WorldWideScience

Sample records for nos3 glu298asp snp

  1. NOS3 Glu298Asp genotype and blood pressure response to endurance training: the HERITAGE family study.

    Science.gov (United States)

    Rankinen, T; Rice, T; Pérusse, L; Chagnon, Y C; Gagnon, J; Leon, A S; Skinner, J S; Wilmore, J H; Rao, D C; Bouchard, C

    2000-11-01

    Endothelium-dependent vasodilation is a mechanism that may affect blood pressure response to endurance training. Because NO plays a central role in this process, the endothelial NO synthase gene is a good candidate for the regulation of exercise blood pressure. We investigated the associations between an endothelial NO synthase gene polymorphism (Glu298Asp) and endurance training-induced changes in resting and submaximal exercise blood pressure in 471 white subjects of the HERITAGE Family Study. Two submaximal exercise tests at 50 W were conducted both before and after a 20-week endurance training program. Steady-state exercise blood pressure was measured twice in each test with an automated unit. The Glu298Asp polymorphism was typed with a PCR-based method and digestion with BAN:II. Both systolic and diastolic blood pressure at 50 W decreased in response to the training program, whereas resting blood pressure remained unchanged. The decrease in diastolic blood pressure at 50 W was greater (P=0.0005, adjusted for age, gender, baseline body mass index, and baseline diastolic blood pressure at 50 W) in the Glu/Glu homozygotes (4.4 [SEM 0.4] mm Hg, n=187) than in the heterozygotes (3.1 [0.4] mm Hg, n=213) and the Asp/Asp homozygotes (1.3 [0.7] mm Hg, n=71). The genotype accounted for 2.3% of the variance in diastolic blood pressure at 50 W training response. Both the Glu298 homozygotes and the heterozygotes had a greater (P=0.013) training-induced reduction in rate-pressure product at 50 W than the Asp298 homozygotes. These data suggest that DNA sequence variation in the endothelial NO synthase gene locus is associated with the endurance training-induced decreases in submaximal exercise diastolic blood pressure and rate-pressure product in sedentary normotensive white subjects.

  2. Endothelial nitric oxide synthase gene Glu298Asp polymorphism ...

    African Journals Online (AJOL)

    Administrator

    2011-09-12

    Sep 12, 2011 ... Figure 1. The Glu298Asp polymorphism of eNOS gene was shown by .... mechanisms by which eNOS Asp298 polymorphism ... Asp298 is exposed to selective proteolytic cleavage in ... grounds, inclusion and exclusion criteria for PE women ... attention to meta analysis study, it is more probable that.

  3. GLU298ASP and 4G/5G Polymorphisms and the Risk of Ischemic Stroke in Young Individuals.

    Science.gov (United States)

    Esparza-García, Juan Carlos; Santiago-Germán, David; Guadalupe Valades-Mejía, María; Hernández-Juárez, Jesus; Aguilar-Sosa, Eberth; Leaños-Miranda, Alfredo; Alvarado-Moreno, Antonio; Majluf-Cruz, Abraham; Isordia-Salas, Irma

    2015-09-01

    Polymorphisms in the endothelial nitric oxide synthase (eNOS) and in the plasminogen activator inhibitor -1 (PAI-1) genes have been implicated in stroke pathogenesis but results are still controversial. The aim of this study was to examine the possible contribution of Glu298Asp in the eNOS and 4G/5G in the PAI-1polymorphisms with ischemic stroke in a young Mexican population. In a case-control study, conducted between January 2006 and June 2010, 204 patients ≤45 years of age with ischemic stroke and 204 controls matched by age and gender, were recruited. The Glu298Asp and 4G/5G polymorphisms were determined in all participants by polymerase chain reaction-restriction fragment length polymorphism. There was a significant difference in the Glu298Asp genotype distribution (P=0.001) and allele frequency between the two groups (P=0.001). The 4G/5G genotype distribution (P=0.40) and the allele frequency was similar between groups; (P=0.13). There were independent factors for ischemic stroke: Asp carriage (GluAsp+AspAsp) (P=0.02); smoking (P=0.01); hypertension (P=0.03), and familial history of atherothrombotic disease (P=0.04). The Asp allele from the Gu298Asp gene represents an independent risk factor for ischemic stroke in a young Mexican population. In contrast, the 4G/5G was not associated with an increased risk for this disease in the same group of patients, as previously has been demonstrated in other populations.

  4. Prevalence of endothelial nitric oxide synthase (eNOS) gene exon 7 Glu298Asp variant in North Eastern India

    Science.gov (United States)

    Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish

    2011-01-01

    Background & objectives Endothelial nitric oxide is a potent vasodilator and impairment of its generation brought about by gene polymorphism is considered a major predictor for several diseases. A single nucleotide polymorphism G894T within exon 7 of endothelial nitric oxide synthase (eNOS-7) gene, resulting in a replacement of glutamic acid by aspartic acid, has been studied as a putative candidate gene for cardiovascular diseases. The pattern of eNOS-7 Glu298Asp variant in the Indian population is poorly known. The present study was planned to determine the prevalence of the variant of this gene among tea garden community in Assam, North-East India with high prevalence of hypertension. Methods Study participants of both sex aged ≥18 yr were recruited randomly from temporary field clinics established in tea gardens of Dibrugarh, Assam. Genomic DNA was extracted from 409 subjects by the conventional phenol-chloroform method. The prevalence of the eNOS exon 7 Glu298Asp variant was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. Results The study population was in Hardy-Weinberg Equilibrium. The frequency of the eNOS GG, GT and TT genotypes was found to be 75, 22 and 3 per cent respectively and did not show any significant difference in gender wise analysis. Interpretation & conclusions Our results showed that the prevalence of the homozygous GG genotype was high (75%) and the rare mutant genotype (homozygous, TT) was 3 per cent in a population at risk with cardiovascular disease. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics. PMID:21623032

  5. Association between Polymorphism of Endothelial Nitric Oxide Synthase Gene (Glu298Asp) and Chronic Heart Failure in Patients with Ischemic Heart Disease and Obesity

    OpenAIRE

    O.I. Kadykova; P.P. Kravchun

    2016-01-01

    The article reviewed the links between polymorphism of endothelial nitric oxide synthase gene (Glu298Asp) and the development and progression of chronic heart failure in patients with ischemic heart disease and obesity. There has been a comprehensive survey of 222 patients with ischemic heart disease. Comparison group consisted of 115 patients with ischemic heart disease with normal body weight. The control group included 35 healthy individuals. G allele and genotype G/G polymorphism of the g...

  6. Differential effect of beetroot bread on postprandial DBP according to Glu298Asp polymorphism in the eNOS gene: a pilot study.

    Science.gov (United States)

    Hobbs, D A; George, T W; Lovegrove, J A

    2014-12-01

    Our objective was to investigate whether the presence of Glu298Asp polymorphism in the endothelial NO synthase (eNOS) gene differentially affects the postprandial blood pressure response to dietary nitrate-rich beetroot bread. A randomised, single-blind, controlled, crossover acute pilot study was performed in 14 healthy men (mean age: 34±9 years) who were retrospectively genotyped for Glu298Asp polymorphism (7GG; T carriers 7). Volunteers were randomised to receive 200 g beetroot-enriched bread (1.1 mmol nitrate) or control bread (no beetroot; 0.01 mmol nitrate) on two separate occasions 10 days apart. Baseline and incremental area under the curve of blood pressure and NOx (nitrate/nitrite) were measured for a 6-h postprandial period. A treatment × genotype interaction was observed for diastolic blood pressure (Pconsumption of beetroot bread compared with control bread. No significant differences were observed in the GG group. The beneficial diastolic blood pressure reduction was observed only in the T carriers of the Glu298Asp polymorphism in the eNOS gene after consumption of nitrate-rich beetroot bread. These data require confirmation in a larger population group.

  7. eNOS Glu298Asp polymorphism is associated with development of complicated plaques in patients from Serbia with advanced carotid atherosclerosis

    Directory of Open Access Journals (Sweden)

    Đurić Tamara

    2013-01-01

    Full Text Available Nitric oxide inhibits adhesion of thrombocytes, proliferation and migration of smooth muscle cells and restricts oxidation of atherogenic low-density lipoproteins. Therefore, decreased production or activity of NO may play a role in the initiation, progression or complications of atherosclerosis. The aim of this study was to estimate the effect of Glu298Asp eNOS gene polymorphism on the individual risk for development of complicated carotid atherosclerotic plaque in patients from Serbia with advanced carotid atherosclerosis (CA who had undergone endarterectomy. The study population included 233 patients. eNOS G894T gene polymorphism was identified by PCR and RFLP methods. Multivariate logistic regression analysis showed that Asp298Asp is an independent risk factor for the presence of complicated plaques in CA patients. Patients who were homozygous for the Asp298 allele had an adjusted OR of 4.36 for the development of complicated plaques compared to those that carry the Glu298 allele. Further validation and replication studies are needed. [Projekat Ministarstva nauke Republike Srbije, br. OI175085

  8. [Prevalence of dyslipidemia in middle-aged adults with NOS3 gene polymorphism and low cardiorespiratory fitness].

    Science.gov (United States)

    Malagrino, Pamella A; Sponton, Carlos H G; Esposti, Rodrigo D; Franco-Penteado, Carla F; Fernandes, Romulo A; Bezerra, Marcos André C; Albuquerque, Dulcinéia M; Rodovalho, Cynara M; Bacci, Maurício; Zanesco, Angelina

    2013-02-01

    To evaluate the influence of the interaction between endothelial nitric oxide synthase gene (NOS3) polymorphisms at positions -786T>C, Glu298Asp and intron 4b/a, and cardiorespiratory fitness on plasma nitrite/nitrate levels, blood pressure, lipid profile, and prevalence of cardiometabolic disorders. Ninety-two volunteers were genotyped for NOS3 polymorphisms at positions (-786T>C and Glu298Asp) and (intron 4b/a) and divided according to the genotype: non-polymorphic (NP) and polymorphic (P). After that, they were subdivided according to the cardiorespiratory fitness associated with genotype: high (HNP and HP) and low (LNP and LP). The subjects with polymorphism for the interactions at positions Glu298Asp + intron 4b/a, and Glu298Asp+-786T>C showed the highest values in total cholesterol, as well as dyslipidemia. Our findings show that NOS3 gene polymorphisms at positions -786T>C, Glu298Asp, and intron 4b/a exert negative effects on the lipid profile compared with those who do not carry polymorphisms.

  9. A variant of the endothelial nitric oxide synthase gene (NOS3) associated with AMS susceptibility is less common in the Quechua, a high altitude Native population.

    Science.gov (United States)

    Wang, Pei; Ha, Alice Y N; Kidd, Kenneth K; Koehle, Michael S; Rupert, Jim L

    2010-01-01

    Endothelial nitric oxide synthase (eNOS) is a vascular enzyme that produces nitric oxide, a transient signaling molecule that by vasodilatation regulates blood flow and pressure. Nitric oxide is believed to play roles in both short-term acclimatization and long-term evolutionary adaptation to environmental hypoxia. Several laboratories, including ours, have shown that variants in NOS3 (the gene encoding eNOS) are overrepresented in individuals with altitude-related illnesses such as high altitude pulmonary edema (HAPE) and acute mountain sickness (AMS), suggesting that NOS3 genotypes contribute to altitude tolerance. To further test our hypothesis that the G allele at the G894T polymorphism in NOS3 (dbSNP number: rs1799983; protein polymorphism Glu298Asp) is beneficial in hypoxic environments, we compared frequencies of this allele in an altitude-adapted Amerindian population, Quechua of the Andean altiplano, with those in a lowland Amerindian population, Maya of the Yucatan Peninsula. While common in both populations, the G allele was significantly more frequent in the highlanders. Taken together, our data suggest that this variant in NOS3, which has been previously associated with higher levels of nitric oxide, contributes to both acclimatization and adaptation to altitude.

  10. NOS3 Polymorphisms and Chronic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Alejandro Marín Medina

    2018-05-01

    Full Text Available ABSTRACT Chronic kidney disease (CKD is a multifactorial pathophysiologic irreversible process that often leads to a terminal state in which the patient requires renal replacement therapy. Most cases of CKD are due to chronic-degenerative diseases and endothelial dysfunction is one of the factors that contribute to its pathophysiology. One of the most important mechanisms for proper functioning of the endothelium is the regulation of the synthesis of nitric oxide. This compound is synthesized by the enzyme nitric oxide synthase, which has 3 isoforms. Polymorphisms in the NOS3 gene have been implicated as factors that alter the homeostasis of this mechanism. The Glu298Asp polymorphisms 4 b/a and -786T>C of the NOS3 gene have been associated with a more rapid deterioration of kidney function in patients with CKD. These polymorphisms have been evaluated in patients with CKD of determined and undetermined etiology and related to a more rapid deterioration of kidney function.

  11. Effect of Multicomponent Training on Blood Pressure, Nitric Oxide, Redox Status, and Physical Fitness in Older Adult Women: Influence of Endothelial Nitric Oxide Synthase (NOS3 Haplotypes

    Directory of Open Access Journals (Sweden)

    Atila Alexandre Trapé

    2017-01-01

    Full Text Available The purpose of this study was to verify the influence of the genotype or haplotype (interaction of the NOS3 polymorphisms [-786T>C, 894G>T (Glu298Asp, and intron 4b/a] on the response to multicomponent training (various capacities and motor skills on blood pressure (BP, nitrite concentration, redox status, and physical fitness in older adult women. The sample consisted of 52 participants, who underwent body mass index and BP assessments. Physical fitness was evaluated by six-minute walk, elbow flexion, and sit and stand up tests. Plasma/blood samples were used to evaluate redox status, nitrite concentration, and genotyping. Associations were observed between isolated polymorphisms and the response of decreased systolic and diastolic BP and increased nitrite concentration and antioxidant activity. In the haplotype analysis, the group composed of ancestral alleles (H1 was the only one to present improvement in all variables studied (decrease in systolic and diastolic BP, improvement in nitrite concentration, redox status, and physical fitness, while the group composed of variant alleles (H8 only demonstrated improvement in some variables of redox status and physical fitness. These findings suggest that NOS3 polymorphisms and physical training are important interacting variables to consider in evaluating redox status, nitric oxide availability and production, and BP control.

  12. Outcome after BCG treatment for urinary bladder cancer may be influenced by polymorphisms in the NOS2 and NOS3 genes.

    Science.gov (United States)

    Ryk, Charlotta; Koskela, Lotta Renström; Thiel, Tomas; Wiklund, N Peter; Steineck, Gunnar; Schumacher, Martin C; de Verdier, Petra J

    2015-12-01

    Bacillus Calmette-Guérin (BCG)-treatment is an established treatment for bladder cancer, but its mechanisms of action are not fully understood. High-risk non-muscle invasive bladder-cancer (NMIBC)-patients failing to respond to BCG-treatment have worse prognosis than those undergoing immediate radical cystectomy and identification of patients at risk for BCG-failure is of high priority. Several studies indicate a role for nitric oxide (NO) in the cytotoxic effect that BCG exerts on bladder cancer cells. In this study we investigated whether NO-synthase (NOS)-gene polymorphisms, NOS2-promoter microsatellite (CCTTT)n, and the NOS3-polymorphisms-786T>C (rs2070744) and Glu298Asp (rs1799983), can serve as possible molecular markers for outcome after BCG-treatment for NMIBC. All NMIBC-patients from a well-characterized population based cohort were analyzed (n=88). Polymorphism data were combined with information from 15-years of clinical follow-up. The effect of BCG-treatment on cancer-specific death (CSD), recurrence and progression in patients with varying NOS-genotypes were studied using Cox proportional hazard-models and log rank tests. BCG-treatment resulted in significantly better survival in patients without (Log rank: p=0.006; HR: 0.12, p=0.048), but not in patients with a long version ((CCTTT)n ≧13 repeats) of the NOS2-promoter microsatellite. The NOS3-rs2070744(TT) and rs1799983(GG)-genotypes showed decreased risk for CSD (Log rank(TT): p=0.001; Log rank(GG): p=0.010, HR(GG): 0.16, p=0.030) and progression (Log rank(TT): p<0.001, HR(TT): 0.05, p=0.005; Log rank(GG): p<0.001, HR(GG): 0.10, p=0.003) after BCG-therapy compared to the other genotypes. There was also a reduction in recurrence in BCG-treated patients that was mostly genotype independent. Analysis of combined genotypes identified a subgroup of 30% of the BCG-treated patients that did not benefit from BCG-treatment. Our results suggest that the investigated polymorphisms influence patient response

  13. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: an updated meta-analysis and systematic review.

    Directory of Open Access Journals (Sweden)

    Himanshu Rai

    Full Text Available Several association studies of endothelial nitric oxide synthase (NOS3 gene polymorphisms with respect to coronary artery disease (CAD have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235, examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27 bp VNTR b/a with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28-1.52, and P<0.00001 for all comparisons, followed by T786-C (OR range = 1.34-1.42, and P<0.00001 for all comparisons and 4b/a, (OR range = 1.19-1.41, and P ≤ 0.002 for all comparisons in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54-1.87, and P<0.004 for all comparisons and 4b/a (OR range = 1.71-3.02, and P<0.00001 for all comparisons have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61-1.90, and P ≤ 0.01 for all comparisons.

  14. A common variant of endothelial nitric oxide synthase (Glu298Asp) is associated with collateral development in patients with chronic coronary occlusions

    International Nuclear Information System (INIS)

    Lamblin, Nicolas; Cuilleret, François J; Helbecque, Nicole; Dallongeville, Jean; Lablanche, Jean-Marc; Amouyel, Philippe; Bauters, Christophe; Van Belle, Eric

    2005-01-01

    Experimental studies support an important role for endothelial nitric oxide synthase (eNOS) in the regulation of angiogenesis. In humans, a common polymorphism exists in the eNOS gene that results in the conversion of glutamate to aspartate for codon 298. In vitro and in vivo studies have suggested a decreased NOS activity in patients with the Asp 298 variant. We hypothesized that a genetic-mediated decreased eNOS activity may limit collateral development in patients with chronic coronary occlusions. We selected 291 consecutive patients who underwent coronary angiography and who had at least one chronic (>15 days) total coronary occlusion. Collateral development was graded angiographically using two different methods: the collateral flow grade and the recipient filling grade. Genomic DNA was extracted from white blood cells and genotyping was performed using previously published techniques. Collateral development was lower in patients carrying the Asp 298 variant than in Glu-Glu homozygotes (collateral flow grade: 2.64 ± 0.08 and 2.89 ± 0.08, respectively, p = 0.04; recipient filling grade: 3.00 ± 0.08 and 3.24 ± 0.07, respectively, p = 0.04). By multivariable analysis, three variables were independently associated with the collateral flow grade: female gender, smoking, and the Asp 298 variant (p = 0.03) while the Asp 298 variant was the sole variable independently associated with the recipient filling grade (p = 0.03). Collateral development is lower in patients with the Asp 298 variant. This may be explained by the decreased NOS activity in patients with the Asp 298 variant. Further studies will have to determine whether increasing eNOS activity in humans is associated with coronary collateral development

  15. Association of NOS3 gene variants and clinical contributors of hypoxic-ischemic encephalopathy

    Energy Technology Data Exchange (ETDEWEB)

    Kuzmanić Šamija, R. [Department of Pediatrics, University Hospital Split, Split (Croatia); Primorac, D. [School of Medicine Split, University of Split, Split (Croatia); Department of Pediatrics, School of Medicine, University of Osijek, Osijek (Croatia); Eberly College of Science, Penn State University, University Park, PA (United States); St. Catherine Speciality Hospital, Zabok (Croatia); Rešić, B. [School of Medicine Split, University of Split, Split (Croatia); Pavlov, V. [Department of Neonatology, University Hospital Split, Split (Croatia); Čapkun, V. [Department of Nuclear Medicine, University Hospital Split, Split (Croatia); Punda, H. [School of Medicine Split, University of Split, Split (Croatia); Lozić, B. [Department of Pediatrics, University Hospital Split, Split (Croatia); Zemunik, T. [Department of Medical Biology, School of Medicine Split, University of Split, Split (Croatia)

    2014-08-15

    The aim of this study was to analyze the association of different clinical contributors of hypoxic-ischemic encephalopathy with NOS3 gene polymorphisms. A total of 110 children with hypoxic-ischemic encephalopathy and 128 control children were selected for this study. Association of gender, gestational age, birth weight, Apgar score, cranial ultrasonography, and magnetic resonance imaging findings with genotypic data of six haplotype-tagging single nucleotide polymorphisms and the most commonly investigated rs1800779 and rs2070744 polymorphisms was analyzed. The TGT haplotype of rs1800783, rs1800779, and rs2070744 polymorphisms was associated with hypoxic-ischemic encephalopathy. Children with the TGT haplotype were infants below 32 weeks of gestation and they had the most severe brain damage. Increased incidence of the TT genotype of the NOS3 rs1808593 SNP was found in the group of hypoxic-ischemic encephalopathy patients with medium and severe brain damage. The probability of brain damage was twice as high in children with the TT genotype than in children with the TG genotype of the same polymorphism. Furthermore, the T allele of the same polymorphism was twice as frequent in children with lower Apgar scores. This study strongly suggests associations of NOS3 gene polymorphism with intensity of brain damage and severity of the clinical picture in affected children.

  16. Association of NOS3 gene variants and clinical contributors of hypoxic-ischemic encephalopathy

    International Nuclear Information System (INIS)

    Kuzmanić Šamija, R.; Primorac, D.; Rešić, B.; Pavlov, V.; Čapkun, V.; Punda, H.; Lozić, B.; Zemunik, T.

    2014-01-01

    The aim of this study was to analyze the association of different clinical contributors of hypoxic-ischemic encephalopathy with NOS3 gene polymorphisms. A total of 110 children with hypoxic-ischemic encephalopathy and 128 control children were selected for this study. Association of gender, gestational age, birth weight, Apgar score, cranial ultrasonography, and magnetic resonance imaging findings with genotypic data of six haplotype-tagging single nucleotide polymorphisms and the most commonly investigated rs1800779 and rs2070744 polymorphisms was analyzed. The TGT haplotype of rs1800783, rs1800779, and rs2070744 polymorphisms was associated with hypoxic-ischemic encephalopathy. Children with the TGT haplotype were infants below 32 weeks of gestation and they had the most severe brain damage. Increased incidence of the TT genotype of the NOS3 rs1808593 SNP was found in the group of hypoxic-ischemic encephalopathy patients with medium and severe brain damage. The probability of brain damage was twice as high in children with the TT genotype than in children with the TG genotype of the same polymorphism. Furthermore, the T allele of the same polymorphism was twice as frequent in children with lower Apgar scores. This study strongly suggests associations of NOS3 gene polymorphism with intensity of brain damage and severity of the clinical picture in affected children

  17. SNP Arrays

    Directory of Open Access Journals (Sweden)

    Jari Louhelainen

    2016-10-01

    Full Text Available The papers published in this Special Issue “SNP arrays” (Single Nucleotide Polymorphism Arrays focus on several perspectives associated with arrays of this type. The range of papers vary from a case report to reviews, thereby targeting wider audiences working in this field. The research focus of SNP arrays is often human cancers but this Issue expands that focus to include areas such as rare conditions, animal breeding and bioinformatics tools. Given the limited scope, the spectrum of papers is nothing short of remarkable and even from a technical point of view these papers will contribute to the field at a general level. Three of the papers published in this Special Issue focus on the use of various SNP array approaches in the analysis of three different cancer types. Two of the papers concentrate on two very different rare conditions, applying the SNP arrays slightly differently. Finally, two other papers evaluate the use of the SNP arrays in the context of genetic analysis of livestock. The findings reported in these papers help to close gaps in the current literature and also to give guidelines for future applications of SNP arrays.

  18. The Association between NOS3 Gene Polymorphisms and Hypoxic-Ischemic Encephalopathy Susceptibility and Symptoms in Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Yongqin Wu

    2016-01-01

    Full Text Available Endothelial NOS (NOS3 has a potential role in the prevention of neuronal injury in hypoxic-ischemic encephalopathy (HIE. Thus, we aimed to explore the association between NOS3 gene polymorphisms and HIE susceptibility and symptoms in a Chinese Han population. Three single nucleotide polymorphisms (SNPs in the NOS3 gene, rs1800783, rs1800779, and rs2070744, were detected in 226 children with HIE and 212 healthy children in a Chinese Han population. Apgar scores and magnetic resonance image scans were used to estimate the symptoms and brain damage. The association analyses were conducted by using SNPStats and SPSS 18.0 software. The genotype and allele distributions of rs1800779 and rs1799983 displayed no significant differences between the patients and the controls, while the rs2070744 allele distribution was significantly different (corrected P=0.009. For clinical characteristics, the rs2070744 genotype distribution was significantly different in patients with different Apgar scores (≤5, TT/TC/CC = 6/7/5; 6~7, TT/TC/CC = 17/0/0; 8~9, TT/TC/CC = 6/2/0; 10, TT/TC/CC = 7/1/0; corrected P=0.006 in the 1001 to 1449 g birth weight subgroup. The haplotype test did not show any associations with the risk and clinical characteristics of HIE. The results suggest that NOS3 gene SNP rs2070744 was significantly associated with HIE susceptibility and symptom expression in Chinese Han population.

  19. Endothelial nitric oxide synthase single nucleotide polymorphism and left ventricular function in early chronic kidney disease.

    Directory of Open Access Journals (Sweden)

    Sourabh Chand

    Full Text Available Chronic kidney disease (CKD is associated with accelerated cardiovascular disease and heart failure. Endothelial nitric oxide synthase (eNOS Glu298Asp single nucleotide polymorphism (SNP genotype has been associated with a worse phenotype amongst patients with established heart failure and in patients with progression of their renal disease. The association of a cardiac functional difference in non-dialysis CKD patients with no known previous heart failure, and eNOS gene variant is investigated.140 non-dialysis CKD patients, who had cardiac magnetic resonance (CMR imaging and tissue doppler echocardiography as part of two clinical trials, were genotyped for eNOS Glu298Asp SNP retrospectively.The median estimated glomerular filtration rate (eGFR was 50 mls/min and left ventricular ejection fraction (LVEF was 74% with no overt diastolic dysfunction in this cohort. There were significant differences in LVEF across eNOS genotypes with GG genotype being associated with a worse LVEF compared to other genotypes (LVEF: GG 71%, TG 76%, TT 73%, p = 0.006. After multivariate analysis, (adjusting for age, eGFR, baseline mean arterial pressure, contemporary CMR heart rate, total cholesterol, high sensitive C-reactive protein, body mass index and gender GG genotype was associated with a worse LVEF, and increased LV end-diastolic and systolic index (p = 0.004, 0.049 and 0.009 respectively.eNOS Glu298Asp rs1799983 polymorphism in CKD patients is associated with relevant sub-clinical cardiac remodelling as detected by CMR. This gene variant may therefore represent an important genetic biomarker, and possibly highlight pathways for intervention, in these patients who are at particular risk of worsening cardiac disease as their renal dysfunction progresses.

  20. NOS3 Variants, Physical Activity, and Blood Pressure in the European Youth Heart Study

    DEFF Research Database (Denmark)

    Grøntved, Anders; Andersen, Lars Bo; Franks, Paul W

    2011-01-01

    BackgroundIn this study, we examined the influence of genetic variation in NOS3 on resting blood pressure (BP) in children and adolescents from the European Youth Heart Study (EYHS). Because the NOS3 gene expression is altered by physical activity (PA), we also tested for interaction between...

  1. SNP interaction pattern identifier (SIPI)

    DEFF Research Database (Denmark)

    Lin, Hui Yi; Chen, Dung Tsa; Huang, Po Yu

    2017-01-01

    Motivation: Testing SNP-SNP interactions is considered as a key for overcoming bottlenecks of genetic association studies. However, related statistical methods for testing SNP-SNP interactions are underdeveloped. Results: We propose the SNP Interaction Pattern Identifier (SIPI), which tests 45...

  2. SNP genotyping technologies

    DEFF Research Database (Denmark)

    Studer, Bruno; Kölliker, Roland

    2013-01-01

    In the recent years, single nucleotide polymorphism (SNP) markers have emerged as the marker technology of choice for plant genetics and breeding applications. Besides the efficient technologies available for SNP discovery even in complex genomes, one of the main reasons for this is the availabil...

  3. dbSNP

    Data.gov (United States)

    U.S. Department of Health & Human Services — dbSNP is a database of single nucleotide polymorphisms (SNPs) and multiple small-scale variations that include insertions/deletions, microsatellites, and...

  4. Circulating NOS3 modulates left ventricular remodeling following reperfused myocardial infarction.

    Directory of Open Access Journals (Sweden)

    Simone Gorressen

    Full Text Available Nitric oxide (NO is constitutively produced and released from the endothelium and several blood cell types by the isoform 3 of the NO synthase (NOS3. We have shown that NO protects against myocardial ischemia/reperfusion (I/R injury and that depletion of circulating NOS3 increases within 24 h of ischemia/reperfusion the size of myocardial infarction (MI in chimeric mice devoid of circulating NOS3. In the current study we hypothesized that circulating NOS3 also affects remodeling of the left ventricle following reperfused MI.To analyze the role of circulating NOS3 we transplanted bone marrow of NOS3-/- and wild type (WT mice into WT mice, producing chimerae expressing NOS3 only in vascular endothelium (BC-/EC+ or in both, blood cells and vascular endothelium (BC+/EC+. Both groups underwent 60 min of coronary occlusion in a closed-chest model of reperfused MI. During the 3 weeks post MI, structural and functional LV remodeling was serially assessed (24 h, 4 d, 1 w, 2 w and 3 w by echocardiography. At 72 hours post MI, gene expression of several extracellular matrix (ECM modifying molecules was determined by quantitative RT-PCR analysis. At 3 weeks post MI, hemodynamics were obtained by pressure catheter, scar size and collagen content were quantified post mortem by Gomori's One-step trichrome staining.Three weeks post MI, LV end-systolic (53.2±5.9 μl; ***p≤0.001; n = 5 and end-diastolic volumes (82.7±5.6 μl; *p<0.05; n = 5 were significantly increased in BC-/EC+, along with decreased LV developed pressure (67.5±1.8 mm Hg; n = 18; ***p≤0.001 and increased scar size/left ventricle (19.5±1.5%; n = 13; **p≤0.01 compared to BC+/EC+ (ESV: 35.6±2.2 μl; EDV: 69.1±2.6 μl n = 8; LVDP: 83.2±3.2 mm Hg; n = 24; scar size/LV13.8±0.7%; n = 16. Myocardial scar of BC-/EC+ was characterized by increased total collagen content (20.2±0.8%; n = 13; ***p≤0.001 compared to BC+/EC+ (15.9±0.5; n = 16, and increased collagen type I and III subtypes

  5. Evidence of Aortopathy in Mice with Haploinsufficiency of Notch1 in Nos3-Null Background

    Directory of Open Access Journals (Sweden)

    Sara N. Koenig

    2015-03-01

    Full Text Available Thoracic aortic aneurysms (TAA are a significant cause of morbidity and mortality in humans. While the exact etiology is unknown, genetic factors play an important role. Mutations in NOTCH1 have been linked to bicuspid aortic valve (BAV and aortopathy in humans. The aim of this study was to determine if haploinsufficiency of Notch1 contributes to aortopathy using Notch1+/−; Nos3−/− mice. Echocardiographic analysis of Notch1+/−; Nos3−/− mice reveals effacement of the sinotubular junction and a trend toward dilation of the aortic sinus. Furthermore, examination of the proximal aorta of Notch1+/−; Nos3−/− mice reveals elastic fiber degradation, a trend toward increased matrix metalloproteinase 2 expression, and increased smooth muscle cell apoptosis, features characteristic of aneurysmal disease. Although at a lower penetrance, we also found features consistent with aortopathic changes in Notch1 heterozygote mice and in Nos3-null mice. Our findings implicate a novel role for Notch1 in aortopathy of the proximal aorta.

  6. Association of the NOS3 intron-4 VNTR polymorphism with aneurysmal subarachnoid hemorrhage

    DEFF Research Database (Denmark)

    Staalsø, Jonatan Myrup; Edsen, Troels; Kotinis, Alexandros

    2014-01-01

    OBJECT: The nitric oxide system has been linked to the pathogenesis of aneurysmal subarachnoid hemorrhage (SAH). The authors performed a case-control study to investigate the association between SAH and common genetic variants within the endothelial nitric oxide synthase gene (NOS3). METHODS: Thr...

  7. SNP-PHAGE – High throughput SNP discovery pipeline

    Directory of Open Access Journals (Sweden)

    Cregan Perry B

    2006-10-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs as defined here are single base sequence changes or short insertion/deletions between or within individuals of a given species. As a result of their abundance and the availability of high throughput analysis technologies SNP markers have begun to replace other traditional markers such as restriction fragment length polymorphisms (RFLPs, amplified fragment length polymorphisms (AFLPs and simple sequence repeats (SSRs or microsatellite markers for fine mapping and association studies in several species. For SNP discovery from chromatogram data, several bioinformatics programs have to be combined to generate an analysis pipeline. Results have to be stored in a relational database to facilitate interrogation through queries or to generate data for further analyses such as determination of linkage disequilibrium and identification of common haplotypes. Although these tasks are routinely performed by several groups, an integrated open source SNP discovery pipeline that can be easily adapted by new groups interested in SNP marker development is currently unavailable. Results We developed SNP-PHAGE (SNP discovery Pipeline with additional features for identification of common haplotypes within a sequence tagged site (Haplotype Analysis and GenBank (-dbSNP submissions. This tool was applied for analyzing sequence traces from diverse soybean genotypes to discover over 10,000 SNPs. This package was developed on UNIX/Linux platform, written in Perl and uses a MySQL database. Scripts to generate a user-friendly web interface are also provided with common queries for preliminary data analysis. A machine learning tool developed by this group for increasing the efficiency of SNP discovery is integrated as a part of this package as an optional feature. The SNP-PHAGE package is being made available open source at http://bfgl.anri.barc.usda.gov/ML/snp-phage/. Conclusion SNP-PHAGE provides a bioinformatics

  8. SAQC: SNP Array Quality Control

    Directory of Open Access Journals (Sweden)

    Li Ling-Hui

    2011-04-01

    Full Text Available Abstract Background Genome-wide single-nucleotide polymorphism (SNP arrays containing hundreds of thousands of SNPs from the human genome have proven useful for studying important human genome questions. Data quality of SNP arrays plays a key role in the accuracy and precision of downstream data analyses. However, good indices for assessing data quality of SNP arrays have not yet been developed. Results We developed new quality indices to measure the quality of SNP arrays and/or DNA samples and investigated their statistical properties. The indices quantify a departure of estimated individual-level allele frequencies (AFs from expected frequencies via standardized distances. The proposed quality indices followed lognormal distributions in several large genomic studies that we empirically evaluated. AF reference data and quality index reference data for different SNP array platforms were established based on samples from various reference populations. Furthermore, a confidence interval method based on the underlying empirical distributions of quality indices was developed to identify poor-quality SNP arrays and/or DNA samples. Analyses of authentic biological data and simulated data show that this new method is sensitive and specific for the detection of poor-quality SNP arrays and/or DNA samples. Conclusions This study introduces new quality indices, establishes references for AFs and quality indices, and develops a detection method for poor-quality SNP arrays and/or DNA samples. We have developed a new computer program that utilizes these methods called SNP Array Quality Control (SAQC. SAQC software is written in R and R-GUI and was developed as a user-friendly tool for the visualization and evaluation of data quality of genome-wide SNP arrays. The program is available online (http://www.stat.sinica.edu.tw/hsinchou/genetics/quality/SAQC.htm.

  9. Association between polymorphisms in NOS3 and KCNH2 and social memory

    Directory of Open Access Journals (Sweden)

    Susanne eHenningsson

    2015-10-01

    Full Text Available Social memory, including the ability to recognize faces and voices, is essential for social relationships. It has a large heritable component, but the knowledge about the contributing genes is sparse. The genetic variation underlying inter-individual differences in social memory was investigated in an exploratory sample (n=55, genotyped with a chip comprising approximately 200.000 single nucleotide polymorphisms (SNPs, and in a validation sample (n=582, where 30 SNPs were targeted. In the exploratory study face identity recognition was measured. The validation study also measured vocal sound recognition, as well as recognition of faces and vocal sounds combined (multimodal condition. In the exploratory study, the 30 SNPs that were associated with face recognition at puncorrected<0.001 and located in genes, were chosen for further study. In the validation study two of the SNPs showed significant associations with recognition of faces, vocal sounds, and multimodal stimuli: rs1800779 in the gene encoding nitric oxide synthase 3 (NOS3 and rs3807370 in the gene encoding the voltage-gated channel, subfamily H, member 2 (KCNH2, in strong linkage disequilibrium with each other. The uncommon alleles were associated with superior performance, and the effects were present for men only (p<0.0002. The exploratory study also showed a weaker but significant association with (non-emotional word recognition, an effect that was independent of the effect on face recognition. This study demonstrates evidence for an association between NOS3 and KCNH2 SNPs and social memory.

  10. Influence of training status and eNOS haplotypes on plasma nitrite concentrations in normotensive older adults: a hypothesis-generating study.

    Science.gov (United States)

    da Silva, Roberta Fernanda; Sertório, Jonas Tadeu Cau; Lacchini, Riccardo; Trapé, Atila Alexandre; Tanus-Santos, José Eduardo; Rush, James W E; Amaral, Sandra Lia; Zago, Anderson Saranz

    2014-12-01

    The purpose of this study was to evaluate the relationship between 3 eNOS gene polymorphisms and training status (TS) in affecting plasma nitrite concentration (NO2) in normotensive adults over 50 years old. Resting blood pressure (BP) was measured in all participants (n = 101). Plasma was taken to analyze: lipid profile, nitrite concentration (NO2) and lipid peroxide levels (T-BARS). Also, genomic DNA was extracted from plasma for genotyping NOS3 polymorphisms (-786T>C; 894G>T; and VNTR in intron 4). TS was determined by one-mile walk test and Functional Fitness Test Battery from AAHPERD (TS1-regular TS; TS2-good TS; and TS3-very good TS). BP was not influenced by TS, but NO2 was 15% higher in TS3 (123 ± 27 nM) compared to TS-2 (106 ± 22 nM). No differences were found in plasma NO2 in the haplotype analyses. However, the presence of the C allele (T-786C) and ASP allele (Glu298Asp) was found to enhance the correlation between TS and NO2 levels (r = 0.492 in C/4b/ASP haplotype and r = 0.855 in C/4a/ASP haplotype). This study thus identifies NOS3 polymorphism-dependent sensitivity to the effects of physical training on plasma NO2. Maintenance of good levels of training status, in carriers of C allele for T-786C polymorphism, combined with ASP allele for Glu298Asp polymorphism, may result in an increase in the NO2 plasma concentrations, which may reflect improved NO bioavailability in older adult normotensive individuals.

  11. KONSUMSI MIKRONUTRIEN DAN EKSPRESI GEN eNOS3 ALEL INTRO 4a4b PADA PENDERITA HIPERTENSI ETNIK MINANGKABAU

    Directory of Open Access Journals (Sweden)

    Delmi Sulastri

    2011-05-01

    Full Text Available AbstrakGen eNOS3 varian intron 4a4b merupakan salah satu gen yang berhubungan dengan kejadian hipertensi esensial. Kemampuan Gen eNOS3 varian ini untuk mensintesis enzim nitric oxide synthase (NOS berkurang sehingga sintesis Nitric oxide (NO menurun. Senyawa NO adalah suatu senyawa vasoaktif yang menyebabkan vasodilatasi pembuluh darah.Penelitian pada subjek hipertensi dan normotensi berusia 30-65 tahun bertujuan untuk melihat pengaruh mikronutrien terhadap ekspresi gen eNOS3 alel intron 4a4b. 130 subjek, diwawancara pola makannya lalu dilakukan analisis asupan mikronutrien, gen eNOS3, serta kadar NO plasma. Data yang diperoleh dianalisis menggunakan uji T dan chi-square.Kadar NO plasma penderita hipertensi adalah 26.91 + 15.40 μM/L dan normotensi 25.79 + 15.04 μM/L. 55.5% subjek hipertensi memiliki gen eNOS3 varian intron 4b dan 69% subjek normotensi mempunyai varian intron 4a4b. Kadar NO plasma rendah, (66.7% ditemukan pada subjek hipertensi dengan varian intron 4b. Tidak terdapat hubungan bermakna asupan mikronutrien dengan kadar NO plasma pada subjek hipertensi.Hasil ini tidak mendukung pengaruh konsumsi mikronutrien terhadap kadar NO plasma pada penderita hipertensi dengan gen eNOS3 varian intron 4a4b.Kata Kunci : hipertensi esensial, gen eNOS3, kadar NO plasmaAbstracteNOS 3 gene intron 4a4b allel is one of the important genes which is related to hypertesion essensial. This gene expresses the nitric oxide synthase (NOS enzyme which regulates the synthesis of Nitric oxide (NO in human body. NO causes vasodilatation, which decreases peripheral resistant and blood pressure.A research has been done based on cross sectional study on hypertension patients and those with normal blood pressure in the range of 30-65 years old. The main of this research is to evaluate the influence of micronutrient consumption on eNOS3 gene intron 4a4b allel expression in hypertension subjects in Minangkabau ethnicity. 130 subjects interviewed about micronutrient

  12. Nitric Oxide Synthase Enzymes in the Airways of Mice Exposed to Ovalbumin: NOS2 Expression Is NOS3 Dependent

    Directory of Open Access Journals (Sweden)

    Jennifer M. Bratt

    2010-01-01

    Full Text Available Objectives and Design. The function of the airway nitric oxide synthase (NOS isoforms and the lung cell types responsible for its production are not fully understood. We hypothesized that NO homeostasis in the airway is important to control inflammation, which requires upregulation, of NOS2 protein expression by an NOS3-dependent mechanism. Materials or Subjects. Mice from a C57BL/6 wild-type, NOS1−/−, NOS2−/−, and NOS3−/− genotypes were used. All mice strains were systemically sensitized and exposed to filtered air or ovalbumin (OVA aerosol for two weeks to create a subchronic model of allergen-induced airway inflammation. Methods. We measured lung function, lung lavage inflammatory and airway epithelial goblet cell count, exhaled NO, nitrate and nitrite concentration, and airway NOS1, NOS2, and NOS3 protein content. Results. Deletion of NOS1 or NOS3 increases NOS2 protein present in the airway epithelium and smooth muscle of air-exposed animals. Exposure to allergen significantly reduced the expression of NOS2 protein in the airway epithelium and smooth muscle of the NOS3−/− strain only. This reduction in NOS2 expression was not due to the replacement of epithelial cells with goblet cells as remaining epithelial cells did not express NOS2. NOS1−/− animals had significantly reduced goblet cell metaplasia compared to C57Bl/6 wt, NOS2−/−, and NOS3−/− allergen-exposed mice. Conclusion. The airway epithelial and smooth muscle cells maintain a stable airway NO concentration under noninflammatory conditions. This “homeostatic” mechanism is unable to distinguish between NOS derived from the different constitutive NOS isoforms. NOS3 is essential for the expression of NOS2 under inflammatory conditions, while NOS1 expression contributes to allergen-induced goblet cell metaplasia.

