia in type 1 diabetic mice.

    Science.gov (United States)

    Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D

    2010-04-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.

  6. Hemistepsin A ameliorates acute inflammation in macrophages via inhibition of nuclear factor-κB and activation of nuclear factor erythroid 2-related factor 2.

    Science.gov (United States)

    Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan

    2018-01-01

    Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer

    2017-12-01

    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.

  8. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

    Science.gov (United States)

    Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

    2017-07-11

    Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  9. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

    Directory of Open Access Journals (Sweden)

    Alessandro Di Tullio

    2017-07-01

    Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

  10. DJ-1 Modulates Nuclear Erythroid 2-Related Factor-2-Mediated Protection in Human Primary Alveolar Type II Cells in Smokers.

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata

    2016-09-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.

  11. Catalase overexpression prevents nuclear factor erythroid 2-related factor 2 stimulation of renal angiotensinogen gene expression, hypertension, and kidney injury in diabetic mice.

    Science.gov (United States)

    Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D

    2014-10-01

    This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  12. The nuclear factor-erythroid 2-related factor/heme oxygenase-1 axis is critical for the inflammatory features of type 2 diabetes-associated osteoarthritis.

    Science.gov (United States)

    Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie

    2017-09-01

    Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  14. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    International Nuclear Information System (INIS)

    Lo, Raymond; Matthews, Jason

    2013-01-01

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  15. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  16. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.

  17. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  18. DJ-1 Modulates Nuclear Erythroid 2–Related Factor-2–Mediated Protection in Human Primary Alveolar Type II Cells in Smokers

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.

    2016-01-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578

  19. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  20. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Science.gov (United States)

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  1. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  2. Qing brick tea (QBT) aqueous extract protects monosodium glutamate-induced obese mice against metabolic syndrome and involves up-regulation Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) antioxidant pathway.

    Science.gov (United States)

    Gao, Wenqi; Xiao, Changyi; Hu, Jun; Chen, Biaoxin; Wang, Chunyan; Cui, Bangping; Deng, Pengyi; Yang, Jian; Deng, Zhifang

    2018-04-18

    Qing brick tea (QBT), traditional and popular beverage for Chinese people, is an important post-fermentation dark tea. Our present study was performed to investigate the ameliorative effects of QBT aqueous extract on metabolic syndrome (Mets) in monosodium glutamate-induced obese mice and the potential mechanisms. Monosodium glutamate-induced obese mice were used to evaluate the anti-Mets effects of QBT. Content levels of malonaldehyde (MDA), reactive oxygen species (ROS) and protein carbonylation, antioxidant enzyme activities of superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), glutathione reductase (GR) in the skeletal muscle were assessed by commercial kits, respectively. Western blot and Q-PCR were used to detect the expressions of Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) signaling pathway and downstream antioxidant factors. In addition, activity of AKT signaling and expression of glucose transporter type 4 (GLUT4) in the skeletal muscle were investigated by western blot. QBT treatment limited gain of body weight, waistline and LEE index, improved insulin resistance and glucose intolerance, reduced lipid level in MSG mice. Content levels of MDA, ROS and protein carbonylation in skeletal muscle of QBT group were significantly improved compared to those of MSG mice. The antioxidant enzyme activities of SOD, GPx, CAT, and GR were increased in skeletal muscle of MSG mice intervened with QBT. After 20-week QBT treatment, Nrf2 signaling pathway and downstream antioxidant factors were both increased in the skeletal muscle. In addition, QBT treatment improved insulin signaling by preferentially augmenting AKT signaling, as well as increased the protein expression of GLUT4 in the skeletal muscle. Our results showed that QBT intake was effective in protecting monosodium glutamate-induced obese mice against metabolic syndrome and involved in the Nrf2 signaling pathway in the skeletal muscle. Copyright © 2018

  3. Glycogen synthase kinase 3 regulates expression of nuclear factor-erythroid-2 related transcription factor-1 (Nrf1) and inhibits pro-survival function of Nrf1

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu

    2013-08-01

    Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.

  4. Andrographolide stimulates p38 mitogen-activated protein kinase-nuclear factor erythroid-2-related factor 2-heme oxygenase 1 signaling in primary cerebral endothelial cells for definite protection against ischemic stroke in rats.

    Science.gov (United States)

    Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong

    2016-04-01

    Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could

  5. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    International Nuclear Information System (INIS)

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

    2016-01-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  6. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    Energy Technology Data Exchange (ETDEWEB)

    Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)

    2016-08-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  7. Increased Energy Expenditure, Ucp1 Expression, and Resistance to Diet-induced Obesity in Mice Lacking Nuclear Factor-Erythroid-2-related Transcription Factor-2 (Nrf2).

    Science.gov (United States)

    Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y

    2016-04-01

    The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. The transcription factor, Nuclear factor, erythroid 2 (Nfe2), is a regulator of the oxidative stress response during Danio rerio development

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Larissa M., E-mail: lwillia2@bates.edu [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Lago, Briony A., E-mail: lagoba@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); McArthur, Andrew G., E-mail: mcarthua@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Raphenya, Amogelang R., E-mail: raphenar@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Pray, Nicholas, E-mail: pray.nicholas@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); Saleem, Nabil, E-mail: nabilsaleem@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Salas, Sophia, E-mail: sophia.salas2@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Paulson, Katherine, E-mail: krpaulson@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Mangar, Roshni S., E-mail: rmangar@coa.edu [The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); College of the Atlantic, 105 Eden Street, Bar Harbor, ME 04609 (United States); and others

    2016-11-15

    Highlights: • Nfe2 is involved in erythropoiesis in zebrafish. • Nfe2 is a novel regulator of pro-oxidant induced oxidative stress. • Embryos mount a molecularly unique oxidative stress response compared to larvae. • Nfe2 regulates a wide-variety of genes beyond erythropoiesis. - Abstract: Development is a complex and well-defined process characterized by rapid cell proliferation and apoptosis. At this stage in life, a developmentally young organism is more sensitive to toxicants as compared to an adult. In response to pro-oxidant exposure, members of the Cap’n’Collar (CNC) basic leucine zipper (b-ZIP) transcription factor family (including Nfe2 and Nfe2-related factors, Nrfs) activate the expression of genes whose protein products contribute to reduced toxicity. Here, we studied the role of the CNC protein, Nfe2, in the developmental response to pro-oxidant exposure in the zebrafish (Danio rerio). Following acute waterborne exposures to diquat or tert-buytlhydroperoxide (tBOOH) at one of three developmental stages, wildtype (WT) and nfe2 knockout (KO) embryos and larvae were morphologically scored and their transcriptomes sequenced. Early in development, KO animals suffered from hypochromia that was made more severe through exposure to pro-oxidants; this phenotype in the KO may be linked to decreased expression of alas2, a gene involved in heme synthesis. WT and KO eleutheroembryos and larvae were phenotypically equally affected by exposure to pro-oxidants, where tBOOH caused more pronounced phenotypes as compared to diquat. Comparing diquat and tBOOH exposed embryos relative to the WT untreated control, a greater number of genes were up-regulated in the tBOOH condition as compared to diquat (tBOOH: 304 vs diquat: 148), including those commonly found to be differentially regulated in the vertebrate oxidative stress response (OSR) (e.g. hsp70.2, txn1, and gsr). When comparing WT and KO across all treatments and times, there were 1170 genes that were

  9. l-2-Oxothiazolidine-4-Carboxylic Acid or α-Lipoic Acid Attenuates Airway Remodeling: Involvement of Nuclear Factor-κB (NF-κB, Nuclear Factor Erythroid 2p45-Related Factor-2 (Nrf2, and Hypoxia-Inducible Factor (HIF

    Directory of Open Access Journals (Sweden)

    Heung Bum Lee

    2012-06-01

    Full Text Available Reactive oxygen species (ROS play a crucial role in the pathogenesis of acute and chronic respiratory diseases. Antioxidants have been found to ameliorate airway inflammation and hyperresponsiveness in animal models employing short-term exposure to allergen. However, little data are available on the effect of antioxidants on airway remodeling and signaling pathways in chronic asthma. In the present study, we used a long-term exposure murine model of allergic airway disease to evaluate the effects of an antioxidant, l-2-oxothiazolidine-4-carboxylic acid (OTC or α-lipoic acid (LA on airway remodeling, focusing on the ROS-related hypoxia-inducible signaling. Long-term challenge of ovalbumin (OVA increased ROS production, airway inflammation, and airway hyperresponsiveness, and developed features of airway remodeling such as excessive mucus secretion, subepithelial fibrosis, and thickening of the peribronchial smooth muscle layer. Administration of OTC or LA reduced these features of asthma, including airway remodeling, which was accompanied by suppression of transforming growth factor-β1, vascular endothelial growth factor, and T-helper 2 cytokines. In addition, OVA-induced activation of nuclear factor-κB (NF-κB, nuclear factor erythroid 2p45-related factor-2 (Nrf2, hypoxia-inducible factor (HIF-1α, and HIF-2α was reduced by OTC or LA. Our results also showed that OTC or LA down-regulated phosphoinositide 3-kinase activity and decreased phosphorylation of p38 mitogen-activated protein kinase but not extracellular signal-regulated kinase 1/2 or c-Jun N-terminal kinase. These findings demonstrate that OTC and LA can inhibit activation of NF-κB, Nrf2, and HIF, leading to attenuate allergen-induced airway remodeling.

  10. Dual-energy precursor and nuclear erythroid-related factor 2 activator treatment additively improve redox glutathione levels and neuron survival in aging and Alzheimer mouse neurons upstream of reactive oxygen species.

    Science.gov (United States)

    Ghosh, Debolina; LeVault, Kelsey R; Brewer, Gregory J

    2014-01-01

    To determine whether glutathione (GSH) loss or increased reactive oxygen species (ROS) are more important to neuron loss, aging, and Alzheimer's disease (AD), we stressed or boosted GSH levels in neurons isolated from aging 3xTg-AD neurons compared with those from age-matched nontransgenic (non-Tg) neurons. Here, using titrating with buthionine sulfoximine, an inhibitor of γ-glutamyl cysteine synthetase (GCL), we observed that GSH depletion increased neuronal death of 3xTg-AD cultured neurons at increasing rates across the age span, whereas non-Tg neurons were resistant to GSH depletion until old age. Remarkably, the rate of neuron loss with ROS did not increase in old age and was the same for both genotypes, which indicates that cognitive deficits in the AD model were not caused by ROS. Therefore, we targeted for neuroprotection activation of the redox sensitive transcription factor, nuclear erythroid-related factor 2 (Nrf2) by 18 alpha glycyrrhetinic acid to stimulate GSH synthesis through GCL. This balanced stimulation of a number of redox enzymes restored the lower levels of Nrf2 and GCL seen in 3xTg-AD neurons compared with those of non-Tg neurons and promoted translocation of Nrf2 to the nucleus. By combining the Nrf2 activator together with the NADH precursor, nicotinamide, we increased neuron survival against amyloid beta stress in an additive manner. These stress tests and neuroprotective treatments suggest that the redox environment is more important for neuron survival than ROS. The dual neuroprotective treatment with nicotinamide and an Nrf2 inducer indicates that these age-related and AD-related changes are reversible. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Dimethyl sulfoxide-inducible cytoplasmic factor involved in erythroid differentiation in mouse erythroleukemia (Friend) cells

    International Nuclear Information System (INIS)

    Watanabe, T.; Oishi, M.

    1987-01-01

    A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed

  12. Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions.

    Science.gov (United States)

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-08-01

    Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  13. Sulforaphane Inhibits Lipopolysaccharide-Induced Inflammation, Cytotoxicity, Oxidative Stress, and miR-155 Expression and Switches to Mox Phenotype through Activating Extracellular Signal-Regulated Kinase 1/2-Nuclear Factor Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway in Murine Microglial Cells.

    Science.gov (United States)

    Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin

    2018-01-01

    Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.

  14. RECOMBINANT HUMAN MAST-CELL GROWTH-FACTOR SUPPORTS ERYTHROID COLONY FORMATION IN POLYCYTHEMIA-VERA IN THE PRESENCE AND ABSENCE OF ERYTHROPOIETIN AND SERUM

    NARCIS (Netherlands)

    MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral

  15. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  16. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    International Nuclear Information System (INIS)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

    2009-01-01

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  17. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    Science.gov (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  18. Factors affecting nuclear development

    International Nuclear Information System (INIS)

    Stevens, G.H.; Girouard, P.

    1995-01-01

    Among the factors affecting nuclear development, some depend more or less on public authorities, but many are out of public authorities control (foreign policies, market and deregulation, socials and environmental impacts, public opinion). As far as possible, the following study tries to identify those factors. (D.L.). 2 photos

  19. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  20. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  1. Power peaking nuclear reliability factors

    International Nuclear Information System (INIS)

    Hassan, H.A.; Pegram, J.W.; Mays, C.W.; Romano, J.J.; Woods, J.J.; Warren, H.D.

    1977-11-01

    The Calculational Nuclear Reliability Factor (CNRF) assigned to the limiting power density calculated in reactor design has been determined. The CNRF is presented as a function of the relative power density of the fuel assembly and its radial local. In addition, the Measurement Nuclear Reliability Factor (MNRF) for the measured peak hot pellet power in the core has been evaluated. This MNRF is also presented as a function of the relative power density and radial local within the fuel assembly

  2. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.

    1985-01-01

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  3. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

    2012-01-01

    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  4. Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.

    Science.gov (United States)

    Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A

    2004-10-01

    A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.

  5. Organizational factors in nuclear safety

    International Nuclear Information System (INIS)

    Wilpert, Bernhard

    2000-01-01

    The overall picture of factors which contributed to the event presents a panorama of a NPP where organizational and managerial characteristics were intricately intertwined and emerged as crucial for a general deterioration of the plant's capabilities to continually correct its deficiencies and optimize its operations. In the following author shall attempt to first cover various important efforts to modeling organizational factors relevant to safety. The second part of my presentation will offer an attempt towards an integrative model. The third part concludes with an agenda for research and practice. Most of the twelve different approaches above attempt to consider safety relevant organizational factors by way of pragmatic classifications. Together with their sub-categories we can count close to 160 different factors on various levels of abstraction. This is tantamount to say that most approaches lack systematic theoretical underpinnings. Thus then arises the question whether we need to develop a generic model, which promises to encompass these three major approaches altogether. Practical issues emerge particularly in the domain of organizational development, i.e. the goal oriented efforts to change the structures and the functioning of nuclear operations in such a way that the desired outputs in terms safety and reliability result in a sustained fashion. Again, these practical concerns are intimately related to developments and advances in theory and methodology. Only a close cooperation among scientists from various disciplines and of practitioners holds the promise of adequately understanding and use of organizational factors in future improving the safety record of nuclear industry worldwide. (S.Y.)

  6. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria

    2017-10-20

    The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.

  7. Dynamics of GATA1 binding and expression response in a GATA1-induced erythroid differentiation system

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    2015-06-01

    Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.

  8. Human factors in nuclear power plants

    International Nuclear Information System (INIS)

    Swain, A.D.

    1981-01-01

    This report describes some of the human factors problems in nuclear power plants and the technology that can be employed to reduce those problems. Many of the changes to improve the human factors in existing plants are inexpensive, and the expected gain in human reliability is substantial. The human factors technology is well-established and there are practitioners in most countries that have nuclear power plants. (orig.) [de

  9. Human factors in nuclear power plant operations

    International Nuclear Information System (INIS)

    Swain, A.D.

    1980-08-01

    This report describes some of the human factors problems in nuclear power plants and the technology that can be employed to reduce those problems. Many of the changes to improve the human factors in existing plants are inexpensive, and the expected gain in human reliability is substantial. The human factors technology is well-established and there are practitioners in most countries that have nuclear power plants

  10. A hanging drop culture method to study terminal erythroid differentiation.

    Science.gov (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

    2005-10-01

    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  11. Protection by dimethyl fumarate against diabetic cardiomyopathy in type 1 diabetic mice likely via activation of nuclear factor erythroid-2 related factor 2.

    Science.gov (United States)

    Hu, Xinyue; Rajesh, Mohanraj; Zhang, Jian; Zhou, Shanshan; Wang, Shudong; Sun, Jian; Tan, Yi; Zheng, Yang; Cai, Lu

    2018-05-01

    Oxidative stress and inflammation play key roles in the development of diabetic cardiomyopathy (DCM). Dimethyl fumarate (DMF), an FDA approved medicine for relapsing multiple sclerosis, has manifested its antioxidant and anti-inflammatory function mostly in the central nervous system. In this study, we investigated whether DMF could attenuate the development of DCM. Type 1 diabetes mouse model was established using multiple low-dose streptozotocin, and the diabetic mice were treated with DMF (10 mg/kg body weight) for 3 months. Cardiac functions were determined using echocardiography. Oxidative stress, pro-inflammatory cytokines and pro-fibrotic markers were determined with commercially available kits, real-time quantitative PCR or western blot techniques. DCM was characterized by diminished cardiac function, accompanied by oxidative stress and enhanced expression of pro-inflammatory cytokines. Diabetic cardiac tissue exhibited marked fibrosis, revealed by extracellular matrix deposition as determined by Sirius red staining of the myocardial tissues. Furthermore, Nrf2 and its downstream effectors were repressed in diabetic myocardium. On the contrary, diabetic animals treated with DMF exhibited blunted oxidative stress, inflammation, fibrosis and this correlated with Nrf2 activation. Our findings suggest that DMF could potentially thwart diabetes-induced myocardial tissue injury, likely via activation of Nrf2 function, providing firm impetus for future repurposing of DMF in the management of DCM. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.

    Science.gov (United States)

    Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C

    2017-05-01

    Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.

  13. The Nuclear Energy Factor In Indian Politics

    Directory of Open Access Journals (Sweden)

    A. A. Boyko

    2017-01-01

    Full Text Available Nuclear energy is a key branch of the world power system. The nuclear energy development is viewed by India as one of the ways to resolve the problem of the energy supply. In 2008 the country gained more opportunities for developing nuclear power sector and solving the national power deficit problem after NSG lifted restrictions on nuclear trade. This resulted in foreign companies emerging on the Indian nuclear market. In 2011 after the major emergency at Fukushima Daiichi Nuclear Power Plant in Japan India faced numerous anti-nuclear protests backed by NGOs, including those with foreign funding, and political parties. The article deals with the question of the political role this anti-nuclear opposition plays in India. According to some researchers the protests are organized by the competitors in order to compromise the business of a Russian company Rosatom in India. However, such demonstrations are spread throughout the country and directed against the competitors of Rosatom as well. The article comes to conclusion that the protests are just a reflection of the political fights in India where nuclear energy is a significant political factor.

  14. Human Factor on Gravelines Nuclear Power Plants

    International Nuclear Information System (INIS)

    Duboc, Gerard

    1998-01-01

    In a first part, the documents describes the commitments by EDF nuclear power plan operations to demands made by the Safety Authority regarding actions in the field of human factors (concerns expressed by the Authority, in-depth analysis, positions on different points raised by the Authority). In a second part, it presents the various actions undertaken in the Gravelines nuclear power station regarding human factors: creation of an 'operator club' (mission and objectives, methods and means, first meetings, tracking file), development of risk analysis strategy, setting up of a human factor engineering mission and example of action in case of a significant event

  15. Human factor problem in nuclear power generation

    International Nuclear Information System (INIS)

    Yoshino, Kenji; Fujimoto, Junzo

    1999-01-01

    Since a nuclear power plant accident at Threemile Island in U.S.A. occurred in March, 1979, twenty years have passed. After the accident, the human factor problem became focussed in nuclear power, to succeed its research at present. For direct reason of human error, most of factors at individual level or work operation level are often listed at their center. Then, it is natural that studies on design of a machine or apparatus suitable for various human functions and abilities and on improvement of relationship between 'human being and machine' and 'human being and working environment' are important in future. Here was, as first, described on outlines of the human factor problem in a nuclear power plant developed at a chance of past important accident, and then was described on educational training for its countermeasure. At last, some concrete researching results obtained by human factor research were introduced. (G.K.)

  16. Human factors in nuclear power plants

    International Nuclear Information System (INIS)

    Pack, R.W.

    1978-01-01

    The Electric Power Research Institute has started research in human factors in nuclear power plants. One project, completed in March 1977, reviewed human factors problems in operating power plants and produced a report evaluating those problems. A second project developed computer programs for evaluating operator performance on training simulators. A third project is developing and evaluating control-room design approaches. A fourth project is reviewing human factors problems associated with power-plant maintainability and instrumentation and control technician activities. Human factors engineering is an interdisciplinary specialty concerned with influencing the design of equipment systems, facilities, and operational environments to promote safe, efficient, and reliable operator performance. The Electric Power Research Institute (EPRI) has undertaken four projects studying the application of human factors engineering principles to nuclear power plants. (author)

  17. Human factors in nuclear power plants

    International Nuclear Information System (INIS)

    Hennig, J.; Bohr, E.

    1976-04-01

    This annotated bibliography is a first attempt to give a survey of the kind of literature which is relevant for the ergonomic working conditions in nuclear power plants. Such a survey seems to be useful in view of the fact that the 'factor human being' comes recently more and more to the fore in nuclear power plants. In this context, the necessity is often pointed out to systematically include our knowledge of the performance capacity and limits of human beings when designing the working conditions for the personnel of nuclear power plants. For this reason, the bibliography is so much intended for the ergonomics experts as for the experts of nuclear engineering. (orig./LN) [de

  18. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.

    1999-01-01

    Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors

  19. The human factor in the nuclear industry

    International Nuclear Information System (INIS)

    Colas, Armand

    1998-01-01

    After having evoked the progressive reduction and stabilization of significant incidents occurring every year in French nuclear power plants, and the challenges faced by nuclear energy (loss of public confidence, loss of competitiveness), and then outlined the importance of safety to overcome these challenges, the author comments EDF's approach to the human factor. He first highlights the importance of information and communication towards the population. He briefly discusses the meaning of human factors for the nuclear industry, sometimes perceived as the contribution people to the company's safety and performance. He comments the evolution observed in the perception of human error in different industrial or technical environments and situations, and outlines what is at stake to reduce the production of faults and organize a 'hunt for latent defects'

  20. Human factors methods in DOE nuclear facilities

    International Nuclear Information System (INIS)

    Bennett, C.T.; Banks, W.W.; Waters, R.J.

    1993-01-01

    The US Department of Energy (DOE) is in the process of developing a series of guidelines for the use of human factors standards, procedures, and methods to be used in nuclear facilities. This paper discusses the philosophy and process being used to develop a DOE human factors methods handbook to be used during the design cycle. The following sections will discuss: (1) basic justification for the project; (2) human factors design objectives and goals; and (3) role of human factors engineering (HFE) in the design cycle

  1. Uranium, a factor limiting nuclear energy?

    International Nuclear Information System (INIS)

    Ohnemus, J.

    2006-01-01

    Nuclear power has been back as a topic of public debate since early this year. A special subject under discussion is the extension of nuclear power plant life. Hardly had it been on the agenda, when interested parties announced that this step was impossible because uranium reserves were no longer sufficient. A variety of terms are being used in this discussion without their meaning being taken into account: stocks, resources, and reserves. To clarify the situation, this article outlines important aspects of short and long term uranium supplies, and analyzes their meaning. Here are some of the most important issues under consideration: - For what period of time is there really enough uranium? - Is uranium becoming the limiting factor in the use of nuclear power? - Is uranium really a 'sustainable' energy resource? - Will higher prices extend the range? - What is the influence of the price of uranium on the cost of electricity generation? Among other results, it is found that comprehensive sources of low-price uranium and nuclear fuels are, or can be made, available worldwide. Consequently, the 'range' is beyond the time frames currently mentioned, also as a function of technological factors, i.e. reaching several hundred years. It is also important to note that nuclear power - ensures greater independence of volatile imported sources, - guarantees reliably low electricity prices, - has a huge potential of environmental protection, and - is a clean source of energy. (orig.)

  2. Uranium, a factor limiting nuclear energy?

    International Nuclear Information System (INIS)

    2006-01-01

    Nuclear power has been back as a topic of public debate since early this year. A special subject under discussion is the extension of nuclear power plant life. Hardly had it been on the agenda, when interested parties announced that this step was impossible because uranium reserves were no longer sufficient. A variety of terms are being used in this discussion without their meaning being taken into account: stocks, resources, and reserves. To clarify the situation, this article outlines important aspects of short and long term uranium supplies, and analyzes their meaning. Here are some of the most important issues under consideration: - For what period of time is there really enough uranium? - Is uranium becoming the limiting factor in the use of nuclear power? - Is uranium really a 'sustainable' energy resource? - Will higher prices extend the range? - What is the influence of the price of uranium on the cost of electricity generation? Among other results, it is found that comprehensive sources of low-price uranium and nuclear fuels are, or can be made, available worldwide. Consequently, the 'range' is beyond the time frames currently mentioned, also as a function of technological factors, i.e. reaching several hundred years. It is also important to note that nuclear power - ensures greater independence of volatile imported sources, - guarantees reliably low electricity prices, - has a huge potential of environmental protection, and - is a clean source of energy. (orig./GL)

  3. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P

    2013-01-01

    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  4. Review of EPRI Nuclear Human Factors Program

    International Nuclear Information System (INIS)

    Hanes, L.F.; O'Brien, J.F.

    1996-01-01

    The Electric Power Research Institute (EPRI) Human Factors Program, which is part of the EPRI Nuclear Power Group, was established in 1975. Over the years, the Program has changed emphasis based on the shifting priorities and needs of the commercial nuclear power industry. The Program has produced many important products that provide significant safety and economic benefits for EPRI member utilities. This presentation will provide a brief history of the Program and products. Current projects and products that have been released recently will be mentioned

  5. Human and organizational factors in nuclear safety

    International Nuclear Information System (INIS)

    Garcia, A.; Barrientos, M.; Gil, B.

    2015-01-01

    Nuclear installations are socio technical systems where human and organizational factors, in both utilities and regulators, have a significant impact on safety. Three Mile Island (TMI) accident, original of several initiatives in the human factors field, nevertheless became a lost opportunity to timely acquire lessons related to the upper tiers of the system. Nowadays, Spanish nuclear installations have integrated in their processes specialists and activities in human and organizational factors, promoted by the licensees After many years of hard work, Spanish installations have achieved a better position to face new challenges, such as those posed by Fukushima. With this experience, only technology-centered action plan would not be acceptable, turning this accident in yet another lost opportunity. (Author)

  6. Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

    Science.gov (United States)

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

    2014-05-13

    Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  7. Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome.

    Science.gov (United States)

    Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang

    2017-07-01

    Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Uranium - a factor limiting nuclear energy?

    International Nuclear Information System (INIS)

    Ohnemus, J.

    2006-01-01

    Nuclear power has been back as a topic of public debate since early this year. A special subject under discussion is the extension of nuclear power plant life. Hardly had it been on the agenda, when interested parties announced that this st ep was impossible because uranium reserves were no longer sufficient. A variety of terms are being used in this discussion without their meaning being taken int o account: stocks, resources, and reserves. To clarify the situation, this artic le outlines important aspects of short and long term uranium supplies, and analy zes their meaning. Here are some of the most important issues under consideration: - For what period of time is there really enough uranium? - Is uranium becoming the limiting factor in the use of nuclear power? - Is uranium really a 'sustainable' energy resource? - Will higher prices extend the range? - What is the in fluence of the price of uranium on the cost of electricity generation? Among oth er results, it is found that comprehensive sources of low-price uranium and nucl ear fuels are, or can be made, available worldwide. Consequently, the 'range' is beyond the time frames currently mentioned, also as a function of technological factors, i.e. reaching several hundred years. It is also important to note that nuclear power - ensures greater independence of volatile imported sources, - guarantees reliably low electricity prices, - has a huge potential of environmental protection, and - is a clean source of energy. (orig.)

  9. Human factors in nuclear safety oversight

    International Nuclear Information System (INIS)

    Taylor, K.

    1989-01-01

    The mission of the nuclear safety oversight function at the Savannah River Plant is to enhance the process and nuclear safety of site facilities. One of the major goals surrounding this mission is the reduction of human error. It is for this reason that several human factors engineers are assigned to the Operations assessment Group of the Facility Safety Evaluation Section (FSES). The initial task of the human factors contingent was the design and implementation of a site wide root cause analysis program. The intent of this system is to determine the most prevalent sources of human error in facility operations and to assist in determining where the limited human factors resources should be focused. In this paper the strategy used to educate the organization about the field of human factors is described. Creating an awareness of the importance of human factors engineering in all facets of design, operation, and maintenance is considered to be an important step in reducing the rate of human error

  10. The nuclear factor (erythroid-derived 2)-like 2 (NRF2) antioxidant response promotes melanocyte viability and reduces toxicity of the vitiligo-inducing phenol monobenzone.

    Science.gov (United States)

    Arowojolu, Omotayo A; Orlow, Seth J; Elbuluk, Nada; Manga, Prashiela

    2017-07-01

    Vitiligo, characterised by progressive melanocyte death, can be initiated by exposure to vitiligo-inducing phenols (VIPs). VIPs generate oxidative stress in melanocytes and activate the master antioxidant regulator NRF2. While NRF2-regulated antioxidants are reported to protect melanocytes from oxidative stress, the role of NRF2 in the melanocyte response to monobenzone, a clinically relevant VIP, has not been characterised. We hypothesised that activation of NRF2 may protect melanocytes from monobenzone-induced toxicity. We observed that knockdown of NRF2 or NRF2-regulated antioxidants NQO1 and PRDX6 reduced melanocyte viability, but not viability of keratinocytes and fibroblasts, suggesting that melanocytes were preferentially dependent upon NRF2 activity for growth compared to other cutaneous cells. Furthermore, melanocytes activated the NRF2 response following monobenzone exposure and constitutive NRF2 activation reduced monobenzone toxicity, supporting NRF2's role in the melanocyte stress response. In contrast, melanocytes from individuals with vitiligo (vitiligo melanocytes) did not activate the NRF2 response as efficiently. Dimethyl fumarate-mediated NRF2 activation protected normal and vitiligo melanocytes against monobenzone-induced toxicity. Given the contribution of oxidant-antioxidant imbalance in vitiligo, modulation of this pathway may be of therapeutic interest. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Geologic factors in nuclear waste disposal

    International Nuclear Information System (INIS)

    Towse, D.

    1978-07-01

    The study of geosciences and their relation to nuclear waste disposal and management entails analyzing the hydrology, chemistry, and geometry of the nuclear waste migration process. Hydrologic effects are determined by analyzing the porosity and permeability (natural and induced) of rock as well as pressures and gradients, dispersion, and aquifer length of the system. Chemistry parameters include radionuclide retardation factors and waste dissolution rate. Geometric parameters (i.e., parameters with dimension) evaluated include repository layer thickness, fracture zone area, tunnel length, and aquifer length. The above parameters act as natural barriers or controls to nuclear waste migration, and are evaluated in three potential geologic media: salt, shale, and crystalline rock deposits. Parametric values are assigned that correspond to many existing situations. These values, in addition to other important inputs, are lumped as a hydrology input into a computer simulation program used to model and calculate nuclear waste migration from the repository to the biosphere, and potential individual and population dose and radiation effects. These results are preliminary and show trends only; they do not represent an actual risk analysis

  12. Two different in vitro growth patterns for erythroid precursors in 18 patients with pure erythrocytosis

    International Nuclear Information System (INIS)

    Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.

    1982-01-01

    Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)

  13. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio

    2015-01-01

    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

  14. Human Factors in Nuclear Reactor Accidents

    International Nuclear Information System (INIS)

    Mustafa, M.E.

    2016-01-01

    While many people would blame nature for the disaster of the “Fukushima Daiichi” accident, experts considered this accident to be also a human-induced disaster. This confirmed the importance of human errors which have been getting a growing interest in the nuclear field after the Three Mile Island accident. Personnel play an important role in design, operation, maintenance, planning, and management. The interface between machine and man is known as a human factor. In the present work, the human factors that have to be considered were discussed. The effect of the control room configuration and equipment design effect on the human behavior was also discussed. Precise reviewing of person’s qualifications and experience was focused. Insufficient training has been a major cause of human error in the nuclear field. The effective training issues were introduced. Avoiding complicated operational processes and non responsive management systems was stressed. Distinguishing between the procedures for normal and emergency operations was emphasised. It was stated that human error during maintenance and testing activities could cause a serious accident. This is because safety systems do not cover much more risk probabilities in the maintenance and testing activities like they do in the normal operation. In nuclear industry, the need for a classification and identification of human errors has been well recognised. As a result of this, human reliability must be assessed. These errors are analyzed by a probabilistic safety assessment which deals with errors in reading, listening and implementing procedures but not with cognitive errors. Much efforts must be accomplished to consider cognitive errors in the probabilistic safety assessment. The ways of collecting human factor data were surveyed. The methods for identifying safe designs, helping decision makers to predict how proposed or current policies will affect safety, and comprehensive understanding of the relationship

  15. Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.

    Directory of Open Access Journals (Sweden)

    Abigail A Lamikanra

    2009-12-01

    Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that

  16. Regression analysis of nuclear plant capacity factors

    International Nuclear Information System (INIS)

    Stocks, K.J.; Faulkner, J.I.

    1980-07-01

    Operating data on all commercial nuclear power plants of the PWR, HWR, BWR and GCR types in the Western World are analysed statistically to determine whether the explanatory variables size, year of operation, vintage and reactor supplier are significant in accounting for the variation in capacity factor. The results are compared with a number of previous studies which analysed only United States reactors. The possibility of specification errors affecting the results is also examined. Although, in general, the variables considered are statistically significant, they explain only a small portion of the variation in the capacity factor. The equations thus obtained should certainly not be used to predict the lifetime performance of future large reactors

  17. Organizational factors and nuclear power plant safety

    International Nuclear Information System (INIS)

    Haber, S.B.

    1995-01-01

    There are many organizations in our society that depend on human performance to avoid incidents involving significant adverse consequences. As our culture and technology have become more sophisticated, the management of risk on a broad basis has become more and more critical. The safe operation of military facilities, chemical plants, airlines, and mass transit, to name a few, are substantially dependent on the performance of the organizations that operate those facilities. The nuclear power industry has, within the past 15 years, increased the attention given to the influence of human performance in the safe operation of nuclear power plants (NPP). While NPPs have been designed through engineering disciplines to intercept and mitigate events that could cause adverse consequences, it has been clear from various safety-related incidents that human performance also plays a dominant role in preventing accidents. Initial efforts following the 1979 Three Mile Island incident focused primarily on ergonomic factors (e.g., the best design of control rooms for maximum performance). Greater attention was subsequently directed towards cognitive processes involved in the use of NPP decision support systems and decision making in general, personnel functions such as selection systems, and the influence of work scheduling and planning on employees' performance. Although each of these approaches has contributed to increasing the safety of NPPS, during the last few years, there has been a growing awareness that particular attention must be paid to how organizational processes affect NPP personnel performance, and thus, plant safety. The direct importance of organizational factors on safety performance in the NPP has been well-documented in the reports on the Three Mile Island and Chernobyl accidents as well as numerous other events, especially as evaluated by the U.S. Nuclear Regulatory Commission (NRC)

  18. Surface sensitivity of nuclear-knock-out form factors

    International Nuclear Information System (INIS)

    Fratamico, G.

    1984-01-01

    A numerical calculation has been performed to investigate the sensitivity of nuclear-knock-out form factors to nuclear-surface behaviour of bound-state wave functions. The result of our investigation suggests that one can extract the bound-state behaviour at the surface from experimental information on nuclear-knock-out form factors

  19. Enhancement of erythroid colony growth in culture by hemin

    International Nuclear Information System (INIS)

    Porter, P.N.; Meints, R.H.; Mesner, K.

    1979-01-01

    Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)

  20. Development of human factors engineering guide for nuclear power project

    International Nuclear Information System (INIS)

    Wu Dangshi; Sheng Jufang

    1997-01-01

    'THE PRACTICAL GUIDE FOR APPLICATION OF HUMAN FACTORS ENGINEERING TO NUCLEAR POWER PROJECT (First Draft, in Chinese)', which was developed under a research program sponsored by National Nuclear Safety Administration (NNSA) is described briefly. It is hoped that more conscious, more systematical and more comprehensive application of Human Factors Engineering to the nuclear power projects from the preliminary feasibility studies up to the commercial operation will benefit the safe, efficient and economical operations of nuclear power plants in China

  1. Human factors in nuclear power plant operation

    International Nuclear Information System (INIS)

    Sabri, Z.A.; Husseiny, A.A.

    1980-01-01

    An extensive effort is being devoted to developing a comprehensive human factor program that encompasses establishment of a data base for human error prediction using past operation experience in commercial nuclear power plants. Some of the main results of such an effort are reported including data retrieval and classification systems which have been developed to assist in estimation of operator error rates. Also, statistical methods are developed to relate operator error data to reactor type, age, and specific technical design features. Results reported in this paper are based on an analysis of LER's covering a six-year period for LWR's. Developments presently include a computer data management program, statistical model, and detailed error taxonomy

  2. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

    Science.gov (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

    2017-05-01

    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  3. TMEM14C is required for erythroid mitochondrial heme metabolism.

    Science.gov (United States)

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

    2014-10-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  4. Nuclear safety regulation on nuclear safety equipment activities in relation to human and organizational factors

    International Nuclear Information System (INIS)

    Li Tianshu

    2013-01-01

    Based on years of knowledge in nuclear safety supervision and experience of investigating and dealing with violation events in repair welding of DFHM, this paper analyzes major faults in manufacturing and maintaining activities of nuclear safety equipment in relation to human and organizational factors. It could be deducted that human and organizational factors has definitely become key features in the development of nuclear energy and technology. Some feasible measures to reinforce supervision on nuclear safety equipment activities have also been proposed. (author)

  5. Human factors in nuclear power plants

    International Nuclear Information System (INIS)

    Bohr, E.; Hennig, J.; Preuss, W.; Thau, G.

    1977-01-01

    This report describes the results of a study on the functions of operating and maintenance personnel in nuclear power plants. Since an effective power plant design must take into systematic account the possibilities and limitations of the human element, the basic aim of the study was to identify what the human operators are required to do and how they achieve it. Information was acquired by direct observation and by interviews as well as by evaluation of written documents (e.g. incident reports, procedures manuals, work regulations) and of working conditions (e.g. equipment and workplace design). A literature search and evaluation carried out within the scope of this study has been published as a separate document. The main part of the report is devoted to discussions and conclusions on selected areas of potential improvements. The topics include control room design, factors of the physical environment including radiation, problems of maintainability, design of written documents, problems in communicating information, design and control of tasks, placement and training. A separate section deals with problems of recording human errors. (orig.) [de

  6. Proteomic analysis of erythroid differentiation induced by hexamethylene bisacetamide in murine erythroleukemia cells

    Czech Academy of Sciences Publication Activity Database

    Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.

    2007-01-01

    Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007

  7. Factors in public perception of nuclear energy

    International Nuclear Information System (INIS)

    Hore-Lacy, I.

    1999-01-01

    Public communication about nuclear energy needs to relate to the cultural undercurrents which determine how people perceive the environment. The paper discusses some of these and suggests ways of responding to them. It also outlines major ethical considerations relevant to uranium mining and nuclear energy and communication about both and shows that competent discourse about values is fundamental

  8. Public opinion factors regarding nuclear power

    International Nuclear Information System (INIS)

    Benson, B.

    1991-01-01

    This paper is an effort to identify, as comprehensively as possible, public concerns about nuclear power, and to assess, where possible, the relative importance of these concerns as they relate to government regulation of and policy towards nuclear power. It is based on some two dozen in-depth interviews with key communicators representing the nuclear power industry, the environmental community, and government, as well as on the parallel efforts in our research project: (1) review of federal court case law, (2) a selective examination of the Nuclear Regulatory Commission (NRC) administrative process, and (3) the preceding George Mason University research project in this series. The paper synthesizes our findings about public attitudes towards nuclear power as expressed through federal court case law, NRC administrative law, public opinion surveys, and direct personal interviews. In so doing, we describe the public opinion environment in which the nuclear regulatory process must operate. Our premise is that public opinion ultimately underlies the approaches government agencies take towards regulating nuclear power, and that, to the degree that the nuclear power industry's practices are aligned with public opinion, a more favorable regulatory climate is possible

  9. Public opinion factors regarding nuclear power

    Energy Technology Data Exchange (ETDEWEB)

    Benson, B.

    1991-12-31

    This paper is an effort to identify, as comprehensively as possible, public concerns about nuclear power, and to assess, where possible, the relative importance of these concerns as they relate to government regulation of and policy towards nuclear power. It is based on some two dozen in-depth interviews with key communicators representing the nuclear power industry, the environmental community, and government, as well as on the parallel efforts in our research project: (1) review of federal court case law, (2) a selective examination of the Nuclear Regulatory Commission (NRC) administrative process, and (3) the preceding George Mason University research project in this series. The paper synthesizes our findings about public attitudes towards nuclear power as expressed through federal court case law, NRC administrative law, public opinion surveys, and direct personal interviews. In so doing, we describe the public opinion environment in which the nuclear regulatory process must operate. Our premise is that public opinion ultimately underlies the approaches government agencies take towards regulating nuclear power, and that, to the degree that the nuclear power industry`s practices are aligned with public opinion, a more favorable regulatory climate is possible.

  10. Public opinion factors regarding nuclear power

    Energy Technology Data Exchange (ETDEWEB)

    Benson, B.

    1991-01-01

    This paper is an effort to identify, as comprehensively as possible, public concerns about nuclear power, and to assess, where possible, the relative importance of these concerns as they relate to government regulation of and policy towards nuclear power. It is based on some two dozen in-depth interviews with key communicators representing the nuclear power industry, the environmental community, and government, as well as on the parallel efforts in our research project: (1) review of federal court case law, (2) a selective examination of the Nuclear Regulatory Commission (NRC) administrative process, and (3) the preceding George Mason University research project in this series. The paper synthesizes our findings about public attitudes towards nuclear power as expressed through federal court case law, NRC administrative law, public opinion surveys, and direct personal interviews. In so doing, we describe the public opinion environment in which the nuclear regulatory process must operate. Our premise is that public opinion ultimately underlies the approaches government agencies take towards regulating nuclear power, and that, to the degree that the nuclear power industry's practices are aligned with public opinion, a more favorable regulatory climate is possible.

  11. Induction of erythroid differentiation in human erythroleukemia cells by depletion of malic enzyme 2.

    Directory of Open Access Journals (Sweden)

    Jian-Guo Ren

    2010-09-01

    Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel

  12. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    International Nuclear Information System (INIS)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-01-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

  13. Ergonomics in nuclear and human factors engineering

    International Nuclear Information System (INIS)

    Muench, E.; Schultheiss, G.F.

    1988-01-01

    The work situation including man-machine-relationships in nuclear power plants is described. The overview gives only a compact summary of some important ergonomic parameters, i.e. human body dimension, human load, human characteristics and human knowledge. (DG)

  14. Lycopene activates antioxidant enzymes and nuclear transcription factor systems in heat-stressed broilers.

    Science.gov (United States)

    Sahin, K; Orhan, C; Tuzcu, M; Sahin, N; Hayirli, A; Bilgili, S; Kucuk, O

    2016-05-01

    This study was conducted to evaluate the effects of dietary lycopene supplementation on growth performance, antioxidant status, and muscle nuclear transcription factor [Kelch like-ECH-associated protein 1 (Keap1) and (erythroid-derived 2)-like 2 (Nrf2)] expressions in broiler chickens exposed to heat stress (HS). A total of 180 one-day-old male broiler chicks (Ross 308) were assigned randomly to one of 2×3 factorially arranged treatments: two housing temperatures (22°C for 24 h/d; thermoneutral, TN or 34°C for 8 h/d HS) and three dietary lycopene levels (0, 200, or 400 mg/kg). Each treatment consisted of three replicates of 10 birds. Birds were reared to 42 d of age. Heat stress caused reductions in feed intake and weight gain by 12.2 and 20.7% and increased feed efficiency by 10.8% (Plycopene level improved performance in both environments. Birds reared under the HS environment had lower serum and muscle lycopene concentration (0.34 vs. 0.50 μg/mL and 2.80 vs. 2.13 μg/g), activities of superoxide dismutase (151 vs. 126 U/mL and 131 vs. 155 U/mg protein), glutathione peroxidase (184 vs. 154 U/mL and 1.39 vs. 1.74 U/mg protein), and higher malondialdehyde (MDA) concentration (0.53 vs. 0.83 μg/mL and 0.78 vs. 0.45 μg/ mg protein) than birds reared under the TN environment. Changes in levels of lycopene and MDA and activities of enzymes in serum and muscle varied by the environmental temperature as dietary lycopene level increased. Moreover, increasing dietary lycopene level suppressed muscle Keap1 expression and enhanced muscle Nrf2 expression, which had increased by 150% and decreased by 40%, respectively in response to HS. In conclusion, lycopene supplementation alleviates adverse effects of HS on performance through modulating expressions of stress-related nuclear transcription factors. © 2016 Poultry Science Association Inc.

  15. Transcriptional regulation of Hb-α and Hb-β through nuclear factor E2-related factor-2 (Nrf2) activation in human vaginal cells: A novel mechanism of cellular adaptability to oxidative stress.

    Science.gov (United States)

    Saha, Debarchana; Koli, Swanand; Reddy, Kudumula Venkata Rami

    2017-06-01

    Hemoglobin (Hb), a major protein involved in transport of oxygen (O 2 ), is expressed by erythroid lineages. Until recently, it was not known whether non-erythroid cells express Hb. The objective was to evaluate the expression and functional significance of Hb-α and Hb-β in human primary vaginal epithelial cells (hPVECs) and decipher downstream signaling. RT-PCR, qRT-PCR, flow cytometry, Western blot, immunofluorescence were used to evaluate the expression of Hb-α, Hb-β, and nuclear factor E2-related factor-2(Nrf2) after hydrogen peroxide (H 2 O 2 ) induction. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay were used to determine the binding efficiency of Nrf2 on the Hb-α promoter. Stimulation of hPVECs and human vaginal epithelial cell line, VK2/E6E7 with H 2 O 2 augmented the expression of Hb-α, Hb-β, Nrf2, heme oxygenase-1 (HO-1), and reactive oxygen species (ROS). Treatment of these cells with Nrf2 inhibitor, trigonelline (Trig) inhibited Hb-α and Hb-β expressions. Hb-α and Hb-β overexpression downregulated H 2 O 2 -induced ROS. The presence of Nrf2 binding domain was demonstrated within Hb-α promoter. The results revealed for the first time that Hb-α and Hb-β were induced by oxidative stress through the activation of Nrf2. Overexpression of Hb-α and Hb-β ameliorated H 2 O 2 -induced oxidative stress, indicating one of the possible mechanism(s) to protect hPVECS from oxidative stress. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells

    International Nuclear Information System (INIS)

    Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)

  17. Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.

  18. Human factor as nuclear safety element

    International Nuclear Information System (INIS)

    Valeca, S.C.; Preda, M.; Valeca, M.; Ana, E. M.; Popescu, D.

    2008-01-01

    National nuclear power system is based on western technology, it covers almost 20% from national need and could be briefly described by: - Safety and economic performances of Cernavoda NPP Unit 1; - Reduced influence on environment, population and workers; - Excellent ranking (place 4) among CANDU units from all over the world. Also, the national nuclear power system plays a major role in Romanian power policy accomplishment: - Energy safety and independence assurance; - Decrease of production of greenhouse effect gases; - Preserve the stability and adequacy of energy cost. 'Nuclear Safety' concept covers all the activities resulting from nuclear fuel cycle. By taking into account the international experience, the related activities are estimated to last around 70 years in Romania: - 10 years for site description and selection, design, manufacturing and commissioning activities; - 40 years for Nuclear Power Plant operation, maintenance and modernization activities; - 20 years for preservation and decommissioning activities. The above mentioned activities requires human resources, qualified and specialized in the following areas: - research and development; - equipment design, manufacturing and operation; - components construction and assembly, operation and maintenance. (authors)

  19. Omeprazole induces NAD(P)H quinone oxidoreductase 1 via aryl hydrocarbon receptor-independent mechanisms: Role of the transcription factor nuclear factor erythroid 2–related factor 2

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Shaojie; Patel, Ananddeep; Moorthy, Bhagavatula; Shivanna, Binoy, E-mail: shivanna@bcm.edu

    2015-11-13

    Activation of the aryl hydrocarbon receptor (AhR) transcriptionally induces phase I (cytochrome P450 (CYP) 1A1) and phase II (NAD(P)H quinone oxidoreductase 1 (NQO1) detoxifying enzymes. The effects of the classical and nonclassical AhR ligands on phase I and II enzymes are well studied in human hepatocytes. Additionally, we observed that the proton pump inhibitor, omeprazole (OM), transcriptionally induces CYP1A1 in the human adenocarcinoma cell line, H441 cells via AhR. Whether OM activates AhR and induces the phase II enzyme, NAD(P)H quinone oxidoreductase 1 (NQO1), in fetal primary human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce NQO1 in HPMEC via the AhR. The concentrations of OM used in our experiments did not result in cytotoxicity. OM activated AhR as evident by increased CYP1A1 mRNA expression. However, contrary to our hypothesis, OM increased NQO1 mRNA and protein via an AhR-independent mechanism as AhR knockdown failed to abrogate OM-mediated increase in NQO1 expression. Interestingly, OM activated Nrf2 as evident by increased phosphoNrf2 (S40) expression in OM-treated compared to vehicle-treated cells. Furthermore, Nrf2 knockdown abrogated OM-mediated increase in NQO1 expression. In conclusion, we provide evidence that OM induces NQO1 via AhR-independent, but Nrf2-dependent mechanisms. - Highlights: • We investigated whether omeprazole induces NQO1 in human fetal lung cells. • Omeprazole induces the phase II enzyme, NQO1, in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of NQO1. • Omeprazole increases phosphoNrf2 (S40) protein expression in human fetal lung cells. • Nrf2 knockdown abrogates the induction of NQO1 by omeprazole in human lung cells.

  20. Importance of human factors on nuclear installations safety

    International Nuclear Information System (INIS)

    Caruso, G.J.

    1990-01-01

    Actually, installations safety and, in particular the nuclear installations infer a strong incidence in human factors related to the design and operation of such installations. In general, the experience aims to that the most important accidents have happened as result of the components' failures combination and human failures in the operation of safety systems. Human factors in the nuclear installations may be divided into two areas: economy and human reliability. Human factors treatments for the safety evaluation of the nuclear installations allow to diagnose the weak points of man-machine interaction. (Author) [es

  1. The human factor in nuclear reactor operation

    International Nuclear Information System (INIS)

    Bertron, L.

    1982-05-01

    The principal operating characteristics of nuclear power plants are summarized. A description of major hazards relating to operator fallibility in normal and abnormal operating conditions is followed by a specific analysis of control room hazards, shift organization and selection and training of management personnel

  2. Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.

    Science.gov (United States)

    Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali

    2017-03-01

    Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.

  3. Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

    International Nuclear Information System (INIS)

    Porter, P.N.; Ogawa, M.