  13. Nitric Oxide Synthase Enzymes in the Airways of Mice Exposed to Ovalbumin: NOS2 Expression Is NOS3 Dependent

    Science.gov (United States)

    Bratt, Jennifer M.; Williams, Keisha; Rabowsky, Michelle F.; Last, Michael S.; Franzi, Lisa M.; Last, Jerold A.; Kenyon, Nicholas J.

    2010-01-01

    Objectives and Design. The function of the airway nitric oxide synthase (NOS) isoforms and the lung cell types responsible for its production are not fully understood. We hypothesized that NO homeostasis in the airway is important to control inflammation, which requires upregulation, of NOS2 protein expression by an NOS3-dependent mechanism. Materials or Subjects. Mice from a C57BL/6 wild-type, NOS1−/−, NOS2−/−, and NOS3−/− genotypes were used. All mice strains were systemically sensitized and exposed to filtered air or ovalbumin (OVA) aerosol for two weeks to create a subchronic model of allergen-induced airway inflammation. Methods. We measured lung function, lung lavage inflammatory and airway epithelial goblet cell count, exhaled NO, nitrate and nitrite concentration, and airway NOS1, NOS2, and NOS3 protein content. Results. Deletion of NOS1 or NOS3 increases NOS2 protein present in the airway epithelium and smooth muscle of air-exposed animals. Exposure to allergen significantly reduced the expression of NOS2 protein in the airway epithelium and smooth muscle of the NOS3−/− strain only. This reduction in NOS2 expression was not due to the replacement of epithelial cells with goblet cells as remaining epithelial cells did not express NOS2. NOS1−/− animals had significantly reduced goblet cell metaplasia compared to C57Bl/6 wt, NOS2−/−, and NOS3−/− allergen-exposed mice. Conclusion. The airway epithelial and smooth muscle cells maintain a stable airway NO concentration under noninflammatory conditions. This “homeostatic” mechanism is unable to distinguish between NOS derived from the different constitutive NOS isoforms. NOS3 is essential for the expression of NOS2 under inflammatory conditions, while NOS1 expression contributes to allergen-induced goblet cell metaplasia. PMID:20953358

  14. Report on ISFG SNP Panel Discussion

    DEFF Research Database (Denmark)

    Butler, John M.; Budowle, B.; Gill, P.

    2008-01-01

    Six scientists presented their views and experience with single nucleotide polymorphism (SNP) markers, multiplexes, and methods regarding their potential application in forensic identity and relationship testing. Benefits and limitations of SNPs were reviewed, as were different SNP marker...

  15. A NOS3 polymorphism determines endothelial response to folate in children with type 1 diabetes or obesity.

    Science.gov (United States)

    Wiltshire, Esko J; Peña, Alexia S; MacKenzie, Karen; Bose-Sundernathan, Tulika; Gent, Roger; Couper, Jennifer J

    2015-02-01

    To determine the effect of polymorphisms in NOS3 and folate pathway enzymes on vascular function and folate status and endothelial response to folate in children with diabetes or obesity. A total of 244 subjects (age 13.8 ± 2.8 years, 125 males) were studied for NOS3 and/or folate pathway polymorphisms using polymerase chain reaction/restriction fragment length polymorphism, including at baseline: 139 with type 1 diabetes; 58 with obesity; and 47 controls. The effect of NOS3 genotype on endothelial response to folate (5 mg) was assessed in 85 subjects with diabetes and 28 obese subjects who received active treatment during intervention trials. Vascular function (flow-mediated dilatation [FMD] and glyceryl trinitrate-mediated dilatation), clinical, and biochemical measurements were assessed at baseline and 8 weeks in folate intervention studies. Folate pathway enzyme and NOS3 polymorphisms did not significantly affect baseline vascular function. The polymorphism in intron 4 of endothelial nitric oxide synthase altered endothelial response to folate significantly: in subjects with diabetes FMD improved by 6.4 ± 5% (insertion carriers) vs 2.3 ± 6.6% (deletion carriers), P = .01; in obese subjects FMD improved by 1.8 ± 5.4% (insertion carriers) and deteriorated by -3.2 ± 7.2% (deletion carriers), P = .05. More subjects carrying the insertion normalized FMD after folate supplementation (insertion 64% vs deletion 28%, χ(2) = 10.14, P = .001). A NOS3 polymorphism predicts endothelial response to folate in children with diabetes or obesity, with implications for vascular risk and folate intervention studies. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. SNP-SNP interactions in breast cancer susceptibility

    International Nuclear Information System (INIS)

    Onay, Venüs Ümmiye; Ozcelik, Hilmi; Briollais, Laurent; Knight, Julia A; Shi, Ellen; Wang, Yuanyuan; Wells, Sean; Li, Hong; Rajendram, Isaac; Andrulis, Irene L

    2006-01-01

    Breast cancer predisposition genes identified to date (e.g., BRCA1 and BRCA2) are responsible for less than 5% of all breast cancer cases. Many studies have shown that the cancer risks associated with individual commonly occurring single nucleotide polymorphisms (SNPs) are incremental. However, polygenic models suggest that multiple commonly occurring low to modestly penetrant SNPs of cancer related genes might have a greater effect on a disease when considered in combination. In an attempt to identify the breast cancer risk conferred by SNP interactions, we have studied 19 SNPs from genes involved in major cancer related pathways. All SNPs were genotyped by TaqMan 5'nuclease assay. The association between the case-control status and each individual SNP, measured by the odds ratio and its corresponding 95% confidence interval, was estimated using unconditional logistic regression models. At the second stage, two-way interactions were investigated using multivariate logistic models. The robustness of the interactions, which were observed among SNPs with stronger functional evidence, was assessed using a bootstrap approach, and correction for multiple testing based on the false discovery rate (FDR) principle. None of these SNPs contributed to breast cancer risk individually. However, we have demonstrated evidence for gene-gene (SNP-SNP) interaction among these SNPs, which were associated with increased breast cancer risk. Our study suggests cross talk between the SNPs of the DNA repair and immune system (XPD-[Lys751Gln] and IL10-[G(-1082)A]), cell cycle and estrogen metabolism (CCND1-[Pro241Pro] and COMT-[Met108/158Val]), cell cycle and DNA repair (BARD1-[Pro24Ser] and XPD-[Lys751Gln]), and within carcinogen metabolism (GSTP1-[Ile105Val] and COMT-[Met108/158Val]) pathways. The importance of these pathways and their communication in breast cancer predisposition has been emphasized previously, but their biological interactions through SNPs have not been described

  17. SNP-SNP interactions in breast cancer susceptibility

    Directory of Open Access Journals (Sweden)

    Wang Yuanyuan

    2006-05-01

    Full Text Available Abstract Background Breast cancer predisposition genes identified to date (e.g., BRCA1 and BRCA2 are responsible for less than 5% of all breast cancer cases. Many studies have shown that the cancer risks associated with individual commonly occurring single nucleotide polymorphisms (SNPs are incremental. However, polygenic models suggest that multiple commonly occurring low to modestly penetrant SNPs of cancer related genes might have a greater effect on a disease when considered in combination. Methods In an attempt to identify the breast cancer risk conferred by SNP interactions, we have studied 19 SNPs from genes involved in major cancer related pathways. All SNPs were genotyped by TaqMan 5'nuclease assay. The association between the case-control status and each individual SNP, measured by the odds ratio and its corresponding 95% confidence interval, was estimated using unconditional logistic regression models. At the second stage, two-way interactions were investigated using multivariate logistic models. The robustness of the interactions, which were observed among SNPs with stronger functional evidence, was assessed using a bootstrap approach, and correction for multiple testing based on the false discovery rate (FDR principle. Results None of these SNPs contributed to breast cancer risk individually. However, we have demonstrated evidence for gene-gene (SNP-SNP interaction among these SNPs, which were associated with increased breast cancer risk. Our study suggests cross talk between the SNPs of the DNA repair and immune system (XPD-[Lys751Gln] and IL10-[G(-1082A], cell cycle and estrogen metabolism (CCND1-[Pro241Pro] and COMT-[Met108/158Val], cell cycle and DNA repair (BARD1-[Pro24Ser] and XPD-[Lys751Gln], and within carcinogen metabolism (GSTP1-[Ile105Val] and COMT-[Met108/158Val] pathways. Conclusion The importance of these pathways and their communication in breast cancer predisposition has been emphasized previously, but their

  18. Population genetic analysis of ascertained SNP data

    Directory of Open Access Journals (Sweden)

    Nielsen Rasmus

    2004-03-01

    Full Text Available Abstract The large single nucleotide polymorphism (SNP typing projects have provided an invaluable data resource for human population geneticists. Almost all of the available SNP loci, however, have been identified through a SNP discovery protocol that will influence the allelic distributions in the sampled loci. Standard methods for population genetic analysis based on the available SNP data will, therefore, be biased. This paper discusses the effect of this ascertainment bias on allelic distributions and on methods for quantifying linkage disequilibrium and estimating demographic parameters. Several recently developed methods for correcting for the ascertainment bias will also be discussed.

  19. Utilization of the NASA Operational Simulator for Small Satellites (NOS3) for V&V of STF-1’s Semiautonomous On-Orbit Operations

    OpenAIRE

    Grubb, Matthew; Lucas, John; Morris, Justin; Zemerick, Scott

    2017-01-01

    The NASA Operational Simulator for Small Satellites (NOS3) is a suite of software tools that significantly aids the SmallSat community with software development, integration and test (I&T), mission operations/training, verification and validation (V&V), and software systems check-out. NOS3 has been utilized extensively for NASA’s Simulation-to-Flight 1 (STF-1) cubesat mission with respect to V&V of its semiautonomous science operations. NOS3 provides a software development environment, a mult...

  20. SNP-RFLPing 2: an updated and integrated PCR-RFLP tool for SNP genotyping

    Directory of Open Access Journals (Sweden)

    Chang Hsueh-Wei

    2010-04-01

    Full Text Available Abstract Background PCR-restriction fragment length polymorphism (RFLP assay is a cost-effective method for SNP genotyping and mutation detection, but the manual mining for restriction enzyme sites is challenging and cumbersome. Three years after we constructed SNP-RFLPing, a freely accessible database and analysis tool for restriction enzyme mining of SNPs, significant improvements over the 2006 version have been made and incorporated into the latest version, SNP-RFLPing 2. Results The primary aim of SNP-RFLPing 2 is to provide comprehensive PCR-RFLP information with multiple functionality about SNPs, such as SNP retrieval to multiple species, different polymorphism types (bi-allelic, tri-allelic, tetra-allelic or indels, gene-centric searching, HapMap tagSNPs, gene ontology-based searching, miRNAs, and SNP500Cancer. The RFLP restriction enzymes and the corresponding PCR primers for the natural and mutagenic types of each SNP are simultaneously analyzed. All the RFLP restriction enzyme prices are also provided to aid selection. Furthermore, the previously encountered updating problems for most SNP related databases are resolved by an on-line retrieval system. Conclusions The user interfaces for functional SNP analyses have been substantially improved and integrated. SNP-RFLPing 2 offers a new and user-friendly interface for RFLP genotyping that can be used in association studies and is freely available at http://bio.kuas.edu.tw/snp-rflping2.

  1. SNP-RFLPing 2: an updated and integrated PCR-RFLP tool for SNP genotyping.

    Science.gov (United States)

    Chang, Hsueh-Wei; Cheng, Yu-Huei; Chuang, Li-Yeh; Yang, Cheng-Hong

    2010-04-08

    PCR-restriction fragment length polymorphism (RFLP) assay is a cost-effective method for SNP genotyping and mutation detection, but the manual mining for restriction enzyme sites is challenging and cumbersome. Three years after we constructed SNP-RFLPing, a freely accessible database and analysis tool for restriction enzyme mining of SNPs, significant improvements over the 2006 version have been made and incorporated into the latest version, SNP-RFLPing 2. The primary aim of SNP-RFLPing 2 is to provide comprehensive PCR-RFLP information with multiple functionality about SNPs, such as SNP retrieval to multiple species, different polymorphism types (bi-allelic, tri-allelic, tetra-allelic or indels), gene-centric searching, HapMap tagSNPs, gene ontology-based searching, miRNAs, and SNP500Cancer. The RFLP restriction enzymes and the corresponding PCR primers for the natural and mutagenic types of each SNP are simultaneously analyzed. All the RFLP restriction enzyme prices are also provided to aid selection. Furthermore, the previously encountered updating problems for most SNP related databases are resolved by an on-line retrieval system. The user interfaces for functional SNP analyses have been substantially improved and integrated. SNP-RFLPing 2 offers a new and user-friendly interface for RFLP genotyping that can be used in association studies and is freely available at http://bio.kuas.edu.tw/snp-rflping2.

  2. SNP genotyping by DNA photoligation: application to SNP detection of genes from food crops

    Energy Technology Data Exchange (ETDEWEB)

    Yoshimura, Yoshinaga; Ohtake, Tomoko; Okada, Hajime; Fujimoto, Kenzo [School of Materials Science, Japan Advanced Institute of Science and Technology, 1-1 Asahidai, Nomi, Ishikawa 923-1292 (Japan); Ami, Takehiro [Innovation Plaza Ishikawa, Japan Science and Technology Agency, 2-13 Asahidai, Nomi, Ishikawa 923-1211 (Japan); Tsukaguchi, Tadashi, E-mail: kenzo@jaist.ac.j [Faculty of Bioresources and Environmental Sciences, Ishikawa Prefectural University, 1-308 Suematsu, Nonoichi, Ishikawa 921-8836 (Japan)

    2009-06-15

    We describe a simple and inexpensive single-nucleotide polymorphism (SNP) typing method, using DNA photoligation with 5-carboxyvinyl-2'-deoxyuridine and two fluorophores. This SNP-typing method facilitates qualitative determination of genes from indica and japonica rice, and showed a high degree of single nucleotide specificity up to 10 000. This method can be used in the SNP typing of actual genomic DNA samples from food crops.

  3. SNP genotyping by DNA photoligation: application to SNP detection of genes from food crops

    Directory of Open Access Journals (Sweden)

    Yoshinaga Yoshimura, Tomoko Ohtake, Hajime Okada, Takehiro Ami, Tadashi Tsukaguchi and Kenzo Fujimoto

    2009-01-01

    Full Text Available We describe a simple and inexpensive single-nucleotide polymorphism (SNP typing method, using DNA photoligation with 5-carboxyvinyl-2'-deoxyuridine and two fluorophores. This SNP-typing method facilitates qualitative determination of genes from indica and japonica rice, and showed a high degree of single nucleotide specificity up to 10 000. This method can be used in the SNP typing of actual genomic DNA samples from food crops.

  4. Resveratrol Increases Serum BDNF Concentrations and Reduces Vascular Smooth Muscle Cells Contractility via a NOS-3-Independent Mechanism

    Directory of Open Access Journals (Sweden)

    Michał Wiciński

    2017-01-01

    Full Text Available Resveratrol is a polyphenol that presents both antineuroinflammatory properties and the ability to interact with NOS-3, what contributes to vasorelaxation. Brain-derived neurotrophic factor (BNDF, a molecule associated with neuroprotection in many neurodegenerative disorders, is considered as an important element of maintaining stable cerebral blood flow. Vascular smooth muscle cells (VSMCs are considered to be an important element in the pathogenesis of neurodegeneration and a potential preventative target by agents which reduce the contractility of the vessels. Our main objectives were to define the relationship between serum and long-term oral resveratrol administration in the rat model, as well as to assess the effect of resveratrol on phenylephrine- (PHE- induced contraction of vascular smooth muscle cells (VSMCs. Moreover, we attempt to define the dependence of contraction mechanisms on endothelial NO synthase. Experiments were performed on Wistar rats (n=17 pretreated with resveratrol (4 weeks; 10 mg/kg p.o. or placebo. Serum BDNF levels were quantified after 2 and 4 weeks of treatment with ELISA. Contraction force was measured on isolated and perfused tail arteries as the increase of perfusion pressure with a constant flow. Values of serum BNDF in week 0 were 1.18±0.12 ng/mL (treated and 1.17±0.13 ng/mL (control (p = ns. After 2 weeks of treatment, BDNF in the treatment group was higher than in controls, 1.52±0.23 ng/mL and 1.24±0.13 ng/mL, respectively. (p=0.02 Following 4 weeks of treatment, BDNF values were higher in the resveratrol group compared to control 1.64±0.31 ng/mL and 1.32±0.26 ng/mL, respectively (p=0.031. EC50 values obtained for PHE in resveratrol pretreated arteries were significantly higher than controls (5.33±1.7 × 10−7 M/L versus 4.53±1.2 × 10−8 M/L, p<0.05. These results show a significant increase in BDNF concentration in the resveratrol pretreated group. The reactivity of resistant

  5. Genome-Wide SNP Detection, Validation, and Development of an 8K SNP Array for Apple

    NARCIS (Netherlands)

    Chagné, D.; Crowhurst, R.N.; Troggio, M.; Davey, M.W.; Gilmore, B.; Lawley, C.; Vanderzande, S.; Hellens, R.P.; Kumar, S.; Cestaro, A.; Velasco, R.; Main, D.; Rees, J.D.; Iezzoni, A.F.; Mockler, T.; Wilhelm, L.; Weg, van de W.E.; Gardiner, S.E.; Bassil, N.; Peace, C.

    2012-01-01

    As high-throughput genetic marker screening systems are essential for a range of genetics studies and plant breeding applications, the International RosBREED SNP Consortium (IRSC) has utilized the Illumina Infinium® II system to develop a medium- to high-throughput SNP screening tool for genome-wide

  6. Tumor Necrosis Factor (TNF -308G>A, Nitric Oxide Synthase 3 (NOS3 +894G>T Polymorphisms and Migraine Risk: A Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Min Chen

    Full Text Available Conflicting data have been reported on the association between tumor necrosis factor (TNF -308G>A and nitric oxide synthase 3 (NOS3 +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF -308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine.We performed an updated meta-analysis for TNF -308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR and 95% confidence intervals (95% CI assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates.Eleven studies in 6682 migraineurs and 22591 controls for TNF -308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the "A" allele of the TNF -308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 - 2.87. The risk of migraine with aura (MA was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the "T" allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 - 3.88.Our findings appear to support the hypothesis that the TNF -308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians.

  7. [Association of I/D and -786 Polymorphisms of ACE and NOS3 Genes With Features of the Course of Ischemic Heart Disease and Diabetes Mellitus Type 2].

    Science.gov (United States)

    Afanasiev, S A; Muslimova, E F; Rebrov, T Y; Sergienko, T N; Repin, A N

    2016-09-01

    to study relationship of ACE insertion-deletion (I/D) polymorphism and NOS3 T-786C polymorphism with characteristics of the course of ischemic heart disease (IHD) at the background of diabetes mellitus. Were examined 114 patients with IHD, 29.8% of patients had type 2 diabetes mellitus. ACE and NOS3 polymorphisms were determined by allele-specific polymerase chain reaction with primers by "Lytech". Patients with combined pathology belonged to older age group, had increased frequency of obesity and predominance of functional class II chronic heart failure. In this group we detected association of D allele of the ACE gene with higher frequency of dyslipidemia and obesity. Among patients with IHD without diabetes we observed associations of ACE I/D and NOS3 T-786C polymorphisms (close and moderate, respectively) with severity of effort angina. We also found that frequency of dyslipidemia among carriers of II and TT genotypes was lower than among carriers of other genotypes. Presence of type 2 diabetes as background pathology leads to a change of character of association of ACE I/D and NOS3 T-786C polymorphisms with clinical characteristics of patients with IHD.

  8. Interaction between the NOS3 gene and obesity as a determinant of risk of type 2 diabetes: the Atherosclerosis Risk in Communities study.

    Directory of Open Access Journals (Sweden)

    Jan Bressler

    Full Text Available Endothelial nitric oxide synthase 3 (NOS3 catalyzes the production of nitric oxide from L-arginine in endothelial cells. Obesity is a modifiable risk factor for diabetes, and obese individuals have been reported to have reduced nitric oxide availability compared to controls whose weight is in the normal range. Since homozygous carriers of the NOS3 G894T variant are predicted to have decreased enzyme activity, the association between NOS3 genotype and type 2 diabetes, and possible effect modification by body mass index (BMI were evaluated. The prevalence of diabetes and BMI was determined at baseline in 14,374 participants 45-66 years of age from the prospective biracial population-based Atherosclerosis Risk in Communities (ARIC Study of the development of atherosclerosis in four communities in the United States. Individuals with a BMI ≥30 kg/m(2 were considered obese. Those subjects not meeting the case definition were the comparison groups for the 728 African American and 980 white participants with diabetes. Multivariable logistic regression models adjusted for age, sex, and field center were used to test for main genetic effects and interaction with obesity. Although the NOS3 G894T variant was not independently associated with diabetes in either African Americans or whites, significant interaction between BMI and the NOS3 polymorphism indicated that obesity was an effect modifier of diabetes risk for white individuals with the TT genotype (odds ratio (OR for interaction = 1.65, p = 0.04. In stratified analyses, homozygosity for the NOS3 T allele in obese white participants but not in those whose BMI <30 kg/m(2 was associated with an elevated risk of diabetes (OR = 1.47, p = 0.02 when compared to the common GG genotype. These results suggest that interaction between obesity and NOS3 genotype may be a determinant of diabetes case status in whites in the ARIC cohort. Replication in other populations will be required to confirm

  9. Compression and fast retrieval of SNP data.

    Science.gov (United States)

    Sambo, Francesco; Di Camillo, Barbara; Toffolo, Gianna; Cobelli, Claudio

    2014-11-01

    The increasing interest in rare genetic variants and epistatic genetic effects on complex phenotypic traits is currently pushing genome-wide association study design towards datasets of increasing size, both in the number of studied subjects and in the number of genotyped single nucleotide polymorphisms (SNPs). This, in turn, is leading to a compelling need for new methods for compression and fast retrieval of SNP data. We present a novel algorithm and file format for compressing and retrieving SNP data, specifically designed for large-scale association studies. Our algorithm is based on two main ideas: (i) compress linkage disequilibrium blocks in terms of differences with a reference SNP and (ii) compress reference SNPs exploiting information on their call rate and minor allele frequency. Tested on two SNP datasets and compared with several state-of-the-art software tools, our compression algorithm is shown to be competitive in terms of compression rate and to outperform all tools in terms of time to load compressed data. Our compression and decompression algorithms are implemented in a C++ library, are released under the GNU General Public License and are freely downloadable from http://www.dei.unipd.it/~sambofra/snpack.html. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. SNP marker detection and genotyping in tilapia

    NARCIS (Netherlands)

    Bers, van N.E.M.; Crooijmans, R.P.M.A.; Groenen, M.A.M.; Dibbits, B.W.; Komen, J.

    2012-01-01

    We have generated a unique resource consisting of nearly 175 000 short contig sequences and 3569 SNP markers from the widely cultured GIFT (Genetically Improved Farmed Tilapia) strain of Nile tilapia (Oreochromis niloticus). In total, 384 SNPs were selected to monitor the wider applicability of the

  11. Snap: an integrated SNP annotation platform

    DEFF Research Database (Denmark)

    Li, Shengting; Ma, Lijia; Li, Heng

    2007-01-01

    Snap (Single Nucleotide Polymorphism Annotation Platform) is a server designed to comprehensively analyze single genes and relationships between genes basing on SNPs in the human genome. The aim of the platform is to facilitate the study of SNP finding and analysis within the framework of medical...

  12. An Improved Opposition-Based Learning Particle Swarm Optimization for the Detection of SNP-SNP Interactions

    Science.gov (United States)

    Shang, Junliang; Sun, Yan; Li, Shengjun; Liu, Jin-Xing; Zheng, Chun-Hou; Zhang, Junying

    2015-01-01

    SNP-SNP interactions have been receiving increasing attention in understanding the mechanism underlying susceptibility to complex diseases. Though many works have been done for the detection of SNP-SNP interactions, the algorithmic development is still ongoing. In this study, an improved opposition-based learning particle swarm optimization (IOBLPSO) is proposed for the detection of SNP-SNP interactions. Highlights of IOBLPSO are the introduction of three strategies, namely, opposition-based learning, dynamic inertia weight, and a postprocedure. Opposition-based learning not only enhances the global explorative ability, but also avoids premature convergence. Dynamic inertia weight allows particles to cover a wider search space when the considered SNP is likely to be a random one and converges on promising regions of the search space while capturing a highly suspected SNP. The postprocedure is used to carry out a deep search in highly suspected SNP sets. Experiments of IOBLPSO are performed on both simulation data sets and a real data set of age-related macular degeneration, results of which demonstrate that IOBLPSO is promising in detecting SNP-SNP interactions. IOBLPSO might be an alternative to existing methods for detecting SNP-SNP interactions. PMID:26236727

  13. Tumor Necrosis Factor (TNF) –308G>A, Nitric Oxide Synthase 3 (NOS3) +894G>T Polymorphisms and Migraine Risk: A Meta-Analysis

    Science.gov (United States)

    Chen, Min; Tang, Wenjing; Hou, Lei; Liu, Ruozhuo; Dong, Zhao; Han, Xun; Zhang, Xiaofei; Wan, Dongjun; Yu, Shengyuan

    2015-01-01

    Background and Objective Conflicting data have been reported on the association between tumor necrosis factor (TNF) –308G>A and nitric oxide synthase 3 (NOS3) +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF –308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine. Method We performed an updated meta-analysis for TNF –308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR) and 95% confidence intervals (95% CI) assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates. Results Eleven studies in 6682 migraineurs and 22591 controls for TNF –308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the “A” allele of the TNF –308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 – 2.87). The risk of migraine with aura (MA) was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the “T” allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 – 3.88). Conclusions Our findings appear to support the hypothesis that the TNF –308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians. PMID:26098763

  14. Forensic SNP genotyping with SNaPshot

    DEFF Research Database (Denmark)

    Fondevila, M; Børsting, C; Phillips, C

    2017-01-01

    to routine STR profiling, use of SNaPshot is an important part of the development of SNP sets for a wide range of forensic applications with these markers, from genotyping highly degraded DNA with very short amplicons to the introduction of SNPs to ascertain the ancestry and physical characteristics......This review explores the key factors that influence the optimization, routine use, and profile interpretation of the SNaPshot single-base extension (SBE) system applied to forensic single-nucleotide polymorphism (SNP) genotyping. Despite being a mainly complimentary DNA genotyping technique...... of an unidentified contact trace donor. However, this technology, as resourceful as it is, displays several features that depart from the usual STR genotyping far enough to demand a certain degree of expertise from the forensic analyst before tackling the complex casework on which SNaPshot application provides...

  15. Tag SNP selection via a genetic algorithm.

    Science.gov (United States)

    Mahdevar, Ghasem; Zahiri, Javad; Sadeghi, Mehdi; Nowzari-Dalini, Abbas; Ahrabian, Hayedeh

    2010-10-01

    Single Nucleotide Polymorphisms (SNPs) provide valuable information on human evolutionary history and may lead us to identify genetic variants responsible for human complex diseases. Unfortunately, molecular haplotyping methods are costly, laborious, and time consuming; therefore, algorithms for constructing full haplotype patterns from small available data through computational methods, Tag SNP selection problem, are convenient and attractive. This problem is proved to be an NP-hard problem, so heuristic methods may be useful. In this paper we present a heuristic method based on genetic algorithm to find reasonable solution within acceptable time. The algorithm was tested on a variety of simulated and experimental data. In comparison with the exact algorithm, based on brute force approach, results show that our method can obtain optimal solutions in almost all cases and runs much faster than exact algorithm when the number of SNP sites is large. Our software is available upon request to the corresponding author.

  16. Genome-Wide SNP Detection, Validation, and Development of an 8K SNP Array for Apple

    Science.gov (United States)

    Chagné, David; Crowhurst, Ross N.; Troggio, Michela; Davey, Mark W.; Gilmore, Barbara; Lawley, Cindy; Vanderzande, Stijn; Hellens, Roger P.; Kumar, Satish; Cestaro, Alessandro; Velasco, Riccardo; Main, Dorrie; Rees, Jasper D.; Iezzoni, Amy; Mockler, Todd; Wilhelm, Larry; Van de Weg, Eric; Gardiner, Susan E.; Bassil, Nahla; Peace, Cameron

    2012-01-01

    As high-throughput genetic marker screening systems are essential for a range of genetics studies and plant breeding applications, the International RosBREED SNP Consortium (IRSC) has utilized the Illumina Infinium® II system to develop a medium- to high-throughput SNP screening tool for genome-wide evaluation of allelic variation in apple (Malus×domestica) breeding germplasm. For genome-wide SNP discovery, 27 apple cultivars were chosen to represent worldwide breeding germplasm and re-sequenced at low coverage with the Illumina Genome Analyzer II. Following alignment of these sequences to the whole genome sequence of ‘Golden Delicious’, SNPs were identified using SoapSNP. A total of 2,113,120 SNPs were detected, corresponding to one SNP to every 288 bp of the genome. The Illumina GoldenGate® assay was then used to validate a subset of 144 SNPs with a range of characteristics, using a set of 160 apple accessions. This validation assay enabled fine-tuning of the final subset of SNPs for the Illumina Infinium® II system. The set of stringent filtering criteria developed allowed choice of a set of SNPs that not only exhibited an even distribution across the apple genome and a range of minor allele frequencies to ensure utility across germplasm, but also were located in putative exonic regions to maximize genotyping success rate. A total of 7867 apple SNPs was established for the IRSC apple 8K SNP array v1, of which 5554 were polymorphic after evaluation in segregating families and a germplasm collection. This publicly available genomics resource will provide an unprecedented resolution of SNP haplotypes, which will enable marker-locus-trait association discovery, description of the genetic architecture of quantitative traits, investigation of genetic variation (neutral and functional), and genomic selection in apple. PMID:22363718

  17. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data

    Directory of Open Access Journals (Sweden)

    Steve Davis

    2015-08-01

    Full Text Available The analysis of next-generation sequence (NGS data is often a fragmented step-wise process. For example, multiple pieces of software are typically needed to map NGS reads, extract variant sites, and construct a DNA sequence matrix containing only single nucleotide polymorphisms (i.e., a SNP matrix for a set of individuals. The management and chaining of these software pieces and their outputs can often be a cumbersome and difficult task. Here, we present CFSAN SNP Pipeline, which combines into a single package the mapping of NGS reads to a reference genome with Bowtie2, processing of those mapping (BAM files using SAMtools, identification of variant sites using VarScan, and production of a SNP matrix using custom Python scripts. We also introduce a Python package (CFSAN SNP Mutator that when given a reference genome will generate variants of known position against which we validate our pipeline. We created 1,000 simulated Salmonella enterica sp. enterica Serovar Agona genomes at 100× and 20× coverage, each containing 500 SNPs, 20 single-base insertions and 20 single-base deletions. For the 100× dataset, the CFSAN SNP Pipeline recovered 98.9% of the introduced SNPs and had a false positive rate of 1.04 × 10−6; for the 20× dataset 98.8% of SNPs were recovered and the false positive rate was 8.34 × 10−7. Based on these results, CFSAN SNP Pipeline is a robust and accurate tool that it is among the first to combine into a single executable the myriad steps required to produce a SNP matrix from NGS data. Such a tool is useful to those working in an applied setting (e.g., food safety traceback investigations as well as for those interested in evolutionary questions.

  18. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple.

    Directory of Open Access Journals (Sweden)

    David Chagné

    Full Text Available As high-throughput genetic marker screening systems are essential for a range of genetics studies and plant breeding applications, the International RosBREED SNP Consortium (IRSC has utilized the Illumina Infinium® II system to develop a medium- to high-throughput SNP screening tool for genome-wide evaluation of allelic variation in apple (Malus×domestica breeding germplasm. For genome-wide SNP discovery, 27 apple cultivars were chosen to represent worldwide breeding germplasm and re-sequenced at low coverage with the Illumina Genome Analyzer II. Following alignment of these sequences to the whole genome sequence of 'Golden Delicious', SNPs were identified using SoapSNP. A total of 2,113,120 SNPs were detected, corresponding to one SNP to every 288 bp of the genome. The Illumina GoldenGate® assay was then used to validate a subset of 144 SNPs with a range of characteristics, using a set of 160 apple accessions. This validation assay enabled fine-tuning of the final subset of SNPs for the Illumina Infinium® II system. The set of stringent filtering criteria developed allowed choice of a set of SNPs that not only exhibited an even distribution across the apple genome and a range of minor allele frequencies to ensure utility across germplasm, but also were located in putative exonic regions to maximize genotyping success rate. A total of 7867 apple SNPs was established for the IRSC apple 8K SNP array v1, of which 5554 were polymorphic after evaluation in segregating families and a germplasm collection. This publicly available genomics resource will provide an unprecedented resolution of SNP haplotypes, which will enable marker-locus-trait association discovery, description of the genetic architecture of quantitative traits, investigation of genetic variation (neutral and functional, and genomic selection in apple.

  19. Exhaustive Genome-Wide Search for SNP-SNP Interactions Across 10 Human Diseases

    Directory of Open Access Journals (Sweden)

    William Murk

    2016-07-01

    Full Text Available The identification of statistical SNP-SNP interactions may help explain the genetic etiology of many human diseases, but exhaustive genome-wide searches for these interactions have been difficult, due to a lack of power in most datasets. We aimed to use data from the Resource for Genetic Epidemiology Research on Adult Health and Aging (GERA study to search for SNP-SNP interactions associated with 10 common diseases. FastEpistasis and BOOST were used to evaluate all pairwise interactions among approximately N = 300,000 single nucleotide polymorphisms (SNPs with minor allele frequency (MAF ≥ 0.15, for the dichotomous outcomes of allergic rhinitis, asthma, cardiac disease, depression, dermatophytosis, type 2 diabetes, dyslipidemia, hemorrhoids, hypertensive disease, and osteoarthritis. A total of N = 45,171 subjects were included after quality control steps were applied. These data were divided into discovery and replication subsets; the discovery subset had > 80% power, under selected models, to detect genome-wide significant interactions (P < 10−12. Interactions were also evaluated for enrichment in particular SNP features, including functionality, prior disease relevancy, and marginal effects. No interaction in any disease was significant in both the discovery and replication subsets. Enrichment analysis suggested that, for some outcomes, interactions involving SNPs with marginal effects were more likely to be nominally replicated, compared to interactions without marginal effects. If SNP-SNP interactions play a role in the etiology of the studied conditions, they likely have weak effect sizes, involve lower-frequency variants, and/or involve complex models of interaction that are not captured well by the methods that were utilized.

  20. Glucose Tolerance, MTHFR C677T and NOS3 G894T Polymorphisms, and Global DNA Methylation in Mixed Ancestry African Individuals

    Directory of Open Access Journals (Sweden)

    Tandi E. Matsha

    2016-01-01

    Full Text Available The aim of this study is to quantify global DNA methylation and investigate the relationship with diabetes status and polymorphisms in MTHFR C677T and NOS3 G894T genes in mixed ancestry subjects from South Africa. Global DNA methylation was measured, and MTHFR rs1801133 and NOS3 rs1799983 polymorphisms were genotyped using high throughput real-time polymerase chain reaction and direct DNA sequencing. Of the 564 participants, 158 (28% individuals had T2DM of which 97 (17.2% were screen-detected cases. Another 119 (21.1% had prediabetes, that is, impaired fasting glucose, impaired glucose tolerance, or the combination of both, and the remainder 287 (50.9% had normal glucose tolerance. Global DNA methylation was significantly higher in prediabetes and screen-detected diabetes than in normal glucose tolerance (both p≤0.033 and in screen-detected diabetes compared to known diabetes on treatment (p=0.019. There was no difference in global DNA methylation between known diabetes on treatment and normal glucose tolerance (p>0.999. In multivariable linear regression analysis, only NOS3 was associated with increasing global DNA methylation (β=0.943; 95% CI: 0.286 to 1.560. The association of global DNA methylation with screen-detected diabetes but not treated diabetes suggests that glucose control agents to some extent may be reversing DNA methylation. The association between NOS3 rs1799983 polymorphisms and DNA methylation suggests gene-epigenetic mechanisms through which vascular diabetes complications develop despite adequate metabolic control.

  1. Glucose Tolerance, MTHFR C677T and NOS3 G894T Polymorphisms, and Global DNA Methylation in Mixed Ancestry African Individuals

    Science.gov (United States)

    Mutize, Tinashe; Erasmus, Rajiv T.

    2016-01-01

    The aim of this study is to quantify global DNA methylation and investigate the relationship with diabetes status and polymorphisms in MTHFR C677T and NOS3 G894T genes in mixed ancestry subjects from South Africa. Global DNA methylation was measured, and MTHFR rs1801133 and NOS3 rs1799983 polymorphisms were genotyped using high throughput real-time polymerase chain reaction and direct DNA sequencing. Of the 564 participants, 158 (28%) individuals had T2DM of which 97 (17.2%) were screen-detected cases. Another 119 (21.1%) had prediabetes, that is, impaired fasting glucose, impaired glucose tolerance, or the combination of both, and the remainder 287 (50.9%) had normal glucose tolerance. Global DNA methylation was significantly higher in prediabetes and screen-detected diabetes than in normal glucose tolerance (both p ≤ 0.033) and in screen-detected diabetes compared to known diabetes on treatment (p = 0.019). There was no difference in global DNA methylation between known diabetes on treatment and normal glucose tolerance (p > 0.999). In multivariable linear regression analysis, only NOS3 was associated with increasing global DNA methylation (β = 0.943; 95% CI: 0.286 to 1.560). The association of global DNA methylation with screen-detected diabetes but not treated diabetes suggests that glucose control agents to some extent may be reversing DNA methylation. The association between NOS3 rs1799983 polymorphisms and DNA methylation suggests gene-epigenetic mechanisms through which vascular diabetes complications develop despite adequate metabolic control. PMID:27990443

  2. SNPServer: a real-time SNP discovery tool.

    Science.gov (United States)

    Savage, David; Batley, Jacqueline; Erwin, Tim; Logan, Erica; Love, Christopher G; Lim, Geraldine A C; Mongin, Emmanuel; Barker, Gary; Spangenberg, German C; Edwards, David

    2005-07-01

    SNPServer is a real-time flexible tool for the discovery of SNPs (single nucleotide polymorphisms) within DNA sequence data. The program uses BLAST, to identify related sequences, and CAP3, to cluster and align these sequences. The alignments are parsed to the SNP discovery software autoSNP, a program that detects SNPs and insertion/deletion polymorphisms (indels). Alternatively, lists of related sequences or pre-assembled sequences may be entered for SNP discovery. SNPServer and autoSNP use redundancy to differentiate between candidate SNPs and sequence errors. For each candidate SNP, two measures of confidence are calculated, the redundancy of the polymorphism at a SNP locus and the co-segregation of the candidate SNP with other SNPs in the alignment. SNPServer is available at http://hornbill.cspp.latrobe.edu.au/snpdiscovery.html.

  3. saSNP Approach for Scalable SNP Analyses of Multiple Bacterial or Viral Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, Shea [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Slezak, Tom [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2010-07-27

    With the flood of whole genome finished and draft microbial sequences, we need faster, more scalable bioinformatics tools for sequence comparison. An algorithm is described to find single nucleotide polymorphisms (SNPs) in whole genome data. It scales to hundreds of bacterial or viral genomes, and can be used for finished and/or draft genomes available as unassembled contigs. The method is fast to compute, finding SNPs and building a SNP phylogeny in seconds to hours. We use it to identify thousands of putative SNPs from all publicly available Filoviridae, Poxviridae, foot-and-mouth disease virus, Bacillus, and Escherichia coli genomes and plasmids. The SNP-based trees that result are consistent with known taxonomy and trees determined in other studies. The approach we describe can handle as input hundreds of gigabases of sequence in a single run. The algorithm is based on k-mer analysis using a suffix array, so we call it saSNP.

  4. SNP mining porcine ESTs with MAVIANT, a novel tool for SNP evaluation and annotation

    DEFF Research Database (Denmark)

    Panitz, Frank; Stengaard, Henrik; Hornshoj, Henrik

    2007-01-01

    MOTIVATION: Single nucleotide polymorphisms (SNPs) analysis is an important means to study genetic variation. A fast and cost-efficient approach to identify large numbers of novel candidates is the SNP mining of large scale sequencing projects. The increasing availability of sequence trace data...... manual annotation, which is immediately accessible and can be easily shared with external collaborators. RESULTS: Large-scale SNP mining of polymorphisms bases on porcine EST sequences yielded more than 7900 candidate SNPs in coding regions (cSNPs), which were annotated relative to the human genome. Non...

  5. SNP-SNP interaction analysis of NF-κB signaling pathway on breast cancer survival

    DEFF Research Database (Denmark)

    Jamshidi, Maral; Fagerholm, Rainer; Khan, Sofia

    2015-01-01

    of SNP pairs without and with an interaction term. We found two interacting pairs associating with prognosis: patients simultaneously homozygous for the rare alleles of rs5996080 and rs7973914 had worse survival (HRinteraction 6.98, 95% CI=3.3-14.4, P=1.42E-07), and patients carrying at least one rare...

  6. A SNP Genotyping Array for Hexaploid Oat

    Directory of Open Access Journals (Sweden)

    Nicholas A. Tinker

    2014-11-01

    Full Text Available Recognizing a need in cultivated hexaploid oat ( L. for a reliable set of reference single nucleotide polymorphisms (SNPs, we have developed a 6000 (6K BeadChip design containing 257 Infinium I and 5486 Infinium II designs corresponding to 5743 SNPs. Of those, 4975 SNPs yielded successful assays after array manufacturing. These SNPs were discovered based on a variety of bioinformatics pipelines in complementary DNA (cDNA and genomic DNA originating from 20 or more diverse oat cultivars. The array was validated in 1100 samples from six recombinant inbred line (RIL mapping populations and sets of diverse oat cultivars and breeding lines, and provided approximately 3500 discernible Mendelian polymorphisms. Here, we present an annotation of these SNPs, including methods of discovery, gene identification and orthology, population-genetic characteristics, and tentative positions on an oat consensus map. We also evaluate a new cluster-based method of calling SNPs. The SNP design sequences are made publicly available, and the full SNP genotyping platform is available for commercial purchase from an independent third party.