    1982-01-01

    Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture

  4. Nuclear safety and human factors: the French factory of expertise

    International Nuclear Information System (INIS)

    Rolina, G.

    2009-01-01

    The French regulation of the nuclear safety is based on the maintaining of a deep technical dialogue between the nuclear safety authority, the I.R.S.N. (Institute of radiation protection and nuclear safety) and the nuclear operators. This type of risk management is called 'french coking' by the Anglo-Saxons, followers of stricter regulatory approach, more readable by the civil society. This technical dialogue is not without quality, especially in the field of human and organizational factors where it allows to improve the know how situation that stays incomplete. (N.C.)

  5. U.S. Nuclear Regulatory Commission human factors program plan

    International Nuclear Information System (INIS)

    1986-04-01

    The purpose of the U.S. Nuclear Regulatory Commission (NRC) Human Factors Program Plan is to ensure that proper consideration is given to human factors in the design and operation of nuclear facilities. This revised plan addresses human factors issues related to the operation of nuclear power plants (NPPs). The three issues of concern are (1) the activities planned to provide the technical bases to resolve the remaining tasks related to human factors as described in NUREG-0660, The NRC Action Plan Developed as a Result of the TMI-2 Accident, and NUREG-0737, Clarification of TMI Action Plan Requirements; (2) the need to address the additional human factors efforts that were identified during implementation of the Action Plan; and (3) the actual fulfillment of those developmental activities specified in Revision 1 of this plan. The plan represents a systematic approach for addressing high priority human factors concerns important to NPP safety in FY 1986 through 1987

  6. Human factors aspects of advanced instrumentation in the nuclear industry

    International Nuclear Information System (INIS)

    Carter, R.J.

    1989-01-01

    An important consideration in regards to the use of advanced instrumentation in the nuclear industry is the interface between the instrumentation system and the human. A survey, oriented towards identifying the human factors aspects of digital instrumentation, was conducted at a number of United States (US) and Canadian nuclear vendors and utilities. Human factors issues, subsumed under the categories of computer-generated displays, controls, organizational support, training, and related topics were identified. 20 refs., 2 tabs

  7. Availability improvement factors at Taipower's nuclear power plant system

    International Nuclear Information System (INIS)

    Chen, J.H.

    1985-01-01

    Sufficient electricity to meet the needs of a growing industrial economy, is one of the most important factors in the total economic development of a nation. Currently, nuclear power is considered one of the most economical and available sources of energy. To keep pace with Taiwan's rapid economic development, while also observing our government's policy of diversifying the requirements for imported forms of energy, Taiwan Power Company has embarked upon an ambitious of nuclear power plant construction. This paper discusses the improvement of Taiwan's nuclear power plants. At the present time, Taipower has completed three nuclear power plants. Two of these are located in northern Taiwan, along the East China Sea, while the third is on the southern tip of Taiwan, bordering the South China Sea. These three plants, each with two nuclear generating units, comprise a total nuclear generating capacity of 5144 MWe

  8. Factors influencing chemical durability of nuclear waste glasses

    International Nuclear Information System (INIS)

    Feng, Xiangdong; Bates, J.K.

    1993-01-01

    A short summary is given of our studies on the major factors that affect the chemical durability of nuclear waste glasses. These factors include glass composition, solution composition, SA/V (ratio of glass surface area to the volume of solution), radiation, and colloidal formation. These investigations have enabled us to gain a better understanding of the chemical durability of nuclear waste glasses and to accumulate.a data base for modeling the long-term durability of waste glass, which will be used in the risk assessment of nuclear waste disposal. This knowledge gained also enhances our ability to formulate optimal waste glass compositions

  9. Human factor analysis and preventive countermeasures in nuclear power plant

    International Nuclear Information System (INIS)

    Li Ye

    2010-01-01

    Based on the human error analysis theory and the characteristics of maintenance in a nuclear power plant, human factors of maintenance in NPP are divided into three different areas: human, technology, and organization. Which is defined as individual factors, including psychological factors, physiological characteristics, health status, level of knowledge and interpersonal skills; The technical factors including technology, equipment, tools, working order, etc.; The organizational factors including management, information exchange, education, working environment, team building and leadership management,etc The analysis found that organizational factors can directly or indirectly affect the behavior of staff and technical factors, is the most basic human error factor. Based on this nuclear power plant to reduce human error and measures the response. (authors)

  10. Research of human factor in nuclear power plants

    International Nuclear Information System (INIS)

    Nopp, I.

    1983-01-01

    The question is discussed of the study of the human factor with regard to the reliability of nuclear power plant operation. The reliability of the human factor is the result of the functional fitness, motivation, working conditions and working regime of personnel. (J.B.)

  11. Economic benefits of power factor correction at a nuclear facility

    International Nuclear Information System (INIS)

    Boger, R.M.; Dalos, W.; Juguilon, M.E.

    1986-01-01

    The economic benefits of correcting poor power factor at an operating nuclear facility are shown. A project approach for achieving rapid return of investment without disrupting plant availability is described. Examples of technical problems associated with using capacitors for power factor correction are presented

  12. Nuclear energy - stabilising factor in the world economy

    International Nuclear Information System (INIS)

    Legassov, V.; Feoktistov, L.; Kouzmine, I.

    1986-01-01

    One of the most important factors for international stability is the development of the economy, reducing the risk of local armed conflicts which could escalate into world-wide nuclear war. Economic progress which plays such a vital part is in turn heavily dependent on energy supplies. The article takes a brief look at the role of nuclear power in this context. (B.M.S.)

  13. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  14. Transfer factors for nuclear emergency preparedness

    Energy Technology Data Exchange (ETDEWEB)

    Kostiainen, E.; Haenninen, R. [Radiation and Nuclear Safety Authority (STUK) (Finland); Rosen, K.; Haak, E.; Eriksson, Aa. [Swedish Univ. of Agricultural Science (Sweden); Nielsen, S.P.; Keith-Roach, M. [Risoe National Lab. (Denmark); Salbu, B. [Agricultural Univ. of Norway (Norway)

    2002-12-01

    This report by the NKS/BOK-1.4 project subgroup describes transfer factors for radiocaesium and radiostrontium for the fallout year and the years after the fallout. The intention has been to collect information on tools to assess the order of magnitude of radioactive contamination of agricultural products in an emergency situation in Nordic environment. The report describes transfer paths from fallout to plant, from soil to plant and to animal products. The transfer factors of radionuclides (Sr, Cs, I) given in the report are intended to be used for making rough estimates of the contamination of agricultural products soon after the heaviness and composition of the deposition (Bq m{sup -2}) is known. (au)

  15. Transfer factors for nuclear emergency preparedness

    International Nuclear Information System (INIS)

    Kostiainen, E.; Haenninen, R.; Rosen, K.; Haak, E.; Eriksson, Aa.; Nielsen, S.P.; Keith-Roach, M.; Salbu, B.

    2002-12-01

    This report by the NKS/BOK-1.4 project subgroup describes transfer factors for radiocaesium and radiostrontium for the fallout year and the years after the fallout. The intention has been to collect information on tools to assess the order of magnitude of radioactive contamination of agricultural products in an emergency situation in Nordic environment. The report describes transfer paths from fallout to plant, from soil to plant and to animal products. The transfer factors of radionuclides (Sr, Cs, I) given in the report are intended to be used for making rough estimates of the contamination of agricultural products soon after the heaviness and composition of the deposition (Bq m -2 ) is known. (au)

  16. Human factors engineering in nuclear plant rehabilitations

    International Nuclear Information System (INIS)

    Bernston, K.; Remisz, M.; Malcolm, S.

    2001-01-01

    There are several unique considerations when creating and maintaining a human factors program for a plant refurbishment. These consideration arise from a variety of sources, including budget and time constraints on life extension projects, working to existing plant protocols and current acceptable HFE practices, and issues relating to function and task analysis. This results in a need to streamline and carefully time HFE practices from project start up to completion. In order to perform this task adequately, a comprehensive Human Factors Engineering Program Plan should be designed and tailored to the project. Systems of planning and prioritization are essential, and the required HFE designer training needs to be established. HFE specialists need to be aware of the existing plant constraints, and he prepared to work within them when providing support. The current paper discusses these aspects in the context of major refurbishment work at CANDU stations. (author)

  17. Key Factors for Nuclear Being Economic after Fukushima

    Energy Technology Data Exchange (ETDEWEB)

    Roh, Myung Sub; Park, Seo Yeon [KEPCO International Nuclear Graduate School, Ulju (Korea, Republic of)

    2012-05-15

    It is hard to overstate the importance of electricity to the standard of living and the quality of life in a country. Electricity demand grows with population and with the changing nature, level and composition of economic and social activity. Civilization, industrialization and urbanization are, of course, key factors. It, historically, has shown that each major nuclear accident has caused a re-examination of the risk of nuclear power leading to more stringent safety requirement and higher costs. The Fukushima accident and its likely impact on future nuclear power development are difficult to foresee. The accident was a tragedy for the people affected and seriously undermined public confidence in the safety of nuclear power. A number of countries announced reviews of their programs, some took steps toward phasing out nuclear power entirely, and others reemphasized their expansion plans. The Korean nuclear community is carry out many ambitious projects for last three decades continuously and facing the another challenges relating to the future nuclear power economics and difficulty in financing new investment. In order to meet the above economic objective, it is strongly recommended that great emphasis should be placed on maintaining the nuclear economics without jeopardizing safety such as design simplification, standardization, shortening of construction period, increased availability, etc

  18. Key Factors for Nuclear Being Economic after Fukushima

    International Nuclear Information System (INIS)

    Roh, Myung Sub; Park, Seo Yeon

    2012-01-01

    It is hard to overstate the importance of electricity to the standard of living and the quality of life in a country. Electricity demand grows with population and with the changing nature, level and composition of economic and social activity. Civilization, industrialization and urbanization are, of course, key factors. It, historically, has shown that each major nuclear accident has caused a re-examination of the risk of nuclear power leading to more stringent safety requirement and higher costs. The Fukushima accident and its likely impact on future nuclear power development are difficult to foresee. The accident was a tragedy for the people affected and seriously undermined public confidence in the safety of nuclear power. A number of countries announced reviews of their programs, some took steps toward phasing out nuclear power entirely, and others reemphasized their expansion plans. The Korean nuclear community is carry out many ambitious projects for last three decades continuously and facing the another challenges relating to the future nuclear power economics and difficulty in financing new investment. In order to meet the above economic objective, it is strongly recommended that great emphasis should be placed on maintaining the nuclear economics without jeopardizing safety such as design simplification, standardization, shortening of construction period, increased availability, etc

  19. Overview of factors affecting the leachability of nuclear waste forms

    International Nuclear Information System (INIS)

    Stone, J.A.

    1980-01-01

    An overview of various factors that affect the leachability of nuclear waste forms is presented. The factors affect primarily the leaching system (temperature, for example), the leachant (pH, for example), or the solid being leached (surface condition, for example). A qualitative understanding exists of the major factors affecting leaching, but further studies are needed to establish leaching mechanisms and develop predictive models. 67 refs

  20. A regulatory perspective on human factors in nuclear power

    International Nuclear Information System (INIS)

    Whitfield, D.

    1987-01-01

    This paper sets out the approaches being taken by the United Kingdom Nuclear Installations Inspectorate (NII) to monitoring the application of human factors principles and practice in the UK industry. The role of NII is outlined, the development of human factors concerns is reviewed, the assessment of the Sizewell 'B' safety case is presented as a particular example, and pertinent future developments in the human factors discipline are proposed. (author)

  1. Human factor engineering applied to nuclear power plant design

    International Nuclear Information System (INIS)

    Manrique, A.; Valdivia, J.C.; Jimenez, A.

    2001-01-01

    For the design and construction of new nuclear power plants as well as for maintenance and operation of the existing ones new man-machine interface designs and modifications are been produced. For these new designs Human Factor Engineering must be applied the same as for any other traditional engineering discipline. Advantages of implementing adequate Human Factor Engineering techniques in the design of nuclear reactors have become not only a fact recognized by the majority of engineers and operators but also an explicit requirement regulated and mandatory for the new designs of the so called advanced reactors. Additionally, the big saving achieved by a nuclear power plant having an operating methodology which significantly decreases the risk of operating errors makes it necessary and almost vital its implementation. The first step for this is preparing a plan to incorporate all the Human Factor Engineering principles and developing an integral design of the Instrumentation and Control and Man-machine interface systems. (author)

  2. The significance of human factors in nuclear activities

    International Nuclear Information System (INIS)

    Weil, L.; Berg, H.P.

    1999-01-01

    Human factors is an aspect increasingly investigated in the last few years in efforts and programmes for enhancing the operational safety of nuclear systems. Methodology has been elaborated for analysis and evaluation of human reliability, or development of instruments supporting the decisions to be taken by the operators at the man-control room interface of nuclear installations, as well as initial approaches to introduce organisational factors which may influence the man-machine function allocation, and thus are an element of the safety culture concept. The significance of human factors in nuclear activities, as well as activities at the national and international level for optimisation of the man-machine interface and the man-organisation interface are discussed. (orig./CB) [de

  3. Human factors in the Canadian nuclear industry: future needs

    International Nuclear Information System (INIS)

    Harrison, F.

    2008-01-01

    Currently the industry is facing refurbishment and new builds. At present most licensees in Canada do not have sufficient numbers of Human Factors staff. As a result, the activities of the CNSC are too often focused on providing guidance regarding the application of Human Factors, in addition to reviewing work submitted by the licensee. Greater efficiencies for both the licensee and the CNSC could be realized if licensee staff had greater Human Factors expertise. Strategies for developing Human Factors expertise should be explored through cooperative partnerships with universities, which could be encouraged to include Human Factors courses specific to nuclear. (author)

  4. Human factor in the problem of Russian nuclear industry safety

    International Nuclear Information System (INIS)

    Abramova, V.

    2002-01-01

    The approach to human factor definition, considered in the paper, consists of recognition of as many as possible factors for developing a complete list of factors, which have influence on mistakes or successful work of NPP personnel. Safety culture is considered as the main factor. The enhancement in nuclear power industry includes an optimization of organizational structures and development of personnel safety attitudes. The organizational factors, as possible root causes for human errors, need to be identified, assessed and improved. The organizational activities taken in Russia are presented

  5. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna

    2017-01-01

    are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark

  6. Serum-free Erythroid Differentiation for Efficient Genetic Modification and High-Level Adult Hemoglobin Production.

    Science.gov (United States)

    Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F

    2018-06-15

    In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.

  7. US Nuclear Regulatory Commission human-factors program plan

    International Nuclear Information System (INIS)

    1983-08-01

    The purpose of the NRC Human Factors Program Plan is to ensure that proper consideration is given to human factors in the design, operation, and maintenance of nuclear facilities. This initial plan addresses nuclear power plants (NPP) and describes (1) the technical assistance and research activities planned to provide the technical bases for the resolution of the remaining human factors related tasks described in NUREG-0660, The NRC Action Plan Developed as a Result of the TMI-2 Accident, and NUREG-0737, Clarification of TMI Action Plan Requirements, and (2) the additional human factors efforts identified during implementation of the Action Plan that should receive NRC attention. The plan represents a systematic and comprehensive approach for addressing human factors concerns important to NPP safety in the FY-83 through FY-85 time frame

  8. Correction factors for photon spectrometry in nuclear parameters study

    International Nuclear Information System (INIS)

    Patrao, Karla Cristina de Souza

    2004-10-01

    The goal of this work was the determination, using metrologic severity, the factors of correction for coincidences XX, Xγ and γγ and the factors of transference of efficiency for use in gamma spectrometry. On this way, it was carried through by determination of nuclear parameters of a nuclide used in medicine diagnostic ( 201 Tl) and the standardization of two environmental samples, of regular and irregular geometry, proceeding from the residual (ashes and slag) from the nuclear industry. The results shows that this adopted methodology is valid, and it allows its application for many different nuclides, including complex decay schema nuclides, using only photons spectrometry techniques on semiconductor detectors. (author)

  9. Nuclear modification factor using Tsallis non-extensive statistics

    Energy Technology Data Exchange (ETDEWEB)

    Tripathy, Sushanta; Garg, Prakhar; Kumar, Prateek; Sahoo, Raghunath [Indian Institute of Technology Indore, Discipline of Physics, School of Basic Sciences, Simrol (India); Bhattacharyya, Trambak; Cleymans, Jean [University of Cape Town, UCT-CERN Research Centre and Department of Physics, Rondebosch (South Africa)

    2016-09-15

    The nuclear modification factor is derived using Tsallis non-extensive statistics in relaxation time approximation. The variation of the nuclear modification factor with transverse momentum for different values of the non-extensive parameter, q, is also observed. The experimental data from RHIC and LHC are analysed in the framework of Tsallis non-extensive statistics in a relaxation time approximation. It is shown that the proposed approach explains the R{sub AA} of all particles over a wide range of transverse momentum but does not seem to describe the rise in R{sub AA} at very high transverse momenta. (orig.)

  10. Economic Conditions and Factors Affecting New Nuclear Power Deployment

    Energy Technology Data Exchange (ETDEWEB)

    Harrison, Thomas J [ORNL

    2014-10-01

    This report documents work performed in support of the US Department of Energy Office of Nuclear Energy’s Advanced Small Modular Reactor (AdvSMR) program. The report presents information and results from economic analyses to describe current electricity market conditions and those key factors that may impact the deployment of AdvSMRs or any other new nuclear power plants. Thus, this report serves as a reference document for DOE as it moves forward with its plans to develop advanced reactors, including AdvSMRs. For the purpose of this analysis, information on electricity markets and nuclear power plant operating costs will be combined to examine the current state of the nuclear industry and the process required to successfully move forward with new nuclear power in general and AdvSMRs in particular. The current electricity market is generally unfavorable to new nuclear construction, especially in deregulated markets with heavy competition from natural gas and subsidized renewables. The successful and profitable operation of a nuclear power plant (or any power plant) requires the rate at which the electricity is sold to be sufficiently greater than the cost to operate. The wholesale rates in most US markets have settled into values that provide profits for most operating nuclear power plants but are too low to support the added cost of capital recovery for new nuclear construction. There is a strong geographic dependence on the wholesale rate, with some markets currently able to support new nuclear construction. However, there is also a strong geographic dependence on pronuclear public opinion; the areas where power prices are high tend to have unfavorable views on the construction of new nuclear power plants. The use of government-backed incentives, such as subsidies, can help provide a margin to help justify construction projects that otherwise may not seem viable. Similarly, low interest rates for the project will also add a positive margin to the economic

  11. Factors which could limit the nuclear fuel cycle development

    International Nuclear Information System (INIS)

    Pecqueur, M.; Barre, B.

    1977-01-01

    The nuclear fuel cycle is a most important industry for the energy future of the world. It has also a leading part as regards the physical continuity of energy supply of the countries engaged in the nuclear field. The development of this industry is subject to the economic or political constraints involved by the availability of raw materials, technologies or production means. The various limiting factors which could affect the different stages of the fuel cycle are linked with the technical, economic and financial aspects, with the impact on the environment, nuclear safety, risks of non-pacific uses and proliferation of arms. Interesting to note is also the correlation between the fuel cycle development and the problems of energy independence and security of nuclear programs. As a conclusion, the nuclear fuel cycle industry is confronted to difficulties due to its extremely rapid growth (doubling time 5 years) which only few heavy industries have encountered for long periods. It is more over submitted to the political and safety constraints always linked with nuclear matters. The task is therefore a difficult one. But the objective is worth-while since it is a condition to the development of nuclear industry [fr

  12. Human factor in the process of nuclear power development

    International Nuclear Information System (INIS)

    Enenkl, V.

    The building up of nuclear power requires the training not only of personnel but of the whole population as well. Professional workers in nuclear power facilities production and personnel operating the equipment of nuclear power plants must be on a high technical and managerial level. The important quality of such personnel is their reliability and responsibility. The human factor influences the level, quality and thereby also the service-life of the machines and equipment and their operation. The improvement of the quality of work in nuclear power production depends on upgrading the scientific and technical level of workers and personnel, their training, in-service education and the raising of the social standing. (B.H.)

  13. Human factors engineering plan for reviewing nuclear plant modernization programs

    International Nuclear Information System (INIS)

    O'Hara, John; Higgins, James

    2004-12-01

    The Swedish Nuclear Power Inspectorate reviews the human factors engineering (HFE) aspects of nuclear power plants (NPPs) involved in the modernization of the plant systems and control rooms. The purpose of a HFE review is to help ensure personnel and public safety by verifying that accepted HFE practices and guidelines are incorporated into the program and nuclear power plant design. Such a review helps to ensure the HFE aspects of an NPP are developed, designed, and evaluated on the basis of a structured top-down system analysis using accepted HFE principles. The review addresses eleven HFE elements: HFE Program Management, Operating Experience Review, Functional Requirements Analysis and Allocation, Task Analysis, Staffing, Human Reliability Analysis, Human-System Interface Design, Procedure Development, Training Program Development, Human Factors Verification and Validation, and Design Implementation

  14. Human factors engineering plan for reviewing nuclear plant modernization programs

    Energy Technology Data Exchange (ETDEWEB)

    O' Hara, John; Higgins, James [Brookhaven National Laboratory, Upton, NY (United States)

    2004-12-01

    The Swedish Nuclear Power Inspectorate reviews the human factors engineering (HFE) aspects of nuclear power plants (NPPs) involved in the modernization of the plant systems and control rooms. The purpose of a HFE review is to help ensure personnel and public safety by verifying that accepted HFE practices and guidelines are incorporated into the program and nuclear power plant design. Such a review helps to ensure the HFE aspects of an NPP are developed, designed, and evaluated on the basis of a structured top-down system analysis using accepted HFE principles. The review addresses eleven HFE elements: HFE Program Management, Operating Experience Review, Functional Requirements Analysis and Allocation, Task Analysis, Staffing, Human Reliability Analysis, Human-System Interface Design, Procedure Development, Training Program Development, Human Factors Verification and Validation, and Design Implementation.

  15. Personality Factors and Nuclear Power Plant Operators: Initial License Success

    Science.gov (United States)

    DeVita-Cochrane, Cynthia

    Commercial nuclear power utilities are under pressure to effectively recruit and retain licensed reactor operators in light of poor candidate training completion rates and recent candidate failures on the Nuclear Regulatory Commission (NRC) license exam. One candidate failure can cost a utility over $400,000, making the successful licensing of new operators a critical path to operational excellence. This study was designed to discover if the NEO-PI-3, a 5-factor measure of personality, could improve selection in nuclear utilities by identifying personality factors that predict license candidate success. Two large U.S. commercial nuclear power corporations provided potential participant contact information and candidate results on the 2014 NRC exam from their nuclear power units nation-wide. License candidates who participated (n = 75) completed the NEO-PI-3 personality test and results were compared to 3 outcomes on the NRC exam: written exam, simulated operating exam, and overall exam result. Significant correlations were found between several personality factors and both written and operating exam outcomes on the NRC exam. Further, a regression analysis indicated that personality factors, particularly Conscientiousness, predicted simulated operating exam scores. The results of this study may be used to support the use of the NEO-PI-3 to improve operator selection as an addition to the current selection protocol. Positive social change implications from this study include support for the use of a personality measure by utilities to improve their return-on-investment in candidates and by individual candidates to avoid career failures. The results of this study may also positively impact the public by supporting the safe and reliable operation of commercial nuclear power utilities in the United States.

  16. A report on human factors in nuclear safety

    International Nuclear Information System (INIS)

    1983-03-01

    Following the Three Mile Island incident of 1979, studies were undertaken by the Atomic Energy Control Board (AECB), in-house and through outside consultants, to address the role of human factors in the regulatory process. This report by the Advisory Committee on Nuclear Safety (ACNS) comments briefly on these studies and offers suggestions which would promote a more formal treatment of human factors by the AECB

  17. Factor of radioactive waste on nuclear power program

    International Nuclear Information System (INIS)

    Syed Abdul Malik Syed Zain

    2009-01-01

    Global warming phenomena and rising oil prices have brought the excitement of open space use of nuclear power. Arguments in favor of this technology range in terms of more environmentally friendly, energy diversification and cost efficiency has prompted the government to widen the choice of nuclear power be considered as a serious alternative. Despite the attractive factors to the use of these powers, there are also factors that stem from the continued development of nuclear power. These include the factor of safety, security, security of fuel supply, and public attention is often associated with radioactive waste management. This article attempts to debate specific to radioactive waste management factors that impact on public acceptance of a country's nuclear power program, especially in Malaysia. Starting from the absence of radioactive waste management policy to model uncertainty of the landfill and complications in selecting a repository site shows the basic infrastructure is still lacking. In addition, previous experience handling thorium waste has not reached a final settlement after several years of implementation. It reinforced the perception about the level of public confidence in the competence and attitude of local workers who are not very encouraging to pursue this advanced.

  18. on skin keratinocytes by nuclear factor-kappa B

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-06-21

    Jun 21, 2012 ... Effects of advanced glycation end-products (AGEs) on ... AGE levels, nuclear factor-kappa B (NF-κB) localization and cell viability were measured in vivo. ..... and related alteration in NF-κB activity, we treated normal cells by ...

  19. Expression of assayable residual stem cell damage in erythroid differentiation

    International Nuclear Information System (INIS)

    Huebner, G.E.; Miller, M.E.; Cronkite, E.P.

    1985-01-01

    In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)

  20. Natural antioxidants exhibit chemopreventive characteristics through the regulation of CNC b-Zip transcription factors in estrogen-induced breast carcinogenesis.

    Science.gov (United States)

    Chatterjee, Anwesha; Ronghe, Amruta; Singh, Bhupendra; Bhat, Nimee K; Chen, Jie; Bhat, Hari K

    2014-12-01

    The objective of the present study was to characterize the role of resveratrol (Res) and vitamin C (VC) in prevention of estrogen-induced breast cancer through regulation of cap "n"collar (CNC) b-zip transcription factors. Human breast epithelial cell line MCF-10A was treated with 17β-estradiol (E2) and VC or Res with or without E2. mRNA and protein expression levels of CNC b-zip transcription factors nuclear factor erythroid 2-related factor 1 (Nrf1), nuclear factor erythroid 2 related factor 2 (Nrf2), nuclear factor erythroid 2 related factor 3 (Nrf3), and Nrf2-regulated antioxidant enzymes superoxide dismutase 3 (SOD3) and quinone oxidoreductase 1 (NQO1) were quantified. The treatment with E2 suppressed, whereas VC and Res prevented E2-mediated decrease in the expression levels of SOD3, NQO1, Nrf2 mRNA, and protein in MCF-10A cells. The treatment with E2, Res, or VC significantly increased mRNA and protein expression levels of Nrf1. 17β-Estradiol treatment significantly increased but VC or Res decreased Nrf3 mRNA and protein expression levels. Our studies demonstrate that estrogen-induced breast cancer might be prevented through upregulation of antioxidant enzymes via Nrf-dependent pathways. © 2014 Wiley Periodicals, Inc.

  1. Reduction of erythroid progenitors in protein-energy malnutrition.

    Science.gov (United States)

    Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio

    2007-02-01

    Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.

  2. US Nuclear Regulatory Commission Human Factors Program Plan. Revision 1

    International Nuclear Information System (INIS)

    1984-09-01

    The purpose of the NRC Human Factors Program Plan (NUREG-0985) is to ensure that proper consideration is given to human factors in the design, operation, and maintenance of nuclear facilities. This revised plan addresses nuclear power plants (NPPs) and describes (1) the technical assistance and research activities planned to provide the technical bases for the resolution of the remaining human factors related tasks described in NUREG-0660, THE NRC Action Plan developed as a result of the TMI-2 Accident, and NUREG-0737, Clarification of TMI Action Plan Requirements; (2) the additional human factors efforts identified during implementation of the Action Plan that should receive NRC attention; (3) conduct of developmental activities specified in NUREG-0985 during FY-83; and (4) the impact of Section 306 of the Nuclear Waste Policy Act of 1982, PL 97-425. The plan represents a systematic and comprehensive approach for addressing human factors concerns important to NPP safety in the FY-84 through FY-86 time frame

  3. Quality management in the nuclear industry: the human factor

    International Nuclear Information System (INIS)

    1990-01-01

    In the nuclear industry it is vital to understand the 'human factor' with regard to plant performance and plant safety. A proper management system ensures that personnel perform their duties correctly. 'Quality Management in the Nuclear Industry: the Human Factor', was a conference organized by the Institution of Mechanical Engineers in October 1990. The conference covered a wide range of topics on an international level including: standards, licensing and regulatory procedures; selection assessment and training of personnel; feedback from experience of good practice and of deviations; management and support of personnel performance; modelling and evaluation of human factors. The papers presented at the conference are contained in this volume. All twenty papers are indexed separately. (author)

  4. Erythroblastic Sarcoma Presenting as Bilateral Ovarian Masses in an Infant with Pure Erythroid Leukemia

    Science.gov (United States)

    Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.

    2010-01-01

    Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494

  5. Nuclear Factor-kappaB in Autoimmunity: Man and Mouse.

    Science.gov (United States)

    Miraghazadeh, Bahar; Cook, Matthew C

    2018-01-01

    NF-κB (nuclear factor-kappa B) is a transcription complex crucial for host defense mediated by innate and adaptive immunity, where canonical NF-κB signaling, mediated by nuclear translocation of RelA, c-Rel, and p50, is important for immune cell activation, differentiation, and survival. Non-canonical signaling mediated by nuclear translocation of p52 and RelB contributes to lymphocyte maturation and survival and is also crucial for lymphoid organogenesis. We outline NF-κB signaling and regulation, then summarize important molecular contributions of NF-κB to mechanisms of self-tolerance. We relate these mechanisms to autoimmune phenotypes described in what is now a substantial catalog of immune defects conferred by mutations in NF-κB pathways in mouse models. Finally, we describe Mendelian autoimmune syndromes arising from human NF-κB mutations, and speculate on implications for understanding sporadic autoimmune disease.

  6. Human factors guidelines for nuclear power plant applications

    International Nuclear Information System (INIS)

    Ketchel, J.

    1993-01-01

    In 1989, Waters et al. reported to the Human Factors Society on developing human factors criteria for a new reactor plant. They correctly indicated that much of the guidance documentation in human factors engineering has derived from MIL-STD-1472 and its antecedents. Guidelines for human-computer interface have sprung primarily from the Smith and Mosier compendium and its source documents. NUREG-0700, which is currently being updated, was developed by the US Nuclear Regulatory Commission (NRC) as a general evaluation guide for inspecting control rooms. In addition, the Electric Power Research Institute, Institute of Nuclear Power Operations, US Department of Energy, the NRC, and others have published a number of specialized documents on a range of subjects. The number of guidelines and standards has grown in the past few years to an impressive number, including those published by international organizations and professional societies. This paper provides an update on current efforts to provide appropriate guidance for the power industry and, perhaps more importantly, offers a perspective on how users should think about using the available materials and what else is needed. The Electric Power Research Institute (EPRI) continues to be one of the principal participants in providing guidance to the utilities. Human factors guidelines is indeed a timely topic, currently of great interest to EPRI's constituents and to designers of new and upgraded nuclear power plants (NPMs) in the Advanced Light Water Reactor and the Instrumentation and Control Upgrade Initiative programs

  7. Factors affecting the next generation of nuclear power

    International Nuclear Information System (INIS)

    Remick, F.J.

    1990-01-01

    For both financial, environmental and health reasons, and because of external and internal factors affecting this nation's energy supply, nuclear power will likely play a part in supplying this nation's energy in the coming decades. I believe this to be true for some other parts of the world as well. Even some severe critics of the nuclear power industry and the NRC might agree with me on this point. Increasing concern with the environmental consequences of the burning of fossil fuels has led some former opponents of the use of nuclear power to balance anew the risks and benefits of nuclear power and to modify to some degree their former opposition. A related concern with the adequacy of the energy supply is leading others to modify their positions. According to analyses done by the U.S. Department of Energy, after 1994 the United States will no longer be able to assure all its citizens a reliable supply of electricity. Already, many areas of the country are in need of additional electric capacity. In both Sweden and Switzerland, similar concerns have led to the adoption by many of more compromising positions. Some critics of nuclear power may in the end still reject it as an alternative, but, with the increased pressures on the environment and on our energy supply, nuclear power is an alternative which cannot be rejected without the most serious consideration. This should be, I believe, a point of consensus among us. In sum, there is a future for nuclear power in the sense that there is a use for it

  8. Factors affecting the next generation of nuclear power

    Energy Technology Data Exchange (ETDEWEB)

    Remick, F J [Nuclear Regulatory Commission, Washington, DC (United States)

    1990-07-01

    For both financial, environmental and health reasons, and because of external and internal factors affecting this nation's energy supply, nuclear power will likely play a part in supplying this nation's energy in the coming decades. I believe this to be true for some other parts of the world as well. Even some severe critics of the nuclear power industry and the NRC might agree with me on this point. Increasing concern with the environmental consequences of the burning of fossil fuels has led some former opponents of the use of nuclear power to balance anew the risks and benefits of nuclear power and to modify to some degree their former opposition. A related concern with the adequacy of the energy supply is leading others to modify their positions. According to analyses done by the U.S. Department of Energy, after 1994 the United States will no longer be able to assure all its citizens a reliable supply of electricity. Already, many areas of the country are in need of additional electric capacity. In both Sweden and Switzerland, similar concerns have led to the adoption by many of more compromising positions. Some critics of nuclear power may in the end still reject it as an alternative, but, with the increased pressures on the environment and on our energy supply, nuclear power is an alternative which cannot be rejected without the most serious consideration. This should be, I believe, a point of consensus among us. In sum, there is a future for nuclear power in the sense that there is a use for it.

  9. Statistical factors affecting the success of nuclear operations

    International Nuclear Information System (INIS)

    Sunder, S.; Stephenson, J.R.; Hochman, D.

    1999-01-01

    In this article, the authors present a statistical analysis to determine the operational, financial, technical, and managerial factors that most significantly affect the success of nuclear operations. The study analyzes data for over 70 nuclear plants and 40 operating companies over a period of five years in order to draw conclusions that they hope will be of interest to utility companies and public utility commissions as they seek ways to improve rates of success in nuclear operations. Some of these conclusions will not be surprising--for example, that older plants have heavier maintenance requirements--but others are less intuitive. For instance, the observation that operators of fewer plants have lower costs suggests that any experience curve benefits associated with managing multiple nuclear facilities is overshadowed by the logistic problems of multiple facilities. After presenting a brief history of nuclear power in America, the authors outline the motivations of the study and the methodology of their analysis. They end the article with the results of the study and discuss some of the managerial implications of these findings

  10. Factors influencing the decommissioning of large-scale nuclear plants

    International Nuclear Information System (INIS)

    Large, J.H.

    1988-01-01

    The decision-making process involving the decommissioning of the UK graphite moderated, gas-cooled nuclear power stations is complex. There are timing, engineering, waste disposal, cost and lost generation capacity factors to consider and the overall decision of when and how to proceed with decommissioning may include political and public tolerance dimensions. For the final stage of decommissioning the nuclear industry could either completely dismantle the reactor island leaving a green-field site or, alternatively, the reactor island could be maintained indefinitely with additional super- and substructure containment. At this time the first of these options, or deferred decommissioning, prevails and with this the nuclear industry has expressed considerable confidence that the technology required will become available with passing time, that acceptable radioactive waste disposal methods and facilities will be available and that the eventual costs of decommissioning will not escalate without restraint. If the deferred decommissioning strategy is wrong and it is not possible to completely dismantle the reactor islands a century into the future, then it may be too late to effect sufficient longer term containment to maintain the reactor hulks in a reliable condition. With respect to the final decommissioning of large-scale nuclear plant, it is concluded that the nuclear industry does not know quite how to do it, when it will be attempted and when it will be completed, and they do not know how much it will eventually cost. (author)

  11. Human factor engineering applied to nuclear power plant design

    International Nuclear Information System (INIS)

    Manrique, A.; Valdivia, J.C.

    2007-01-01

    Advantages of implementing adequate Human Factor Engineering techniques in the design of nuclear reactors have become not only a fact recognized by the majority of engineers and operators but also an explicit requirement regulated and mandatory for the new designs of the so called advanced reactors. The first step for this is preparing a plan to incorporate all the Human Factor Engineering principles and developing an integral design of the Instrumentation and Control and Man-machine interface systems. Such a plan should state: -) Activities to be performed, and -) Creation of a Human Factor Engineering team adequately qualified. The Human Factor Engineering team is an integral part of the design team and is strongly linked to the engineering organizations but simultaneously has independence to act and is free to evaluate designs and propose changes in order to enhance human behavior. TECNATOM S.A. (a Spanish company) has been a part of the Design and Human Factor Engineering Team and has collaborated in the design of an advanced Nuclear Power Plant, developing methodologies and further implementing those methodologies in the design of the plant systems through the development of the plant systems operational analysis and of the man-machine interface design. The methodologies developed are made up of the following plans: -) Human Factor Engineering implementation in the Man-Machine Interface design; -) Plant System Functional Requirement Analysis; -) Allocation of Functions to man/machine; -) Task Analysis; -) Human-System Interface design; -) Control Room Verification and -) Validation

  12. Nuclear Regulatory Commission Human Factors Program Plan. Revision 2

    International Nuclear Information System (INIS)

    1986-04-01

    This document is the Second Annual Revision to the NRC Human Factors Program Plan. The first edition was published in August 1983. Revision 1 was published in July of 1984. Purpose of the NRC Human Factors Program is to ensure that proper consideration is given to human factors in the design and operation of nuclear power plants. This document describes the plans of the Office of Nuclear Reactor Regulation to address high priority human factors concerns of importance to reactor safety in FY 1986 and FY 1987. Revision 2 of the plan incorporates recent Commission decisions and policies bearing on the human factors aspects of reactor safety regulation. With a few exceptions, the principal changes from prior editions reflect a shift from developing new requirements to staff evaluation of industry progress in resolving human factors issues. The plan addresses seven major program elements: (1) Training, (2) Licensing Examinations, (3) Procedures, (4) Man-Machine Interface, (5) Staffing and Qualifications, (6) Management and Organization, and (7) Human Performance

  13. Major factors influencing craft productivity in nuclear power plant construction

    International Nuclear Information System (INIS)

    Borcherding, J.D.; Sebastian, S.J.

    1980-01-01

    This paper reports on a research study whose objective was to determine the most influential factors adversely affecting craft productivity in nuclear power plant construction from the perspective of the tradesmen employed at the sites. Data were collected through the use of a questionnaire survey and group interview sessions, predominantly with workmen, at six nuclear power plant construction projects. Craftsmen were chosen as the major data base because of their awareness of how their time would actually be spent on the project. Topics considered include the factors influencing craft productivity, material availability, redoing work, crew interfacing, overcrowded work areas, instruction time, inspection delays, craft turnover, craft absenteeism, foreman changes, foreman incompetence, engineering design lead time, comprehensive scheduling of the design function, the responsibility of the utility, value engineering, plant standardization, the effective utilization of the planning and scheduling system, and the labor-management committee

  14. PI3 kinase is important for Ras, MEK and Erk activation of Epo-stimulated human erythroid progenitors

    Directory of Open Access Journals (Sweden)

    Schmidt Enrico K

    2004-05-01

    Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.

  15. Human-factor operating concept for Borssele Nuclear Power Station

    International Nuclear Information System (INIS)

    Wieman, J.L.

    1995-01-01

    The safety level in the operation of a reactor is determined basically by human beings. The Borssele Nuclear Power Station has carried out measures for improving the man-machine interface through training and operating instructions for the shift personnel. The retrofitting of control technology relevant to safety engineering should avoid operating instructions which can cause potential failures. A safety study has shown that the remaining risk following all retrofitting measures remains dependent to the extent of 80% on human factors and that human factors as a whole have a positive effect on reactor safety. (orig.) [de

  16. A human factors data bank for French nuclear power plants

    International Nuclear Information System (INIS)

    Villemeur, A.; Mosneron-Dupin, F.; Bouissou, M.; Meslin, T.

    1986-01-01

    CONFUCIUS is a computerized data bank developed by Electricite de France to study human factors in nuclear power plants. A detailed and homogeneous grouping of described operation and maintenance errors as well as of performance times is possible with CONFUCIUS. It also incorporates a selection of statistical treatment softwares. Readily usable and modifiable, the system can easily evolve. It allows a wide range of applications (safety analysis, event analysis, training, human factors engineering, probabilistic analysis). Data derived from the analysis of significant events reported in power plants and from the analysis of simulator tests are used as inputs into this data bank

  17. Battelle's human factors program for the US Nuclear Regulatory Commission

    International Nuclear Information System (INIS)

    Shikiar, R.

    1983-10-01

    Battelle has been involved in a programmatic effort of technical assistance to the Division of Human Factors Safety of the NRC. This program involves the efforts of over 75 professionals engaged in over 20 projects. These projects span the areas of human factors engineering, procedures, examinations, training, staffing and qualifications, and utility management and organization. All of these bear, one way or another, on the role of operators in nuclear power plants. This programmatic effort can be viewed as part of an integrative approach to system safety

  18. Human factors methods for nuclear control room design. Volume I. Human factors enhancement of existing nuclear control rooms. Final report

    International Nuclear Information System (INIS)

    Seminara, J.L.; Seidenstein, S.; Eckert, S.K.; Smith, D.L.

    1979-11-01

    Human factors engineering is an interdisciplinary specialty concerned with influencing the design of equipment systems, facilities, and operational environments to promote safe, efficient, and reliable operator performance. Human factors approaches were applied in the design of representative nuclear power plant control panels. First, methods for upgrading existing operational control panels were examined. Then, based on detailed human factors analyses of operator information and control requirements, designs of reactor, feedwater, and turbine-generator control panels were developed to improve the operator-control board interface, thereby reducing the potential for operator errors. In addition to examining present-generation concepts, human factors aspects of advanced systems and of hybrid combinations of advanced and conventional designs were investigated. Special attention was given to warning system designs. Also, a survey was conducted among control board designers to (1) develop an overview of design practices in the industry, and (2) establish appropriate measures leading to a more systematic concern for human factors in control board design

  19. Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

    International Nuclear Information System (INIS)

    Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella

    2010-01-01

    Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

  20. Key Response Planning Factors for the Aftermath of Nuclear Terrorism

    Energy Technology Data Exchange (ETDEWEB)

    Buddemeier, B R; Dillon, M B

    2009-01-21

    Despite hundreds of above-ground nuclear tests and data gathered from Hiroshima and Nagasaki, the effects of a ground-level, low-yield nuclear detonation in a modern urban environment are still the subject of considerable scientific debate. Extensive review of nuclear weapon effects studies and discussions with nuclear weapon effects experts from various federal agencies, national laboratories, and technical organizations have identified key issues and bounded some of the unknowns required to support response planning for a low-yield, ground-level nuclear detonation in a modern U.S. city. This study, which is focused primarily upon the hazards posed by radioactive fallout, used detailed fallout predictions from the advanced suite of three-dimensional (3-D) meteorology and plume/fallout models developed at Lawrence Livermore National Laboratory (LLNL), including extensive global Key Response Planning Factors for the Aftermath of Nuclear Terrorism geographical and real-time meteorological databases to support model calculations. This 3-D modeling system provides detailed simulations that account for complex meteorology and terrain effects. The results of initial modeling and analysis were presented to federal, state, and local working groups to obtain critical, broad-based review and feedback on strategy and messaging. This effort involved a diverse set of communities, including New York City, National Capitol Regions, Charlotte, Houston, Portland, and Los Angeles. The largest potential for reducing casualties during the post-detonation response phase comes from reducing exposure to fallout radiation. This can be accomplished through early, adequate sheltering followed by informed, delayed evacuation.B The response challenges to a nuclear detonation must be solved through multiple approaches of public education, planning, and rapid response actions. Because the successful response will require extensive coordination of a large number of organizations, supplemented by

  1. Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio

    2017-07-15

    Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. [Update on the biology of heme synthesis in erythroid cells].

    Science.gov (United States)

    Fujiwara, Tohru; Harigae, Hideo

    2015-02-01

    Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.

  3. Prospective identification of erythroid elements in cultured peripheral blood.

    Science.gov (United States)

    Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P

    1999-04-01

    We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.

  4. Transferring aviation human factors technology to the nuclear power industry

    International Nuclear Information System (INIS)

    Montemerlo, M.D.

    1981-01-01

    The purpose of this paper is to demonstrate the availability of aviation safety technology and research on problems which are sufficiently similar to those faced by the nuclear power industry that an agressive effort to adapt and transfer that technology and research is warranted. Because of time and space constraints, the scope of this paper is reduced from a discussion of all of aviation safety technology to the human factors of air carrier safety. This area was selected not only because of similarities in the human factors challenges shared by both industries (e.g. selection, training, evaluation, certification, etc.) but because experience in aviation has clearly demonstrated that human error contributes to a substantially greater proportion of accidents and incidents than does equipment failure. The Congress of the United States has placed a great deal of emphasis on investigating and solving human factors problems in aviation. A number of recent examples of this interest and of the resulting actions are described. The opinions of prominent aviation organizations as to the human factors problems most in need of research are presented, along with indications of where technology transfer to the nuclear power industry may be viable. The areas covered include: fatigue, crew size, information transfer, resource management, safety data-bases, the role of automation, voice and data recording systems, crew distractions, the management of safety regulatory agencies, equipment recertification, team training, crew work-load, behavioural factors, human factors of equipment design, medical problems, toxicological factors, the use of simulators for training and certification, determining the causes of human errors, the politics of systems improvement, and importance of both safety and public perception of safety if the industry is to be viable. (author)

  5. Tumour Necrosis Factor-alpha and Nuclear Factor-kappa B Gene Variants in Sepsis.

    Science.gov (United States)

    Acar, Leyla; Atalan, Nazan; Karagedik, E Hande; Ergen, Arzu

    2018-01-20

    The humoral system is activated and various cytokines are released due to infections in tissues and traumatic damage. Nuclear factor-kappa B dimers are encoded by nuclear factor-kappa B genes and regulate transcription of several crucial proteins of inflammation such as tumour necrosis factor-alpha. To investigate the possible effect of polymorphisms on tumour necrosis factor-alpha serum levels with clinical and prognostic parameters of sepsis by determining the nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A) gene polymorphisms and tumour necrosis factor-alpha serum levels. Case-control study. Seventy-two patients with sepsis and 104 healthy controls were included in the study. In order to determine the polymorphisms of nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A), polymerase chain reaction-restriction fragment length polymorphism analysis was performed and serum tumour necrosis factor-alpha levels were determined using an enzyme-linked immunosorbent assay. We observed no significant differences in tumour necrosis factor-alpha serum levels between the study groups. In the patient group, an increase in the tumour necrosis factor-alpha serum levels in patients carrying the tumour necrosis factor-alpha (-308 G/A) A allele compared to those without the A allele was found to be statistically significant. Additionally, an increase in the tumour necrosis factor-alpha serum levels in patients carrying tumour necrosis factor-alpha (-308 G/A) AA genotype compared with patients carrying the AG or GG genotypes was statistically significant. No significant differences were found in these 2 polymorphisms between the patient and control groups (p>0.05). Our results showed the AA genotype and the A allele of the tumour necrosis factor-alpha (-308 G/A) polymorphism may be used as a predictor of elevated tumour necrosis factor-alpha levels in patients with sepsis.

  6. Human Factors Engineering Review Model for advanced nuclear power reactors

    International Nuclear Information System (INIS)

    O'Hara, J.; Higgins, J.; Goodman, C.; Galletti, G.: Eckenrode, R.

    1993-01-01

    One of the major issues to emerge from the initial design reviews under the certification process was that detailed human-systems interface (HSI) design information was not available for staff review. To address the lack of design detail issue. The Nuclear Regulatory Commission (NRC) is performing the design certification reviews based on a design process plan which describes the human factors engineering (HFE) program elements that are necessary and sufficient to develop an acceptable detailed design specification. Since the review of a design process is unprecedented in the nuclear industry. The criteria for review are not addressed by current regulations or guidance documents and. therefore, had to be developed. Thus, an HFE Program Review Model was developed. This paper will describe the model's rationale, scope, objectives, development, general characteristics. and application

  7. Human factors considerations for expert systems in the nuclear industry

    International Nuclear Information System (INIS)

    Nelson, W.R.

    1988-01-01

    This paper discusses the general human factors issues relative to the development and implementation of expert systems for the nuclear industry. It summarizes the relevant research that addresses these issues, and identifies those areas that need the most effort for success. Since much of the prominent work for the application of expert systems has focused on computerized aids for decision making in emergencies, this paper draws from this area for its examples. This area tends to highlight the issues because of the safety-critical nature of the application. The same issues, however, are relevant to other applications of expert systems in the nuclear industry as well, even though the consequences of failure may not be as dramatic

  8. Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

    International Nuclear Information System (INIS)

    Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

    2004-01-01

    The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

  9. Human and social factors in the transportation of nuclear wastes

    International Nuclear Information System (INIS)

    Freudenburg, W.R.

    1991-01-01

    The main body of this report is a broad-based examination of human and social factors in the transportation of nuclear wastes. It deals with pair interested problems that, while familiar to the social science community, appear to have received little attention from the risk assessment community to data: The human and social attenuation of risk estimates, and the organizational amplification of risks. Second, given the special opportunities for learning that are presented by the recent Alaska oil spill, in particular, the Appendix to this report examines the issue of organizational foresight in the context of the Exxon oil spill

  10. Factors affecting the cost and competitiveness of nuclear electricity

    International Nuclear Information System (INIS)

    Bertel, E.; Stevens, G.H.

    1996-01-01

    The general context in which are carried out the investment choices of the electric sector has evolved in a significant way during these last years and the changes are to a certain extent irreversible. Economic globalization, deregulation of the electricity market, privatisation of electricity producers, and increasing awareness of environmental issues are modifying the policy-making landscape and the criteria and priorities of decision-makers in the power sector. Competitiveness remains a cornerstone for evaluating and choosing alternative technologies in the process of planning and decision-making for electricity system expansion or power plant replacement. Nevertheless, the production costs analysis inserts factors which were not taking before into account as for instance social impacts, health and environmental effects. These new approaches better reveal the total costs of the different production means. They will certainly lead to different choices than those based on the whole comparison of direct costs supported by producers. The economic studies carried out by the Nuclear Energy Agency of the OECD (NEA) cover all the preceding aspects and give objective information on the competitiveness of nuclear electricity. The nuclear industry has today the necessary means to take up the challenges of the electricity new markets. (O.M.)

  11. Studies on human factors in nuclear power plants

    International Nuclear Information System (INIS)

    Tsukuda, H.; Miyaoka, S.