  7. V-MitoSNP: visualization of human mitochondrial SNPs

    Directory of Open Access Journals (Sweden)

    Tsui Ke-Hung

    2006-08-01

    Full Text Available Abstract Background Mitochondrial single nucleotide polymorphisms (mtSNPs constitute important data when trying to shed some light on human diseases and cancers. Unfortunately, providing relevant mtSNP genotyping information in mtDNA databases in a neatly organized and transparent visual manner still remains a challenge. Amongst the many methods reported for SNP genotyping, determining the restriction fragment length polymorphisms (RFLPs is still one of the most convenient and cost-saving methods. In this study, we prepared the visualization of the mtDNA genome in a way, which integrates the RFLP genotyping information with mitochondria related cancers and diseases in a user-friendly, intuitive and interactive manner. The inherent problem associated with mtDNA sequences in BLAST of the NCBI database was also solved. Description V-MitoSNP provides complete mtSNP information for four different kinds of inputs: (1 color-coded visual input by selecting genes of interest on the genome graph, (2 keyword search by locus, disease and mtSNP rs# ID, (3 visualized input of nucleotide range by clicking the selected region of the mtDNA sequence, and (4 sequences mtBLAST. The V-MitoSNP output provides 500 bp (base pairs flanking sequences for each SNP coupled with the RFLP enzyme and the corresponding natural or mismatched primer sets. The output format enables users to see the SNP genotype pattern of the RFLP by virtual electrophoresis of each mtSNP. The rate of successful design of enzymes and primers for RFLPs in all mtSNPs was 99.1%. The RFLP information was validated by actual agarose electrophoresis and showed successful results for all mtSNPs tested. The mtBLAST function in V-MitoSNP provides the gene information within the input sequence rather than providing the complete mitochondrial chromosome as in the NCBI BLAST database. All mtSNPs with rs number entries in NCBI are integrated in the corresponding SNP in V-MitoSNP. Conclusion V-MitoSNP is a web

  8. SNIT: SNP identification for strain typing

    Directory of Open Access Journals (Sweden)

    Reifman Jaques

    2011-09-01

    Full Text Available Abstract With ever-increasing numbers of microbial genomes being sequenced, efficient tools are needed to perform strain-level identification of any newly sequenced genome. Here, we present the SNP identification for strain typing (SNIT pipeline, a fast and accurate software system that compares a newly sequenced bacterial genome with other genomes of the same species to identify single nucleotide polymorphisms (SNPs and small insertions/deletions (indels. Based on this information, the pipeline analyzes the polymorphic loci present in all input genomes to identify the genome that has the fewest differences with the newly sequenced genome. Similarly, for each of the other genomes, SNIT identifies the input genome with the fewest differences. Results from five bacterial species show that the SNIT pipeline identifies the correct closest neighbor with 75% to 100% accuracy. The SNIT pipeline is available for download at http://www.bhsai.org/snit.html

  9. (SNP) markers for the Chinese black sleeper, Bostrychus sinensis

    African Journals Online (AJOL)

    We characterized 11 single nucleotide ploymorphism (SNP) markers for the Chinese black sleeper, Bostrychus sinensis. These markers were isolated from a genomic library and tested in ten geographically distant individuals of B. sinensis. Polymorphisms of these SNP loci were assessed using a wild population including ...

  10. Evaluation of the Ion Torrent™ HID SNP 169-plex

    DEFF Research Database (Denmark)

    Børsting, Claus; Fordyce, Sarah L; Olofsson, Jill Katharina

    2014-01-01

    The Ion Torrent™ HID SNP assay amplified 136 autosomal SNPs and 33 Y-chromosome markers in one PCR and the markers were subsequently typed using the Ion PGM™ second generation sequencing platform. A total of 51 of the autosomal SNPs were selected from the SNPforID panel that is routinely used...... in our ISO 17025 accredited laboratory. Concordance between the Ion Torrent™ HID SNP assay and the SNPforID assay was tested by typing 44 Iraqis twice with the Ion Torrent™ HID SNP assay. The same samples were previously typed with the SNPforID assay and the Y-chromosome haplogroups of the individuals...

  11. (SNP) assay for population stratification test between eastern Asians

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... program STRUCTURE 2.0, which uses a Markov chain Monte. Carlo (MCMC) algorithm to cluster individuals into different cryptic ... HapMap project. .... Evaluation of the 124-plex SNP typing microarray for forensic testing.

  12. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  13. A SNP resource for Douglas-fir: de novo transcriptome assembly and SNP detection and validation.

    Science.gov (United States)

    Howe, Glenn T; Yu, Jianbin; Knaus, Brian; Cronn, Richard; Kolpak, Scott; Dolan, Peter; Lorenz, W Walter; Dean, Jeffrey F D

    2013-02-28

    Douglas-fir (Pseudotsuga menziesii), one of the most economically and ecologically important tree species in the world, also has one of the largest tree breeding programs. Although the coastal and interior varieties of Douglas-fir (vars. menziesii and glauca) are native to North America, the coastal variety is also widely planted for timber production in Europe, New Zealand, Australia, and Chile. Our main goal was to develop a SNP resource large enough to facilitate genomic selection in Douglas-fir breeding programs. To accomplish this, we developed a 454-based reference transcriptome for coastal Douglas-fir, annotated and evaluated the quality of the reference, identified putative SNPs, and then validated a sample of those SNPs using the Illumina Infinium genotyping platform. We assembled a reference transcriptome consisting of 25,002 isogroups (unique gene models) and 102,623 singletons from 2.76 million 454 and Sanger cDNA sequences from coastal Douglas-fir. We identified 278,979 unique SNPs by mapping the 454 and Sanger sequences to the reference, and by mapping four datasets of Illumina cDNA sequences from multiple seed sources, genotypes, and tissues. The Illumina datasets represented coastal Douglas-fir (64.00 and 13.41 million reads), interior Douglas-fir (80.45 million reads), and a Yakima population similar to interior Douglas-fir (8.99 million reads). We assayed 8067 SNPs on 260 trees using an Illumina Infinium SNP genotyping array. Of these SNPs, 5847 (72.5%) were called successfully and were polymorphic. Based on our validation efficiency, our SNP database may contain as many as ~200,000 true SNPs, and as many as ~69,000 SNPs that could be genotyped at ~20,000 gene loci using an Infinium II array-more SNPs than are needed to use genomic selection in tree breeding programs. Ultimately, these genomic resources will enhance Douglas-fir breeding and allow us to better understand landscape-scale patterns of genetic variation and potential responses to

  14. Partitioned learning of deep Boltzmann machines for SNP data.

    Science.gov (United States)

    Hess, Moritz; Lenz, Stefan; Blätte, Tamara J; Bullinger, Lars; Binder, Harald

    2017-10-15

    Learning the joint distributions of measurements, and in particular identification of an appropriate low-dimensional manifold, has been found to be a powerful ingredient of deep leaning approaches. Yet, such approaches have hardly been applied to single nucleotide polymorphism (SNP) data, probably due to the high number of features typically exceeding the number of studied individuals. After a brief overview of how deep Boltzmann machines (DBMs), a deep learning approach, can be adapted to SNP data in principle, we specifically present a way to alleviate the dimensionality problem by partitioned learning. We propose a sparse regression approach to coarsely screen the joint distribution of SNPs, followed by training several DBMs on SNP partitions that were identified by the screening. Aggregate features representing SNP patterns and the corresponding SNPs are extracted from the DBMs by a combination of statistical tests and sparse regression. In simulated case-control data, we show how this can uncover complex SNP patterns and augment results from univariate approaches, while maintaining type 1 error control. Time-to-event endpoints are considered in an application with acute myeloid leukemia patients, where SNP patterns are modeled after a pre-screening based on gene expression data. The proposed approach identified three SNPs that seem to jointly influence survival in a validation dataset. This indicates the added value of jointly investigating SNPs compared to standard univariate analyses and makes partitioned learning of DBMs an interesting complementary approach when analyzing SNP data. A Julia package is provided at 'http://github.com/binderh/BoltzmannMachines.jl'. binderh@imbi.uni-freiburg.de. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  15. Heterogeneous computing architecture for fast detection of SNP-SNP interactions.

    Science.gov (United States)

    Sluga, Davor; Curk, Tomaz; Zupan, Blaz; Lotric, Uros

    2014-06-25

    The extent of data in a typical genome-wide association study (GWAS) poses considerable computational challenges to software tools for gene-gene interaction discovery. Exhaustive evaluation of all interactions among hundreds of thousands to millions of single nucleotide polymorphisms (SNPs) may require weeks or even months of computation. Massively parallel hardware within a modern Graphic Processing Unit (GPU) and Many Integrated Core (MIC) coprocessors can shorten the run time considerably. While the utility of GPU-based implementations in bioinformatics has been well studied, MIC architecture has been introduced only recently and may provide a number of comparative advantages that have yet to be explored and tested. We have developed a heterogeneous, GPU and Intel MIC-accelerated software module for SNP-SNP interaction discovery to replace the previously single-threaded computational core in the interactive web-based data exploration program SNPsyn. We report on differences between these two modern massively parallel architectures and their software environments. Their utility resulted in an order of magnitude shorter execution times when compared to the single-threaded CPU implementation. GPU implementation on a single Nvidia Tesla K20 runs twice as fast as that for the MIC architecture-based Xeon Phi P5110 coprocessor, but also requires considerably more programming effort. General purpose GPUs are a mature platform with large amounts of computing power capable of tackling inherently parallel problems, but can prove demanding for the programmer. On the other hand the new MIC architecture, albeit lacking in performance reduces the programming effort and makes it up with a more general architecture suitable for a wider range of problems.

  16. RASSF1A and the rs2073498 Cancer Associated SNP

    International Nuclear Information System (INIS)

    Donninger, Howard; Barnoud, Thibaut; Nelson, Nick; Kassler, Suzanna; Clark, Jennifer; Cummins, Timothy D.; Powell, David W.; Nyante, Sarah; Millikan, Robert C.; Clark, Geoffrey J.

    2011-01-01

    RASSF1A is one of the most frequently inactivated tumor suppressors yet identified in human cancer. It is pro-apoptotic and appears to function as a scaffolding protein that interacts with a variety of other tumor suppressors to modulate their function. It can also complex with the Ras oncoprotein and may serve to integrate pro-growth and pro-death signaling pathways. A SNP has been identified that is present in approximately 29% of European populations [rs2073498, A(133)S]. Several studies have now presented evidence that this SNP is associated with an enhanced risk of developing breast cancer. We have used a proteomics based approach to identify multiple differences in the pattern of protein/protein interactions mediated by the wild type compared to the SNP variant protein. We have also identified a significant difference in biological activity between wild type and SNP variant protein. However, we have found only a very modest association of the SNP with breast cancer predisposition.

  17. Screening of the NOS3 gene identifies the variants 894G/T, 1998C/G and 2479G/A to be associated with acute onset ischemic stroke in young Asian Indians.

    Science.gov (United States)

    Akhter, Mohd Suhail; Biswas, Arijit; Rashid, Hina; Devi, Luxmi; Behari, Madhuri; Saxena, Renu

    2014-09-15

    Nitric oxide levels and NOS3 gene variants play a pivotal role in the development of vascular diseases/stroke. We attempted to determine the role of NOS3 gene variants and plasma NO levels towards the development of ischemic stroke in young Asian-Indians. One hundred ischemic stroke patients and 200 age and sex matched control study subjects were screened for NOS3 gene variants using SSCP [single stranded confirmation polymorphism] and PCR based techniques. Plasma NO metabolites [NOx] were evaluated for the investigated population. Significantly higher NOx levels were observed in controls [controls 56.63±25.92 μmol/L, patients 34.73±19.88 μmol/L, pischemic stroke in young Asian Indians. These NOS3 SNPs might represent genetic risk factors for ischemic stroke in young Asian Indians. However these observations need to be confirmed by larger replicate/cross-sectional studies. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. MDM2 SNP309 and SNP285 Act as Negative Prognostic Markers for Non-small Cell Lung Cancer Adenocarcinoma Patients

    Science.gov (United States)

    Deben, Christophe; Op de Beeck, Ken; Van den Bossche, Jolien; Jacobs, Julie; Lardon, Filip; Wouters, An; Peeters, Marc; Van Camp, Guy; Rolfo, Christian; Deschoolmeester, Vanessa; Pauwels, Patrick

    2017-01-01

    Objectives: Two functional polymorphisms in the MDM2 promoter region, SNP309T>G and SNP285G>C, have been shown to impact MDM2 expression and cancer risk. Currently available data on the prognostic value of MDM2 SNP309 in non-small cell lung cancer (NSCLC) is contradictory and unavailable for SNP285. The goal of this study was to clarify the role of these MDM2 SNPs in the outcome of NSCLC patients. Materials and Methods: In this study we genotyped SNP309 and SNP285 in 98 NSCLC adenocarcinoma patients and determined MDM2 mRNA and protein levels. In addition, we assessed the prognostic value of these common SNPs on overall and progression free survival, taking into account the TP53 status of the tumor. Results and Conclusion: We found that the SNP285C allele, but not the SNP309G allele, was significantly associated with increased MDM2 mRNA expression levels (p = 0.025). However, we did not observe an association with MDM2 protein levels for SNP285. The SNP309G allele was significantly associated with the presence of wild type TP53 (p = 0.047) and showed a strong trend towards increased MDM2 protein levels (p = 0.068). In addition, patients harboring the SNP309G allele showed a worse overall survival, but only in the presence of wild type TP53. The SNP285C allele was significantly associated with an early age of diagnosis and metastasis. Additionally, the SNP285C allele acted as an independent predictor for worse progression free survival (HR = 3.97; 95% CI = 1.51 - 10.42; p = 0.005). Our data showed that both SNP309 (in the presence of wild type TP53) and SNP285 act as negative prognostic markers for NSCLC patients, implicating a prominent role for these variants in the outcome of these patients. PMID:28819417

  19. [G894T (NOS3) and G1958A (MTHFD1) gene polymorphisms and risk of ischemic heart disease in Yucatan, Mexico].

    Science.gov (United States)

    García-González, Igrid; Solís-Cárdenas, Alberto de Jesús; Flores-Ocampo, Jorge A; Alejos-Mex, Ricardo; Herrera-Sánchez, Luis Fernando; González-Herrera, Lizbeth Josefina

    2015-01-01

    Cardiovascular medicine is focused on the search for genetic risk markers with predictive and/or prognostic value. Among the genetic variants of interest are G894T endothelial nitric oxide synthase and G1958A methylenetetrahydrofolate dehydrogenase1 gene polymorphisms. The aim of this study was to determine the possible association between these polymorphisms and ischemic heart disease in patients from Southern of Mexico (Yucatán). Case-control study matched by age, sex and origin was designed. We studied 98 patients with coronary disease and 101 controls. Participants were evaluated for the usual risk factors. The polymorphisms were identified using the polymerase chain reaction/restriction fragment length polymorphism analysis. Informed consent was obtained from all participants. The G894T and G1958A polymorphisms were not associated with ischemic heart disease, however, the TT genotype (G894T) was associated with the angina (OR=10.2; 95%CI, 1.51-68.8; p=0.025). The genotype GT (G894T) was the most frequent in patients with family history of coronary artery disease. Multiple logistic regression analysis identified smoking (OR=5.21; 95%CI, 2.1-12.9; p=0.000), hypertension (OR=3.54; 95%CI, 1.47-8.56; p=0.005) and obesity (OR=1.16; 95%CI, 1.1-1.27; p=0.001) as risk factors predicting the ischemic heart disease. The G894T and G1958A polymorphisms showed not association with ischemic heart disease. However, homozygosis for the 894T allele (NOS3) confers at risk to develop angina on Yucatán. Copyright © 2014 Sociedad Española de Arteriosclerosis. Published by Elsevier España. All rights reserved.

  20. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  1. Sodium nitroprusside (SNP) alleviates the oxidative stress induced ...

    African Journals Online (AJOL)

    Oxidative damage is often induced by abiotic stress, nitric oxide (NO) is considered as a functional molecule in modulating antioxidant metabolism of plants. In the present study, effects of sodium nitroprusside (SNP), a NO donor, on the phenotype, antioxidant capacity and chloroplast ultrastructure of cucumber leaves were ...

  2. Large SNP arrays for genotyping in crop plants

    Indian Academy of Sciences (India)

    Genotyping with large numbers of molecular markers is now an indispensable tool within plant genetics and breeding. Especially through the identification of large numbers of single nucleotide polymorphism (SNP) markers using the novel high-throughput sequencing technologies, it is now possible to reliably identify many ...

  3. Genomic scans for selective sweeps using SNP data

    DEFF Research Database (Denmark)

    Nielsen, Rasmus; Williamson, Scott; Kim, Yuseob

    2005-01-01

    of the selection coefficient. To illustrate the method, we apply our approach to data from the Seattle SNP project and to Chromosome 2 data from the HapMap project. In Chromosome 2, the most extreme signal is found in the lactase gene, which previously has been shown to be undergoing positive selection. Evidence...

  4. SNP Discovery In Marine Fish Species By 454 Sequencing

    DEFF Research Database (Denmark)

    Panitz, Frank; Nielsen, Rasmus Ory; van Houdt, Jeroen K J

    2011-01-01

    Based on the 454 Next-Generation-Sequencing technology (Roche) a high throughput screening method was devised in order to generate novel genetic markers (SNPs). SNP discovery was performed for three target species of marine fish: hake (Merluccius merluccius), herring (Clupea harengus) and sole...

  5. Application of high resolution SNP arrays in patients with congenital ...

    Indian Academy of Sciences (India)

    clinical experience in implementing whole-genome high-resolution SNP arrays to investigate 33 patients with syndromic and .... Online Mendelian Inheritance in Man database (OMIM, ..... of damaged mitochondria through either autophagy or mito- ..... malformations: associations with maternal and infant character- istics in a ...

  6. Phenylethynylpyrene excimer forming hybridization probes for fluorescence SNP detection

    DEFF Research Database (Denmark)

    Prokhorenko, Igor A.; Astakhova, Irina V.; Momynaliev, Kuvat T.

    2009-01-01

    Excimer formation is a unique feature of some fluorescent dyes (e.g., pyrene) which can be used for probing the proximity of biomolecules. Pyrene excimer fluorescence has previously been used for homogeneous detection of single nucleotide polymorphism (SNP) on DNA. 1-Phenylethynylpyrene (1-1-PEPy...

  7. (SNP) markers for the Chinese black sleeper, Bostrychus sinensis

    African Journals Online (AJOL)

    ajl yemi

    2011-04-25

    Apr 25, 2011 ... Polynesia, north to Japan and south to Australia (Kottelat et al., 1993; Masuda ... developed the first set of SNP markers for Chinese black sleeper which can ... Then, the. 44 primer pairs were designed based on all the cloning.

  8. Do you really know where this SNP goes?

    Science.gov (United States)

    The release of build 10.2 of the swine genome was a marked improvement over previous builds and has proven extremely useful. However, as most know, there are regions of the genome that this particular build does not accurately represent. For instance, nearly 25% of the 62,162 SNP on the Illumina Por...

  9. SNP based heritability estimation using a Bayesian approach

    DEFF Research Database (Denmark)

    Krag, Kristian; Janss, Luc; Mahdi Shariati, Mohammad

    2013-01-01

    . Differences in family structure were in general not found to influence the estimation of the heritability. For the sample sizes used in this study, a 10-fold increase of SNP density did not improve precision estimates compared with set-ups with a less dense distribution of SNPs. The methods used in this study...

  10. Genome wide in silico SNP-tumor association analysis

    International Nuclear Information System (INIS)

    Qiu, Ping; Wang, Luquan; Kostich, Mitch; Ding, Wei; Simon, Jason S; Greene, Jonathan R

    2004-01-01

    Carcinogenesis occurs, at least in part, due to the accumulation of mutations in critical genes that control the mechanisms of cell proliferation, differentiation and death. Publicly accessible databases contain millions of expressed sequence tag (EST) and single nucleotide polymorphism (SNP) records, which have the potential to assist in the identification of SNPs overrepresented in tumor tissue. An in silico SNP-tumor association study was performed utilizing tissue library and SNP information available in NCBI's dbEST (release 092002) and dbSNP (build 106). A total of 4865 SNPs were identified which were present at higher allele frequencies in tumor compared to normal tissues. A subset of 327 (6.7%) SNPs induce amino acid changes to the protein coding sequences. This approach identified several SNPs which have been previously associated with carcinogenesis, as well as a number of SNPs that now warrant further investigation This novel in silico approach can assist in prioritization of genes and SNPs in the effort to elucidate the genetic mechanisms underlying the development of cancer

  11. SNP typing on the NanoChip electronic microarray

    DEFF Research Database (Denmark)

    Børsting, Claus; Sanchez Sanchez, Juan Jose; Morling, Niels

    2005-01-01

    We describe a single nucleotide polymorphism (SNP) typing protocol developed for the NanoChip electronic microarray. The NanoChip array consists of 100 electrodes covered by a thin hydrogel layer containing streptavidin. An electric currency can be applied to one, several, or all electrodes...

  12. In silico characterization of functional SNP within the oestrogen ...

    Indian Academy of Sciences (India)

    MAHA REBAÕ

    (polyphen-2, SNAP), as well as by the ESEfinder program, and one nonsense nsSNP was found. For noncoding ... mon type of genetic variation in the human genome that are ...... polymorphisms in type 2 diabetes mellitus and in android type.

  13. In silico characterization of functional SNP within the oestrogen ...

    Indian Academy of Sciences (India)

    MAHA REBAÕ

    found that one SNP in 5 UTR may potentially change protein expression level, nine SNPs were found to affect miRNA binding site and 28 SNPs might affect ..... Riancho et al. 2010), breast cancer (Tapper et al. 2008; Ding et al. .... in postmenopausal women: associations with common estrogen receptor alpha polymorphic ...

  14. Ascertainment biases in SNP chips affect measures of population divergence

    DEFF Research Database (Denmark)

    Albrechtsen, Anders; Nielsen, Finn Cilius; Nielsen, Rasmus

    2010-01-01

    Chip-based high-throughput genotyping has facilitated genome-wide studies of genetic diversity. Many studies have utilized these large data sets to make inferences about the demographic history of human populations using measures of genetic differentiation such as F(ST) or principal component...... on direct sequencing. In addition, we also analyze publicly available genome-wide data. We demonstrate that the ascertainment biases will distort measures of human diversity and possibly change conclusions drawn from these measures in some times unexpected ways. We also show that details of the genotyping...... analyses. However, the single nucleotide polymorphism (SNP) chip data suffer from ascertainment biases caused by the SNP discovery process in which a small number of individuals from selected populations are used as discovery panels. In this study, we investigate the effect of the ascertainment bias...

  15. Assessing SNP-SNP interactions among DNA repair, modification and metabolism related pathway genes in breast cancer susceptibility.

    Directory of Open Access Journals (Sweden)

    Yadav Sapkota

    Full Text Available Genome-wide association studies (GWASs have identified low-penetrance common variants (i.e., single nucleotide polymorphisms, SNPs associated with breast cancer susceptibility. Although GWASs are primarily focused on single-locus effects, gene-gene interactions (i.e., epistasis are also assumed to contribute to the genetic risks for complex diseases including breast cancer. While it has been hypothesized that moderately ranked (P value based weak single-locus effects in GWASs could potentially harbor valuable information for evaluating epistasis, we lack systematic efforts to investigate SNPs showing consistent associations with weak statistical significance across independent discovery and replication stages. The objectives of this study were i to select SNPs showing single-locus effects with weak statistical significance for breast cancer in a GWAS and/or candidate-gene studies; ii to replicate these SNPs in an independent set of breast cancer cases and controls; and iii to explore their potential SNP-SNP interactions contributing to breast cancer susceptibility. A total of 17 SNPs related to DNA repair, modification and metabolism pathway genes were selected since these pathways offer a priori knowledge for potential epistatic interactions and an overall role in breast carcinogenesis. The study design included predominantly Caucasian women (2,795 cases and 4,505 controls from Alberta, Canada. We observed two two-way SNP-SNP interactions (APEX1-rs1130409 and RPAP1-rs2297381; MLH1-rs1799977 and MDM2-rs769412 in logistic regression that conferred elevated risks for breast cancer (P(interaction<7.3 × 10(-3. Logic regression identified an interaction involving four SNPs (MBD2-rs4041245, MLH1-rs1799977, MDM2-rs769412, BRCA2-rs1799943 (P(permutation = 2.4 × 10(-3. SNPs involved in SNP-SNP interactions also showed single-locus effects with weak statistical significance, while BRCA2-rs1799943 showed stronger statistical significance (P

  16. Application of high resolution SNP arrays in patients with congenital ...

    Indian Academy of Sciences (India)

    TING-YING LEI

    lent oligonucleotide-based array-CGH to determine the exact breakpoints in 14 patients with partial deletions of chromo- some 13q21.1-qter. They were able to refine the smallest deletion region linked to cleft lip/palate (13q31.3–13q33.1). Except for the arrays that measure DNA copy number differ- ences only, SNP arrays, ...

  17. SNPdetector: a software tool for sensitive and accurate SNP detection.

    Directory of Open Access Journals (Sweden)

    Jinghui Zhang

    2005-10-01

    Full Text Available Identification of single nucleotide polymorphisms (SNPs and mutations is important for the discovery of genetic predisposition to complex diseases. PCR resequencing is the method of choice for de novo SNP discovery. However, manual curation of putative SNPs has been a major bottleneck in the application of this method to high-throughput screening. Therefore it is critical to develop a more sensitive and accurate computational method for automated SNP detection. We developed a software tool, SNPdetector, for automated identification of SNPs and mutations in fluorescence-based resequencing reads. SNPdetector was designed to model the process of human visual inspection and has a very low false positive and false negative rate. We demonstrate the superior performance of SNPdetector in SNP and mutation analysis by comparing its results with those derived by human inspection, PolyPhred (a popular SNP detection tool, and independent genotype assays in three large-scale investigations. The first study identified and validated inter- and intra-subspecies variations in 4,650 traces of 25 inbred mouse strains that belong to either the Mus musculus species or the M. spretus species. Unexpected heterozygosity in CAST/Ei strain was observed in two out of 1,167 mouse SNPs. The second study identified 11,241 candidate SNPs in five ENCODE regions of the human genome covering 2.5 Mb of genomic sequence. Approximately 50% of the candidate SNPs were selected for experimental genotyping; the validation rate exceeded 95%. The third study detected ENU-induced mutations (at 0.04% allele frequency in 64,896 traces of 1,236 zebra fish. Our analysis of three large and diverse test datasets demonstrated that SNPdetector is an effective tool for genome-scale research and for large-sample clinical studies. SNPdetector runs on Unix/Linux platform and is available publicly (http://lpg.nci.nih.gov.

  18. Robust Demographic Inference from Genomic and SNP Data

    Science.gov (United States)

    Excoffier, Laurent; Dupanloup, Isabelle; Huerta-Sánchez, Emilia; Sousa, Vitor C.; Foll, Matthieu

    2013-01-01

    We introduce a flexible and robust simulation-based framework to infer demographic parameters from the site frequency spectrum (SFS) computed on large genomic datasets. We show that our composite-likelihood approach allows one to study evolutionary models of arbitrary complexity, which cannot be tackled by other current likelihood-based methods. For simple scenarios, our approach compares favorably in terms of accuracy and speed with , the current reference in the field, while showing better convergence properties for complex models. We first apply our methodology to non-coding genomic SNP data from four human populations. To infer their demographic history, we compare neutral evolutionary models of increasing complexity, including unsampled populations. We further show the versatility of our framework by extending it to the inference of demographic parameters from SNP chips with known ascertainment, such as that recently released by Affymetrix to study human origins. Whereas previous ways of handling ascertained SNPs were either restricted to a single population or only allowed the inference of divergence time between a pair of populations, our framework can correctly infer parameters of more complex models including the divergence of several populations, bottlenecks and migration. We apply this approach to the reconstruction of African demography using two distinct ascertained human SNP panels studied under two evolutionary models. The two SNP panels lead to globally very similar estimates and confidence intervals, and suggest an ancient divergence (>110 Ky) between Yoruba and San populations. Our methodology appears well suited to the study of complex scenarios from large genomic data sets. PMID:24204310

  19. A large-scale chromosome-specific SNP discovery guideline.

    Science.gov (United States)

    Akpinar, Bala Ani; Lucas, Stuart; Budak, Hikmet

    2017-01-01

    Single-nucleotide polymorphisms (SNPs) are the most prevalent type of variation in genomes that are increasingly being used as molecular markers in diversity analyses, mapping and cloning of genes, and germplasm characterization. However, only a few studies reported large-scale SNP discovery in Aegilops tauschii, restricting their potential use as markers for the low-polymorphic D genome. Here, we report 68,592 SNPs found on the gene-related sequences of the 5D chromosome of Ae. tauschii genotype MvGB589 using genomic and transcriptomic sequences from seven Ae. tauschii accessions, including AL8/78, the only genotype for which a draft genome sequence is available at present. We also suggest a workflow to compare SNP positions in homologous regions on the 5D chromosome of Triticum aestivum, bread wheat, to mark single nucleotide variations between these closely related species. Overall, the identified SNPs define a density of 4.49 SNPs per kilobyte, among the highest reported for the genic regions of Ae. tauschii so far. To our knowledge, this study also presents the first chromosome-specific SNP catalog in Ae. tauschii that should facilitate the association of these SNPs with morphological traits on chromosome 5D to be ultimately targeted for wheat improvement.

  20. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains

    KAUST Repository

    Coll, Francesc

    2014-09-01

    Strain-specific genomic diversity in the Mycobacterium tuberculosis complex (MTBC) is an important factor in pathogenesis that may affect virulence, transmissibility, host response and emergence of drug resistance. Several systems have been proposed to classify MTBC strains into distinct lineages and families. Here, we investigate single-nucleotide polymorphisms (SNPs) as robust (stable) markers of genetic variation for phylogenetic analysis. We identify ∼92k SNP across a global collection of 1,601 genomes. The SNP-based phylogeny is consistent with the gold-standard regions of difference (RD) classification system. Of the ∼7k strain-specific SNPs identified, 62 markers are proposed to discriminate known circulating strains. This SNP-based barcode is the first to cover all main lineages, and classifies a greater number of sublineages than current alternatives. It may be used to classify clinical isolates to evaluate tools to control the disease, including therapeutics and vaccines whose effectiveness may vary by strain type. © 2014 Macmillan Publishers Limited.

  1. snpTree - a web-server to identify and construct SNP trees from whole genome sequence data

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Kaas, Rolf Sommer; Thomsen, Martin Christen Frølund

    2012-01-01

    identify SNPs and construct phylogenetic trees from WGS as well as from assembled genomes or contigs. WGS data in fastq format are aligned to reference genomes by BWA while contigs in fasta format are processed by Nucmer. SNPs are concatenated based on position on reference genome and a tree is constructed...... to differentiate and classify isolates. One of the successfully and broadly used methods is analysis of single nucletide polymorphisms (SNPs). Currently, there are different tools and methods to identify SNPs including various options and cut-off values. Furthermore, all current methods require bioinformatic...... skills. Thus, we lack a standard and simple automatic tool to determine SNPs and construct phylogenetic tree from WGS data. Results Here we introduce snpTree, a server for online-automatic SNPs analysis. This tool is composed of different SNPs analysis suites, perl and python scripts. snpTree can...

  2. Detecting imbalanced expression of SNP alleles by minisequencing on microarrays

    Directory of Open Access Journals (Sweden)

    Dahlgren Andreas

    2004-10-01

    Full Text Available Abstract Background Each of the human genes or transcriptional units is likely to contain single nucleotide polymorphisms that may give rise to sequence variation between individuals and tissues on the level of RNA. Based on recent studies, differential expression of the two alleles of heterozygous coding single nucleotide polymorphisms (SNPs may be frequent for human genes. Methods with high accuracy to be used in a high throughput setting are needed for systematic surveys of expressed sequence variation. In this study we evaluated two formats of multiplexed, microarray based minisequencing for quantitative detection of imbalanced expression of SNP alleles. We used a panel of ten SNPs located in five genes known to be expressed in two endothelial cell lines as our model system. Results The accuracy and sensitivity of quantitative detection of allelic imbalance was assessed for each SNP by constructing regression lines using a dilution series of mixed samples from individuals of different genotype. Accurate quantification of SNP alleles by both assay formats was evidenced for by R2 values > 0.95 for the majority of the regression lines. According to a two sample t-test, we were able to distinguish 1–9% of a minority SNP allele from a homozygous genotype, with larger variation between SNPs than between assay formats. Six of the SNPs, heterozygous in either of the two cell lines, were genotyped in RNA extracted from the endothelial cells. The coefficient of variation between the fluorescent signals from five parallel reactions was similar for cDNA and genomic DNA. The fluorescence signal intensity ratios measured in the cDNA samples were compared to those in genomic DNA to determine the relative expression levels of the two alleles of each SNP. Four of the six SNPs tested displayed a higher than 1.4-fold difference in allelic ratios between cDNA and genomic DNA. The results were verified by allele-specific oligonucleotide hybridisation and

  3. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    Science.gov (United States)

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  5. SNP and haplotype mapping for genetic analysis in the rat

    Czech Academy of Sciences Publication Activity Database

    Saar, K.; Beck, A.; Bihoreau, M. T.; Birney, E.; Brocklebank, D.; Chen, Y.; Cuppen, E.; Demonchy, S.; Dopazo, J.; Flicek, P.; Foglio, M.; Fujiyama, A.; Gut, I. G.; Gauguier, D.; Guigo, R.; Guryev, V.; Heinig, M.; Hummel, O.; Jahn, N.; Klages, S.; Křen, Vladimír; Kube, M.; Kuhl, H.; Kuramoto, T.; Pravenec, Michal

    2008-01-01

    Roč. 40, č. 5 (2008), s. 560-566 ISSN 1061-4036 R&D Projects: GA MŠk(CZ) 1P05ME791; GA MŠk(CZ) 1M0520; GA MŠk(CZ) ME08006 Grant - others:HHMI(US) 55005624; -(XE) LSHG-CT-2005-019015 Institutional research plan: CEZ:AV0Z50110509 Source of funding: N - neverejné zdroje ; R - rámcový projekt EK Keywords : SNP * rat * complete map Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 30.259, year: 2008

  6. SNP Data Quality Control in a National Beef and Dairy Cattle System and Highly Accurate SNP Based Parentage Verification and Identification

    Directory of Open Access Journals (Sweden)

    Matthew C. McClure

    2018-03-01

    Full Text Available A major use of genetic data is parentage verification and identification as inaccurate pedigrees negatively affect genetic gain. Since 2012 the international standard for single nucleotide polymorphism (SNP verification in Bos taurus cattle has been the ISAG SNP panels. While these ISAG panels provide an increased level of parentage accuracy over microsatellite markers (MS, they can validate the wrong parent at ≤1% misconcordance rate levels, indicating that more SNP are needed if a more accurate pedigree is required. With rapidly increasing numbers of cattle being genotyped in Ireland that represent 61 B. taurus breeds from a wide range of farm types: beef/dairy, AI/pedigree/commercial, purebred/crossbred, and large to small herd size the Irish Cattle Breeding Federation (ICBF analyzed different SNP densities to determine that at a minimum ≥500 SNP are needed to consistently predict only one set of parents at a ≤1% misconcordance rate. For parentage validation and prediction ICBF uses 800 SNP (ICBF800 selected based on SNP clustering quality, ISAG200 inclusion, call rate (CR, and minor allele frequency (MAF in the Irish cattle population. Large datasets require sample and SNP quality control (QC. Most publications only deal with SNP QC via CR, MAF, parent-progeny conflicts, and Hardy-Weinberg deviation, but not sample QC. We report here parentage, SNP QC, and a genomic sample QC pipelines to deal with the unique challenges of >1 million genotypes from a national herd such as SNP genotype errors from mis-tagging of animals, lab errors, farm errors, and multiple other issues that can arise. We divide the pipeline into two parts: a Genotype QC and an Animal QC pipeline. The Genotype QC identifies samples with low call rate, missing or mixed genotype classes (no BB genotype or ABTG alleles present, and low genotype frequencies. The Animal QC handles situations where the genotype might not belong to the listed individual by identifying: >1 non

  7. Fine-scaled human genetic structure revealed by SNP microarrays.

    Science.gov (United States)

    Xing, Jinchuan; Watkins, W Scott; Witherspoon, David J; Zhang, Yuhua; Guthery, Stephen L; Thara, Rangaswamy; Mowry, Bryan J; Bulayeva, Kazima; Weiss, Robert B; Jorde, Lynn B

    2009-05-01

    We report an analysis of more than 240,000 loci genotyped using the Affymetrix SNP microarray in 554 individuals from 27 worldwide populations in Africa, Asia, and Europe. To provide a more extensive and complete sampling of human genetic variation, we have included caste and tribal samples from two states in South India, Daghestanis from eastern Europe, and the Iban from Malaysia. Consistent with observations made by Charles Darwin, our results highlight shared variation among human populations and demonstrate that much genetic variation is geographically continuous. At the same time, principal components analyses reveal discernible genetic differentiation among almost all identified populations in our sample, and in most cases, individuals can be clearly assigned to defined populations on the basis of SNP genotypes. All individuals are accurately classified into continental groups using a model-based clustering algorithm, but between closely related populations, genetic and self-classifications conflict for some individuals. The 250K data permitted high-level resolution of genetic variation among Indian caste and tribal populations and between highland and lowland Daghestani populations. In particular, upper-caste individuals from Tamil Nadu and Andhra Pradesh form one defined group, lower-caste individuals from these two states form another, and the tribal Irula samples form a third. Our results emphasize the correlation of genetic and geographic distances and highlight other elements, including social factors that have contributed to population structure.

  8. A SNP uncoupling Mina expression from the TGFβ signaling pathway.

    Science.gov (United States)

    Lian, Shang L; Mihi, Belgacem; Koyanagi, Madoka; Nakayama, Toshinori; Bix, Mark

    2018-03-01

    Mina is a JmjC family 2-oxoglutarate oxygenase with pleiotropic roles in cell proliferation, cancer, T cell differentiation, pulmonary inflammation, and intestinal parasite expulsion. Although Mina expression varies according to cell-type, developmental stage and activation state, its transcriptional regulation is poorly understood. Across inbred mouse strains, Mina protein level exhibits a bimodal distribution, correlating with inheritance of a biallelic haplotype block comprising 21 promoter/intron 1-region SNPs. We previously showed that heritable differences in Mina protein level are transcriptionally regulated. Accordingly, we decided to test the hypothesis that at least one of the promoter/intron 1-region SNPs perturbs a Mina cis-regulatory element (CRE). Here, we have comprehensively scanned for CREs across a Mina locus-spanning 26-kilobase genomic interval. We discovered 8 potential CREs and functionally validated 4 of these, the strongest of which (E2), residing in intron 1, contained a SNP whose BALB/c-but not C57Bl/6 allele-abolished both Smad3 binding and transforming growth factor beta (TGFβ) responsiveness. Our results demonstrate the TGFβ signaling pathway plays a critical role in regulating Mina expression and SNP rs4191790 controls heritable variation in Mina expression level, raising important questions regarding the evolution of an allele that uncouples Mina expression from the TGFβ signaling pathway. © 2017 The Authors. Immunity, Inflammation and Disease Published by John Wiley & Sons Ltd.

  9. Psoriasis prediction from genome-wide SNP profiles

    Directory of Open Access Journals (Sweden)

    Fang Xiangzhong

    2011-01-01

    Full Text Available Abstract Background With the availability of large-scale genome-wide association study (GWAS data, choosing an optimal set of SNPs for disease susceptibility prediction is a challenging task. This study aimed to use single nucleotide polymorphisms (SNPs to predict psoriasis from searching GWAS data. Methods Totally we had 2,798 samples and 451,724 SNPs. Process for searching a set of SNPs to predict susceptibility for psoriasis consisted of two steps. The first one was to search top 1,000 SNPs with high accuracy for prediction of psoriasis from GWAS dataset. The second one was to search for an optimal SNP subset for predicting psoriasis. The sequential information bottleneck (sIB method was compared with classical linear discriminant analysis(LDA for classification performance. Results The best test harmonic mean of sensitivity and specificity for predicting psoriasis by sIB was 0.674(95% CI: 0.650-0.698, while only 0.520(95% CI: 0.472-0.524 was reported for predicting disease by LDA. Our results indicate that the new classifier sIB performs better than LDA in the study. Conclusions The fact that a small set of SNPs can predict disease status with average accuracy of 68% makes it possible to use SNP data for psoriasis prediction.

  10. New generation pharmacogenomic tools: a SNP linkage disequilibrium Map, validated SNP assay resource, and high-throughput instrumentation system for large-scale genetic studies.

    Science.gov (United States)

    De La Vega, Francisco M; Dailey, David; Ziegle, Janet; Williams, Julie; Madden, Dawn; Gilbert, Dennis A

    2002-06-01

    Since public and private efforts announced the first draft of the human genome last year, researchers have reported great numbers of single nucleotide polymorphisms (SNPs). We believe that the availability of well-mapped, quality SNP markers constitutes the gateway to a revolution in genetics and personalized medicine that will lead to better diagnosis and treatment of common complex disorders. A new generation of tools and public SNP resources for pharmacogenomic and genetic studies--specifically for candidate-gene, candidate-region, and whole-genome association studies--will form part of the new scientific landscape. This will only be possible through the greater accessibility of SNP resources and superior high-throughput instrumentation-assay systems that enable affordable, highly productive large-scale genetic studies. We are contributing to this effort by developing a high-quality linkage disequilibrium SNP marker map and an accompanying set of ready-to-use, validated SNP assays across every gene in the human genome. This effort incorporates both the public sequence and SNP data sources, and Celera Genomics' human genome assembly and enormous resource ofphysically mapped SNPs (approximately 4,000,000 unique records). This article discusses our approach and methodology for designing the map, choosing quality SNPs, designing and validating these assays, and obtaining population frequency ofthe polymorphisms. We also discuss an advanced, high-performance SNP assay chemisty--a new generation of the TaqMan probe-based, 5' nuclease assay-and high-throughput instrumentation-software system for large-scale genotyping. We provide the new SNP map and validation information, validated SNP assays and reagents, and instrumentation systems as a novel resource for genetic discoveries.