    1988-01-01

    In order to raise the reliability and safety of nuclear power plants to the highest possible level, improvements to the mechanical system alone are not sufficient. Human factors must be systematically analysed and the causes and mechanisms of human error clarified to allow the development of countermeasures that will reduce error as much as possible. The paper introduces research in two areas, fundamental clarification of human behavioural, physiological and psychological characteristics to aid in the development of preventive measures for reducing error, and studies involving analysis of actual cases of accidents and failures related to man along with development of countermeasures to prevent the recurrence of such cases. The paper especially considers the latter area. The Human Performance Evaluation System (HPES) developed by the Institute of Nuclear Power Operations (INPO) in the USA was applied on a trial basis to 31 recent accidents and failures at Japanese nuclear power plants. The effectiveness of and possible improvement to HPES were considered. Also, cases that were not directly linked to accidents or failures were analysed using a method developed independently in Japan using data collected from a survey of approximately 3,000 power plant personnel. Fundamental research on human behaviour, physiology and psychology are also introduced. (author). 4 figs

  12. Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c-Kit in stress erythropoiesis

    NARCIS (Netherlands)

    von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.

    2001-01-01

    Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal

  13. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

    Science.gov (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

    1998-06-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  14. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    Science.gov (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  15. Nuclear alpha spectrin: Critical roles in DNA interstrand cross-link repair and genomic stability

    OpenAIRE

    Lambert, Muriel W

    2016-01-01

    Non-erythroid alpha spectrin (?IISp) is a structural protein which we have shown is present in the nucleus of human cells. It interacts with a number of nuclear proteins such as actin, lamin, emerin, chromatin remodeling factors, and DNA repair proteins. ?IISp?s interaction with DNA repair proteins has been extensively studied. We have demonstrated that nuclear ?IISp is critical in DNA interstrand cross-link (ICL) repair in S phase, in both genomic (non-telomeric) and telomeric DNA, and in ma...

  16. Human Factors Considerations in New Nuclear Power Plants: Detailed Analysis.

    Energy Technology Data Exchange (ETDEWEB)

    OHara,J.; Higgins, J.; Brown, W.; Fink, R.

    2008-02-14

    This Nuclear Regulatory Commission (NRC) sponsored study has identified human-performance issues in new and advanced nuclear power plants. To identify the issues, current industry developments and trends were evaluated in the areas of reactor technology, instrumentation and control technology, human-system integration technology, and human factors engineering (HFE) methods and tools. The issues were organized into seven high-level HFE topic areas: Role of Personnel and Automation, Staffing and Training, Normal Operations Management, Disturbance and Emergency Management, Maintenance and Change Management, Plant Design and Construction, and HFE Methods and Tools. The issues where then prioritized into four categories using a 'Phenomena Identification and Ranking Table' methodology based on evaluations provided by 14 independent subject matter experts. The subject matter experts were knowledgeable in a variety of disciplines. Vendors, utilities, research organizations and regulators all participated. Twenty issues were categorized into the top priority category. This Brookhaven National Laboratory (BNL) technical report provides the detailed methodology, issue analysis, and results. A summary of the results of this study can be found in NUREG/CR-6947. The research performed for this project has identified a large number of human-performance issues for new control stations and new nuclear power plant designs. The information gathered in this project can serve as input to the development of a long-term strategy and plan for addressing human performance in these areas through regulatory research. Addressing human-performance issues will provide the technical basis from which regulatory review guidance can be developed to meet these challenges. The availability of this review guidance will help set clear expectations for how the NRC staff will evaluate new designs, reduce regulatory uncertainty, and provide a well-defined path to new nuclear power plant

  17. The Antioxidant Additive Approach for Alzheimer's Disease Therapy: New Ferulic (Lipoic) Acid Plus Melatonin Modified Tacrines as Cholinesterases Inhibitors, Direct Antioxidants, and Nuclear Factor (Erythroid-Derived 2)-Like 2 Activators.

    Science.gov (United States)

    Benchekroun, Mohamed; Romero, Alejandro; Egea, Javier; León, Rafael; Michalska, Patrycja; Buendía, Izaskun; Jimeno, María Luisa; Jun, Daniel; Janockova, Jana; Sepsova, Vendula; Soukup, Ondrej; Bautista-Aguilera, Oscar M; Refouvelet, Bernard; Ouari, Olivier; Marco-Contelles, José; Ismaili, Lhassane

    2016-11-10

    Novel multifunctional tacrines for Alzheimer's disease were obtained by Ugi-reaction between ferulic (or lipoic acid), a melatonin-like isocyanide, formaldehyde, and tacrine derivatives, according to the antioxidant additive approach in order to modulate the oxidative stress as therapeutic strategy. Compound 5c has been identified as a promising permeable agent showing excellent antioxidant properties, strong cholinesterase inhibitory activity, less hepatotoxicity than tacrine, and the best neuroprotective capacity, being able to significantly activate the Nrf2 transcriptional pathway.

  18. Acute erythroid neoplastic proliferations. A biological study based on 62 patients.

    Science.gov (United States)

    Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad

    2002-02-01

    The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was

  19. Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.

    Directory of Open Access Journals (Sweden)

    Eyayu Belay

    Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.

  20. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Ruth Merkle

    2016-08-01

    Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in

  1. Influence factors on etching rate of PET nuclear pore membrane

    International Nuclear Information System (INIS)

    Zuo Zhenzhong; Wu Zhendong; Liang Haiying; Ju Wei; Chen Dongfeng; Fu Yuanyong; Qu Guopu

    2014-01-01

    Background: The nuclear pore membrane is a kind of liquid filtration material manufactured by irradiation and chemical etching. Various conditions in etch process have a great influence on etch rate. Purpose: The influence factors of concentration and temperature of etch solution and the irradiation energy of heavy ions on etch rate was studied. Methods: Four layers of PET (polyethylene terephthalate) films were stacked together and were irradiated with 140-MeV 32 S ions at room temperature under vacuum conditions. Utilizing conductivity measurement technique, the electrical current changes through the u:radiated PET film were monitored during etching, from which the breakthrough time and therefore the track etching rate was calculated. Results: The results show that there is an exponential correlation between etch rate and temperature, and a linear correlation between etch rate and concentration. The track etching rate increases linearly with energy loss rate. Empirical formula for the bulk etching rate as a function of etchant concentration and temperature was also established via fitting of measurements. Conclusion: It is concluded that by using 1.6-MeV·u -1 32 S ions, PET nuclear pore membrane with cylindrical pore shape can be prepared at 85℃ with etchant concentration of l mol·L -1 . (authors)

  2. Scaling of nuclear modification factors for hadrons and light nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, C.S. [Chinese Academy of Sciences, Shanghai Institute of Applied Physics, Shanghai (China); University of Chinese Academy of Sciences, Beijing (China); Ma, Y.G. [Chinese Academy of Sciences, Shanghai Institute of Applied Physics, Shanghai (China); ShanghaiTech University, Shanghai (China); Zhang, S. [Chinese Academy of Sciences, Shanghai Institute of Applied Physics, Shanghai (China)

    2016-12-15

    The number of constituent quarks (NCQ) scaling for hadrons and the number of constituent nucleons (NCN) scaling for light nuclei are proposed for nuclear modification factors (R{sub cp}) of hadrons and light nuclei, respectively, according to the experimental investigations in relativistic heavy-ion collisions. Based on the coalescence mechanism the scalings are performed for pions and protons at the quark level, and for light nuclei d(anti d) and {sup 3}He at the nucleonic level, respectively, formed in Au+Au and Pb+Pb collisions, and a nice scaling behaviour emerges. The NCQ or NCN scaling law of R{sub cp} can be, respectively, taken as a probe for the quark or nucleon coalescence mechanism for the formation of hadron or light nuclei in relativistic heavy-ion collisions. (orig.)

  3. Factors determining the UK's back-end nuclear fuel cycle strategy and future nuclear systems

    International Nuclear Information System (INIS)

    Dunn, M.J.; Ainsworth, Z.E.

    2002-01-01

    Nuclear generating capacity in the UK is static with no units currently under construction. The AGRs and the UK's only PWR, Sizewell B, are operated by British Energy Generation Ltd (BEGL) and British Energy Generation (UK) Ltd (BEG(UK)L), who are subsidiaries of British Energy plc (BE) which was privatised in July 1996. Ownership of the Magnox stations, which were excluded from this privatisation, has now been transferred to BNFL.Government policy on spent fuel management in the UK is that it is for the owners of the spent fuel to decide on the appropriate spent fuel management options, based on their own commercial judgement, subject to meeting the necessary regulatory requirements. The main factors which have predominantly determined UK utility decisions on spent fuel management, to date, have been based on the technical considerations of the spent fuel characteristics, economic attractiveness of the options and at reactor site spent fuel storage capacities. To date, reprocessing has been the dominant form of spent fuel treatment in the UK. Spent fuel storage facilities consist of a mixture of at-reactor stores and large, centralised ponds associated with the reprocessing activities which take place at the Sellafield site. BEGL and BEG(UK)L have contracts for the lifetime arisings of AGR fuel which allow for all AGR spent fuel to be sent to Sellafield for reprocessing or long-term storage. The prompt reprocessing of all Magnox fuel will continue, and spent PWR fuel will continue to be stored at the reactor site in the short to medium term. It is likely that a combination of factors, which are discussed later in this paper, will continue to affect back-end nuclear fuel cycle strategy and future nuclear systems. (author)

  4. A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Pablo Manresa

    2017-12-01

    Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.

  5. THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

    NARCIS (Netherlands)

    DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1994-01-01

    Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using

  6. Factors relevant to the sealing of nuclear facilities

    International Nuclear Information System (INIS)

    1991-05-01

    This report reviews and summaries the factors to be considered in the design, construction and surveillance of confinement structures for damaged nuclear facilities. General engineering, design and environmental considerations are included, both from the standpoint of the mitigation of near-term effects by virtue of interim confinement, and from the standpoint of the acceptability of the structure for long-term confinement. Factors which influence optimization of the design and the construction sequence are reviewed, including the nature of the accident, natural conditions of the site, and thermal and radiation effects. Safety criteria are presented from the standpoint of regulatory requirements, radiological consequences, and monitoring/surveillance requirements for both interim and long-term confinement. Methodologies related to concrete fabrication technology and other construction techniques appropriate for building confinement structures are discussed. Long-term considerations relative to the future of the site for in-place storage/disposal of the waste, and possible future reuse of the site are also included

  7. Characterization of germ cell-specific expression of the orphan nuclear receptor, germ cell nuclear factor.

    Science.gov (United States)

    Katz, D; Niederberger, C; Slaughter, G R; Cooney, A J

    1997-10-01

    Nuclear receptors, such as those for androgens, estrogens, and progesterones, control many reproductive processes. Proteins with structures similar to these receptors, but for which ligands have not yet been identified, have been termed orphan nuclear receptors. One of these orphans, germ cell nuclear factor (GCNF), has been shown to be germ cell specific in the adult and, therefore, may also participate in the regulation of reproductive functions. In this paper, we examine more closely the expression patterns of GCNF in germ cells to begin to define spatio-temporal domains of its activity. In situ hybridization showed that GCNF messenger RNA (mRNA) is lacking in the testis of hypogonadal mutant mice, which lack developed spermatids, but is present in the wild-type testis. Thus, GCNF is, indeed, germ cell specific in the adult male. Quantitation of the specific in situ hybridization signal in wild-type testis reveals that GCNF mRNA is most abundant in stage VII round spermatids. Similarly, Northern analysis and specific in situ hybridization show that GCNF expression first occurs in testis of 20-day-old mice, when round spermatids first emerge. Therefore, in the male, GCNF expression occurs postmeiotically and may participate in the morphological changes of the maturing spermatids. In contrast, female expression of GCNF is shown in growing oocytes that have not completed the first meiotic division. Thus, GCNF in the female is expressed before the completion of meiosis. Finally, the nature of the two different mRNAs that hybridize to the GCNF complementary DNA was studied. Although both messages contain the DNA binding domain, only the larger message is recognized by a probe from the extreme 3' untranslated region. In situ hybridization with these differential probes demonstrates that both messages are present in growing oocytes. In addition, the coding region and portions of the 3' untranslated region of the GCNF complementary DNA are conserved in the rat.

  8. Bim nuclear translocation and inactivation by viral interferon regulatory factor.

    Directory of Open Access Journals (Sweden)

    Young Bong Choi

    2010-08-01

    Full Text Available Viral replication efficiency is in large part governed by the ability of viruses to counteract pro-apoptotic signals induced by infection of the host cell. Human herpesvirus 8 (HHV-8 uses several strategies to block the host's innate antiviral defenses via interference with interferon and apoptotic signaling. Contributors include the four viral interferon regulatory factors (vIRFs 1-4, which function in dominant negative fashion to block cellular IRF activities in addition to targeting IRF signaling-induced proteins such as p53 and inhibiting other inducers of apoptosis such as TGFbeta receptor-activated Smad transcription factors. Here we identify direct targeting by vIRF-1 of BH3-only pro-apoptotic Bcl-2 family member Bim, a key negative regulator of HHV-8 replication, to effect its inactivation via nuclear translocation. vIRF-1-mediated relocalization of Bim was identified in transfected cells, by both immunofluorescence assay and western analysis of fractionated cell extracts. Also, co-localization of vIRF-1 and Bim was detected in nuclei of lytically infected endothelial cells. In vitro co-precipitation assays using purified vIRF-1 and Bim revealed direct interaction between the proteins, and Bim-binding residues of vIRF-1 were mapped by deletion and point mutagenesis. Generation and experimental utilization of Bim-refractory vIRF-1 variants revealed the importance of vIRF-1:Bim interaction, specifically, in pro-replication and anti-apoptotic activity of vIRF-1. Furthermore, blocking of the interaction with cell-permeable peptide corresponding to the Bim-binding region of vIRF-1 confirmed the relevance of vIRF-1:Bim association to vIRF-1 pro-replication activity. To our knowledge, this is the first report of an IRF protein that interacts with a Bcl-2 family member and of nuclear sequestration of Bim or any other member of the family as a means of inactivation. The data presented reveal a novel mechanism utilized by a virus to control

  9. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  10. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  11. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

    Directory of Open Access Journals (Sweden)

    Ryo Kurita

    Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

  12. A nuclear free southeast Asia - the China factor

    International Nuclear Information System (INIS)

    Malik, J.M.

    1989-01-01

    It is estimated that the principal nuclear threat to Southeast Asia comes from nuclear weapons stored by the two superpowers in their respective bases and their targeting of each other's bases. Calls for the creation of a nuclear weapons free zone in Southeast Asia (SEANFZ) poses a number of problems to China because of the perceived negative impact of such zones on Chinese security interests, force deployment and strategic doctrine. Hence, it is argued that China is unlikely to support a nuclear free zone treaty which only embraces the Asean states because it would lead to unilateral disarmament on the part of pro-western countries while leaving Indochinese states and the Soviet Union. However, if the proposed SEANFZ treaty resembles the South Pacific Nuclear Free Zone treaty, which allow the transit of nuclear-armed vessels, China could be expected to support it. ills

  13. Factors affecting nuclear research reactor utilization across countries

    International Nuclear Information System (INIS)

    Hien, P.D.

    2000-01-01

    In view of the worldwide declining trend of research reactor utilization and the fact that many reactors in developing countries are under-utilised, a question naturally arises as to whether the investment in a research reactor is justifiable. Statistical analyses were applied to reveal relationships between the status of reactor utilization and socio-economic conditions among countries, that may provide a guidance for reactor planning and cost benefit assessment. The reactor power has significant regression relationships with size indicators such as GNP, electricity consumption and R and D expenditure. Concerning the effectiveness of investment in research reactors, the number of reactor operation days per year only weakly correlates with electricity consumption and R and D expenditure, implying that there are controlling factors specific of each group of countries. In the case of less developed countries, the low customer demands on reactor operation may be associated with the failure in achieving quality assurance for the reactor products and services, inadequate investment in the infrastructure for reactor exploitation, the shortage of R and D funding and well trained manpower and the lack of measures to get the scientific community involved in the application of nuclear techniques. (author)

  14. The human factors specialist in nuclear control centre design

    International Nuclear Information System (INIS)

    Wilson, R.B.; Beattie, J.D.

    The main focus at Ontario Hydro for man-machine interface design is in the design of control centres. Because the control of a nuclear generating unit is highly centralized there is an increasing need for effective information display and control layout. Control panel design innovations such as the use of CRT displays and the extended use of computerized control in the Darlington station have made it possible for Ontario Hydro to continue to have one first operator for each generating unit. The human factors specialist involved in control panel design must deal with people who know much more about the specific systems being controlled, and must become a generalist in all these systems as well. Designers have to use conceptual techniques such as task analysis, systems design, panel mock-ups, anthropometric data, and personal judgement based on experience as they design panels. They must find a balance between becoming locked into existing technology and methods, slavishly following the latest technological trends, and forgetting that real people will be using what they design

  15. The human factor in the operation of nuclear powered submarines

    International Nuclear Information System (INIS)

    Dambier, M.

    1982-05-01

    The conditions characterizing the operation of nuclear powered submarines are described and the precautionary measures suitable to reduce the incidence of human errors and their consequences are explained

  16. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin.

    Science.gov (United States)

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.

  17. Nuclear-polarization correction to the bound-electron g factor in heavy hydrogenlike ions

    OpenAIRE

    Nefiodov, A. V.; Plunien, G.; Soff, G.

    2002-01-01

    The influence of nuclear polarization on the bound-electron $g$ factor in heavy hydrogenlike ions is investigated. Numerical calculations are performed for the K- and L-shell electrons taking into account the dominant virtual nuclear excitations. This determines the ultimate limit for tests of QED utilizing measurements of the bound-electron $g$ factor in highly charged ions.

  18. Nuclear-polarization correction to the bound-electron g factor in heavy hydrogenlike ions.

    Science.gov (United States)

    Nefiodov, A V; Plunien, G; Soff, G

    2002-08-19

    The influence of nuclear polarization on the bound-electron g factor in heavy hydrogenlike ions is investigated. Numerical calculations are performed for the K- and L-shell electrons taking into account the dominant virtual nuclear excitations. This determines the ultimate limit for tests of QED utilizing measurements of the bound-electron g factor in highly charged ions.

  19. The Security of Russia's Nuclear Arsenal: The Human Factor

    International Nuclear Information System (INIS)

    Ball, D.Y.

    1999-01-01

    Assertions by the Russian military that all of their nuclear weapons are secure against theft and that nuclear units within the military are somehow insulated from the problems plaguing the Russian military should not be accepted uncritically. Accordingly, we should not give unwarranted credence to the pronouncements of military figures like Cal.-Gen. Igor Valynkin, Chief of the Defense Ministry's 12th Main Directorate, which oversees the country's nuclear arsenal. He contends that ''Russian nuclear weapons are under reliable supervision'' and that ''talk about the unreliability of our control over nuclear weapons has only one pragmatic goal--to convince international society that the country is incapable of maintaining nuclear safety and to introduce international oversight over those weapons, as it is done, for example, in Iraq.'' While the comparison to Iraq is preposterous, many analysts might agree with Valynkin's sanguine appraisal of the security of Russia's nuclear weapons. In contrast, I argue that the numerous difficulties confronting the military as a whole should cause concern in the West over the security of the Russian nuclear arsenal

  20. Choosing the nuclear power option: Factors to be considered

    International Nuclear Information System (INIS)

    1998-01-01

    A need was expressed by Member States for guidance on policy issues to be addressed by decision makers considering the introduction of nuclear power programmes. This publication has been prepared by the IAEA, on the basis of past experience with nuclear power programmes in Member States and the current realities of the world nuclear regime, to provide information on political, governmental, economic, financial, technical and safety issues associated with planning and implementing a nuclear power programme. It highlights the main areas in which policies must be developed as well as the roles and responsibilities of the government, the plant owner and the national industry. For those interested in examining some of the issues in more depth, a list of related IAEA publications is provided in the bibliography. It is hoped that this guide will serve a useful purpose in assisting decision makers and governments in Member States considering the introduction of nuclear power programmes

  1. Separating form factor and nuclear model effects in quasielastic neutrino-nucleus scattering

    Science.gov (United States)

    Wieske, Joseph

    2017-09-01

    When studying neutrino oscillations an understanding of charged current quasielastic (CCQE) neutrino-nucleus scattering is imperative. This interaction depends on a nuclear model as well as knowledge of form factors. In the past, CCQE data from the MiniBooNE experiment was analyzed assuming the Relativistic Fermi Gas (RFG) nuclear model, an axial dipole form factor in, and using the the z-expansion for the axial form factor in. We present the first analysis that combines a non-RFG nuclear model, in particular the Correlated Fermi Gas nuclear model (CFG) of, and the z expansion for the axial form factor. This will allow us to separate form factor and nuclear model effects in CCQE scattering. This project was supported through the Wayne State University REU program under NSF Grant PHY-1460853 and by the DOE Grant DE-SC0007983.

  2. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-01-01

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

  3. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  4. Factors affecting the future of nuclear power in OECD Europe

    International Nuclear Information System (INIS)

    Thompson, S.

    1997-01-01

    This report provides a brief review of nuclear power in OECD Europe and addresses the prospects for its future over, say, the next quarter century. Most of the data and findings are drawn from studies published by the Nuclear Energy Agency (NEA) of the Organisation for Economic Co-operation and Development (OECD). The NEA is a small agency with a rather modest budget whose 27 members are industrialized countries from North America, Asia and Europe. The Agency works to pool the expertise of our member countries to produce technical, economic and legal work of considerable depth and quality addressing issues of common interest to those countries. Our work covers such fields as nuclear science, nuclear power economics, nuclear safety, radiation protection, waste management and nuclear liability. The studies carried out in the framework of the Agency require fewer resources than would be needed by our member countries if they were to pursue them individually, which is especially important at a time of cut-backs in national programmes in such critical areas as nuclear safety research. (author)

  5. Factor Analysis and Framework Development for Incorporating Public Trust on Nuclear Safety issues

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Seongkyung; Lee, Gyebong [The Myongji Univ., Seoul (Korea, Republic of); Lee, Gihyung; Lee, Gyehwi; Jeong, Jina [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2014-05-15

    The Korea Institute of Nuclear Safety (KINS), a regulatory expert organization in charge of nuclear safety in Korea, realized that a more fundamental and systematic analysis of activities is needed to actively meet the greater variety of concerns people have and increase the reliability of the results of regulation. Nuclear safety, a highly specialized field, has previously been discussed primarily from the viewpoint of the engineers who deal with the technology, but now 'public trust in nuclear safety' has to be viewed from the standpoint of the general public and from the socio-cultural perspective. Specific measures must be taken to examine which factors affect public trust and how we can secure and reproduce those factors to gain it. Also, an efficient system for incorporating public trust in nuclear safety must be established. In this study, various case studies were examined to identify the factors that affect public trust in nuclear safety. First, nuclear safety laws and information disclosure systems of major countries were examined by investigating data and conducting in-depth interviews. To explore a public framework concerning nuclear safety, big data of social media were analyzed. Also, Q methodology was used to analyze the risk schemata of the opinion leaders living in areas near nuclear power plants. Several surveys were conducted to analyze the amount of trust the public had in nuclear safety as well as their awareness of nuclear safety issues. Based on these analyses, factors affecting public trust in nuclear safety were extracted, and measures to build systems incorporating public trust in nuclear safety were proposed. This study addresses the public trust in nuclear safety on condition that the safety is ensured technically and mechanically.

  6. Factor Analysis and Framework Development for Incorporating Public Trust on Nuclear Safety issues

    International Nuclear Information System (INIS)

    Cho, Seongkyung; Lee, Gyebong; Lee, Gihyung; Lee, Gyehwi; Jeong, Jina

    2014-01-01

    The Korea Institute of Nuclear Safety (KINS), a regulatory expert organization in charge of nuclear safety in Korea, realized that a more fundamental and systematic analysis of activities is needed to actively meet the greater variety of concerns people have and increase the reliability of the results of regulation. Nuclear safety, a highly specialized field, has previously been discussed primarily from the viewpoint of the engineers who deal with the technology, but now 'public trust in nuclear safety' has to be viewed from the standpoint of the general public and from the socio-cultural perspective. Specific measures must be taken to examine which factors affect public trust and how we can secure and reproduce those factors to gain it. Also, an efficient system for incorporating public trust in nuclear safety must be established. In this study, various case studies were examined to identify the factors that affect public trust in nuclear safety. First, nuclear safety laws and information disclosure systems of major countries were examined by investigating data and conducting in-depth interviews. To explore a public framework concerning nuclear safety, big data of social media were analyzed. Also, Q methodology was used to analyze the risk schemata of the opinion leaders living in areas near nuclear power plants. Several surveys were conducted to analyze the amount of trust the public had in nuclear safety as well as their awareness of nuclear safety issues. Based on these analyses, factors affecting public trust in nuclear safety were extracted, and measures to build systems incorporating public trust in nuclear safety were proposed. This study addresses the public trust in nuclear safety on condition that the safety is ensured technically and mechanically

  7. Factors that influence a sustainable nuclear waste management policy

    International Nuclear Information System (INIS)

    Riley, P.

    2004-01-01

    The predicted increase in world demand for electricity requires that the gift of nuclear energy that has served developed nations must not be wasted. The development of nuclear energy is hampered by the absence of a clear and unequivocal policy regarding the storage and disposal of radioactive waste and is seen by a significant section of the public as a threat to their rights. Public opposition may cause the demise of nuclear electric power in developed nations and proscribe its use in the third world. (author)

  8. Calculating the Unit Cost Factors for Decommissioning Cost Estimation of the Nuclear Research Reactor

    International Nuclear Information System (INIS)

    Jeong, Kwan Seong; Lee, Dong Gyu; Jung, Chong Hun; Lee, Kune Woo

    2006-01-01

    The estimated decommissioning cost of nuclear research reactor is calculated by applying a unit cost factor-based engineering cost calculation method on which classification of decommissioning works fitted with the features and specifications of decommissioning objects and establishment of composition factors are based. Decommissioning cost of nuclear research reactor is composed of labor cost, equipment and materials cost. Labor cost of decommissioning costs in decommissioning works are calculated on the basis of working time consumed in decommissioning objects. In this paper, the unit cost factors and work difficulty factors which are needed to calculate the labor cost in estimating decommissioning cost of nuclear research reactor are derived and figured out.

  9. Cloning animals by somatic cell nuclear transfer – biological factors

    Science.gov (United States)

    Tian, X Cindy; Kubota, Chikara; Enright, Brian; Yang, Xiangzhong

    2003-01-01

    Cloning by nuclear transfer using mammalian somatic cells has enormous potential application. However, somatic cloning has been inefficient in all species in which live clones have been produced. High abortion and fetal mortality rates are commonly observed. These developmental defects have been attributed to incomplete reprogramming of the somatic nuclei by the cloning process. Various strategies have been used to improve the efficiency of nuclear transfer, however, significant breakthroughs are yet to happen. In this review we will discuss studies conducted, in our laboratories and those of others, to gain a better understanding of nuclear reprogramming. Because cattle are a species widely used for nuclear transfer studies, and more laboratories have succeeded in cloning cattle than any other specie, this review will be focused on somatic cell cloning of cattle. PMID:14614770

  10. Human factors design guidelines for maintainability of Department of Energy nuclear facilities

    International Nuclear Information System (INIS)

    Bongarra, J.P. Jr.; VanCott, H.P.; Pain, R.F.; Peterson, L.R.; Wallace, R.I.

    1985-01-01

    Intent of these guidelines is to provide design and design review teams of DOE nuclear facilities with human factors principles to enhance the design and aid in the inspection of DOE nuclear facilities, systems, and equipment. These guidelines are concerned with design features of DOE nuclear facilities which can potentially affect preventive and corrective maintenance of systems within DOE nuclear facilities. Maintenance includes inspecting, checking, troubleshooting, adjusting, replacing, repairing, and servicing activities. Other factors which influence maintainability such as repair and maintenance suport facilities, maintenance information, and various aspects of the environment are also addressed

  11. Human factors design guidelines for maintainability of Department of Energy nuclear facilities

    Energy Technology Data Exchange (ETDEWEB)

    Bongarra, J.P. Jr.; VanCott, H.P.; Pain, R.F.; Peterson, L.R.; Wallace, R.I.

    1985-06-18

    Intent of these guidelines is to provide design and design review teams of DOE nuclear facilities with human factors principles to enhance the design and aid in the inspection of DOE nuclear facilities, systems, and equipment. These guidelines are concerned with design features of DOE nuclear facilities which can potentially affect preventive and corrective maintenance of systems within DOE nuclear facilities. Maintenance includes inspecting, checking, troubleshooting, adjusting, replacing, repairing, and servicing activities. Other factors which influence maintainability such as repair and maintenance suport facilities, maintenance information, and various aspects of the environment are also addressed.

  12. Imaging analysis of nuclear antiviral factors through direct detection of incoming adenovirus genome complexes

    Energy Technology Data Exchange (ETDEWEB)

    Komatsu, Tetsuro [Microbiologie Fondamentale et Pathogénicité, MFP CNRS UMR 5234, Université de Bordeaux, Bordeaux 33076 (France); Department of Infection Biology, Faculty of Medicine, University of Tsukuba, Tsukuba 305-8575 (Japan); Will, Hans [Department of Tumor Biology, University Hospital Hamburg-Eppendorf, 20246 Hamburg (Germany); Nagata, Kyosuke [Department of Infection Biology, Faculty of Medicine, University of Tsukuba, Tsukuba 305-8575 (Japan); Wodrich, Harald, E-mail: harald.wodrich@u-bordeaux.fr [Microbiologie Fondamentale et Pathogénicité, MFP CNRS UMR 5234, Université de Bordeaux, Bordeaux 33076 (France)

    2016-04-22

    Recent studies involving several viral systems have highlighted the importance of cellular intrinsic defense mechanisms through nuclear antiviral proteins that restrict viral propagation. These factors include among others components of PML nuclear bodies, the nuclear DNA sensor IFI16, and a potential restriction factor PHF13/SPOC1. For several nuclear replicating DNA viruses, it was shown that these factors sense and target viral genomes immediately upon nuclear import. In contrast to the anticipated view, we recently found that incoming adenoviral genomes are not targeted by PML nuclear bodies. Here we further explored cellular responses against adenoviral infection by focusing on specific conditions as well as additional nuclear antiviral factors. In line with our previous findings, we show that neither interferon treatment nor the use of specific isoforms of PML nuclear body components results in co-localization between incoming adenoviral genomes and the subnuclear domains. Furthermore, our imaging analyses indicated that neither IFI16 nor PHF13/SPOC1 are likely to target incoming adenoviral genomes. Thus our findings suggest that incoming adenoviral genomes may be able to escape from a large repertoire of nuclear antiviral mechanisms, providing a rationale for the efficient initiation of lytic replication cycle. - Highlights: • Host nuclear antiviral factors were analyzed upon adenovirus genome delivery. • Interferon treatments fail to permit PML nuclear bodies to target adenoviral genomes. • Neither Sp100A nor B targets adenoviral genomes despite potentially opposite roles. • The nuclear DNA sensor IFI16 does not target incoming adenoviral genomes. • PHF13/SPOC1 targets neither incoming adenoviral genomes nor genome-bound protein VII.

  13. Imaging analysis of nuclear antiviral factors through direct detection of incoming adenovirus genome complexes

    International Nuclear Information System (INIS)

    Komatsu, Tetsuro; Will, Hans; Nagata, Kyosuke; Wodrich, Harald

    2016-01-01

    Recent studies involving several viral systems have highlighted the importance of cellular intrinsic defense mechanisms through nuclear antiviral proteins that restrict viral propagation. These factors include among others components of PML nuclear bodies, the nuclear DNA sensor IFI16, and a potential restriction factor PHF13/SPOC1. For several nuclear replicating DNA viruses, it was shown that these factors sense and target viral genomes immediately upon nuclear import. In contrast to the anticipated view, we recently found that incoming adenoviral genomes are not targeted by PML nuclear bodies. Here we further explored cellular responses against adenoviral infection by focusing on specific conditions as well as additional nuclear antiviral factors. In line with our previous findings, we show that neither interferon treatment nor the use of specific isoforms of PML nuclear body components results in co-localization between incoming adenoviral genomes and the subnuclear domains. Furthermore, our imaging analyses indicated that neither IFI16 nor PHF13/SPOC1 are likely to target incoming adenoviral genomes. Thus our findings suggest that incoming adenoviral genomes may be able to escape from a large repertoire of nuclear antiviral mechanisms, providing a rationale for the efficient initiation of lytic replication cycle. - Highlights: • Host nuclear antiviral factors were analyzed upon adenovirus genome delivery. • Interferon treatments fail to permit PML nuclear bodies to target adenoviral genomes. • Neither Sp100A nor B targets adenoviral genomes despite potentially opposite roles. • The nuclear DNA sensor IFI16 does not target incoming adenoviral genomes. • PHF13/SPOC1 targets neither incoming adenoviral genomes nor genome-bound protein VII.

  14. Clinical validation of nuclear factor kappa B expression in invasive breast cancer.

    Science.gov (United States)

    Agrawal, Anil Kumar; Pielka, Ewa; Lipinski, Artur; Jelen, Michal; Kielan, Wojciech; Agrawal, Siddarth

    2018-01-01

    Breast cancer is the most commonly diagnosed cancer in Polish women. The expression of transcription nuclear factor kappa B, a key inducer of inflammatory response promoting carcinogenesis and cancer progression in breast cancer, is not well-established. We assessed the nuclear factor kappa B expression in a total of 119 invasive breast carcinomas and 25 healthy control samples and correlated this expression pattern with several clinical and pathologic parameters including histologic type and grade, tumor size, lymph node status, estrogen receptor status, and progesterone receptor status. The data used for the analysis were derived from medical records. An immunohistochemical analysis of nuclear factor kappa B, estrogen receptor, and progesterone receptor was carried out and evaluation of stainings was performed. The expression of nuclear factor kappa B was significantly higher than that in the corresponding healthy control samples. No statistical difference was demonstrated in nuclear factor kappa B expression in relation to age, menopausal status, lymph node status, tumor size and location, grade and histologic type of tumor, and hormonal status (estrogen receptor and progesterone receptor). Nuclear factor kappa B is significantly overexpressed in invasive breast cancer tissues. Although nuclear factor kappa B status does not correlate with clinicopathological findings, it might provide important additional information on prognosis and become a promising object for targeted therapy.

  15. Study of factors governing US utility nuclear power decisions

    International Nuclear Information System (INIS)

    1980-05-01

    Under DOE contract No. DE-AC02-79ET34009, The S.M. Stoller Corporation has conducted a study of US utility attitudes toward nuclear power. In the course of this study SMSC carried out a utility survey the objectives of which were: (1) to identify and rank in importance the governing considerations in actions taken in the past three years to cancel or defer nuclear projects, and (2) to gain insight into the circumstances and attitudes likely to govern new base-load commitments over the next several years. During the survey, contacts were made at the senior management level with utilities representing approximately half of the country's total electric capacity and two-thirds of its present nuclear commitment. Analysis of the responses led to the conclusion that most, if not all, of the decisions reached by the respondent utilities in the past several years to cancel or defer nuclear projects were triggered by one or a combination of the following four considerations: financial constraints; reduction in expected system load growth; schedule delay in licensing and construction and/or unpredictability; and adverse state government policies or attitudes regarding nuclear power

  16. Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria

    NARCIS (Netherlands)

    Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.

    Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired

  17. Nuclear modification factor for J/ψ production in nucleus-nucleus collisions

    International Nuclear Information System (INIS)

    Xu Xiaoming; Zhou Jie

    2011-01-01

    The STAR Collaboration has offered an eminent nuclear modification factor of J/ψ at high p T and midrapidity produced in Cu-Cu collisions at √ s NN= 200 GeV. Recalling a prediction, we can understand that the feature of high-p T nuclear modification factor is related to cc produced by 2 → 1 and 2 → 2 partonic processes in deconfined matter, particularly in the prethermal stage and to the recombination of c and c-bar. The nuclear modification factor at high p T is sensitive to the earliest form of deconfined matter that does not have a temperature.(authors)

  18. Discussion on verification criterion and method of human factors engineering for nuclear power plant controller

    International Nuclear Information System (INIS)

    Yang Hualong; Liu Yanzi; Jia Ming; Huang Weijun

    2014-01-01

    In order to prevent or reduce human error and ensure the safe operation of nuclear power plants, control device should be verified from the perspective of human factors engineering (HFE). The domestic and international human factors engineering guidelines about nuclear power plant controller were considered, the verification criterion and method of human factors engineering for nuclear power plant controller were discussed and the application examples were provided for reference in this paper. The results show that the appropriate verification criterion and method should be selected to ensure the objectivity and accuracy of the conclusion. (authors)

  19. Study of greenhouse gases emission factor for nuclear power chain of China

    International Nuclear Information System (INIS)

    Ma Zhonghai; Pan Ziqiang; Xie Jianlun; Xiu Binglin

    2001-01-01

    The Greenhouse Gases Emission Factor (GGEF) for nuclear power chain of China is calculated based on Life Cycle Analysis method and the definition of full energy chain. There is no greenhouse gases released directly from nuclear power plant. The greenhouse gases emission from nuclear power plant is mainly from coal-fired electricity supply to nuclear power plant for its normal operation and the production of construction materials those are used in the nuclear power plant. The total GGEF of nuclear power chain in China is 13.71 g-co 2 /kWh. It is necessary to regulate un-rational power source mix and to use the energy sources in rational way for reducing the greenhouse gas effect. Nuclear power for electricity generation is one of effective ways to reduce greenhouse gases emission and retard the greenhouse effect

  20. The human factor in the organisation and regulation of nuclear safety

    International Nuclear Information System (INIS)

    Bordes, F.; Savagner, J.-M.; Snanoudj, G.

    1981-10-01

    The TMI accident has brought to light the importance of the human factor in the safe operation of complex installations such as nuclear power plants. On this basis, the paper outlines the institutional framework for nuclear safety in France and reports on EDF practices in human resources management as well as in the improvement of working premises (control rooms) to optimize human behaviour in accident conditions. Finally, the interaction of labour laws on nuclear law in connection with safety is described. (NEA) [fr

  1. Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage

    OpenAIRE

    Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.

    2013-01-01

    Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...

  2. Erythroid differentiation and commitment in rat erythroleukemia cells with hypertonic culture conditions.

    OpenAIRE

    Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M

    1981-01-01

    Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...

  3. Account of the uncertainty factor in forecasting nuclear power development

    International Nuclear Information System (INIS)

    Chernavskij, S.Ya.

    1979-01-01

    Minimization of total discounted costs for linear constraints is commonly used in forecasting nuclear energy growth. This approach is considered inadequate due to the uncertainty of exogenous variables of the model. A method of forecasting that takes into account the presence of uncertainty is elaborated. An example that demonstrates the expediency of the method and its advantage over the conventional approximation method used for taking uncertainty into account is given. In the framework of the example, the optimal strategy for nuclear energy growth over period of 500 years is determined

  4. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    Science.gov (United States)

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

  5. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice

    Directory of Open Access Journals (Sweden)

    Ibrahim Mansur

    2016-01-01

    Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.

  6. Mutation in the factor VII hepatocyte nuclear factor 4α-binding site contributes to factor VII deficiency.

    Science.gov (United States)

    Zheng, Xing-Wu; Kudaravalli, Rama; Russell, Theresa T; DiMichele, Donna M; Gibb, Constance; Russell, J Eric; Margaritis, Paris; Pollak, Eleanor S

    2011-10-01

    Severe coagulant factor VII (FVII) deficiency in postpubertal dizygotic twin males results from two point mutations in the FVII gene, a promoter region T→C transition at -60 and a His-to-Arg substitution at amino acid 348; both mutations prevent persistence of plasma functional FVII. This report documents longitudinal laboratory measurements from infancy to adulthood of FVII coagulant activity (FVII:C) in the twin FVII-deficient patients; it also details specific biochemical analyses of the -60 T→C mutation. The results revealed FVII:C levels of less than 1% in infancy that remain severely decreased through puberty and into adulthood. In-vitro analyses utilizing hepatocyte nuclear factor 4α (HNF4α) co-transfection and a chromatin immunoprecipitation assay indicate that the -60 T→C mutation severely diminishes functional interaction between the FVII promoter and transcription factor HNF4α. The importance of interaction between the FVII gene and HNF4α in normal FVII expression provides an in-vivo illustration of the regulated expression of an autosomal gene encoding a coagulation protein. The constancy of FVII:C and peripubertal patient symptomatology reported here illustrates androgen-independent expression in contrast to expression with an analogous mutation in the promoter region of the gene encoding coagulation FIX.

  7. The human factors issue in the next generation nuclear plants

    International Nuclear Information System (INIS)

    Noviello, L.; Bolognini, G.; Nobile, M.

    1992-01-01

    The national Energy Plan approved by the Italian Government in 1988, soon after the public referendum on nuclear issues held in the wake of the Chernobyl accident, requested the start of a research program to study next generation nuclear plants. These new reactors should feature some important and innovative characteristics to have a chance to be considered for future constructions, should the politicians decide the conditions for such a step are again re-established in Italy. The most important of these characteristics is certainly the fact that no evaluation nor land set a-side shall be required even in case of the most severe conceivable accident. This challenging objective should be reached through: a) the simplification of the nuclear plant as a whole b) the extensive use of passive components and/or inherent safety features in the design of the engineering safeguard systems c) a containment designed to cope with any conceivable accident sequence without releasing any major quantity of radioactive products into the environment. d) the upgrading of the man-machine interface and the introduction of computerized aids both for operational and maintenance activities. This paper deals in particular with the improvements, described in point d), that aim at greatly reducing the probability of human errors, widely recognized as one of the most important aspects to be pursued to increase nuclear plant safety. (author)

  8. GATA transcription factors associate with a novel class of nuclear bodies in erythroblasts and megakaryocytes.

    NARCIS (Netherlands)

    A.G. Elefanty (Andrew); M. Antoniou (Michael); N. Custodio; M. Carmo-Fonseca; F.G. Grosveld (Frank)

    1996-01-01

    textabstractThe nuclear distribution of GATA transcription factors in murine haemopoietic cells was examined by indirect immunofluorescence. Specific bright foci of GATA-1 fluorescence were observed in erythroleukaemia cells and primary murine erythroblasts and megakaryocytes, in addition to diffuse

  9. Nuclear energy 1985: Nuclear power as an economic factor of growing importance

    International Nuclear Information System (INIS)

    Anon.

    1985-01-01

    Summary of the results of the Technical Sessions and Poster Sessions of the ten Technical Sections: Reactor physics; thermodynamics and fluid dynamics; safety of nuclear facilities; fuel cycle and waste management; fuel elements and fuel element materials; components and component materials; quality assurance; construction and operation of nuclear facilities; fusion technology; energy systems - energy industry; atomic law, radiation protection law, law on the protection against misances, related fields of law. Separate records are available for each paper. (HP) [de

  10. Social-political factors influencing the expansion of nuclear power

    International Nuclear Information System (INIS)

    Waltar, A.E.; Upson, P.

    1999-01-01

    As humanity marches closer to entering a new millennium, it is crucial that we nuclear professionals take renewed stock in the importance of our role in public interactions. The lack of public support has been very influential in bringing the once robust nuclear power construction program in America, Europe and Russia to a grinding halt. In trying to understand the key forces that shape public opinion on technologies such as ours, it becomes clear that the major force is the media enterprise. If we compare the basic driving forces behind successful media with the basic drivers behind successful science, we quickly come to the realization that the media are fundamentally in the entertainment business. Capturing instant attention and holding it are the principal ingredients of success for newspapers, radio, and television. Recognizing that these success drivers are diametrically opposite of those governing good science, we can readily understand why the antinuclear movement has been so successful in orchestrating their message in a package ideally suited to a receptive media enterprise. However, before blaming all our woes on the media, we need to assess at least four technical areas where additional professional work could be of substantial value. These include determining the real health effects of low-level radiation, further developing intrinsic robustness to enhance reactor safety, refining and articulating the environmental ethic associated with the recycling of nuclear waste, and exposing the myth that burying plutonium solves our nuclear non-proliferation problems. We suggest six key ingredients as necessary steps that merit strong consideration in regaining public support for nuclear power. These include 1) seriously addressing the four technical issues summarized above; 2) expressing our key issues and results in language understandable at the high school (or lower) level; 3) continually striving for an open and honest management of the Industry; 4

  11. Main factors affecting the fixing work about nuclear engineering and its discussion

    International Nuclear Information System (INIS)

    Zhang Zhihua; Liu Yaoguan; Qian Dazhi; Liu Hangang; Xu Xianqi; Deng Yue

    2010-01-01

    Main factors to the impact of the fixing work about nuclear engineering such as project design, construction, plan program, document, preparation, order, locale management, surveillance, quality assurance system and so on were presented. These factors were analyzed and discussed in this paper. Some measures and suggestions were put forward to accelerate construction fixing plan and insure good quality. We wish provide some references and help for someone engaged with construction of nuclear engineering. (authors)

  12. Incidents at nuclear power plants caused by the human factor

    International Nuclear Information System (INIS)

    Mashin, V. A.

    2012-01-01

    Psychological analysis of the causes of incorrect actions by personnel is discussed as presented in the report “Methodological guidelines for analyzing the causes of incidents in the operation of nuclear power plants.” The types of incorrect actions and classification of the root causes of errors by personnel are analyzed. Recommendations are made for improvements in the psychological analysis of causes of incorrect actions by personnel.

  13. Choosing the nuclear power option: Factors to be considered

    International Nuclear Information System (INIS)

    Gueorguiev, B.; Mahadeva Rao, K.V.

    2000-01-01

    To plan and develop a nuclear power program, policies must be formulated and decided at different stages and at different levels by the government and its organizations, by the utility and by other organizations in industry and research and education, each within its sphere of interest and influence. The purpose of this paper is to highlight areas where policy decisions are needed, the options available, what they mean and the contexts in which they should be considered. (author)

  14. Nuclear pulse. I - Awakening to the chaos factor

    Science.gov (United States)

    Broad, W. J.

    1981-05-01

    The discovery of the significance of the high-voltage wave termed electromagnetic pulse (EMP), which occurs following the high-altitude detonation of a nuclear device, is discussed. The disruptions to the street lights, burglar alarms and circuit breakers of Hawaii caused by the detonation of a nuclear device 248 mi above Johnson Island in the Pacific in July, 1962 are described and attributed to the Compton electrons produced by the impact of gamma rays from the nuclear explosion on air in the upper atmosphere. It is pointed out, however, that at the time of the explosion, most communications systems were based on vacuum tube and electromechanical technology, which is about 10,000,000 times harder against EMP than integrated solid-state circuitry, and thus the threat posed by EMP to the power grid and communications capabilities was not apparent. Efforts undertaken to harden discrete (missile) and communications systems against EMP are outlined for the example of the Safeguard ABM system, and difficulties are pointed out. Soviet awareness of EMP is considered, and the discovery of vacuum tubes on board the state-of-the-art Foxbat MiG interceptor flown into Japan is noted as a possible indicator of this awareness. It is concluded that the problem of EMP will increase in significance as semiconductor electronics proliferates.

  15. The contribution of nuclear training staff to human factors work in the CEGB and Nuclear Electric PLC

    International Nuclear Information System (INIS)

    Madden, V.J.

    1990-01-01

    The staff and simulators of utility's nuclear training function are being utilized in support of a wide range of human factor related activities. In addition to work on man machines interface review, operating procedures, operator support system and VDU format design and validation for the Magnox and AGR series of nuclear power plants, support is also being provided to the PWR Project Team through staff who have undergone extensive and comprehensive overseas PWR training programs. This paper discusses how recent initiatives in connection with a survey on operator stress and the possible use of psychometric testing in support of the selection of reactor desk engineers are also being supported

  16. Ultimate capacity and influenced factors analysis of nuclear RC containment subjected to internal pressure

    International Nuclear Information System (INIS)

    Song Chenning; Hou Gangling; Zhou Guoliang

    2014-01-01

    Ultimate compressive bearing capacity, influenced factors and its rules of nuclear RC containment are key problems of safety assessment, accident treatment and structure design, etc. Ultimate compressive bearing capacity of nuclear RC containment is shown by concrete damaged plasticity model and steel double liner model of ABAQUS. The study shows that the concrete of nuclear RC containment cylinder wall becomes plastic when the internal pressure is up to 0.87 MPa, the maximum tensile strain of steel liner exceeds 3000 × 10 6 and nuclear RC containment reaches ultimate status when the internal pressure is up to 1.02 MPa. The result shows that nuclear RC containment is in elastic condition under the design internal pressure and the bearing capacity meets requirement. Prestress and steel liner play key parts in the ultimate internal pressure and failure mode of nuclear RC containment. The study results have value for the analysis of ultimate compressive bearing capacity, structure design and safety assessment. (authors)

  17. Research on cognitive reliability model for main control room considering human factors in nuclear power plants

    International Nuclear Information System (INIS)

    Jiang Jianjun; Zhang Li; Wang Yiqun; Zhang Kun; Peng Yuyuan; Zhou Cheng

    2012-01-01

    Facing the shortcomings of the traditional cognitive factors and cognitive model, this paper presents a Bayesian networks cognitive reliability model by taking the main control room as a reference background and human factors as the key points. The model mainly analyzes the cognitive reliability affected by the human factors, and for the cognitive node and influence factors corresponding to cognitive node, a series of methods and function formulas to compute the node cognitive reliability is proposed. The model and corresponding methods can be applied to the evaluation of cognitive process for the nuclear power plant operators and have a certain significance for the prevention of safety accidents in nuclear power plants. (authors)

  18. Development of human factors evaluation techniques for nuclear power plants

    International Nuclear Information System (INIS)

    Oh, I.S.; Lee, Y.H.; Lee, J.W.; Sim, B.S.

    1999-01-01

    This paper describes development of an operator task simulation analyzer and human factors evaluation techniques performed recently at Korea Atomic Energy Research Institute. The first is the SACOM (Simulation Analyzer with a Cognitive Operator Model) for the assessment of task performance by simulating control room operation. The latter has two objectives: to establish a human factors experiment facility, the Integrated Test Facility (ITF), and to establish techniques for human factors experiments. (author)

  19. Nuclear Power and Resource Efficiency—A Proposal for a Revised Primary Energy Factor

    Directory of Open Access Journals (Sweden)

    Ola Eriksson

    2017-06-01

    Full Text Available Measuring resource efficiency can be achieved using different methods, of which primary energy demand is commonly used. The primary energy factor (PEF is a figure describing how much energy from primary resources is being used per unit of energy delivered. The PEF for nuclear power is typically 3, which refers to thermal energy released from fission in relation to electricity generated. Fuel losses are not accounted for. However; nuclear waste represents an energy loss, as current plans for nuclear waste management mostly include final disposal. Based on a literature review and mathematical calculations of the power-to-fuel ratio for nuclear power, PEF values for the open nuclear fuel cycle (NFC option of nuclear power and different power mixes are calculated. These calculations indicate that a more correct PEF for nuclear power would be 60 (range 32–88; for electricity in Sweden (41% nuclear power PEF would change from 1.8 to 25.5, and the average PEF for electricity in the European Union (EU would change from 2.5 to 18. The results illustrate the poor resource efficiency of nuclear power, which paves the way for the fourth generation of nuclear power and illustrates the policy implication of using PEFs which are inconsistent with current waste management plans.

  20. Factor analysis for the adoption of nuclear technology in diagnosis and treatment of chronic diseases

    International Nuclear Information System (INIS)

    Sato, Renato Cesar; Zouain, Desiree Moraes

    2012-01-01

    To identify and evaluate latent variables (variables that are not directly observed) for adopting and using nuclear technologies in diagnosis and treatment of chronic diseases. The measurement and management of these latent factors are important for health care due to complexities of the sector. Methods: An exploratory factor analysis study was conducted among 52 physicians practicing in the areas of Cardiology, Neurology and Oncology in the State of Sao Paulo who agreed to participate in the study between 2009 and 2010. Data were collected using an attitude measurement questionnaire, and analyzed according to the principal component method with Varimax rotation. Results: The component matrix after factor rotation showed three elucidative groups arranged according to demand for nuclear technology: clinical factors, structural factors, and technological factors. Clinical factors included questionnaire answers referring to medical history, previous interventions, complexity and chronicity of the disease. Structural factors included patient age, physician's practice area, and payment ability. Technological factors included prospective growth in the use of nuclear technology and availability of services. Conclusions: The clinical factors group dimension identified in the study included patient history, prior interventions, and complexity and chronicity of the disease. This dimension is the main motivating for adopting nuclear technology in diagnosis and treatment of chronic diseases. (author)

  1. Nuclear recycle: One of the key factors ensuring the sustainable development of China's nuclear power

    International Nuclear Information System (INIS)

    Jiang Yunqing

    2002-01-01

    Since early 1970's China has established a complete nuclear fuel cycle system for defense purpose. CNNC and its formers deal mainly with business in nuclear power and nuclear fuel cycle fields. Now COSTIND (CAEA) implements the governmental functions. Based on the features of energy sources, China is steady developing nuclear power as the appropriate supplement to meet demand of electricity in the southeast coastal regions. In the middle of 1980's, considering a number of elements, covering spent fuel arising from PWR dominantly, uranium source availability, development of FBR, radioactive waste management safely and existing good nuclear industry foundation etc., the closed fuel cycle strategy was formulated and announced internationally. In view of complexity of reprocessing technology and the limited spent fuel arising in the early period of nuclear power growing up, a multi-purpose pilot plant will be first set up. The plant involved in spent fuel AFR storage, and HEU/LEU fuel reprocessing separately has been constructed since 1991. At present more than a half of the project job has been completed while the preparation for long-distance transport of spent fuel is actively pushed on. It is expected that a centralized wet storage facility will be finished at the end of next year but the whole plant will be put into active commissioning in 2003. With the extension of the cumulative arising of spent fuel, a large scale reprocessing plant would be established around 2020. Reprocessed uranium will be surely re-enriched in the past manner while reactor-grade plutonium would be fabricated into MOX fuel to supply to FBR program. (author)

  2. UNC Nuclear Industries' human-factored approach to the operating or maintenance procedure

    International Nuclear Information System (INIS)

    Nelson, A.A.; Clark, J.E.

    1982-01-01

    The development of Human Factors Engineering (HFE) and UNC Nuclear Industries' (UNC) commitment to minimizing the potential for human error in the performance of operating or maintenance procedures have lead to a procedure upgrade program. Human-factored procedures were developed using information from many sources including, but not limited to, operators, a human factors specialist, engineers and supervisors. This has resulted in the Job Performance Aid (JPA). This paper presents UNC's approach to providing human-factored operating and maintenance procedures

  3. Peroxiredoxin 6 expression is inversely correlated with nuclear factor-κB activation during Clonorchis sinensis infestation.

    Science.gov (United States)

    Pak, Jhang Ho; Son, Woo Chan; Seo, Sang-Beom; Hong, Sung-Jong; Sohn, Woon-Mok; Na, Byoung-Kuk; Kim, Tong-Soo

    2016-10-01

    Clonorchis sinensis is a carcinogenic human liver fluke. Its infection promotes persistent oxidative stress and chronic inflammation environments in the bile duct and surrounding liver tissues owing to direct contact with worms and their excretory-secretory products (ESPs), provoking epithelial hyperplasia, periductal fibrosis, and cholangiocarcinogenesis. We examined the reciprocal regulation of two ESP-induced redox-active proteins, NF-κB and peroxiredoxin 6 (Prdx6), during C. sinensis infection. Prdx6 overexpression suppressed intracellular free-radical generation by inhibiting NADPH oxidase2 and inducible nitric oxide synthase activation in the ESP-treated cholangiocarcinoma cells, substantially attenuating NF-κB-mediated inflammation. NF-κB overexpression decreased Prdx6 transcription levels by binding to two κB sites within the promoter. This transcriptional repression was compensated for by other ESP-induced redox-active transcription factors, including erythroid 2-related factor 2 (Nrf2), hypoxia inducible factor 1α (HIF1α), and CCAAT/enhancer-binding protein β (C/EBPβ). Distribution of immunoreactive Prdx6 and NF-κB was distinct in the early stages of infection in mouse livers but shared concomitant localization in the later stages. The intensity and extent of their immunoreactive staining in infected mouse livers are proportional to lesion severity and infection duration. The constitutive elevations of Prdx6 and NF-κB during C. sinensis infection may be associated with more severe persistent hepatobiliary abnormalities mediated by clonorchiasis. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Tight regulation of a timed nuclear import wave of EKLF by PKCθ and FOE during Pro-E to Baso-E transition.

    Science.gov (United States)

    Shyu, Yu-Chiau; Lee, Tung-Liang; Chen, Xin; Hsu, Pang-Hung; Wen, Shau-Ching; Liaw, Yi-Wei; Lu, Chi-Huan; Hsu, Po-Yen; Lu, Mu-Jie; Hwang, JauLang; Tsai, Ming-Daw; Hwang, Ming-Jing; Chen, Jim-Ray; Shen, Che-Kun James

    2014-02-24

    Erythropoiesis is a highly regulated process during which BFU-E are differentiated into RBCs through CFU-E, Pro-E, PolyCh-E, OrthoCh-E, and reticulocyte stages. Uniquely, most erythroid-specific genes are activated during the Pro-E to Baso-E transition. We show that a wave of nuclear import of the erythroid-specific transcription factor EKLF occurs during the Pro-E to Baso-E transition. We further demonstrate that this wave results from a series of finely tuned events, including timed activation of PKCθ, phosphorylation of EKLF at S68 by P-PKCθ(S676), and sumoylation of EKLF at K74. The latter EKLF modifications modulate its interactions with a cytoplasmic ankyrin-repeat-protein FOE and importinβ1, respectively. The role of FOE in the control of EKLF nuclear import is further supported by analysis of the subcellular distribution patterns of EKLF in FOE-knockout mice. This study reveals the regulatory mechanisms of the nuclear import of EKLF, which may also be utilized in the nuclear import of other factors. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Factors contributing to the nuclear caloric curve aspect

    International Nuclear Information System (INIS)

    Raduta, Al.H.; Raduta, Ad.R.

    1999-01-01

    After the first experimental evaluation of the nuclear caloric curve a large amount of theoretical work was concentrated to reproduce the transition-like plateau of the caloric curve from 5 MeV temperature. Both dynamical and statistical models have been employed in order to deduce the excitation energy dependence of the temperature of the equilibrated nuclear systems formed in violent heavy ion collisions. For describing such kind of systems a microcanonical model fully obeying the involved physical constrains seems to be the most appropriate option. However, the currently used statistical multifragmentation models (SMM and MMMC ) are not fully satisfying the microcanonical rules. For these reasons the nuclear caloric curve is studied in the present work from the point of view of a sharp microcanonical model. In this respect a detailed analysis concerning the contribution of the various energetic degrees of freedom (binding, Coulomb repulsive and internal excitation) to the curve aspect is performed. The method adopted here consists in suppressing each of the above-mentioned degrees of freedom once at a time keeping the rest of the system parameters unchanged. The Coulomb repulsive (V) and excitation (ε) degrees of freedom are suppressed by fixing the respective energies to zero. The binding degree of freedom (B) is 'suppressed' by fixing it to the constant value of - 8.5 MeV/nucleon for all fragments. The effect of the correlation between the Coulomb repulsive and the excitation degrees of freedom on the caloric curve aspect is also studied. The resulting caloric curves are denoted T -V , T -ε , T -B , T -Vε . One may observe that the suppression of the excitation degree of freedom has the effect of lifting and diminishing the plateau and the suppression of the Coulomb degree of freedom is lowering the plateau and almost washes-out the plateau-like region. The spectacular effect concerns the complementary moves T -Vε and - B: While the Vε couple suppression

  6. Deletion of hepatocyte nuclear factor-1-beta in an infant with prune belly syndrome.

    Science.gov (United States)

    Haeri, Sina; Devers, Patricia L; Kaiser-Rogers, Kathleen A; Moylan, Vincent J; Torchia, Beth S; Horton, Amanda L; Wolfe, Honor M; Aylsworth, Arthur S

    2010-08-01

    Prune belly syndrome is a rare congenital disorder characterized by deficiency of abdominal wall muscles, cryptorchidism, and urinary tract anomalies. We have had the opportunity to study a baby with prune belly syndrome associated with an apparently de novo 1.3-megabase interstitial 17q12 microdeletion that includes the hepatocyte nuclear factor-1-beta gene at 17q12. One previous patient, an adult, has been reported with prune belly syndrome and a hepatocyte nuclear factor-1-beta microdeletion. Hepatocyte nuclear factor-1-beta is a widely expressed transcription factor that regulates tissue-specific gene expression and is expressed in numerous tissues including mesonephric duct derivatives, the renal tubule of the metanephros, and the developing prostate of the mouse. Mutations in hepatocyte nuclear factor-1-beta cause the "renal cysts and diabetes syndrome," isolated renal cystic dysplasia, and a variety of other malformations. Based on its expression pattern and the observation of two affected cases, we propose that haploinsufficiency of hepatocyte nuclear factor-1-beta may be causally related to the production of the prune belly syndrome phenotype through a mechanism of prostatic and ureteral hypoplasia that results in severe obstructive uropathy with urinary tract and abdominal distension. Copyright Thieme Medical Publishers.

  7. Human factors in the operation of nuclear power plants

    International Nuclear Information System (INIS)

    Swaton, E.; Neboyan, V.; Lederman, L.

    1987-01-01

    In large and complex interactive systems, human error can contribute substantially to system failures. At nuclear power plants, operational experience demonstrates that human error accounts for a considerable proportion of safety-related incidents. However, experience also shows that human intervention can be very effective if there is a thorough understanding of the situation in the plant. Thus, an efficient interface of man and machine is important not only to prevent human errors but also to assist the operator in coping with unforeseen events. Human reliability can be understood as a qualitative as well as a quantitative term. Qualitatively it can be described as the aim for successful human performance of activities necessary for system reliability and availability. Quantitatively, it refers to data on failure rates or error probabilities that can be used, for example, for probabilistic safety assessments

  8. The Regulatory Role of Nuclear Factor Kappa B in the Heart of Hereditary Hypertriglyceridemic Rat

    Czech Academy of Sciences Publication Activity Database

    Vranková, S.; Barta, A.; Klimentová, J.; Dovinová, I.; Líšková, Silvia; Dobešová, Zdenka; Pecháňová, O.; Kuneš, Jaroslav; Zicha, Josef

    2016-01-01

    Roč. 2016, č. 2016 (2016), s. 9814038 ISSN 1942-0900 R&D Projects: GA MZd(CZ) NV15-25396A Institutional support: RVO:67985823 Keywords : nuclear factor-kB * nitric oxide * reactive oxygen species * heart * hereditary hypertriglyceridemic rats Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery Impact factor: 4.593, year: 2016

  9. Capacity factor of nuclear power stations in Japan in fiscal year 1984

    International Nuclear Information System (INIS)

    Agawa, Takashi

    1985-01-01

    In Japan presently a total of 28 nuclear power plants are in operation with aggregate capacity 20,561 MW, 22 % of the total power generation. Around 1975 there occurred such as stress corrosion cracking and to repair them much time was consumed, leading to the low capacity factor. With such troubles removed, in fiscal 1984, the capacity factor on average of the nuclear power stations is 73.9 %, the highest so far. Contributing to this are long period of the continuous operation, short period of the periodical inspection and increase in the in-operation capacity factor. Contents are the following : construction state of nuclear power stations, operation state in fiscal 1984, causes leading to the high capacity factor, future directions. (Mori, K.)

  10. Generation of erythroid cells from polyploid giant cancer cells: re-thinking about tumor blood supply.

    Science.gov (United States)

    Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu

    2018-04-01

    During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.

  11. A human factors design of a nuclear plant analyzer

    Energy Technology Data Exchange (ETDEWEB)

    Byeon, Seung Nam; Lee, Dong Hoon; Park, Chan Woo [Kyounghee Univ., Seoul (Korea, Republic of)

    2000-12-15

    The project consists of four key stages as follows : based on the review of various literature, human factors design principles and processes are identified, the literature reviewed in the project includes NUREG-0700, research papers for MMI, human factors handbooks, and laboratory reports, after the design principles and processes are determined, a design checklist is developed to evaluate the user interface of NPA, the design checklist consists of seven different categories such as display screen, menu interface, form-fillin, alphanumeric characters, symbols, color, and highlighting, NPA was tested with the design checklist for conformance to the human factors design principles, the expert reviews are performed to evaluate a graphic user interface of NPA, the application of the design checklist and the subjective opinion of the expert identify the design included in the user interface of NPA, based on the thorough analysis of design defects, design guidelines are recommended to improve the user interface of NPA.

  12. A human factors design of a nuclear plant analyzer

    International Nuclear Information System (INIS)

    Byeon, Seung Nam; Lee, Dong Hoon; Park, Chan Woo

    2000-12-01

    The project consists of four key stages as follows : based on the review of various literature, human factors design principles and processes are identified, the literature reviewed in the project includes NUREG-0700, research papers for MMI, human factors handbooks, and laboratory reports, after the design principles and processes are determined, a design checklist is developed to evaluate the user interface of NPA, the design checklist consists of seven different categories such as display screen, menu interface, form-fillin, alphanumeric characters, symbols, color, and highlighting, NPA was tested with the design checklist for conformance to the human factors design principles, the expert reviews are performed to evaluate a graphic user interface of NPA, the application of the design checklist and the subjective opinion of the expert identify the design included in the user interface of NPA, based on the thorough analysis of design defects, design guidelines are recommended to improve the user interface of NPA

  13. Role of zinc finger structure in nuclear localization of transcription factor Sp1

    International Nuclear Information System (INIS)

    Ito, Tatsuo; Azumano, Makiko; Uwatoko, Chisana; Itoh, Kohji; Kuwahara, Jun

    2009-01-01

    Transcription factor Sp1 is localized in the nucleus and regulates gene expression. Our previous study demonstrated that the carboxyl terminal region of Sp1 containing 3-zinc finger region as DNA binding domain can also serve as nuclear localization signal (NLS). However, the nuclear transport mechanism of Sp1 has not been well understood. In this study, we performed a gene expression study on mutant Sp1 genes causing a set of amino acid substitutions in zinc finger domains to elucidate nuclear import activity. Nuclear localization of the GFP-fused mutant Sp1 proteins bearing concomitant substitutions in the first and third zinc fingers was highly inhibited. These mutant Sp1 proteins had also lost the binding ability as to the GC box sequence. The results suggest that the overall tertiary structure formed by the three zinc fingers is essential for nuclear localization of Sp1 as well as dispersed basic amino acids within the zinc fingers region.

  14. Explaining the ratification of nuclear waste disposal by the finnish parliament: political culture and contextual factors

    International Nuclear Information System (INIS)

    Ruostetsaari, I.

    2002-01-01

    According to the Nuclear Energy Act the government's Decision in Principle (DiP) on the nuclear waste disposal needs to be ratified by Parliament. The DiP was ratified by general consent (159-3) on 18 May 2001. How we can explain this parliamentary consensus taking account that the previous DiP concerning construction of a new nuclear power plant was overruled in 1993 and the public debate on nuclear power is still pronounced. The explanation can be sought, together with the institutional arrangements, from two sources; on one hand from the Finnish political culture, i.e., traditional and inherited ways of decision-makers to make decisions and citizens' ways to react to those decisions, and on the other hand, from current contextual factors linking to nuclear waste management. (authors)

  15. PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia

    DEFF Research Database (Denmark)

    Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta

    2004-01-01

    markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...

  16. Nuclear substructure reorganization during late stageerythropoiesis is selective and does not involve caspase cleavage ofmajor nuclear substructural proteins

    Energy Technology Data Exchange (ETDEWEB)

    Krauss, Sharon Wald; Lo, Annie J.; Short, Sarah A.; Koury, MarkJ.; Mohandas, Narla; Chasis, Joel Anne

    2005-04-06

    Enucleation, a rare feature of mammalian differentiation, occurs in three cell types: erythroblasts, lens epithelium and keratinocytes. Previous investigations suggest that caspase activation functions in lens epithelial and keratinocyte enucleation, as well as in early erythropoiesis encompassing BFU-E differentiation to proerythroblast. To determine whether caspase activation contributes to later erythropoiesis and whether nuclear substructures other than chromatin reorganize, we analyzed distributions of nuclear subcompartment proteins and assayed for caspase-induced cleavage of subcompartmental target proteins in mouse erythroblasts. We found that patterns of lamin B in the filamentous network interacting with both the nuclear envelope and DNA, nuclear matrix protein NuMA, and splicing factors Sm and SC35 persisted during nuclear condensation, consistent with effective transcription of genes expressed late in differentiation. Thus nuclear reorganization prior to enucleation is selective, allowing maintenance of critical transcriptional processes independent of extensive chromosomal reorganization. Consistent with these data, we found no evidence for caspase-induced cleavage of major nuclear subcompartment proteins during late erythropoiesis, in contrast to what has been observed in early erythropoiesis and in lens epithelial and keratinocyte differentiation. These findings imply that nuclear condensation and extrusion during terminal erythroid differentiation involve novel mechanisms that do not entail major activation of apoptotic machinery.

  17. Human factors in maintenance: Development and research in Swedish nuclear power plants

    International Nuclear Information System (INIS)

    Salo, I.; Svensson, Ola

    2001-11-01

    The present report investigated previously completed, ongoing, and planned research and development projects focusing human factors and maintenance work carried out at Swedish nuclear power plants and SKI. In addition, needs for future research and development works were also investigated. Participants from all nuclear power plants and SKI were included in the study. Participants responded to a set of questions in an interview. The interviews also generated a list of future research and development projects

  18. Human factors design review guidelines for advanced nuclear control room technologies

    International Nuclear Information System (INIS)

    O'Hara, J.; Brown, W.; Granda, T.; Baker, C.

    1991-01-01

    Advanced control rooms (ACRs) for future nuclear power plants are being designed utilizing computer-based technologies. The US Nuclear Regulatory Commission reviews the human engineering aspects of such control rooms to ensure that they are designed to good human factors engineering principles and that operator performance and reliability are appropriately supported in order to protect public health and safety. This paper describes the rationale, general approach, and initial development of an NRC Advanced Control Room Design Review Guideline. 20 refs., 1 fig

  19. Human factors in maintenance: development and research in Swedish nuclear power plants

    International Nuclear Information System (INIS)

    Salo, I.; Svenson, O.

    2001-11-01

    The report investigated previously completed, ongoing, and planned research and development projects focusing human factors and maintenance work carried out at Swedish nuclear power plants and SKI. In addition, needs for future research and development works were also investigated. Participants from all nuclear power plants and SKI were included in the study. Participants responded to a set of questions in an interview. The interviews also generated a list of future research and development projects. (au)

  20. Human factors in maintenance: Development and research in Swedish nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Salo, I. [Lund Univ. (Sweden). Dept. of Psychology; Svensson, Ola [Stockholm Univ. (Sweden). Dept. of Psychology

    2001-11-01

    The present report investigated previously completed, ongoing, and planned research and development projects focusing human factors and maintenance work carried out at Swedish nuclear power plants and SKI. In addition, needs for future research and development works were also investigated. Participants from all nuclear power plants and SKI were included in the study. Participants responded to a set of questions in an interview. The interviews also generated a list of future research and development projects.

  1. Reassessment of selected factors affecting siting of Nuclear Power Plants

    Energy Technology Data Exchange (ETDEWEB)

    Davis, R.E.; Hanson, A.L.; Mubayi, V.; Nourbakhsh, H.P.

    1997-02-01

    Brookhaven National Laboratory has performed a series of probabilistic consequence assessment calculations for nuclear reactor siting. This study takes into account recent insights into severe accident source terms and examines consequences in a risk based format consistent with the quantitative health objectives (QHOs) of the NRC`s Safety Goal Policy. Simplified severe accident source terms developed in this study are based on the risk insights of NUREG-1150. The results of the study indicate that both the quantity of radioactivity released in a severe accident as well as the likelihood of a release are lower than those predicted in earlier studies. The accident risks using the simplified source terms are examined at a series of generic plant sites, that vary in population distribution, meteorological conditions, and exclusion area boundary distances. Sensitivity calculations are performed to evaluate the effects of emergency protective action assumptions on the risk of prompt fatality and latent cancers fatality, and population relocation. The study finds that based on the new source terms the prompt and latent fatality risks at all generic sites meet the QHOs of the NRC`s Safety Goal Policy by margins ranging from one to more than three orders of magnitude. 4 refs., 17 figs., 24 tabs.

  2. Computerized aids and human factors in nuclear power plant operation

    International Nuclear Information System (INIS)

    Bastl, W.

    1988-01-01

    When guiding a complex process and associated intermeshed systems in a nuclear power plant, a primary issue consists of the call for excellent information. Technically speaking, today's centralized control rooms are at the end of a development phase which has been governed by the introduction of remote information and remote control systems. But by centralization, an information overload problem arose, and it has been solved by dividing panels according to systems, operational phases and specific tasks. In addition, the overview and relationship of systems have been visualized by mimic diagrams. It is attempted to make transparent the technical back-ground of the processes and systems to be controlled, thus to provide the necessary basis for understanding the problems of operators. Practical examples are used for the purpose. The information dilemma, the systems for high level information, automation and information, plant safety and information, and the problem of where to go from here are described. Computerized operator aids must be discussed along assistance in information and assistance in automatic control. (Kako, I.)

  3. Human factors estimation methods in nuclear power plant

    International Nuclear Information System (INIS)

    Takano, Kenichi; Yoshino, Kenji; Nagasaka, Akihiko; Ishii, Keichiro; Nakasa, Hiroyasu

    1985-01-01

    To improve the operational and maintenance work reliability, it is neccessary for workers to maintain his performance always at high level, that leads to decreasing mistaken judgements and operations. This paper inuolves the development and evaluation of ''Multi-Purpose Physiological Information Measurement system'' to estimate human performance and conditions with a highly fixed quantity. The following itemes is mentioned : (1) Most suitable physiological informations are selected to measure worker' performance in nuclear power plant with none-disturbance, ambulatory, continual, and multi channel measurement. (2) Relatively important physiological informations are measured with the real-time monitoring functions. (electrocardiogram, respirometric functions and EMG (electromyogram) pulse rete). (3) It is made to optimize the measurement condition and analysing methods in the use of a noise-cut function and a D.C. drift cutting method. (4) As a example, it is clear that, when the different weight is loaded to the arm and make it strech-bend motion, the EMG signal is measured and analysed by this system, the analysed EMG pulse rate and maximum amplitude is related to the arm loaded weight. (author)

  4. Negative transcriptional regulation of mitochondrial transcription factor A (TFAM) by nuclear TFAM

    International Nuclear Information System (INIS)

    Lee, Eun Jin; Kang, Young Cheol; Park, Wook-Ha; Jeong, Jae Hoon; Pak, Youngmi Kim

    2014-01-01

    Highlights: • TFAM localizes in nuclei and mitochondria of neuronal cells. • Nuclear TFAM does not bind the Tfam promoter. • Nuclear TFAM reduced the Tfam promoter activity via suppressing NRF-1 activity. • A novel self-negative feedback regulation of Tfam gene expression is explored. • FAM may play different roles depending on its subcellular localizations. - Abstract: The nuclear DNA-encoded mitochondrial transcription factor A (TFAM) is synthesized in cytoplasm and transported into mitochondria. TFAM enhances both transcription and replication of mitochondrial DNA. It is unclear, however, whether TFAM plays a role in regulating nuclear gene expression. Here, we demonstrated that TFAM was localized to the nucleus and mitochondria by immunostaining, subcellular fractionation, and TFAM-green fluorescent protein hybrid protein studies. In HT22 hippocampal neuronal cells, human TFAM (hTFAM) overexpression suppressed human Tfam promoter-mediated luciferase activity in a dose-dependent manner. The mitochondria targeting sequence-deficient hTFAM also repressed Tfam promoter activity to the same degree as hTFAM. It indicated that nuclear hTFAM suppressed Tfam expression without modulating mitochondrial activity. The repression required for nuclear respiratory factor-1 (NRF-1), but hTFAM did not bind to the NRF-1 binding site of its promoter. TFAM was co-immunoprecipitated with NRF-1. Taken together, we suggest that nuclear TFAM down-regulate its own gene expression as a NRF-1 repressor, showing that TFAM may play different roles depending on its subcellular localizations

  5. Human factors methods for nuclear control room design. Volume 2. Human factors survey of control room design practices

    International Nuclear Information System (INIS)

    Seminara, J.L.; Parsons, S.O.

    1979-11-01

    An earlier review of the control rooms of operating nuclear power plants identified many design problems having potential for degrading operator performance. As a result, the formal application of human factors principles was found to be needed. This report demonstrates the use of human factors in the design of power plant control rooms. The approaches shown in the report can be applied to operating power plants, as well as to those in the design stage. This study documents human factors techniques required to provide a sustained concern for the man-machine interface from control room concept definition to system implementation

  6. Relationship between organizational factors, safety culture and PSA in nuclear power plant operations

    International Nuclear Information System (INIS)

    Joksimovich, V.; Orvis, D.D.

    1997-01-01

    There are four nuclear safety imperatives or ''4Ms'': machine (hardware, design, QA/QC), milieux (operating conditions, environment, natural phenomena), man (human reliability) and management (organizational and management influences). Nuclear safety evaluations as well as evolution of its most powerful tool, Probabilistic Safety Assessment (PSA), followed chronologically the 4M constituents. The nuclear industry worldwide, and the nuclear safety regulators in particular, have been preoccupied with the first M almost to the point of obsession with belated and only intuitive interest in the third and fourth M (human dimension). Human factors or economics in the nuclear industry was an afterthought. Human reliability was essentially born in the aftermath of the Three Mile Island (TMI) accident. Impact of organizational factors on nuclear safety is only in the early stages of R and D. This paper describes some of the concepts being pursued by APG to link organizational factors and safety culture to Human Reliability Analysis (HRA) and to integrate such into probabilistic safety assessment (PSA), e.g. [APG, 1993]. (author). 11 refs, 4 figs, 1 tab

  7. Evironmental assessment factors relating to reprocessing of spent nuclear fuel

    International Nuclear Information System (INIS)

    1978-05-01

    This document is in two parts. Part I presents the criteria and evaluation factors, based primarily on US experience, which may be used to carry out an environmental assessment of spent fuel reprocessing. The concept of As Low as is Reasonably Achievable (ALARA) is introduced in limiting radiation exposure. The factors influencing both occupational and general public radiation exposure are reviewed. Part II provides information on occupational and general public radiation exposure in relation to reprocessing taken from various sources including UNSCEAR and GESMO. Some information is provided in relation to potential accidents at reprocessing or MOX fuel refabrication plants. The magnitude of the services, energy, land use and non-radiological effluents for the reference design of reprocessing plant are also presented

  8. Nuclear fuel management via fuel quality factor averaging

    International Nuclear Information System (INIS)

    Mingle, J.O.

    1978-01-01

    The numerical procedure of prime number averaging is applied to the fuel quality factor distribution of once and twice-burned fuel in order to evolve a fuel management scheme. The resulting fuel shuffling arrangement produces a near optimal flat power profile both under beginning-of-life and end-of-life conditions. The procedure is easily applied requiring only the solution of linear algebraic equations. (author)

  9. Efficiency factor of a chemical nuclear reactor with gamma sources

    International Nuclear Information System (INIS)

    Anguis T, C.

    1975-01-01

    A chemonuclear reactor is simulated in order to calculate the efficiency factor of molecular species in chemical reactions induced by gamma radiation, with the purpose to obtain information for its design and consider the electromagnetic energy as a possible solution to the present problem of energy. The research is based on a mathematical model of succesive Compton processes applied to spherical and cylindrical geometry and corroborated through the absorbed dose and the experimental date of the increase factor, for the radioisotopic sources Co-60 and Cs-137 relating the quantity of energy deposited into various cylinders with the G value, the relation radius/height of the reactor is optimized according to the molecular production. This is illustrated with the radiolysis of a solution of CH 3 OH/H 2 O which forms H 2 and with the obtainment of C 2 H 5 Br that represents and industrial process induced radioactively. The results show a greater energy deposition with Cs-137 but a larger production of H 2 /hr with Co-60, and besides we can find high production values of C 2 H 5 Br. The cylinder with more advantages is that whose relation R/H is of 0.5. It can be concluded that the final selection of the reactor should be made after a more intense study of the used isotope and the source activity. The efficiency factor of H 2 can be increased selecting the appropriate type and concentration of solute of the irradiated aqueous solutions

  10. Analysis on nuclear power plant control room system design and improvement based on human factor engineering

    International Nuclear Information System (INIS)

    Gao Feng; Liu Yanzi; Sun Yongbin

    2014-01-01

    The design of nuclear power plant control room system is a process of improvement with the implementation of human factor engineering theory and guidance. The method of implementation human factor engineering principles into the nuclear power plant control room system design and improvement was discussed in this paper. It is recommended that comprehensive address should be done from control room system function, human machine interface, digital procedure, control room layout and environment design based on the human factor engineering theory and experience. The main issues which should be paid more attention during the control room system design and improvement also were addressed in this paper, and then advices and notices for the design and improvement of the nuclear power plant control room system were afforded. (authors)

  11. Evidence for site-specific occupancy of the mitochondrial genome by nuclear transcription factors.

    Directory of Open Access Journals (Sweden)

    Georgi K Marinov

    Full Text Available Mitochondria contain their own circular genome, with mitochondria-specific transcription and replication systems and corresponding regulatory proteins. All of these proteins are encoded in the nuclear genome and are post-translationally imported into mitochondria. In addition, several nuclear transcription factors have been reported to act in mitochondria, but there has been no comprehensive mapping of their occupancy patterns and it is not clear how many other factors may also be found in mitochondria. Here we address these questions by using ChIP-seq data from the ENCODE, mouseENCODE and modENCODE consortia for 151 human, 31 mouse and 35 C. elegans factors. We identified 8 human and 3 mouse transcription factors with strong localized enrichment over the mitochondrial genome that was usually associated with the corresponding recognition sequence motif. Notably, these sites of occupancy are often the sites with highest ChIP-seq signal intensity within both the nuclear and mitochondrial genomes and are thus best explained as true binding events to mitochondrial DNA, which exist in high copy number in each cell. We corroborated these findings by immunocytochemical staining evidence for mitochondrial localization. However, we were unable to find clear evidence for mitochondrial binding in ENCODE and other publicly available ChIP-seq data for most factors previously reported to localize there. As the first global analysis of nuclear transcription factors binding in mitochondria, this work opens the door to future studies that probe the functional significance of the phenomenon.

  12. Human factors engineering applied to Control Centre Design of a research nuclear reactor

    Energy Technology Data Exchange (ETDEWEB)

    Farias, Larissa P. de; Santos, Isaac J.A. Luquetti dos; Carvalho, Paulo V.R., E-mail: larissapfarias@ymail.com [Instituto de Engenharia Nuclear (DENN/SEESC/IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Lab, de Usabilidade e Confiabilidade Humana; Monteiro, Beany G. [Universidade Federal do Rio Janeiro (UFRJ), Rio Janeiro, RJ (Brazil). Departamento de Desenho Industrial

    2017-07-01

    The Human Factors Engineering (HFE) program is an essential aspect for the design of nuclear installations. The overall aim of the HFE program is the improvement of the operational reliability and safety of plant operation. The HFE program main purpose is to ensure that human factor practices are incorporated into the plant design, emphasizing man-machine interface issues and design improvement of the nuclear reactor Control Centre. The Control Centre of nuclear reactor is a combination of control rooms, control suites and local control stations, which are functionally connected and located on the reactor site. The objective of this paper is to present a design approach for the Control Centre of a nuclear reactor used to produce radioisotopes and for nuclear research, including human factor issues. The design approach is based on participatory design principles, using human factor standards, ergonomic guidelines, and the participation of a multidisciplinary team during all design phases. Using the information gathered, an initial sketch 3D of the Control Centre was developed. (author)

  13. Human factors engineering applied to Control Centre Design of a research nuclear reactor

    International Nuclear Information System (INIS)

    Farias, Larissa P. de; Santos, Isaac J.A. Luquetti dos; Carvalho, Paulo V.R.; Monteiro, Beany G.

    2017-01-01

    The Human Factors Engineering (HFE) program is an essential aspect for the design of nuclear installations. The overall aim of the HFE program is the improvement of the operational reliability and safety of plant operation. The HFE program main purpose is to ensure that human factor practices are incorporated into the plant design, emphasizing man-machine interface issues and design improvement of the nuclear reactor Control Centre. The Control Centre of nuclear reactor is a combination of control rooms, control suites and local control stations, which are functionally connected and located on the reactor site. The objective of this paper is to present a design approach for the Control Centre of a nuclear reactor used to produce radioisotopes and for nuclear research, including human factor issues. The design approach is based on participatory design principles, using human factor standards, ergonomic guidelines, and the participation of a multidisciplinary team during all design phases. Using the information gathered, an initial sketch 3D of the Control Centre was developed. (author)

  14. Economic assessment factors relating to spent nuclear fuel reprocessing

    International Nuclear Information System (INIS)

    This paper is in two parts. Part I discusses the factors to be applied in an economic assessment of reprocessing. It sets forth three basic cost components, namely capital costs, operating costs and the cost of capital utilization. It lists the various components of each cost area. Part II proposes a relationship between these respective cost areas, tabulates a range of costs and then develops unit costs for reprocessing operations. Finally, an addendum to the paper gives a more detailed breakdown of the capital costs of a reprocessing plant

  15. Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.

    Science.gov (United States)

    Sherazi, Syed Furqan Haider; Butt, Zeeshan

    2012-09-01

    AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.

  16. Erythroid cells in vitro: from developmental biology to blood transfusion products.

    Science.gov (United States)

    Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni

    2009-07-01

    Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.

  17. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Parvovirus B19 integration into human CD36+ erythroid progenitor cells.

    Science.gov (United States)

    Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik

    2017-11-01

    The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Nuclear medicine - factors influencing the choice and use of radionuclides in diagnosis and therapy

    International Nuclear Information System (INIS)

    Anon.

    1983-01-01

    This report addresses the many factors which influence the choice of the proper radiopharmaceutical drug product for the diagnosis or treatment of a specific disease or condition in a human subject. The Report examines the historical factors that influence the choice of radionuclides, the factors that influence the localization of radionuclides in tissues, the factors that influence the choice of instruments, and include an evaluation of the nuclear medicine procedures that could be selected and their clinical usefulness. In examining these factors the desirable characteristics of the radiopharmaceutical drug products of the measurement systems are identified. The methods of dose determination and the assumptions used in determination of dose are developed. There is also a section on radiation effects. A chapter on guidelines for procedures in nuclear medicine and some general and specific recommendations for protection of patients conclude the body of the text

  20. Quantum shielding effects on the Gamow penetration factor for nuclear fusion reaction in quantum plasmas

    Science.gov (United States)

    Lee, Myoung-Jae; Jung, Young-Dae

    2017-01-01

    The quantum shielding effects on the nuclear fusion reaction process are investigated in quantum plasmas. The closed expression of the classical turning point for the Gamow penetration factor in quantum plasmas is obtained by the Lambert W-function. The closed expressions of the Gamow penetration factor and the cross section for the nuclear fusion reaction in quantum plasmas are obtained as functions of the plasmon energy and the relative kinetic energy by using the effective interaction potential with the WKB analysis. It is shown that the influence of quantum screening suppresses the Sommerfeld reaction factor. It is also shown that the Gamow penetration factor increases with an increase of the plasmon energy. It is also shown that the quantum shielding effect enhances the deuterium formation by the proton-proton reaction in quantum plasmas. In addition, it is found that the energy dependences on the reaction cross section and the Gamow penetration factor are more significant in high plasmon-energy domains.

  1. Safety review for human factors engineering and control rooms of nuclear power plants

    International Nuclear Information System (INIS)

    Yang Mengzhuo

    1998-01-01

    Safety review for human factors engineering and control rooms of nuclear power plants (NPP) is in a forward position of science and technology, which began at American TMI severe accident and had been implemented in China. The importance and the significance of the safety review are expounded, the requirements of its scope and profundity are explained in detail. In addition, the situation of the technical document system for nuclear safety regulation on human factors engineering and control rooms of NPP in China is introduced briefly, on which the safety review is based

  2. Psychological factors affecting public acceptance of nuclear energy. Comparative analysis focusing on regional characteristics and degree of knowledge

    International Nuclear Information System (INIS)

    Kimura, Hiroshi; Suzuki, Atsuyuki; Furuta, Kazuo

    2003-01-01

    The purpose of this research is to clarify how psychological factors' impact on public acceptance of nuclear energy varies with where they live and their degree of knowledge. For this purpose, we carried out questionnaire survey about nuclear energy at three urban areas and two nuclear power plant siting areas. After collecting data, we applied factor analysis to the data, and found four factors which construct cognitive structure of nuclear energy. Using multiple regression analysis, we evaluated the impact of the four factors on two issues: the decision for or against nuclear policy and the reaction to nuclear power plant siting, and compared changes of the impact by where respondents live and their degree of knowledge. Consequently, we found that the impact of all four factors on the two issues varies with where respondents live. We also found that the impact of respondents' degree of knowledge to four factors varies with where they live. (author)

  3. Safe Operation of Nuclear Power Plants: Impacts of Human and Organisational Factors and Emerging Technologies

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    In co-operation with the OECD Nuclear Energy Agency (NEA), the Halden Reactor Project organised a Summer School on ''Safe Operation of Nuclear Power Plants: Impacts of Human and Organisational Factors and Emerging Technologies'' in the period August 27-August 31, 2001. The Summer School was intended for scientists, engineers and technicians working for nuclear installations, engineering companies, industry and members of universities and research institutes, who wanted to broaden their nuclear background by getting acquainted with Man-Technology-Organisation-related subjects and issues. The Summer School should also serve to transfer knowledge to the ''young generation'' in the nuclear field. The following presentations were given: (1) Overview of the Nuclear Community and Current issues, (2) The Elements of Safety Culture; Evaluation of Events, (3) Quality Management (QM), (4) Probabilistic Risk Assessment (PSA), (5) Human Behaviour from the Viewpoint of Industrial Psychology, (6) Technical tour of the Halden Project Experimental Facilities, (7) Human Factors in Control Room Design, (8) Computerised Operator Support Systems (COSSs) and (9) Artificial Intelligence; a new Approach. Most of the contributions are overhead figures from spoken lectures.

  4. Safe Operation of Nuclear Power Plants: Impacts of Human and Organisational Factors and Emerging Technologies

    International Nuclear Information System (INIS)

    2001-01-01

    In co-operation with the OECD Nuclear Energy Agency (NEA), the Halden Reactor Project organised a Summer School on ''Safe Operation of Nuclear Power Plants: Impacts of Human and Organisational Factors and Emerging Technologies'' in the period August 27-August 31, 2001. The Summer School was intended for scientists, engineers and technicians working for nuclear installations, engineering companies, industry and members of universities and research institutes, who wanted to broaden their nuclear background by getting acquainted with Man-Technology-Organisation-related subjects and issues. The Summer School should also serve to transfer knowledge to the ''young generation'' in the nuclear field. The following presentations were given: (1) Overview of the Nuclear Community and Current issues, (2) The Elements of Safety Culture; Evaluation of Events, (3) Quality Management (QM), (4) Probabilistic Risk Assessment (PSA), (5) Human Behaviour from the Viewpoint of Industrial Psychology, (6) Technical tour of the Halden Project Experimental Facilities, (7) Human Factors in Control Room Design, (8) Computerised Operator Support Systems (COSSs) and (9) Artificial Intelligence; a new Approach. Most of the contributions are overhead figures from spoken lectures

  5. Safe Operation of Nuclear Power Plants: Impacts of Human and Organisational Factors and Emerging Technologies

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    In co-operation with the OECD Nuclear Energy Agency (NEA), the Halden Reactor Project organised a Summer School on ''Safe Operation of Nuclear Power Plants: Impacts of Human and Organisational Factors and Emerging Technologies'' in the period August 27-August 31, 2001. The Summer School was intended for scientists, engineers and technicians working for nuclear installations, engineering companies, industry and members of universities and research institutes, who wanted to broaden their nuclear background by getting acquainted with Man-Technology-Organisation-related subjects and issues. The Summer School should also serve to transfer knowledge to the ''young generation'' in the nuclear field. The following presentations were given: (1) Overview of the Nuclear Community and Current issues, (2) The Elements of Safety Culture; Evaluation of Events, (3) Quality Management (QM), (4) Probabilistic Risk Assessment (PSA), (5) Human Behaviour from the Viewpoint of Industrial Psychology, (6) Technical tour of the Halden Project Experimental Facilities, (7) Human Factors in Control Room Design, (8) Computerised Operator Support Systems (COSSs) and (9) Artificial Intelligence; a new Approach. Most of the contributions are overhead figures from spoken lectures.

  6. The human factor and organization to support nuclear power plant operators

    International Nuclear Information System (INIS)

    Naumov, V.I.

    1993-01-01

    Analysis reveals three basic factors which affect the safety of nuclear power reactors: (1) Internal physical properties of the reactor which provide self protection under breakdown and accident conditions; (2) The reliability of technical systems which provide monitoring, control, accident prevention, heat release, and localization of hazardous products during accidents; (3) Reliability of the reactor control personnel. The last of these factors is usually called the human factor. From published data, this factor makes a large contribution to the downtime and accident statistics at nuclear power plants: from 30 to 80% in various countries. Today the importance of the human factor in operating a nuclear power units is rather well recognized. Current ideas on how to increase the reliability of a human operator are reflected in IAEA recommendations and domestic official documents. The concept of 'a culture of safety' is introduced. Basic types of actions to increase the reliability of personnel who control a nuclear reactor are discussed, including: (1) The qualifying and psychological selection and the training of candidates on the operator's obligations. (2) The automation of routine operations which do not require the operator's intellect. (3) Perfecting the work place, information input to the operator, and the organization of the controls

  7. The unit cost factors and calculation methods for decommissioning - Cost estimation of nuclear research facilities

    International Nuclear Information System (INIS)

    Kwan-Seong Jeong; Dong-Gyu Lee; Chong-Hun Jung; Kune-Woo Lee

    2007-01-01

    Available in abstract form only. Full text of publication follows: The uncertainties of decommissioning costs increase high due to several conditions. Decommissioning cost estimation depends on the complexity of nuclear installations, its site-specific physical and radiological inventories. Therefore, the decommissioning costs of nuclear research facilities must be estimated in accordance with the detailed sub-tasks and resources by the tasks of decommissioning activities. By selecting the classified activities and resources, costs are calculated by the items and then the total costs of all decommissioning activities are reshuffled to match with its usage and objectives. And the decommissioning cost of nuclear research facilities is calculated by applying a unit cost factor method on which classification of decommissioning works fitted with the features and specifications of decommissioning objects and establishment of composition factors are based. Decommissioning costs of nuclear research facilities are composed of labor cost, equipment and materials cost. Of these three categorical costs, the calculation of labor costs are very important because decommissioning activities mainly depend on labor force. Labor costs in decommissioning activities are calculated on the basis of working time consumed in decommissioning objects and works. The working times are figured out of unit cost factors and work difficulty factors. Finally, labor costs are figured out by using these factors as parameters of calculation. The accuracy of decommissioning cost estimation results is much higher compared to the real decommissioning works. (authors)

  8. Factors affecting economic performance of nuclear power projects in the USA and abroad

    International Nuclear Information System (INIS)

    Braun, C.

    1988-01-01

    Trends in nuclear power economics in the USA, as well as in other large power programmes, are reviewed in this paper. The current US coal/nuclear economic situation, the implications for operating cost improvements and the potential for the introduction of new low-cost nuclear units are discussed. The average economic advantage of nuclear over coal plants has been significantly eroded over the last four years, though the rate of decline has recently slowed. Discussion of an average plant's performance indices is always imprecise, given the wide distribution of the costs data. However, several nuclear power plants can be identified whose total generation costs in 1985 were less than coal units' variable costs or total generation expenses. It is concluded that the impact of new, low-cost plants on improving the overall US nuclear/coal economics will require a long time to make itself felt. In the near term the most cost effective methods for improving US nuclear power economics are a reduction in operating expenses and an increase in average plant capacity factors. (author). 9 refs, 9 figs

  9. Global Developmental Gene Programing Involves a Nuclear Form of Fibroblast Growth Factor Receptor-1 (FGFR1.

    Directory of Open Access Journals (Sweden)

    Christopher Terranova

    Full Text Available Genetic studies have placed the Fgfr1 gene at the top of major ontogenic pathways that enable gastrulation, tissue development and organogenesis. Using genome-wide sequencing and loss and gain of function experiments the present investigation reveals a mechanism that underlies global and direct gene regulation by the nuclear form of FGFR1, ensuring that pluripotent Embryonic Stem Cells differentiate into Neuronal Cells in response to Retinoic Acid. Nuclear FGFR1, both alone and with its partner nuclear receptors RXR and Nur77, targets thousands of active genes and controls the expression of pluripotency, homeobox, neuronal and mesodermal genes. Nuclear FGFR1 targets genes in developmental pathways represented by Wnt/β-catenin, CREB, BMP, the cell cycle and cancer-related TP53 pathway, neuroectodermal and mesodermal programing networks, axonal growth and synaptic plasticity pathways. Nuclear FGFR1 targets the consensus sequences of transcription factors known to engage CREB-binding protein, a common coregulator of transcription and established binding partner of nuclear FGFR1. This investigation reveals the role of nuclear FGFR1 as a global genomic programmer of cell, neural and muscle development.

  10. Multiple NUCLEAR FACTOR Y transcription factors respond to abiotic stress in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Li Xu

    Full Text Available Members of the plant NUCLEAR FACTOR Y (NF-Y family are composed of the NF-YA, NF-YB, and NF-YC subunits. In Brassica napus (canola, each of these subunits forms a multimember subfamily. Plant NF-Ys were reported to be involved in several abiotic stresses. In this study, we demonstrated that multiple members of thirty three BnNF-Ys responded rapidly to salinity, drought, or ABA treatments. Transcripts of five BnNF-YAs, seven BnNF-YBs, and two BnNF-YCs were up-regulated by salinity stress, whereas the expression of thirteen BnNF-YAs, ten BnNF-YBs, and four BnNF-YCs were induced by drought stress. Under NaCl treatments, the expression of one BnNF-YA10 and four NF-YBs (BnNF-YB3, BnNF-YB7, BnNF-YB10, and BnNF-YB14 were greatly increased. Under PEG treatments, the expression levels of four NF-YAs (BnNF-YA9, BnNF-YA10, BnNF-YA11, and BnNF-YA12 and five NF-YBs (BnNF-YB1, BnNF-YB8, BnNF-YB10, BnNF-YB13, and BnNF-YB14 were greatly induced. The expression profiles of 20 of the 27 salinity- or drought-induced BnNF-Ys were also affected by ABA treatment. The expression levels of six NF-YAs (BnNF-YA1, BnNF-YA7, BnNF-YA8, BnNF-YA9, BnNF-YA10, and BnNF-YA12 and seven BnNF-YB members (BnNF-YB2, BnNF-YB3, BnNF-YB7, BnNF-YB10, BnNF-YB11, BnNF-YB13, and BnNF-YB14 and two NF-YC members (BnNF-YC2 and BnNF-YC3 were greatly up-regulated by ABA treatments. Only a few BnNF-Ys were inhibited by the above three treatments. Several NF-Y subfamily members exhibited collinear expression patterns. The promoters of all stress-responsive BnNF-Ys harbored at least two types of stress-related cis-elements, such as ABRE, DRE, MYB, or MYC. The cis-element organization of BnNF-Ys was similar to that of Arabidopsis thaliana, and the promoter regions exhibited higher levels of nucleotide sequence identity with Brassica rapa than with Brassica oleracea. This work represents an entry point for investigating the roles of canola NF-Y proteins during abiotic stress responses and provides

  11. Multiple NUCLEAR FACTOR Y transcription factors respond to abiotic stress in Brassica napus L.

    Science.gov (United States)

    Xu, Li; Lin, Zhongyuan; Tao, Qing; Liang, Mingxiang; Zhao, Gengmao; Yin, Xiangzhen; Fu, Ruixin

    2014-01-01

    Members of the plant NUCLEAR FACTOR Y (NF-Y) family are composed of the NF-YA, NF-YB, and NF-YC subunits. In Brassica napus (canola), each of these subunits forms a multimember subfamily. Plant NF-Ys were reported to be involved in several abiotic stresses. In this study, we demonstrated that multiple members of thirty three BnNF-Ys responded rapidly to salinity, drought, or ABA treatments. Transcripts of five BnNF-YAs, seven BnNF-YBs, and two BnNF-YCs were up-regulated by salinity stress, whereas the expression of thirteen BnNF-YAs, ten BnNF-YBs, and four BnNF-YCs were induced by drought stress. Under NaCl treatments, the expression of one BnNF-YA10 and four NF-YBs (BnNF-YB3, BnNF-YB7, BnNF-YB10, and BnNF-YB14) were greatly increased. Under PEG treatments, the expression levels of four NF-YAs (BnNF-YA9, BnNF-YA10, BnNF-YA11, and BnNF-YA12) and five NF-YBs (BnNF-YB1, BnNF-YB8, BnNF-YB10, BnNF-YB13, and BnNF-YB14) were greatly induced. The expression profiles of 20 of the 27 salinity- or drought-induced BnNF-Ys were also affected by ABA treatment. The expression levels of six NF-YAs (BnNF-YA1, BnNF-YA7, BnNF-YA8, BnNF-YA9, BnNF-YA10, and BnNF-YA12) and seven BnNF-YB members (BnNF-YB2, BnNF-YB3, BnNF-YB7, BnNF-YB10, BnNF-YB11, BnNF-YB13, and BnNF-YB14) and two NF-YC members (BnNF-YC2 and BnNF-YC3) were greatly up-regulated by ABA treatments. Only a few BnNF-Ys were inhibited by the above three treatments. Several NF-Y subfamily members exhibited collinear expression patterns. The promoters of all stress-responsive BnNF-Ys harbored at least two types of stress-related cis-elements, such as ABRE, DRE, MYB, or MYC. The cis-element organization of BnNF-Ys was similar to that of Arabidopsis thaliana, and the promoter regions exhibited higher levels of nucleotide sequence identity with Brassica rapa than with Brassica oleracea. This work represents an entry point for investigating the roles of canola NF-Y proteins during abiotic stress responses and provides insight into

  12. An improvement of the applicability of human factors guidelines for coping with human factors issues in nuclear power plants

    International Nuclear Information System (INIS)

    Lee, Y. H.; Lee, J. Y.