  11. SNP markers retrieval for a non-model species: a practical approach

    Directory of Open Access Journals (Sweden)

    Shahin Arwa

    2012-01-01

    Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism markers are rapidly becoming the markers of choice for applications in breeding because of next generation sequencing technology developments. For SNP development by NGS technologies, correct assembly of the huge amounts of sequence data generated is essential. Little is known about assembler's performance, especially when dealing with highly heterogeneous species that show a high genome complexity and what the possible consequences are of differences in assemblies on SNP retrieval. This study tested two assemblers (CAP3 and CLC on 454 data from four lily genotypes and compared results with respect to SNP retrieval. Results CAP3 assembly resulted in higher numbers of contigs, lower numbers of reads per contig, and shorter average read lengths compared to CLC. Blast comparisons showed that CAP3 contigs were highly redundant. Contrastingly, CLC in rare cases combined paralogs in one contig. Redundant and chimeric contigs may lead to erroneous SNPs. Filtering for redundancy can be done by blasting selected SNP markers to the contigs and discarding all the SNP markers that show more than one blast hit. Results on chimeric contigs showed that only four out of 2,421 SNP markers were selected from chimeric contigs. Conclusion In practice, CLC performs better in assembling highly heterogeneous genome sequences compared to CAP3, and consequently SNP retrieval is more efficient. Additionally a simple flow scheme is suggested for SNP marker retrieval that can be valid for all non-model species.

  12. Development and Applications of a High Throughput Genotyping Tool for Polyploid Crops: Single Nucleotide Polymorphism (SNP Array

    Directory of Open Access Journals (Sweden)

    Qian You

    2018-02-01

    Full Text Available Polypoid species play significant roles in agriculture and food production. Many crop species are polyploid, such as potato, wheat, strawberry, and sugarcane. Genotyping has been a daunting task for genetic studies of polyploid crops, which lags far behind the diploid crop species. Single nucleotide polymorphism (SNP array is considered to be one of, high-throughput, relatively cost-efficient and automated genotyping approaches. However, there are significant challenges for SNP identification in complex, polyploid genomes, which has seriously slowed SNP discovery and array development in polyploid species. Ploidy is a significant factor impacting SNP qualities and validation rates of SNP markers in SNP arrays, which has been proven to be a very important tool for genetic studies and molecular breeding. In this review, we (1 discussed the pros and cons of SNP array in general for high throughput genotyping, (2 presented the challenges of and solutions to SNP calling in polyploid species, (3 summarized the SNP selection criteria and considerations of SNP array design for polyploid species, (4 illustrated SNP array applications in several different polyploid crop species, then (5 discussed challenges, available software, and their accuracy comparisons for genotype calling based on SNP array data in polyploids, and finally (6 provided a series of SNP array design and genotype calling recommendations. This review presents a complete overview of SNP array development and applications in polypoid crops, which will benefit the research in molecular breeding and genetics of crops with complex genomes.

  13. SNP Discovery for mapping alien introgressions in wheat

    Science.gov (United States)

    2014-01-01

    Background Monitoring alien introgressions in crop plants is difficult due to the lack of genetic and molecular mapping information on the wild crop relatives. The tertiary gene pool of wheat is a very important source of genetic variability for wheat improvement against biotic and abiotic stresses. By exploring the 5Mg short arm (5MgS) of Aegilops geniculata, we can apply chromosome genomics for the discovery of SNP markers and their use for monitoring alien introgressions in wheat (Triticum aestivum L). Results The short arm of chromosome 5Mg of Ae. geniculata Roth (syn. Ae. ovata L.; 2n = 4x = 28, UgUgMgMg) was flow-sorted from a wheat line in which it is maintained as a telocentric chromosome. DNA of the sorted arm was amplified and sequenced using an Illumina Hiseq 2000 with ~45x coverage. The sequence data was used for SNP discovery against wheat homoeologous group-5 assemblies. A total of 2,178 unique, 5MgS-specific SNPs were discovered. Randomly selected samples of 59 5MgS-specific SNPs were tested (44 by KASPar assay and 15 by Sanger sequencing) and 84% were validated. Of the selected SNPs, 97% mapped to a chromosome 5Mg addition to wheat (the source of t5MgS), and 94% to 5Mg introgressed from a different accession of Ae. geniculata substituting for chromosome 5D of wheat. The validated SNPs also identified chromosome segments of 5MgS origin in a set of T5D-5Mg translocation lines; eight SNPs (25%) mapped to TA5601 [T5DL · 5DS-5MgS(0.75)] and three (8%) to TA5602 [T5DL · 5DS-5MgS (0.95)]. SNPs (gsnp_5ms83 and gsnp_5ms94), tagging chromosome T5DL · 5DS-5MgS(0.95) with the smallest introgression carrying resistance to leaf rust (Lr57) and stripe rust (Yr40), were validated in two released germplasm lines with Lr57 and Yr40 genes. Conclusion This approach should be widely applicable for the identification of species/genome-specific SNPs. The development of a large number of SNP markers will facilitate the precise introgression and

  14. SNP Discovery for mapping alien introgressions in wheat.

    Science.gov (United States)

    Tiwari, Vijay K; Wang, Shichen; Sehgal, Sunish; Vrána, Jan; Friebe, Bernd; Kubaláková, Marie; Chhuneja, Praveen; Doležel, Jaroslav; Akhunov, Eduard; Kalia, Bhanu; Sabir, Jamal; Gill, Bikram S

    2014-04-10

    Monitoring alien introgressions in crop plants is difficult due to the lack of genetic and molecular mapping information on the wild crop relatives. The tertiary gene pool of wheat is a very important source of genetic variability for wheat improvement against biotic and abiotic stresses. By exploring the 5Mg short arm (5MgS) of Aegilops geniculata, we can apply chromosome genomics for the discovery of SNP markers and their use for monitoring alien introgressions in wheat (Triticum aestivum L). The short arm of chromosome 5Mg of Ae. geniculata Roth (syn. Ae. ovata L.; 2n = 4x = 28, UgUgMgMg) was flow-sorted from a wheat line in which it is maintained as a telocentric chromosome. DNA of the sorted arm was amplified and sequenced using an Illumina Hiseq 2000 with ~45x coverage. The sequence data was used for SNP discovery against wheat homoeologous group-5 assemblies. A total of 2,178 unique, 5MgS-specific SNPs were discovered. Randomly selected samples of 59 5MgS-specific SNPs were tested (44 by KASPar assay and 15 by Sanger sequencing) and 84% were validated. Of the selected SNPs, 97% mapped to a chromosome 5Mg addition to wheat (the source of t5MgS), and 94% to 5Mg introgressed from a different accession of Ae. geniculata substituting for chromosome 5D of wheat. The validated SNPs also identified chromosome segments of 5MgS origin in a set of T5D-5Mg translocation lines; eight SNPs (25%) mapped to TA5601 [T5DL · 5DS-5MgS(0.75)] and three (8%) to TA5602 [T5DL · 5DS-5MgS (0.95)]. SNPs (gsnp_5ms83 and gsnp_5ms94), tagging chromosome T5DL · 5DS-5MgS(0.95) with the smallest introgression carrying resistance to leaf rust (Lr57) and stripe rust (Yr40), were validated in two released germplasm lines with Lr57 and Yr40 genes. This approach should be widely applicable for the identification of species/genome-specific SNPs. The development of a large number of SNP markers will facilitate the precise introgression and monitoring of alien segments in crop

  15. An improved PSO algorithm for generating protective SNP barcodes in breast cancer.

    Directory of Open Access Journals (Sweden)

    Li-Yeh Chuang

    Full Text Available BACKGROUND: Possible single nucleotide polymorphism (SNP interactions in breast cancer are usually not investigated in genome-wide association studies. Previously, we proposed a particle swarm optimization (PSO method to compute these kinds of SNP interactions. However, this PSO does not guarantee to find the best result in every implement, especially when high-dimensional data is investigated for SNP-SNP interactions. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we propose IPSO algorithm to improve the reliability of PSO for the identification of the best protective SNP barcodes (SNP combinations and genotypes with maximum difference between cases and controls associated with breast cancer. SNP barcodes containing different numbers of SNPs were computed. The top five SNP barcode results are retained for computing the next SNP barcode with a one-SNP-increase for each processing step. Based on the simulated data for 23 SNPs of six steroid hormone metabolisms and signalling-related genes, the performance of our proposed IPSO algorithm is evaluated. Among 23 SNPs, 13 SNPs displayed significant odds ratio (OR values (1.268 to 0.848; p<0.05 for breast cancer. Based on IPSO algorithm, the jointed effect in terms of SNP barcodes with two to seven SNPs show significantly decreasing OR values (0.84 to 0.57; p<0.05 to 0.001. Using PSO algorithm, two to four SNPs show significantly decreasing OR values (0.84 to 0.77; p<0.05 to 0.001. Based on the results of 20 simulations, medians of the maximum differences for each SNP barcode generated by IPSO are higher than by PSO. The interquartile ranges of the boxplot, as well as the upper and lower hinges for each n-SNP barcode (n = 3∼10 are more narrow in IPSO than in PSO, suggesting that IPSO is highly reliable for SNP barcode identification. CONCLUSIONS/SIGNIFICANCE: Overall, the proposed IPSO algorithm is robust to provide exact identification of the best protective SNP barcodes for breast cancer.

  16. Population structure of Atlantic Mackerel inferred from RAD-seq derived SNP markers: effects of sequence clustering parameters and hierarchical SNP selection

    KAUST Repository

    Rodrí guez-Ezpeleta, Naiara; Bradbury, Ian R.; Mendibil, Iñ aki; Á lvarez, Paula; Cotano, Unai; Irigoien, Xabier

    2016-01-01

    : the maximum number of mismatches allowed to merge reads into a locus and the relatedness of the individuals used for genotype calling and SNP selection. Our study resolves the population structure of the Atlantic mackerel, but, most importantly, provides

  17. FunctSNP: an R package to link SNPs to functional knowledge and dbAutoMaker: a suite of Perl scripts to build SNP databases

    Directory of Open Access Journals (Sweden)

    Watson-Haigh Nathan S

    2010-06-01

    Full Text Available Abstract Background Whole genome association studies using highly dense single nucleotide polymorphisms (SNPs are a set of methods to identify DNA markers associated with variation in a particular complex trait of interest. One of the main outcomes from these studies is a subset of statistically significant SNPs. Finding the potential biological functions of such SNPs can be an important step towards further use in human and agricultural populations (e.g., for identifying genes related to susceptibility to complex diseases or genes playing key roles in development or performance. The current challenge is that the information holding the clues to SNP functions is distributed across many different databases. Efficient bioinformatics tools are therefore needed to seamlessly integrate up-to-date functional information on SNPs. Many web services have arisen to meet the challenge but most work only within the framework of human medical research. Although we acknowledge the importance of human research, we identify there is a need for SNP annotation tools for other organisms. Description We introduce an R package called FunctSNP, which is the user interface to custom built species-specific databases. The local relational databases contain SNP data together with functional annotations extracted from online resources. FunctSNP provides a unified bioinformatics resource to link SNPs with functional knowledge (e.g., genes, pathways, ontologies. We also introduce dbAutoMaker, a suite of Perl scripts, which can be scheduled to run periodically to automatically create/update the customised SNP databases. We illustrate the use of FunctSNP with a livestock example, but the approach and software tools presented here can be applied also to human and other organisms. Conclusions Finding the potential functional significance of SNPs is important when further using the outcomes from whole genome association studies. FunctSNP is unique in that it is the only R

  18. Development of maizeSNP3072, a high-throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties.

    Science.gov (United States)

    Tian, Hong-Li; Wang, Feng-Ge; Zhao, Jiu-Ran; Yi, Hong-Mei; Wang, Lu; Wang, Rui; Yang, Yang; Song, Wei

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are abundant and evenly distributed throughout the maize ( Zea mays L.) genome. SNPs have several advantages over simple sequence repeats, such as ease of data comparison and integration, high-throughput processing of loci, and identification of associated phenotypes. SNPs are thus ideal for DNA fingerprinting, genetic diversity analysis, and marker-assisted breeding. Here, we developed a high-throughput and compatible SNP array, maizeSNP3072, containing 3072 SNPs developed from the maizeSNP50 array. To improve genotyping efficiency, a high-quality cluster file, maizeSNP3072_GT.egt, was constructed. All 3072 SNP loci were localized within different genes, where they were distributed in exons (43 %), promoters (21 %), 3' untranslated regions (UTRs; 22 %), 5' UTRs (9 %), and introns (5 %). The average genotyping failure rate using these SNPs was only 6 %, or 3 % using the cluster file to call genotypes. The genotype consistency of repeat sample analysis on Illumina GoldenGate versus Infinium platforms exceeded 96.4 %. The minor allele frequency (MAF) of the SNPs averaged 0.37 based on data from 309 inbred lines. The 3072 SNPs were highly effective for distinguishing among 276 examined hybrids. Comparative analysis using Chinese varieties revealed that the 3072SNP array showed a better marker success rate and higher average MAF values, evaluation scores, and variety-distinguishing efficiency than the maizeSNP50K array. The maizeSNP3072 array thus can be successfully used in DNA fingerprinting identification of Chinese maize varieties and shows potential as a useful tool for germplasm resource evaluation and molecular marker-assisted breeding.

  19. SNP detection for massively parallel whole-genome resequencing

    DEFF Research Database (Denmark)

    Li, Ruiqiang; Li, Yingrui; Fang, Xiaodong

    2009-01-01

    -genome or target region resequencing. Here, we have developed a consensus-calling and SNP-detection method for sequencing-by-synthesis Illumina Genome Analyzer technology. We designed this method by carefully considering the data quality, alignment, and experimental errors common to this technology. All...... of this information was integrated into a single quality score for each base under Bayesian theory to measure the accuracy of consensus calling. We tested this methodology using a large-scale human resequencing data set of 36x coverage and assembled a high-quality nonrepetitive consensus sequence for 92.......25% of the diploid autosomes and 88.07% of the haploid X chromosome. Comparison of the consensus sequence with Illumina human 1M BeadChip genotyped alleles from the same DNA sample showed that 98.6% of the 37,933 genotyped alleles on the X chromosome and 98% of 999,981 genotyped alleles on autosomes were covered...

  20. Honey bee-inspired algorithms for SNP haplotype reconstruction problem

    Science.gov (United States)

    PourkamaliAnaraki, Maryam; Sadeghi, Mehdi

    2016-03-01

    Reconstructing haplotypes from SNP fragments is an important problem in computational biology. There have been a lot of interests in this field because haplotypes have been shown to contain promising data for disease association research. It is proved that haplotype reconstruction in Minimum Error Correction model is an NP-hard problem. Therefore, several methods such as clustering techniques, evolutionary algorithms, neural networks and swarm intelligence approaches have been proposed in order to solve this problem in appropriate time. In this paper, we have focused on various evolutionary clustering techniques and try to find an efficient technique for solving haplotype reconstruction problem. It can be referred from our experiments that the clustering methods relying on the behaviour of honey bee colony in nature, specifically bees algorithm and artificial bee colony methods, are expected to result in more efficient solutions. An application program of the methods is available at the following link. http://www.bioinf.cs.ipm.ir/software/haprs/

  1. Grouping preprocess for haplotype inference from SNP and CNV data

    International Nuclear Information System (INIS)

    Shindo, Hiroyuki; Chigira, Hiroshi; Nagaoka, Tomoyo; Inoue, Masato; Kamatani, Naoyuki

    2009-01-01

    The method of statistical haplotype inference is an indispensable technique in the field of medical science. The authors previously reported Hardy-Weinberg equilibrium-based haplotype inference that could manage single nucleotide polymorphism (SNP) data. We recently extended the method to cover copy number variation (CNV) data. Haplotype inference from mixed data is important because SNPs and CNVs are occasionally in linkage disequilibrium. The idea underlying the proposed method is simple, but the algorithm for it needs to be quite elaborate to reduce the calculation cost. Consequently, we have focused on the details on the algorithm in this study. Although the main advantage of the method is accuracy, in that it does not use any approximation, its main disadvantage is still the calculation cost, which is sometimes intractable for large data sets with missing values.

  2. SNP-VISTA: An Interactive SNPs Visualization Tool

    Energy Technology Data Exchange (ETDEWEB)

    Shah, Nameeta; Teplitsky, Michael V.; Pennacchio, Len A.; Hugenholtz, Philip; Hamann, Bernd; Dubchak, Inna L.

    2005-07-05

    Recent advances in sequencing technologies promise better diagnostics for many diseases as well as better understanding of evolution of microbial populations. Single Nucleotide Polymorphisms(SNPs) are established genetic markers that aid in the identification of loci affecting quantitative traits and/or disease in a wide variety of eukaryotic species. With today's technological capabilities, it is possible to re-sequence a large set of appropriate candidate genes in individuals with a given disease and then screen for causative mutations.In addition, SNPs have been used extensively in efforts to study the evolution of microbial populations, and the recent application of random shotgun sequencing to environmental samples makes possible more extensive SNP analysis of co-occurring and co-evolving microbial populations. The program is available at http://genome.lbl.gov/vista/snpvista.

  3. Grouping preprocess for haplotype inference from SNP and CNV data

    Energy Technology Data Exchange (ETDEWEB)

    Shindo, Hiroyuki; Chigira, Hiroshi; Nagaoka, Tomoyo; Inoue, Masato [Department of Electrical Engineering and Bioscience, School of Advanced Science and Engineering, Waseda University, 3-4-1, Okubo, Shinjuku-ku, Tokyo 169-8555 (Japan); Kamatani, Naoyuki, E-mail: masato.inoue@eb.waseda.ac.j [Institute of Rheumatology, Tokyo Women' s Medical University, 10-22, Kawada-cho, Shinjuku-ku, Tokyo 162-0054 (Japan)

    2009-12-01

    The method of statistical haplotype inference is an indispensable technique in the field of medical science. The authors previously reported Hardy-Weinberg equilibrium-based haplotype inference that could manage single nucleotide polymorphism (SNP) data. We recently extended the method to cover copy number variation (CNV) data. Haplotype inference from mixed data is important because SNPs and CNVs are occasionally in linkage disequilibrium. The idea underlying the proposed method is simple, but the algorithm for it needs to be quite elaborate to reduce the calculation cost. Consequently, we have focused on the details on the algorithm in this study. Although the main advantage of the method is accuracy, in that it does not use any approximation, its main disadvantage is still the calculation cost, which is sometimes intractable for large data sets with missing values.

  4. UPD detection using homozygosity profiling with a SNP genotyping microarray.

    Science.gov (United States)

    Papenhausen, Peter; Schwartz, Stuart; Risheg, Hiba; Keitges, Elisabeth; Gadi, Inder; Burnside, Rachel D; Jaswaney, Vikram; Pappas, John; Pasion, Romela; Friedman, Kenneth; Tepperberg, James

    2011-04-01

    Single nucleotide polymorphism (SNP) based chromosome microarrays provide both a high-density whole genome analysis of copy number and genotype. In the past 21 months we have analyzed over 13,000 samples primarily referred for developmental delay using the Affymetrix SNP/CN 6.0 version array platform. In addition to copy number, we have focused on the relative distribution of allele homozygosity (HZ) throughout the genome to confirm a strong association of uniparental disomy (UPD) with regions of isoallelism found in most confirmed cases of UPD. We sought to determine whether a long contiguous stretch of HZ (LCSH) greater than a threshold value found only in a single chromosome would correlate with UPD of that chromosome. Nine confirmed UPD cases were retrospectively analyzed with the array in the study, each showing the anticipated LCSH with the smallest 13.5 Mb in length. This length is well above the average longest run of HZ in a set of control patients and was then set as the prospective threshold for reporting possible UPD correlation. Ninety-two cases qualified at that threshold, 46 of those had molecular UPD testing and 29 were positive. Including retrospective cases, 16 showed complete HZ across the chromosome, consistent with total isoUPD. The average size LCSH in the 19 cases that were not completely HZ was 46.3 Mb with a range of 13.5-127.8 Mb. Three patients showed only segmental UPD. Both the size and location of the LCSH are relevant to correlation with UPD. Further studies will continue to delineate an optimal threshold for LCSH/UPD correlation. Copyright © 2011 Wiley-Liss, Inc.

  5. Differential growth of Mycobacterium leprae strains (SNP genotypes) in armadillos.

    Science.gov (United States)

    Sharma, Rahul; Singh, Pushpendra; Pena, Maria; Subramanian, Ramesh; Chouljenko, Vladmir; Kim, Joohyun; Kim, Nayong; Caskey, John; Baudena, Marie A; Adams, Linda B; Truman, Richard W

    2018-04-14

    Leprosy (Hansen's Disease) has occurred throughout human history, and persists today at a low prevalence in most populations. Caused by Mycobacterium leprae, the infection primarily involves the skin, mucosa and peripheral nerves. The susceptible host range for Mycobacterium leprae is quite narrow. Besides humans, nine banded armadillos (Dasypus novemcinctus) and red squirrels (Sciurus vulgaris) are the only other natural hosts for M. leprae, but only armadillos recapitulate the disease as seen in humans. Armadillos across the Southern United States harbor a single predominant genotypic strain (SNP Type-3I) of M. leprae, which is also implicated in the zoonotic transmission of leprosy. We investigated, whether the zoonotic strain (3I) has any notable growth advantages in armadillos over another genetically distant strain-type (SNP Type-4P) of M. leprae, and if M. leprae strains manifest any notably different pathology among armadillos. We co-infected armadillos (n = 6) with 2 × 10 9 highly viable M. leprae of both strains and assessed the relative growth and dissemination of each strain in the animals. We also analyzed 12 additional armadillos, 6 each individually infected with the same quantity of either strain. The infections were allowed to fulminate and the clinical manifestations of the disease were noted. Animals were humanely sacrificed at the terminal stage of infection and the number of bacilli per gram of liver, spleen and lymph node tissue were enumerated by Q-PCR assay. The growth of M. leprae strain 4P was significantly higher (P leprae strains within armadillos suggest there are notable pathological variations between M. leprae strain-types. Copyright © 2018. Published by Elsevier B.V.

  6. A 48-plex autosomal SNP GenPlex™ assay for human individualization and relationship testing

    DEFF Research Database (Denmark)

    Tomas Mas, Carmen; Børsting, Claus; Morling, Niels

    2012-01-01

    SNPs are being increasingly used by forensic laboratories. Different platforms have been developed for SNP typing. We describe the GenPlex™ HID system protocol, a new SNP-typing platform developed by Applied Biosystems where 48 of the 52 SNPforID SNPs and amelogenin are included. The GenPlex™ HID...

  7. Performance of the SNPforID 52 SNP-plex assay in paternity testing

    DEFF Research Database (Denmark)

    Børsting, Claus; Sanchez, Juan Jose; Hansen, Hanna E

    2008-01-01

    (VNTRs). The typical PIs based on 15 STRs or seven VNTRs were 5-50 times higher than the typical PIs based on 52 SNPs. Six mutations in tandem repeats were detected among the randomly selected trios. In contrast, there was not found any mutations in the SNP loci. The results showed that the 52 SNP...

  8. Evaluation of the OvineSNP50 chip for use in four South African ...

    African Journals Online (AJOL)

    Relatively rapid and cost-effective genotyping using the OvineSNP50 chip holds great promise for the South African sheep industry and research partners. However, SNP ascertainment bias may influence inferences from the genotyping results of South African sheep breeds. Therefore, samples from Dorper, Namaqua ...

  9. Development and application of a 20K SNP array in potato

    NARCIS (Netherlands)

    Vos, Peter

    2016-01-01

    In this thesis the results are described of investigations of various application of genome wide SNP (single nucleotide polymorphism) markers. The set of SNP markers was identified by GBS (genotyping by sequencing) strategy. The resulting dataset of 129,156 SNPs across 83 tetraploid varieties was

  10. The joint effect of the endothelin receptor B gene (EDNRB polymorphism rs10507875 and nitric oxide synthase 3 gene (NOS3 polymorphism rs869109213 in Slovenian patients with type 2 diabetes mellitus and diabetic retinopathy

    Directory of Open Access Journals (Sweden)

    Dejan Bregar

    2018-02-01

    Full Text Available Increasing evidence suggests that endothelin and nitric oxide synthase genes and their products exert biological effects on the vasculature via the nitric oxide or endothelin pathway. The aim of the study was to evaluate the association of rs10507875 and rs869109213 (alone or in interaction with diabetic retinopathy (DR in subjects with type 2 diabetes mellitus (T2DM. We genotyped the single nucleotide polymorphism rs10507875 of the endothelin receptor B gene (EDNRB and variable number tandem repeats rs869109213 of the nitric oxide synthase 3 gene (NOS3 in 270 Slovenian patients with DR and T2DM and 256 controls with T2DM without clinical signs of DR. The genotyping was performed using either real-time polymerase chain reaction (PCR or standard PCR. We found a significant association between the genotypes of NOS3 rs869109213 polymorphism and the risk of DR in the co-dominant model (4a4b genotype; 1.99-fold increased risk [1.09-3.65]; 95% confidence interval [CI]; p = 0.02, co-dominant model (4a4a genotype; 4.16-fold increased risk [1.03-16.74]; 95% CI; p = 0.04, and dominant model (4a4a and 4a4b genotypes; 2.22-fold increased risk [1.26-3.92]; 95% CI; p = 0.01 compared to the 4b4b genotype. Moreover, the joint effect of the two polymorphisms on DR risk was greater than the individual effect of each polymorphism in the analyzed genetic models. Additionally, adjusted odds ratio showed an increased risk in dominant × dominant (4.15-fold [1.40-12.26]; 95% CI; p = 0.01 and recessive × dominant (2.24-fold [1.25-4.01]; 95% CI; p = 0.02 genotype combinations of the two polymorphisms. In conclusion, our results indicate that NOS3 rs869109213 polymorphism alone or in a combination with EDNRB rs10507875 polymorphism may be associated with DR in Slovenian patients with T2DM.

  11. Identification of SNP barcode biomarkers for genes associated with facial emotion perception using particle swarm optimization algorithm.

    Science.gov (United States)

    Chuang, Li-Yeh; Lane, Hsien-Yuan; Lin, Yu-Da; Lin, Ming-Teng; Yang, Cheng-Hong; Chang, Hsueh-Wei

    2014-01-01

    Facial emotion perception (FEP) can affect social function. We previously reported that parts of five tested single-nucleotide polymorphisms (SNPs) in the MET and AKT1 genes may individually affect FEP performance. However, the effects of SNP-SNP interactions on FEP performance remain unclear. This study compared patients with high and low FEP performances (n = 89 and 93, respectively). A particle swarm optimization (PSO) algorithm was used to identify the best SNP barcodes (i.e., the SNP combinations and genotypes that revealed the largest differences between the high and low FEP groups). The analyses of individual SNPs showed no significant differences between the high and low FEP groups. However, comparisons of multiple SNP-SNP interactions involving different combinations of two to five SNPs showed that the best PSO-generated SNP barcodes were significantly associated with high FEP score. The analyses of the joint effects of the best SNP barcodes for two to five interacting SNPs also showed that the best SNP barcodes had significantly higher odds ratios (2.119 to 3.138; P < 0.05) compared to other SNP barcodes. In conclusion, the proposed PSO algorithm effectively identifies the best SNP barcodes that have the strongest associations with FEP performance. This study also proposes a computational methodology for analyzing complex SNP-SNP interactions in social cognition domains such as recognition of facial emotion.

  12. LS-SNP/PDB: annotated non-synonymous SNPs mapped to Protein Data Bank structures.

    Science.gov (United States)

    Ryan, Michael; Diekhans, Mark; Lien, Stephanie; Liu, Yun; Karchin, Rachel

    2009-06-01

    LS-SNP/PDB is a new WWW resource for genome-wide annotation of human non-synonymous (amino acid changing) SNPs. It serves high-quality protein graphics rendered with UCSF Chimera molecular visualization software. The system is kept up-to-date by an automated, high-throughput build pipeline that systematically maps human nsSNPs onto Protein Data Bank structures and annotates several biologically relevant features. LS-SNP/PDB is available at (http://ls-snp.icm.jhu.edu/ls-snp-pdb) and via links from protein data bank (PDB) biology and chemistry tabs, UCSC Genome Browser Gene Details and SNP Details pages and PharmGKB Gene Variants Downloads/Cross-References pages.

  13. Design and characterization of a 52K SNP chip for goats.

    Directory of Open Access Journals (Sweden)

    Gwenola Tosser-Klopp

    Full Text Available The success of Genome Wide Association Studies in the discovery of sequence variation linked to complex traits in humans has increased interest in high throughput SNP genotyping assays in livestock species. Primary goals are QTL detection and genomic selection. The purpose here was design of a 50-60,000 SNP chip for goats. The success of a moderate density SNP assay depends on reliable bioinformatic SNP detection procedures, the technological success rate of the SNP design, even spacing of SNPs on the genome and selection of Minor Allele Frequencies (MAF suitable to use in diverse breeds. Through the federation of three SNP discovery projects consolidated as the International Goat Genome Consortium, we have identified approximately twelve million high quality SNP variants in the goat genome stored in a database together with their biological and technical characteristics. These SNPs were identified within and between six breeds (meat, milk and mixed: Alpine, Boer, Creole, Katjang, Saanen and Savanna, comprising a total of 97 animals. Whole genome and Reduced Representation Library sequences were aligned on >10 kb scaffolds of the de novo goat genome assembly. The 60,000 selected SNPs, evenly spaced on the goat genome, were submitted for oligo manufacturing (Illumina, Inc and published in dbSNP along with flanking sequences and map position on goat assemblies (i.e. scaffolds and pseudo-chromosomes, sheep genome V2 and cattle UMD3.1 assembly. Ten breeds were then used to validate the SNP content and 52,295 loci could be successfully genotyped and used to generate a final cluster file. The combined strategy of using mainly whole genome Next Generation Sequencing and mapping on a contig genome assembly, complemented with Illumina design tools proved to be efficient in producing this GoatSNP50 chip. Advances in use of molecular markers are expected to accelerate goat genomic studies in coming years.

  14. A customized pigmentation SNP array identifies a novel SNP associated with melanoma predisposition in the SLC45A2 gene.

    Directory of Open Access Journals (Sweden)

    Maider Ibarrola-Villava

    Full Text Available As the incidence of Malignant Melanoma (MM reflects an interaction between skin colour and UV exposure, variations in genes implicated in pigmentation and tanning response to UV may be associated with susceptibility to MM. In this study, 363 SNPs in 65 gene regions belonging to the pigmentation pathway have been successfully genotyped using a SNP array. Five hundred and ninety MM cases and 507 controls were analyzed in a discovery phase I. Ten candidate SNPs based on a p-value threshold of 0.01 were identified. Two of them, rs35414 (SLC45A2 and rs2069398 (SILV/CKD2, were statistically significant after conservative Bonferroni correction. The best six SNPs were further tested in an independent Spanish series (624 MM cases and 789 controls. A novel SNP located on the SLC45A2 gene (rs35414 was found to be significantly associated with melanoma in both phase I and phase II (P<0.0001. None of the other five SNPs were replicated in this second phase of the study. However, three SNPs in TYR, SILV/CDK2 and ADAMTS20 genes (rs17793678, rs2069398 and rs1510521 respectively had an overall p-value<0.05 when considering the whole DNA collection (1214 MM cases and 1296 controls. Both the SLC45A2 and the SILV/CDK2 variants behave as protective alleles, while the TYR and ADAMTS20 variants seem to function as risk alleles. Cumulative effects were detected when these four variants were considered together. Furthermore, individuals carrying two or more mutations in MC1R, a well-known low penetrance melanoma-predisposing gene, had a decreased MM risk if concurrently bearing the SLC45A2 protective variant. To our knowledge, this is the largest study on Spanish sporadic MM cases to date.

  15. MDM2 gene SNP309 T/G and p53 gene SNP72 G/C do not influence diffuse large B-cell non-Hodgkin lymphoma onset or survival in central European Caucasians

    Directory of Open Access Journals (Sweden)

    Landt Olfert

    2008-04-01

    Full Text Available Abstract Background SNP309 T/G (rs2279744 causes higher levels of MDM2, the most important negative regulator of the p53 tumor suppressor. SNP72 G/C (rs1042522 gives rise to a p53 protein with a greatly reduced capacity to induce apoptosis. Both polymorphisms have been implicated in cancer. The SNP309 G-allele has recently been reported to accelerate diffuse large B-cell lymphoma (DLBCL formation in pre-menopausal women and suggested to constitute a genetic basis for estrogen affecting human tumorigenesis. Here we asked whether SNP309 and SNP72 are associated with DLBCL in women and are correlated with age of onset, diagnosis, or patient's survival. Methods SNP309 and SNP72 were PCR-genotyped in a case-control study that included 512 controls and 311 patients diagnosed with aggressive NHL. Of these, 205 were diagnosed with DLBCL. Results The age of onset was similar in men and women. The control and patients group showed similar SNP309 and SNP72 genotype frequencies. Importantly and in contrast to the previous findings, similar genotype frequencies were observed in female patients diagnosed by 51 years of age and those diagnosed later. Specifically, 3/20 female DLBCL patients diagnosed by 51 years of age were homozygous for SNP309 G and 2/20 DLBCL females in that age group were homozygous for SNP72 C. Neither SNP309 nor SNP72 had a significant influence on event-free and overall survival in multivariate analyses. Conclusion In contrast to the previous study on Ashkenazi Jewish Caucasians, DLBCL in pre-menopausal women of central European Caucasian ethnicity was not associated with SNP309 G. Neither SNP309 nor SNP72 seem to be correlated with age of onset, diagnosis, or survival of patients.

  16. Heap: a highly sensitive and accurate SNP detection tool for low-coverage high-throughput sequencing data

    KAUST Repository

    Kobayashi, Masaaki; Ohyanagi, Hajime; Takanashi, Hideki; Asano, Satomi; Kudo, Toru; Kajiya-Kanegae, Hiromi; Nagano, Atsushi J.; Tainaka, Hitoshi; Tokunaga, Tsuyoshi; Sazuka, Takashi; Iwata, Hiroyoshi; Tsutsumi, Nobuhiro; Yano, Kentaro

    2017-01-01

    and GP depends on not only their mathematical models, but the quality and quantity of variants employed in the analysis. In NGS single nucleotide polymorphism (SNP) calling, conventional tools ideally require more reads for higher SNP sensitivity

  17. SNP Polymorphism Survey of the Parental Lines of ISRA Sorghum Breeding Program as Part of the Feed the Future

    Data.gov (United States)

    US Agency for International Development — Polymorphism of SNP Markers (single nucleotide polymorphisms) was assessed on 24 parental lines of the ISRA sorghum breeding program . About 1300 SNP have been used...

  18. Alkali-developable silicone-based negative photoresist (SNP) for deep UV, electron beam, and X-ray lithographies

    International Nuclear Information System (INIS)

    Ban, Hiroshi; Tanaka, Akinobu; Kawai, Yoshio; Deguchi, Kimiyoshi

    1989-01-01

    A new silicone-based negative photoresist (SNP) developable with alkaline aqueous solutions is prepared. SNP composed of acetylated phenylsilsesquioxane oligomer and azidopyrene is applied to deep UV, electron beam (EB), and X-ray lithographies. SNP slightly swells in alkaline developers, thus exhibiting exceptionally high resolution characteristics for a negative resist. The resistance of SNP to oxygen reactive ion etching is approximately 30 times greater than that of conventional novolac resists. (author)

  19. Two combinatorial optimization problems for SNP discovery using base-specific cleavage and mass spectrometry.

    Science.gov (United States)

    Chen, Xin; Wu, Qiong; Sun, Ruimin; Zhang, Louxin

    2012-01-01

    The discovery of single-nucleotide polymorphisms (SNPs) has important implications in a variety of genetic studies on human diseases and biological functions. One valuable approach proposed for SNP discovery is based on base-specific cleavage and mass spectrometry. However, it is still very challenging to achieve the full potential of this SNP discovery approach. In this study, we formulate two new combinatorial optimization problems. While both problems are aimed at reconstructing the sample sequence that would attain the minimum number of SNPs, they search over different candidate sequence spaces. The first problem, denoted as SNP - MSP, limits its search to sequences whose in silico predicted mass spectra have all their signals contained in the measured mass spectra. In contrast, the second problem, denoted as SNP - MSQ, limits its search to sequences whose in silico predicted mass spectra instead contain all the signals of the measured mass spectra. We present an exact dynamic programming algorithm for solving the SNP - MSP problem and also show that the SNP - MSQ problem is NP-hard by a reduction from a restricted variation of the 3-partition problem. We believe that an efficient solution to either problem above could offer a seamless integration of information in four complementary base-specific cleavage reactions, thereby improving the capability of the underlying biotechnology for sensitive and accurate SNP discovery.

  20. Interference of Homologous Sequences on the SNP Study of CYP2A13 Gene

    Directory of Open Access Journals (Sweden)

    Qinghua ZHOU

    2010-02-01

    Full Text Available Background and objective It has been proven that cytochrome P450 enzyme 2A13 (CYP2A13 played an important role in the association between single nucleotide polymorphisms (SNP and human diseases. Cytochrome P450 enzymes are a group of isoenzymes, whose sequence homology may interfere with the study for SNP. The aim of this study is to explore the interference on the SNP study of CYP2A13 caused by homologous sequences. Methods Taqman probe was applied to detect distribution of rs8192789 sites in 573 subjects, and BLAST method was used to analyze the amplified sequences. Partial sequences of CYP2A13 were emplified by PCR from 60 cases. The emplified sequences were TA cloned and sequenced. Results For rs8192789 loci in 573 cases, only 3 cases were TT, while the rest were CT heterozygotes, which was caused by homologous sequences. There are a large number of overlapping peaks in identical sequences of 60 cases, and the SNP of 101 amino acid site reported in the SNP database is not found. The cloned sequences are 247 bp, 235 bp fragments. Conclusion The homologous sequences may interfere the study for SNP of CYP2A13, and some SNP may not exist.

  1. Genetic Polymorphism of MDM2 SNP309 in Patients with Helicobacter Pylori-Associated Gastritis.

    Science.gov (United States)

    Tongtawee, Taweesak; Dechsukhum, Chavaboon; Leeanansaksiri, Wilairat; Kaewpitoon, Soraya; Kaewpitoon, Natthawut; Loyd, Ryan A; Matrakool, Likit; Panpimanmas, Sukij

    2015-01-01

    Helicobacter pylori plays an important role in gastric cancer, which has a relatively low inciduence in Thailand. MDM2 is a major negative regulator of p53, the key tumor suppressor involved in tumorigenesis of the majority of human cancers. Whether its expression might explain the relative lack of gastric cancer in Thailand was assessed here. This single-center study was conducted in the northeast region of Thailand. Gastric mucosa from 100 patients with Helicobacter pylori associated gastritis was analyzed for MDM2 SNP309 using real-time PCR hybridization (light-cycler) probes. In the total 100 Helicobacter pylori associated gastritis cases the incidence of SNP 309 T/T homozygous was 78 % with SNP309 G/T heterozygous found in 19% and SNP309 G/G homozygous in 3%. The result show SNP 309 T/T and SNP 309 G/T to be rather common in the Thai population. Our study indicates that the MDM2 SNP309 G/G homozygous genotype might be a risk factor for gastric cancer in Thailand and the fact that it is infrequent could explain to some extent the low incidence of gastric cancer in the Thai population.

  2. GenomeRunner web server: regulatory similarity and differences define the functional impact of SNP sets.

    Science.gov (United States)

    Dozmorov, Mikhail G; Cara, Lukas R; Giles, Cory B; Wren, Jonathan D

    2016-08-01

    The growing amount of regulatory data from the ENCODE, Roadmap Epigenomics and other consortia provides a wealth of opportunities to investigate the functional impact of single nucleotide polymorphisms (SNPs). Yet, given the large number of regulatory datasets, researchers are posed with a challenge of how to efficiently utilize them to interpret the functional impact of SNP sets. We developed the GenomeRunner web server to automate systematic statistical analysis of SNP sets within a regulatory context. Besides defining the functional impact of SNP sets, GenomeRunner implements novel regulatory similarity/differential analyses, and cell type-specific regulatory enrichment analysis. Validated against literature- and disease ontology-based approaches, analysis of 39 disease/trait-associated SNP sets demonstrated that the functional impact of SNP sets corresponds to known disease relationships. We identified a group of autoimmune diseases with SNPs distinctly enriched in the enhancers of T helper cell subpopulations, and demonstrated relevant cell type-specificity of the functional impact of other SNP sets. In summary, we show how systematic analysis of genomic data within a regulatory context can help interpreting the functional impact of SNP sets. GenomeRunner web server is freely available at http://www.integrativegenomics.org/ mikhail.dozmorov@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  3. A set of 14 DIP-SNP markers to detect unbalanced DNA mixtures.

    Science.gov (United States)

    Liu, Zhizhen; Liu, Jinding; Wang, Jiaqi; Chen, Deqing; Liu, Zidong; Shi, Jie; Li, Zeqin; Li, Wenyan; Zhang, Gengqian; Du, Bing

    2018-03-04

    Unbalanced DNA mixture is still a difficult problem for forensic practice. DIP-STRs are useful markers for detection of minor DNA but they are not widespread in the human genome and having long amplicons. In this study, we proposed a novel type of genetic marker, termed DIP-SNP. DIP-SNP refers to the combination of INDEL and SNP in less than 300bp length of human genome. The multiplex PCR and SNaPshot assay were established for 14 DIP-SNP markers in a Chinese Han population from Shanxi, China. This novel compound marker allows detection of the minor DNA contributor with sensitivity from 1:50 to 1:1000 in a DNA mixture of any gender with 1 ng-10 ng DNA template. Most of the DIP-SNP markers had a relatively high probability of informative alleles with an average I value of 0.33. In all, we proposed DIP-SNP as a novel kind of genetic marker for detection of minor contributor from unbalanced DNA mixture and established the detection method by associating the multiplex PCR and SNaPshot assay. DIP-SNP polymorphisms are promising markers for forensic or clinical mixture examination because they are shorter, widespread and higher sensitive. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Sequential sentinel SNP Regional Association Plots (SSS-RAP): an approach for testing independence of SNP association signals using meta-analysis data.

    Science.gov (United States)

    Zheng, Jie; Gaunt, Tom R; Day, Ian N M

    2013-01-01

    Genome-Wide Association Studies (GWAS) frequently incorporate meta-analysis within their framework. However, conditional analysis of individual-level data, which is an established approach for fine mapping of causal sites, is often precluded where only group-level summary data are available for analysis. Here, we present a numerical and graphical approach, "sequential sentinel SNP regional association plot" (SSS-RAP), which estimates regression coefficients (beta) with their standard errors using the meta-analysis summary results directly. Under an additive model, typical for genes with small effect, the effect for a sentinel SNP can be transformed to the predicted effect for a possibly dependent SNP through a 2×2 2-SNP haplotypes table. The approach assumes Hardy-Weinberg equilibrium for test SNPs. SSS-RAP is available as a Web-tool (http://apps.biocompute.org.uk/sssrap/sssrap.cgi). To develop and illustrate SSS-RAP we analyzed lipid and ECG traits data from the British Women's Heart and Health Study (BWHHS), evaluated a meta-analysis for ECG trait and presented several simulations. We compared results with existing approaches such as model selection methods and conditional analysis. Generally findings were consistent. SSS-RAP represents a tool for testing independence of SNP association signals using meta-analysis data, and is also a convenient approach based on biological principles for fine mapping in group level summary data. © 2012 Blackwell Publishing Ltd/University College London.