    2003-01-01

    Human factors have been well known as one of the key factors to the system effectiveness as well as the efficiency and safety of nuclear power plants(NPPs). Human factors engineering(HFE) are included in periodic safety review(PSR) on the existing NPPs and the formal safety assessment for the new ones. However, HFE for NPPs is still neither popular in practice nor concrete in methodology. Especially, the human factors guidelines, which are the most frequent form of human factors engineering in practice, reveal the limitations in their applications. We discuss the limitations and their casual factors found in human factors guidelines in order to lesson the workload of HFE practitioners and to improve the applicability of human factors guidelines. According to the purposes and the phases of HFE for NPPs, more selective items and specified criteria should be prepared carefully in the human factors guidelines for the each HFE applications in practice. These finding on the human factors guidelines can be transferred to the other HFE application field, such as military, aviation, telecommunication, HCI, and product safety

  13. Human factors estimation method in nuclear power plants

    International Nuclear Information System (INIS)

    Takano, Kenichi; Yoshino, Kenji; Nagasaka, Akihiko

    1987-01-01

    It is need for improving a NPS reliability to prevent human-errors of operators in a control room. Especially, the time error or omission error may be often caused by a exceed of the mental work load. Therefore, in order to decrease such kinds of human errors, not only the planning of an equipment and a console is well considered about proper level of mental work load but also the exceeded mental work load must be let down by trainning etc. This paper present measurement techniques of the mental work load by physiological informations and the relation between the error rate and mental work load on the basis of the experiment by various modeled tasks. Following results are obtained. (1) TSF, the indicator of the mental work load, is well correlated to the subsidary task reaction time. Therefore it is able to estimate the TSF by subsidary tasks if the task was loaded instanteniously with main task. (2) The relation between the TSF and GSR pulses rate has a 0.81 correlation factor except the case of a parallel processing task. Because we can evaluate the mental work load by the measurement of the GSR pulses rate if the task was processed by a single channel. But if uses GSR, the atomospheric condition is kept constant and the arousal level must be at the well stage. (3) The human error is greatly increase when the TSF exceed above 60 %, that values are almost agreed to the tolerance limit of the TTS methods. (author)

  14. A Study on the Allowable Safety Factor of Cut-Slopes for Nuclear Facilities

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Myung Soo; Yee, Eric [KEPCO International Nuclear Graduate School, Ulsan (Korea, Republic of)

    2015-10-15

    In this study, the issues of allowable safety factor design criteria for cut-slopes in nuclear facilities is derived through case analysis, a proposed construction work slope design criteria that provides relatively detailed conditions can be applied in case of the dry season and some unclear parts of slope design criteria be modified in case of the rainy season. This safety factor can be further subdivided into two; normal and earthquake factors, a factor of 1.5 is applied for normal conditions and a factor of 1.2 is applied for seismic conditions. This safety factor takes into consideration the effect of ground water and rainfall conditions. However, no criteria for the case of cut-slope in nuclear facilities and its response to seismic conditions is clearly defined, this can cause uncertainty in design. Therefore, this paper investigates the allowable safety factor for cut-slopes in nuclear facilities, reviews conditions of both local and international cut-slope models and finally suggests an alternative method of analysis. It is expected that the new design criteria adequately ensures the stability of the cut-slope to reflect clear conditions for both the supervising and design engineers.

  15. Overall analysis of the cost key factors for the nuclear energy

    International Nuclear Information System (INIS)

    Caero, M.

    1996-01-01

    In 1995, 25,8 % of the world electricity consumption was of nuclear origin, while in the EU this figure is increased up to 50,6 %. In order to maintain and even to increase its share in the electricity generation, Nuclear Energy needs to achieve a good economic performance as a base load source when compared with its competitors, basically coal and gas fired plants. Fossil-fired generation costs have declined over the past ten years, mainly due to lower fossil fuel prices. This factor together with the recently observed tendency of higher discount rates to be applied are challenging the attractiveness of the nuclear energy. Nuclear energy is a capital intensive option. Taken into account extensive standardization programs has been established aiming at cost reductions as well as to increase efficiency of nuclear energy utilization, among their main purposes. Externalities play an important role, as they are already internalized in nuclear generation costs. This is not true for many existing coal-fired plants. Even a great uncertainly exists on greenhouse gas effects. Also decisions on greenhouse gas control and their impact on carbonaceous fuel generation costs cannot be clearly predicted, even in the immediate future. Macroeconomic factors like employment, competitiveness, energy conservation, energy availability, energy demand control, etc are positively influenced by the use of nuclear energy. A sustainable economic development cannot be achieved only relying on fossil fuel generation. As a wrap up sustainable development demands nuclear energy in order to cover the future objectives of energy availability, environmental control and energy cost control. (author)

  16. Agmatine inhibits nuclear factor-κB nuclear translocation in acute ...

    African Journals Online (AJOL)

    Doaa M. Samy

    2016-02-18

    Feb 18, 2016 ... proteins called IkBs that render them inactive.5,6 Tumor necro- sis factor-o ... receptors,15,16 o2-adrenergic receptors,18 imidazoline receptors,19 inducible ... manual bladder evacuation in male rats is difficult.24 Animals.

  17. b-jet tagged nuclear modification factors in heavy ion collisions with CMS

    CERN Document Server

    Jung, Kurt

    2014-01-01

    The energy loss of jets in heavy-ion collisions is expected to depend on the flavor of the fragmenting parton. Thus, measurements of jet quenching as a function of flavor place powerful constraints on the thermodynamical and transport properties of the hot and dense medium. Measurements of the nuclear modification factors of the heavy-flavor-tagged jets in both PbPb and pPb collisions can quantify such energy loss effects. Specifically, pPb measurements provide crucial insights into the behavior of the cold nuclear matter effect, which is required to fully understand the hot and dense medium effects on jets in PbPb collisions. In this talk, we present the b-jet spectra and the first measurement of the nuclear modification factors as a function of transverse momentum and pseudorapidity, using the high statistics pp, pPb and PbPb data taken in 2011 and 2013.

  18. Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

    Directory of Open Access Journals (Sweden)

    Pascariello Caterina

    2008-05-01

    Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of

  19. Human factors review of nuclear power plant control room design. Final report

    International Nuclear Information System (INIS)

    Seminara, J.L.; Gonzalez, W.R.; Parsons, S.O.

    1976-11-01

    The human factors aspects of five representative nuclear power plant control rooms were evaluated using such methods as a checklist guided observation system, structured interviews with operators and trainers, direct observations of operator behavior, task analyses and procedure evaluation, and historical error analyses. The human factors aspects of design practices are illustrated, and many improvements in current practices are suggested. The study recommends that a detailed set of applicable human factors standards be developed to stimulate a uniform and systematic concern for human factors in design considerations

  20. Improving performance of high risk organizations Spanish nuclear sector from the analysis of organizational culture factors

    International Nuclear Information System (INIS)

    La Salabarnada, E.; German, S.; Silla, I.; Navajas, J.

    2012-01-01

    This paper presents the research project funded by UNESA and conducted by the CISOT-CIEMAT that aims to contribute to improving the operating performance of the Spanish nuclear power plants. This paper aims to identify the factors and key organizational processes to improve efficiency, in order to advance knowledge about the influence of organizational culture on the safety of high reliability organizations.

  1. Orphan nuclear receptor TR4 and fibroblast growth factor 1 in metabolism

    NARCIS (Netherlands)

    Liu, Weilin

    2016-01-01

    Metabolic homeostasis is achieved, in part, through the coordinated activities of members of the Nuclear Receptor (NR) family, a superfamily of ligand-modulated transcription factors (TFs) that mediate responses to a wide range of lipophilic signaling molecules including lipids, steroids, retinoids,

  2. Development of a Pilot Program for Human Factors Management in Operating Nuclear Power plants

    International Nuclear Information System (INIS)

    Lee, Jung-Woon; Lee, Yong-Hee; Jang, Tong-Il; Kim, Dae-Ho

    2007-01-01

    The human factors of operating NPPs have been reviewed as a part of Periodic Safety Reviews (PSRs). This human factors PSR covers a wide range of human factors including control room man-machine interfaces (MMIs), procedures, working conditions, qualification, training, information requirements and workload. Korea Atomic Energy Research Institute (KAERI) has performed human factors PSRs from the first PSR for Kori 1. It was determined in 2005 that for a Continuous Operation of the Korean NPPs an enhanced PSR should be performed and issues raised from the PSRs should be resolved. From the results of the PSR for Kori 1, several safety enhancement issues related to human factors were raised. KAERI is working on a resolution of some of the human factors issues for the Korea Hydro and Nuclear Power Co. (KHNP). As a part of the resolution, we are developing a human factors management program (HFMP) for Kori 1. This paper introduces the status of our development of HFMP

  3. Role of apoptosis-inducing factor (AIF in programmed nuclear death during conjugation in Tetrahymena thermophila

    Directory of Open Access Journals (Sweden)

    Endoh Hiroshi

    2010-02-01

    Full Text Available Abstract Background Programmed nuclear death (PND, which is also referred to as nuclear apoptosis, is a remarkable process that occurs in ciliates during sexual reproduction (conjugation. In Tetrahymena thermophila, when the new macronucleus differentiates, the parental macronucleus is selectively eliminated from the cytoplasm of the progeny, concomitant with apoptotic nuclear events. However, the molecular mechanisms underlying these events are not well understood. The parental macronucleus is engulfed by a large autophagosome, which contains numerous mitochondria that have lost their membrane potential. In animals, mitochondrial depolarization precedes apoptotic cell death, which involves DNA fragmentation and subsequent nuclear degradation. Results We focused on the role of mitochondrial apoptosis-inducing factor (AIF during PND in Tetrahymena. The disruption of AIF delays the normal progression of PND, specifically, nuclear condensation and kilobase-size DNA fragmentation. AIF is localized in Tetrahymena mitochondria and is released into the macronucleus prior to nuclear condensation. In addition, AIF associates and co-operates with the mitochondrial DNase to facilitate the degradation of kilobase-size DNA, which is followed by oligonucleosome-size DNA laddering. Conclusions Our results suggest that Tetrahymena AIF plays an important role in the degradation of DNA at an early stage of PND, which supports the notion that the mitochondrion-initiated apoptotic DNA degradation pathway is widely conserved among eukaryotes.

  4. Leukemic blast cell colony formation in semisolid culture with erythropoietin: a case report of acute poorly differentiated erythroid leukemia.

    Science.gov (United States)

    Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T

    1987-02-01

    The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.

  5. Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.

    Science.gov (United States)

    Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong

    2017-02-03

    Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.

  6. Comparison of different methods for erythroid differentiation in the K562 cell line.

    Science.gov (United States)

    Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

    2016-08-01

    To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

  7. The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice

    International Nuclear Information System (INIS)

    Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.

    1981-01-01

    The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)

  8. DMPD: Nuclear factor-kappaB: activation and regulation during toll-like receptorsignaling. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17349209 Nuclear factor-kappaB: activation and regulation during toll-like receptorsignaling. Carmody...uclear factor-kappaB: activation and regulation during toll-like receptorsignaling. Authors Carmody

  9. Dose factors to calculate the radiation exposure due to radioactive waste air from nuclear facilities

    International Nuclear Information System (INIS)

    Brenk, H.D.; Vogt, K.J.

    1977-01-01

    An evaluation of the environmental impact of nuclear plants according to paragraph 45 of the Radiation Protection Directive of the Federal Republic of Germany requires the calculation of dose conversion factors indicating the correlation between the contaminated medium and individual radiation exposure. The present study is to be conceived as a contribution to discussion on this subject. For the determination of radiation exposure caused by the waste air of nuclear plants, models are being specified for computing the dose conversion factors for the external exposure pathways of β-submersion, γ-submersion and γ-radiation from contaminated ground as well as the internal exposure pathways of inhalation and ingestion, which further elaborate and improve the models previously applied, especially as far as the ingestion pathway is concerned, which distinguishes between 6 major food categories. The computer models are applied to those radionuclides which are significan for nuclear emitters, in particular nuclear light-water power stations. The results obtained for the individual exposure pathways and affected organs are specified in the form of tables. For this purpose, calculations were first of all carried out for the so-called 'reference man'. The results can be transferred to population groups with different consumption habits (e.g. vegetarians) by the application of correction factors. The models are capable of being extended with a view to covering other age groups. (orig.) [de

  10. Safety, reliability, risk management and human factors: an integrated engineering approach applied to nuclear facilities

    Energy Technology Data Exchange (ETDEWEB)

    Vasconcelos, Vanderley de; Silva, Eliane Magalhaes Pereira da; Costa, Antonio Carlos Lopes da; Reis, Sergio Carneiro dos [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: vasconv@cdtn.br, e-mail: silvaem@cdtn.br, e-mail: aclc@cdtn.br, e-mail: reissc@cdtn.br

    2009-07-01

    Nuclear energy has an important engineering legacy to share with the conventional industry. Much of the development of the tools related to safety, reliability, risk management, and human factors are associated with nuclear plant processes, mainly because the public concern about nuclear power generation. Despite the close association between these subjects, there are some important different approaches. The reliability engineering approach uses several techniques to minimize the component failures that cause the failure of the complex systems. These techniques include, for instance, redundancy, diversity, standby sparing, safety factors, and reliability centered maintenance. On the other hand system safety is primarily concerned with hazard management, that is, the identification, evaluation and control of hazards. Rather than just look at failure rates or engineering strengths, system safety would examine the interactions among system components. The events that cause accidents may be complex combinations of component failures, faulty maintenance, design errors, human actions, or actuation of instrumentation and control. Then, system safety deals with a broader spectrum of risk management, including: ergonomics, legal requirements, quality control, public acceptance, political considerations, and many other non-technical influences. Taking care of these subjects individually can compromise the completeness of the analysis and the measures associated with both risk reduction, and safety and reliability increasing. Analyzing together the engineering systems and controls of a nuclear facility, their management systems and operational procedures, and the human factors engineering, many benefits can be realized. This paper proposes an integration of these issues based on the application of systems theory. (author)

  11. Safety, reliability, risk management and human factors: an integrated engineering approach applied to nuclear facilities

    International Nuclear Information System (INIS)

    Vasconcelos, Vanderley de; Silva, Eliane Magalhaes Pereira da; Costa, Antonio Carlos Lopes da; Reis, Sergio Carneiro dos

    2009-01-01

    Nuclear energy has an important engineering legacy to share with the conventional industry. Much of the development of the tools related to safety, reliability, risk management, and human factors are associated with nuclear plant processes, mainly because the public concern about nuclear power generation. Despite the close association between these subjects, there are some important different approaches. The reliability engineering approach uses several techniques to minimize the component failures that cause the failure of the complex systems. These techniques include, for instance, redundancy, diversity, standby sparing, safety factors, and reliability centered maintenance. On the other hand system safety is primarily concerned with hazard management, that is, the identification, evaluation and control of hazards. Rather than just look at failure rates or engineering strengths, system safety would examine the interactions among system components. The events that cause accidents may be complex combinations of component failures, faulty maintenance, design errors, human actions, or actuation of instrumentation and control. Then, system safety deals with a broader spectrum of risk management, including: ergonomics, legal requirements, quality control, public acceptance, political considerations, and many other non-technical influences. Taking care of these subjects individually can compromise the completeness of the analysis and the measures associated with both risk reduction, and safety and reliability increasing. Analyzing together the engineering systems and controls of a nuclear facility, their management systems and operational procedures, and the human factors engineering, many benefits can be realized. This paper proposes an integration of these issues based on the application of systems theory. (author)

  12. Nuclear localization of Src-family tyrosine kinases is required for growth factor-induced euchromatinization

    International Nuclear Information System (INIS)

    Takahashi, Akinori; Obata, Yuuki; Fukumoto, Yasunori; Nakayama, Yuji; Kasahara, Kousuke; Kuga, Takahisa; Higashiyama, Yukihiro; Saito, Takashi; Yokoyama, Kazunari K.; Yamaguchi, Naoto

    2009-01-01

    Src-family kinases (SFKs), which participate in various signaling events, are found at not only the plasma membrane but also several subcellular compartments, including the nucleus. Nuclear structural changes are frequently observed during transcription, cell differentiation, senescence, tumorigenesis, and cell cycle. However, little is known about signal transduction in the alteration of chromatin texture. Here, we develop a pixel imaging method for quantitatively evaluating chromatin structural changes. Growth factor stimulation increases euchromatic hypocondensation and concomitant heterochromatic hypercondensation in G 1 phase, and the levels reach a plateau by 30 min, sustain for at least 5 h and return to the basal levels after 24 h. Serum-activated SFKs in the nucleus were more frequently detected in the euchromatin areas than the heterochromatin areas. Nuclear expression of kinase-active SFKs, but not unrelated Syk kinase, drastically increases both euchromatinization and heterochromatinization in a manner dependent on the levels of nuclear tyrosine phosphorylation. However, growth factor stimulation does not induce chromatin structural changes in SYF cells lacking SFKs, and reintroduction of one SFK member into SYF cells can, albeit insufficiently, induce chromatin structural changes. These results suggest that nuclear tyrosine phosphorylation by SFKs plays an important role in chromatin structural changes upon growth factor stimulation.

  13. Nuclear exclusion of transcription factors associated with apoptosis in developing nervous tissue

    Directory of Open Access Journals (Sweden)

    R. Linden

    1999-07-01

    Full Text Available Programmed cell death in the form of apoptosis involves a network of metabolic events and may be triggered by a variety of stimuli in distinct cells. The nervous system contains several neuron and glial cell types, and developmental events are strongly dependent on selective cell interactions. Retinal explants have been used as a model to investigate apoptosis in nervous tissue. This preparation maintains the structural complexity and cell interactions similar to the retina in situ, and contains cells in all stages of development. We review the finding of nuclear exclusion of several transcription factors during apoptosis in retinal cells. The data reviewed in this paper suggest a link between apoptosis and a failure in the nucleo-cytoplasmic partition of transcription factors. It is argued that the nuclear exclusion of transcription factors may be an integral component of apoptosis both in the nervous system and in other types of cells and tissues.

  14. Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.

    Science.gov (United States)

    Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem

    2016-12-01

    In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

    Directory of Open Access Journals (Sweden)

    Reed Christopher

    2009-11-01

    Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

  16. Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle

    International Nuclear Information System (INIS)

    Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella

    2012-01-01

    Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.

  17. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Gloria Bua

    Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

  18. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

    Science.gov (United States)

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  19. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells.

    Directory of Open Access Journals (Sweden)

    Laurie A Steiner

    Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.

  20. Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

    Directory of Open Access Journals (Sweden)

    Shlomi Toobiak

    Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

  1. IRSN-ANCCLI partnership. Organizational and human factors in nuclear safety - April 2014

    International Nuclear Information System (INIS)

    Jeffroy, Francois; Garron, Joel; Mercel, Philippe; Compagnat, Gilles; Gaucher, Eric; Gaillard, Pierre; Fanchini, Henri; Jacquemont, Vincent

    2013-06-01

    The contributions (Power Point presentations) of this seminar first address the history of the taking into account of organizational and human factors until the Fukushima accident (history of their taking into account in nuclear safety expertise in France, history of the development of policy of organizational and human factors by an operator). The next contributions discuss the main issues regarding these factors after Fukushima: report by a work-group, work performed by the the Comite d'Orientation sur les Facteurs Sociaux, Organisationnels et Humains (Committee of orientation on social, organizational and human factors). The third session addresses the implication of stakeholders in expertise on these factors: analysis of organizational and human factors by a local information commission or by a CHSCT (committee of hygiene, safety and working conditions)

  2. Engineering factors influencing Corbicula fouling in nuclear-service water systems

    International Nuclear Information System (INIS)

    Henager, C.H.; Johnson, K.I.; Page, T.L.

    1983-06-01

    Corbicula fouling is a continuing problem in nuclear-service water systems. More knowledge of biological and engineering factors is needed to develop effective detection and control methods. A data base on Corbicula fouling was compiled from nuclear and non-nuclear power stations and industries using raw water. This data base was used in an analysis to identify systems and components which are conducive to fouling by Corbicula. Bounds on several engineering parameters such as velocity and temperature which support Corbicula growth are given. Service water systems found in BWR and PWR reactors are listed and those that show fouling are identified. Possible safety implications of Corbicula fouling are discussed for specific service water systems. Several effective control methods in current use include backflushing with heated water, centrifugal strainers, and continuous chlorination during spawning seasons

  3. Critical factors supporting the confidence in U.S. nuclear power industries

    International Nuclear Information System (INIS)

    Yoshida, Tomoaki

    2004-01-01

    The risk informed regulation in U.S. is summarized and factors supporting the confidence in U.S. nuclear power industries are thought to be helpful to our country for improving the state of nuclear power industries. In U.S., on the basis of clear Regulatory Guide, an entrepreneur constructs and practices corrective action of nonconformance. A regulatory commission submitted by the nation watches their movements. The movements related to regulatory are opened to the people and they make a thousand preparations for the rule to make correct the insufficient part. These above system get good results in U.S. It is important in Japan that we are not going to get away with anything on the system satisfied above conditions and practice. The risk informed regulation, effectiveness of risk informed regulation supporting conditions, a part of NRC (Nuclear Regulatory Commission) and entrepreneur are described. (S.Y.)

  4. FTZ-Factor1 and Fushi tarazu interact via conserved nuclear receptor and coactivator motifs

    Science.gov (United States)

    Schwartz, Carol J.E.; Sampson, Heidi M.; Hlousek, Daniela; Percival-Smith, Anthony; Copeland, John W.R.; Simmonds, Andrew J.; Krause, Henry M.

    2001-01-01

    To activate transcription, most nuclear receptor proteins require coactivators that bind to their ligand-binding domains (LBDs). The Drosophila FTZ-Factor1 (FTZ-F1) protein is a conserved member of the nuclear receptor superfamily, but was previously thought to lack an AF2 motif, a motif that is required for ligand and coactivator binding. Here we show that FTZ-F1 does have an AF2 motif and that it is required to bind a coactivator, the homeodomain-containing protein Fushi tarazu (FTZ). We also show that FTZ contains an AF2-interacting nuclear receptor box, the first to be found in a homeodomain protein. Both interaction motifs are shown to be necessary for physical interactions in vitro and for functional interactions in developing embryos. These unexpected findings have important implications for the conserved homologs of the two proteins. PMID:11157757

  5. Critical human-factors issues in nuclear-power regulation and a recommended comprehensive human-factors long-range plan. Executive summary

    International Nuclear Information System (INIS)

    Hopkins, C.O.; Snyder, H.L.; Price, H.E.; Hornick, R.J.; Mackie, R.R.; Smillie, R.J.; Sugarman, R.C.

    1982-08-01

    This comprehensive long-range human factors plan for nuclear reactor regulation was developed by a Study Group of the Human Factors Society, Inc. This Study Group was selected by the Executive Council of the Society to provide a balanced, experienced human factors perspective to the applications of human factors scientific and engineering knowledge to nuclear power generation. The report is presented in three volumes. Volume 1 contains an Executive Summary of the 18-month effort and its conclusions. Volume 2 summarizes all known nuclear-related human factors activities, evaluates these activities wherever adequate information is available, and describes the recommended long-range (10-year) plan for human factors in regulation. Volume 3 elaborates upon each of the human factors issues and areas of recommended human factors involvement contained in the plan, and discusses the logic that led to the recommendations

  6. Inhibition of CRM1-mediated nuclear export of transcription factors by leukemogenic NUP98 fusion proteins.

    Science.gov (United States)

    Takeda, Akiko; Sarma, Nayan J; Abdul-Nabi, Anmaar M; Yaseen, Nabeel R

    2010-05-21

    NUP98 is a nucleoporin that plays complex roles in the nucleocytoplasmic trafficking of macromolecules. Rearrangements of the NUP98 gene in human leukemia result in the expression of numerous fusion oncoproteins whose effect on nucleocytoplasmic trafficking is poorly understood. The present study was undertaken to determine the effects of leukemogenic NUP98 fusion proteins on CRM1-mediated nuclear export. NUP98-HOXA9, a prototypic NUP98 fusion, inhibited the nuclear export of two known CRM1 substrates: mutated cytoplasmic nucleophosmin and HIV-1 Rev. In vitro binding assays revealed that NUP98-HOXA9 binds CRM1 through the FG repeat motif in a Ran-GTP-dependent manner similar to but stronger than the interaction between CRM1 and its export substrates. Two NUP98 fusions, NUP98-HOXA9 and NUP98-DDX10, whose fusion partners are structurally and functionally unrelated, interacted with endogenous CRM1 in myeloid cells as shown by co-immunoprecipitation. These leukemogenic NUP98 fusion proteins interacted with CRM1, Ran, and the nucleoporin NUP214 in a manner fundamentally different from that of wild-type NUP98. NUP98-HOXA9 and NUP98-DDX10 formed characteristic aggregates within the nuclei of a myeloid cell line and primary human CD34+ cells and caused aberrant localization of CRM1 to these aggregates. These NUP98 fusions caused nuclear accumulation of two transcription factors, NFAT and NFkappaB, that are regulated by CRM1-mediated export. The nuclear entrapment of NFAT and NFkappaB correlated with enhanced transcription from promoters responsive to these transcription factors. Taken together, the results suggest a new mechanism by which NUP98 fusions dysregulate transcription and cause leukemia, namely, inhibition of CRM1-mediated nuclear export with aberrant nuclear retention of transcriptional regulators.

  7. What factors facilitate regulatory competence in supervising the safety of nuclear technology?

    International Nuclear Information System (INIS)

    Mishar, Marina

    2012-01-01

    The proposed utilization of nuclear energy for electricity generation as the alternative energy source requires Atomic Energy Licensing Board (AELB), the Malaysian nuclear regulatory body taking key role in supervising the safety of the program. This study looked into factors influencing the competency of current AELB human resource as technical competency has been identified as one of the main contributors to the success of a civil nuclear power program. The four quadrant competency model developed by International Atomic Energy Agency was utilized as the required competency. A comprehensive study on 81 personnel from five states in different geographic regions of the country were carried out to investigate the impact of six factors related to competency (educational level, years of working experience, trainings attended, participation in technical committees, numbers of technical papers written and number of technical presentation presented) on four dependent measures in the areas of regulatory competency (legal basis, technical disciplines, regulatory practices and personal and interpersonal effectiveness). Multiple regression (method enter) identified factors that had significant contribution to level of competency while stepwise regression resulted in identifying predictors to enhance competencies. Results were mixed but each of the independent factors is a predictor to different competencies. This study had identified the best predictors that could significantly contribute to the enhancement of regulatory. (author)

  8. Organizational factors and reoccurrence protection on the JCO nuclear critical accident

    International Nuclear Information System (INIS)

    Takano, Kenichi

    2000-01-01

    A nuclear critical accident formed at a nuclear fuel conversion factory in Tokai-mura on September, 1999 became gradually clear not to be a simple human error formed at a level of workmen but to be an organizational error or accident relating to various organizational factors. As a nuclear power facility adopts a depth protection system fundamentally, a large accident with serious danger would not form only by a single trouble and a human error and unless some factors overlaps. By reviewing recent serious accidents and troubles, all of them seem to have a keyword of 'organizational factor'. In the JCO accident, there are some organizational factors such as a climate deviating from a manual, insufficient and loose check against change of procedure, reduction of operators from a reason of profit priority, attitude on priority of working efficiency, and so forth, which are partially common to the Chernobyl accident. Recently, accidents and troubles impossible to make them a cause of simple human error by a person but to have to say an organizational error, have increased. This trend seems to depend upon not only complication and scale-up of technology system but also graduate change of social and management systems operating them. Therefore, it seems to be necessary to introduce a concept of depth protection (multiple protection) in order to keep its reliability and safety when complicating and scaling-up of system. (G.K.)

  9. A HUMAN FACTORS META MODEL FOR U.S. NUCLEAR POWER PLANT CONTROL ROOM MODERNIZATION

    Energy Technology Data Exchange (ETDEWEB)

    Joe, Jeffrey C.

    2017-03-01

    Over the last several years, the United States (U.S.) Department of Energy (DOE) has sponsored human factors research and development (R&D) and human factors engineering (HFE) activities through its Light Water Reactor Sustainability (LWRS) program to modernize the main control rooms (MCR) of commercial nuclear power plants (NPP). Idaho National Laboratory (INL), in partnership with numerous commercial nuclear utilities, has conducted some of this R&D to enable the life extension of NPPs (i.e., provide the technical basis for the long-term reliability, productivity, safety, and security of U.S. NPPs). From these activities performed to date, a human factors meta model for U.S. NPP control room modernization can now be formulated. This paper discusses this emergent HFE meta model for NPP control room modernization, with the goal of providing an integrated high level roadmap and guidance on how to perform human factors R&D and HFE for those in the U.S. nuclear industry that are engaging in the process of upgrading their MCRs.

  10. Establishing a value chain for human factors in nuclear power plantcontrol room modernization

    Energy Technology Data Exchange (ETDEWEB)

    Joe, Jeffrey Clark [Idaho National Laboratory; Thomas, Kenneth David [Idaho National Laboratory; Boring, Ronald Laurids [Idaho National Laboratory

    2015-07-01

    Commercial nuclear power plants in the United States (U.S.) have operated reliably and efficiently for decades. With the life extensions of plants now being planned for operation beyond their original operating licenses, there are opportunities to achieve even greater efficiencies, while maintaining high operational reliabilities, with strategic, risk- and economically-informed, upgrades to plant systems and infrastructure. The U.S. Department of Energy’s Light Water Reactor Sustainability (LWRS) program supports the commercial nuclear industry’s modernization efforts through research and development (R&D) activities across many areas to help establish the technical and economic bases for modernization activities. The Advanced Instrumentation, Information, and Control Systems Technologies pathway is one R&D focus area for the LWRS program, and has researchers at Idaho National Laboratory working with select utility partners to use human factors and instrumentation and controls R&D to help modernize the plant’s main control room. However, some in the nuclear industry have not been as enthusiastic about using human factors R&D to inform life extension decision making. Part of the reason for this may stem from uncertainty decision-makers have regarding how human factors fits into the value chain for nuclear power plant control room modernization. This paper reviews past work that has attempted to demonstrate the value of human factors, and then describes the value chain concept, how it applies to control room modernization, and then makes a case for how and why human factors is an essential link in the modernization value chain.

  11. Absence of prognostic value of nuclear shape factor analysis in colorectal carcinoma: relevance of interobserver and intraobserver variability.

    Science.gov (United States)

    Di Fabio, Francesco; Shrier, Ian; Bégin, Louis R; Gordon, Philip H

    2008-12-01

    Several retrospective studies, including our previous investigation, have shown a prognostic value of nuclear shape factor in colorectal carcinomas. This prospective study was designed to assess the reliability of nuclear shape factor determined by nuclear morphometry and to confirm its prognostic value. Ninety-eight patients who underwent colorectal carcinoma resection were prospectively enrolled. Measurement of nuclear shape factor was performed by using a computer-based image analysis system. Nuclear shape factor was defined as the degree of circularity of the nucleus (1.0 for a perfect circle and values by American Joint Committee on Cancer stage were: 0.73 (0.07) in Stage I, 0.74 (0.06) in Stage II, and 0.75 (0.05) in Stage III carcinomas (P = 0.78, ANOVA). The intraobserver agreement was poor for observer A (r = 0.28) and practically nonexistent for observer B (r = -0.004, Pearson correlation). The intraclass coefficient for interobserver agreement was practically nonexistent. No significant association between nuclear shape factor and ten-year survival was found. Our prospective results, as opposed to our previous retrospective results, suggest that the reliability for nuclear shape factor morphometric analysis is very poor. We failed to confirm a prognostic value for nuclear shape factor in colorectal carcinoma.

  12. Multilateral nuclear approaches (MNAs), factors and issues lessons from IAEA study to regional cooperation

    International Nuclear Information System (INIS)

    Hwang, Yong Soo

    2005-01-01

    In response to the increasing emphasis being placed on the importance of international cooperation as part of global efforts to cope with growing non proliferation, and security concerns in the nuclear field, the Director General of the International Atomic Energy Agency (IAEA), Mohammed Elbaradei, appointed an international group of experts to consider possible multilateral approaches to the nuclear fuel cycle. The mandate of the Expert Group was three fold: · To identify and provide an analysis of issues and options relevant to multilateral approaches to the front and back ends of the nuclear fuel cycle; · To provide an overview of the policy, legal, security, economic, institutional and technological incentives and disincentives for cooperation in multilateral arrangements for the front and back ends of the nuclear fuel cycle; and · To provide a brief review of the historical and current experiences and analyses relating to multilateral fuel cycle arrangements relevant to the work of the Expert Group. The overall purpose was to assess MNAs in the framework of a double objective: strengthening the international nuclear non proliferation regime and making the peaceful uses of nuclear energy more economical and attractive. The Group identifies options for MNAs - options in terms of policy, institutional and legal factors - for those parts of the nuclear fuel cycle of greatest sensitivity from the point of view of proliferation risk. It also reflects the Groups deliberations on the corresponding benefits and disadvantages (pros and cons) of the various options and approaches. Although the Expert Group was able to agree to forward the resulting report to the Director General, it is important to note that the report does not reflect agreement by all of the experts on any of the options, nor a consensus assessment of their respective value. It is intended only to present options for MNAs, and to reflect on the range of considerations which could impact on the

  13. Fermi liquid, clustering, and structure factor in dilute warm nuclear matter

    Science.gov (United States)

    Röpke, G.; Voskresensky, D. N.; Kryukov, I. A.; Blaschke, D.

    2018-02-01

    Properties of nuclear systems at subsaturation densities can be obtained from different approaches. We demonstrate the use of the density autocorrelation function which is related to the isothermal compressibility and, after integration, to the equation of state. This way we connect the Landau Fermi liquid theory well elaborated in nuclear physics with the approaches to dilute nuclear matter describing cluster formation. A quantum statistical approach is presented, based on the cluster decomposition of the polarization function. The fundamental quantity to be calculated is the dynamic structure factor. Comparing with the Landau Fermi liquid theory which is reproduced in lowest approximation, the account of bound state formation and continuum correlations gives the correct low-density result as described by the second virial coefficient and by the mass action law (nuclear statistical equilibrium). Going to higher densities, the inclusion of medium effects is more involved compared with other quantum statistical approaches, but the relation to the Landau Fermi liquid theory gives a promising approach to describe not only thermodynamic but also collective excitations and non-equilibrium properties of nuclear systems in a wide region of the phase diagram.

  14. The need and direction of a human factors research program for the nuclear power industry

    International Nuclear Information System (INIS)

    Blackman, H.S.; Meyer, O.R.; Nelson, W.R.

    1986-01-01

    It is axiomatic that the need for a human factors program in the nuclear power industry must be based upon an examination of the process of nuclear energy production and the role that the human plays in this process. It has been pointed out by others that a large number of incidents in technology based industries can be attributed to human error, thereby demonstrating the need to understand the human in interacting with complex processes. But an emphasis upon human ''error'' is a negative approach and can be non-productive, particularly when the ''correct'' human action has not been clearly defined prior to the incident. Some industries have expended great resources in a positive attempt to maximize the performance of the human in critical roles, e.g., the man-in-space program, the commercial airlines industry, deep-sea exploration. Central to this issue of human factors in nuclear power is the question of the role that the human plays in reducing the risk of the total system. If, as in other areas of application, the nuclear industry can make substantial improvements in the performance of humans, one needs to know how much risk is really reduced

  15. Human factors review of nuclear power plant control room design. Summary report

    International Nuclear Information System (INIS)

    Seminara, J.L.; Gonzalez, W.R.; Parsons, S.O.

    1976-11-01

    Human factors engineering is an interdisciplinary specialty concerned with influencing the design of equipment systems, facilities, and operational environments to promote safe, efficient, and reliable operator performance. The human factors aspects of five representative nuclear power plant control rooms were evaluated using such methods as a checklist-guided observation system, structured interviews with operators and trainers, direct observations of operator behavior, task analyses and procedure evaluation, and historical error analyses. The human factors aspects of design practices are illustrated, and many improvements in current practices are suggested. The study recommends that a detailed set of applicable human factors standards be developed to stimulate a uniform and systematic concern for human factors in design considerations

  16. Quality factors in the life cycle of software oriented to safety systems in nuclear power plants

    International Nuclear Information System (INIS)

    Nunez McLeod, J.E.; Rivera, S.S.

    1997-01-01

    The inclusion of software in safety related systems for nuclear power plants, makes it necessary to include the software quality assurance concept. The software quality can be defined as the adjustment degree between the software and the specified requirements and user expectations. To guarantee a certain software quality level it is necessary to make a systematic and planned set of tasks, that constitute a software quality guaranty plan. The application of such a plan involves activities that should be performed all along the software life cycle, and that can be evaluated through the so called quality factors, due to the fact that the quality itself cannot be directly measured, but indirectly as some of it manifestations. In this work, a software life cycle model is proposed, for nuclear power plant safety related systems. A set os software quality factors is also proposed , with its corresponding classification according to the proposed model. (author) [es

  17. Testing collinear factorization and nuclear parton distributions with pA collisions at the LHC

    CERN Document Server

    Quiroga-Arias, Paloma; Wiedemann, Urs Achim

    2011-01-01

    Global perturbative QCD analyses, based on large data sets from electron-proton and hadron collider experiments, provide tight constraints on the parton distribution function (PDF) in the proton. The extension of these analyses to nuclear parton distributions (nPDF) has attracted much interest in recent years. nPDFs are needed as benchmarks for the characterization of hot QCD matter in nucleus-nucleus collisions, and attract further interest since they may show novel signatures of non- linear density-dependent QCD evolution. However, it is not known from first principles whether the factorization of long-range phenomena into process-independent parton distribution, which underlies global PDF extractions for the proton, extends to nuclear effects. As a consequence, assessing the reliability of nPDFs for benchmark calculations goes beyond testing the numerical accuracy of their extraction and requires phenomenological tests of the factorization assumption. Here we argue that a proton-nucleus collision program a...

  18. Inhibitors of nuclear factor kappa B cause apoptosis in cultured macrophages

    Directory of Open Access Journals (Sweden)

    E. E. Mannick

    1997-01-01

    Full Text Available The precise role of the transcription factor nuclear factor kappa B (NF- κB in the regulation of cell survival and cell death is still unresolved and may depend on cell type and position in the cell cycle. The aim of this study was to determine if three pharmacologic inhibitors of NF-κB, pyrrolidine dithiocarbamate, N-tosyl-L-lysl chloromethyl ketone and calpain I inhibitor, induce apoptosis in a murine macrophage cell line (RAW 264.7 at doses similar to those required for NF-κB inhibition. We found that each of the three inhibitors resulted in a dose- and time-dependent increase in morphologic indices of apoptosis in unstimulated, LPS-stimulated and TNF-stimulated cells. Lethal doses were consistent with those required for NF- κB inhibition. We conclude that nuclear NF-κB activation may represent an important survival mechanism in macrophages.

  19. The human factor in operating nuclear power plants during crisis situations

    International Nuclear Information System (INIS)

    Schnauder, H.; Smidt, D.

    1981-10-01

    Human factors in nuclear power plant operation are a main part of safety analyses. A considerable reduction in the influence of human factors has been obtained through ergonomic control room design, automation, clearly formulated operating manuals, and appropriate personnel education and training. These precautions are directed primarily at skill- and rule-based behaviour and are intended for normal operation and design accidents. In addition, one can construct an area of uncommon and very rare events where a partial failure of the safety systems is assumed. This is an area of knowledge-based behaviour. This report describes and assesses the present situation in German nuclear power plants. Recommendations for further research activity are made and, as a main result, for improvements in knowledge-based behaviour. (orig.) [de

  20. Research and development on the human factors technologies for nuclear power plants in Korea

    International Nuclear Information System (INIS)

    Sim, B.S.; Lee, J.W.; Cheon, S.W.

    1996-01-01

    This paper introduces our research project on the development of human factors technologies for nuclear power plants in Korea. The project is divided into two sub-projects. The first sub-project is the development of human factors experimental evaluation techniques, which aims to develop the techniques for experimental design, experimental measurement and data collection/analysis, and to construct an integrated test facility (ITF) suitable for the experimental evaluation of man-machine interfaces (MMIs) at an advanced control room. The second is the development of human behavior analysis techniques, which has two research areas: one is the development of a task simulation analyzer and the other is human error case studies for nuclear power plants. (author)

  1. Development of safety factors to be used for evaluation of cracked nuclear components

    International Nuclear Information System (INIS)

    Brickstad, B.; Bergman, M.

    1996-10-01

    A modified concept for safety evaluation is introduced which separately accounts for the failure mechanisms fracture and plastic collapse. For application on nuclear components a set of safety factors are also proposed that retain the safety margins expressed in ASME, section III and XI. By performing comparative studies of the acceptance levels for surface cracks in pipes and a pressure vessel, it is shown that some of the anomalies connected with the old safety procedures are removed. It is the authors belief that the outlined safety evaluation procedure has the capability of treating cracks in a consistent way and that the procedure together with the proposed safety factors fulfill the basic safety requirements for nuclear components. Hopefully, it is possible in the near future to develop a probabilistic safety assessment procedure in Sweden, which enables a systematic treatment of uncertainties in the involved data. 14 refs

  2. The Nuclear Factor of Activated T Cells (Nfat) Transcription Factor Nfatp (Nfatc2) Is a Repressor of Chondrogenesis

    Science.gov (United States)

    Ranger, Ann M.; Gerstenfeld, Louis C.; Wang, Jinxi; Kon, Tamiyo; Bae, Hyunsu; Gravallese, Ellen M.; Glimcher, Melvin J.; Glimcher, Laurie H.

    2000-01-01

    Nuclear factor of activated T cells (NFAT) transcription factors regulate gene expression in lymphocytes and control cardiac valve formation. Here, we report that NFATp regulates chondrogenesis in the adult animal. In mice lacking NFATp, resident cells in the extraarticular connective tissues spontaneously differentiate to cartilage. These cartilage cells progressively differentiate and the tissue undergoes endochondral ossification, recapitulating the development of endochondral bone. Proliferation of already existing articular cartilage cells also occurs in some older animals. At both sites, neoplastic changes in the cartilage cells occur. Consistent with these data, NFATp expression is regulated in mesenchymal stem cells induced to differentiate along a chondrogenic pathway. Lack of NFATp in articular cartilage cells results in increased expression of cartilage markers, whereas overexpression of NFATp in cartilage cell lines extinguishes the cartilage phenotype. Thus, NFATp is a repressor of cartilage cell growth and differentiation and also has the properties of a tumor suppressor. PMID:10620601

  3. Proceedings of the international topical meeting on advances in human factors in nuclear power systems

    International Nuclear Information System (INIS)

    Anon.

    1986-01-01

    This book presents the papers given at a conference on the human factors engineering of nuclear power plants. Topics considered at the conference included human modeling, artificial intelligence, expert systems, robotics and teleoperations, organizational issues, innovative applications, testing and evaluation, training systems technology, a modeling framework for crew decisions during reactor accident sequences, intelligent operator support systems, control algorithms for robot navigation, and personnel management

  4. MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

    Directory of Open Access Journals (Sweden)

    Dongsheng Wang

    2018-03-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

  5. Quality factors quantification/assurance for software related to safety in nuclear power plants

    International Nuclear Information System (INIS)

    Nunez McLeod, J.E.; Rivera, S.S.

    1997-01-01

    Quality assurance plan is needed to guarantee the software quality. The use of such a plan involves activities that should take place all along the life cycle, and which can be evaluated using the so called quality factors. This is due to the fact that the quality itself cannot be measured, but some of its manifestations can be used for this purpose. In the present work, a methodology to quantify a set of quality factors is proposed, for software based systems to be used in safety related areas in nuclear power plants. (author) [es

  6. Novel nuclear-encoded proteins interacting with a plastid sigma factor, Sig1, in Arabidopsis thaliana.

    Science.gov (United States)

    Morikawa, Kazuya; Shiina, Takashi; Murakami, Shinya; Toyoshima, Yoshinori

    2002-03-13

    Sigma factor binding proteins are involved in modifying the promoter preferences of the RNA polymerase in bacteria. We found the nuclear encoded protein (SibI) that is transported into chloroplasts and interacts specifically with the region 4 of Sig1 in Arabidopsis. SibI and its homologue, T3K9.5 are novel proteins, which are not homologous to any protein of known function. The expression of sibI was tissue specific, light dependent, and developmentally timed. We suggest the transcriptional regulation by sigma factor binding proteins to function in the plastids of higher plant.

  7. Organisational factors. Their definition and influence on nuclear safety. Final report

    International Nuclear Information System (INIS)

    Baumont, G.; Wahlstroem, B.; Sola, R.; Williams, J.; Frischknecht, A.; Wilpert, B.; Rollenhagen, C.

    2000-12-01

    The importance of organisational factors in the operational safety and efficiency of nuclear power plants (NPP) has been recognised by many organisations around the world. Despite this recognition, however, there are as yet very few methods by which organisational factors can be systematically assessed and improved. The majority of research efforts applied so far have tended to be modest and scattered. The ORFA project was created as a remedy to these problems. The objective of the project is to create a better understanding of how organisation and management factors influence nuclear safety. A key scientific objective of the project is to identify components of a theoretical framework, which would help in understanding the relationships between organisational factors and nuclear safety. Three work packages were planned. First, a review of literature listed out the identified factors and methods for assessing them. Then, a draft version of the present report was prepared to clarify the environment context and the main issues of the topics. This draft was discussed at the ORFA seminar in Madrid 21-22 October 1999. During the seminar views and comments were collected on preliminary results of the project. Finally, this information has been integrated in the present and other reports and will be used to give further guidance to the European Commission in the development of forthcoming research programmes in the field. The project has addressed nuclear safety taking a broad perspective, which reflected and took into account the views of senior NPP management and regulators. The questions discussed during the project have been: how can organisational factors be included in safety assessments, how can good and bad operational practices be identified, which methods can be used for detecting weak signals of deteriorating performance, how should incidents be analysed with respect to organisational factors to give the largest learning benefit, how can data on organisational

  8. Effects of different ligands on epidermal growth factor receptor (EGFR) nuclear translocation

    Energy Technology Data Exchange (ETDEWEB)

    Faria, Jerusa A.Q.A.; Andrade, Carolina de; Goes, Alfredo M. [Department of Biochemistry and Immunology, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, Belo Horizonte, MG, 31270-901 (Brazil); Rodrigues, Michele A. [Department of Biochemistry and Immunology, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, Belo Horizonte, MG, 31270-901 (Brazil); Department of General Pathology, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, Belo Horizonte, MG, 31270-901 (Brazil); Gomes, Dawidson A., E-mail: dawidson@ufmg.br [Department of Biochemistry and Immunology, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, Belo Horizonte, MG, 31270-901 (Brazil)

    2016-09-09

    The epidermal growth factor receptor (EGFR) is activated through binding to specific ligands and generates signals for proliferation, differentiation, migration, and cell survival. Recent data show the role of nuclear EGFR in tumors. Although many EGFR ligands are upregulated in cancers, little is known about their effects on EGFR nuclear translocation. We have compared the effects of six EGFR ligands (EGF, HB-EGF, TGF-α, β-Cellulin, amphiregulin, and epiregulin) on nuclear translocation of EGFR, receptor phosphorylation, migration, and proliferation. Cell fractionation and confocal immunofluorescence detected EGFR in the nucleus after EGF, HB-EGF, TGF-α and β-Cellulin stimulation in a dose-dependent manner. In contrast, amphiregulin and epiregulin did not generate nuclear translocation of EGFR. EGF, HB-EGF, TGF-α and β-Cellulin showed correlations between a higher rate of wound closure and increased phosphorylation of residues in the carboxy-terminus of EGFR, compared to amphiregulin and epiregulin. The data indicate that EGFR is translocated to the nucleus after stimulation with EGF, HB-EGF, TGF-α and β-Cellulin, and that these ligands are related to increased phosphorylation of EGFR tyrosine residues, inducing migration of SkHep-1 cells. - Highlights: • EGF, HB-EGF, TGF-α, β-Cellulin are involved in the EGFR nuclear translocation. • Amphiregulin and epiregulin did not promote nuclear translocation of EGFR. • EGF, HB-EGF, TGF-α and β-Cellulin have a role in SkHep-1 cells migration. • EGFR ligands associated with better prognosis don't stimulate EGFR translocation.

  9. Effects of different ligands on epidermal growth factor receptor (EGFR) nuclear translocation

    International Nuclear Information System (INIS)

    Faria, Jerusa A.Q.A.; Andrade, Carolina de; Goes, Alfredo M.; Rodrigues, Michele A.; Gomes, Dawidson A.

    2016-01-01

    The epidermal growth factor receptor (EGFR) is activated through binding to specific ligands and generates signals for proliferation, differentiation, migration, and cell survival. Recent data show the role of nuclear EGFR in tumors. Although many EGFR ligands are upregulated in cancers, little is known about their effects on EGFR nuclear translocation. We have compared the effects of six EGFR ligands (EGF, HB-EGF, TGF-α, β-Cellulin, amphiregulin, and epiregulin) on nuclear translocation of EGFR, receptor phosphorylation, migration, and proliferation. Cell fractionation and confocal immunofluorescence detected EGFR in the nucleus after EGF, HB-EGF, TGF-α and β-Cellulin stimulation in a dose-dependent manner. In contrast, amphiregulin and epiregulin did not generate nuclear translocation of EGFR. EGF, HB-EGF, TGF-α and β-Cellulin showed correlations between a higher rate of wound closure and increased phosphorylation of residues in the carboxy-terminus of EGFR, compared to amphiregulin and epiregulin. The data indicate that EGFR is translocated to the nucleus after stimulation with EGF, HB-EGF, TGF-α and β-Cellulin, and that these ligands are related to increased phosphorylation of EGFR tyrosine residues, inducing migration of SkHep-1 cells. - Highlights: • EGF, HB-EGF, TGF-α, β-Cellulin are involved in the EGFR nuclear translocation. • Amphiregulin and epiregulin did not promote nuclear translocation of EGFR. • EGF, HB-EGF, TGF-α and β-Cellulin have a role in SkHep-1 cells migration. • EGFR ligands associated with better prognosis don't stimulate EGFR translocation.