  5. MDM2 promoter SNP344T>A (rs1196333 status does not affect cancer risk.

    Directory of Open Access Journals (Sweden)

    Stian Knappskog

    Full Text Available The MDM2 proto-oncogene plays a key role in central cellular processes like growth control and apoptosis, and the gene locus is frequently amplified in sarcomas. Two polymorphisms located in the MDM2 promoter P2 have been shown to affect cancer risk. One of these polymorphisms (SNP309T>G; rs2279744 facilitates Sp1 transcription factor binding to the promoter and is associated with increased cancer risk. In contrast, SNP285G>C (rs117039649, located 24 bp upstream of rs2279744, and in complete linkage disequilibrium with the SNP309G allele, reduces Sp1 recruitment and lowers cancer risk. Thus, fine tuning of MDM2 expression has proven to be of significant importance with respect to tumorigenesis. We assessed the potential functional effects of a third MDM2 promoter P2 polymorphism (SNP344T>A; rs1196333 located on the SNP309T allele. While in silico analyses indicated SNP344A to modulate TFAP2A, SPIB and AP1 transcription factor binding, we found no effect of SNP344 status on MDM2 expression levels. Assessing the frequency of SNP344A in healthy Caucasians (n = 2,954 and patients suffering from ovarian (n = 1,927, breast (n = 1,271, endometrial (n = 895 or prostatic cancer (n = 641, we detected no significant difference in the distribution of this polymorphism between any of these cancer forms and healthy controls (6.1% in healthy controls, and 4.9%, 5.0%, 5.4% and 7.2% in the cancer groups, respectively. In conclusion, our findings provide no evidence indicating that SNP344A may affect MDM2 transcription or cancer risk.

  6. SNP-based typing: a useful tool to study Bordetella pertussis populations.

    Directory of Open Access Journals (Sweden)

    Marjolein van Gent

    Full Text Available To monitor changes in Bordetella pertussis populations, mainly two typing methods are used; Pulsed-Field Gel Electrophoresis (PFGE and Multiple-Locus Variable-Number Tandem Repeat Analysis (MLVA. In this study, a single nucleotide polymorphism (SNP typing method, based on 87 SNPs, was developed and compared with PFGE and MLVA. The discriminatory indices of SNP typing, PFGE and MLVA were found to be 0.85, 0.95 and 0.83, respectively. Phylogenetic analysis, using SNP typing as Gold Standard, revealed false homoplasies in the PFGE and MLVA trees. Further, in contrast to the SNP-based tree, the PFGE- and MLVA-based trees did not reveal a positive correlation between root-to-tip distance and the isolation year of strains. Thus PFGE and MLVA do not allow an estimation of the relative age of the selected strains. In conclusion, SNP typing was found to be phylogenetically more informative than PFGE and more discriminative than MLVA. Further, in contrast to PFGE, it is readily standardized allowing interlaboratory comparisons. We applied SNP typing to study strains with a novel allele for the pertussis toxin promoter, ptxP3, which have a worldwide distribution and which have replaced the resident ptxP1 strains in the last 20 years. Previously, we showed that ptxP3 strains showed increased pertussis toxin expression and that their emergence was associated with increased notification in The Netherlands. SNP typing showed that the ptxP3 strains isolated in the Americas, Asia, Australia and Europe formed a monophyletic branch which recently diverged from ptxP1 strains. Two predominant ptxP3 SNP types were identified which spread worldwide. The widespread use of SNP typing will enhance our understanding of the evolution and global epidemiology of B. pertussis.

  7. SNP-Based Typing: A Useful Tool to Study Bordetella pertussis Populations

    Science.gov (United States)

    van der Heide, Han G. J.; Heuvelman, Kees J.; Kallonen, Teemu; He, Qiushui; Mertsola, Jussi; Advani, Abdolreza; Hallander, Hans O.; Janssens, Koen; Hermans, Peter W.; Mooi, Frits R.

    2011-01-01

    To monitor changes in Bordetella pertussis populations, mainly two typing methods are used; Pulsed-Field Gel Electrophoresis (PFGE) and Multiple-Locus Variable-Number Tandem Repeat Analysis (MLVA). In this study, a single nucleotide polymorphism (SNP) typing method, based on 87 SNPs, was developed and compared with PFGE and MLVA. The discriminatory indices of SNP typing, PFGE and MLVA were found to be 0.85, 0.95 and 0.83, respectively. Phylogenetic analysis, using SNP typing as Gold Standard, revealed false homoplasies in the PFGE and MLVA trees. Further, in contrast to the SNP-based tree, the PFGE- and MLVA-based trees did not reveal a positive correlation between root-to-tip distance and the isolation year of strains. Thus PFGE and MLVA do not allow an estimation of the relative age of the selected strains. In conclusion, SNP typing was found to be phylogenetically more informative than PFGE and more discriminative than MLVA. Further, in contrast to PFGE, it is readily standardized allowing interlaboratory comparisons. We applied SNP typing to study strains with a novel allele for the pertussis toxin promoter, ptxP3, which have a worldwide distribution and which have replaced the resident ptxP1 strains in the last 20 years. Previously, we showed that ptxP3 strains showed increased pertussis toxin expression and that their emergence was associated with increased notification in the Netherlands. SNP typing showed that the ptxP3 strains isolated in the Americas, Asia, Australia and Europe formed a monophyletic branch which recently diverged from ptxP1 strains. Two predominant ptxP3 SNP types were identified which spread worldwide. The widespread use of SNP typing will enhance our understanding of the evolution and global epidemiology of B. pertussis. PMID:21647370

  8. Drop-out probabilities of IrisPlex SNP alleles

    DEFF Research Database (Denmark)

    Andersen, Jeppe Dyrberg; Tvedebrink, Torben; Mogensen, Helle Smidt

    2013-01-01

    In certain crime cases, information about a perpetrator's phenotype, including eye colour, may be a valuable tool if no DNA profile of any suspect or individual in the DNA database matches the DNA profile found at the crime scene. Often, the available DNA material is sparse and allelic drop-out...... of true alleles is possible. As part of the validation of the IrisPlex assay in our ISO17025 accredited, forensic genetic laboratory, we estimated the probability of drop-out of specific SNP alleles using 29 and 30 PCR cycles and 25, 50 and 100 Single Base Extension (SBE) cycles. We observed no drop-out...... when the amount of DNA was greater than 125 pg for 29 cycles of PCR and greater than 62 pg for 30 cycles of PCR. With the use of a logistic regression model, we estimated the allele specific probability of drop-out in heterozygote systems based on the signal strength of the observed allele...

  9. Typing of 48 autosomal SNPs and amelogenin with GenPlex SNP genotyping system in forensic genetics

    DEFF Research Database (Denmark)

    Tomas Mas, Carmen; Stangegaard, Michael; Børsting, Claus

    2008-01-01

    , Somalia and Greenland were investigated with GenPlex using a Biomek 3000 (Beckman Coulter) robot. The results were compared to results obtained with an ISO 17025 accredited SNP typing assay based on single base extension (SBE). With the GenPlex SNP genotyping system, full SNP profiles were obtained in 97.......6% of the investigations. Perfect concordance was obtained in duplicate investigations and the SNP genotypes obtained with the GenPlex system were concordant with those of the accredited SBE based SNP typing system except for one result in rs901398 in one of 286 individuals most likely due to a mutation 6 bp downstream...

  10. Genome-wide joint meta-analysis of SNP and SNP-by-smoking interaction identifies novel loci for pulmonary function.

    Directory of Open Access Journals (Sweden)

    Dana B Hancock

    Full Text Available Genome-wide association studies have identified numerous genetic loci for spirometic measures of pulmonary function, forced expiratory volume in one second (FEV(1, and its ratio to forced vital capacity (FEV(1/FVC. Given that cigarette smoking adversely affects pulmonary function, we conducted genome-wide joint meta-analyses (JMA of single nucleotide polymorphism (SNP and SNP-by-smoking (ever-smoking or pack-years associations on FEV(1 and FEV(1/FVC across 19 studies (total N = 50,047. We identified three novel loci not previously associated with pulmonary function. SNPs in or near DNER (smallest P(JMA = 5.00×10(-11, HLA-DQB1 and HLA-DQA2 (smallest P(JMA = 4.35×10(-9, and KCNJ2 and SOX9 (smallest P(JMA = 1.28×10(-8 were associated with FEV(1/FVC or FEV(1 in meta-analysis models including SNP main effects, smoking main effects, and SNP-by-smoking (ever-smoking or pack-years interaction. The HLA region has been widely implicated for autoimmune and lung phenotypes, unlike the other novel loci, which have not been widely implicated. We evaluated DNER, KCNJ2, and SOX9 and found them to be expressed in human lung tissue. DNER and SOX9 further showed evidence of differential expression in human airway epithelium in smokers compared to non-smokers. Our findings demonstrated that joint testing of SNP and SNP-by-environment interaction identified novel loci associated with complex traits that are missed when considering only the genetic main effects.

  11. Polygenic analysis of genome-wide SNP data identifies common variants on allergic rhinitis

    DEFF Research Database (Denmark)

    Mohammadnejad, Afsaneh; Brasch-Andersen, Charlotte; Haagerup, Annette

    Background: Allergic Rhinitis (AR) is a complex disorder that affects many people around the world. There is a high genetic contribution to the development of the AR, as twins and family studies have estimated heritability of more than 33%. Due to the complex nature of the disease, single SNP...... analysis has limited power in identifying the genetic variations for AR. We combined genome-wide association analysis (GWAS) with polygenic risk score (PRS) in exploring the genetic basis underlying the disease. Methods: We collected clinical data on 631 Danish subjects with AR cases consisting of 434...... sibling pairs and unrelated individuals and control subjects of 197 unrelated individuals. SNP genotyping was done by Affymetrix Genome-Wide Human SNP Array 5.0. SNP imputation was performed using "IMPUTE2". Using additive effect model, GWAS was conducted in discovery sample, the genotypes...

  12. Interim report on updated microarray probes for the LLNL Burkholderia pseudomallei SNP array

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S; Jaing, C

    2012-03-27

    The overall goal of this project is to forensically characterize 100 unknown Burkholderia isolates in the US-Australia collaboration. We will identify genome-wide single nucleotide polymorphisms (SNPs) from B. pseudomallei and near neighbor species including B. mallei, B. thailandensis and B. oklahomensis. We will design microarray probes to detect these SNP markers and analyze 100 Burkholderia genomic DNAs extracted from environmental, clinical and near neighbor isolates from Australian collaborators on the Burkholderia SNP microarray. We will analyze the microarray genotyping results to characterize the genetic diversity of these new isolates and triage the samples for whole genome sequencing. In this interim report, we described the SNP analysis and the microarray probe design for the Burkholderia SNP microarray.

  13. Association test based on SNP set: logistic kernel machine based test vs. principal component analysis.

    Directory of Open Access Journals (Sweden)

    Yang Zhao

    Full Text Available GWAS has facilitated greatly the discovery of risk SNPs associated with complex diseases. Traditional methods analyze SNP individually and are limited by low power and reproducibility since correction for multiple comparisons is necessary. Several methods have been proposed based on grouping SNPs into SNP sets using biological knowledge and/or genomic features. In this article, we compare the linear kernel machine based test (LKM and principal components analysis based approach (PCA using simulated datasets under the scenarios of 0 to 3 causal SNPs, as well as simple and complex linkage disequilibrium (LD structures of the simulated regions. Our simulation study demonstrates that both LKM and PCA can control the type I error at the significance level of 0.05. If the causal SNP is in strong LD with the genotyped SNPs, both the PCA with a small number of principal components (PCs and the LKM with kernel of linear or identical-by-state function are valid tests. However, if the LD structure is complex, such as several LD blocks in the SNP set, or when the causal SNP is not in the LD block in which most of the genotyped SNPs reside, more PCs should be included to capture the information of the causal SNP. Simulation studies also demonstrate the ability of LKM and PCA to combine information from multiple causal SNPs and to provide increased power over individual SNP analysis. We also apply LKM and PCA to analyze two SNP sets extracted from an actual GWAS dataset on non-small cell lung cancer.

  14. Direct inference of SNP heterozygosity rates and resolution of LOH detection.

    Directory of Open Access Journals (Sweden)

    Xiaohong Li

    2007-11-01

    Full Text Available Single nucleotide polymorphisms (SNPs have been increasingly utilized to investigate somatic genetic abnormalities in premalignancy and cancer. LOH is a common alteration observed during cancer development, and SNP assays have been used to identify LOH at specific chromosomal regions. The design of such studies requires consideration of the resolution for detecting LOH throughout the genome and identification of the number and location of SNPs required to detect genetic alterations in specific genomic regions. Our study evaluated SNP distribution patterns and used probability models, Monte Carlo simulation, and real human subject genotype data to investigate the relationships between the number of SNPs, SNP HET rates, and the sensitivity (resolution for detecting LOH. We report that variances of SNP heterozygosity rate in dbSNP are high for a large proportion of SNPs. Two statistical methods proposed for directly inferring SNP heterozygosity rates require much smaller sample sizes (intermediate sizes and are feasible for practical use in SNP selection or verification. Using HapMap data, we showed that a region of LOH greater than 200 kb can be reliably detected, with losses smaller than 50 kb having a substantially lower detection probability when using all SNPs currently in the HapMap database. Higher densities of SNPs may exist in certain local chromosomal regions that provide some opportunities for reliably detecting LOH of segment sizes smaller than 50 kb. These results suggest that the interpretation of the results from genome-wide scans for LOH using commercial arrays need to consider the relationships among inter-SNP distance, detection probability, and sample size for a specific study. New experimental designs for LOH studies would also benefit from considering the power of detection and sample sizes required to accomplish the proposed aims.

  15. Electrochemical Li Topotactic Reaction in Layered SnP3 for Superior Li-Ion Batteries

    Science.gov (United States)

    Park, Jae-Wan; Park, Cheol-Min

    2016-10-01

    The development of new anode materials having high electrochemical performances and interesting reaction mechanisms is highly required to satisfy the need for long-lasting mobile electronic devices and electric vehicles. Here, we report a layer crystalline structured SnP3 and its unique electrochemical behaviors with Li. The SnP3 was simply synthesized through modification of Sn crystallography by combination with P and its potential as an anode material for LIBs was investigated. During Li insertion reaction, the SnP3 anode showed an interesting two-step electrochemical reaction mechanism comprised of a topotactic transition (0.7-2.0 V) and a conversion (0.0-2.0 V) reaction. When the SnP3-based composite electrode was tested within the topotactic reaction region (0.7-2.0 V) between SnP3 and LixSnP3 (x ≤ 4), it showed excellent electrochemical properties, such as a high volumetric capacity (1st discharge/charge capacity was 840/663 mA h cm-3) with a high initial coulombic efficiency, stable cycle behavior (636 mA h cm-3 over 100 cycles), and fast rate capability (550 mA h cm-3 at 3C). This layered SnP3 anode will be applicable to a new anode material for rechargeable LIBs.

  16. Imputation of microsatellite alleles from dense SNP genotypes for parental verification

    Directory of Open Access Journals (Sweden)

    Matthew eMcclure

    2012-08-01

    Full Text Available Microsatellite (MS markers have recently been used for parental verification and are still the international standard despite higher cost, error rate, and turnaround time compared with Single Nucleotide Polymorphisms (SNP-based assays. Despite domestic and international interest from producers and research communities, no viable means currently exist to verify parentage for an individual unless all familial connections were analyzed using the same DNA marker type (MS or SNP. A simple and cost-effective method was devised to impute MS alleles from SNP haplotypes within breeds. For some MS, imputation results may allow inference across breeds. A total of 347 dairy cattle representing 4 dairy breeds (Brown Swiss, Guernsey, Holstein, and Jersey were used to generate reference haplotypes. This approach has been verified (>98% accurate for imputing the International Society of Animal Genetics (ISAG recommended panel of 12 MS for cattle parentage verification across a validation set of 1,307 dairy animals.. Implementation of this method will allow producers and breed associations to transition to SNP-based parentage verification utilizing MS genotypes from historical data on parents where SNP genotypes are missing. This approach may be applicable to additional cattle breeds and other species that wish to migrate from MS- to SNP- based parental verification.

  17. Involvement of Sodium Nitroprusside (SNP in the Mechanism That Delays Stem Bending of Different Gerbera Cultivars

    Directory of Open Access Journals (Sweden)

    Aung H. Naing

    2017-11-01

    Full Text Available Longevity of cut flowers of many gerbera cultivars (Gerbera jamesonii is typically short because of stem bending; hence, stem bending that occurs during the early vase life period is a major problem in gerbera. Here, we investigated the effects of sodium nitroprusside (SNP on the delay of stem bending in the gerbera cultivars, Alliance, Rosalin, and Bintang, by examining relative fresh weight, bacterial density in the vase solution, transcriptional analysis of a lignin biosynthesis gene, antioxidant activity, and xylem blockage. All three gerbera cultivars responded to SNP by delaying stem bending, compared to the controls; however, the responses were dose- and cultivar-dependent. Among the treatments, SNP at 20 mg L-1 was the best to delay stem bending in Alliance, while dosages of 10 and 5 mg L-1 were the best for Rosalin and Bintang, respectively. However, stem bending in Alliance and Rosalin was faster than in Bintang, indicating a discrepancy influenced by genotype. According to our analysis of the role of SNP in the delay of stem bending, the results revealed that SNP treatment inhibited bacterial growth and xylem blockage, enhanced expression levels of a lignin biosynthesis gene, and maintained antioxidant activities. Therefore, it is suggested that the cause of stem bending is associated with the above-mentioned parameters and SNP is involved in the mechanism that delays stem bending in the different gerbera cultivars.

  18. SNP discovery in nonmodel organisms: strand bias and base-substitution errors reduce conversion rates.

    Science.gov (United States)

    Gonçalves da Silva, Anders; Barendse, William; Kijas, James W; Barris, Wes C; McWilliam, Sean; Bunch, Rowan J; McCullough, Russell; Harrison, Blair; Hoelzel, A Rus; England, Phillip R

    2015-07-01

    Single nucleotide polymorphisms (SNPs) have become the marker of choice for genetic studies in organisms of conservation, commercial or biological interest. Most SNP discovery projects in nonmodel organisms apply a strategy for identifying putative SNPs based on filtering rules that account for random sequencing errors. Here, we analyse data used to develop 4723 novel SNPs for the commercially important deep-sea fish, orange roughy (Hoplostethus atlanticus), to assess the impact of not accounting for systematic sequencing errors when filtering identified polymorphisms when discovering SNPs. We used SAMtools to identify polymorphisms in a velvet assembly of genomic DNA sequence data from seven individuals. The resulting set of polymorphisms were filtered to minimize 'bycatch'-polymorphisms caused by sequencing or assembly error. An Illumina Infinium SNP chip was used to genotype a final set of 7714 polymorphisms across 1734 individuals. Five predictors were examined for their effect on the probability of obtaining an assayable SNP: depth of coverage, number of reads that support a variant, polymorphism type (e.g. A/C), strand-bias and Illumina SNP probe design score. Our results indicate that filtering out systematic sequencing errors could substantially improve the efficiency of SNP discovery. We show that BLASTX can be used as an efficient tool to identify single-copy genomic regions in the absence of a reference genome. The results have implications for research aiming to identify assayable SNPs and build SNP genotyping assays for nonmodel organisms. © 2014 John Wiley & Sons Ltd.

  19. Interest in genomic SNP testing for prostate cancer risk: a pilot survey.

    Science.gov (United States)

    Hall, Michael J; Ruth, Karen J; Chen, David Yt; Gross, Laura M; Giri, Veda N

    2015-01-01

    Advancements in genomic testing have led to the identification of single nucleotide polymorphisms (SNPs) associated with prostate cancer. The clinical utility of SNP tests to evaluate prostate cancer risk is unclear. Studies have not examined predictors of interest in novel genomic SNP tests for prostate cancer risk in a diverse population. Consecutive participants in the Fox Chase Prostate Cancer Risk Assessment Program (PRAP) (n = 40) and unselected men from surgical urology clinics (n = 40) completed a one-time survey. Items examined interest in genomic SNP testing for prostate cancer risk, knowledge, impact of unsolicited findings, and psychosocial factors including health literacy. Knowledge of genomic SNP tests was low in both groups, but interest was higher among PRAP men (p testing in both groups. Multivariable modeling identified several predictors of higher interest in a genomic SNP test including higher perceived risk (p = 0.025), indicating zero reasons for not wanting testing (vs ≥1 reason) (p = 0.013), and higher health literacy (p = 0.016). Knowledge of genomic SNP testing was low in this sample, but higher among high-risk men. High-risk status may increase interest in novel genomic tests, while low literacy may lessen interest.

  20. Identification of Laying-Related SNP Markers in Geese Using RAD Sequencing.

    Directory of Open Access Journals (Sweden)

    ShiGang Yu

    Full Text Available Laying performance is an important economical trait of goose production. As laying performance is of low heritability, it is of significance to develop a marker-assisted selection (MAS strategy for this trait. Definition of sequence variation related to the target trait is a prerequisite of quantitating MAS, but little is presently known about the goose genome, which greatly hinders the identification of genetic markers for the laying traits of geese. Recently developed restriction site-associated DNA (RAD sequencing is a possible approach for discerning large-scale single nucleotide polymorphism (SNP and reducing the complexity of a genome without having reference genomic information available. In the present study, we developed a pooled RAD sequencing strategy for detecting geese laying-related SNP. Two DNA pools were constructed, each consisting of equal amounts of genomic DNA from 10 individuals with either high estimated breeding value (HEBV or low estimated breeding value (LEBV. A total of 139,013 SNP were obtained from 42,291,356 sequences, of which 18,771,943 were for LEBV and 23,519,413 were for HEBV cohorts. Fifty-five SNP which had different allelic frequencies in the two DNA pools were further validated by individual-based AS-PCR genotyping in the LEBV and HEBV cohorts. Ten out of 55 SNP exhibited distinct allele distributions in these two cohorts. These 10 SNP were further genotyped in a goose population of 492 geese to verify the association with egg numbers. The result showed that 8 of 10 SNP were associated with egg numbers. Additionally, liner regression analysis revealed that SNP Record-111407, 106975 and 112359 were involved in a multiplegene network affecting laying performance. We used IPCR to extend the unknown regions flanking the candidate RAD tags. The obtained sequences were subjected to BLAST to retrieve the orthologous genes in either ducks or chickens. Five novel genes were cloned for geese which harbored the

  1. Optimal Design of Low-Density SNP Arrays for Genomic Prediction: Algorithm and Applications.

    Directory of Open Access Journals (Sweden)

    Xiao-Lin Wu

    Full Text Available Low-density (LD single nucleotide polymorphism (SNP arrays provide a cost-effective solution for genomic prediction and selection, but algorithms and computational tools are needed for the optimal design of LD SNP chips. A multiple-objective, local optimization (MOLO algorithm was developed for design of optimal LD SNP chips that can be imputed accurately to medium-density (MD or high-density (HD SNP genotypes for genomic prediction. The objective function facilitates maximization of non-gap map length and system information for the SNP chip, and the latter is computed either as locus-averaged (LASE or haplotype-averaged Shannon entropy (HASE and adjusted for uniformity of the SNP distribution. HASE performed better than LASE with ≤1,000 SNPs, but required considerably more computing time. Nevertheless, the differences diminished when >5,000 SNPs were selected. Optimization was accomplished conditionally on the presence of SNPs that were obligated to each chromosome. The frame location of SNPs on a chip can be either uniform (evenly spaced or non-uniform. For the latter design, a tunable empirical Beta distribution was used to guide location distribution of frame SNPs such that both ends of each chromosome were enriched with SNPs. The SNP distribution on each chromosome was finalized through the objective function that was locally and empirically maximized. This MOLO algorithm was capable of selecting a set of approximately evenly-spaced and highly-informative SNPs, which in turn led to increased imputation accuracy compared with selection solely of evenly-spaced SNPs. Imputation accuracy increased with LD chip size, and imputation error rate was extremely low for chips with ≥3,000 SNPs. Assuming that genotyping or imputation error occurs at random, imputation error rate can be viewed as the upper limit for genomic prediction error. Our results show that about 25% of imputation error rate was propagated to genomic prediction in an Angus

  2. On the impact of relatedness on SNP association analysis.

    Science.gov (United States)

    Gross, Arnd; Tönjes, Anke; Scholz, Markus

    2017-12-06

    When testing for SNP (single nucleotide polymorphism) associations in related individuals, observations are not independent. Simple linear regression assuming independent normally distributed residuals results in an increased type I error and the power of the test is also affected in a more complicate manner. Inflation of type I error is often successfully corrected by genomic control. However, this reduces the power of the test when relatedness is of concern. In the present paper, we derive explicit formulae to investigate how heritability and strength of relatedness contribute to variance inflation of the effect estimate of the linear model. Further, we study the consequences of variance inflation on hypothesis testing and compare the results with those of genomic control correction. We apply the developed theory to the publicly available HapMap trio data (N=129), the Sorbs (a self-contained population with N=977 characterised by a cryptic relatedness structure) and synthetic family studies with different sample sizes (ranging from N=129 to N=999) and different degrees of relatedness. We derive explicit and easily to apply approximation formulae to estimate the impact of relatedness on the variance of the effect estimate of the linear regression model. Variance inflation increases with increasing heritability. Relatedness structure also impacts the degree of variance inflation as shown for example family structures. Variance inflation is smallest for HapMap trios, followed by a synthetic family study corresponding to the trio data but with larger sample size than HapMap. Next strongest inflation is observed for the Sorbs, and finally, for a synthetic family study with a more extreme relatedness structure but with similar sample size as the Sorbs. Type I error increases rapidly with increasing inflation. However, for smaller significance levels, power increases with increasing inflation while the opposite holds for larger significance levels. When genomic control

  3. Dog Y chromosomal DNA sequence: identification, sequencing and SNP discovery

    Directory of Open Access Journals (Sweden)

    Kirkness Ewen

    2006-10-01

    Full Text Available Abstract Background Population genetic studies of dogs have so far mainly been based on analysis of mitochondrial DNA, describing only the history of female dogs. To get a picture of the male history, as well as a second independent marker, there is a need for studies of biallelic Y-chromosome polymorphisms. However, there are no biallelic polymorphisms reported, and only 3200 bp of non-repetitive dog Y-chromosome sequence deposited in GenBank, necessitating the identification of dog Y chromosome sequence and the search for polymorphisms therein. The genome has been only partially sequenced for one male dog, disallowing mapping of the sequence into specific chromosomes. However, by comparing the male genome sequence to the complete female dog genome sequence, candidate Y-chromosome sequence may be identified by exclusion. Results The male dog genome sequence was analysed by Blast search against the human genome to identify sequences with a best match to the human Y chromosome and to the female dog genome to identify those absent in the female genome. Candidate sequences were then tested for male specificity by PCR of five male and five female dogs. 32 sequences from the male genome, with a total length of 24 kbp, were identified as male specific, based on a match to the human Y chromosome, absence in the female dog genome and male specific PCR results. 14437 bp were then sequenced for 10 male dogs originating from Europe, Southwest Asia, Siberia, East Asia, Africa and America. Nine haplotypes were found, which were defined by 14 substitutions. The genetic distance between the haplotypes indicates that they originate from at least five wolf haplotypes. There was no obvious trend in the geographic distribution of the haplotypes. Conclusion We have identified 24159 bp of dog Y-chromosome sequence to be used for population genetic studies. We sequenced 14437 bp in a worldwide collection of dogs, identifying 14 SNPs for future SNP analyses, and

  4. fcGENE: a versatile tool for processing and transforming SNP datasets.

    Directory of Open Access Journals (Sweden)

    Nab Raj Roshyara

    Full Text Available Modern analysis of high-dimensional SNP data requires a number of biometrical and statistical methods such as pre-processing, analysis of population structure, association analysis and genotype imputation. Software used for these purposes often rely on specific and incompatible input and output data formats. Therefore extensive data management including multiple format conversions is necessary during analyses.In order to support fast and efficient management and bio-statistical quality control of high-dimensional SNP data, we developed the publically available software fcGENE using C++ object-oriented programming language. This software simplifies and automates the use of different existing analysis packages, especially during the workflow of genotype imputations and corresponding analyses.fcGENE transforms SNP data and imputation results into different formats required for a large variety of analysis packages such as PLINK, SNPTEST, HAPLOVIEW, EIGENSOFT, GenABEL and tools used for genotype imputation such as MaCH, IMPUTE, BEAGLE and others. Data Management tasks like merging, splitting, extracting SNP and pedigree information can be performed. fcGENE also supports a number of bio-statistical quality control processes and quality based filtering processes at SNP- and sample-wise level. The tool also generates templates of commands required to run specific software packages, especially those required for genotype imputation. We demonstrate the functionality of fcGENE by example workflows of SNP data analyses and provide a comprehensive manual of commands, options and applications.We have developed a user-friendly open-source software fcGENE, which comprehensively supports SNP data management, quality control and analysis workflows. Download statistics and corresponding feedbacks indicate that software is highly recognised and extensively applied by the scientific community.

  5. High-throughput SNP genotyping in Cucurbita pepo for map construction and quantitative trait loci mapping.

    Science.gov (United States)

    Esteras, Cristina; Gómez, Pedro; Monforte, Antonio J; Blanca, José; Vicente-Dólera, Nelly; Roig, Cristina; Nuez, Fernando; Picó, Belén

    2012-02-22

    Cucurbita pepo is a member of the Cucurbitaceae family, the second- most important horticultural family in terms of economic importance after Solanaceae. The "summer squash" types, including Zucchini and Scallop, rank among the highest-valued vegetables worldwide. There are few genomic tools available for this species.The first Cucurbita transcriptome, along with a large collection of Single Nucleotide Polymorphisms (SNP), was recently generated using massive sequencing. A set of 384 SNP was selected to generate an Illumina GoldenGate assay in order to construct the first SNP-based genetic map of Cucurbita and map quantitative trait loci (QTL). We herein present the construction of the first SNP-based genetic map of Cucurbita pepo using a population derived from the cross of two varieties with contrasting phenotypes, representing the main cultivar groups of the species' two subspecies: Zucchini (subsp. pepo) × Scallop (subsp. ovifera). The mapping population was genotyped with 384 SNP, a set of selected EST-SNP identified in silico after massive sequencing of the transcriptomes of both parents, using the Illumina GoldenGate platform. The global success rate of the assay was higher than 85%. In total, 304 SNP were mapped, along with 11 SSR from a previous map, giving a map density of 5.56 cM/marker. This map was used to infer syntenic relationships between C. pepo and cucumber and to successfully map QTL that control plant, flowering and fruit traits that are of benefit to squash breeding. The QTL effects were validated in backcross populations. Our results show that massive sequencing in different genotypes is an excellent tool for SNP discovery, and that the Illumina GoldenGate platform can be successfully applied to constructing genetic maps and performing QTL analysis in Cucurbita. This is the first SNP-based genetic map in the Cucurbita genus and is an invaluable new tool for biological research, especially considering that most of these markers are located in

  6. Mining and Analysis of SNP in Response to Salinity Stress in Upland Cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Wang, Xiaoge; Lu, Xuke; Wang, Junjuan; Wang, Delong; Yin, Zujun; Fan, Weili; Wang, Shuai; Ye, Wuwei

    2016-01-01

    Salinity stress is a major abiotic factor that affects crop output, and as a pioneer crop in saline and alkaline land, salt tolerance study of cotton is particularly important. In our experiment, four salt-tolerance varieties with different salt tolerance indexes including CRI35 (65.04%), Kanghuanwei164 (56.19%), Zhong9807 (55.20%) and CRI44 (50.50%), as well as four salt-sensitive cotton varieties including Hengmian3 (48.21%), GK50 (40.20%), Xinyan96-48 (34.90%), ZhongS9612 (24.80%) were used as the materials. These materials were divided into salt-tolerant group (ST) and salt-sensitive group (SS). Illumina Cotton SNP 70K Chip was used to detect SNP in different cotton varieties. SNPv (SNP variation of the same seedling pre- and after- salt stress) in different varieties were screened; polymorphic SNP and SNPr (SNP related to salt tolerance) were obtained. Annotation and analysis of these SNPs showed that (1) the induction efficiency of salinity stress on SNPv of cotton materials with different salt tolerance index was different, in which the induction efficiency on salt-sensitive materials was significantly higher than that on salt-tolerant materials. The induction of salt stress on SNPv was obviously biased. (2) SNPv induced by salt stress may be related to the methylation changes under salt stress. (3) SNPr may influence salt tolerance of plants by affecting the expression of salt-tolerance related genes.

  7. Tri-allelic SNP markers enable analysis of mixed and degraded DNA samples.

    Science.gov (United States)

    Westen, Antoinette A; Matai, Anuska S; Laros, Jeroen F J; Meiland, Hugo C; Jasper, Mandy; de Leeuw, Wiljo J F; de Knijff, Peter; Sijen, Titia

    2009-09-01

    For the analysis of degraded DNA in disaster victim identification (DVI) and criminal investigations, single nucleotide polymorphisms (SNPs) have been recognized as promising markers mainly because they can be analyzed in short sized amplicons. Most SNPs are bi-allelic and are thereby ineffective to detect mixtures, which may lead to incorrect genotyping. We developed an algorithm to find non-binary (i.e. tri-allelic or tetra-allelic) SNPs in the NCBI dbSNP database. We selected 31 potential tri-allelic SNPs with a minor allele frequency of at least 10%. The tri-allelic nature was confirmed for 15 SNPs residing on 14 different chromosomes. Multiplex SNaPshot assays were developed, and the allele frequencies of 16 SNPs were determined among 153 Dutch and 111 Netherlands Antilles reference samples. Using these multiplex SNP assays, the presence of a mixture of two DNA samples in a ratio up to 1:8 could be recognized reliably. Furthermore, we compared the genotyping efficiency of the tri-allelic SNP markers and short tandem repeat (STR) markers by analyzing artificially degraded DNA and DNA from 30 approximately 500-year-old bone and molar samples. In both types of degraded DNA samples, the larger sized STR amplicons failed to amplify whereas the tri-allelic SNP markers still provided valuable information. In conclusion, tri-allelic SNP markers are suited for the analysis of degraded DNA and enable the detection of a second DNA source in a sample.

  8. The Generalized Higher Criticism for Testing SNP-Set Effects in Genetic Association Studies

    Science.gov (United States)

    Barnett, Ian; Mukherjee, Rajarshi; Lin, Xihong

    2017-01-01

    It is of substantial interest to study the effects of genes, genetic pathways, and networks on the risk of complex diseases. These genetic constructs each contain multiple SNPs, which are often correlated and function jointly, and might be large in number. However, only a sparse subset of SNPs in a genetic construct is generally associated with the disease of interest. In this article, we propose the generalized higher criticism (GHC) to test for the association between an SNP set and a disease outcome. The higher criticism is a test traditionally used in high-dimensional signal detection settings when marginal test statistics are independent and the number of parameters is very large. However, these assumptions do not always hold in genetic association studies, due to linkage disequilibrium among SNPs and the finite number of SNPs in an SNP set in each genetic construct. The proposed GHC overcomes the limitations of the higher criticism by allowing for arbitrary correlation structures among the SNPs in an SNP-set, while performing accurate analytic p-value calculations for any finite number of SNPs in the SNP-set. We obtain the detection boundary of the GHC test. We compared empirically using simulations the power of the GHC method with existing SNP-set tests over a range of genetic regions with varied correlation structures and signal sparsity. We apply the proposed methods to analyze the CGEM breast cancer genome-wide association study. Supplementary materials for this article are available online. PMID:28736464

  9. [Relationship between genetic polymorphisms of 3 SNP loci in 5-HTT gene and paranoid schizophrenia].

    Science.gov (United States)

    Xuan, Jin-Feng; Ding, Mei; Pang, Hao; Xing, Jia-Xin; Sun, Yi-Hua; Yao, Jun; Zhao, Yi; Li, Chun-Mei; Wang, Bao-Jie

    2012-12-01

    To investigate the population genetic data of 3 SNP loci (rs25533, rs34388196 and rs1042173) of 5-hydroxytryptamine transporter (5-HTT) gene and the association with paranoid schizophrenia. Three SNP loci of 5-HTT gene were examined in 132 paranoid schizophrenia patients and 150 unrelated healthy individuals of Northern Chinese Han population by PCR-RFLP technique. The Hardy-Weinberg equilibrium test was performed using the chi-square test and the data of haplotype frequency and population genetics parameters were statistically analyzed. Among these three SNP loci, four haplotypes were obtained. There were no statistically significant differences between the patient group and the control group (P > 0.05). The DP values of the 3 SNP loci were 0.276, 0.502 and 0.502. The PIC of them were 0.151, 0.281 and 0.281. The PE of them were 0.014, 0.072 and 0.072. The three SNP loci and four haplotypes of 5-HTT gene have no association with paranoid schizophrenia, while the polymorphism still have high potential application in forensic practice.

  10. Underestimated effect sizes in GWAS: fundamental limitations of single SNP analysis for dichotomous phenotypes.

    Directory of Open Access Journals (Sweden)

    Sven Stringer

    Full Text Available Complex diseases are often highly heritable. However, for many complex traits only a small proportion of the heritability can be explained by observed genetic variants in traditional genome-wide association (GWA studies. Moreover, for some of those traits few significant SNPs have been identified. Single SNP association methods test for association at a single SNP, ignoring the effect of other SNPs. We show using a simple multi-locus odds model of complex disease that moderate to large effect sizes of causal variants may be estimated as relatively small effect sizes in single SNP association testing. This underestimation effect is most severe for diseases influenced by numerous risk variants. We relate the underestimation effect to the concept of non-collapsibility found in the statistics literature. As described, continuous phenotypes generated with linear genetic models are not affected by this underestimation effect. Since many GWA studies apply single SNP analysis to dichotomous phenotypes, previously reported results potentially underestimate true effect sizes, thereby impeding identification of true effect SNPs. Therefore, when a multi-locus model of disease risk is assumed, a multi SNP analysis may be more appropriate.

  11. Leveraging ethnic group incidence variation to investigate genetic susceptibility to glioma: A novel candidate SNP approach

    Directory of Open Access Journals (Sweden)

    Daniel Ian Jacobs

    2012-10-01

    Full Text Available Objectives: Using a novel candidate SNP approach, we aimed to identify a possible genetic basis for the higher glioma incidence in Whites relative to East Asians and African-Americans. Methods: We hypothesized that genetic regions containing SNPs with extreme differences in allele frequencies across ethnicities are most likely to harbor susceptibility variants. We used International HapMap Project data to identify 3,961 candidate SNPs with the largest allele frequency differences in Whites compared to East Asians and Africans and tested these SNPs for association with glioma risk in a set of White cases and controls. Top SNPs identified in the discovery dataset were tested for association with glioma in five independent replication datasets. Results: No SNP achieved statistical significance in either the discovery or replication datasets after accounting for multiple testing. However, the most strongly associated SNP, rs879471, was found to be in linkage disequilibrium with a previously identified risk SNP, rs6010620, in RTEL1. We estimate rs6010620 to account for a glioma incidence rate ratio of 1.34 for Whites relative to East Asians. Conclusions: We explored genetic susceptibility to glioma using a novel candidate SNP method which may be applicable to other diseases with appropriate epidemiologic patterns.

  12. A SNP-Based Molecular Barcode for Characterization of Common Wheat.

    Directory of Open Access Journals (Sweden)

    LiFeng Gao

    Full Text Available Wheat is grown as a staple crop worldwide. It is important to develop an effective genotyping tool for this cereal grain both to identify germplasm diversity and to protect the rights of breeders. Single-nucleotide polymorphism (SNP genotyping provides a means for developing a practical, rapid, inexpensive and high-throughput assay. Here, we investigated SNPs as robust markers of genetic variation for typing wheat cultivars. We identified SNPs from an array of 9000 across a collection of 429 well-known wheat cultivars grown in China, of which 43 SNP markers with high minor allele frequency and variations discriminated the selected wheat varieties and their wild ancestors. This SNP-based barcode will allow for the rapid and precise identification of wheat germplasm resources and newly released varieties and will further assist in the wheat breeding program.

  13. Quantification of within-sample genetic heterogeneity from SNP-array data

    DEFF Research Database (Denmark)

    Martinez, Pierre; Kimberley, Christopher; Birkbak, Nicolai Juul

    2017-01-01

    Intra-tumour genetic heterogeneity (ITH) fosters drug resistance and is a critical hurdle to clinical treatment. ITH can be well-measured using multi-region sampling but this is costly and challenging to implement. There is therefore a need for tools to estimate ITH in individual samples, using...... standard genomic data such as SNP-arrays, that could be implemented routinely. We designed two novel scores S and R, respectively based on the Shannon diversity index and Ripley's L statistic of spatial homogeneity, to quantify ITH in single SNP-array samples. We created in-silico and in-vitro mixtures...... sequencing data but heterogeneity in the fraction of tumour cells present across samples hampered accurate quantification. The prognostic potential of both scores was moderate but significantly predictive of survival in several tumour types (corrected p = 0.03). Our work thus shows how individual SNP...

  14. SNP calling using genotype model selection on high-throughput sequencing data

    KAUST Repository

    You, Na

    2012-01-16

    Motivation: A review of the available single nucleotide polymorphism (SNP) calling procedures for Illumina high-throughput sequencing (HTS) platform data reveals that most rely mainly on base-calling and mapping qualities as sources of error when calling SNPs. Thus, errors not involved in base-calling or alignment, such as those in genomic sample preparation, are not accounted for.Results: A novel method of consensus and SNP calling, Genotype Model Selection (GeMS), is given which accounts for the errors that occur during the preparation of the genomic sample. Simulations and real data analyses indicate that GeMS has the best performance balance of sensitivity and positive predictive value among the tested SNP callers. © The Author 2012. Published by Oxford University Press. All rights reserved.

  15. An integrated SNP mining and utilization (ISMU) pipeline for next generation sequencing data.

    Science.gov (United States)

    Azam, Sarwar; Rathore, Abhishek; Shah, Trushar M; Telluri, Mohan; Amindala, BhanuPrakash; Ruperao, Pradeep; Katta, Mohan A V S K; Varshney, Rajeev K

    2014-01-01

    Open source single nucleotide polymorphism (SNP) discovery pipelines for next generation sequencing data commonly requires working knowledge of command line interface, massive computational resources and expertise which is a daunting task for biologists. Further, the SNP information generated may not be readily used for downstream processes such as genotyping. Hence, a comprehensive pipeline has been developed by integrating several open source next generation sequencing (NGS) tools along with a graphical user interface called Integrated SNP Mining and Utilization (ISMU) for SNP discovery and their utilization by developing genotyping assays. The pipeline features functionalities such as pre-processing of raw data, integration of open source alignment tools (Bowtie2, BWA, Maq, NovoAlign and SOAP2), SNP prediction (SAMtools/SOAPsnp/CNS2snp and CbCC) methods and interfaces for developing genotyping assays. The pipeline outputs a list of high quality SNPs between all pairwise combinations of genotypes analyzed, in addition to the reference genome/sequence. Visualization tools (Tablet and Flapjack) integrated into the pipeline enable inspection of the alignment and errors, if any. The pipeline also provides a confidence score or polymorphism information content value with flanking sequences for identified SNPs in standard format required for developing marker genotyping (KASP and Golden Gate) assays. The pipeline enables users to process a range of NGS datasets such as whole genome re-sequencing, restriction site associated DNA sequencing and transcriptome sequencing data at a fast speed. The pipeline is very useful for plant genetics and breeding community with no computational expertise in order to discover SNPs and utilize in genomics, genetics and breeding studies. The pipeline has been parallelized to process huge datasets of next generation sequencing. It has been developed in Java language and is available at http://hpc.icrisat.cgiar.org/ISMU as a standalone

  16. Vitis phylogenomics: hybridization intensities from a SNP array outperform genotype calls.

    Directory of Open Access Journals (Sweden)

    Allison J Miller

    Full Text Available Understanding relationships among species is a fundamental goal of evolutionary biology. Single nucleotide polymorphisms (SNPs identified through next generation sequencing and related technologies enable phylogeny reconstruction by providing unprecedented numbers of characters for analysis. One approach to SNP-based phylogeny reconstruction is to identify SNPs in a subset of individuals, and then to compile SNPs on an array that can be used to genotype additional samples at hundreds or thousands of sites simultaneously. Although powerful and efficient, this method is subject to ascertainment bias because applying variation discovered in a representative subset to a larger sample favors identification of SNPs with high minor allele frequencies and introduces bias against rare alleles. Here, we demonstrate that the use of hybridization intensity data, rather than genotype calls, reduces the effects of ascertainment bias. Whereas traditional SNP calls assess known variants based on diversity housed in the discovery panel, hybridization intensity data survey variation in the broader sample pool, regardless of whether those variants are present in the initial SNP discovery process. We apply SNP genotype and hybridization intensity data derived from the Vitis9kSNP array developed for grape to show the effects of ascertainment bias and to reconstruct evolutionary relationships among Vitis species. We demonstrate that phylogenies constructed using hybridization intensities suffer less from the distorting effects of ascertainment bias, and are thus more accurate than phylogenies based on genotype calls. Moreover, we reconstruct the phylogeny of the genus Vitis using hybridization data, show that North American subgenus Vitis species are monophyletic, and resolve several previously poorly known relationships among North American species. This study builds on earlier work that applied the Vitis9kSNP array to evolutionary questions within Vitis vinifera

  17. Mycobacterium leprae in Colombia described by SNP7614 in gyrA, two minisatellites and geography

    Science.gov (United States)

    Cardona-Castro, Nora; Beltrán-Alzate, Juan Camilo; Romero-Montoya, Irma Marcela; Li, Wei; Brennan, Patrick J; Vissa, Varalakshmi

    2013-01-01

    New cases of leprosy are still being detected in Colombia after the country declared achievement of the WHO defined ‘elimination’ status. To study the ecology of leprosy in endemic regions, a combination of geographic and molecular tools were applied for a group of 201 multibacillary patients including six multi-case families from eleven departments. The location (latitude and longitude) of patient residences were mapped. Slit skin smears and/or skin biopsies were collected and DNA was extracted. Standard agarose gel electrophoresis following a multiplex PCR-was developed for rapid and inexpensive strain typing of M. leprae based on copy numbers of two VNTR minisatellite loci 27-5 and 12-5. A SNP (C/T) in gyrA (SNP7614) was mapped by introducing a novel PCR-RFLP into an ongoing drug resistance surveillance effort. Multiple genotypes were detected combining the three molecular markers. The two frequent genotypes in Colombia were SNP7614(C)/27-5(5)/12-5(4) [C54] predominantly distributed in the Atlantic departments and SNP7614 (T)/27-5(4)/12-5(5) [T45] associated with the Andean departments. A novel genotype SNP7614 (C)/27-5(6)/12-5(4) [C64] was detected in cities along the Magdalena river which separates the Andean from Atlantic departments; a subset was further characterized showing association with a rare allele of minisatellite 23-3 and the SNP type 1 of M. leprae. The genotypes within intra-family cases were conserved. Overall, this is the first large scale study that utilized simple and rapid assay formats for identification of major strain types and their distribution in Colombia. It provides the framework for further strain type discrimination and geographic information systems as tools for tracing transmission of leprosy. PMID:23291420

  18. Mycobacterium leprae in Colombia described by SNP7614 in gyrA, two minisatellites and geography.

    Science.gov (United States)

    Cardona-Castro, Nora; Beltrán-Alzate, Juan Camilo; Romero-Montoya, Irma Marcela; Li, Wei; Brennan, Patrick J; Vissa, Varalakshmi

    2013-03-01

    New cases of leprosy are still being detected in Colombia after the country declared achievement of the WHO defined 'elimination' status. To study the ecology of leprosy in endemic regions, a combination of geographic and molecular tools were applied for a group of 201 multibacillary patients including six multi-case families from eleven departments. The location (latitude and longitude) of patient residences were mapped. Slit skin smears and/or skin biopsies were collected and DNA was extracted. Standard agarose gel electrophoresis following a multiplex PCR-was developed for rapid and inexpensive strain typing of Mycobacterium leprae based on copy numbers of two VNTR minisatellite loci 27-5 and 12-5. A SNP (C/T) in gyrA (SNP7614) was mapped by introducing a novel PCR-RFLP into an ongoing drug resistance surveillance effort. Multiple genotypes were detected combining the three molecular markers. The two frequent genotypes in Colombia were SNP7614(C)/27-5(5)/12-5(4) [C54] predominantly distributed in the Atlantic departments and SNP7614 (T)/27-5(4)/12-5(5) [T45] associated with the Andean departments. A novel genotype SNP7614 (C)/27-5(6)/12-5(4) [C64] was detected in cities along the Magdalena river which separates the Andean from Atlantic departments; a subset was further characterized showing association with a rare allele of minisatellite 23-3 and the SNP type 1 of M. leprae. The genotypes within intra-family cases were conserved. Overall, this is the first large scale study that utilized simple and rapid assay formats for identification of major strain types and their distribution in Colombia. It provides the framework for further strain type discrimination and geographic information systems as tools for tracing transmission of leprosy. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Functional characterization of the Thr946Ala SNP at the type 1 diabetes IFIH1 locus.

    Science.gov (United States)

    Zouk, Hana; Marchand, Luc; Li, Quan; Polychronakos, Constantin

    2014-02-01

    The Thr allele at the Thr946Ala non-synonymous single-nucleotide polymorphism (nsSNP) in the IFIH1 gene confers risk for type 1 diabetes (T1D). IFIH1 binds viral double-stranded RNA (dsRNA), inducing a type I interferon (IFN) response. Reports of this nsSNP's role in IFIH1 expression regulation have produced conflicting results and a study evaluating transfected Thr946Ala protein alleles in an artificial system overexpressing IFIH1 shows that the SNP does not affect IFH1 function. In this study, we examine the effects of the Thr946Ala polymorphism on IFN-α response in a cell line that endogenously expresses physiological levels of IFIH1. Eleven lymphoblastoid cell lines (LCLs) homozygous for the major predisposing allele (Thr/Thr) and 6 LCLs homozygous for the minor protective allele (Ala/Ala) were electroporated with the viral dsRNA mimic, poly I:C, in three independent experiments. Media were collected 24 hours later and measured for IFN-α production by ELISA. Basal IFN response is minimal in mock-transfected cells from both genotypes and increases by about 8-fold in cells treated with poly I:C. LCLs with the Ala/Ala genotype have slightly higher IFN-α levels than their Thr/Thr counterparts but this did not reach statistical significance because of the large variability of the IFN response, due mostly to two high outliers (biological, not technical). A larger sample size would be needed to determine whether the Thr946Ala SNP affects the poly I:C-driven IFN-α response. Additionally, the possibility that this nsSNP recognizes viral dsRNA specificities cannot be ruled out. Thus, the mechanism of the observed association of this SNP with T1D remains to be determined.

  20. Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

    Directory of Open Access Journals (Sweden)

    R. Vasudevan

    2014-06-01

    Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

  1. A 50 SNP-multiplex mass spectrometry assay for human identification

    DEFF Research Database (Denmark)

    Wächter, Andrea; Mengel-From, Jonas; Børsting, Claus

    2008-01-01

    We developed a 50 SNP-multiplex assay for detection on a MALDI-TOF MS platform based on the SNPs in the 52 SNP-multiplex assay recently developed by the SNPforID Consortium. After PCR amplification, the products were purified on Qiagen columns and used as templates in one single base extension (SBE...... primers were extended with biotin labelled ddNTPs and purified on avidin beads ensuring that only the extended SBE primers were isolated and spotted on the MALDI-TOF anchor target. Detection of the 50 extended primers from the SBE reaction was performed in a mass range between 3000 and 10,000 m/z...

  2. SNP-by-fitness and SNP-by-BMI interactions from seven candidate genes and incident hypertension after 20 years of follow-up: the CARDIA Fitness Study.

    Science.gov (United States)

    Sarzynski, M A; Rankinen, T; Sternfeld, B; Fornage, M; Sidney, S; Bouchard, C

    2011-08-01

    The association of single nucleotide polymorphisms (SNPs) from seven candidate genes, including genotype-by-baseline fitness and genotype-by-baseline body mass index (BMI) interactions, with incident hypertension over 20 years was investigated in 2663 participants (1301 blacks, 1362 whites) of the Coronary Artery Risk Development in Young Adults Study (CARDIA). Baseline cardiorespiratory fitness was determined from duration of a modified Balke treadmill test. A total of 98 SNPs in blacks and 89 SNPs in whites from seven candidate genes were genotyped. Participants that became hypertensive (295 blacks and 146 whites) had significantly higher blood pressure and BMI (both races), and lower fitness (blacks only) at baseline than those who remained normotensive. Markers at the peroxisome proliferative activated receptor gamma coactivator 1α (PPARGC1A) and bradykinin β2 receptor (BDKRB2) genes were nominally associated with greater risk of hypertension, although one marker each at the BDKRB2 and endothelial nitric oxide synthase-3 (NOS3) genes were nominally associated with lower risk. The association of baseline fitness with risk of hypertension was nominally modified by genotype at markers within the angiotensin converting enzyme, angiotensinogen, BDKRB2 and NOS3 genes in blacks and the BDKRB2, endothelin-1 and PPARGC1A genes in whites. BDKRB2 rs4900318 showed nominal interactions with baseline fitness on the risk of hypertension in both races. The association of baseline BMI with risk of hypertension was nominally modified by GNB3 rs2301339 genotype in whites. None of the above associations were statistically significant after correcting for multiple testing. We found that SNPs in these candidate genes did not modify the association between baseline fitness or BMI and risk of hypertension in CARDIA participants.

  3. SNP-Seek II: A resource for allele mining and analysis of big genomic data in Oryza sativa

    Directory of Open Access Journals (Sweden)

    Locedie Mansueto

    2016-11-01

    In this paper, we discuss the datasets stored in SNP-Seek, architecture of the database and web application, interoperability methodologies in place, and discuss a few use cases demonstrating the utility of SNP-Seek for diversity analysis and molecular breeding.

  4. Functional SNP associated with birth weight in independent populations identified with a permutation step added to GBLUP-GWAS

    Science.gov (United States)

    This study was conducted as an initial assessment of a newly available genotyping assay containing about 34,000 common SNP included on previous SNP chips, and 199,000 sequence variants predicted to affect gene function. Objectives were to identify functional variants associated with birth weight in...

  5. SNP calling using genotype model selection on high-throughput sequencing data

    KAUST Repository

    You, Na; Murillo, Gabriel; Su, Xiaoquan; Zeng, Xiaowei; Xu, Jian; Ning, Kang; Zhang, ShouDong; Zhu, Jian-Kang; Cui, Xinping

    2012-01-01

    calling SNPs. Thus, errors not involved in base-calling or alignment, such as those in genomic sample preparation, are not accounted for.Results: A novel method of consensus and SNP calling, Genotype Model Selection (GeMS), is given which accounts

  6. The impact of SNP fingerprinting and parentage analysis on the effectiveness of variety recommendations in cacao

    Science.gov (United States)

    Evidence for the impact of mislabeling and/or pollen contamination on consistency of field performance has been lacking to reinforce the need for strict adherence to quality control protocols in cacao seed garden and germplasm plot management. The present study used SNP fingerprinting at 64 loci to ...

  7. Applying SNP marker technology in the cacao breeding program at the Cocoa Research Institute of Ghana

    Science.gov (United States)

    In this investigation 45 parental cacao plants and five progeny derived from the parental stock studied were genotyped using six SNP markers to determine off-types or mislabeled clones and to authenticate crosses made in the Cocoa Research Institute of Ghana (CRIG) breeding program. Investigation wa...

  8. EvoSNP-DB: A database of genetic diversity in East Asian populations.

    Science.gov (United States)

    Kim, Young Uk; Kim, Young Jin; Lee, Jong-Young; Park, Kiejung

    2013-08-01

    Genome-wide association studies (GWAS) have become popular as an approach for the identification of large numbers of phenotype-associated variants. However, differences in genetic architecture and environmental factors mean that the effect of variants can vary across populations. Understanding population genetic diversity is valuable for the investigation of possible population specific and independent effects of variants. EvoSNP-DB aims to provide information regarding genetic diversity among East Asian populations, including Chinese, Japanese, and Korean. Non-redundant SNPs (1.6 million) were genotyped in 54 Korean trios (162 samples) and were compared with 4 million SNPs from HapMap phase II populations. EvoSNP-DB provides two user interfaces for data query and visualization, and integrates scores of genetic diversity (Fst and VarLD) at the level of SNPs, genes, and chromosome regions. EvoSNP-DB is a web-based application that allows users to navigate and visualize measurements of population genetic differences in an interactive manner, and is available online at [http://biomi.cdc.go.kr/EvoSNP/].

  9. Usefulness of the SNP microarray technology to identify rare mutations in the case of perinatal death

    DEFF Research Database (Denmark)

    Hoeffding, L. K.; Kock, K. F.; Johnsen, Iben Birgit Gade

    2015-01-01

    The single nucleotide polymorphism (SNP) microarray technology has emerged as a powerful tool to screen the whole genome for sub-microscopic duplications and deletions that are not detectable by traditional cytogenetic analysis. Case: We report a case of a female twin born at 27th week of gestation...

  10. SNP high-throughput screening in grapevine using the SNPlex™ genotyping system

    Directory of Open Access Journals (Sweden)

    Velasco Riccardo

    2008-01-01

    Full Text Available Abstract Background Until recently, only a small number of low- and mid-throughput methods have been used for single nucleotide polymorphism (SNP discovery and genotyping in grapevine (Vitis vinifera L.. However, following completion of the sequence of the highly heterozygous genome of Pinot Noir, it has been possible to identify millions of electronic SNPs (eSNPs thus providing a valuable source for high-throughput genotyping methods. Results Herein we report the first application of the SNPlex™ genotyping system in grapevine aiming at the anchoring of an eukaryotic genome. This approach combines robust SNP detection with automated assay readout and data analysis. 813 candidate eSNPs were developed from non-repetitive contigs of the assembled genome of Pinot Noir and tested in 90 progeny of Syrah × Pinot Noir cross. 563 new SNP-based markers were obtained and mapped. The efficiency rate of 69% was enhanced to 80% when multiple displacement amplification (MDA methods were used for preparation of genomic DNA for the SNPlex assay. Conclusion Unlike other SNP genotyping methods used to investigate thousands of SNPs in a few genotypes, or a few SNPs in around a thousand genotypes, the SNPlex genotyping system represents a good compromise to investigate several hundred SNPs in a hundred or more samples simultaneously. Therefore, the use of the SNPlex assay, coupled with whole genome amplification (WGA, is a good solution for future applications in well-equipped laboratories.

  11. An abbreviated SNP panel for ancestry assignment of honeybees (Apis mellifera)

    Science.gov (United States)

    This paper examines whether an abbreviated panel of 37 single nucleotide polymorphisms (SNPs) has the same power as a larger and more expensive panel of 95 SNPs to assign ancestry of honeybees (Apis mellifera) to three ancestral lineages. We selected 37 SNPs from the original 95 SNP panel using alle...

  12. New tools and methods for direct programmatic access to the dbSNP relational database.

    Science.gov (United States)

    Saccone, Scott F; Quan, Jiaxi; Mehta, Gaurang; Bolze, Raphael; Thomas, Prasanth; Deelman, Ewa; Tischfield, Jay A; Rice, John P

    2011-01-01

    Genome-wide association studies often incorporate information from public biological databases in order to provide a biological reference for interpreting the results. The dbSNP database is an extensive source of information on single nucleotide polymorphisms (SNPs) for many different organisms, including humans. We have developed free software that will download and install a local MySQL implementation of the dbSNP relational database for a specified organism. We have also designed a system for classifying dbSNP tables in terms of common tasks we wish to accomplish using the database. For each task we have designed a small set of custom tables that facilitate task-related queries and provide entity-relationship diagrams for each task composed from the relevant dbSNP tables. In order to expose these concepts and methods to a wider audience we have developed web tools for querying the database and browsing documentation on the tables and columns to clarify the relevant relational structure. All web tools and software are freely available to the public at http://cgsmd.isi.edu/dbsnpq. Resources such as these for programmatically querying biological databases are essential for viably integrating biological information into genetic association experiments on a genome-wide scale.

  13. Making a chocolate chip: development and evaluation of a 6K SNP array for Theobroma cacao.

    Science.gov (United States)

    Theobroma cacao, the key ingredient in chocolate production, is one of the world's most important tree fruit crops, with ~4,000,000 metric tons produced across 50 countries. To move towards gene discovery and marker-assisted breeding in cacao, a single-nucleotide polymorphism (SNP) identification pr...

  14. Comparison of three PCR-based assays for SNP genotyping in sugar beet

    Science.gov (United States)

    Background: PCR allelic discrimination technologies have broad applications in the detection of single nucleotide polymorphisms (SNPs) in genetics and genomics. The use of fluorescence-tagged probes is the leading method for targeted SNP detection, but assay costs and error rates could be improved t...

  15. SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate

    Science.gov (United States)

    Gretchen H. Roffler; Stephen J. Amish; Seth Smith; Ted Cosart; Marty Kardos; Michael K. Schwartz; Gordon Luikart

    2016-01-01

    Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding...

  16. Genome-wide SNP association-based localization of a dwarfism gene in Friesian dwarf horses

    NARCIS (Netherlands)

    Orr, J.L.; Back, W.; Gu, J.; Leegwater, P.H.; Govindarajan, P.; Conroy, J.; Ducro, B.J.; Arendonk, van J.A.M.

    2010-01-01

    The recent completion of the horse genome and commercial availability of an equine SNP genotyping array has facilitated the mapping of disease genes. We report putative localization of the gene responsible for dwarfism, a trait in Friesian horses that is thought to have a recessive mode of

  17. Design and Characterization of a 52K SNP Chip for Goats

    NARCIS (Netherlands)

    Tosser-klopp, G.; Bardou, P.; Bouchez, O.; Cabau, C.; Crooijmans, R.P.M.A.; Dong, Y.; Donnadieu-Tonon, C.; Eggen, A.; Heuven, H.C.M.; Jamli, S.; Jiken, A.J.; Klopp, C.; Lawley, C.T.; McEwen, J.; Martin, P.; Moreno, C.R.; Mulsant, P.; Nabihoudine, I.; Pailhoux, E.; Palhiere, I.; Rupp, R.; Sarry, J.; Sayre, B.L.; Tircazes, A.; Wang, J.; Wang, W.; Zhang, W.G.

    2014-01-01

    The success of Genome Wide Association Studies in the discovery of sequence variation linked to complex traits in humans has increased interest in high throughput SNP genotyping assays in livestock species. Primary goals are QTL detection and genomic selection. The purpose here was design of a

  18. A SNP-centric database for the investigation of the human genome

    Directory of Open Access Journals (Sweden)

    Kohane Isaac S

    2004-03-01

    Full Text Available Abstract Background Single Nucleotide Polymorphisms (SNPs are an increasingly important tool for genetic and biomedical research. Although current genomic databases contain information on several million SNPs and are growing at a very fast rate, the true value of a SNP in this context is a function of the quality of the annotations that characterize it. Retrieving and analyzing such data for a large number of SNPs often represents a major bottleneck in the design of large-scale association studies. Description SNPper is a web-based application designed to facilitate the retrieval and use of human SNPs for high-throughput research purposes. It provides a rich local database generated by combining SNP data with the Human Genome sequence and with several other data sources, and offers the user a variety of querying, visualization and data export tools. In this paper we describe the structure and organization of the SNPper database, we review the available data export and visualization options, and we describe how the architecture of SNPper and its specialized data structures support high-volume SNP analysis. Conclusions The rich annotation database and the powerful data manipulation and presentation facilities it offers make SNPper a very useful online resource for SNP research. Its success proves the great need for integrated and interoperable resources in the field of computational biology, and shows how such systems may play a critical role in supporting the large-scale computational analysis of our genome.

  19. Interactions Between SNP Alleles at Multiple Loci and Variation in Skin Pigmentation in 122 Caucasians

    Directory of Open Access Journals (Sweden)

    Sumiko Anno

    2007-01-01

    Full Text Available This study was undertaken to clarify the molecular basis for human skin color variation and the environmental adaptability to ultraviolet irradiation, with the ultimate goal of predicting the impact of changes in future environments on human health risk. One hundred twenty-two Caucasians living in Toledo, Ohio participated. Back and cheek skin were assayed for melanin as a quantitative trait marker. Buccal cell samples were collected and used for DNA extraction. DNA was used for SNP genotyping using the Masscode™ system, which entails two-step PCR amplification and a platform chemistry which allows cleavable mass spectrometry tags. The results show gene-gene interaction between SNP alleles at multiple loci (not necessarily on the same chromosome contributes to inter-individual skin color variation while suggesting a high probability of linkage disequilibrium. Confirmation of these findings requires further study with other ethic groups to analyze the associations between SNP alleles at multiple loci and human skin color variation. Our overarching goal is to use remote sensing data to clarify the interaction between atmospheric environments and SNP allelic frequency and investigate human adaptability to ultraviolet irradiation. Such information should greatly assist in the prediction of the health effects of future environmental changes such as ozone depletion and increased ultraviolet exposure. If such health effects are to some extent predictable, it might be possible to prepare for such changes in advance and thus reduce the extent of their impact.

  20. SNPhylo: a pipeline to construct a phylogenetic tree from huge SNP data.

    Science.gov (United States)

    Lee, Tae-Ho; Guo, Hui; Wang, Xiyin; Kim, Changsoo; Paterson, Andrew H

    2014-02-26

    Phylogenetic trees are widely used for genetic and evolutionary studies in various organisms. Advanced sequencing technology has dramatically enriched data available for constructing phylogenetic trees based on single nucleotide polymorphisms (SNPs). However, massive SNP data makes it difficult to perform reliable analysis, and there has been no ready-to-use pipeline to generate phylogenetic trees from these data. We developed a new pipeline, SNPhylo, to construct phylogenetic trees based on large SNP datasets. The pipeline may enable users to construct a phylogenetic tree from three representative SNP data file formats. In addition, in order to increase reliability of a tree, the pipeline has steps such as removing low quality data and considering linkage disequilibrium. A maximum likelihood method for the inference of phylogeny is also adopted in generation of a tree in our pipeline. Using SNPhylo, users can easily produce a reliable phylogenetic tree from a large SNP data file. Thus, this pipeline can help a researcher focus more on interpretation of the results of analysis of voluminous data sets, rather than manipulations necessary to accomplish the analysis.

  1. Combinations of SNP genotypes from the Wellcome Trust Case Control Study of bipolar patients

    DEFF Research Database (Denmark)

    Mellerup, Erling; Jørgensen, Martin Balslev; Dam, Henrik

    2018-01-01

    Objectives: Combinations of genetic variants are the basis for polygenic disorders. We examined combinations of SNP genotypes taken from the 446 729 SNPs in The Wellcome Trust Case Control Study of bipolar patients. Methods: Parallel computing by graphics processing units, cloud computing, and data...

  2. The Association of FTO SNP rs9939609 with Weight Gain at University

    NARCIS (Netherlands)

    Meisel, S.F.; Beeken, R.J.; Jaarsveld, C.H.M. van; Wardle, J.

    2015-01-01

    AIM: We tested the hypothesis that the obesity-associated FTO SNP rs9939609 would be associated with clinically significant weight gain (>/= 5% of initial body weight) in the first year of university; a time identified as high risk for weight gain. METHODS: We collected anthropometric data from

  3. Use of SNP markers to conserve genome-wide genetic diversity in livestock

    NARCIS (Netherlands)

    Engelsma, K.A.

    2012-01-01

    Conservation of genetic diversity in livestock breeds is important since it is, both within and between breeds, under threat. The availability of large numbers of SNP markers has resulted in new opportunities to estimate genetic diversity in more detail, and to improve prioritization of animals

  4. Affymetrix SNP array data for wild Dutch great tits (Parus major)

    NARCIS (Netherlands)

    Silva, Da Vinicius; Laine, Veronika N.; Bosse, M.; Oers, C.H.J.; Dibbits, B.W.; Visser, M.E.; Crooijmans, R.P.M.A.; Groenen, M.

    2018-01-01

    The great tit is a widely studied passerine bird species in ecology that, in the past decades, has provided important insights into speciation, phenology, behavior and microevolution. After completion of the great tit genome sequence, a customized high density 650k SNP array was developed enabling

  5. Advanced statistical tools for SNP arrays : signal calibration, copy number estimation and single array genotyping

    NARCIS (Netherlands)

    Rippe, Ralph Christian Alexander

    2012-01-01

    Fluorescence bias in in signals from individual SNP arrays can be calibrated using linear models. Given the data, the system of equations is very large, so a specialized symbolic algorithm was developed. These models are also used to illustrate that genomic waves do not exist, but are merely an

  6. Experience from large scale use of the EuroGenomics custom SNP chip in cattle

    DEFF Research Database (Denmark)

    Boichard, Didier A; Boussaha, Mekki; Capitan, Aurélien

    2018-01-01

    This article presents the strategy to evaluate candidate mutations underlying QTL or responsible for genetic defects, based upon the design and large-scale use of the Eurogenomics custom SNP chip set up for bovine genomic selection. Some variants under study originated from mapping genetic defect...

  7. Longevity and plasticity of CFTR provide an argument for noncanonical SNP organization in hominid DNA.

    Directory of Open Access Journals (Sweden)

    Aubrey E Hill

    Full Text Available Like many other ancient genes, the cystic fibrosis transmembrane conductance regulator (CFTR has survived for hundreds of millions of years. In this report, we consider whether such prodigious longevity of an individual gene--as opposed to an entire genome or species--should be considered surprising in the face of eons of relentless DNA replication errors, mutagenesis, and other causes of sequence polymorphism. The conventions that modern human SNP patterns result either from purifying selection or random (neutral drift were not well supported, since extant models account rather poorly for the known plasticity and function (or the established SNP distributions found in a multitude of genes such as CFTR. Instead, our analysis can be taken as a polemic indicating that SNPs in CFTR and many other mammalian genes may have been generated--and continue to accrue--in a fundamentally more organized manner than would otherwise have been expected. The resulting viewpoint contradicts earlier claims of 'directional' or 'intelligent design-type' SNP formation, and has important implications regarding the pace of DNA adaptation, the genesis of conserved non-coding DNA, and the extent to which eukaryotic SNP formation should be viewed as adaptive.

  8. Highly effective SNP-based association mapping and management of recessive defects in livestock

    DEFF Research Database (Denmark)

    Charlier, Carole; Coppieters, Wouter; Rollin, Frédéric

    2008-01-01

    The widespread use of elite sires by means of artificial insemination in livestock breeding leads to the frequent emergence of recessive genetic defects, which cause significant economic and animal welfare concerns. Here we show that the availability of genome-wide, high-density SNP panels, combi...

  9. A novel approach to analyzing fMRI and SNP data via parallel independent component analysis

    Science.gov (United States)

    Liu, Jingyu; Pearlson, Godfrey; Calhoun, Vince; Windemuth, Andreas

    2007-03-01

    There is current interest in understanding genetic influences on brain function in both the healthy and the disordered brain. Parallel independent component analysis, a new method for analyzing multimodal data, is proposed in this paper and applied to functional magnetic resonance imaging (fMRI) and a single nucleotide polymorphism (SNP) array. The method aims to identify the independent components of each modality and the relationship between the two modalities. We analyzed 92 participants, including 29 schizophrenia (SZ) patients, 13 unaffected SZ relatives, and 50 healthy controls. We found a correlation of 0.79 between one fMRI component and one SNP component. The fMRI component consists of activations in cingulate gyrus, multiple frontal gyri, and superior temporal gyrus. The related SNP component is contributed to significantly by 9 SNPs located in sets of genes, including those coding for apolipoprotein A-I, and C-III, malate dehydrogenase 1 and the gamma-aminobutyric acid alpha-2 receptor. A significant difference in the presences of this SNP component is found between the SZ group (SZ patients and their relatives) and the control group. In summary, we constructed a framework to identify the interactions between brain functional and genetic information; our findings provide new insight into understanding genetic influences on brain function in a common mental disorder.

  10. Assessing the Clinical Utility of SNP Microarray for Prader-Willi Syndrome due to Uniparental Disomy.

    Science.gov (United States)

    Santoro, Stephanie L; Hashimoto, Sayaka; McKinney, Aimee; Mihalic Mosher, Theresa; Pyatt, Robert; Reshmi, Shalini C; Astbury, Caroline; Hickey, Scott E

    2017-01-01

    Maternal uniparental disomy (UPD) 15 is one of the molecular causes of Prader-Willi syndrome (PWS), a multisystem disorder which presents with neonatal hypotonia and feeding difficulty. Current diagnostic algorithms differ regarding the use of SNP microarray to detect PWS. We retrospectively examined the frequency with which SNP microarray could identify regions of homozygosity (ROH) in patients with PWS. We determined that 7/12 (58%) patients with previously confirmed PWS by methylation analysis and microsatellite-positive UPD studies had ROH (>10 Mb) by SNP microarray. Additional assessment of 5,000 clinical microarrays, performed from 2013 to present, determined that only a single case of ROH for chromosome 15 was not caused by an imprinting disorder or identity by descent. We observed that ROH for chromosome 15 is rarely incidental and strongly associated with hypotonic infants having features of PWS. Although UPD microsatellite studies remain essential to definitively establish the presence of UPD, SNP microarray has important utility in the timely diagnostic algorithm for PWS. © 2017 S. Karger AG, Basel.

  11. Prediction of a deletion copy number variant by a dense SNP panel

    NARCIS (Netherlands)

    Kadri, N.K.; Koks, P.D.; Meuwissen, T.H.E.

    2012-01-01

    Background: A newly recognized type of genetic variation, Copy Number Variation (CNV), is detected in mammalian genomes, e.g. the cattle genome. This form of variation can potentially cause phenotypic variation. Our objective was to determine whether dense SNP (single nucleotide polymorphisms)

  12. Identification of Mendelian inconsistencies between SNP and pedigree Information of Sibs

    NARCIS (Netherlands)

    Calus, M.P.L.; Mulder, H.A.; Bastiaansen, J.W.M.

    2011-01-01

    Background Using SNP genotypes to apply genomic selection in breeding programs is becoming common practice. Tools to edit and check the quality of genotype data are required. Checking for Mendelian inconsistencies makes it possible to identify animals for which pedigree information and genotype

  13. [Restriction endonuclease digest - melting curve analysis: a new SNP genotyping and its application in traditional Chinese medicine authentication].

    Science.gov (United States)

    Jiang, Chao; Huang, Lu-Qi; Yuan, Yuan; Chen, Min; Hou, Jing-Yi; Wu, Zhi-Gang; Lin, Shu-Fang

    2014-04-01

    Single nucleotide polymorphisms (SNP) is an important molecular marker in traditional Chinese medicine research, and it is widely used in TCM authentication. The present study created a new genotyping method by combining restriction endonuclease digesting with melting curve analysis, which is a stable, rapid and easy doing SNP genotyping method. The new method analyzed SNP genotyping of two chloroplast SNP which was located in or out of the endonuclease recognition site, the results showed that when attaching a 14 bp GC-clamp (cggcgggagggcgg) to 5' end of the primer and selecting suited endonuclease to digest the amplification products, the melting curve of Lonicera japonica and Atractylodes macrocephala were all of double peaks and the adulterants Shan-yin-hua and A. lancea were of single peaks. The results indicated that the method had good stability and reproducibility for identifying authentic medicines from its adulterants. It is a potential SNP genotyping method and named restriction endonuclease digest - melting curve analysis.

  14. Genome-wide SNP identification in multiple morphotypes of allohexaploid tall fescue (Festuca arundinacea Schreb

    Directory of Open Access Journals (Sweden)

    Hand Melanie L

    2012-06-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs provide essential tools for the advancement of research in plant genomics, and the development of SNP resources for many species has been accelerated by the capabilities of second-generation sequencing technologies. The current study aimed to develop and use a novel bioinformatic pipeline to generate a comprehensive collection of SNP markers within the agriculturally important pasture grass tall fescue; an outbreeding allopolyploid species displaying three distinct morphotypes: Continental, Mediterranean and rhizomatous. Results A bioinformatic pipeline was developed that successfully identified SNPs within genotypes from distinct tall fescue morphotypes, following the sequencing of 414 polymerase chain reaction (PCR – generated amplicons using 454 GS FLX technology. Equivalent amplicon sets were derived from representative genotypes of each morphotype, including six Continental, five Mediterranean and one rhizomatous. A total of 8,584 and 2,292 SNPs were identified with high confidence within the Continental and Mediterranean morphotypes respectively. The success of the bioinformatic approach was demonstrated through validation (at a rate of 70% of a subset of 141 SNPs using both SNaPshot™ and GoldenGate™ assay chemistries. Furthermore, the quantitative genotyping capability of the GoldenGate™ assay revealed that approximately 30% of the putative SNPs were accessible to co-dominant scoring, despite the hexaploid genome structure. The sub-genome-specific origin of each SNP validated from Continental tall fescue was predicted using a phylogenetic approach based on comparison with orthologous sequences from predicted progenitor species. Conclusions Using the appropriate bioinformatic approach, amplicon resequencing based on 454 GS FLX technology is an effective method for the identification of polymorphic SNPs within the genomes of Continental and Mediterranean tall fescue. The

  15. RS-SNP: a random-set method for genome-wide association studies

    Directory of Open Access Journals (Sweden)

    Mukherjee Sayan

    2011-03-01

    Full Text Available Abstract Background The typical objective of Genome-wide association (GWA studies is to identify single-nucleotide polymorphisms (SNPs and corresponding genes with the strongest evidence of association (the 'most-significant SNPs/genes' approach. Borrowing ideas from micro-array data analysis, we propose a new method, named RS-SNP, for detecting sets of genes enriched in SNPs moderately associated to the phenotype. RS-SNP assesses whether the number of significant SNPs, with p-value P ≤ α, belonging to a given SNP set is statistically significant. The rationale of proposed method is that two kinds of null hypotheses are taken into account simultaneously. In the first null model the genotype and the phenotype are assumed to be independent random variables and the null distribution is the probability of the number of significant SNPs in greater than observed by chance. The second null model assumes the number of significant SNPs in depends on the size of and not on the identity of the SNPs in . Statistical significance is assessed using non-parametric permutation tests. Results We applied RS-SNP to the Crohn's disease (CD data set collected by the Wellcome Trust Case Control Consortium (WTCCC and compared the results with GENGEN, an approach recently proposed in literature. The enrichment analysis using RS-SNP and the set of pathways contained in the MSigDB C2 CP pathway collection highlighted 86 pathways rich in SNPs weakly associated to CD. Of these, 47 were also indicated to be significant by GENGEN. Similar results were obtained using the MSigDB C5 pathway collection. Many of the pathways found to be enriched by RS-SNP have a well-known connection to CD and often with inflammatory diseases. Conclusions The proposed method is a valuable alternative to other techniques for enrichment analysis of SNP sets. It is well founded from a theoretical and statistical perspective. Moreover, the experimental comparison with GENGEN highlights that it is

  16. SNP discovery in the bovine milk transcriptome using RNA-Seq technology.

    Science.gov (United States)

    Cánovas, Angela; Rincon, Gonzalo; Islas-Trejo, Alma; Wickramasinghe, Saumya; Medrano, Juan F

    2010-12-01

    High-throughput sequencing of RNA (RNA-Seq) was developed primarily to analyze global gene expression in different tissues. However, it also is an efficient way to discover coding SNPs. The objective of this study was to perform a SNP discovery analysis in the milk transcriptome using RNA-Seq. Seven milk samples from Holstein cows were analyzed by sequencing cDNAs using the Illumina Genome Analyzer system. We detected 19,175 genes expressed in milk samples corresponding to approximately 70% of the total number of genes analyzed. The SNP detection analysis revealed 100,734 SNPs in Holstein samples, and a large number of those corresponded to differences between the Holstein breed and the Hereford bovine genome assembly Btau4.0. The number of polymorphic SNPs within Holstein cows was 33,045. The accuracy of RNA-Seq SNP discovery was tested by comparing SNPs detected in a set of 42 candidate genes expressed in milk that had been resequenced earlier using Sanger sequencing technology. Seventy of 86 SNPs were detected using both RNA-Seq and Sanger sequencing technologies. The KASPar Genotyping System was used to validate unique SNPs found by RNA-Seq but not observed by Sanger technology. Our results confirm that analyzing the transcriptome using RNA-Seq technology is an efficient and cost-effective method to identify SNPs in transcribed regions. This study creates guidelines to maximize the accuracy of SNP discovery and prevention of false-positive SNP detection, and provides more than 33,000 SNPs located in coding regions of genes expressed during lactation that can be used to develop genotyping platforms to perform marker-trait association studies in Holstein cattle.

  17. SNP discovery in candidate adaptive genes using exon capture in a free-ranging alpine ungulate

    Science.gov (United States)

    Roffler, Gretchen H.; Amish, Stephen J.; Smith, Seth; Cosart, Ted F.; Kardos, Marty; Schwartz, Michael K.; Luikart, Gordon

    2016-01-01

    Identification of genes underlying genomic signatures of natural selection is key to understanding adaptation to local conditions. We used targeted resequencing to identify SNP markers in 5321 candidate adaptive genes associated with known immunological, metabolic and growth functions in ovids and other ungulates. We selectively targeted 8161 exons in protein-coding and nearby 5′ and 3′ untranslated regions of chosen candidate genes. Targeted sequences were taken from bighorn sheep (Ovis canadensis) exon capture data and directly from the domestic sheep genome (Ovis aries v. 3; oviAri3). The bighorn sheep sequences used in the Dall's sheep (Ovis dalli dalli) exon capture aligned to 2350 genes on the oviAri3 genome with an average of 2 exons each. We developed a microfluidic qPCR-based SNP chip to genotype 476 Dall's sheep from locations across their range and test for patterns of selection. Using multiple corroborating approaches (lositan and bayescan), we detected 28 SNP loci potentially under selection. We additionally identified candidate loci significantly associated with latitude, longitude, precipitation and temperature, suggesting local environmental adaptation. The three methods demonstrated consistent support for natural selection on nine genes with immune and disease-regulating functions (e.g. Ovar-DRA, APC, BATF2, MAGEB18), cell regulation signalling pathways (e.g. KRIT1, PI3K, ORRC3), and respiratory health (CYSLTR1). Characterizing adaptive allele distributions from novel genetic techniques will facilitate investigation of the influence of environmental variation on local adaptation of a northern alpine ungulate throughout its range. This research demonstrated the utility of exon capture for gene-targeted SNP discovery and subsequent SNP chip genotyping using low-quality samples in a nonmodel species.

  18. Development and characterization of a high density SNP genotyping assay for cattle.

    Directory of Open Access Journals (Sweden)

    Lakshmi K Matukumalli

    Full Text Available The success of genome-wide association (GWA studies for the detection of sequence variation affecting complex traits in human has spurred interest in the use of large-scale high-density single nucleotide polymorphism (SNP genotyping for the identification of quantitative trait loci (QTL and for marker-assisted selection in model and agricultural species. A cost-effective and efficient approach for the development of a custom genotyping assay interrogating 54,001 SNP loci to support GWA applications in cattle is described. A novel algorithm for achieving a compressed inter-marker interval distribution proved remarkably successful, with median interval of 37 kb and maximum predicted gap of <350 kb. The assay was tested on a panel of 576 animals from 21 cattle breeds and six outgroup species and revealed that from 39,765 to 46,492 SNP are polymorphic within individual breeds (average minor allele frequency (MAF ranging from 0.24 to 0.27. The assay also identified 79 putative copy number variants in cattle. Utility for GWA was demonstrated by localizing known variation for coat color and the presence/absence of horns to their correct genomic locations. The combination of SNP selection and the novel spacing algorithm allows an efficient approach for the development of high-density genotyping platforms in species having full or even moderate quality draft sequence. Aspects of the approach can be exploited in species which lack an available genome sequence. The BovineSNP50 assay described here is commercially available from Illumina and provides a robust platform for mapping disease genes and QTL in cattle.

  19. SNP discovery in the transcriptome of white Pacific shrimp Litopenaeus vannamei by next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Yang Yu

    Full Text Available The application of next generation sequencing technology has greatly facilitated high throughput single nucleotide polymorphism (SNP discovery and genotyping in genetic research. In the present study, SNPs were discovered based on two transcriptomes of Litopenaeus vannamei (L. vannamei generated from Illumina sequencing platform HiSeq 2000. One transcriptome of L. vannamei was obtained through sequencing on the RNA from larvae at mysis stage and its reference sequence was de novo assembled. The data from another transcriptome were downloaded from NCBI and the reads of the two transcriptomes were mapped separately to the assembled reference by BWA. SNP calling was performed using SAMtools. A total of 58,717 and 36,277 SNPs with high quality were predicted from the two transcriptomes, respectively. SNP calling was also performed using the reads of two transcriptomes together, and a total of 96,040 SNPs with high quality were predicted. Among these 96,040 SNPs, 5,242 and 29,129 were predicted as non-synonymous and synonymous SNPs respectively. Characterization analysis of the predicted SNPs in L. vannamei showed that the estimated SNP frequency was 0.21% (one SNP per 476 bp and the estimated ratio for transition to transversion was 2.0. Fifty SNPs were randomly selected for validation by Sanger sequencing after PCR amplification and 76% of SNPs were confirmed, which indicated that the SNPs predicted in this study were reliable. These SNPs will be very useful for genetic study in L. vannamei, especially for the high density linkage map construction and genome-wide association studies.