  10. Human factors evaluation of man-machine interface for periodic safety review of nuclear power plants

    International Nuclear Information System (INIS)

    Lee, Yong Hee; Lee, Jung Woon; Park, Jae Chang; Hwang, In Koo; Lee, Hyun Cheol; Jang, Tong Il; Ku, Jin Young; Kim, Soo Jin

    2004-12-01

    This report describes the research results of human factors assessment on the MMI(Man Machine Interface) equipment as part of Periodic Safety Review(PSR) of Nuclear Power Plants(NPPs). As MMI is a key factor among human factors to be reviewed in PSR, we reviewed the MMI components of nuclear power plants in aspect of human factors engineering. The availability, suitability, and effectiveness of the MMI devices were chosen to be reviewed. The MMI devices were investigated through the review of design documents related to the MMI, survey of control panels, evaluation of experts, and experimental assessment. Checklists were used to perform this assessment and record the review results. The items mentioned by the expert comments to review in detail in relation with task procedures were tested by experiments with operators' participation. For some questionable issues arisen during this MMI review, operator workload and possibility of errors in operator actions were analysed. The reviewed MMI devices contain MCR(Main Control Room), SPDS(Safety Parameter Display System), RSP(Remote Shutdown Panel), and the selected LCBs(Local Control Boards) importantly related to safety. As results of the assessments, any significant problem challenging the safety was not found on human factors in the MMI devices. However, several small items to be changed and improved in suitability of MMI devices were discovered. An action plan is recommended to accommodate the suggestions and review comments. It will enhance the plant safety on MMI area

  11. The Impact of Organizational Factors on Safety. The Perspective of Experts from the Spanish Nuclear Sector

    International Nuclear Information System (INIS)

    German, S.; Silla, I.; Navajas, J.

    2014-01-01

    Previous research supports the importance of organizational factors on safety in high reliability organizations. This study aims to determine the impact of those factors in the Spanish nuclear sector. Particularly, this study focuses on examining the role of performance indicators, organizational culture, organizational factors, and organizational context. With that purpose, an electronic survey addressed to experts from the Spanish nuclear sector was carried out. Results showed that performance indicators are well-known among industry experts and are perceived as useful for improving performance. Behavioural norms that influence safety and some relevant factors that promote problem identification were identified. Additionally, findings suggested that organizational context must be taken into account to better understand the role of organizational culture. Moreover, industry experts pointed out organizational factors to be improved: organizational communication processes within the organization, positive reinforcement, and field supervisors practices. Finally, findings supported the influence of organizational context on safety. It is noteworthy the role of the social impact of international events (e.g., Chernobyl...), the relationship with the regulator and the legislative and governmental framework. (Author)

  12. The dependence of the nuclear charge form factor on short range correlations and surface fluctuation effects

    International Nuclear Information System (INIS)

    Massen, S. E.; Garistov, V. P.; Grypeos, M. E.

    1996-01-01

    The effects of nuclear surface fluctuations on harmonic oscillator elastic charge form factor of light nuclei are investigated, simultaneously approximating the short-range correlations through a Jastrow correlation factor. Inclusion of the surface fluctuation effects within this description, by truncating the cluster expansion at the two-body part, is found to improve somewhat the fit to the elastic charge form-factor of 16 O and 40 Ca. However, the convergence of the cluster expansion is expected to deteriorate. An additional finding is that surface-fluctuation correlations produce a drastic change in the asymptotic behaviour of the point-proton form-factor, which now falls off quite slowly (i.e. as const.q -4 ) at large values of the momentum transfer q

  13. Radiation factors and smoking interaction at lung cancer incidence for workers at a nuclear enterprise

    International Nuclear Information System (INIS)

    Tokarskaya, Z.B.; Khokhryakov, V.T.; Okladnikova, N.D.; Belyaeva, Z.D.; Zhuntova, G.V.; Fleck, C.M.; Schollnberger, H.; Drozhko, E.G.

    1998-01-01

    A study is reported which is a continuation of a previous investigation of lung cancer incidence in workers at a nuclear enterprise and its relation to three basic etiological factors: the body burden due to 239 Pu, chronic external gamma irradiation, and smoking. Whereas previously each of the factors was assessed separately, in the present study the attempt was made to assess the interaction of the factors. A statistical analysis of the data revealed that for the following pairs of factors a superposition effect could be seen: external gamma irradiation and 239 Pu body burden; external gamma irradiation and a medium level of smoking; and 239 Pu body burden and a medium level of smoking. (A.K.)

  14. Prescribing safety, negotiating expertise. Building of nuclear safety human factors expertise

    International Nuclear Information System (INIS)

    Rolina, Gregory

    2008-01-01

    This Ph.D thesis is dedicated to a specific type of expertise, the safety of nuclear installations in the field of human and organisational factors. Empirical work is at the foundation of this thesis: the monitoring of experts 'in action', allowed a detailed reconstruction of three cases they were examining. The analysis, at the core of which lies the definition of what an efficient expertise can be, emphasizes the incompleteness of the knowledge that links together the nuclear facilities' organisational characteristics and their safety. This leads us to identify the expert's three ranges of actions (rhetorical, cognitive, operative). Defined from objectives and constraints likely to influence the expert's behaviour, those three ranges each require specific skills. A conception of expertise based on these ranges seems adaptable to other sectors and allows an enrichment of models of expertise cited in literature. Historical elements from French institutions of nuclear safety are also called upon to take into consideration some of the determinants of the expertise; its efficiency relies on the upholding of a continuous dialogue between the regulators (the experts and the control authority) and the regulated (the operators). This type of historically inherited regulation makes up a specificity of the French system of external control of nuclear risks. (author) [fr

  15. Critique of the Council on Economic Priorities test ''power plant performance: nuclear and coal capacity factors and economics''

    International Nuclear Information System (INIS)

    Simard, R.L.

    1977-01-01

    The Council on Economic Priorities (CEP) has assembled capacity factor data on most U.S. nuclear and coal-fired units in operation, performed a regression analysis upon capacity factor as a function of intrinsic unit variables such as size and age, and attempted a comparison of the economics of typical nuclear and coal-fired units using the resultant fitted-capacity factors. The report points out inadequacies in the CEP data base, the lack of predictive value in the results of the regression analysis, and inconsistencies in the economic evaluation of nuclear and coal-fired units

  16. A Review on the Regulatory Strategy of Human Factors Engineering Consideration in Pakistan Nuclear Facilities

    Energy Technology Data Exchange (ETDEWEB)

    Sohail, Sabir [Korea Advanced Institute of Science and Technology, Daejeon (Korea, Republic of); Choi, Seong Nam [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2013-10-15

    In this paper, the legal and regulatory infrastructure available in Pakistan for HFE requirements is assessed, and the methodology for strengthening of legal infrastructure is presented. The regulatory strategy on evaluation of HFE consideration should provide reviewers with guidance on review process. Therefore, the suggested methodology is based on preparation of guidance documents such as checklist, working procedures, S and Gs etc.; incorporation of PRM elements in regulatory system; and finally the development of PRM implementation criteria. Altogether, the scheme provide the enhancement in regulatory infrastructure and also the effective and efficient review process. The Three Mile Island (TMI) accident brought the general consensus among the nuclear community on the integration of human factors engineering (HFE) principles in all phases of nuclear power. This notion has further strengthened after the recent Fukushima nuclear accident. Much effort has been put over to incorporate the lesson learned and continuous technical evolution on HFE to device different standards. The total of 174 ergonomics standards are alone identified by Dul et al. (2004) published by International Organization for Standardization (ISO) and the European Committee for Standardization (CEN) and number of standards and HFE guidelines (S and Gs) are also published by organizations like Institute for Electrical and Electronics Engineering (IEEE), International Electrotechnical Commission (IEC), International Atomic Energy Agency (IAEA), United States Nuclear Regulatory Commission (USNRC), etc. The ambition of effective review on HFE integration in nuclear facility might be accomplished through the development of methodology for systematic implementation of S and Gs. Such kind of methodology would also be beneficial for strengthening the regulatory framework and practices for countries new in the nuclear arena and with small scale nuclear program. The objective of paper is to review the

  17. Agmatine inhibits nuclear factor-κB nuclear translocation in acute spinal cord compression injury rat model

    Directory of Open Access Journals (Sweden)

    Doaa M. Samy

    2016-09-01

    Full Text Available Secondary damage after acute spinal cord compression injury (SCCI exacerbates initial insult. Nuclear factor kappa-B (NF-κB-p65 activation is involved in SCCI deleterious effects. Agmatine (Agm showed neuroprotection against various CNS injuries. However, Agm impact on NF-κB signaling in acute SCCI remains to be investigated. The present study compared the effectiveness of Agm therapy and decompression laminectomy (DL in functional recovery, oxidative stress, inflammatory and apoptotic responses, and modulation of NF-κB activation in acute SCCI rat model. Rats were either sham-operated or subjected to SCCI at T8–9, using 2-Fr. catheter. SCCI rats were randomly treated with DL at T8–9, intraperitoneal Agm (100 mg/kg/day, combined (DL/Agm treatment or saline (n = 16/group. After 28-days of neurological follow-up, spinal cords were either subjected to biochemical measurement of oxidative stress and inflammatory markers or histopathology and immuno-histochemistry for NF-κB-p65 and caspase-3 expression (n = 8/group. Agm was comparable to DL in facilitating neurological functions recovery, reducing inflammation (TNF-α/interleukin-6, and apoptosis. Agm was distinctive in combating oxidative stress. Agm neuroprotective effects were paralleled with inhibition of NF-κB-p65 nuclear translocation. Combined pharmacological and surgical interventions were proved superior in functional recovery. In conclusion, present research suggested a new mechanism for Agm neuroprotection in rats SCCI through inhibition of NF-κB activation.

  18. Basic factors to forecast maintenance cost and failure processes for nuclear power plants

    International Nuclear Information System (INIS)

    Popova, Elmira; Yu, Wei; Kee, Ernie; Sun, Alice; Richards, Drew; Grantom, Rick

    2006-01-01

    Two types of maintenance interventions are usually administered at nuclear power plants: planned and corrective. The cost incurred includes the labor (manpower) cost, cost for new parts, or emergency order of expensive items. At the plant management level there is a budgeted amount of money to be spent every year for such operations. It is very important to have a good forecast for this cost since unexpected events can trigger it to a very high level. In this research we present a statistical factor model to forecast the maintenance cost for the incoming month. One of the factors is the expected number of unplanned (due to failure) maintenance interventions. We introduce a Bayesian model for the failure rate of the equipment, which is input to the cost forecasting model. The importance of equipment reliability and prediction in the commercial nuclear power plant is presented along with applicable governmental and industry organization requirements. A detailed statistical analysis is performed on a set of maintenance cost and failure data gathered at the South Texas Project Nuclear Operating Company (STPNOC) in Bay City, Texas, USA

  19. Cellular and molecular mechanisms of chronic rhinosinusitis and potential therapeutic strategies: review on cytokines, nuclear factor kappa B and transforming growth factor beta.

    Science.gov (United States)

    Phan, N T; Cabot, P J; Wallwork, B D; Cervin, A U; Panizza, B J

    2015-07-01

    Chronic rhinosinusitis is characterised by persistent inflammation of the sinonasal mucosa. Multiple pathophysiological mechanisms are likely to exist. Previous research has focused predominantly on T-helper type cytokines to highlight the inflammatory mechanisms. However, proteins such as nuclear factor kappa B and transforming growth factor beta are increasingly recognised to have important roles in sinonasal inflammation and tissue remodelling. This review article explores the roles of T-helper type cytokines, nuclear factor kappa B and transforming growth factor beta in the pathophysiological mechanisms of chronic rhinosinusitis. An understanding of these mechanisms will allow for better identification and classification of chronic rhinosinusitis endotypes, and, ultimately, improved therapeutic strategies.

  20. Zyxin regulates migration of renal epithelial cells through activation of hepatocyte nuclear factor-1β.

    Science.gov (United States)

    Choi, Yun-Hee; McNally, Brian T; Igarashi, Peter

    2013-07-01

    Hepatocyte nuclear factor-1β (HNF-1β) is an epithelial tissue-specific transcription factor that regulates gene expression in the kidney, liver, pancreas, intestine, and other organs. Mutations of HNF-1β in humans produce renal cysts and congenital kidney anomalies. Here, we identify the LIM-domain protein zyxin as a novel binding partner of HNF-1β in renal epithelial cells. Zyxin shuttles to the nucleus where it colocalizes with HNF-1β. Immunoprecipitation of zyxin in leptomycin B-treated cells results in coprecipitation of HNF-1β. The protein interaction requires the second LIM domain of zyxin and two distinct domains of HNF-1β. Overexpression of zyxin stimulates the transcriptional activity of HNF-1β, whereas small interfering RNA silencing of zyxin inhibits HNF-1β-dependent transcription. Epidermal growth factor (EGF) induces translocation of zyxin into the nucleus and stimulates HNF-1β-dependent promoter activity. The EGF-mediated nuclear translocation of zyxin requires activation of Akt. Expression of dominant-negative mutant HNF-1β, knockdown of zyxin, or inhibition of Akt inhibits EGF-stimulated cell migration. These findings reveal a novel pathway by which extracellular signals are transmitted to the nucleus to regulate the activity of a transcription factor that is essential for renal epithelial differentiation.

  1. Incorporating organizational factors into probabilistic safety assessment of nuclear power plants through canonical probabilistic models

    Energy Technology Data Exchange (ETDEWEB)

    Galan, S.F. [Dpto. de Inteligencia Artificial, E.T.S.I. Informatica (UNED), Juan del Rosal, 16, 28040 Madrid (Spain)]. E-mail: seve@dia.uned.es; Mosleh, A. [2100A Marie Mount Hall, Materials and Nuclear Engineering Department, University of Maryland, College Park, MD 20742 (United States)]. E-mail: mosleh@umd.edu; Izquierdo, J.M. [Area de Modelado y Simulacion, Consejo de Seguridad Nuclear, Justo Dorado, 11, 28040 Madrid (Spain)]. E-mail: jmir@csn.es

    2007-08-15

    The {omega}-factor approach is a method that explicitly incorporates organizational factors into Probabilistic safety assessment of nuclear power plants. Bayesian networks (BNs) are the underlying formalism used in this approach. They have a structural part formed by a graph whose nodes represent organizational variables, and a parametric part that consists of conditional probabilities, each of them quantifying organizational influences between one variable and its parents in the graph. The aim of this paper is twofold. First, we discuss some important limitations of current procedures in the {omega}-factor approach for either assessing conditional probabilities from experts or estimating them from data. We illustrate the discussion with an example that uses data from Licensee Events Reports of nuclear power plants for the estimation task. Second, we introduce significant improvements in the way BNs for the {omega}-factor approach can be constructed, so that parameter acquisition becomes easier and more intuitive. The improvements are based on the use of noisy-OR gates as model of multicausal interaction between each BN node and its parents.

  2. Incorporating organizational factors into probabilistic safety assessment of nuclear power plants through canonical probabilistic models

    International Nuclear Information System (INIS)

    Galan, S.F.; Mosleh, A.; Izquierdo, J.M.

    2007-01-01

    The ω-factor approach is a method that explicitly incorporates organizational factors into Probabilistic safety assessment of nuclear power plants. Bayesian networks (BNs) are the underlying formalism used in this approach. They have a structural part formed by a graph whose nodes represent organizational variables, and a parametric part that consists of conditional probabilities, each of them quantifying organizational influences between one variable and its parents in the graph. The aim of this paper is twofold. First, we discuss some important limitations of current procedures in the ω-factor approach for either assessing conditional probabilities from experts or estimating them from data. We illustrate the discussion with an example that uses data from Licensee Events Reports of nuclear power plants for the estimation task. Second, we introduce significant improvements in the way BNs for the ω-factor approach can be constructed, so that parameter acquisition becomes easier and more intuitive. The improvements are based on the use of noisy-OR gates as model of multicausal interaction between each BN node and its parents

  3. Defining the Minimal Factors Required for Erythropoiesis through Direct Lineage Conversion

    Directory of Open Access Journals (Sweden)

    Sandra Capellera-Garcia

    2016-06-01

    Full Text Available Erythroid cell commitment and differentiation proceed through activation of a lineage-restricted transcriptional network orchestrated by a group of well characterized genes. However, the minimal set of factors necessary for instructing red blood cell (RBC development remains undefined. We employed a screen for transcription factors allowing direct lineage reprograming from fibroblasts to induced erythroid progenitors/precursors (iEPs. We show that Gata1, Tal1, Lmo2, and c-Myc (GTLM can rapidly convert murine and human fibroblasts directly to iEPs. The transcriptional signature of murine iEPs resembled mainly that of primitive erythroid progenitors in the yolk sac, whereas addition of Klf1 or Myb to the GTLM cocktail resulted in iEPs with a more adult-type globin expression pattern. Our results demonstrate that direct lineage conversion is a suitable platform for defining and studying the core factors inducing the different waves of erythroid development.

  4. Importance of nuclear station load factor in applied ro energy policies

    International Nuclear Information System (INIS)

    Gomes, Daniel de Souza

    2015-01-01

    Load factor is the ration between the energy produced by a station and the energy it would have produced running at maximum power. The factor intends for all types of commercial reactors. Nuclear plants continuously provide over 11% of the world's electricity. The reactors for which data were available generated 618.7 TWh of electricity in 2014. Typical load factor was around 75% in worldwide during the first quarter of 2015. In this manner, it obtained from an average, three-monthly or yearly. The regular load factor of the reactors in operation was around 56% in 1970. While, in 1980's decade, we have an increase to 63%, the same situation occurred in next the decade and suffering increasing to 73%. Currently, the load factor reaches 78%. Accidents are seasonal factors, with the occurrence of reduction of power generation plants. In 2015 in January, there are over 437 operable commercial reactors in 31 countries, with over 377,728 MWe of full capacity. In Brazil, total capacity is 1901 MWe, with around 2.8% of electricity energy consumed. The primary objective of this study was to find a forecast model that express the evolution of the load factor in the next years. In recent years occur an extensive development of pressurized water reactors in Asia. The periodicity of seasonal effects on the performance of nuclear power plants due to aging. However, the impact of plant age depended on new technologies that allow the growth of the performance. The accident of Fukushima was an inflection point for energy policies. The event produced a trend that reduced the load in the world. (author)

  5. Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

    OpenAIRE

    Walker, Aisha L.; Ofori-Acquah, Solomon

    2016-01-01

    The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

  6. Biosynthesis of heme in immature erythroid cells. The regulatory step for heme formation in the human erythron

    International Nuclear Information System (INIS)

    Gardner, L.C.; Cox, T.M.

    1988-01-01

    Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation

  7. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    OpenAIRE

    Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

    2015-01-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

  8. Main influence factors on the final energy generation cost of a nuclear power plant in comparison with other energy sources

    International Nuclear Information System (INIS)

    Souza, J.A.M. de; Glardon, C.; Schmidt, R.M.

    1981-01-01

    The main factors in the construction and in the operation of nuclear power plants that affect the final energy generation cost are presented. The structure of the energy generation cost, of the nuclear fuel cost and the total investment are studied. (E.G.) [pt

  9. Interaction of Sp1 zinc finger with transport factor in the nuclear localization of transcription factor Sp1

    International Nuclear Information System (INIS)

    Ito, Tatsuo; Kitamura, Haruka; Uwatoko, Chisana; Azumano, Makiko; Itoh, Kohji; Kuwahara, Jun

    2010-01-01

    Research highlights: → Sp1 zinc fingers themselves interact with importin α. → Sp1 zinc finger domains play an essential role as a nuclear localization signal. → Sp1 can be transported into the nucleus in an importin-dependent manner. -- Abstract: Transcription factor Sp1 is localized in the nucleus and regulates the expression of many cellular genes, but the nuclear transport mechanism of Sp1 is not well understood. In this study, we revealed that GST-fused Sp1 protein bound to endogenous importin α in HeLa cells via the Sp1 zinc finger domains, which comprise the DNA binding domain of Sp1. It was found that the Sp1 zinc finger domains directly interacted with a wide range of importin α including the armadillo (arm) repeat domain and the C-terminal acidic domain. Furthermore, it turned out that all three zinc fingers of Sp1 are essential for binding to importin α. Taken together, these results suggest that the Sp1 zinc finger domains play an essential role as a NLS and Sp1 can be transported into the nucleus in an importin-dependent manner even though it possesses no classical NLSs.

  10. Review of human factors R and D in the nuclear power industry

    International Nuclear Information System (INIS)

    Parris, H.L.

    1986-01-01

    The history of human factors (HF) R and D in the nuclear power industry can clearly be divided into two phases: pre- and post-Three Mile Island (TMI). Pre-TMI, most people in the industry were unfamiliar with the discipline and its contributions to military and space system designs, and the number of HF professionals involved with nuclear power could essentially be counted on the fingers of two hands. Consequently, there was little research into the improvement of plant man/machine interfaces. The picture changed dramatically in the aftermath of TMI as investigation after investigation pointed to deficiencies in the operator/control room interface, training, procedures, communications, and organizational effectiveness. This paper first outlines pre-TMI events, then examines the post-TMI scenario, and concludes with summary observations and suggestions for future efforts

  11. Nuclear Modification Factor RpA of b jets in pPb collisions

    CERN Document Server

    CMS Collaboration

    2014-01-01

    We present a measurement of the nuclear modification factor $R_{\\mathrm{pA}}^{\\mathrm{PYTHIA}}$ of b jets in proton-lead collisions from CMS. Jets from b-quark fragmentations are found by exploiting the long lifetime of the b-quark through tagging methods using distributions of the secondary vertex displacement. From these, b-jet cross-sections are calculated and compared to a pp cross-section obtained from a PYTHIA simulation. The $R_{\\mathrm{pA}}^{\\mathrm{PYTHIA}}$ is consistent with unity within systematic uncertainties and may show slight enhancement due to cold nuclear matter effects for a wide range in pseudorapidity. These effects are qualitatively consistent with the observed value for the inclusive jet $R_{\\mathrm{pA}}$. We use 35 nb$^{-1}$ of proton-lead data collected during the 2013 heavy-ion run at the LHC.

  12. The role of hepatocyte nuclear factor 4 alpha in development and progression of liver diseases

    Directory of Open Access Journals (Sweden)

    YANG Jinlian

    2016-02-01

    Full Text Available Hepatocyte nuclear factor 4 alpha (HNF4α, a member of the nuclear receptor superfamily, has a high expression level in mature hepatocytes. HNF4α can regulate hepatocyte-specific gene expression at a transcriptional level, promote hepatocyte development and differentiation, participate in establishment and maintenance of hepatocyte polarity, and enhance the synthetic, metabolic, and detoxifying functions of the liver. Through inhibiting the activation of hepatic stellate cells, reversing epithelial-mesenchymal transition, and inhibiting the proliferation, invasion, and metastasis of hepatoma cells, HNF4α may be involved in the development and progression of various liver diseases including liver fibrosis, liver cirrhosis, and hepatocellular carcinoma. This paper elaborates on the biological functions of HNF4α, and summarizes and analyzes the research advances in the mechanisms of action of HNF4α in the pathological process of liver diseases, in order to provide references for further investigation of the potential targeted therapies for liver diseases.

  13. Thyroid hormone and retinoic acid nuclear receptors: specific ligand-activated transcription factors

    International Nuclear Information System (INIS)

    Brtko, J.

    1998-01-01

    Transcriptional regulation by both the thyroid hormone and the vitamin A-derived 'retinoid hormones' is a critical component in controlling many aspects of higher vertebrate development and metabolism. Their functions are mediated by nuclear receptors, which comprise a large super-family of ligand-inducible transcription factors. Both the thyroid hormone and the retinoids are involved in a complex arrangement of physiological and development responses in many tissues of higher vertebrates. The functions of 3,5,3'-triiodothyronine (T 3 ), the thyromimetically active metabolite of thyroxine as well as all-trans retinoic acid, the biologically active vitamin A metabolite are mediated by nuclear receptor proteins that are members of the steroid/thyroid/retinoid hormone receptor family. The functions of all members of the receptor super family are discussed. (authors)

  14. Analysis of human factors in incidents reported by Swiss nuclear power plants to the inspectorate

    International Nuclear Information System (INIS)

    Alder, H.P.; Hausmann, W.

    1997-01-01

    197 reported incidents in Swiss Nuclear Power Plants were analyzed by a team of the Swiss Federal Nuclear Safety Inspectorate (HSK) using the OECD/NEA Incident Reporting System. The following conclusions could be drawn from this exercise. While the observed cause reported by the plant was ''technical failure'' in about 90% of the incidents, the HSK-Team identified for more than 60% of the incidents ''human factors'' as the root cause. When analyzing this root cause further it was shown that only a smaller contribution came from the side of the operators and the more important shares were caused by plant maintenance, vendors/constructors and plant management with procedural and organizational deficiencies. These findings demonstrate that root cause analysis of incidents by the IRS-Code is a most useful tool to analyze incidents and to find weak points in plant performance. (author). 5 tabs

  15. Organizational factors in design and implementation of technological and organizational solutions in the nuclear industry

    International Nuclear Information System (INIS)

    Macchi, L.; Reiman, T.; Savioja, P.; Kahlbom, U.; Rollenhagen, C.

    2012-02-01

    Design is often found as one of the contributing factors in accident in the nuclear industry. The design of new technological systems and organisational structures has to take into account and be driven by the future users' needs and has to consider how their role and work practices within the organisation will be affected. The SADE project explores to which extend the concepts of safety culture and resilience engineering can contribute to the prevention of design errors when no hindsight data are available. In 2011, the SADE project focused on gathering experience and clarifying the current issues and challenges related to the design process. During 2011 seventeen interviews have been conducted in Finland and Sweden to identify some of the major challenges the nuclear industry is currently facing. At the same time a literature review has been conducted to establish a sound common theoretical ground. This progress report presents some of the relevant theoretical findings and preliminary results from the interviews. (Author)

  16. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  17. FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia

    International Nuclear Information System (INIS)

    Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K

    2011-01-01

    The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6

  18. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.

    Science.gov (United States)

    Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A

    2010-10-28

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.

  19. Training and other conditioning factors in nuclear medicine in a developing country

    International Nuclear Information System (INIS)

    Touya, E.

    1986-01-01

    The aim of the paper is to discuss the validity of nuclear medicine in 1985, in a developing region, on the basis of certain knowledge of the area and with 20 years' experience of the problem in a small country belonging to that region. An attempt is made to identify the factors which have most significance and the action to take so as to arrive at proposals which would be useful in planning this special field. The effect of the difficult economic situation at the present time in the developing regions on health programmes and policies is discussed. The vital need for promoting and giving impetus to primary medical care is recognized and the obligation to provide secondary and tertiary medical care in the same manner in order to restore health standards is pointed out. It is understood that nuclear medicine may have an impact at the three levels of medical care, and that only those studies which strictly valorize the effectiveness and the cost/benefit and risk/benefit ratios should be encouraged. It is believed that criteria of centralization and critical mass should be met when organizing a nuclear medicine programme. The main items of multipurpose nuclear medicine equipment are determined and there is discussion of the problems involved in training for the nuclear physician, radiopharmacist, hospital physicist, electronics engineer, technician and nurse. Mention is made of the most critical aspects of equipment maintenance, availability of spares, supply of radioisotopes and radiopharmaceuticals, quality control and the individual effectiveness of each service. Reasons are given for the advantage of intervening mainly at the level on instruction and through continuous training courses so as to correct deviations and introduce new policies making for greater effectiveness in utilizing the limited economic resources available. (author)

  20. Human factor analysis and preventive countermeasures of maintenance in nuclear power plant

    International Nuclear Information System (INIS)

    Zhang Li; Hu Chao

    2008-01-01

    Based on the human error analysis theory and the characteristics of maintenance in a nuclear power plant, human factors of maintenance in NPP are divided into three different areas: human, technology, and organization, in which human refers to the individual factors, mainly including psychological quality, physiological characteristic, state of health, knowledge, skill level, and interpersonal relationship. Technology includes the maintenance technology, maintenance strategy, maintenance tool, maintenance interface, maintenance regulation, and work environment. Organization includes task arrangement, information communication, training, personnel external environment, team construction, and leadership. The analysis also reveals that the organization factors, which can indirectly influence personnel performance, are the primary initiators of human error. Based on these, some countermeasures are brought forward in order to reduce human errors. (authors)

  1. The human factor data management system of Daya Bay Nuclear Power Station

    International Nuclear Information System (INIS)

    Zhang Li; Zhang Ning; Guo Jianbing; Huang Weigang; Zhu Minhong; Wang Jin

    1999-12-01

    The collection, analysis and quantification of human factor data are very important parts of human reliability analysis and probabilistic risk assessment. Therefore various human databases have been created. But a human data management system with the functions of data collection, classification, analysis, computation and forecast is scarcely seen at home and abroad. So the authors have developed the human data management system of Daya Bay Nuclear Power Station. The system includes three modules and four databases. The authors firstly set forth some basic problems on the human factor data, which are concerned during the development of the system. Then the structure and function of the system are described. In view of the important role of human factor databases in the system, the authors also discuss the structure problems of the data in the databases in detail

  2. Potential human factors research relating to modern technology in nuclear power plants

    International Nuclear Information System (INIS)

    Ketchel, J.; Fink, R.; Hanes, L.; Williges, R.; Williges, B.

    1994-01-01

    This paper discusses proposed human factors research to address advanced human-machine interface technology in nuclear power plants. It relates to a current EPRI project to identify a prioritized list of specific research issues that could be assessed to improve control room and other user interface areas. The project seeks to bridge the gap between the functional requirements of advanced design initiatives and the human factors research needed to support them. It seeks to identify potential benefits to be expected, as well as potential problems that might be introduced by advanced technology. It provides an organized approach to identifying human factors research needs, information already available, and measures of performance and effectiveness that might be used to assess the value of potential improvements. Those parts of the proposed plan that are subsequently approved by EPRI management and by the utility advisory committee will provide a basis for recommending research priorities

  3. Human primary erythroid cells as a more sensitive alternative in vitro hematological model for nanotoxicity studies: Toxicological effects of silver nanoparticles.

    Science.gov (United States)

    Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan

    2015-12-01

    Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Human factors engineering measures taken by nuclear power plant owners/operators for optimisation of the man-machine interface

    International Nuclear Information System (INIS)

    Eisgruber, H.

    1996-01-01

    Both operating results and human factors studies show that man is able to meet the requirements in this working environment. Hence the degree of human reliability required by the design basis of nuclear power plants is ensured. This means: - Nuclear technology for electricity generation is justifiable from the human factors point of view. - The chief opponent is not right in saying that man is not able to cope with the risks and challenges brought about by nuclear technology applications. The human factors concept for optimisation or configuration of the man-machine systems represents an additional endeavor on the part of nuclear power plant operators within the framework of their responsibilities. Human factors analyses meet with good response by the personnel, as analysis results and clarification of causes of accident scenarios contribute to relieve the personnel (exoneration) and find ways for remedial action. (orig./DG) [de

  5. Nuclear

    International Nuclear Information System (INIS)

    2014-01-01

    This document proposes a presentation and discussion of the main notions, issues, principles, or characteristics related to nuclear energy: radioactivity (presence in the environment, explanation, measurement, periods and activities, low doses, applications), fuel cycle (front end, mining and ore concentration, refining and conversion, fuel fabrication, in the reactor, back end with reprocessing and recycling, transport), the future of the thorium-based fuel cycle (motivations, benefits and drawbacks), nuclear reactors (principles of fission reactors, reactor types, PWR reactors, BWR, heavy-water reactor, high temperature reactor of HTR, future reactors), nuclear wastes (classification, packaging and storage, legal aspects, vitrification, choice of a deep storage option, quantities and costs, foreign practices), radioactive releases of nuclear installations (main released radio-elements, radioactive releases by nuclear reactors and by La Hague plant, gaseous and liquid effluents, impact of releases, regulation), the OSPAR Convention, management and safety of nuclear activities (from control to quality insurance, to quality management and to sustainable development), national safety bodies (mission, means, organisation and activities of ASN, IRSN, HCTISN), international bodies, nuclear and medicine (applications of radioactivity, medical imagery, radiotherapy, doses in nuclear medicine, implementation, the accident in Epinal), nuclear and R and D (past R and D programmes and expenses, main actors in France and present funding, main R and D axis, international cooperation)

  6. A preliminary study on related factors of mental health in nuclear power plant operators

    International Nuclear Information System (INIS)

    Dai Tingting; Liu Yulong; Li Yuan; Liao Haihong; Qiu Mengyue; Bian Huahui; Chen Weibo; Liu Chunfeng

    2012-01-01

    Objective: To explore the status of nuclear power plant operators in mental health and its correlation with emotional stability, liveliness, anxiety and urgency. Methods: 255 male operators were randomly selected from three nuclear power bases, meanwhile 61 undergraduates were used as control group. The mental health and neurobehavioral evaluation system of Chinese nuclear power plant operators was developed by Second Affiliated Hospital of Soochow University, which was used to assess mental health of the subjects. The scores of mental health personality factors were recorded, together with four main personality factors including emotional stability, liveliness, anxiety and urgency. Results: The score of lie was lower than 8 which showed all inspected groups were normal. 1.57% (4/255) operators had psychological disorders, 3.92% (10/255) had poor mental health, 27.84% (71/255) had general mental health, 66.7% (170/255) had excellent mental health, whereas 9.84% (6/61) for control group had psychological disorders. Obvious difference was observed in the final scores between the nuclear power plant operators and control group. The former gained higher scores on mental health,emotional stability,and lower scores on anxiety and urgency (t=3.437, 4.423, -2.493, -2.093, P<0.05). Both groups aged over 27 years and with length of service over 5 years were awarded higher scores on mental health, emotional stability (t=2.585, 2.349; t=2.606, 2.947, P<0.05), lower scores on anxiety and urgency (t=-3.407, -2.138; t=- 2.941, -2.256, P<0.05). The mental health was positively correlated with emotional stability and liveliness (r=0.721, 0.650, P<0.05), but negatively correlated with anxiety and urgency (r=-0.809, -0.693, P<0.05). Conclusions: The majority of nuclear power plant operators had excellent psychological quality, but some factors should be paid more attention, such as different ages and length of service time. (authors)

  7. An Adenovirus DNA Replication Factor, but Not Incoming Genome Complexes, Targets PML Nuclear Bodies.

    Science.gov (United States)

    Komatsu, Tetsuro; Nagata, Kyosuke; Wodrich, Harald

    2016-02-01

    Promyelocytic leukemia protein nuclear bodies (PML-NBs) are subnuclear domains implicated in cellular antiviral responses. Despite the antiviral activity, several nuclear replicating DNA viruses use the domains as deposition sites for the incoming viral genomes and/or as sites for viral DNA replication, suggesting that PML-NBs are functionally relevant during early viral infection to establish productive replication. Although PML-NBs and their components have also been implicated in the adenoviral life cycle, it remains unclear whether incoming adenoviral genome complexes target PML-NBs. Here we show using immunofluorescence and live-cell imaging analyses that incoming adenovirus genome complexes neither localize at nor recruit components of PML-NBs during early phases of infection. We further show that the viral DNA binding protein (DBP), an early expressed viral gene and essential DNA replication factor, independently targets PML-NBs. We show that DBP oligomerization is required to selectively recruit the PML-NB components Sp100 and USP7. Depletion experiments suggest that the absence of one PML-NB component might not affect the recruitment of other components toward DBP oligomers. Thus, our findings suggest a model in which an adenoviral DNA replication factor, but not incoming viral genome complexes, targets and modulates PML-NBs to support a conducive state for viral DNA replication and argue against a generalized concept that PML-NBs target incoming viral genomes. The immediate fate upon nuclear delivery of genomes of incoming DNA viruses is largely unclear. Early reports suggested that incoming genomes of herpesviruses are targeted and repressed by PML-NBs immediately upon nuclear import. Genome localization and/or viral DNA replication has also been observed at PML-NBs for other DNA viruses. Thus, it was suggested that PML-NBs may immediately sense and target nuclear viral genomes and hence serve as sites for deposition of incoming viral genomes and

  8. A Human Factors Study on an Information Visualization System for Nuclear Power Plants Decommissioning Engineering

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Chih Wei; Yang, Li Chen [Institute of Nuclear Energy Research, Atomic Energy Council, Longtan (China)

    2014-08-15

    Most nuclear power plants (NPPs) in the world have an operating life of up to 40 years. The utility should prepare a comprehensive decommissioning plan with purpose to document and to display how decommissioning activities can be safely performed. In the past, most studies related to NPPs decommissioning planning put emphasis on technical issues, little attention have been given to human factors in decommissioning activities. In fact, human factors are a critical factor to successful NPPs decommissioning. NPPs decommissioning will face potential risks. These risks include not only dismantling and moving large equipment but also treating with the radioactive materials. Using information visualization system, such as virtual reality (VR) technology, for staff training can improve decommissioning work safety and economy. Therefore, this study presents a study using VR to solve real world problems in the nuclear plant decommissioning. Then appropriate cases for introducing VR systems are summarized and future prospects are given. This study assesses availability and performance of the work training system by using heuristic evaluation and actual experiment. In the result, block type of radiation visibility was found relatively better both in performance and person's preference than other types. The results presented in this paper illustrate the VR applications a NPP decommissioning perspective.

  9. Testing collinear factorization and nuclear parton distributions with pA collisions at the LHC

    Energy Technology Data Exchange (ETDEWEB)

    Quiroga-Arias, Paloma [Departamento de Fisica de PartIculas and IGFAE, Universidade de Santiago de Compostela 15706 Santiago de Compostela (Spain); Milhano, Jose Guilherme [CENTRA, Departamento de Fisica, Instituto Superior Tecnico (IST), Av. Rovisco Pais 1, P-1049-001 Lisboa (Portugal); Wiedemann, Urs Achim, E-mail: pquiroga@fpaxpl.usc.es [Physics Department, Theory Unit, CERN, CH-1211 Geneve 23 (Switzerland)

    2011-01-01

    Global perturbative QCD analyses, based on large data sets from electron-proton and hadron collider experiments, provide tight constraints on the parton distribution function (PDF) in the proton. The extension of these analyses to nuclear parton distributions (nPDF) has attracted much interest in recent years. nPDFs are needed as benchmarks for the characterization of hot QCD matter in nucleus-nucleus collisions, and attract further interest since they may show novel signatures of non- linear density-dependent QCD evolution. However, it is not known from first principles whether the factorization of long-range phenomena into process-independent parton distribution, which underlies global PDF extractions for the proton, extends to nuclear effects. As a consequence, assessing the reliability of nPDFs for benchmark calculations goes beyond testing the numerical accuracy of their extraction and requires phenomenological tests of the factorization assumption. Here we argue that a proton-nucleus collision program at the LHC would provide a set of measurements allowing for unprecedented tests of the factorization assumption underlying global nPDF fits.

  10. Receptor activator of nuclear factor kappa B ligand and osteoprotegerin levels in gingival crevicular fluid

    Science.gov (United States)

    Sarlati, Fatemeh; Sattari, Mandana; Razzaghi, Shilan; Nasiri, Malihe

    2012-01-01

    Background: Osteoclastogenesis is coordinated by the interaction of three members of the tumor necrosis factor (TNF) superfamily: Osteoprotegerin (OPG)/receptor activator of nuclear factor kappa B ligand (RANKL)/receptor activator of nuclear factor kappa B (RANK). The aim of this study was to investigate RANKL and OPG levels, and their relative ratio in gingival crevicular fluid (GCF) of patients with chronic and aggressive periodontitis, as well as healthy controls. Materials and Methods: In this analytical study, GCF was obtained from healthy (n = 10), mild chronic periodontitis (n = 18), moderate chronic periodontitis (n = 18), severe chronic periodontitis (n = 20), and generalized aggressive periodontitis (n = 20) subjects. RANKL and OPG concentrations were measured by enzyme-linked immunosorbent assay. Statistical tests used were Kruskal–Wallis test, Mann–Whitney U rank sum test, and Spearman's rank correlation analysis. The level of statistical significance was set at P chronic periodontitis (mild, moderate, severe), and aggressive periodontitis (P = 0.41). There was statistically significant correlation between the concentration of sRANKL and Clinical Attachment Level (CAL) in moderate chronic periodontitis patients (R = 0.48, P = 0.04). There was also negative correlation between OPG concentration and CAL in moderate chronic periodontitis patients, although not significant (R = −0.13). Conclusion: RANKL was prominent in periodontitis sites, especially in moderate periodontitis patients, whereas OPG was not detectable in some diseased sites with bleeding on probing, supporting the role of these two molecules in the bone loss developed in this disease. PMID:23559954

  11. Spent nuclear fuel project, Cold Vacuum Drying Facility human factors engineering (HFE) analysis: Results and findings

    International Nuclear Information System (INIS)

    Garvin, L.J.

    1998-01-01

    This report presents the background, methodology, and findings of a human factors engineering (HFE) analysis performed in May, 1998, of the Spent Nuclear Fuels (SNF) Project Cold Vacuum Drying Facility (CVDF), to support its Preliminary Safety Analysis Report (PSAR), in responding to the requirements of Department of Energy (DOE) Order 5480.23 (DOE 1992a) and drafted to DOE-STD-3009-94 format. This HFE analysis focused on general environment, physical and computer workstations, and handling devices involved in or directly supporting the technical operations of the facility. This report makes no attempt to interpret or evaluate the safety significance of the HFE analysis findings. The HFE findings presented in this report, along with the results of the CVDF PSAR Chapter 3, Hazards and Accident Analyses, provide the technical basis for preparing the CVDF PSAR Chapter 13, Human Factors Engineering, including interpretation and disposition of findings. The findings presented in this report allow the PSAR Chapter 13 to fully respond to HFE requirements established in DOE Order 5480.23. DOE 5480.23, Nuclear Safety Analysis Reports, Section 8b(3)(n) and Attachment 1, Section-M, require that HFE be analyzed in the PSAR for the adequacy of the current design and planned construction for internal and external communications, operational aids, instrumentation and controls, environmental factors such as heat, light, and noise and that an assessment of human performance under abnormal and emergency conditions be performed (DOE 1992a)

  12. A Human Factors Study on an Information Visualization System for Nuclear Power Plants Decommissioning Engineering

    International Nuclear Information System (INIS)

    Yang, Chih Wei; Yang, Li Chen

    2014-01-01

    Most nuclear power plants (NPPs) in the world have an operating life of up to 40 years. The utility should prepare a comprehensive decommissioning plan with purpose to document and to display how decommissioning activities can be safely performed. In the past, most studies related to NPPs decommissioning planning put emphasis on technical issues, little attention have been given to human factors in decommissioning activities. In fact, human factors are a critical factor to successful NPPs decommissioning. NPPs decommissioning will face potential risks. These risks include not only dismantling and moving large equipment but also treating with the radioactive materials. Using information visualization system, such as virtual reality (VR) technology, for staff training can improve decommissioning work safety and economy. Therefore, this study presents a study using VR to solve real world problems in the nuclear plant decommissioning. Then appropriate cases for introducing VR systems are summarized and future prospects are given. This study assesses availability and performance of the work training system by using heuristic evaluation and actual experiment. In the result, block type of radiation visibility was found relatively better both in performance and person's preference than other types. The results presented in this paper illustrate the VR applications a NPP decommissioning perspective

  13. Calmodulin-dependent nuclear import of HMG-box family nuclear factors: importance of the role of SRY in sex reversal.

    Science.gov (United States)

    Kaur, Gurpreet; Delluc-Clavieres, Aurelie; Poon, Ivan K H; Forwood, Jade K; Glover, Dominic J; Jans, David A

    2010-08-15

    The HMG (high-mobility group)-box-containing chromatin-remodelling factor SRY (sex-determining region on the Y chromosome) plays a key role in sex determination. Its role in the nucleus is critically dependent on two NLSs (nuclear localization signals) that flank its HMG domain: the C-terminally located 'beta-NLS' that mediates nuclear transport through Impbeta1 (importin beta1) and the N-terminally located 'CaM-NLS' which is known to recognize the calcium-binding protein CaM (calmodulin). In the present study, we examined a number of missense mutations in the SRY CaM-NLS from human XY sex-reversed females for the first time, showing that they result in significantly reduced nuclear localization of GFP (green fluorescent protein)-SRY fusion proteins in transfected cells compared with wild-type. The CaM antagonist CDZ (calmidazolium chloride) was found to significantly reduce wild-type SRY nuclear accumulation, indicating dependence of SRY nuclear import on CaM. Intriguingly, the CaM-NLS mutants were all resistant to CDZ's effects, implying a loss of interaction with CaM, which was confirmed by direct binding experiments. CaM-binding/resultant nuclear accumulation was the only property of SRY found to be impaired by two of the CaM-NLS mutations, implying that inhibition of CaM-dependent nuclear import is the basis of sex reversal in these cases. Importantly, the CaM-NLS is conserved in other HMG-box-domain-containing proteins such as SOX-2, -9, -10 and HMGN1, all of which were found for the first time to rely on CaM for optimal nuclear localization. CaM-dependent nuclear translocation is thus a common mechanism for this family of important transcription factors.

  14. Platelet-derived growth factor induces phosphorylation of a 64-kDa nuclear protein

    International Nuclear Information System (INIS)

    Shawver, L.K.; Pierce, G.F.; Kawahara, R.S.; Deuel, T.F.

    1989-01-01

    The platelet-derived growth factor (PDGF) stimulated the phosphorylation of a nuclear protein of 64 kDa (pp64) in nuclei of nontransformed normal rat kidney (NRK) cells. Low levels of phosphorylation of pp64 were observed in nuclei of serum-starved NRK cells. Fetal calf serum (FCS), PDGF, and homodimeric v-sis and PDGF A-chain protein enhanced the incorporation of 32P into pp64 over 4-fold within 30 min and over 8-fold within 2 h of exposure of NRK cells to the growth factors. In contrast, constitutive phosphorylation of 32P-labeled pp64 in nuclei of NRK cells transformed by the simian sarcoma virus (SSV) was high and only minimally stimulated by PDGF and FCS. 32P-Labeled pp64 was isolated from nuclei of PDGF-stimulated nontransformed NRK cells; the 32P of pp64 was labile in 1 M KOH, and pp64 was not significantly recognized by anti-phosphotyrosine antisera, suggesting that the PDGF-induced phosphorylation of pp64 occurred on serine or on threonine residues. However, pp64 from SSV-transformed NRK cell nuclei was significantly stable to base hydrolysis and was immunoprecipitated with anti-phosphotyrosine antisera, suggesting that pp64 from SSV-transformed cell nuclei is phosphorylated also on tyrosine. FCS, PDGF, and PDGF A- and B-chain homodimers thus stimulate the rapid time-dependent phosphorylation of a 64-kDa nuclear protein shortly after stimulation of responsive cells. The growth factor-stimulated phosphorylation of pp64 and the constitutive high levels of pp64 phosphorylation in cells transformed by SSV suggest important roles for pp64 and perhaps regulated nuclear protein kinases and phosphatases in cell division and proliferation

  15. Modification of the ASME code z-factor for circumferential surface crack in nuclear ferritic pipings

    International Nuclear Information System (INIS)

    Choi, Young Hwan; Chung, Yon Ki; Koh, Wan Young; Lee, Joung Bae

    1996-01-01

    The purpose of this paper is to modify the ASME Code Z-Factor, which is used in the evaluation of circumferential surface crack in nuclear ferritic pipings. The ASME Code Z-Factor is a load multiplier to compensate plastic load with elasto-plastic load. The current ASME Code Z-Factor underestimates pipe maximum load. In this study, the original SC. TNP method is modified first because the original SC. TNP method has a problem that the maximum allowable load predicted from the original SC. TNP method is slightly higher than that measured from the experiment. Then the new Z-Factor is developed using the modified SC. TNP method. The desirability of both the modified SC. TNP method and the new Z-Factor is examined using the experimental results for the circumferential surface crack in pipings. The results show that (1) the modified SC. TNP method is good for predicting the circumferential surface crack behavior in pipings, and (2) the Z-Factor obtained from the modified SC. TNP method well predicts the behavior of circumferential surface crack in ferritic pipings. 30 refs., 13 figs., 4 tabs. (author)

  16. Factor analysis for imperfect maintenance planning at nuclear power plants by cognitive task analysis

    International Nuclear Information System (INIS)

    Takagawa, Kenichi; Iida, Hiroyasu

    2011-01-01

    Imperfect maintenance planning was frequently identified in domestic nuclear power plants. To prevent such an event, we analyzed causal factors in maintenance planning stages and showed the directionality of countermeasures in this study. There is a pragmatic limit in finding the causal factors from the items based on report descriptions. Therefore, the idea of the systemic accident model, which is used to monitor the performance variability in normal circumstances, is taken as a new concept instead of investigating negative factors. As an actual method for analyzing usual activities, cognitive task analysis (CTA) was applied. Persons who experienced various maintenance activities at one electric power company were interviewed about sources related to decision making during maintenance planning, and then usual factors affecting planning were extracted as performance variability factors. The tendency of domestic events was analyzed using the classification item of those factors, and the directionality of countermeasures was shown. The following are critical for preventing imperfect maintenance planning: the persons in charge should fully understand the situation of the equipment for which they are responsible in the work planning and maintenance evaluation stages, and they should definitely understand, for example, the maintenance bases of that equipment. (author)

  17. Experimental realization of Shor's quantum factoring algorithm using nuclear magnetic resonance.

    Science.gov (United States)

    Vandersypen, L M; Steffen, M; Breyta, G; Yannoni, C S; Sherwood, M H; Chuang, I L

    The number of steps any classical computer requires in order to find the prime factors of an l-digit integer N increases exponentially with l, at least using algorithms known at present. Factoring large integers is therefore conjectured to be intractable classically, an observation underlying the security of widely used cryptographic codes. Quantum computers, however, could factor integers in only polynomial time, using Shor's quantum factoring algorithm. Although important for the study of quantum computers, experimental demonstration of this algorithm has proved elusive. Here we report an implementation of the simplest instance of Shor's algorithm: factorization of N = 15 (whose prime factors are 3 and 5). We use seven spin-1/2 nuclei in a molecule as quantum bits, which can be manipulated with room temperature liquid-state nuclear magnetic resonance techniques. This method of using nuclei to store quantum information is in principle scalable to systems containing many quantum bits, but such scalability is not implied by the present work. The significance of our work lies in the demonstration of experimental and theoretical techniques for precise control and modelling of complex quantum computers. In particular, we present a simple, parameter-free but predictive model of decoherence effects in our system.

  18. Radiation factors and smoking interaction at lung cancer incidence for workers at a nuclear enterprise

    International Nuclear Information System (INIS)

    Tokarskaya, Z.B.; Khokhryakov, V.F.; Okladnikova, N.D.; Belyaeva, Z.D.; Zhuntova, G.V.

    1997-01-01

    It was shown on the basis of retrospective investigation of 500 workers at a nuclear enterprise (162 cases of lung cancer, 338 persons as matching control) that the interaction of external gamma-irradiation (> 2.0 Gy) and the body - burden of 239 Pu (> 9.3 kBq) at lung cancer is characterized as the multiplicative effect. Combined influence of smoking and radiation factors dependent on smoking index (SI): it changed from additive up to multiplicative and than to antagonistic with the increase of the smoking effect. The received results could be explained on the basis of a two - mutation model of radiation carcinogenesis

  19. Analysis of chemical factors affecting marine ecosystem around nuclear power plant

    International Nuclear Information System (INIS)

    Chun, Kwan Sik; Choi, Yoon Dong; Chun, Ki Jeong; Kim, Jin Kyu; Jung, Kyeong Chai; Lee, Yeong Keun; Park, Hyo Kook

    1994-06-01

    The ecological data of the coastal area of Youngkwang nuclear power plant from 1987 to 1993 were comprehensively analyzed, and various physical and chemical properties of sea water and sediments were measured. Major factors affecting phytoplankton standing crops were suspended substances, nitrate, and silicate. The contents of iron, chromium, copper, and sulfur in sediments sampled from the discharge channel were slightly higher than those in the other areas. In order to qantify the chemical impacts on marine ecosystem, it is desirable that a systematic survey be made through the whole year cycle to assure the consistency and confidence of the related data. (Author)

  20. Factors influencing the design and assessment of elastomer seals for nuclear fuel transport flasks

    International Nuclear Information System (INIS)

    Chivers, T.C.; George, A.F.

    1984-06-01

    Elastomeric seals offer considerable advantages in the achievement of high integrity sealing. This report discusses the factors limiting the performance of elastomers under fault conditions, with particular attention to Nuclear Fuel Transport Flask seals. There is emphasis on seal compression and its optimisation, so that it is high enough to ensure adequate surface roughness infilling, and low enough to avoid damaging tensile stresses. The assessment of seal performance is discussed, and includes consideration of pressure actuation and extrusion, permeation losses and rig testing. It is concluded that to reach a satisfactory design requires considerable information on different aspects of elastomeric performance. (author)

  1. Adjustement of Dancoff factor for calculating the cell of fluidized bed nuclear reactor

    International Nuclear Information System (INIS)

    Borges, V.; Sefidvash, F.

    1988-01-01

    A new nuclear reactor design based on the fluidized bed concept is under reserch and development. It utilized spherical fuel of slightly enriched zircaloy-clad uranium dioxide fluidized by light water under pressure since the Leopard code has been developed for light water reactor analysis, it was necessary to develop a method to determine the dimensions of the hypothetical fuel rod lattice, which are neutronically equivalent to the spherical fuel pellet lattice. This method is shown to calculate the Dancoff factor correctly. (author) [pt

  2. Applying Human Factors Evaluation and Design Guidance to a Nuclear Power Plant Digital Control System

    Energy Technology Data Exchange (ETDEWEB)

    Thomas Ulrich; Ronald Boring; William Phoenix; Emily Dehority; Tim Whiting; Jonathan Morrell; Rhett Backstrom

    2012-08-01

    The United States (U.S.) nuclear industry, like similar process control industries, has moved toward upgrading its control rooms. The upgraded control rooms typically feature digital control system (DCS) displays embedded in the panels. These displays gather information from the system and represent that information on a single display surface. In this manner, the DCS combines many previously separate analog indicators and controls into a single digital display, whereby the operators can toggle between multiple windows to monitor and control different aspects of the plant. The design of the DCS depends on the function of the system it monitors, but revolves around presenting the information most germane to an operator at any point in time. DCSs require a carefully designed human system interface. This report centers on redesigning existing DCS displays for an example chemical volume control system (CVCS) at a U.S. nuclear power plant. The crucial nature of the CVCS, which controls coolant levels and boration in the primary system, requires a thorough human factors evaluation of its supporting DCS. The initial digital controls being developed for the DCSs tend to directly mimic the former analog controls. There are, however, unique operator interactions with a digital vs. analog interface, and the differences have not always been carefully factored in the translation of an analog interface to a replacement DCS. To ensure safety, efficiency, and usability of the emerging DCSs, a human factors usability evaluation was conducted on a CVCS DCS currently being used and refined at an existing U.S. nuclear power plant. Subject matter experts from process control engineering, software development, and human factors evaluated the DCS displays to document potential usability issues and propose design recommendations. The evaluation yielded 167 potential usability issues with the DCS. These issues should not be considered operator performance problems but rather opportunities

  3. Nuclear critical opalescence and the M1 form factors of 12C and 13C

    International Nuclear Information System (INIS)

    Delorme, J.; Figureau, A.; Guichon, P.

    1981-01-01

    It is shown that core polarization by the nuclear pion field has opposite effects on the M1 form factors of 12 C(15.11 MeV) and 13 C(g.s.). New data on 13 C are found to agree with this prediction and a common interpretation of the experiments is shown to be possible for the two nuclei in terms of critical opalescence. Discrimination from alternative explanations of the observed anomalies should await further experiments, especially photopion reactions. (orig.)

  4. Alternative nuclear fuel cycle arrangements for proliferation resistance: an overview of regulatory factors

    International Nuclear Information System (INIS)

    O'Brien, J.N.

    1982-08-01

    President Carter proposed the International Fuel Cycle Evaluation to analyze various alternative fuel cycles which could minimize the risk of nuclear weapons proliferation. DOE also initiated the Non-Proliferation Alternative Systems Assessment Program. In response to GAO contentions that NRC was not sufficiently involved in these two assessments, a NRC study was initiated, with emphasis on legal and institutional factors. Objectives were to examine multinational fuel cycle facilities, potential effects on the US/IAEA agreement, development of an algorithm for ranking potential fuel cycles, and potential licensing of candidate fuel cycles. This anthology represents the products of this study which has been conducted between 1979 and 1981

  5. Human factors survey of advanced instrumentation and controls technologies in nuclear plants

    International Nuclear Information System (INIS)

    Carter, R.J.

    1992-01-01

    A survey of advanced instrumentation and controls (I ampersand C) technologies and associated human factors issues in the US and Canadian nuclear industries was carried out by a team from Oak Ridge national laboratory to provide background for the development of regulatory policy, criteria, and guides for review of advanced I ampersand C systems as well as human engineering guidelines for evaluating these systems. The survey found those components of the US nuclear industry surveyed to be quite interested in advanced I ampersand C, but very cautious in implementing such systems in nuclear facilities and power plants. The trend in the facilities surveyed is to experiment cautiously when there is an intuitive advantage or short-term payoff. In the control room, the usual practice is direct substitution of digital and microprocessor-based instruments or systems that are functionally identical to the analog instruments or systems being replaced. The most advanced I ampersand C systems were found in the Canadian CANDU plants, where the newest plant has digital system in almost 100% of its control systems and in over 70% of its plant protection system. The hypothesis that properly 'introducing digital systems increases safety' is supported by the Canadian experience. The performance of these digital systems was achieved using an appropriate quality assurance program for the software development. The ability of digital systems to detect impending failures and initiate a fail-safe action, is a significant safety issue that should be of special interest to every US utility as well as to the US Nuclear Regulatory Commission. (orig.)

  6. CD151, a novel host factor of nuclear export signaling in influenza virus infection.

    Science.gov (United States)

    Qiao, Yongkang; Yan, Yan; Tan, Kai Sen; Tan, Sheryl S L; Seet, Ju Ee; Arumugam, Thiruma Valavan; Chow, Vincent T K; Wang, De Yun; Tran, Thai

    2018-05-01

    Despite advances in our understanding of the mechanisms of influenza A virus (IAV) infection, the crucial virus-host interactions during the viral replication cycle still remain incomplete. Tetraspanin CD151 is highly expressed in the human respiratory tract, but its pathological role in IAV infection is unknown. We sought to characterize the functional role and mechanisms of action of CD151 in IAV infection of the upper and lower respiratory tracts with H1N1 and H3N2 strains. We used CD151-null mice in an in vivo model of IAV infection and clinical donor samples of in vitro-differentiated human nasal epithelial cells cultured at air-liquid interface. As compared with wild-type infected mice, CD151-null infected mice exhibited a significant reduction in virus titer and improvement in survival that is associated with pronounced host antiviral response and inflammasome activation together with accelerated lung repair. Interestingly, we show that CD151 complexes newly synthesized viral proteins with host nuclear export proteins and stabilizes microtubule complexes, which are key processes necessary for the polarized trafficking of viral progeny to the host plasma membrane for assembly. Our results provide new mechanistic insights into our understanding of IAV infection. We show that CD151 is a critical novel host factor of nuclear export signaling whereby the IAV nuclear export uses it to complement its own nuclear export proteins (a site not targeted by current therapy), making this regulation unique, and holds promise for the development of novel alternative/complementary strategies to reduce IAV severity. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  7. Psychological and social factors influencing the choice of strategy after a nuclear accident

    International Nuclear Information System (INIS)

    Heriard-Dubreuil, G.F.

    1995-01-01

    The analysis of the post-accident situation in Chernobyl provides information that focuses on social and psychological factors in the management of nuclear accidents. This paper concentrates on the short term countermeasures. It presents the main conclusions of a field survey carried out in Ukraine. The issues talked are the concern about extend of post-response in Chernobyl, the worries over health, contamination, the concern over the future and the complexity of post-accident situation. In a second part, the paper analyses and models the factors that caused the 1993 post-accident situation. Finally, several advices are given concerning the public information and behaviour focusing on the social and psychological aspect of short-term decisions (a constant effort should always be, for example, limiting the element of surprise in order to reduce the stress of population). (TEC). 3 figs

  8. The human factor in the design and operation of french light water nuclear power plants

    International Nuclear Information System (INIS)

    Gomolinski, M.

    1986-10-01

    The accident which occurred at Three Mile Island (TMI 2) on March 28, 1979 is considered rightfully as the outset of the approach taking the human factor explicitly into account in nuclear safety, both in the design of the plants and in their operational use. In this paper, we shall endeavour to explain how this human factor has been taken into account in France. For this purpose, in the first part, we shall define the requirements, i.e. describe the sectors in which improvements were deemed necessary. In the second part, we shall describe the structures set up both at EDF and at the CEA to handle these problems. Lastly, in the third part, we shall describe the principal actions taken or in progress [fr

  9. A Study on Human Factors in Maintenance of a Nuclear Power Plant (NPP)

    International Nuclear Information System (INIS)

    Park, Young Ho; Seong, Poong Hyun

    2006-01-01

    In human factors research, more attention has been devoted to the operation of a nuclear power plant (NPP) than to their maintenance. However, more NPP incidents are caused by inadequate maintenance rather than by faulty operation. There is a trend in NPP toward introducing digital technology into safety and non-safety systems. This lead to changes of maintenance, and support systems such as diagnosis system, augmentation system and handy terminal will be developed. In this context, it is important to identify tasks of human related to each phase of maintenance and their relation in order to apply those to maintenance. However, there are few researches of human factors in maintenance. This paper studies on framework of cognitive task analysis for developing maintenance support systems

  10. Lessons Learned from Human Factor Technical Support for Nuclear Power Plants

    International Nuclear Information System (INIS)

    Jung, Yeon Sub; Song, Tae Young

    2011-01-01

    NETEC is on the frontier to support Korean nuclear power plants. Requests of service are distributed through web based system. Human factor requests are occasionally posted. This paper analyzes interesting human factors requests/responses serviced, and summarizes the lesson learned. Subjects of the service include man machine interface, equipment label, procedure writing, procedure adherence, BISI, hand switch and alarm tile. Specifically the man machine interface is related to control command generated by acknowledge button, arrangement of switches. Procedure writing is about how to write contingency actions with proper numbering scheme. BISI is analyzed in view of automation level. Alarm tile is about how to handle the common alarm tile originated from local alarm boards. These topics seem to be legacies of past technology. Even though there are still human engineering discrepancies, these have been less evaluated because the topics need knowledge of other field domains

  11. Estimation of the self-attenuation correction factor for gamma rays emission from nuclear materials

    International Nuclear Information System (INIS)

    Badawy, A.; El-Gammal, W.A.

    2001-01-01

    This work presents an investigation of the self-attenuation of gamma-rays emission from nuclear materials (NMs) for measuring the U-235 enrichment, U-235 mass content and isotopic composition of NMs by non-destructive assay technique [NDA]. The measurements then would not need the use of suitable NM Standards which may not be available in many situations. The self-attenuation correction factor (F) may be estimated by the use of the linear attenuation factor of the assayed sample, the geometrical configuration of the assay set-up and the position of the assayed sample relative to the detector. A developed mathematical analysis makes use of specific parameters which affect the estimation of the self-attenuation of the source-detector system which emits passive gamma-rays at certain prominent signatures

  12. Organizational/institutional factors affecting performance in the nuclear power industry

    International Nuclear Information System (INIS)

    Benson, J.L.

    1992-01-01

    The dramatic macro experiences occurring at Three Mile Island and Chernobyl as well as the cumulative micro experiences represented by sky-rocketing costs and public concerns have demonstrated how the institutionally and organizationally related aspects of the nuclear power industry have dominated and shaped the technical ones. Further, given the relatively stable or evolutionary nature of the technology as it is currently applied, these institutional and organizational factors contain the roots of most of the complications/problems associated with the industry relative to achieving any or all of its future performance objectives (technical, economic, and safety). Some technology transfer was attempted by the author from the field of general systems/cybernetics, which was explicitly aimed at dealing with the organizational/institutional factors, i.e., the problems and issues were approached using principles and methodology substantially different from that typically seen from applications based on the more traditional paradigmic engineering/industrial management orientation

  13. System dynamics modeling of social/political factors in nuclear power plant operations

    International Nuclear Information System (INIS)

    Hansen, K.F.; Turek, M.G.; Eubanks, C.K.

    1995-01-01

    The safety and performance of nuclear power plants are a function of many technical factors such as initial design, service and maintenance programs, and utility investment in improvements. Safety and performance are also a function of the social/political influences that affect requirements on personnel, practices and procedures, and resource availability. This paper describes a process for constructing models of the social/political influences on plant operations using the system dynamics technique. The model incorporates representation of internal utility actions and decisions as affected by external factors such as public opinion, intervenor actions, safety and economic regulation, and the financial community. The feedback between external agents and plant performance is explicitly modeled. The resulting model can be used to simulate performance under a variety of different external and internal policy choices. In particular, the model can be used to study means of improving performance in response to externally imposed regulations

  14. Evaluation of response factors for seismic probabilistic safety assessment of nuclear power plants

    International Nuclear Information System (INIS)

    Ebisawa, K.; Abe, K.; Muramatsu, K.; Itoh, M.; Kohno, K.; Tanaka, T.

    1994-01-01

    This paper presents a method for evaluating 'response factors' of components in nuclear power plants for use in a seismic probabilistic safety assessment (PSA). The response factor here is a measure of conservatism included in response calculations in seismic design analysis of components and is defined as a ratio of conservative design resonse to actual response. This method has the following characteristic features: (1) The components are classified into several groups based on the differences in their location and in the vibration models used in design response analyses; (2) the response factors are decomposed into subfactors corresponding to the stages of the seismic response analyses in the design practices; (3) the response factors for components are calculated as products of subfactors; (4) the subfactors are expressed either as a single value or as a function of parameters that influence the response of components. This paper describes the outline of this method and results from an application to a sample problem in which response factors were quantified for examples of components selected from the groups. (orig.)

  15. Human factors analysis and design methods for nuclear waste retrieval systems. Human factors design methodology and integration plan

    Energy Technology Data Exchange (ETDEWEB)

    Casey, S.M.

    1980-06-01

    The purpose of this document is to provide an overview of the recommended activities and methods to be employed by a team of human factors engineers during the development of a nuclear waste retrieval system. This system, as it is presently conceptualized, is intended to be used for the removal of storage canisters (each canister containing a spent fuel rod assembly) located in an underground salt bed depository. This document, and the others in this series, have been developed for the purpose of implementing human factors engineering principles during the design and construction of the retrieval system facilities and equipment. The methodology presented has been structured around a basic systems development effort involving preliminary development, equipment development, personnel subsystem development, and operational test and evaluation. Within each of these phases, the recommended activities of the human engineering team have been stated, along with descriptions of the human factors engineering design techniques applicable to the specific design issues. Explicit examples of how the techniques might be used in the analysis of human tasks and equipment required in the removal of spent fuel canisters have been provided. Only those techniques having possible relevance to the design of the waste retrieval system have been reviewed. This document is intended to provide the framework for integrating human engineering with the rest of the system development effort. The activities and methodologies reviewed in this document have been discussed in the general order in which they will occur, although the time frame (the total duration of the development program in years and months) in which they should be performed has not been discussed.

  16. Human factors analysis and design methods for nuclear waste retrieval systems. Human factors design methodology and integration plan

    International Nuclear Information System (INIS)

    Casey, S.M.

    1980-06-01

    The purpose of this document is to provide an overview of the recommended activities and methods to be employed by a team of human factors engineers during the development of a nuclear waste retrieval system. This system, as it is presently conceptualized, is intended to be used for the removal of storage canisters (each canister containing a spent fuel rod assembly) located in an underground salt bed depository. This document, and the others in this series, have been developed for the purpose of implementing human factors engineering principles during the design and construction of the retrieval system facilities and equipment. The methodology presented has been structured around a basic systems development effort involving preliminary development, equipment development, personnel subsystem development, and operational test and evaluation. Within each of these phases, the recommended activities of the human engineering team have been stated, along with descriptions of the human factors engineering design techniques applicable to the specific design issues. Explicit examples of how the techniques might be used in the analysis of human tasks and equipment required in the removal of spent fuel canisters have been provided. Only those techniques having possible relevance to the design of the waste retrieval system have been reviewed. This document is intended to provide the framework for integrating human engineering with the rest of the system development effort. The activities and methodologies reviewed in this document have been discussed in the general order in which they will occur, although the time frame (the total duration of the development program in years and months) in which they should be performed has not been discussed

  17. Human factors analysis and design methods for nuclear waste retrieval systems. Volume II. A compendium of human factors design data

    International Nuclear Information System (INIS)

    Casey, S.M.

    1980-04-01

    This document is a compilation of human factors engineering design recommendations and data, selected and organized to assist in the design of a nuclear waste retrieval system. Design guidelines from a variety of sources have been evaluated, edited, and expanded for inclusion in this document, and, where appropriate, portions of text from selected sources have been included in their entirety. A number of human factors engineering guidelines for equipment designers have been written over the past three decades, each tailored to the needs of the specific system being designed. In the case of this particular document, a review of the preliminary human operator functions involved in each phase of the retrieval process was performed, resulting in the identification of areas of design emphasis upon which this document should be based. Documents containing information and design data on each of these areas were acquired, and data and design guidelines related to the previously identified areas of emphasis were extracted and reorganized. For each system function, actions were first assigned to operator and/or machine, and the operator functions were then described. Separate lists of operator functions were developed for each of the areas of retrieval activities - survey and mapping, remining, floor flange emplacement, plug and canister overcoring, plug and canister removal and transport, and CWSRS activity. These functions and the associated man-machine interface were grouped into categories based on task similarity, and the principal topics of human factors design emphasis were extracted. These topic areas are reflected in the contents of the 12 sections of this document

  18. No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.

    Science.gov (United States)

    Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte

    2017-07-20

    Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Nuclear translocation of phospholipase C-zeta, an egg-activating factor, during early embryonic development

    International Nuclear Information System (INIS)

    Sone, Yoshie; Ito, Masahiko; Shirakawa, Hideki; Shikano, Tomohide; Takeuchi, Hiroyuki; Kinoshita, Katsuyuki; Miyazaki, Shunichi

    2005-01-01

    Phospholipase C-zeta (PLCζ), a strong candidate of the egg-activating sperm factor, causes intracellular Ca 2+ oscillations and egg activation, and is subsequently accumulated into the pronucleus (PN), when expressed in mouse eggs by injection of RNA encoding PLCζ. Changes in the localization of expressed PLCζ were investigated by tagging with a fluorescent protein. PLCζ began to translocate into the PN formed at 5-6 h after RNA injection and increased there. Observation in the same embryo revealed that PLCζ in the PN dispersed to the cytoplasm upon nuclear envelope breakdown and translocated again into the nucleus after cleavage. The dynamics was found in the second mitosis as well. When RNA was injected into fertilization-originated 1-cell embryos or blastomere(s) of 2-8-cell embryos, the nuclear localization of expressed PLCζ was recognized in every embryo up to blastocyst. Thus, PLCζ exhibited alternative cytoplasm/nucleus localization during development. This supports the view that the sperm factor could control cell cycle-dependent generation of Ca 2+ oscillations in early embryogenesis

  20. Respiratory syncytial virus M2-1 protein induces the activation of nuclear factor kappa B

    Energy Technology Data Exchange (ETDEWEB)

    Reimers, Kerstin [Klinik fuer Plastische, Hand-und Wiederherstellungschirurgie, Podbielskistrasse 380, D-30659 Hannover (Germany); Buchholz, Katja [Institut fuer Medizinische Mikrobiologie, Otto-von-Guericke-Universitaet Magdeburg, Leipzigerstrasse 44, D-39120 Magdeburg (Germany); Werchau, Hermann [Institut fuer Medizinische Mikrobiologie, Otto-von-Guericke-Universitaet Magdeburg, Leipzigerstrasse 44, D-39120 Magdeburg (Germany)

    2005-01-20

    Respiratory syncytial virus (RSV) induces the production of a number of cytokines and chemokines by activation of nuclear factor kappa B (NF-{kappa}B). The activation of NF-{kappa}B has been shown to depend on viral replication in the infected cells. In this study, we demonstrate that expression of RSV M2-1 protein, a transcriptional processivity and anti-termination factor, is sufficient to activate NF-{kappa}B in A549 cells. Electromobility shift assays show increased NF-{kappa}B complexes in the nuclei of M2-1-expressing cells. M2-1 protein is found in nuclei of M2-1-expressing cells and in RSV-infected cells. Co-immunoprecipitations of nuclear extracts of M2-1-expressing cells and of RSV-infected cells revealed an association of M2-1 with Rel A protein. Furthermore, the activation of NF-{kappa}B depends on the C-terminus of the RSV M2-1 protein, as shown by NF-{kappa}B-induced gene expression of a reporter gene construct.

  1. Fanconi anemia FANCD2 and FANCI proteins regulate the nuclear dynamics of splicing factors.

    Science.gov (United States)

    Moriel-Carretero, María; Ovejero, Sara; Gérus-Durand, Marie; Vryzas, Dimos; Constantinou, Angelos

    2017-12-04

    Proteins disabled in the cancer-prone disorder Fanconi anemia (FA) ensure the maintenance of chromosomal stability during DNA replication. FA proteins regulate replication dynamics, coordinate replication-coupled repair of interstrand DNA cross-links, and mitigate conflicts between replication and transcription. Here we show that FANCI and FANCD2 associate with splicing factor 3B1 (SF3B1), a key spliceosomal protein of the U2 small nuclear ribonucleoprotein (U2 snRNP). FANCI is in close proximity to SF3B1 in the nucleoplasm of interphase and mitotic cells. Furthermore, we find that DNA replication stress induces the release of SF3B1 from nuclear speckles in a manner that depends on FANCI and on the activity of the checkpoint kinase ATR. In chromatin, both FANCD2 and FANCI associate with SF3B1, prevent accumulation of postcatalytic intron lariats, and contribute to the timely eviction of splicing factors. We propose that FANCD2 and FANCI contribute to the organization of functional domains in chromatin, ensuring the coordination of DNA replication and cotranscriptional processes. © 2017 Moriel-Carretero et al.

  2. Model calculating annual mean atmospheric dispersion factor for coastal site of nuclear power plant

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    This paper describes an atmospheric dispersion field experiment performed on the coastal site of nuclear power plant in the east part of China during 1995 to 1996. The three-dimension joint frequency are obtained by hourly observation of wind and temperature on a 100m high tower; the frequency of the “event day of land and sea breezes” are given by observation of surface wind and land and sea breezes; the diffusion parameters are got from measurements of turbulent and wind tunnel simulation test.A new model calculating the annual mean atmospheric dispersion factor for coastal site of nuclear power plant is developed and established.This model considers not only the effect from mixing release and mixed layer but also the effect from the internal boundary layer and variation of diffusion parameters due to the distance from coast.The comparison between results obtained by the new model and current model shows that the ratio of annual mean atmospheric dispersion factor gained by the new model and the current one is about 2.0.

  3. Statistical analysis on the fluence factor of surveillance test data of Korean nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Gyeong Geun; Kim, Min Chul; Yoon, Ji Hyun; Lee, Bong Sang; Lim, Sang Yeob; Kwon, Jun Hyun [Nuclear Materials Safety Research Division, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2017-06-15

    The transition temperature shift (TTS) of the reactor pressure vessel materials is an important factor that determines the lifetime of a nuclear power plant. The prediction of the TTS at the end of a plant’s lifespan is calculated based on the equation of Regulatory Guide 1.99 revision 2 (RG1.99/2) from the US. The fluence factor in the equation was expressed as a power function, and the exponent value was determined by the early surveillance data in the US. Recently, an advanced approach to estimate the TTS was proposed in various countries for nuclear power plants, and Korea is considering the development of a new TTS model. In this study, the TTS trend of the Korean surveillance test results was analyzed using a nonlinear regression model and a mixed-effect model based on the power function. The nonlinear regression model yielded a similar exponent as the power function in the fluence compared with RG1.99/2. The mixed-effect model had a higher value of the exponent and showed superior goodness of fit compared with the nonlinear regression model. Compared with RG1.99/2 and RG1.99/3, the mixed-effect model provided a more accurate prediction of the TTS.

  4. Critical human-factors issues in nuclear-power regulation and a recommended comprehensive human-factors long-range plan. Critical discussion of human factors areas of concern

    International Nuclear Information System (INIS)

    Hopkins, C.O.; Snyder, H.L.; Price, H.E.; Hornick, R.J.; Mackie, R.R.; Smillie, R.J.; Sugarman, R.C.

    1982-08-01

    This comprehensive long-range human factors plan for nuclear reactor regulation was developed by a Study Group of the Human Factors Society, Inc. This Study Group was selected by the Executive Council of the Society to provide a balanced, experienced human factors perspective to the applications of human factors scientific and engineering knowledge to nuclear power generation. The report is presented in three volumes. Volume 1 contains an Executive Summary of the 18-month effort and its conclusions. Volume 2 summarizes all known nuclear-related human factors activities, evaluates these activities wherever adequate information is available, and describes the recommended long-range (10-year) plan for human factors in regulation. Volume 3 elaborates upon each of the human factors issues and areas of recommended human factors involvement contained in the plan, and discusses the logic that led to the recommendations

  5. Effects of Nuclear Factor-E2-related factor 2/Heme Oxygenase 1 on splanchnic hemodynamics in experimental cirrhosis with portal hypertension.

    Science.gov (United States)

    Qin, Jun; He, Yue; Duan, Ming; Luo, Meng

    2017-05-01

    We explored the effects of Nuclear Factor-E2-related factor 2 (Nrf2) and Heme Oxygenase 1 (HO-1) on splanchnic hemodynamics in portal hypertensive rats. Experimental cirrhosis with portal hypertension was induced by intraperitoneal injection of carbon tetrachloride. The expression of proteins was examined by immunoblotting. Hemodynamic studies were performed by radioactive microspheres. The vascular perfusion system was used to measure the contractile response of mesentery arterioles in rats. Nrf2 expression in the nucleus and HO-1 expression in cytoplasm was significantly enhanced in portal hypertensive rats. Portal pressure, as well as regional blood flow, increased significantly in portal hypertension and can be blocked by tin protoporphyrin IX. The expression of endogenous nitric oxide synthase and vascular endothelial growth factors increased significantly compared to normal rats, while HO-1 inhibition decreased the expression of these proteins significantly. The contractile response of mesenteric arteries decreased in portal hypertension, but can be partially recovered through tin protoporphyrin IX treatment. The expression of Nrf2/HO-1 increased in mesenteric arteries of portal hypertensive rats, which was related to oxidative stress. HO-1was involved in increased portal pressure and anomaly splanchnic hemodynamics in portal hypertensive rats. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Synergistic nuclear import of NeuroD1 and its partner transcription factor, E47, via heterodimerization

    International Nuclear Information System (INIS)

    Mehmood, Rashid; Yasuhara, Noriko; Oe, Souichi; Nagai, Masahiro; Yoneda, Yoshihiro

    2009-01-01

    The transition from undifferentiated pluripotent cells to terminally differentiated neurons is coordinated by a repertoire of transcription factors. NeuroD1 is a type II basic helix loop helix (bHLH) transcription factor that plays critical roles in neuronal differentiation and maintenance in the central nervous system. Its dimerization with E47, a type I bHLH transcription factor, leads to the transcriptional regulation of target genes. Mounting evidence suggests that regulating the localization of transcription factors contributes to the regulation of their activity during development as defects in their localization underlie a variety of developmental disorders. In this study, we attempted to understand the nuclear import mannerisms of NeuroD1 and E47. We found that the nuclear import of NeuroD1 and E47 is energy-dependent and involves the Ran-mediated pathway. Herein, we demonstrate that NeuroD1 and E47 can dimerize inside the cytoplasm before their nuclear import. Moreover, this dimerization promotes nuclear import as the nuclear accumulation of NeuroD1 was enhanced in the presence of E47 in an in vitro nuclear import assay, and NLS-deficient NeuroD1 was successfully imported into the nucleus upon E47 overexpression. NeuroD1 also had a similar effect on the nuclear accumulation of NLS-deficient E47. These findings suggest a novel role for dimerization that may promote, at least partially, the nuclear import of transcription factors allowing them to function efficiently in the nucleus.

  7. Estimation of radon progeny equilibrium factors and their uncertainty bounds using solid state nuclear track detectors

    International Nuclear Information System (INIS)

    Eappen, K.P.; Mayya, Y.S.; Patnaik, R.L.; Kushwaha, H.S.

    2006-01-01

    For the assessment of inhalation doses due to radon and its progeny to uranium mine workers, it is necessary to have information on the time integrated gas concentrations and equilibrium factors. Passive single cup dosimeters using solid state nuclear track detectors (SSNTD) are best suited for this purpose. These generally contain two SSNTDs, one placed inside the cup to measure only the radon gas concentration and other outside the cup for recording tracks due to both radon gas and the progeny species. However, since one obtains only two numbers by this method whereas information on four quantities is required for an unambiguous estimation of dose, there is a need for developing an optimal methodology for extracting information on the equilibrium factors. Several techniques proposed earlier have essentially been based on deterministic approaches, which do not fully take into account all the possible uncertainties in the environmental parameters. Keeping this in view, a simple 'mean of bounds' methodology is proposed to extract equilibrium factors based on their absolute bounds and the associated uncertainties as obtained from general arguments of radon progeny disequilibrium. This may be considered as reasonable estimates of the equilibrium factors in the absence of a knowledge of fluctuation in the environmental variables. The results are compared with those from direct measurements both in the laboratory and in real field situations. In view of the good agreement found between these, it is proposed that the simple mean of bounds estimate may be useful for practical applications in inhalation dosimetry of mine workers

  8. Measurement and evaluation of human factor training in nuclear power plants

    International Nuclear Information System (INIS)

    Hamasaki, Kenichi

    2006-01-01

    The purpose of this study is to measure and evaluate the effectiveness of human factor training aimed at awareness and behavioral changes, conducted by electric power company for the nuclear power plant staff. As the first step, the researcher investigated recent trends in training measurement and evaluation methods in the United States. It was found that many instances of training measurement/evaluation had been reported, and that the ROI model was the mainstream method for such measurement and evaluation. However, there had been no instances reported in which the effectiveness of human factor training for plant staff had been measured. The researcher therefore developed a new questionnaire-type of effectiveness measurement/evaluation method, based on the framework of the ROI model. Two-years of research was then conducted, in which the effectiveness of a human factor training program was measured using the newly developed method. This research revealed that participants' overall satisfaction and knowledge/skill acquisition levels were high. The percentage of participants who demonstrated awareness/behavioral change after returning to the workplace increased from 50% at first measurement to 81% at second measurement. It can therefore be concluded that the effectiveness of the second training is greater than that of the first training. Use of the new effectiveness measurement/evaluation method will enable quantification of human factor training effectiveness and help improve training quality. (author)

  9. Analyzing and sense making of human factors in the Malaysian radiation and nuclear emergency planning framework

    Science.gov (United States)

    Hamid, A. H. A.; Rozan, M. Z. A.; Deris, S.; Ibrahim, R.; Abdullah, W. S. W.; Rahman, A. A.; Yunus, M. N. M.

    2016-01-01

    The evolution of current Radiation and Nuclear Emergency Planning Framework (RANEPF) simulator emphasizes on the human factors to be analyzed and interpreted according to the stakeholder's tacit and explicit knowledge. These human factor criteria are analyzed and interpreted according to the "sense making theory" and Disaster Emergency Response Management Information System (DERMIS) design premises. These criteria are corroborated by the statistical criteria. In recent findings, there were no differences of distributions among the stakeholders according to gender and organizational expertise. These criteria are incrementally accepted and agreed the research elements indicated in the respective emergency planning frameworks and simulator (i.e. 78.18 to 84.32, p-value <0.05). This paper suggested these human factors criteria in the associated analyses and theoretical perspectives to be further acomodated in the future simulator development. This development is in conjunction with the proposed hypothesis building of the process factors and responses diagram. We proposed that future work which implies the additional functionality of the simulator, as strategized, condensed and concise, comprehensive public disaster preparedness and intervention guidelines, to be a useful and efficient computer simulation.

  10. Analyzing and sense making of human factors in the Malaysian radiation and nuclear emergency planning framework

    International Nuclear Information System (INIS)

    Hamid, A. H. A.; Rozan, M. Z. A.; Ibrahim, R.; Deris, S.; Abdullah, W. S. W.; Yunus, M. N. M.; Rahman, A. A.

    2016-01-01

    The evolution of current Radiation and Nuclear Emergency Planning Framework (RANEPF) simulator emphasizes on the human factors to be analyzed and interpreted according to the stakeholder’s tacit and explicit knowledge. These human factor criteria are analyzed and interpreted according to the “sense making theory” and Disaster Emergency Response Management Information System (DERMIS) design premises. These criteria are corroborated by the statistical criteria. In recent findings, there were no differences of distributions among the stakeholders according to gender and organizational expertise. These criteria are incrementally accepted and agreed the research elements indicated in the respective emergency planning frameworks and simulator (i.e. 78.18 to 84.32, p-value <0.05). This paper suggested these human factors criteria in the associated analyses and theoretical perspectives to be further acomodated in the future simulator development. This development is in conjunction with the proposed hypothesis building of the process factors and responses diagram. We proposed that future work which implies the additional functionality of the simulator, as strategized, condensed and concise, comprehensive public disaster preparedness and intervention guidelines, to be a useful and efficient computer simulation

  11. Analyzing and sense making of human factors in the Malaysian radiation and nuclear emergency planning framework

    Energy Technology Data Exchange (ETDEWEB)

    Hamid, A. H. A., E-mail: amyhamijah@gmail.com, E-mail: amyhamijah@nm.gov.my [Faculty of Computing, Universiti Teknologi Malaysia (UTM), Skudai, 81310 Johor Bahru, Johor (Malaysia); Universiti Malaysia Kelantan (UMK), Pengkalan Chepa, 16100 Kota Bharu, Kelantan (Malaysia); Rozan, M. Z. A., E-mail: drmohdzaidi@gmail.com; Ibrahim, R. [Faculty of Computing, Universiti Teknologi Malaysia (UTM), Skudai, 81310 Johor Bahru, Johor (Malaysia); Deris, S. [Universiti Malaysia Kelantan (UMK), Pengkalan Chepa, 16100 Kota Bharu, Kelantan (Malaysia); Abdullah, W. S. W.; Yunus, M. N. M. [Malaysian Nuclear Agency (NM), Bangi, 43000 Kajang, Selangor (Malaysia); Rahman, A. A. [Faculty of Medicine and Health Sciences, Universiti Putra Malaysia (UPM), 43400 Serdang, Selangor (Malaysia)

    2016-01-22

    The evolution of current Radiation and Nuclear Emergency Planning Framework (RANEPF) simulator emphasizes on the human factors to be analyzed and interpreted according to the stakeholder’s tacit and explicit knowledge. These human factor criteria are analyzed and interpreted according to the “sense making theory” and Disaster Emergency Response Management Information System (DERMIS) design premises. These criteria are corroborated by the statistical criteria. In recent findings, there were no differences of distributions among the stakeholders according to gender and organizational expertise. These criteria are incrementally accepted and agreed the research elements indicated in the respective emergency planning frameworks and simulator (i.e. 78.18 to 84.32, p-value <0.05). This paper suggested these human factors criteria in the associated analyses and theoretical perspectives to be further acomodated in the future simulator development. This development is in conjunction with the proposed hypothesis building of the process factors and responses diagram. We proposed that future work which implies the additional functionality of the simulator, as strategized, condensed and concise, comprehensive public disaster preparedness and intervention guidelines, to be a useful and efficient computer simulation.

  12. Noneconomic factors influencing scrap metal disposition decisions at DOE and NRC-licensed nuclear facilities

    Energy Technology Data Exchange (ETDEWEB)

    Ewen, M.D.; Robinson, L.A.

    1997-02-01

    The U.S. Environmental Protection Agency (EPA) is currently developing radiation protection standards for scrap metal, which will establish criteria for the unconditional clearance of scrap from nuclear facilities. In support of this effort, Industrial Economics, Incorporated is assessing the costs and benefits attributable to the rulemaking. The first step in this analysis is to develop an in-depth understanding of the factors influencing scrap disposition decisions, so that one can predict current and future practices under existing requirements and compare them to the potential effects of EPA`s rulemaking. These baseline practices are difficult to predict due to a variety of factors. First, because decommissioning activities are just beginning at many sites, current practices do not necessarily provide an accurate indicator of how these practices may evolve as site managers gain experience with related decisions. Second, a number of different regulations and policies apply to these decisions, and the interactive effects of these requirements can be difficult to predict. Third, factors other than regulatory constraints and costs may have a significant effect on related decisions, such as concerns about public perceptions. In general, research suggests that these factors tend to discourage the unconditional clearance of scrap metal.

  13. Molecular genetics and phenotypic characteristics of MODY caused by hepatocyte nuclear factor 4alpha mutations in a large European collection.

    NARCIS (Netherlands)

    Pearson, E.R.; Pruhova, S.; Tack, C.J.J.; Johansen, A.; Castleden, H.A.; Lumb, P.J.; Wierzbicki, A.S.; Clark, P.M.; Lebl, J.; Pedersen, O.; Ellard, S.; Hansen, T.; Hattersley, A.T.

    2005-01-01

    AIMS/HYPOTHESIS: Heterozygous mutations in the gene of the transcription factor hepatocyte nuclear factor 4alpha (HNF-4alpha) are considered a rare cause of MODY with only 14 mutations reported to date. The description of the phenotype is limited to single families. We investigated the genetics and

  14. Development of new Z-factors for the evaluation of the circumferential surface crack in nuclear pipes

    International Nuclear Information System (INIS)

    Choi, Y.H.; Chung, Y.K.; Park, Y.W.; Lee, J.B.

    1997-01-01

    The purpose of this study is to develop new Z-factors to evaluate the behavior of a circumferential surface crack in nuclear pipe. Z-factor is a load multiplier used in the Z-factor method, which is one of the ASME Code Sec. XI's recommendations for the estimation of a surface crack in nuclear pipe. It has been reported that the load carrying capacities predicted from the current ASME Code Z-factors, are not well in agreement with the experimental results for nuclear pipes with a surface crack. In this study, new Z-factors for ferritic base metal, ferritic submerged arc welding (SAW) weld metal, austenitic base metal, and austenitic SAW weld metal are obtained by use of the surface crack for thin pipe (SC.TNP) method based on GE/EPRI method. The desirability of both the SC.TNP method and the new Z-factors is examined using the results from 48 pipe fracture experiments for nuclear pipes with a circumferential surface crack. The results show that the SC.TNP method is good for describing the circumferential surface crack behavior and the new Z-factors are well in agreement with the measured Z-factors for both ferritic and austenitic pipes. (orig.)

  15. Heat and nuclear radiation as risk factors for male infertility: results of a French case-control study

    International Nuclear Information System (INIS)

    Thonneau, P.F.; Rachou, E.; Ducot, B.; Multigner, L.; Velez de la Calle, J.P.; Le Martelot, M.T.

    1998-01-01

    Very few studies have investigated the possible effects of environmental radiation and heat exposure on male reproductive function. We conducted a case control study to evaluate the various infertility risk factors in the military population of the french town of Brest to investigate an apparently high incidence of infertility in couples in which the man may have been exposed to occupational nuclear radiation. These findings suggest that in addition to well known medical factors, 'potential' exposure to heat or nuclear radiation could also be risk factors for infertility. (N.C.)

  16. A formal design verification and validation on the human factors of a computerized information system in nuclear power plants

    International Nuclear Information System (INIS)

    Lee, Yong Hee; Park, Jae Chang; Cheon, Se Woo; Jung, Kwang Tae; Baek, Seung Min; Han, Seung; Park, Hee Suk; Son, Ki Chang; Kim, Jung Man; Jung Yung Woo

    1999-11-01

    This report describe a technical transfer under the title of ''A formal design verification and validation on the human factors of a computerized information system in nuclear power plants''. Human factors requirements for the information system designs are extracted from various regulatory and industrial standards and guidelines, and interpreted into a more specific procedures and checklists for verifying the satisfaction of those requirements. A formalized implementation plan is established for human factors verification and validation of a computerized information system in nuclear power plants. Additionally, a Computer support system, named as DIMS-web (design Issue Management System), is developed based upon web internet environment so as to enhance the implementation of the human factors activities. DIMS-Web has three maine functions: supporting requirements review, tracking design issues, and management if issues screening evaluation. DIMS-Web shows its benefits in practice through a trial application to the design review of CFMS for YGN nuclear unit 5 and 6. (author)

  17. Hepatocyte nuclear factor 4 alpha is a key factor related to depression and physiological homeostasis in the mouse brain.

    Directory of Open Access Journals (Sweden)

    Kyosuke Yamanishi

    Full Text Available Major depressive disorder (MDD is a common psychiatric disorder that involves marked disabilities in global functioning, anorexia, and severe medical comorbidities. MDD is associated with not only psychological and sociocultural problems, but also pervasive physical dysfunctions such as metabolic, neurobiological and immunological abnormalities. Nevertheless, the mechanisms underlying the interactions between these factors have yet to be determined in detail. The aim of the present study was to identify the molecular mechanisms responsible for the interactions between MDD and dysregulation of physiological homeostasis, including immunological function as well as lipid metabolism, coagulation, and hormonal activity in the brain. We generated depression-like behavior in mice using chronic mild stress (CMS as a model of depression. We compared the gene expression profiles in the prefrontal cortex (PFC of CMS and control mice using microarrays. We subsequently categorized genes using two web-based bioinformatics applications: Ingenuity Pathway Analysis and The Database for Annotation, Visualization, and Integrated Discovery. We then confirmed significant group-differences by analyzing mRNA and protein expression levels not only in the PFC, but also in the thalamus and hippocampus. These web tools revealed that hepatocyte nuclear factor 4 alpha (Hnf4a may exert direct effects on various genes specifically associated with amine synthesis, such as genes involved in serotonin metabolism and related immunological functions. Moreover, these genes may influence lipid metabolism, coagulation, and hormonal activity. We also confirmed the significant effects of Hnf4a on both mRNA and protein expression levels in the brain. These results suggest that Hnf4a may have a critical influence on physiological homeostasis under depressive states, and may be associated with the mechanisms responsible for the interactions between MDD and the dysregulation of

  18. Diclofenac inhibits tumor necrosis factor-α-induced nuclear factor-κB activation causing synergistic hepatocyte apoptosis.

    Science.gov (United States)

    Fredriksson, Lisa; Herpers, Bram; Benedetti, Giulia; Matadin, Quraisha; Puigvert, Jordi C; de Bont, Hans; Dragovic, Sanja; Vermeulen, Nico P E; Commandeur, Jan N M; Danen, Erik; de Graauw, Marjo; van de Water, Bob

    2011-06-01

    Drug-induced liver injury (DILI) is an important clinical problem. It involves crosstalk between drug toxicity and the immune system, but the exact mechanism at the cellular hepatocyte level is not well understood. Here we studied the mechanism of crosstalk in hepatocyte apoptosis caused by diclofenac and the proinflammatory cytokine tumor necrosis factor α (TNF-α). HepG2 cells were treated with diclofenac followed by TNF-α challenge and subsequent evaluation of necrosis and apoptosis. Diclofenac caused a mild apoptosis of HepG2 cells, which was strongly potentiated by TNF-α. A focused apoptosis machinery short interference RNA (siRNA) library screen identified that this TNF-α-mediated enhancement involved activation of caspase-3 through a caspase-8/Bid/APAF1 pathway. Diclofenac itself induced sustained activation of c-Jun N-terminal kinase (JNK) and inhibition of JNK decreased both diclofenac and diclofenac/TNF-α-induced apoptosis. Live cell imaging of GFPp65/RelA showed that diclofenac dampened the TNF-α-mediated nuclear factor kappaB (NF-κB) translocation oscillation in association with reduced NF-κB transcriptional activity. This was associated with inhibition by diclofenac of the TNF-α-induced phosphorylation of the inhibitor of NF-κB alpha (IκBα). Finally, inhibition of IκB kinase β (IKKβ) with BMS-345541 as well as stable lentiviral short hairpin RNA (shRNA)-based knockdown of p65/RelA sensitized hepatocytes towards diclofenac/TNF-α-induced cytotoxicity. Together, our data suggest a model whereby diclofenac-mediated stress signaling suppresses TNF-α-induced survival signaling routes and sensitizes cells to apoptosis. Copyright © 2011 American Association for the Study of Liver Diseases.

  19. Improvements of the Regulatory Framework for Nuclear Installations in the Areas of Human and Organizational Factors and Safety Culture

    International Nuclear Information System (INIS)

    Tronea, M.; Ciurea, C.

    2016-01-01

    The paper presents the development of regulatory requirements in the area of human and organizational factors taking account of the lessons learned from major accidents in the nuclear industry and in particular of the factors that contributed to the Fukushima Daiichi accident and the improvement of the regulatory oversight of nuclear safety culture. New requirements have been elaborated by the National Commission for Nuclear Activities Control (CNCAN) on the nuclear safety policy of licencees for nuclear installations, on independent nuclear safety oversight, on safety conscious work environment and on the assessment of nuclear safety culture. The regulatory process for the oversight of nuclear safety culture within licencees’ organizations operating nuclear installations and the associated procedure and guidelines, based on the IAEA Safety Standards, have been developed in 2010-2011. CNCAN has used the 37 IAEA attributes for a strong safety culture, grouped into five areas corresponding to safety culture characteristics, as the basis for its regulatory guidelines providing support to the reviewers and inspectors, in their routine activities, for recognising and gathering information relevant to safety culture. The safety culture oversight process, procedure and guidelines are in process of being reviewed and revised to improve their effectiveness and to align with the current international practices, using lessons learned from the Fukushima Daiichi accident. Starting with July 2014, Romania has a National Strategy for Nuclear Safety and Security, which includes strategic objectives, associated directions for action and concrete actions for promoting nuclear safety culture in all the organizations in the nuclear sector. The progress with the implementation of this strategy with regard to nuclear safety culture is described in the paper. CNCAN started to define its own organizational culture model and identifying the elements that promote and support safety

  20. Estimation of physiological parameters using knowledge-based factor analysis of dynamic nuclear medicine image sequences

    International Nuclear Information System (INIS)

    Yap, J.T.; Chen, C.T.; Cooper, M.

    1995-01-01

    The authors have previously developed a knowledge-based method of factor analysis to analyze dynamic nuclear medicine image sequences. In this paper, the authors analyze dynamic PET cerebral glucose metabolism and neuroreceptor binding studies. These methods have shown the ability to reduce the dimensionality of the data, enhance the image quality of the sequence, and generate meaningful functional images and their corresponding physiological time functions. The new information produced by the factor analysis has now been used to improve the estimation of various physiological parameters. A principal component analysis (PCA) is first performed to identify statistically significant temporal variations and remove the uncorrelated variations (noise) due to Poisson counting statistics. The statistically significant principal components are then used to reconstruct a noise-reduced image sequence as well as provide an initial solution for the factor analysis. Prior knowledge such as the compartmental models or the requirement of positivity and simple structure can be used to constrain the analysis. These constraints are used to rotate the factors to the most physically and physiologically realistic solution. The final result is a small number of time functions (factors) representing the underlying physiological processes and their associated weighting images representing the spatial localization of these functions. Estimation of physiological parameters can then be performed using the noise-reduced image sequence generated from the statistically significant PCs and/or the final factor images and time functions. These results are compared to the parameter estimation using standard methods and the original raw image sequences. Graphical analysis was performed at the pixel level to generate comparable parametric images of the slope and intercept (influx constant and distribution volume)

  1. Identification of potential nuclear reprogramming and differentiation factors by a novel selection method for cloning chromatin-binding proteins

    International Nuclear Information System (INIS)

    Wang Liu; Zheng Aihua; Yi Ling; Xu Chongren; Ding Mingxiao; Deng Hongkui

    2004-01-01

    Nuclear reprogramming is critical for animal cloning and stem cell creation through nuclear transfer, which requires extensive remodeling of chromosomal architecture involving dramatic changes in chromatin-binding proteins. To understand the mechanism of nuclear reprogramming, it is critical to identify chromatin-binding factors specify the reprogramming process. In this report, we have developed a high-throughput selection method, based on T7 phage display and chromatin immunoprecipitation, to isolate chromatin-binding factors expressed in mouse embryonic stem cells using primary mouse embryonic fibroblast chromatin. Seven chromatin-binding proteins have been isolated by this method. We have also isolated several chromatin-binding proteins involved in hepatocyte differentiation. Our method provides a powerful tool to rapidly and selectively identify chromatin-binding proteins. The method can be used to study epigenetic modification of chromatin during nuclear reprogramming, cell differentiation, and transdifferentiation

  2. Assessment of job stress factors and organizational personality types for procedure-based jobs in nuclear power plants

    International Nuclear Information System (INIS)

    Kim, Dae-Ho; Lee, Yong-Hee; Lee, Jung-Woon

    2008-01-01

    The purpose of this study is to assess the organizational types and the job stress factors that affect procedure-based job performances in nuclear power plants. We derived 24 organizational factors affecting job stress level in nuclear power plants from the job stress analysis models developed by NIOSH, JDI, and IOR. Considering the safety characteristics in the operating tasks of nuclear power plants, we identified the job contents and characteristics through the analyses of job assignments that appeared in the organizational chart and the results of an activity-based costing. By using questionnaire surveys and structured interviews with the plant personnel and expert panels, we assessed 70 jobs among the 777 jobs managed officially in accordance with the procedures. They consist of the representative jobs of each department and are directly related to safety. We utilized the organizational personality type indicators to characterize the personality types of each organization in nuclear power plants. (author)

  3. Bioaccumulation factors and the steady state assumption for cesium isotopes in aquatic foodwebs near nuclear facilities.