  20. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff

    Science.gov (United States)

    Cingolani, Pablo; Platts, Adrian; Wang, Le Lily; Coon, Melissa; Nguyen, Tung; Wang, Luan; Land, Susan J.; Lu, Xiangyi; Ruden, Douglas M.

    2012-01-01

    We describe a new computer program, SnpEff, for rapidly categorizing the effects of variants in genome sequences. Once a genome is sequenced, SnpEff annotates variants based on their genomic locations and predicts coding effects. Annotated genomic locations include intronic, untranslated region, upstream, downstream, splice site, or intergenic regions. Coding effects such as synonymous or non-synonymous amino acid replacement, start codon gains or losses, stop codon gains or losses, or frame shifts can be predicted. Here the use of SnpEff is illustrated by annotating ~356,660 candidate SNPs in ~117 Mb unique sequences, representing a substitution rate of ~1/305 nucleotides, between the Drosophila melanogaster w1118; iso-2; iso-3 strain and the reference y1; cn1 bw1 sp1 strain. We show that ~15,842 SNPs are synonymous and ~4,467 SNPs are non-synonymous (N/S ~0.28). The remaining SNPs are in other categories, such as stop codon gains (38 SNPs), stop codon losses (8 SNPs), and start codon gains (297 SNPs) in the 5′UTR. We found, as expected, that the SNP frequency is proportional to the recombination frequency (i.e., highest in the middle of chromosome arms). We also found that start-gain or stop-lost SNPs in Drosophila melanogaster often result in additions of N-terminal or C-terminal amino acids that are conserved in other Drosophila species. It appears that the 5′ and 3′ UTRs are reservoirs for genetic variations that changes the termini of proteins during evolution of the Drosophila genus. As genome sequencing is becoming inexpensive and routine, SnpEff enables rapid analyses of whole-genome sequencing data to be performed by an individual laboratory. PMID:22728672

  1. Effect of Myostatin SNP on muscle fiber properties in male Thoroughbred horses during training period.

    Science.gov (United States)

    Miyata, Hirofumi; Itoh, Rika; Sato, Fumio; Takebe, Naoya; Hada, Tetsuro; Tozaki, Teruaki

    2017-10-20

    Variants of the Myostatin gene have been shown to have an influence on muscle hypertrophy phenotypes in a wide range of mammalian species. Recently, a Thoroughbred horse with a C-Allele at the g.66493737C/T single-nucleotide polymorphism (SNP) has been reported to be suited to short-distance racing. In this study, we examined the effect of the Myostatin SNP on muscle fiber properties in young Thoroughbred horses during a training period. To investigate the effect of the Myostatin SNP on muscle fiber before training, several mRNA expressions were relatively quantified in biopsy samples from the middle gluteal muscle of 27 untrained male Thoroughbred horses (1.5 years old) using real-time RT-PCR analysis. The remaining muscle samples were used for immunohistochemical analysis to determine the population and area of each fiber type. All measurements were revaluated in biopsy samples of the same horses after a 5-month period of conventional training. Although the expressions of Myostatin mRNA decreased in all SNP genotypes, a significant decrease was found in only the C/C genotype after training. While, expression of VEGFa, PGC1α, and SDHa mRNAs, which relate to the biogenesis of mitochondria and capillaries, was significantly higher (54-82%) in the T/T than the C/C genotypes after training. It is suggested that hypertrophy of muscle fiber is directly associated with a decrease in Myostatin mRNA expression in the C/C genotype, and that increased expressions of VEGFa, PGC1α, and SDHa in the T/T genotype might be indirectly caused by the Myostatin SNP.

  2. SUPLEMENTASI Lactobacillus acidophilus SNP-2 PADA TAPE DAN PENGARUHNYA PADA RELAWAN [Supplementation of Lactocbacillus acidophilus SNP-2 Into Tape and its Effect to the Volunteer

    Directory of Open Access Journals (Sweden)

    Endang S Rahayu1

    2004-08-01

    Full Text Available Functional food is defined as any potentially healthful food or food ingredient that may provide a health benefit beyond the traditional nutrients it contains. Many researches have been conducted on the health benefit of probiotic (life bacterial cells, one of the ingredient of functional foods. One of the potential bacteria used for probiotic agent and also involved in traditional fermented foods are lactic acid bacteria (LAB. Previous research showed that Lactobacillus acidophilus SNP-2 isolated from faecal material of healthy infant is resistant to acid and bile salt, and has an antagonistic effect against several enteric bacterial pathogens. The objective of this research was to study the effect of L. acidophilus SNP-2 as probiotic agent to the health benefits. These bacteria were supplemented into tape ketan (fermented sticky rice, the indigenous Indonesian fermented food. Tape ketan was chosen as the carrier of probiotic biomass based on the high population of LAB in this product, i.e., 1.3 x 108 CFU/g. Addition of L. acidophilus SNP-2 biomass prior to fermentation of tape ketan resulted in a higher total of LAB cells, i.e. 2.1 x 109 CFU/g compared to the amount of 1.5 x 108 CFU/g when the addition was done after fermentation. Consumption of tape ketan containing probiotic agent by the volunteers increased the population of lactobacilli (from 1.7x107 CFU/g to 9.9x107 CFU/g and decreased the population of enterobacteriacea (from 5.4x109 CFU/g to 4.4x108 in their faecal material. This phenomenon revealed that probiotic agent was able to colonize and inhibit the growth of enterobacteriaceae in the gastrointestinal tract. The result implied that tape ketan can be used as a carrier for probiotic agent and it can be categorized as functional food

  3. Transcriptomic SNP discovery for custom genotyping arrays: impacts of sequence data, SNP calling method and genotyping technology on the probability of validation success.

    Science.gov (United States)

    Humble, Emily; Thorne, Michael A S; Forcada, Jaume; Hoffman, Joseph I

    2016-08-26

    Single nucleotide polymorphism (SNP) discovery is an important goal of many studies. However, the number of 'putative' SNPs discovered from a sequence resource may not provide a reliable indication of the number that will successfully validate with a given genotyping technology. For this it may be necessary to account for factors such as the method used for SNP discovery and the type of sequence data from which it originates, suitability of the SNP flanking sequences for probe design, and genomic context. To explore the relative importance of these and other factors, we used Illumina sequencing to augment an existing Roche 454 transcriptome assembly for the Antarctic fur seal (Arctocephalus gazella). We then mapped the raw Illumina reads to the new hybrid transcriptome using BWA and BOWTIE2 before calling SNPs with GATK. The resulting markers were pooled with two existing sets of SNPs called from the original 454 assembly using NEWBLER and SWAP454. Finally, we explored the extent to which SNPs discovered using these four methods overlapped and predicted the corresponding validation outcomes for both Illumina Infinium iSelect HD and Affymetrix Axiom arrays. Collating markers across all discovery methods resulted in a global list of 34,718 SNPs. However, concordance between the methods was surprisingly poor, with only 51.0 % of SNPs being discovered by more than one method and 13.5 % being called from both the 454 and Illumina datasets. Using a predictive modeling approach, we could also show that SNPs called from the Illumina data were on average more likely to successfully validate, as were SNPs called by more than one method. Above and beyond this pattern, predicted validation outcomes were also consistently better for Affymetrix Axiom arrays. Our results suggest that focusing on SNPs called by more than one method could potentially improve validation outcomes. They also highlight possible differences between alternative genotyping technologies that could be

  4. TIA: algorithms for development of identity-linked SNP islands for analysis by massively parallel DNA sequencing.

    Science.gov (United States)

    Farris, M Heath; Scott, Andrew R; Texter, Pamela A; Bartlett, Marta; Coleman, Patricia; Masters, David

    2018-04-11

    Single nucleotide polymorphisms (SNPs) located within the human genome have been shown to have utility as markers of identity in the differentiation of DNA from individual contributors. Massively parallel DNA sequencing (MPS) technologies and human genome SNP databases allow for the design of suites of identity-linked target regions, amenable to sequencing in a multiplexed and massively parallel manner. Therefore, tools are needed for leveraging the genotypic information found within SNP databases for the discovery of genomic targets that can be evaluated on MPS platforms. The SNP island target identification algorithm (TIA) was developed as a user-tunable system to leverage SNP information within databases. Using data within the 1000 Genomes Project SNP database, human genome regions were identified that contain globally ubiquitous identity-linked SNPs and that were responsive to targeted resequencing on MPS platforms. Algorithmic filters were used to exclude target regions that did not conform to user-tunable SNP island target characteristics. To validate the accuracy of TIA for discovering these identity-linked SNP islands within the human genome, SNP island target regions were amplified from 70 contributor genomic DNA samples using the polymerase chain reaction. Multiplexed amplicons were sequenced using the Illumina MiSeq platform, and the resulting sequences were analyzed for SNP variations. 166 putative identity-linked SNPs were targeted in the identified genomic regions. Of the 309 SNPs that provided discerning power across individual SNP profiles, 74 previously undefined SNPs were identified during evaluation of targets from individual genomes. Overall, DNA samples of 70 individuals were uniquely identified using a subset of the suite of identity-linked SNP islands. TIA offers a tunable genome search tool for the discovery of targeted genomic regions that are scalable in the population frequency and numbers of SNPs contained within the SNP island regions

  5. When whole-genome alignments just won't work: kSNP v2 software for alignment-free SNP discovery and phylogenetics of hundreds of microbial genomes.

    Science.gov (United States)

    Gardner, Shea N; Hall, Barry G

    2013-01-01

    Effective use of rapid and inexpensive whole genome sequencing for microbes requires fast, memory efficient bioinformatics tools for sequence comparison. The kSNP v2 software finds single nucleotide polymorphisms (SNPs) in whole genome data. kSNP v2 has numerous improvements over kSNP v1 including SNP gene annotation; better scaling for draft genomes available as assembled contigs or raw, unassembled reads; a tool to identify the optimal value of k; distribution of packages of executables for Linux and Mac OS X for ease of installation and user-friendly use; and a detailed User Guide. SNP discovery is based on k-mer analysis, and requires no multiple sequence alignment or the selection of a single reference genome. Most target sets with hundreds of genomes complete in minutes to hours. SNP phylogenies are built by maximum likelihood, parsimony, and distance, based on all SNPs, only core SNPs, or SNPs present in some intermediate user-specified fraction of targets. The SNP-based trees that result are consistent with known taxonomy. kSNP v2 can handle many gigabases of sequence in a single run, and if one or more annotated genomes are included in the target set, SNPs are annotated with protein coding and other information (UTRs, etc.) from Genbank file(s). We demonstrate application of kSNP v2 on sets of viral and bacterial genomes, and discuss in detail analysis of a set of 68 finished E. coli and Shigella genomes and a set of the same genomes to which have been added 47 assemblies and four "raw read" genomes of H104:H4 strains from the recent European E. coli outbreak that resulted in both bloody diarrhea and hemolytic uremic syndrome (HUS), and caused at least 50 deaths.

  6. Grouping and clustering of maize Lancaster germplasm inbreds according to the results of SNP-analysis

    Directory of Open Access Journals (Sweden)

    K. V. Derkach

    2017-08-01

    Full Text Available The objective of this article is the grouping and clustering of maize inbred lines based on the results of SNP-genotyping for the verification of a separate cluster of Lancaster germplasm inbred lines. As material for the study, we used 91 maize (Zea mays L. inbred lines, including 31 Lancaster germplasm lines and 60 inbred lines of other germplasms (23 Iodent inbreds, 15 Reid inbreds, 7 Lacon inbreds, 12 Mix inbreds and 3 exotic inbreds. The majority of the given inbred lines are included in the Dnipro breeding programme. The SNP-genotyping of these inbred lines was conducted using BDI-III panel of 384 SNP-markers developed by BioDiagnostics, Inc. (USA on the base of Illumina VeraCode Bead Plate. The SNP-markers of this panel are biallelic and are located on all 10 maize chromosomes. Their range of conductivity was >0.6. The SNP-analysis was made in completely automated regime on Illumina BeadStation equipment at BioDiagnostics, Inc. (USA. A principal component analysis was applied to group a general set of 91 inbreds according to allelic states of SNP-markers and to identify a cluster of Lancaster inbreds. The clustering and determining hierarchy in 31 Lancaster germplasm inbreds used quantitative cluster analysis. The share of monomorphic markers in the studied set of 91 inbred lines equaled 0.7%, and the share of dimorphic markers equaled 99.3%. Minor allele frequency (MAF > 0.2 was observed for 80.6% of dimorphic markers, the average index of shift of gene diversity equaled 0.2984, PIC on average reached 0.3144. The index of gene diversity of markers varied from 0.1701 to 0.1901, pairwise genetic distances between inbred lines ranged from 0.0316–0.8000, the frequencies of major alleles of SNP-markers were within 0.5085–0.9821, and the frequencies of minor alleles were within 0.0179–0.4915. The average homozygosity of inbred lines was 98.8%. The principal component analysis of SNP-distances confirmed the isolation of the Lancaster

  7. Analysis of SNP rs16754 of WT1 gene in a series of de novo acute myeloid leukemia patients.

    Science.gov (United States)

    Luna, Irene; Such, Esperanza; Cervera, Jose; Barragán, Eva; Jiménez-Velasco, Antonio; Dolz, Sandra; Ibáñez, Mariam; Gómez-Seguí, Inés; López-Pavía, María; Llop, Marta; Fuster, Óscar; Oltra, Silvestre; Moscardó, Federico; Martínez-Cuadrón, David; Senent, M Leonor; Gascón, Adriana; Montesinos, Pau; Martín, Guillermo; Bolufer, Pascual; Sanz, Miguel A

    2012-12-01

    The single nucleotide polymorphism (SNP) rs16754 of the WT1 gene has been previously described as a possible prognostic marker in normal karyotype acute myeloid leukemia (AML) patients. Nevertheless, the findings in this field are not always reproducible in different series. One hundred and seventy-five adult de novo AML patients were screened with two different methods for the detection of SNP rs16754: high-resolution melting (HRM) and FRET hybridization probes. Direct sequencing was used to validate both techniques. The SNP was detected in 52 out of 175 patients (30 %), both by HRM and hybridization probes. Direct sequencing confirmed that every positive sample in the screening methods had a variation in the DNA sequence. Patients with the wild-type genotype (WT1(AA)) for the SNP rs16754 were significantly younger than those with the heterozygous WT1(AG) genotype. No other difference was observed for baseline characteristic or outcome between patients with or without the SNP. Both techniques are equally reliable and reproducible as screening methods for the detection of the SNP rs16754, allowing for the selection of those samples that will need to be sequenced. We were unable to confirm the suggested favorable outcome of SNP rs16754 in de novo AML.

  8. Dynamic variable selection in SNP genotype autocalling from APEX microarray data

    Directory of Open Access Journals (Sweden)

    Zamar Ruben H

    2006-11-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are DNA sequence variations, occurring when a single nucleotide – adenine (A, thymine (T, cytosine (C or guanine (G – is altered. Arguably, SNPs account for more than 90% of human genetic variation. Our laboratory has developed a highly redundant SNP genotyping assay consisting of multiple probes with signals from multiple channels for a single SNP, based on arrayed primer extension (APEX. This mini-sequencing method is a powerful combination of a highly parallel microarray with distinctive Sanger-based dideoxy terminator sequencing chemistry. Using this microarray platform, our current genotype calling system (known as SNP Chart is capable of calling single SNP genotypes by manual inspection of the APEX data, which is time-consuming and exposed to user subjectivity bias. Results Using a set of 32 Coriell DNA samples plus three negative PCR controls as a training data set, we have developed a fully-automated genotyping algorithm based on simple linear discriminant analysis (LDA using dynamic variable selection. The algorithm combines separate analyses based on the multiple probe sets to give a final posterior probability for each candidate genotype. We have tested our algorithm on a completely independent data set of 270 DNA samples, with validated genotypes, from patients admitted to the intensive care unit (ICU of St. Paul's Hospital (plus one negative PCR control sample. Our method achieves a concordance rate of 98.9% with a 99.6% call rate for a set of 96 SNPs. By adjusting the threshold value for the final posterior probability of the called genotype, the call rate reduces to 94.9% with a higher concordance rate of 99.6%. We also reversed the two independent data sets in their training and testing roles, achieving a concordance rate up to 99.8%. Conclusion The strength of this APEX chemistry-based platform is its unique redundancy having multiple probes for a single SNP. Our

  9. Identification of Mendelian inconsistencies between SNP and pedigree information of sibs

    Directory of Open Access Journals (Sweden)

    Calus Mario PL

    2011-10-01

    Full Text Available Abstract Background Using SNP genotypes to apply genomic selection in breeding programs is becoming common practice. Tools to edit and check the quality of genotype data are required. Checking for Mendelian inconsistencies makes it possible to identify animals for which pedigree information and genotype information are not in agreement. Methods Straightforward tests to detect Mendelian inconsistencies exist that count the number of opposing homozygous marker (e.g. SNP genotypes between parent and offspring (PAR-OFF. Here, we develop two tests to identify Mendelian inconsistencies between sibs. The first test counts SNP with opposing homozygous genotypes between sib pairs (SIBCOUNT. The second test compares pedigree and SNP-based relationships (SIBREL. All tests iteratively remove animals based on decreasing numbers of inconsistent parents and offspring or sibs. The PAR-OFF test, followed by either SIB test, was applied to a dataset comprising 2,078 genotyped cows and 211 genotyped sires. Theoretical expectations for distributions of test statistics of all three tests were calculated and compared to empirically derived values. Type I and II error rates were calculated after applying the tests to the edited data, while Mendelian inconsistencies were introduced by permuting pedigree against genotype data for various proportions of animals. Results Both SIB tests identified animal pairs for which pedigree and genomic relationships could be considered as inconsistent by visual inspection of a scatter plot of pairwise pedigree and SNP-based relationships. After removal of 235 animals with the PAR-OFF test, SIBCOUNT (SIBREL identified 18 (22 additional inconsistent animals. Seventeen animals were identified by both methods. The numbers of incorrectly deleted animals (Type I error, were equally low for both methods, while the numbers of incorrectly non-deleted animals (Type II error, were considerably higher for SIBREL compared to SIBCOUNT. Conclusions

  10. Model SNP development for complex genomes based on hexaploid oat using high-throughput 454 sequencing technology

    Directory of Open Access Journals (Sweden)

    Chao Shiaoman

    2011-01-01

    Full Text Available Abstract Background Genetic markers are pivotal to modern genomics research; however, discovery and genotyping of molecular markers in oat has been hindered by the size and complexity of the genome, and by a scarcity of sequence data. The purpose of this study was to generate oat expressed sequence tag (EST information, develop a bioinformatics pipeline for SNP discovery, and establish a method for rapid, cost-effective, and straightforward genotyping of SNP markers in complex polyploid genomes such as oat. Results Based on cDNA libraries of four cultivated oat genotypes, approximately 127,000 contigs were assembled from approximately one million Roche 454 sequence reads. Contigs were filtered through a novel bioinformatics pipeline to eliminate ambiguous polymorphism caused by subgenome homology, and 96 in silico SNPs were selected from 9,448 candidate loci for validation using high-resolution melting (HRM analysis. Of these, 52 (54% were polymorphic between parents of the Ogle1040 × TAM O-301 (OT mapping population, with 48 segregating as single Mendelian loci, and 44 being placed on the existing OT linkage map. Ogle and TAM amplicons from 12 primers were sequenced for SNP validation, revealing complex polymorphism in seven amplicons but general sequence conservation within SNP loci. Whole-amplicon interrogation with HRM revealed insertions, deletions, and heterozygotes in secondary oat germplasm pools, generating multiple alleles at some primer targets. To validate marker utility, 36 SNP assays were used to evaluate the genetic diversity of 34 diverse oat genotypes. Dendrogram clusters corresponded generally to known genome composition and genetic ancestry. Conclusions The high-throughput SNP discovery pipeline presented here is a rapid and effective method for identification of polymorphic SNP alleles in the oat genome. The current-generation HRM system is a simple and highly-informative platform for SNP genotyping. These techniques provide

  11. Using SNP array to identify aneuploidy and segmental imbalance in translocation carriers

    Directory of Open Access Journals (Sweden)

    B. Xiong

    2014-12-01

    In addition to genetic testing techniques, the embryo biopsy stage (polar body, cleavage embryo or blastocyst and the mode of embryo transfer (fresh or frozen embryos can affect the outcome of PGD. It is now generally recommended that blastomere biopsy should be replaced by blastocyst biopsy to avoid a high mosaic rate and biopsy-related damage to cleavage-stage embryos, which might affect embryo development. However, more clinical data are required to confirm that the technique of SNP array-based PGD (SNP-PGD combined with trophectoderm (TE biopsy and frozen embryo transfer (FET is superior to traditional FISH-PGD combined with Day 3 (D3 blastomere biopsy and fresh embryo transfer.

  12. Using SNP markers to estimate additive, dominance and imprinting genetic variance

    DEFF Research Database (Denmark)

    Lopes, M S; Bastiaansen, J W M; Janss, Luc

    The contributions of additive, dominance and imprinting effects to the variance of number of teats (NT) were evaluated in two purebred pig populations using SNP markers. Three different random regression models were evaluated, accounting for the mean and: 1) additive effects (MA), 2) additive...... and dominance effects (MAD) and 3) additive, dominance and imprinting effects (MADI). Additive heritability estimates were 0.30, 0.28 and 0.27-0.28 in both lines using MA, MAD and MADI, respectively. Dominance heritability ranged from 0.06 to 0.08 using MAD and MADI. Imprinting heritability ranged from 0.......01 to 0.02. Dominance effects make an important contribution to the genetic variation of NT in the two lines evaluated. Imprinting effects appeared less important for NT than additive and dominance effects. The SNP random regression model presented and evaluated in this study is a feasible approach...

  13. Comprehensive evaluation of SNP identification with the Restriction Enzyme-based Reduced Representation Library (RRL method

    Directory of Open Access Journals (Sweden)

    Du Ye

    2012-02-01

    Full Text Available Abstract Background Restriction Enzyme-based Reduced Representation Library (RRL method represents a relatively feasible and flexible strategy used for Single Nucleotide Polymorphism (SNP identification in different species. It has remarkable advantage of reducing the complexity of the genome by orders of magnitude. However, comprehensive evaluation for actual efficacy of SNP identification by this method is still unavailable. Results In order to evaluate the efficacy of Restriction Enzyme-based RRL method, we selected Tsp 45I enzyme which covers 266 Mb flanking region of the enzyme recognition site according to in silico simulation on human reference genome, then we sequenced YH RRL after Tsp 45I treatment and obtained reads of which 80.8% were mapped to target region with an 20-fold average coverage, about 96.8% of target region was covered by at least one read and 257 K SNPs were identified in the region using SOAPsnp software. Compared with whole genome resequencing data, we observed false discovery rate (FDR of 13.95% and false negative rate (FNR of 25.90%. The concordance rate of homozygote loci was over 99.8%, but that of heterozygote were only 92.56%. Repeat sequences and bases quality were proved to have a great effect on the accuracy of SNP calling, SNPs in recognition sites contributed evidently to the high FNR and the low concordance rate of heterozygote. Our results indicated that repeat masking and high stringent filter criteria could significantly decrease both FDR and FNR. Conclusions This study demonstrates that Restriction Enzyme-based RRL method was effective for SNP identification. The results highlight the important role of bias and the method-derived defects represented in this method and emphasize the special attentions noteworthy.

  14. Report on the development of putative functional SSR and SNP markers in passion fruits.

    Science.gov (United States)

    da Costa, Zirlane Portugal; Munhoz, Carla de Freitas; Vieira, Maria Lucia Carneiro

    2017-09-06

    Passionflowers Passiflora edulis and Passiflora alata are diploid, outcrossing and understudied fruit bearing species. In Brazil, passion fruit cultivation began relatively recently and has earned the country an outstanding position as the world's top producer of passion fruit. The fruit's main economic value lies in the production of juice, an essential exotic ingredient in juice blends. Currently, crop improvement strategies, including those for underexploited tropical species, tend to incorporate molecular genetic approaches. In this study, we examined a set of P. edulis transcripts expressed in response to infection by Xanthomonas axonopodis, (the passion fruit's main bacterial pathogen that attacks the vines), aiming at the development of putative functional markers, i.e. SSRs (simple sequence repeats) and SNPs (single nucleotide polymorphisms). A total of 210 microsatellites were found in 998 sequences, and trinucleotide repeats were found to be the most frequent (31.4%). Of the sequences selected for designing primers, 80.9% could be used to develop SSR markers, and 60.6% SNP markers for P. alata. SNPs were all biallelic and found within 15 gene fragments of P. alata. Overall, gene fragments generated 10,003 bp. SNP frequency was estimated as one SNP every 294 bp. Polymorphism rates revealed by SSR and SNP loci were 29.4 and 53.6%, respectively. Passiflora edulis transcripts were useful for the development of putative functional markers for P. alata, suggesting a certain level of sequence conservation between these cultivated species. The markers developed herein could be used for genetic mapping purposes and also in diversity studies.

  15. Evaluation of Bovine High-Density SNP Genotyping Array in Indigenous Dairy Cattle Breeds.

    Science.gov (United States)

    Dash, S; Singh, A; Bhatia, A K; Jayakumar, S; Sharma, A; Singh, S; Ganguly, I; Dixit, S P

    2018-04-03

    In total 52 samples of Sahiwal ( 19 ), Tharparkar ( 17 ), and Gir ( 16 ) were genotyped by using BovineHD SNP chip to analyze minor allele frequency (MAF), genetic diversity, and linkage disequilibrium among these cattle. The common SNPs of BovineHD and 54K SNP Chips were also extracted and evaluated for their performance. Only 40%-50% SNPs of these arrays was found informative for genetic analysis in these cattle breeds. The overall mean of MAF for SNPs of BovineHD SNPChip was 0.248 ± 0.006, 0.241 ± 0.007, and 0.242 ± 0.009 in Sahiwal, Tharparkar and Gir, respectively, while that for 54K SNPs was on lower side. The average Reynold's genetic distance between breeds ranged from 0.042 to 0.055 based on BovineHD Beadchip, and from 0.052 to 0.084 based on 54K SNP Chip. The estimates of genetic diversity based on HD and 54K chips were almost same and, hence, low density chip seems to be good enough to decipher genetic diversity of these cattle breeds. The linkage disequilibrium started decaying (r 2  < 0.2) at 140 kb inter-marker distance and, hence, a 20K low density customized SNP array from HD chip could be designed for genomic selection in these cattle else the 54K Bead Chip as such will be useful.

  16. The clinical application of single-sperm-based SNP haplotyping for PGD of osteogenesis imperfecta.

    Science.gov (United States)

    Chen, Linjun; Diao, Zhenyu; Xu, Zhipeng; Zhou, Jianjun; Yan, Guijun; Sun, Haixiang

    2018-05-15

    Osteogenesis imperfecta (OI) is a genetically heterogeneous disorder, presenting either autosomal dominant, autosomal recessive or X-linked inheritance patterns. The majority of OI cases are autosomal dominant and are caused by heterozygous mutations in either the COL1A1 or COL1A2 gene. In these dominant disorders, allele dropout (ADO) can lead to misdiagnosis in preimplantation genetic diagnosis (PGD). Polymorphic markers linked to the mutated genes have been used to establish haplotypes for identifying ADO and ensuring the accuracy of PGD. However, the haplotype of male patients cannot be determined without data from affected relatives. Here, we developed a method for single-sperm-based single-nucleotide polymorphism (SNP) haplotyping via next-generation sequencing (NGS) for the PGD of OI. After NGS, 10 informative polymorphic SNP markers located upstream and downstream of the COL1A1 gene and its pathogenic mutation site were linked to individual alleles in a single sperm from an affected male. After haplotyping, a normal blastocyst was transferred to the uterus for a subsequent frozen embryo transfer cycle. The accuracy of PGD was confirmed by amniocentesis at 19 weeks of gestation. A healthy infant weighing 4,250 g was born via vaginal delivery at the 40th week of gestation. Single-sperm-based SNP haplotyping can be applied for PGD of any monogenic disorders or de novo mutations in males in whom the haplotype of paternal mutations cannot be determined due to a lack of affected relatives. ADO: allele dropout; DI: dentinogenesis imperfect; ESHRE: European Society of Human Reproduction and Embryology; FET: frozen embryo transfer; gDNA: genomic DNA; ICSI: intracytoplasmic sperm injection; IVF: in vitro fertilization; MDA: multiple displacement amplification; NGS: next-generation sequencing; OI: osteogenesis imperfect; PBS: phosphate buffer saline; PCR: polymerase chain reaction; PGD: preimplantation genetic diagnosis; SNP: single-nucleotide polymorphism; STR

  17. Light whole genome sequence for SNP discovery across domestic cat breeds

    Directory of Open Access Journals (Sweden)

    Driscoll Carlos

    2010-06-01

    Full Text Available Abstract Background The domestic cat has offered enormous genomic potential in the veterinary description of over 250 hereditary disease models as well as the occurrence of several deadly feline viruses (feline leukemia virus -- FeLV, feline coronavirus -- FECV, feline immunodeficiency virus - FIV that are homologues to human scourges (cancer, SARS, and AIDS respectively. However, to realize this bio-medical potential, a high density single nucleotide polymorphism (SNP map is required in order to accomplish disease and phenotype association discovery. Description To remedy this, we generated 3,178,297 paired fosmid-end Sanger sequence reads from seven cats, and combined these data with the publicly available 2X cat whole genome sequence. All sequence reads were assembled together to form a 3X whole genome assembly allowing the discovery of over three million SNPs. To reduce potential false positive SNPs due to the low coverage assembly, a low upper-limit was placed on sequence coverage and a high lower-limit on the quality of the discrepant bases at a potential variant site. In all domestic cats of different breeds: female Abyssinian, female American shorthair, male Cornish Rex, female European Burmese, female Persian, female Siamese, a male Ragdoll and a female African wildcat were sequenced lightly. We report a total of 964 k common SNPs suitable for a domestic cat SNP genotyping array and an additional 900 k SNPs detected between African wildcat and domestic cats breeds. An empirical sampling of 94 discovered SNPs were tested in the sequenced cats resulting in a SNP validation rate of 99%. Conclusions These data provide a large collection of mapped feline SNPs across the cat genome that will allow for the development of SNP genotyping platforms for mapping feline diseases.

  18. Genome rearrangements detected by SNP microarrays in individuals with intellectual disability referred with possible Williams syndrome.

    Directory of Open Access Journals (Sweden)

    Ariel M Pani

    2010-08-01

    Full Text Available Intellectual disability (ID affects 2-3% of the population and may occur with or without multiple congenital anomalies (MCA or other medical conditions. Established genetic syndromes and visible chromosome abnormalities account for a substantial percentage of ID diagnoses, although for approximately 50% the molecular etiology is unknown. Individuals with features suggestive of various syndromes but lacking their associated genetic anomalies pose a formidable clinical challenge. With the advent of microarray techniques, submicroscopic genome alterations not associated with known syndromes are emerging as a significant cause of ID and MCA.High-density SNP microarrays were used to determine genome wide copy number in 42 individuals: 7 with confirmed alterations in the WS region but atypical clinical phenotypes, 31 with ID and/or MCA, and 4 controls. One individual from the first group had the most telomeric gene in the WS critical region deleted along with 2 Mb of flanking sequence. A second person had the classic WS deletion and a rearrangement on chromosome 5p within the Cri du Chat syndrome (OMIM:123450 region. Six individuals from the ID/MCA group had large rearrangements (3 deletions, 3 duplications, one of whom had a large inversion associated with a deletion that was not detected by the SNP arrays.Combining SNP microarray analyses and qPCR allowed us to clone and sequence 21 deletion breakpoints in individuals with atypical deletions in the WS region and/or ID or MCA. Comparison of these breakpoints to databases of genomic variation revealed that 52% occurred in regions harboring structural variants in the general population. For two probands the genomic alterations were flanked by segmental duplications, which frequently mediate recurrent genome rearrangements; these may represent new genomic disorders. While SNP arrays and related technologies can identify potentially pathogenic deletions and duplications, obtaining sequence information

  19. MAFsnp: A Multi-Sample Accurate and Flexible SNP Caller Using Next-Generation Sequencing Data

    Science.gov (United States)

    Hu, Jiyuan; Li, Tengfei; Xiu, Zidi; Zhang, Hong

    2015-01-01

    Most existing statistical methods developed for calling single nucleotide polymorphisms (SNPs) using next-generation sequencing (NGS) data are based on Bayesian frameworks, and there does not exist any SNP caller that produces p-values for calling SNPs in a frequentist framework. To fill in this gap, we develop a new method MAFsnp, a Multiple-sample based Accurate and Flexible algorithm for calling SNPs with NGS data. MAFsnp is based on an estimated likelihood ratio test (eLRT) statistic. In practical situation, the involved parameter is very close to the boundary of the parametric space, so the standard large sample property is not suitable to evaluate the finite-sample distribution of the eLRT statistic. Observing that the distribution of the test statistic is a mixture of zero and a continuous part, we propose to model the test statistic with a novel two-parameter mixture distribution. Once the parameters in the mixture distribution are estimated, p-values can be easily calculated for detecting SNPs, and the multiple-testing corrected p-values can be used to control false discovery rate (FDR) at any pre-specified level. With simulated data, MAFsnp is shown to have much better control of FDR than the existing SNP callers. Through the application to two real datasets, MAFsnp is also shown to outperform the existing SNP callers in terms of calling accuracy. An R package “MAFsnp” implementing the new SNP caller is freely available at http://homepage.fudan.edu.cn/zhangh/softwares/. PMID:26309201

  20. Making a chocolate chip: development and evaluation of a 6K SNP array for Theobroma cacao.

    Science.gov (United States)

    Livingstone, Donald; Royaert, Stefan; Stack, Conrad; Mockaitis, Keithanne; May, Greg; Farmer, Andrew; Saski, Christopher; Schnell, Ray; Kuhn, David; Motamayor, Juan Carlos

    2015-08-01

    Theobroma cacao, the key ingredient in chocolate production, is one of the world's most important tree fruit crops, with ∼4,000,000 metric tons produced across 50 countries. To move towards gene discovery and marker-assisted breeding in cacao, a single-nucleotide polymorphism (SNP) identification project was undertaken using RNAseq data from 16 diverse cacao cultivars. RNA sequences were aligned to the assembled transcriptome of the cultivar Matina 1-6, and 330,000 SNPs within coding regions were identified. From these SNPs, a subset of 6,000 high-quality SNPs were selected for inclusion on an Illumina Infinium SNP array: the Cacao6kSNP array. Using Cacao6KSNP array data from over 1,000 cacao samples, we demonstrate that our custom array produces a saturated genetic map and can be used to distinguish among even closely related genotypes. Our study enhances and expands the genetic resources available to the cacao research community, and provides the genome-scale set of tools that are critical for advancing breeding with molecular markers in an agricultural species with high genetic diversity. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  1. Effect of Tryptophan Hydroxylase-2 rs7305115 SNP on suicide attempts risk in major depression

    Directory of Open Access Journals (Sweden)

    Zhang Yuqi

    2010-08-01

    Full Text Available Abstract Background Suicide and major depressive disorders (MDD are strongly associated, and genetic factors are responsible for at least part of the variability in suicide risk. We investigated whether variation at the tryptophan hydroxylase-2 (TPH2 gene rs7305115 SNP may predispose to suicide attempts in MDD. Methods We genotyped TPH2 gene rs7305115 SNP in 215 MDD patients with suicide and matched MDD patients without suicide. Differences in behavioral and personality traits according to genotypic variation were investigated by logistic regression analysis. Results There were no significant differences between MDD patients with suicide and controls in genotypic (AG and GG frequencies for rs7305115 SNP, but the distribution of AA genotype differed significantly (14.4% vs. 29.3%, p p p Conclusions The study suggested that hopelessness, negative life events and family history of suicide were risk factors of attempted suicide in MDD while the TPH2 rs7305115A remained a significant protective predictor of suicide attempts.

  2. High-resolution SNP array analysis of patients with developmental disorder and normal array CGH results

    Directory of Open Access Journals (Sweden)

    Siggberg Linda

    2012-09-01

    Full Text Available Abstract Background Diagnostic analysis of patients with developmental disorders has improved over recent years largely due to the use of microarray technology. Array methods that facilitate copy number analysis have enabled the diagnosis of up to 20% more patients with previously normal karyotyping results. A substantial number of patients remain undiagnosed, however. Methods and Results Using the Genome-Wide Human SNP array 6.0, we analyzed 35 patients with a developmental disorder of unknown cause and normal array comparative genomic hybridization (array CGH results, in order to characterize previously undefined genomic aberrations. We detected no seemingly pathogenic copy number aberrations. Most of the vast amount of data produced by the array was polymorphic and non-informative. Filtering of this data, based on copy number variant (CNV population frequencies as well as phenotypically relevant genes, enabled pinpointing regions of allelic homozygosity that included candidate genes correlating to the phenotypic features in four patients, but results could not be confirmed. Conclusions In this study, the use of an ultra high-resolution SNP array did not contribute to further diagnose patients with developmental disorders of unknown cause. The statistical power of these results is limited by the small size of the patient cohort, and interpretation of these negative results can only be applied to the patients studied here. We present the results of our study and the recurrence of clustered allelic homozygosity present in this material, as detected by the SNP 6.0 array.

  3. HRM and SNaPshot as alternative forensic SNP genotyping methods.

    Science.gov (United States)

    Mehta, Bhavik; Daniel, Runa; McNevin, Dennis

    2017-09-01

    Single nucleotide polymorphisms (SNPs) have been widely used in forensics for prediction of identity, biogeographical ancestry (BGA) and externally visible characteristics (EVCs). Single base extension (SBE) assays, most notably SNaPshot® (Thermo Fisher Scientific), are commonly used for forensic SNP genotyping as they can be employed on standard instrumentation in forensic laboratories (e.g. capillary electrophoresis). High resolution melt (HRM) analysis is an alternative method and is a simple, fast, single tube assay for low throughput SNP typing. This study compares HRM and SNaPshot®. HRM produced reproducible and concordant genotypes at 500 pg, however, difficulties were encountered when genotyping SNPs with high GC content in flanking regions and differentiating variants of symmetrical SNPs. SNaPshot® was reproducible at 100 pg and is less dependent on SNP choice. HRM has a shorter processing time in comparison to SNaPshot®, avoids post PCR contamination risk and has potential as a screening tool for many forensic applications.

  4. Casein SNP in Norwegian goats: additive and dominance effects on milk composition and quality

    Science.gov (United States)

    2011-01-01

    Background The four casein proteins in goat milk are encoded by four closely linked casein loci (CSN1S1, CSN2, CSN1S2 and CSN3) within 250 kb on caprine chromosome 6. A deletion in exon 12 of CSN1S1, so far reported only in Norwegian goats, has been found at high frequency (0.73). Such a high frequency is difficult to explain because the national breeding goal selects against the variant's effect. Methods In this study, 575 goats were genotyped for 38 Single Nucleotide Polymorphisms (SNP) located within the four casein genes. Milk production records of these goats were obtained from the Norwegian Dairy Goat Control. Test-day mixed models with additive and dominance fixed effects of single SNP were fitted in a model including polygenic effects. Results Significant additive effects of single SNP within CSN1S1 and CSN3 were found for fat % and protein %, milk yield and milk taste. The allele with the deletion showed additive and dominance effects on protein % and fat %, and overdominance effects on milk quantity (kg) and lactose %. At its current frequency, the observed dominance (overdominance) effects of the deletion allele reduced its substitution effect (and additive genetic variance available for selection) in the population substantially. Conclusions The selection pressure of conventional breeding on the allele with the deletion is limited due to the observed dominance (overdominance) effects. Inclusion of molecular information in the national breeding scheme will reduce the frequency of this deletion in the population. PMID:21864407

  5. Novel approach for deriving genome wide SNP analysis data from archived blood spots

    Science.gov (United States)

    2012-01-01

    Background The ability to transport and store DNA at room temperature in low volumes has the advantage of optimising cost, time and storage space. Blood spots on adapted filter papers are popular for this, with FTA (Flinders Technology Associates) Whatman™TM technology being one of the most recent. Plant material, plasmids, viral particles, bacteria and animal blood have been stored and transported successfully using this technology, however the method of porcine DNA extraction from FTA Whatman™TM cards is a relatively new approach, allowing nucleic acids to be ready for downstream applications such as PCR, whole genome amplification, sequencing and subsequent application to single nucleotide polymorphism microarrays has hitherto been under-explored. Findings DNA was extracted from FTA Whatman™TM cards (following adaptations of the manufacturer’s instructions), whole genome amplified and subsequently analysed to validate the integrity of the DNA for downstream SNP analysis. DNA was successfully extracted from 288/288 samples and amplified by WGA. Allele dropout post WGA, was observed in less than 2% of samples and there was no clear evidence of amplification bias nor contamination. Acceptable call rates on porcine SNP chips were also achieved using DNA extracted and amplified in this way. Conclusions DNA extracted from FTA Whatman cards is of a high enough quality and quantity following whole genomic amplification to perform meaningful SNP chip studies. PMID:22974252

  6. SNP Discovery and Development of a High-Density Genotyping Array for Sunflower

    Science.gov (United States)

    Bachlava, Eleni; Taylor, Christopher A.; Tang, Shunxue; Bowers, John E.; Mandel, Jennifer R.; Burke, John M.; Knapp, Steven J.

    2012-01-01

    Recent advances in next-generation DNA sequencing technologies have made possible the development of high-throughput SNP genotyping platforms that allow for the simultaneous interrogation of thousands of single-nucleotide polymorphisms (SNPs). Such resources have the potential to facilitate the rapid development of high-density genetic maps, and to enable genome-wide association studies as well as molecular breeding approaches in a variety of taxa. Herein, we describe the development of a SNP genotyping resource for use in sunflower (Helianthus annuus L.). This work involved the development of a reference transcriptome assembly for sunflower, the discovery of thousands of high quality SNPs based on the generation and analysis of ca. 6 Gb of transcriptome re-sequencing data derived from multiple genotypes, the selection of 10,640 SNPs for inclusion in the genotyping array, and the use of the resulting array to screen a diverse panel of sunflower accessions as well as related wild species. The results of this work revealed a high frequency of polymorphic SNPs and relatively high level of cross-species transferability. Indeed, greater than 95% of successful SNP assays revealed polymorphism, and more than 90% of these assays could be successfully transferred to related wild species. Analysis of the polymorphism data revealed patterns of genetic differentiation that were largely congruent with the evolutionary history of sunflower, though the large number of markers allowed for finer resolution than has previously been possible. PMID:22238659

  7. Application of LogitBoost Classifier for Traceability Using SNP Chip Data.

    Science.gov (United States)

    Kim, Kwondo; Seo, Minseok; Kang, Hyunsung; Cho, Seoae; Kim, Heebal; Seo, Kang-Seok

    2015-01-01

    Consumer attention to food safety has increased rapidly due to animal-related diseases; therefore, it is important to identify their places of origin (POO) for safety purposes. However, only a few studies have addressed this issue and focused on machine learning-based approaches. In the present study, classification analyses were performed using a customized SNP chip for POO prediction. To accomplish this, 4,122 pigs originating from 104 farms were genotyped using the SNP chip. Several factors were considered to establish the best prediction model based on these data. We also assessed the applicability of the suggested model using a kinship coefficient-filtering approach. Our results showed that the LogitBoost-based prediction model outperformed other classifiers in terms of classification performance under most conditions. Specifically, a greater level of accuracy was observed when a higher kinship-based cutoff was employed. These results demonstrated the applicability of a machine learning-based approach using SNP chip data for practical traceability.