    Science.gov (United States)

    Rowan, D J

    2013-07-01

    Steady state approaches, such as transfer coefficients or bioaccumulation factors, are commonly used to model the bioaccumulation of (137)Cs in aquatic foodwebs from routine operations and releases from nuclear generating stations and other nuclear facilities. Routine releases from nuclear generating stations and facilities, however, often consist of pulses as liquid waste is stored, analyzed to ensure regulatory compliance and then released. The effect of repeated pulse releases on the steady state assumption inherent in the bioaccumulation factor approach has not been evaluated. In this study, I examine the steady state assumption for aquatic biota by analyzing data for two cesium isotopes in the same biota, one isotope in steady state (stable (133)Cs) from geologic sources and the other released in pulses ((137)Cs) from reactor operations. I also compare (137)Cs bioaccumulation factors for similar upstream populations from the same system exposed solely to weapon test (137)Cs, and assumed to be in steady state. The steady state assumption appears to be valid for small organisms at lower trophic levels (zooplankton, rainbow smelt and 0+ yellow perch) but not for older and larger fish at higher trophic levels (walleye). Attempts to account for previous exposure and retention through a biokinetics approach had a similar effect on steady state, upstream and non-steady state, downstream populations of walleye, but were ineffective in explaining the more or less constant deviation between fish with steady state exposures and non-steady state exposures of about 2-fold for all age classes of walleye. These results suggest that for large, piscivorous fish, repeated exposure to short duration, pulse releases leads to much higher (137)Cs BAFs than expected from (133)Cs BAFs for the same fish or (137)Cs BAFs for similar populations in the same system not impacted by reactor releases. These results suggest that the steady state approach should be used with caution in any

  4. Over-expression of SR-cyclophilin, an interaction partner of nuclear pinin, releases SR family splicing factors from nuclear speckles

    International Nuclear Information System (INIS)

    Lin, C.-L.; Leu, Steve; Lu, M.-C.; Ouyang Pin

    2004-01-01

    Pre-mRNA splicing takes place within a dynamic ribonucleoprotein particle called the spliceosome and occurs in an ordered pathway. Although it is known that spliceosome consists of five small nuclear RNAs and at least 50 proteins, little is known about how the interaction among the proteins changes during splicing. Here we identify that SR-cyp, a Moca family of nuclear cyclophilin, interacts and colocalizes with nuclear pinin (pnn), a SR-related protein involving in pre-mRNA splicing. Nuclear pnn interacts with SR-cyp via its C-terminal RS domain. Upon SR-cyp over-expression, however, the subnuclear distribution of nuclear pnn is altered, resulting in its redistribution from nuclear speckles to a diffuse nucleoplasmic form. The diffuse subnuclear distribution of nuclear pnn is not due to epitope masking, accelerated protein turnover or post-translational modification. Furthermore, we find that SR-cyp regulates the subnuclear distribution of other SR family proteins, including SC35 and SRm300, in a similar manner as it does on nuclear pnn. This result is significant because it suggests that SR-cyp plays a general role in modulating the distribution pattern of SR-like and SR proteins, similar to that of Clk (cdc2-like kinase)/STY on SR family splicing factors. SR-cyp might direct its effect via either alteration of protein folding/conformation or of protein-protein interaction and thus may add another control level of regulation of SR family proteins and modification of their functions

  5. Interactions of trans-acting factor(s) with the estradiol response element and nuclear factor 1 of the vitellogenin II gene of Japanese quail.

    Science.gov (United States)

    Gupta, S; Upadhayay, R; Kanungo, M S

    1996-08-01

    This study was directed at achieving an understanding of the mechanisms by which steroid hormones control the synthesis of vitellogenin (VTG) protein in the liver of the Japanese quail. Northern hybridization shows that administration of estradiol alone or with progesterone stimulates the synthesis of VTG mRNA. Gel mobility shift assay of DNA fragments containing the ERE and NF 1 shows that estradiol alone or with progesterone increases the levels of nuclear proteins that bind to these cis-acting elements of the promoter of the VTG gene. The cooperative effect of the two hormones seen at the level of expression of the VTG gene may be due to protein-protein interactions of trans-acting factors that bind to ERE and NF 1.

  6. Knowledge Sharing Through Virtual Mode: The Influenced Factors for KM Development Among the Researchers in Nuclear Malaysia

    International Nuclear Information System (INIS)

    Adnan, H.; Sulaiman, M.S.; Yusof, M.H.; Ali, I.

    2014-01-01

    Conclusion: • The primary contribution of this study is to assess the influence of virtual mode as a KM medium in Nuclear Malaysia. • Direct relationship between the researchers and the used of virtual mode in the knowledge sharing process. • Finding reveals that virtual mode contributes significant factors in influencing researchers’ knowledge sharing behaviour. • The findings from the study may be used by the management of Nuclear Malaysia to improve or enhance the capacity of virtual mode provided by the organisation

  7. Greenhouse gas emission factor for coal power chain in China and the comparison with nuclear power chain

    International Nuclear Information System (INIS)

    Ma Zhonghai; Pan Ziqiang; He Huimin

    1999-01-01

    The Greenhouse Gas Emission for coal power chain in China is analyzed in detail and comprehensively by using the Life Cycle Analysis method. The Greenhouse Gas Emission Factors (GGEF) in each link and for the total power chain are calculated. The total GGEF for coal power chain is 1302.3 gCO 2 /kWh, about 40 times more than that for nuclear power chain. And consequently greenhouse effect could not be aggravated further by nuclear power. The energy strategy for nuclear power development is one of reality ways to retard the greenhouse effect, put resources into rational use and protect environment

  8. Organizational factors in design and implementation of technological and organizational solutions in the nuclear industry

    Energy Technology Data Exchange (ETDEWEB)

    Macchi, L.; Reiman, T.; Savioja, P. (VTT Technical Research Centre of Finland (Finland)); Kahlbom, U. (Risk Pilot AB, Stockholm (Sweden)); Rollenhagen, C. (Vattenfall (Sweden))

    2012-03-15

    Design is often found as one of the contributing factors in accident in the nuclear industry. The design of new technological systems and organisational structures has to take into account and be driven by the future users' needs and has to consider how their role and work practices within the organisation will be affected. The SADE project explores to which extend the concepts of safety culture and resilience engineering can contribute to the prevention of design errors when no hindsight data are available. In 2011, the SADE project focused on gathering experience and clarifying the current issues and challenges related to the design process. During 2011 seventeen interviews have been conducted in Finland and Sweden to identify some of the major challenges the nuclear industry is currently facing. At the same time a literature review has been conducted to establish a sound common theoretical ground. This progress report presents some of the relevant theoretical findings and preliminary results from the interviews. (Author)

  9. Primer on Durability of Nuclear Power Plant Reinforced Concrete Structures - A Review of Pertinent Factors

    Energy Technology Data Exchange (ETDEWEB)

    Naus, Dan J [ORNL

    2007-02-01

    The objective of this study was to provide a primer on the environmental effects that can affect the durability of nuclear power plant concrete structures. As concrete ages, changes in its properties will occur as a result of continuing microstructural changes (i.e., slow hydration, crystallization of amorphous constituents, and reactions between cement paste and aggregates), as well as environmental influences. These changes do not have to be detrimental to the point that concrete will not be able to meet its performance requirements. Concrete, however, can suffer undesirable changes with time because of improper specifications, a violation of specifications, or adverse performance of its cement paste matrix or aggregate constituents under either physical or chemical attack. Contained in this report is a discussion on concrete durability and the relationship between durability and performance, a review of the historical perspective related to concrete and longevity, a description of the basic materials that comprise reinforced concrete, and information on the environmental factors that can affect the performance of nuclear power plant concrete structures. Commentary is provided on the importance of an aging management program.

  10. HTLV-1 Tax upregulates early growth response protein 1 through nuclear factor-κB signaling.

    Science.gov (United States)

    Huang, Qingsong; Niu, Zhiguo; Han, Jingxian; Liu, Xihong; Lv, Zhuangwei; Li, Huanhuan; Yuan, Lixiang; Li, Xiangping; Sun, Shuming; Wang, Hui; Huang, Xinxiang

    2017-08-01

    Human T cell leukemia virus type 1 (HTLV-1) is a complex retrovirus that causes adult T cell leukemia (ATL) in susceptible individuals. The HTLV-1-encoded oncoprotein Tax induces persistent activation of the nuclear factor-κB (NF-κB) pathway. Early growth response protein 1 (EGR1) is overexpressed in HTLV-1-infected T cell lines and ATL cells. Here, we showed that both Tax expression and HTLV-1 infection promoted EGR1 overexpression. Loss of the NF-κB binding site in the EGR1 promotor or inhibition of NF-κB activation reduced Tax-induced EGR1 upregulation. Tax mutants unable to activate NF-κB induced only slight EGR1 upregulation as compared with wild-type Tax, confirming NF-κB pathway involvement in EGR1 regulation. Tax also directly interacted with the EGR1 protein and increased endogenous EGR1 stability. Elevated EGR1 in turn promoted p65 nuclear translocation and increased NF-κB activation. These results demonstrate a positive feedback loop between EGR1 expression and NF-κB activation in HTLV-1-infected and Tax-expressing cells. Both NF-κB activation and Tax-induced EGR1 stability upregulated EGR1, which in turn enhanced constitutive NF-κB activation and facilitated ATL progression in HTLV-1-infected cells. These findings suggest EGR1 may be an effective anti-ATL therapeutic target.

  11. Organizational factors influencing human performance in nuclear power plants. Report of a technical committee meeting

    International Nuclear Information System (INIS)

    1997-05-01

    In 1991 a Safety Series report on Safety Culture of the International Nuclear Safety Advisory Group (INSAG) was published as 75-INSAG-4 by the IAEA. This report deals with the concept of Safety Culture as it relates to organizations and individuals involved in the operations of nuclear power plants (NPPs). Generally, the role of management and organization in assuring the safe operation of NPPs has been widely recognized and its importance accepted. However, the understanding of what constitutes effective management and organization the area of safety is less developed than the understanding of most of the technical issues which plant operators and regulatory bodies are confronted with. The Technical Committee meeting provided a forum for a broad exchange of information on practices and experiences in the area of organization and management to accomplish operational safety in NPPs and thus enhance Safety Culture. This report and the papers presented at the meeting discuss those factors which influence and improve human performance covering both aspects, i.e. the basic requirements imposed on the operator and the ways of managerial support which enhance the reliable and safety oriented performance of operators. Refs, figs, tabs

  12. Design engineer perceptions and attitudes regarding human factors application to nuclear power plant design

    International Nuclear Information System (INIS)

    Ma, R.; Jones, J. M.

    2006-01-01

    With the renewed interest in nuclear power and the possibility of constructing new reactors within the next decade in the U.S., there are several challenges for the regulators, designers, and vendors. One challenge is to ensure that Human Factors Engineering (HFE) is involved, and correctly applied in the life-cycle design of the Nuclear Power Plant (NPP). As an important part of the effort, people would ask: 'is the system-design engineer effectively incorporating HFE in the NPPs design?' The present study examines the sagacity of Instrumentation and Control design engineers on issues relating to awareness, attitude, and application of HFE in NPP design. A questionnaire was developed and distributed, focusing on the perceptions and attitudes of the design engineers. The responses revealed that, while the participants had a relatively high positive attitude about HFE, their awareness and application of HFE were moderate. The results also showed that senior engineers applied HFE more frequently in their design work than young engineers. This study provides some preliminary results and implications for improved HFE education and application in NPP design. (authors)

  13. Strategies to regulate transcription factor-mediated gene positioning and interchromosomal clustering at the nuclear periphery.

    Science.gov (United States)

    Randise-Hinchliff, Carlo; Coukos, Robert; Sood, Varun; Sumner, Michael Chas; Zdraljevic, Stefan; Meldi Sholl, Lauren; Garvey Brickner, Donna; Ahmed, Sara; Watchmaker, Lauren; Brickner, Jason H

    2016-03-14

    In budding yeast, targeting of active genes to the nuclear pore complex (NPC) and interchromosomal clustering is mediated by transcription factor (TF) binding sites in the gene promoters. For example, the binding sites for the TFs Put3, Ste12, and Gcn4 are necessary and sufficient to promote positioning at the nuclear periphery and interchromosomal clustering. However, in all three cases, gene positioning and interchromosomal clustering are regulated. Under uninducing conditions, local recruitment of the Rpd3(L) histone deacetylase by transcriptional repressors blocks Put3 DNA binding. This is a general function of yeast repressors: 16 of 21 repressors blocked Put3-mediated subnuclear positioning; 11 of these required Rpd3. In contrast, Ste12-mediated gene positioning is regulated independently of DNA binding by mitogen-activated protein kinase phosphorylation of the Dig2 inhibitor, and Gcn4-dependent targeting is up-regulated by increasing Gcn4 protein levels. These different regulatory strategies provide either qualitative switch-like control or quantitative control of gene positioning over different time scales. © 2016 Randise-Hinchliff et al.

  14. Updating Human Factors Engineering Guidelines for Conducting Safety Reviews of Nuclear Power Plants

    International Nuclear Information System (INIS)

    O'Hara, J.M.; Higgins, J.; Fleger, Stephen

    2011-01-01

    The U.S. Nuclear Regulatory Commission (NRC) reviews the human factors engineering (HFE) programs of applicants for nuclear power plant construction permits, operating licenses, standard design certifications, and combined operating licenses. The purpose of these safety reviews is to help ensure that personnel performance and reliability are appropriately supported. Detailed design review procedures and guidance for the evaluations is provided in three key documents: the Standard Review Plan (NUREG-0800), the HFE Program Review Model (NUREG-0711), and the Human-System Interface Design Review Guidelines (NUREG-0700). These documents were last revised in 2007, 2004 and 2002, respectively. The NRC is committed to the periodic update and improvement of the guidance to ensure that it remains a state-of-the-art design evaluation tool. To this end, the NRC is updating its guidance to stay current with recent research on human performance, advances in HFE methods and tools, and new technology being employed in plant and control room design. This paper describes the role of HFE guidelines in the safety review process and the content of the key HFE guidelines used. Then we will present the methodology used to develop HFE guidance and update these documents, and describe the current status of the update program.

  15. Nuclear functions and subcellular trafficking mechanisms of the epidermal growth factor receptor family

    Science.gov (United States)

    2012-01-01

    Accumulating evidence suggests that various diseases, including many types of cancer, result from alteration of subcellular protein localization and compartmentalization. Therefore, it is worthwhile to expand our knowledge in subcellular trafficking of proteins, such as epidermal growth factor receptor (EGFR) and ErbB-2 of the receptor tyrosine kinases, which are highly expressed and activated in human malignancies and frequently correlated with poor prognosis. The well-characterized trafficking of cell surface EGFR is routed, via endocytosis and endosomal sorting, to either the lysosomes for degradation or back to the plasma membrane for recycling. A novel nuclear mode of EGFR signaling pathway has been gradually deciphered in which EGFR is shuttled from the cell surface to the nucleus after endocytosis, and there, it acts as a transcriptional regulator, transmits signals, and is involved in multiple biological functions, including cell proliferation, tumor progression, DNA repair and replication, and chemo- and radio-resistance. Internalized EGFR can also be transported from the cell surface to several intracellular compartments, such as the Golgi apparatus, the endoplasmic reticulum, and the mitochondria, in addition to the nucleus. In this review, we will summarize the functions of nuclear EGFR family and the potential pathways by which EGFR is trafficked from the cell surface to a variety of cellular organelles. A better understanding of the molecular mechanism of EGFR trafficking will shed light on both the receptor biology and potential therapeutic targets of anti-EGFR therapies for clinical application. PMID:22520625

  16. Primer on Durability of Nuclear Power Plant Reinforced Concrete Structures - A Review of Pertinent Factors

    International Nuclear Information System (INIS)

    Naus, Dan J.

    2007-01-01

    The objective of this study was to provide a primer on the environmental effects that can affect the durability of nuclear power plant concrete structures. As concrete ages, changes in its properties will occur as a result of continuing microstructural changes (i.e., slow hydration, crystallization of amorphous constituents, and reactions between cement paste and aggregates), as well as environmental influences. These changes do not have to be detrimental to the point that concrete will not be able to meet its performance requirements. Concrete, however, can suffer undesirable changes with time because of improper specifications, a violation of specifications, or adverse performance of its cement paste matrix or aggregate constituents under either physical or chemical attack. Contained in this report is a discussion on concrete durability and the relationship between durability and performance, a review of the historical perspective related to concrete and longevity, a description of the basic materials that comprise reinforced concrete, and information on the environmental factors that can affect the performance of nuclear power plant concrete structures. Commentary is provided on the importance of an aging management program

  17. Assessment of factors that affect the effectiveness of regulatory bodies: an application to the nuclear area

    International Nuclear Information System (INIS)

    Almeida, Ivan Pedro Salati de

    2005-09-01

    This work examines the main factors that affect the effectiveness of the non-economic regulatory process and establishes a model to propose actions to improve the regulation and the role of the regulatory body. The Soft Systems Methodology (SSM) is used and some tools for analysis, derived from the expectations of the stake holders, are added to the methodology. The stake holders taken into account are the public, the licensees, the supervisory bodies, other regulatory bodies, international organizations, concerned groups, and the regulatory body staff. The proposed actions aim to gradually change the organization, and the adopted methodology sees the organizational evolution as a continuum. Some elements of the Theory of Complexity are compared to the SSM concepts in order to validate the evolutionary approach. The model is applied to the specific case of,the nuclear regulation and the Brazilian regulatory body. Situations perceived as 'problem situations' are listed and some actions are proposed for improvement, including the establishment of performance indicators for effectiveness in nuclear regulation. (author)

  18. Higher serum levels of rheumatoid factor and anti-nuclear antibodies in helicobacter pylori-infected peptic ulcer patients.

    Science.gov (United States)

    Jafarzadeh, Abdollah; Nemati, Maryam; Rezayati, Mohammad Taghi; Nabizadeh, Mansooreh; Ebrahimi, Medhi

    2013-07-01

    H. pylori infection has been associated with some autoimmune disorders. The aim of this study was to evaluate the serum concentrations of rheumatoid factor and anti-nuclear antibodies in H. pylori-infected peptic ulcer patients, H. pylori-infected asymptomatic carriers and a healthy control group. A Total of 100 H. pylori-infected peptic ulcer patients, 65 asymptomatic carriers and 30 healthy H. pylori-negative subjects (as a control group) were enrolled into study. Serum samples of participants tested for the levels of rheumatoid factor and anti-nuclear antibodies by use of ELISA. The mean serum levels of rheumatoid factor and anti-nuclear antibodies in peptic ulcer group was significantly higher in comparison to the control group (ppeptic ulcer patients and asymptomatic carriers groups regarding the mean serum levels of rheumatoid factor and anti-nuclear antibodies. The mean serum levels of rheumatoid factor in men with peptic ulcer was significantly higher compared to the group of healthy men (ppeptic ulcer patients or asymptomatic carriers groups, the mean serum levels of rheumatoid factor was higher than that in healthy women, but the differences were not statistically significant. Also, no significant differences were observed between men and women with peptic ulcer, asymptomatic carriers control groups based on the serum levels of anti-nuclear antibodies. The results showed higher serum levels of rheumatoid factor and anti-nuclear antibodies in H. pylori-infected patients with peptic ulcer disease which represent the H. pylori-related immune disturbance in these patients. Additional follow-up studies are necessary to clarify the clinical significance of these autoantibodies in patients with H. pylori infection.

  19. CSNI technical opinion papers no.10. The role of human and organisational factors in nuclear power plant modifications

    International Nuclear Information System (INIS)

    2009-01-01

    Nuclear power plant modifications may be needed for a number of different reasons. These include physical ageing of plant systems, structures and components; obsolescence in hardware and software; feedback from operating experience; and opportunities for improved plant safety, reliability or capability. However, experience has also shown that weaknesses in the design and/or implementation of modifications can present significant challenges to plant safety. They can also have a considerable impact on the commercial performance of the plant. It is therefore important that the plant modification process reflect a recognition of the potential impact of human errors and that it incorporate suitable measures to minimise the potential for such errors. In this context, the NEA Committee on the Safety of Nuclear Installations (CSNI) and its Working Group on Human and Organisational Factors organised an international workshop in 2003 to discuss the role of human and organisational performance in the nuclear plant modification process. This technical opinion paper represents the consensus of specialists in human and organisational factors (HOF) in the NEA member countries on commendable practices and approaches to dealing with nuclear plant modifications. It considers factors that should be taken into account when developing a modification process and identifies some lessons learnt from application of the process. The paper should be of particular interest of nuclear safety regulators and nuclear power plant operators. (author)

  20. Low-Concentration Tributyltin Decreases GluR2 Expression via Nuclear Respiratory Factor-1 Inhibition.

    Science.gov (United States)

    Ishida, Keishi; Aoki, Kaori; Takishita, Tomoko; Miyara, Masatsugu; Sakamoto, Shuichiro; Sanoh, Seigo; Kimura, Tomoki; Kanda, Yasunari; Ohta, Shigeru; Kotake, Yaichiro

    2017-08-11

    Tributyltin (TBT), which has been widely used as an antifouling agent in paints, is a common environmental pollutant. Although the toxicity of high-dose TBT has been extensively reported, the effects of low concentrations of TBT are relatively less well studied. We have previously reported that low-concentration TBT decreases α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-type glutamate receptor subunit 2 ( GluR2 ) expression in cortical neurons and enhances neuronal vulnerability to glutamate. However, the mechanism of this TBT-induced GluR2 decrease remains unknown. Therefore, we examined the effects of TBT on the activity of transcription factors that control GluR2 expression. Exposure of primary cortical neurons to 20 nM TBT for 3 h to 9 days resulted in a decrease in GluR2 mRNA expression. Moreover, TBT inhibited the DNA binding activity of nuclear respiratory factor-1 (NRF-1), a transcription factor that positively regulates the GluR2 . This result indicates that TBT inhibits the activity of NRF-1 and subsequently decreases GluR2 expression. In addition, 20 nM TBT decreased the expression of genes such as cytochrome c, cytochrome c oxidase (COX) 4, and COX 6c, which are downstream of NRF-1. Our results suggest that NRF-1 inhibition is an important molecular action of the neurotoxicity induced by low-concentration TBT.

  1. Low-Concentration Tributyltin Decreases GluR2 Expression via Nuclear Respiratory Factor-1 Inhibition

    Science.gov (United States)

    Ishida, Keishi; Aoki, Kaori; Takishita, Tomoko; Miyara, Masatsugu; Sakamoto, Shuichiro; Sanoh, Seigo; Kimura, Tomoki; Kanda, Yasunari; Ohta, Shigeru; Kotake, Yaichiro

    2017-01-01

    Tributyltin (TBT), which has been widely used as an antifouling agent in paints, is a common environmental pollutant. Although the toxicity of high-dose TBT has been extensively reported, the effects of low concentrations of TBT are relatively less well studied. We have previously reported that low-concentration TBT decreases α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-type glutamate receptor subunit 2 (GluR2) expression in cortical neurons and enhances neuronal vulnerability to glutamate. However, the mechanism of this TBT-induced GluR2 decrease remains unknown. Therefore, we examined the effects of TBT on the activity of transcription factors that control GluR2 expression. Exposure of primary cortical neurons to 20 nM TBT for 3 h to 9 days resulted in a decrease in GluR2 mRNA expression. Moreover, TBT inhibited the DNA binding activity of nuclear respiratory factor-1 (NRF-1), a transcription factor that positively regulates the GluR2. This result indicates that TBT inhibits the activity of NRF-1 and subsequently decreases GluR2 expression. In addition, 20 nM TBT decreased the expression of genes such as cytochrome c, cytochrome c oxidase (COX) 4, and COX 6c, which are downstream of NRF-1. Our results suggest that NRF-1 inhibition is an important molecular action of the neurotoxicity induced by low-concentration TBT. PMID:28800112

  2. Calibration factor determination for solid nuclear track detectors CR-39 type exposed to Rn-222

    International Nuclear Information System (INIS)

    Cazula, Camila Dias; Campos, Marcia Pires de; Mazzilli, Barbara Paci

    2014-01-01

    In the detection method with solid nuclear track detector, when a heavy particle rests on the detector surface, causes a breakdown in their molecular structure forming a trace. One of the typical applications of these detectors is the measurement of the concentration of Rn -222 in air, a noble radioactive gas, part of the U-238 series, emitting alpha particles and important in epidemiological studies to protect individuals from natural radiation. To determine the concentration of Rn -222 in the air in a room is necessary to know the density of lines (traces / cm 2 ) on the detector surface, the exposure time and the calibration factor. The determination of the calibration factor for CR-39 detectors was taken from the exposure of these to a known concentration of Rn-222. Therefore, the detectors were placed inside a cell of Lucas adapted and subsequently exposed to a concentration of Rn-222 15 kBq / m 3 , by means of the apparatus RN-150 Pylon Electronics Incorporation, which has a source of Ra-226 and releases known concentrations of Rn-222. Six calibration factor determinations were performed, the average value obtained was 0.0534 ±0.0021 (traces / cm 2 per Bq / m 3 day). The results are consistent with literature values for the same type of detector and showed good reproducibility

  3. The human factors and job task analysis in nuclear power plant operation

    International Nuclear Information System (INIS)

    Stefanescu, Petre; Mihailescu, Nicolae; Dragusin, Octavian

    1999-01-01

    After a long period of time, during the development of the NPP technology, where the plant hardware has been considered to be the main factor for a safe, reliable and economic operation, the industry is now changing to an adequate responsibility of plant hardware and operation. Since the human factors has been not discussed methodically so far, there is still a lack of improved classification systems for human errors as well as a lack of methods for the systematic approach in designing the operator's working system, as for instance by using the job task analysis (J.T.A.). The J.T.A. appears to be an adequate method to study the human factor in the nuclear power plant operation, enabling an easy conversion to operational improvements. While the results of the analysis of human errors tell 'what' is to be improved, the J.T.A. shows 'how' to improve, for increasing the quality of the work and the safety of the operator's working system. The paper analyses the issue of setting the task and displays four criteria used to select aspects in NPP operation which require special consideration as personal training, design of control room, content and layout of the procedure manual, or organizing the operating personnel. The results are given as three tables giving: 1- Evaluation of deficiencies in the Working System; 2- Evaluation of the Deficiencies of Operator's Disposition; 3- Evaluation of the Mental Structure of Operation

  4. Scaling factors for the activity determination of radioactive waste from nuclear power reactors

    International Nuclear Information System (INIS)

    Medici, Marcela A.; Piumetti, Elsa H.

    2007-01-01

    Specific information of the total activity and activity concentration of the radionuclides contained is required for conditioning, transporting and final disposal of radioactive waste. Due to the complexity associated to alpha and beta measurements for these emitters it is worldwide used, particularly in the case of heterogeneous radioactive waste, the Scaling Factor Method. As in other cases, inputs of the results of the analysis of waste samples taking from waste streams are necessary. The Scaling Factor Method is based on the determination of averaged correlations between the activity concentrations of Difficult to Measure (DTM) nuclides (i.e. alpha and beta emitters) and the activity concentration of easy to measure nuclides (i.e. strong gamma emitters) called Key Nuclides (KN). In the application of this method two phases may be identified: in the first one the degree of correlation between averaged activities of DTM and a given KN is verified, and specific Scaling Factors are derived for every DTM radionuclide. In the second stage the total activity and the activity concentration of the selected KN is determined in each waste item and, by applying the SFs obtained previously, the activities of DTM nuclides are calculated. It is concluded that this method is appropriate and cost-effective and it is stressed that it is only applicable while the Nuclear Power Reactor is in operation. (author)

  5. Applying human factors to the design of control centre and workstation of a nuclear reactor

    International Nuclear Information System (INIS)

    Santos, Isaac J.A. Luquetti dos; Carvalho, Paulo V.R.; Goncalves, Gabriel de L.; Souza, Tamara D.M.F.; Falcao, Mariana A.

    2013-01-01

    Human factors is a body of scientific factors about human characteristics, covering biomedical, psychological and psychosocial considerations, including principles and applications in the personnel selection areas, training, job performance aid tools and human performance evaluation. Control Centre is a combination of control rooms, control suites and local control stations which are functionally related and all on the same site. Digital control room includes an arrangement of systems, equipment such as computers and communication terminals and workstations at which control and monitoring functions are conducted by operators. Inadequate integration between control room and operators reduces safety, increases the operation complexity, complicates operator training and increases the likelihood of human errors occurrence. The objective of this paper is to present a specific approach for the conceptual and basic design of the control centre and workstation of a nuclear reactor used to produce radioisotope. The approach is based on human factors standards, guidelines and the participation of a multidisciplinary team in the conceptual and basic phases of the design. Using the information gathered from standards and from the multidisciplinary team, an initial sketch 3D of the control centre and workstation are being developed. (author)

  6. Applying human factors to the design of control centre and workstation of a nuclear reactor

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Isaac J.A. Luquetti dos; Carvalho, Paulo V.R.; Goncalves, Gabriel de L., E-mail: luquetti@ien.gov.br [Instituto de Engenharia Nuclear (IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil); Souza, Tamara D.M.F.; Falcao, Mariana A. [Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro, RJ (Brazil). Dept. de Desenho Industrial

    2013-07-01

    Human factors is a body of scientific factors about human characteristics, covering biomedical, psychological and psychosocial considerations, including principles and applications in the personnel selection areas, training, job performance aid tools and human performance evaluation. Control Centre is a combination of control rooms, control suites and local control stations which are functionally related and all on the same site. Digital control room includes an arrangement of systems, equipment such as computers and communication terminals and workstations at which control and monitoring functions are conducted by operators. Inadequate integration between control room and operators reduces safety, increases the operation complexity, complicates operator training and increases the likelihood of human errors occurrence. The objective of this paper is to present a specific approach for the conceptual and basic design of the control centre and workstation of a nuclear reactor used to produce radioisotope. The approach is based on human factors standards, guidelines and the participation of a multidisciplinary team in the conceptual and basic phases of the design. Using the information gathered from standards and from the multidisciplinary team, an initial sketch 3D of the control centre and workstation are being developed. (author)

  7. Ventilation rate in equilibrium factor measurements with solid state nuclear track detectors (SSNTD)

    International Nuclear Information System (INIS)

    Gil, L.R.; Leitao, R.M.S.; Marques, A.; Rivera, A.

    1994-08-01

    Ventilation rate values are calculated from track density measurements in solid state nuclear track detectors (SSNTD), both when ventilation is the main cause of radioactive disequilibrium in radon progeny and when it shares importance with other agents. The method consists in exposing a SSNTD of high intrinsic efficiency (CR-39) in filtered and unfiltered conditions and, in addition, covered with a thin Aluminium foil, to stop alpha particles from 218 Po and 222 Rn. No calibrations are required but, when necessary, independent measurements of the loss rates of radioactivity to aerosol and to walls have to perform. Ventilation rates depend upon geometry detection efficiencies for alpha particles, here obtained by Monte Carlo simulation, taking into account the space distribution of emission positions. This may lead to sizeable corrections in ventilation and equilibrium factor values. Since geometric detection efficiencies depend upon alpha-particle ranges in air, the influences of barometric variables are also discussed. (author). 7 refs

  8. Apple, Cherry, and Blackcurrant Increases Nuclear Factor Kappa B Activation in Liver of Transgenic Mice

    DEFF Research Database (Denmark)

    Balstad, Trude; Paur, Ingvild; Poulsen, Morten

    2010-01-01

    Nuclear factor kappa B (NF-B) is essential in normal physiology, and several human disorders involve inappropriate regulation of NF-B. Diets dominated by plant-based foods protect against chronic diseases, and several food derived compounds have been identified as promising NF-B modulators. We...... investigated the effects of diets supplemented with apple, blackcurrant, or cherries on lipopolysaccharide (LPS)-induced NF-B activation in transgenic NF-B-luciferase mice. Whole body and organ specific NF-B activities were determined. The mice had ad libitum access to the respective experimental diets for 7...... slightly higher whole-body NF-B activation at 4 h, and all 3 experimental groups had higher NF-B activation at 6 h. LPS-induced NF-B activation in liver was increased with all 3 experimental diets, but no effects were observed in other organs. Our findings indicate that high intakes of lyophilized fruits...

  9. Changes of the nucleolus architecture in absence of the nuclear factor CTCF.

    Science.gov (United States)

    Hernández-Hernández, A; Soto-Reyes, E; Ortiz, R; Arriaga-Canon, C; Echeverría-Martinez, O M; Vázquez-Nin, G H; Recillas-Targa, F

    2012-01-01

    CTCF is a multifunctional nuclear factor involved in many cellular processes like gene regulation, chromatin insulation and genomic organization. Recently, CTCF has been shown to be involved in the transcriptional regulation of ribosomal genes and nucleolar organization in Drosophila cells and different murine cell types, including embryonic stem cells. Moreover, it has been suggested that CTCF could be associated to the nucleolus of human erythroleukemic K562 cells. In the present work, we took advantage of efficient small hairpin RNA interference against human CTCF to analyze nucleolar organization in HeLa cells. We have found that key components of the nucleolar architecture are altered. As a consequence of such alterations, an upregulation of ribosomal gene transcription was observed. We propose that CTCF contributes to the structural organization of the nucleolus and, through epigenetic mechanisms, to the regulation of the ribosomal gene expression. Copyright © 2012 S. Karger AG, Basel.

  10. Analysis of human factor aspects in connection with available incident reports obligatorily reported by German nuclear power plants

    International Nuclear Information System (INIS)

    Wilpert, B.; Freitag, M.; Miller, R.

    1993-01-01

    Goal of the present study is the analysis of human factor aspects in connection with available incident reports obligatorily reported by German nuclear power plants. Based on psychological theories and empirical studies this study develops a classification scheme which permits the identification of foci of erroneous human actions. This classification scheme is applied to a selection of human factor relevant incidents by calculating frequencies of the occurrence of human error categories. The results allow insights into human factor related problem areas. (orig.) [de

  11. Nuclear import of transcription factor BR-C is mediated by its interaction with RACK1.

    Science.gov (United States)

    Cheng, Daojun; Qian, Wenliang; Wang, Yonghu; Meng, Meng; Wei, Ling; Li, Zhiqing; Kang, Lixia; Peng, Jian; Xia, Qingyou

    2014-01-01

    The transcription factor Broad Complex (BR-C) is an early ecdysone response gene in insects and contains two types of domains: two zinc finger domains for the activation of gene transcription and a Bric-a-brac/Tramtrack/Broad complex (BTB) domain for protein-protein interaction. Although the mechanism of zinc finger-mediated gene transcription is well studied, the partners interacting with the BTB domain of BR-C has not been elucidated until now. Here, we performed a yeast two-hybrid screen using the BTB domain of silkworm BR-C as bait and identified the receptor for activated C-kinase 1 (RACK1), a scaffolding/anchoring protein, as the novel partner capable of interacting with BR-C. The interaction between BR-C and RACK1 was further confirmed by far-western blotting and pull-down assays. Importantly, the disruption of this interaction, via RNAi against the endogenous RACK1 gene or deletion of the BTB domain, abolished the nuclear import of BR-C in BmN4 cells. In addition, RNAi against the endogenous PKC gene as well as phosphorylation-deficient mutation of the predicted PKC phosphorylation sites at either Ser373 or Thr406 in BR-C phenocopied RACK1 RNAi and altered the nuclear localization of BR-C. However, when BTB domain was deleted, phosphorylation mimics of either Ser373 or Thr406 had no effect on the nuclear import of BR-C. Moreover, mutating the PKC phosphorylation sites at Ser373 and Thr406 or deleting the BTB domain significantly decreased the transcriptional activation of a BR-C target gene. Given that RACK1 is necessary for recruiting PKC to close and phosphorylate target proteins, we suggest that the PKC-mediated phosphorylation and nuclear import of BR-C is determined by its interaction with RACK1. This novel finding will be helpful for further deciphering the mechanism underlying the role of BR-C proteins during insect development.

  12. Nuclear import of transcription factor BR-C is mediated by its interaction with RACK1.

    Directory of Open Access Journals (Sweden)

    Daojun Cheng

    Full Text Available The transcription factor Broad Complex (BR-C is an early ecdysone response gene in insects and contains two types of domains: two zinc finger domains for the activation of gene transcription and a Bric-a-brac/Tramtrack/Broad complex (BTB domain for protein-protein interaction. Although the mechanism of zinc finger-mediated gene transcription is well studied, the partners interacting with the BTB domain of BR-C has not been elucidated until now. Here, we performed a yeast two-hybrid screen using the BTB domain of silkworm BR-C as bait and identified the receptor for activated C-kinase 1 (RACK1, a scaffolding/anchoring protein, as the novel partner capable of interacting with BR-C. The interaction between BR-C and RACK1 was further confirmed by far-western blotting and pull-down assays. Importantly, the disruption of this interaction, via RNAi against the endogenous RACK1 gene or deletion of the BTB domain, abolished the nuclear import of BR-C in BmN4 cells. In addition, RNAi against the endogenous PKC gene as well as phosphorylation-deficient mutation of the predicted PKC phosphorylation sites at either Ser373 or Thr406 in BR-C phenocopied RACK1 RNAi and altered the nuclear localization of BR-C. However, when BTB domain was deleted, phosphorylation mimics of either Ser373 or Thr406 had no effect on the nuclear import of BR-C. Moreover, mutating the PKC phosphorylation sites at Ser373 and Thr406 or deleting the BTB domain significantly decreased the transcriptional activation of a BR-C target gene. Given that RACK1 is necessary for recruiting PKC to close and phosphorylate target proteins, we suggest that the PKC-mediated phosphorylation and nuclear import of BR-C is determined by its interaction with RACK1. This novel finding will be helpful for further deciphering the mechanism underlying the role of BR-C proteins during insect development.

  13. Nuclear respiratory factor-1 and bioenergetics in tamoxifen-resistant breast cancer cells

    International Nuclear Information System (INIS)

    Radde, Brandie N.; Ivanova, Margarita M.; Mai, Huy Xuan; Alizadeh-Rad, Negin; Piell, Kellianne; Van Hoose, Patrick; Cole, Marsha P.; Muluhngwi, Penn; Kalbfleisch, Ted S.; Rouchka, Eric C.; Hill, Bradford G.; Klinge, Carolyn M.

    2016-01-01

    Acquired tamoxifen (TAM) resistance is a significant clinical problem in treating patients with estrogen receptor α (ERα)+ breast cancer. We reported that ERα increases nuclear respiratory factor-1 (NRF-1), which regulates nuclear-encoded mitochondrial gene transcription, in MCF-7 breast cancer cells and NRF-1 knockdown stimulates apoptosis. Whether NRF-1 and target gene expression is altered in endocrine resistant breast cancer cells is unknown. We measured NRF-1and metabolic features in a cell model of progressive TAM-resistance. NRF-1 and its target mitochondrial transcription factor A (TFAM) were higher in TAM-resistant LCC2 and LCC9 cells than TAM-sensitive MCF-7 cells. Using extracellular flux assays we observed that LCC1, LCC2, and LCC9 cells showed similar oxygen consumption rate (OCR), but lower mitochondrial reserve capacity which was correlated with lower Succinate Dehydrogenase Complex, Subunit B in LCC1 and LCC2 cells. Complex III activity was lower in LCC9 than MCF-7 cells. LCC1, LCC2, and LCC9 cells had higher basal extracellular acidification (ECAR), indicating higher aerobic glycolysis, relative to MCF-7 cells. Mitochondrial bioenergetic responses to estradiol and 4-hydroxytamoxifen were reduced in the endocrine-resistant cells compared to MCF-7 cells. These results suggest the acquisition of altered metabolic phenotypes in response to long term antiestrogen treatment may increase vulnerability to metabolic stress. - Highlights: • NRF-1 and TFAM expression are higher in endocrine-resistant breast cancer cells. • Oxygen consumption rate is similar in endocrine-sensitive and resistant cells. • Mitochondrial reserve capacity is lower in endocrine-resistant cells. • Endocrine-resistant breast cancer cells have increased glycolysis. • Bioenergetic responses to E2 and tamoxifen are lower in endocrine-resistant cells.

  14. Nuclear respiratory factor-1 and bioenergetics in tamoxifen-resistant breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Radde, Brandie N.; Ivanova, Margarita M.; Mai, Huy Xuan; Alizadeh-Rad, Negin; Piell, Kellianne; Van Hoose, Patrick; Cole, Marsha P.; Muluhngwi, Penn; Kalbfleisch, Ted S. [Department of Biochemistry & Molecular Genetics, Center for Genetics and Molecular Medicine, University of Louisville School of Medicine, Louisville, KY 40292 (United States); Rouchka, Eric C. [Bioinformatics and Biomedical Computing Laboratory, Department of Computer Engineering and Computer Science, University of Louisville, Louisville, KY 40292 (United States); Hill, Bradford G. [Department of Medicine, University of Louisville School of Medicine, Louisville, KY 40292 (United States); Klinge, Carolyn M., E-mail: carolyn.klinge@louisville.edu [Department of Biochemistry & Molecular Genetics, Center for Genetics and Molecular Medicine, University of Louisville School of Medicine, Louisville, KY 40292 (United States)

    2016-09-10

    Acquired tamoxifen (TAM) resistance is a significant clinical problem in treating patients with estrogen receptor α (ERα)+ breast cancer. We reported that ERα increases nuclear respiratory factor-1 (NRF-1), which regulates nuclear-encoded mitochondrial gene transcription, in MCF-7 breast cancer cells and NRF-1 knockdown stimulates apoptosis. Whether NRF-1 and target gene expression is altered in endocrine resistant breast cancer cells is unknown. We measured NRF-1and metabolic features in a cell model of progressive TAM-resistance. NRF-1 and its target mitochondrial transcription factor A (TFAM) were higher in TAM-resistant LCC2 and LCC9 cells than TAM-sensitive MCF-7 cells. Using extracellular flux assays we observed that LCC1, LCC2, and LCC9 cells showed similar oxygen consumption rate (OCR), but lower mitochondrial reserve capacity which was correlated with lower Succinate Dehydrogenase Complex, Subunit B in LCC1 and LCC2 cells. Complex III activity was lower in LCC9 than MCF-7 cells. LCC1, LCC2, and LCC9 cells had higher basal extracellular acidification (ECAR), indicating higher aerobic glycolysis, relative to MCF-7 cells. Mitochondrial bioenergetic responses to estradiol and 4-hydroxytamoxifen were reduced in the endocrine-resistant cells compared to MCF-7 cells. These results suggest the acquisition of altered metabolic phenotypes in response to long term antiestrogen treatment may increase vulnerability to metabolic stress. - Highlights: • NRF-1 and TFAM expression are higher in endocrine-resistant breast cancer cells. • Oxygen consumption rate is similar in endocrine-sensitive and resistant cells. • Mitochondrial reserve capacity is lower in endocrine-resistant cells. • Endocrine-resistant breast cancer cells have increased glycolysis. • Bioenergetic responses to E2 and tamoxifen are lower in endocrine-resistant cells.

  15. Xanthophylls increased HDLC level and nuclear factor PPARγ, RXRγ and RARα expression in hens and chicks.

    Science.gov (United States)

    Gao, Y-Y; Jin, L; Peng, H; Xu, L-H; Wang, Q-X; Ji, J; Wang, C-K; Bi, Y-Z

    2018-02-01

    This study was designed to investigate effects of xanthophylls on serum lipid profile (triglyceride, TG; cholesterol, CHO; high-density lipoprotein cholesterol, HDLC; and low-density lipoprotein cholesterol, LDLC) and nuclear factor (peroxisome proliferator-activated receptor gamma, PPARγ; PPAR gamma coactivator 1 alpha, PGC1α; retinoid X receptor gamma, RXRγ; and retinoic acid receptor alpha, RARα) gene expression of breeding hens and chicks. In experiment 1, 432 hens were divided into three groups and fed diets supplemented with 0 (as control group), 20 or 40 mg/kg xanthophylls. Blood was sampled at 7, 14, 21, 28 and 35 days of trial. Liver, duodenum, jejunum and ileum were sampled at 35 days of trial. Results showed that serum HDLC level of hens was increased after dietary 40 mg/kg xanthophyll addition for 21, 28 and 35 days, while serum TG, CHO and LDLC were not affected. Xanthophyll addition also increased PPARγ expression in jejunum, RXRγ expression in duodenum and jejunum, and RARα expression in liver and duodenum. Experiment 2 was a 2 × 2 factorial design. Male chicks hatched from 0 or 40 mg/kg xanthophyll diet of hens were fed diet containing either 0 or 40 mg/kg xanthophylls. Liver, duodenum, jejunum and ileum were sampled at 0, 7, 14 and 21 days after hatching. Blood samples were also collected at 21 days. Results showed that in ovo xanthophylls elevated PPARγ in duodenum and jejunum, and RXRγ and RARα in liver of chicks mainly within 1 week after hatching, while dietary xanthophylls increased serum HDLC level and PPARγ and RXRγ in liver from 2 weeks onwards. In conclusion, our research suggested xanthophylls can regulate serum lipid profile and nuclear factor expression in hens and chicks. © 2017 Blackwell Verlag GmbH.

  16. Virtual reality technology as a tool for human factors requirements evaluation in design of the nuclear reactors control desks

    International Nuclear Information System (INIS)

    Grecco, Claudio H.S.; Santos, Isaac J.A.L.; Mol, Antonio C.A.; Carvalho, Paulo V.R.; Silva, Antonio C.F.; Ferreira, Francisco J.O.; Dutra, Marco A.M.

    2007-01-01

    The Virtual Reality (VR) is an advanced computer interface technology that allows the user to internet or to explore a three-dimensional environment through the computer, as was part of the virtual world. This technology presents great applicability in the most diverse areas of the human knowledge. This paper presents a study on the use of the VR as tool for human factors requirements evaluation in design of the nuclear reactors control desks. Moreover, this paper presents a case study: a virtual model of the control desk, developed using virtual reality technology to be used in the human factors requirements evaluation. This case study was developed in the Virtual Reality Laboratory at IEN, and understands the stereo visualization of the Argonauta research nuclear reactor control desk for a static ergonomic evaluation using check-lists, in accordance to the standards and human factors nuclear international guides (IEC 1771, NUREG-0700). (author)

  17. Virtual reality technology as a tool for human factors requirements evaluation in design of the nuclear reactors control desks

    Energy Technology Data Exchange (ETDEWEB)

    Grecco, Claudio H.S.; Santos, Isaac J.A.L.; Mol, Antonio C.A.; Carvalho, Paulo V.R.; Silva, Antonio C.F.; Ferreira, Francisco J.O.; Dutra, Marco A.M. [Instituto de Engenharia Nuclear (IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil)]. E-mail: grecco@ien.gov.br; luquetti@ien.gov.br; mol@ien.gov.br; paulov@ien.gov.br; tonico@ien.gov.br; fferreira@ien.gov.br; dutra@ien.gov.br

    2007-07-01

    The Virtual Reality (VR) is an advanced computer interface technology that allows the user to internet or to explore a three-dimensional environment through the computer, as was part of the virtual world. This technology presents great applicability in the most diverse areas of the human knowledge. This paper presents a study on the use of the VR as tool for human factors requirements evaluation in design of the nuclear reactors control desks. Moreover, this paper presents a case study: a virtual model of the control desk, developed using virtual reality technology to be used in the human factors requirements evaluation. This case study was developed in the Virtual Reality Laboratory at IEN, and understands the stereo visualization of the Argonauta research nuclear reactor control desk for a static ergonomic evaluation using check-lists, in accordance to the standards and human factors nuclear international guides (IEC 1771, NUREG-0700). (author)

  18. Anti-Inflammatory Effect of ETAS®50 by Inhibiting Nuclear Factor-κB p65 Nuclear Import in Ultraviolet-B-Irradiated Normal Human Dermal Fibroblasts

    Directory of Open Access Journals (Sweden)

    Ken Shirato

    2018-01-01

    Full Text Available Ultraviolet (UV irradiation induces proinflammatory responses in skin cells, including dermal fibroblasts, accelerating premature skin aging (photoaging. ETAS 50, a standardized extract from the Asparagus officinalis stem, is a novel and unique functional food that suppresses proinflammatory responses of hydrogen peroxide-stimulated skin fibroblasts and interleukin- (IL- 1β-stimulated hepatocytes. To elucidate its antiphotoaging potencies, we examined whether ETAS 50 treatment after UV-B irradiation attenuates proinflammatory responses of normal human dermal fibroblasts (NHDFs. UV-B-irradiated NHDFs showed reduced levels of the cytosolic inhibitor of nuclear factor-κB α (IκBα protein and increased levels of nuclear p65 protein. The nuclear factor-κB nuclear translocation inhibitor JSH-23 abolished UV-B irradiation-induced IL-1β mRNA expression, indicating that p65 regulates transcriptional induction. ETAS 50 also markedly suppressed UV-B irradiation-induced increases in IL-1β mRNA levels. Immunofluorescence analysis revealed that ETAS 50 retained p65 in the cytosol after UV-B irradiation. Western blotting also showed that ETAS 50 suppressed the UV-B irradiation-induced increases in nuclear p65 protein. Moreover, ETAS 50 clearly suppressed UV-B irradiation-induced distribution of importin-α protein levels in the nucleus without recovering cytosolic IκBα protein levels. These results suggest that ETAS 50 exerts anti-inflammatory effects on UV-B-irradiated NHDFs by suppressing the nuclear import machinery of p65. Therefore, ETAS 50 may prevent photoaging by suppressing UV irradiation-induced proinflammatory responses of dermal fibroblasts.

  19. Identification of a human erythroid progenitor cell population which expresses the CD34 antigen and binds the plant lectin Ulex europaeus I.

    Science.gov (United States)

    Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G

    1996-01-01

    Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.

  20. X-RAY ABSORPTION, NUCLEAR INFRARED EMISSION, AND DUST COVERING FACTORS OF AGNs: TESTING UNIFICATION SCHEMES

    Energy Technology Data Exchange (ETDEWEB)

    Mateos, S.; Carrera, F. J.; Alonso-Herrero, A.; Hernán-Caballero, A.; Barcons, X. [Instituto de Física de Cantabria (CSIC-Universidad de Cantabria), E-39005, Santander (Spain); Ramos, A. Asensio; Almeida, C. Ramos [Instituto de Astrofísica de Canarias, E-38205, La Laguna, Tenerife (Spain); Watson, M. G.; Blain, A. [Physics and Astronomy, University of Leicester, University Road, Leicester LE1 7RH (United Kingdom); Caccianiga, A.; Ballo, L. [INAF-Osservatorio Astronomico di Brera, via Brera 28, I-20121 Milano (Italy); Braito, V., E-mail: mateos@ifca.unican.es [INAF-Osservatorio Astronomico di Brera, Via Bianchi 46, I-23807 Merate (Italy)

    2016-03-10

    We present the distributions of the geometrical covering factors of the dusty tori (f{sub 2}) of active galactic nuclei (AGNs) using an X-ray selected complete sample of 227 AGNs drawn from the Bright Ultra-hard XMM-Newton Survey. The AGNs have z from 0.05 to 1.7, 2–10 keV luminosities between 10{sup 42} and 10{sup 46} erg s{sup −1}, and Compton-thin X-ray absorption. Employing data from UKIDSS, 2MASS, and the Wide-field Infrared Survey Explorer in a previous work, we determined the rest-frame 1–20 μm continuum emission from the torus, which we model here with the clumpy torus models of Nenkova et al. Optically classified type 1 and type 2 AGNs are intrinsically different, with type 2 AGNs having, on average, tori with higher