  8. Proper joint analysis of summary association statistics requires the adjustment of heterogeneity in SNP coverage pattern.

    Science.gov (United States)

    Zhang, Han; Wheeler, William; Song, Lei; Yu, Kai

    2017-07-07

    As meta-analysis results published by consortia of genome-wide association studies (GWASs) become increasingly available, many association summary statistics-based multi-locus tests have been developed to jointly evaluate multiple single-nucleotide polymorphisms (SNPs) to reveal novel genetic architectures of various complex traits. The validity of these approaches relies on the accurate estimate of z-score correlations at considered SNPs, which in turn requires knowledge on the set of SNPs assessed by each study participating in the meta-analysis. However, this exact SNP coverage information is usually unavailable from the meta-analysis results published by GWAS consortia. In the absence of the coverage information, researchers typically estimate the z-score correlations by making oversimplified coverage assumptions. We show through real studies that such a practice can generate highly inflated type I errors, and we demonstrate the proper way to incorporate correct coverage information into multi-locus analyses. We advocate that consortia should make SNP coverage information available when posting their meta-analysis results, and that investigators who develop analytic tools for joint analyses based on summary data should pay attention to the variation in SNP coverage and adjust for it appropriately. Published by Oxford University Press 2017. This work is written by US Government employees and is in the public domain in the US.

  9. The Brachyury Gly177Asp SNP Is not Associated with a Risk of Skull Base Chordoma in the Chinese Population

    Directory of Open Access Journals (Sweden)

    Zhen Wu

    2013-10-01

    Full Text Available A recent chordoma cancer genotyping study reveals that the rs2305089, a single nucleotide polymorphism (SNP located in brachyury gene and a key gene in the development of notochord, is significantly associated with chordoma risk. The brachyury gene is believed to be one of the key genes involved in the pathogenesis of chordoma, a rare primary bone tumor originating along the spinal column or at the base of the skull. The association between the brachyury Gly177Asp single nucleotide polymorphism (SNP and the risk of skull base chordoma in Chinese populations is currently unknown. We investigated the genotype distribution of this SNP in 65 skull-base chordoma cases and 120 healthy subjects. Comparisons of the genotype distributions and allele frequencies did not reveal any significant difference between the groups. Our data suggest that the brachyury Gly177Asp SNP is not involved in the risks of skull-base chordoma, at least in the Chinese population.

  10. Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies.

    Science.gov (United States)

    Gimode, Davis; Odeny, Damaris A; de Villiers, Etienne P; Wanyonyi, Solomon; Dida, Mathews M; Mneney, Emmarold E; Muchugi, Alice; Machuka, Jesse; de Villiers, Santie M

    2016-01-01

    Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS) technologies to develop both Simple Sequence Repeat (SSR) and Single Nucleotide Polymorphism (SNP) markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC) was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included in the regional

  11. Identification of SNP and SSR Markers in Finger Millet Using Next Generation Sequencing Technologies.

    Directory of Open Access Journals (Sweden)

    Davis Gimode

    Full Text Available Finger millet is an important cereal crop in eastern Africa and southern India with excellent grain storage quality and unique ability to thrive in extreme environmental conditions. Since negligible attention has been paid to improving this crop to date, the current study used Next Generation Sequencing (NGS technologies to develop both Simple Sequence Repeat (SSR and Single Nucleotide Polymorphism (SNP markers. Genomic DNA from cultivated finger millet genotypes KNE755 and KNE796 was sequenced using both Roche 454 and Illumina technologies. Non-organelle sequencing reads were assembled into 207 Mbp representing approximately 13% of the finger millet genome. We identified 10,327 SSRs and 23,285 non-homeologous SNPs and tested 101 of each for polymorphism across a diverse set of wild and cultivated finger millet germplasm. For the 49 polymorphic SSRs, the mean polymorphism information content (PIC was 0.42, ranging from 0.16 to 0.77. We also validated 92 SNP markers, 80 of which were polymorphic with a mean PIC of 0.29 across 30 wild and 59 cultivated accessions. Seventy-six of the 80 SNPs were polymorphic across 30 wild germplasm with a mean PIC of 0.30 while only 22 of the SNP markers showed polymorphism among the 59 cultivated accessions with an average PIC value of 0.15. Genetic diversity analysis using the polymorphic SNP markers revealed two major clusters; one of wild and another of cultivated accessions. Detailed STRUCTURE analysis confirmed this grouping pattern and further revealed 2 sub-populations within wild E. coracana subsp. africana. Both STRUCTURE and genetic diversity analysis assisted with the correct identification of the new germplasm collections. These polymorphic SSR and SNP markers are a significant addition to the existing 82 published SSRs, especially with regard to the previously reported low polymorphism levels in finger millet. Our results also reveal an unexploited finger millet genetic resource that can be included

  12. Development and validation of a high density SNP genotyping array for Atlantic salmon (Salmo salar)

    Science.gov (United States)

    2014-01-01

    Background Dense single nucleotide polymorphism (SNP) genotyping arrays provide extensive information on polymorphic variation across the genome of species of interest. Such information can be used in studies of the genetic architecture of quantitative traits and to improve the accuracy of selection in breeding programs. In Atlantic salmon (Salmo salar), these goals are currently hampered by the lack of a high-density SNP genotyping platform. Therefore, the aim of the study was to develop and test a dense Atlantic salmon SNP array. Results SNP discovery was performed using extensive deep sequencing of Reduced Representation (RR-Seq), Restriction site-Associated DNA (RAD-Seq) and mRNA (RNA-Seq) libraries derived from farmed and wild Atlantic salmon samples (n = 283) resulting in the discovery of > 400 K putative SNPs. An Affymetrix Axiom® myDesign Custom Array was created and tested on samples of animals of wild and farmed origin (n = 96) revealing a total of 132,033 polymorphic SNPs with high call rate, good cluster separation on the array and stable Mendelian inheritance in our sample. At least 38% of these SNPs are from transcribed genomic regions and therefore more likely to include functional variants. Linkage analysis utilising the lack of male recombination in salmonids allowed the mapping of 40,214 SNPs distributed across all 29 pairs of chromosomes, highlighting the extensive genome-wide coverage of the SNPs. An identity-by-state clustering analysis revealed that the array can clearly distinguish between fish of different origins, within and between farmed and wild populations. Finally, Y-chromosome-specific probes included on the array provide an accurate molecular genetic test for sex. Conclusions This manuscript describes the first high-density SNP genotyping array for Atlantic salmon. This array will be publicly available and is likely to be used as a platform for high-resolution genetics research into traits of evolutionary and economic importance in

  13. Comparison of SSR and SNP markers in estimation of genetic diversity and population structure of Indian rice varieties.

    Directory of Open Access Journals (Sweden)

    Nivedita Singh

    Full Text Available Simple sequence repeat (SSR and Single Nucleotide Polymorphic (SNP, the two most robust markers for identifying rice varieties were compared for assessment of genetic diversity and population structure. Total 375 varieties of rice from various regions of India archived at the Indian National GeneBank, NBPGR, New Delhi, were analyzed using thirty six genetic markers, each of hypervariable SSR (HvSSR and SNP which were distributed across 12 rice chromosomes. A total of 80 alleles were amplified with the SSR markers with an average of 2.22 alleles per locus whereas, 72 alleles were amplified with SNP markers. Polymorphic information content (PIC values for HvSSR ranged from 0.04 to 0.5 with an average of 0.25. In the case of SNP markers, PIC values ranged from 0.03 to 0.37 with an average of 0.23. Genetic relatedness among the varieties was studied; utilizing an unrooted tree all the genotypes were grouped into three major clusters with both SSR and SNP markers. Analysis of molecular variance (AMOVA indicated that maximum diversity was partitioned between and within individual level but not between populations. Principal coordinate analysis (PCoA with SSR markers showed that genotypes were uniformly distributed across the two axes with 13.33% of cumulative variation whereas, in case of SNP markers varieties were grouped into three broad groups across two axes with 45.20% of cumulative variation. Population structure were tested using K values from 1 to 20, but there was no clear population structure, therefore Ln(PD derived Δk was plotted against the K to determine the number of populations. In case of SSR maximum Δk was at K=5 whereas, in case of SNP maximum Δk was found at K=15, suggesting that resolution of population was higher with SNP markers, but SSR were more efficient for diversity analysis.

  14. Forensic typing of autosomal SNPs with a 29 SNP-multiplex--results of a collaborative EDNAP exercise.

    Science.gov (United States)

    Sanchez, J J; Børsting, C; Balogh, K; Berger, B; Bogus, M; Butler, J M; Carracedo, A; Court, D Syndercombe; Dixon, L A; Filipović, B; Fondevila, M; Gill, P; Harrison, C D; Hohoff, C; Huel, R; Ludes, B; Parson, W; Parsons, T J; Petkovski, E; Phillips, C; Schmitter, H; Schneider, P M; Vallone, P M; Morling, N

    2008-06-01

    We report the results of an inter-laboratory exercise on typing of autosomal single nucleotide polymorphisms (SNP) for forensic genetic investigations in crime cases. The European DNA Profiling Group (EDNAP), a working group under the International Society for Forensic Genetics (ISFG), organised the exercise. A total of 11 European and one US forensic genetic laboratories tested a subset of a 52 SNP-multiplex PCR kit developed by the SNPforID consortium. The 52 SNP-multiplex kit amplifies 52 DNA fragments with 52 autosomal SNP loci in one multiplex PCR. The 52 SNPs are detected in two separate single base extension (SBE) multiplex reactions with 29 and 23 SNPs, respectively, using SNaPshot kit, capillary electrophoresis and multicolour fluorescence detection. For practical reasons, only the 29 SBE multiplex reaction was carried out by the participating laboratories. A total of 11 bloodstains on FTA cards including a sample of poor quality and a negative control were sent to the laboratories together with the essential reagents for the initial multiplex PCR and the multiplex SBE reaction. The total SNP locus dropout rate was 2.8% and more than 50% of the dropouts were observed with the poor quality sample. The overall rate of discrepant SNP allele assignments was 2.0%. Two laboratories reported 60% of all the discrepancies. Two laboratories reported all 29 SNP alleles in all 10 positive samples correctly. The results of the collaborative exercise were surprisingly good and demonstrate that SNP typing with SBE, capillary electrophoresis and multicolour detection methods can be developed for forensic genetics.

  15. Comparison of SSR and SNP markers in estimation of genetic diversity and population structure of Indian rice varieties.

    Science.gov (United States)

    Singh, Nivedita; Choudhury, Debjani Roy; Singh, Amit Kumar; Kumar, Sundeep; Srinivasan, Kalyani; Tyagi, R K; Singh, N K; Singh, Rakesh

    2013-01-01

    Simple sequence repeat (SSR) and Single Nucleotide Polymorphic (SNP), the two most robust markers for identifying rice varieties were compared for assessment of genetic diversity and population structure. Total 375 varieties of rice from various regions of India archived at the Indian National GeneBank, NBPGR, New Delhi, were analyzed using thirty six genetic markers, each of hypervariable SSR (HvSSR) and SNP which were distributed across 12 rice chromosomes. A total of 80 alleles were amplified with the SSR markers with an average of 2.22 alleles per locus whereas, 72 alleles were amplified with SNP markers. Polymorphic information content (PIC) values for HvSSR ranged from 0.04 to 0.5 with an average of 0.25. In the case of SNP markers, PIC values ranged from 0.03 to 0.37 with an average of 0.23. Genetic relatedness among the varieties was studied; utilizing an unrooted tree all the genotypes were grouped into three major clusters with both SSR and SNP markers. Analysis of molecular variance (AMOVA) indicated that maximum diversity was partitioned between and within individual level but not between populations. Principal coordinate analysis (PCoA) with SSR markers showed that genotypes were uniformly distributed across the two axes with 13.33% of cumulative variation whereas, in case of SNP markers varieties were grouped into three broad groups across two axes with 45.20% of cumulative variation. Population structure were tested using K values from 1 to 20, but there was no clear population structure, therefore Ln(PD) derived Δk was plotted against the K to determine the number of populations. In case of SSR maximum Δk was at K=5 whereas, in case of SNP maximum Δk was found at K=15, suggesting that resolution of population was higher with SNP markers, but SSR were more efficient for diversity analysis.

  16. MDM2 SNP309, gene-gene interaction, and tumor susceptibility: an updated meta-analysis

    Directory of Open Access Journals (Sweden)

    Wu Wei

    2011-05-01

    Full Text Available Abstract Background The tumor suppressor gene p53 is involved in multiple cellular pathways including apoptosis, transcriptional control, and cell cycle regulation. In the last decade it has been demonstrated that the single nucleotide polymorphism (SNP at codon 72 of the p53 gene is associated with the risk for development of various neoplasms. MDM2 SNP309 is a single nucleotide T to G polymorphism located in the MDM2 gene promoter. From the time that this well-characterized functional polymorphism was identified, a variety of case-control studies have been published that investigate the possible association between MDM2 SNP309 and cancer risk. However, the results of the published studies, as well as the subsequent meta-analyses, remain contradictory. Methods To investigate whether currently published epidemiological studies can clarify the potential interaction between MDM2 SNP309 and the functional genetic variant in p53 codon72 (Arg72Pro and p53 mutation status, we performed a meta-analysis of the risk estimate on 27,813 cases with various tumor types and 30,295 controls. Results The data we reviewed indicated that variant homozygote 309GG and heterozygote 309TG were associated with a significant increased risk of all tumor types (homozygote comparison: odds ratio (OR = 1.25, 95% confidence interval (CI = 1.13-1.37; heterozygote comparison: OR = 1.10, 95% CI = 1.03-1.17. We also found that the combination of GG and Pro/Pro, TG and Pro/Pro, GG and Arg/Arg significantly increased the risk of cancer (OR = 3.38, 95% CI = 1.77-6.47; OR = 1.88, 95% CI = 1.26-2.81; OR = 1.96, 95% CI = 1.01-3.78, respectively. In a stratified analysis by tumor location, we also found a significant increased risk in brain, liver, stomach and uterus cancer (OR = 1.47, 95% CI = 1.06-2.03; OR = 2.24, 95%CI = 1.57-3.18; OR = 1.54, 95%CI = 1.04-2.29; OR = 1.34, 95%CI = 1.07-1.29, respectively. However, no association was seen between MDM2 SNP309 and tumor susceptibility

  17. Supplementing High-Density SNP Microarrays for Additional Coverage of Disease-Related Genes: Addiction as a Paradigm

    Energy Technology Data Exchange (ETDEWEB)

    SacconePhD, Scott F [Washington University, St. Louis; Chesler, Elissa J [ORNL; Bierut, Laura J [Washington University, St. Louis; Kalivas, Peter J [Medical College of South Carolina, Charleston; Lerman, Caryn [University of Pennsylvania; Saccone, Nancy L [Washington University, St. Louis; Uhl, George R [Johns Hopkins University; Li, Chuan-Yun [Peking University; Philip, Vivek M [ORNL; Edenberg, Howard [Indiana University; Sherry, Steven [National Center for Biotechnology Information; Feolo, Michael [National Center for Biotechnology Information; Moyzis, Robert K [Johns Hopkins University; Rutter, Joni L [National Institute of Drug Abuse

    2009-01-01

    Commercial SNP microarrays now provide comprehensive and affordable coverage of the human genome. However, some diseases have biologically relevant genomic regions that may require additional coverage. Addiction, for example, is thought to be influenced by complex interactions among many relevant genes and pathways. We have assembled a list of 486 biologically relevant genes nominated by a panel of experts on addiction. We then added 424 genes that showed evidence of association with addiction phenotypes through mouse QTL mappings and gene co-expression analysis. We demonstrate that there are a substantial number of SNPs in these genes that are not well represented by commercial SNP platforms. We address this problem by introducing a publicly available SNP database for addiction. The database is annotated using numeric prioritization scores indicating the extent of biological relevance. The scores incorporate a number of factors such as SNP/gene functional properties (including synonymy and promoter regions), data from mouse systems genetics and measures of human/mouse evolutionary conservation. We then used HapMap genotyping data to determine if a SNP is tagged by a commercial microarray through linkage disequilibrium. This combination of biological prioritization scores and LD tagging annotation will enable addiction researchers to supplement commercial SNP microarrays to ensure comprehensive coverage of biologically relevant regions.

  18. Complex nature of SNP genotype effects on gene expression in primary human leucocytes

    Directory of Open Access Journals (Sweden)

    Dinesen Lotte C

    2009-01-01

    Full Text Available Abstract Background Genome wide association studies have been hugely successful in identifying disease risk variants, yet most variants do not lead to coding changes and how variants influence biological function is usually unknown. Methods We correlated gene expression and genetic variation in untouched primary leucocytes (n = 110 from individuals with celiac disease – a common condition with multiple risk variants identified. We compared our observations with an EBV-transformed HapMap B cell line dataset (n = 90, and performed a meta-analysis to increase power to detect non-tissue specific effects. Results In celiac peripheral blood, 2,315 SNP variants influenced gene expression at 765 different transcripts (cis expression quantitative trait loci, eQTLs. 135 of the detected SNP-probe effects (reflecting 51 unique probes were also detected in a HapMap B cell line published dataset, all with effects in the same allelic direction. Overall gene expression differences within the two datasets predominantly explain the limited overlap in observed cis-eQTLs. Celiac associated risk variants from two regions, containing genes IL18RAP and CCR3, showed significant cis genotype-expression correlations in the peripheral blood but not in the B cell line datasets. We identified 14 genes where a SNP affected the expression of different probes within the same gene, but in opposite allelic directions. By incorporating genetic variation in co-expression analyses, functional relationships between genes can be more significantly detected. Conclusion In conclusion, the complex nature of genotypic effects in human populations makes the use of a relevant tissue, large datasets, and analysis of different exons essential to enable the identification of the function for many genetic risk variants in common diseases.

  19. Solar Radiation-Associated Adaptive SNP Genetic Differentiation in Wild Emmer Wheat, Triticum dicoccoides.

    Science.gov (United States)

    Ren, Jing; Chen, Liang; Jin, Xiaoli; Zhang, Miaomiao; You, Frank M; Wang, Jirui; Frenkel, Vladimir; Yin, Xuegui; Nevo, Eviatar; Sun, Dongfa; Luo, Ming-Cheng; Peng, Junhua

    2017-01-01

    Whole-genome scans with large number of genetic markers provide the opportunity to investigate local adaptation in natural populations and identify candidate genes under positive selection. In the present study, adaptation genetic differentiation associated with solar radiation was investigated using 695 polymorphic SNP markers in wild emmer wheat originated in a micro-site at Yehudiyya, Israel. The test involved two solar radiation niches: (1) sun, in-between trees; and (2) shade, under tree canopy, separated apart by a distance of 2-4 m. Analysis of molecular variance showed a small (0.53%) but significant portion of overall variation between the sun and shade micro-niches, indicating a non-ignorable genetic differentiation between sun and shade habitats. Fifty SNP markers showed a medium (0.05 ≤ F ST ≤ 0.15) or high genetic differentiation ( F ST > 0.15). A total of 21 outlier loci under positive selection were identified by using four different F ST -outlier testing algorithms. The markers and genome locations under positive selection are consistent with the known patterns of selection. These results suggested that genetic differentiation between sun and shade habitats is substantial, radiation-associated, and therefore ecologically determined. Hence, the results of this study reflected effects of natural selection through solar radiation on EST-related SNP genetic diversity, resulting presumably in different adaptive complexes at a micro-scale divergence. The present work highlights the evolutionary theory and application significance of solar radiation-driven natural selection in wheat improvement.

  20. A general SNP-based molecular barcode for Plasmodium falciparum identification and tracking

    Directory of Open Access Journals (Sweden)

    Rosen David

    2008-10-01

    Full Text Available Abstract Background Single nucleotide polymorphism (SNP genotyping provides the means to develop a practical, rapid, inexpensive assay that will uniquely identify any Plasmodium falciparum parasite using a small amount of DNA. Such an assay could be used to distinguish recrudescence from re-infection in drug trials, to monitor the frequency and distribution of specific parasites in a patient population undergoing drug treatment or vaccine challenge, or for tracking samples and determining purity of isolates in the laboratory during culture adaptation and sub-cloning, as well as routine passage. Methods A panel of twenty-four SNP markers has been identified that exhibit a high minor allele frequency (average MAF > 35%, for which robust TaqMan genotyping assays were constructed. All SNPs were identified through whole genome sequencing and MAF was estimated through Affymetrix array-based genotyping of a worldwide collection of parasites. These assays create a "molecular barcode" to uniquely identify a parasite genome. Results Using 24 such markers no two parasites known to be of independent origin have yet been found to have the same allele signature. The TaqMan genotyping assays can be performed on a variety of samples including cultured parasites, frozen whole blood, or whole blood spotted onto filter paper with a success rate > 99%. Less than 5 ng of parasite DNA is needed to complete a panel of 24 markers. The ability of this SNP panel to detect and identify parasites was compared to the standard molecular methods, MSP-1 and MSP-2 typing. Conclusion This work provides a facile field-deployable genotyping tool that can be used without special skills with standard lab equipment, and at reasonable cost that will unambiguously identify and track P. falciparum parasites both from patient samples and in the laboratory.

  1. SNP-associations and phenotype predictions from hundreds of microbial genomes without genome alignments.

    Science.gov (United States)

    Hall, Barry G

    2014-01-01

    SNP-association studies are a starting point for identifying genes that may be responsible for specific phenotypes, such as disease traits. The vast bulk of tools for SNP-association studies are directed toward SNPs in the human genome, and I am unaware of any tools designed specifically for such studies in bacterial or viral genomes. The PPFS (Predict Phenotypes From SNPs) package described here is an add-on to kSNP , a program that can identify SNPs in a data set of hundreds of microbial genomes. PPFS identifies those SNPs that are non-randomly associated with a phenotype based on the χ² probability, then uses those diagnostic SNPs for two distinct, but related, purposes: (1) to predict the phenotypes of strains whose phenotypes are unknown, and (2) to identify those diagnostic SNPs that are most likely to be causally related to the phenotype. In the example illustrated here, from a set of 68 E. coli genomes, for 67 of which the pathogenicity phenotype was known, there were 418,500 SNPs. Using the phenotypes of 36 of those strains, PPFS identified 207 diagnostic SNPs. The diagnostic SNPs predicted the phenotypes of all of the genomes with 97% accuracy. It then identified 97 SNPs whose probability of being causally related to the pathogenic phenotype was >0.999. In a second example, from a set of 116 E. coli genome sequences, using the phenotypes of 65 strains PPFS identified 101 SNPs that predicted the source host (human or non-human) with 90% accuracy.

  2. Comparison of SNP Variation and Distribution in Indigenous Ethiopian and Korean Cattle (Hanwoo Populations

    Directory of Open Access Journals (Sweden)

    Zewdu Edea

    2012-09-01

    Full Text Available Although a large number of single nucleotide polymorphisms (SNPs have been identified from the bovine genome-sequencing project, few of these have been validated at large in Bos indicus breeds. We have genotyped 192 animals, representing 5 cattle populations of Ethiopia, with the Illumina Bovine 8K SNP BeadChip. These include 1 Sanga (Danakil, 3 zebu (Borana, Arsi and Ambo, and 1 zebu × Sanga intermediate (Horro breeds. The Hanwoo (Bos taurus was included for comparison purposes. Analysis of 7,045 SNP markers revealed that the mean minor allele frequency (MAF was 0.23, 0.22, 0.21, 0.21, 0.23, and 0.29 for Ambo, Arsi, Borana, Danakil, Horro, and Hanwoo, respectively. Significant differences of MAF were observed between the indigenous Ethiopian cattle populations and Hanwoo breed (p < 0.001. Across the Ethiopian cattle populations, a common variant MAF (≥0.10 and ≤0.5 accounted for an overall estimated 73.79% of the 7,045 SNPs. The Hanwoo displayed a higher proportion of common variant SNPs (90%. Investigation within Ethiopian cattle populations showed that on average, 16.64% of the markers were monomorphic, but in the Hanwoo breed, only 6% of the markers were monomorphic. Across the sampled Ethiopian cattle populations, the mean observed and expected heterozygosities were 0.314 and 0.313, respectively. The level of SNP variation identified in this particular study highlights that these markers can be potentially used for genetic studies in African cattle breeds.

  3. Construction and evaluation of a high-density SNP array for the Pacific oyster (Crassostrea gigas.

    Directory of Open Access Journals (Sweden)

    Haigang Qi

    Full Text Available Single nucleotide polymorphisms (SNPs are widely used in genetics and genomics research. The Pacific oyster (Crassostrea gigas is an economically and ecologically important marine bivalve, and it possesses one of the highest levels of genomic DNA variation among animal species. Pacific oyster SNPs have been extensively investigated; however, the mechanisms by which these SNPs may be used in a high-throughput, transferable, and economical manner remain to be elucidated. Here, we constructed an oyster 190K SNP array using Affymetrix Axiom genotyping technology. We designed 190,420 SNPs on the chip; these SNPs were selected from 54 million SNPs identified through re-sequencing of 472 Pacific oysters collected in China, Japan, Korea, and Canada. Our genotyping results indicated that 133,984 (70.4% SNPs were polymorphic and successfully converted on the chip. The SNPs were distributed evenly throughout the oyster genome, located in 3,595 scaffolds with a length of ~509.4 million; the average interval spacing was 4,210 bp. In addition, 111,158 SNPs were distributed in 21,050 coding genes, with an average of 5.3 SNPs per gene. In comparison with genotypes obtained through re-sequencing, ~69% of the converted SNPs had a concordance rate of >0.971; the mean concordance rate was 0.966. Evaluation based on genotypes of full-sib family individuals revealed that the average genotyping accuracy rate was 0.975. Carrying 133 K polymorphic SNPs, our oyster 190K SNP array is the first commercially available high-density SNP chip for mollusks, with the highest throughput. It represents a valuable tool for oyster genome-wide association studies, fine linkage mapping, and population genetics.

  4. Statistical power to detect genetic (covariance of complex traits using SNP data in unrelated samples.

    Directory of Open Access Journals (Sweden)

    Peter M Visscher

    2014-04-01

    Full Text Available We have recently developed analysis methods (GREML to estimate the genetic variance of a complex trait/disease and the genetic correlation between two complex traits/diseases using genome-wide single nucleotide polymorphism (SNP data in unrelated individuals. Here we use analytical derivations and simulations to quantify the sampling variance of the estimate of the proportion of phenotypic variance captured by all SNPs for quantitative traits and case-control studies. We also derive the approximate sampling variance of the estimate of a genetic correlation in a bivariate analysis, when two complex traits are either measured on the same or different individuals. We show that the sampling variance is inversely proportional to the number of pairwise contrasts in the analysis and to the variance in SNP-derived genetic relationships. For bivariate analysis, the sampling variance of the genetic correlation additionally depends on the harmonic mean of the proportion of variance explained by the SNPs for the two traits and the genetic correlation between the traits, and depends on the phenotypic correlation when the traits are measured on the same individuals. We provide an online tool for calculating the power of detecting genetic (covariation using genome-wide SNP data. The new theory and online tool will be helpful to plan experimental designs to estimate the missing heritability that has not yet been fully revealed through genome-wide association studies, and to estimate the genetic overlap between complex traits (diseases in particular when the traits (diseases are not measured on the same samples.

  5. High-density SNP assay development for genetic analysis in maritime pine (Pinus pinaster).

    Science.gov (United States)

    Plomion, C; Bartholomé, J; Lesur, I; Boury, C; Rodríguez-Quilón, I; Lagraulet, H; Ehrenmann, F; Bouffier, L; Gion, J M; Grivet, D; de Miguel, M; de María, N; Cervera, M T; Bagnoli, F; Isik, F; Vendramin, G G; González-Martínez, S C

    2016-03-01

    Maritime pine provides essential ecosystem services in the south-western Mediterranean basin, where it covers around 4 million ha. Its scattered distribution over a range of environmental conditions makes it an ideal forest tree species for studies of local adaptation and evolutionary responses to climatic change. Highly multiplexed single nucleotide polymorphism (SNP) genotyping arrays are increasingly used to study genetic variation in living organisms and for practical applications in plant and animal breeding and genetic resource conservation. We developed a 9k Illumina Infinium SNP array and genotyped maritime pine trees from (i) a three-generation inbred (F2) pedigree, (ii) the French breeding population and (iii) natural populations from Portugal and the French Atlantic coast. A large proportion of the exploitable SNPs (2052/8410, i.e. 24.4%) segregated in the mapping population and could be mapped, providing the densest ever gene-based linkage map for this species. Based on 5016 SNPs, natural and breeding populations from the French gene pool exhibited similar level of genetic diversity. Population genetics and structure analyses based on 3981 SNP markers common to the Portuguese and French gene pools revealed high levels of differentiation, leading to the identification of a set of highly differentiated SNPs that could be used for seed provenance certification. Finally, we discuss how the validated SNPs could facilitate the identification of ecologically and economically relevant genes in this species, improving our understanding of the demography and selective forces shaping its natural genetic diversity, and providing support for new breeding strategies. © 2015 John Wiley & Sons Ltd.

  6. PredictSNP: robust and accurate consensus classifier for prediction of disease-related mutations.

    Directory of Open Access Journals (Sweden)

    Jaroslav Bendl

    2014-01-01

    Full Text Available Single nucleotide variants represent a prevalent form of genetic variation. Mutations in the coding regions are frequently associated with the development of various genetic diseases. Computational tools for the prediction of the effects of mutations on protein function are very important for analysis of single nucleotide variants and their prioritization for experimental characterization. Many computational tools are already widely employed for this purpose. Unfortunately, their comparison and further improvement is hindered by large overlaps between the training datasets and benchmark datasets, which lead to biased and overly optimistic reported performances. In this study, we have constructed three independent datasets by removing all duplicities, inconsistencies and mutations previously used in the training of evaluated tools. The benchmark dataset containing over 43,000 mutations was employed for the unbiased evaluation of eight established prediction tools: MAPP, nsSNPAnalyzer, PANTHER, PhD-SNP, PolyPhen-1, PolyPhen-2, SIFT and SNAP. The six best performing tools were combined into a consensus classifier PredictSNP, resulting into significantly improved prediction performance, and at the same time returned results for all mutations, confirming that consensus prediction represents an accurate and robust alternative to the predictions delivered by individual tools. A user-friendly web interface enables easy access to all eight prediction tools, the consensus classifier PredictSNP and annotations from the Protein Mutant Database and the UniProt database. The web server and the datasets are freely available to the academic community at http://loschmidt.chemi.muni.cz/predictsnp.

  7. Development and evaluation of the first high-throughput SNP array for common carp (Cyprinus carpio).

    Science.gov (United States)

    Xu, Jian; Zhao, Zixia; Zhang, Xiaofeng; Zheng, Xianhu; Li, Jiongtang; Jiang, Yanliang; Kuang, Youyi; Zhang, Yan; Feng, Jianxin; Li, Chuangju; Yu, Juhua; Li, Qiang; Zhu, Yuanyuan; Liu, Yuanyuan; Xu, Peng; Sun, Xiaowen

    2014-04-24

    A large number of single nucleotide polymorphisms (SNPs) have been identified in common carp (Cyprinus carpio) but, as yet, no high-throughput genotyping platform is available for this species. C. carpio is an important aquaculture species that accounts for nearly 14% of freshwater aquaculture production worldwide. We have developed an array for C. carpio with 250,000 SNPs and evaluated its performance using samples from various strains of C. carpio. The SNPs used on the array were selected from two resources: the transcribed sequences from RNA-seq data of four strains of C. carpio, and the genome re-sequencing data of five strains of C. carpio. The 250,000 SNPs on the resulting array are distributed evenly across the reference C.carpio genome with an average spacing of 6.6 kb. To evaluate the SNP array, 1,072 C. carpio samples were collected and tested. Of the 250,000 SNPs on the array, 185,150 (74.06%) were found to be polymorphic sites. Genotyping accuracy was checked using genotyping data from a group of full-siblings and their parents, and over 99.8% of the qualified SNPs were found to be reliable. Analysis of the linkage disequilibrium on all samples and on three domestic C.carpio strains revealed that the latter had the longer haplotype blocks. We also evaluated our SNP array on 80 samples from eight species related to C. carpio, with from 53,526 to 71,984 polymorphic SNPs. An identity by state analysis divided all the samples into three clusters; most of the C. carpio strains formed the largest cluster. The Carp SNP array described here is the first high-throughput genotyping platform for C. carpio. Our evaluation of this array indicates that it will be valuable for farmed carp and for genetic and population biology studies in C. carpio and related species.

  8. Role of an SNP in Alternative Splicing of Bovine NCF4 and Mastitis Susceptibility.

    Directory of Open Access Journals (Sweden)

    Zhihua Ju

    Full Text Available Neutrophil cytosolic factor 4 (NCF4 is component of the nicotinamide dinucleotide phosphate oxidase complex, a key factor in biochemical pathways and innate immune responses. In this study, splice variants and functional single-nucleotide polymorphism (SNP of NCF4 were identified to determine the variability and association of the gene with susceptibility to bovine mastitis characterized by inflammation. A novel splice variant, designated as NCF4-TV and characterized by the retention of a 48 bp sequence in intron 9, was detected in the mammary gland tissues of infected cows. The expression of the NCF4-reference main transcript in the mastitic mammary tissues was higher than that in normal tissues. A novel SNP, g.18174 A>G, was also found in the retained 48 bp region of intron 9. To determine whether NCF4-TV could be due to the g.18174 A>G mutation, we constructed two mini-gene expression vectors with the wild-type or mutant NCF4 g.18174 A>G fragment. The vectors were then transiently transfected into 293T cells, and alternative splicing of NCF4 was analyzed by reverse transcription-PCR and sequencing. Mini-gene splicing assay demonstrated that the aberrantly spliced NCF4-TV with 48 bp retained fragment in intron 9 could be due to g.18174 A>G, which was associated with milk somatic count score and increased risk of mastitis infection in cows. NCF4 expression was also regulated by alternative splicing. This study proposes that NCF4 splice variants generated by functional SNP are important risk factors for mastitis susceptibility in dairy cows.

  9. Influence of the MDM2 single nucleotide polymorphism SNP309 on tumour development in BRCA1 mutation carriers

    Directory of Open Access Journals (Sweden)

    Johnson Peter W

    2006-03-01

    Full Text Available Abstract Background The MDM2 gene encodes a negative regulator of the p53 tumour suppressor protein. A single nucleotide polymorphism (SNP in the MDM2 promoter (a T to G exchange at nucleotide 309 has been reported to produce accelerated tumour formation in individuals with inherited p53 mutations. We have investigated the effect of the MDM2 SNP309 on clinical outcome in a cohort of patients with germline mutations of BRCA1. Methods Genomic DNA was obtained for 102 healthy controls and 116 patients with established pathogenic mutations of BRCA1 and Pyrosequencing technology™ was used to determine the genotype at the MDM2 SNP309 locus. Results The polymorphism was present in 52.9% of the controls (G/T in 37.3% and G/G in 15.6% and 58.6% of the BRCA1 mutation carriers (47.4% G/T and 11.2% G/G. Incidence of malignancy in female BRCA1 carriers was not significantly higher in SNP309 carriers than in wildtype (T/T individuals (72.7% vs. 75.6%, p = 1.00. Mean age of diagnosis of first breast cancer was 41.2 years in the SNP309 G/G genotype carriers, 38.6 years in those with the SNP309 G/T genotype and 39.0 years in wildtype subjects (p = 0.80. Conclusion We found no evidence that the MDM2 SNP309 accelerates tumour development in carriers of known pathogenic germline mutations of BRCA1.

  10. Clonal diversity analysis using SNP microarray: a new prognostic tool for chronic lymphocytic leukemia.

    Science.gov (United States)

    Zhang, Linsheng; Znoyko, Iya; Costa, Luciano J; Conlin, Laura K; Daber, Robert D; Self, Sally E; Wolff, Daynna J

    2011-12-01

    Chronic lymphocytic leukemia (CLL) is a clinically heterogeneous disease. The methods currently used for monitoring CLL and determining conditions for treatment are limited in their ability to predict disease progression, patient survival, and response to therapy. Although clonal diversity and the acquisition of new chromosomal abnormalities during the disease course (clonal evolution) have been associated with disease progression, their prognostic potential has been underappreciated because cytogenetic and fluorescence in situ hybridization (FISH) studies have a restricted ability to detect genomic abnormalities and clonal evolution. We hypothesized that whole genome analysis using high resolution single nucleotide polymorphism (SNP) microarrays would be useful to detect diversity and infer clonal evolution to offer prognostic information. In this study, we used the Infinium Omni1 BeadChip (Illumina, San Diego, CA) array for the analysis of genetic variation and percent mosaicism in 25 non-selected CLL patients to explore the prognostic value of the assessment of clonal diversity in patients with CLL. We calculated the percentage of mosaicism for each abnormality by applying a mathematical algorithm to the genotype frequency data and by manual determination using the Simulated DNA Copy Number (SiDCoN) tool, which was developed from a computer model of mosaicism. At least one genetic abnormality was identified in each case, and the SNP data was 98% concordant with FISH results. Clonal diversity, defined as the presence of two or more genetic abnormalities with differing percentages of mosaicism, was observed in 12 patients (48%), and the diversity correlated with the disease stage. Clonal diversity was present in most cases of advanced disease (Rai stages III and IV) or those with previous treatment, whereas 9 of 13 patients without detected clonal diversity were asymptomatic or clinically stable. In conclusion, SNP microarray studies with simultaneous evaluation

  11. A mitochondrial DNA SNP multiplex assigning Caucasians into 36 haplo- and subhaplogroups

    DEFF Research Database (Denmark)

    Mikkelsen, Martin; Rockenbauer, Eszter; Sørensen, Erik

    2008-01-01

    Mitochondrial DNA (mtDNA) is maternally inherited without recombination events and has a high copy number, which makes mtDNA analysis feasible even when genomic DNA is sparse or degraded. Here, we present a SNP typing assay with 33 previously described mtDNA coding region SNPs for haplogroup...... previously typed by sequencing of the mitochondrial HV1 and HV2 regions. Haplogroup assignments based on mtDNA coding region SNPs and sequencing of HV1 and HV2 regions gave identical results for 27% of the samples, and except for one sample, differences in haplogroup assignments were at the subhaplogroup...

  12. mrsFAST-Ultra: a compact, SNP-aware mapper for high performance sequencing applications.

    Science.gov (United States)

    Hach, Faraz; Sarrafi, Iman; Hormozdiari, Farhad; Alkan, Can; Eichler, Evan E; Sahinalp, S Cenk

    2014-07-01

    High throughput sequencing (HTS) platforms generate unprecedented amounts of data that introduce challenges for processing and downstream analysis. While tools that report the 'best' mapping location of each read provide a fast way to process HTS data, they are not suitable for many types of downstream analysis such as structural variation detection, where it is important to report multiple mapping loci for each read. For this purpose we introduce mrsFAST-Ultra, a fast, cache oblivious, SNP-aware aligner that can handle the multi-mapping of HTS reads very efficiently. mrsFAST-Ultra improves mrsFAST, our first cache oblivious read aligner capable of handling multi-mapping reads, through new and compact index structures that reduce not only the overall memory usage but also the number of CPU operations per alignment. In fact the size of the index generated by mrsFAST-Ultra is 10 times smaller than that of mrsFAST. As importantly, mrsFAST-Ultra introduces new features such as being able to (i) obtain the best mapping loci for each read, and (ii) return all reads that have at most n mapping loci (within an error threshold), together with these loci, for any user specified n. Furthermore, mrsFAST-Ultra is SNP-aware, i.e. it can map reads to reference genome while discounting the mismatches that occur at common SNP locations provided by db-SNP; this significantly increases the number of reads that can be mapped to the reference genome. Notice that all of the above features are implemented within the index structure and are not simple post-processing steps and thus are performed highly efficiently. Finally, mrsFAST-Ultra utilizes multiple available cores and processors and can be tuned for various memory settings. Our results show that mrsFAST-Ultra is roughly five times faster than its predecessor mrsFAST. In comparison to newly enhanced popular tools such as Bowtie2, it is more sensitive (it can report 10 times or more mappings per read) and much faster (six times or

  13. Mouse SNP Miner: an annotated database of mouse functional single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Ramensky Vasily E

    2007-01-01

    Full Text Available Abstract Background The mapping of quantitative trait loci in rat and mouse has been extremely successful in identifying chromosomal regions associated with human disease-related phenotypes. However, identifying the specific phenotype-causing DNA sequence variations within a quantitative trait locus has been much more difficult. The recent availability of genomic sequence from several mouse inbred strains (including C57BL/6J, 129X1/SvJ, 129S1/SvImJ, A/J, and DBA/2J has made it possible to catalog DNA sequence differences within a quantitative trait locus derived from crosses between these strains. However, even for well-defined quantitative trait loci ( Description To help identify functional DNA sequence variations within quantitative trait loci we have used the Ensembl annotated genome sequence to compile a database of mouse single nucleotide polymorphisms (SNPs that are predicted to cause missense, nonsense, frameshift, or splice site mutations (available at http://bioinfo.embl.it/SnpApplet/. For missense mutations we have used the PolyPhen and PANTHER algorithms to predict whether amino acid changes are likely to disrupt protein function. Conclusion We have developed a database of mouse SNPs predicted to cause missense, nonsense, frameshift, and splice-site mutations. Our analysis revealed that 20% and 14% of missense SNPs are likely to be deleterious according to PolyPhen and PANTHER, respectively, and 6% are considered deleterious by both algorithms. The database also provides gene expression and functional annotations from the Symatlas, Gene Ontology, and OMIM databases to further assess candidate phenotype-causing mutations. To demonstrate its utility, we show that Mouse SNP Miner successfully finds a previously identified candidate SNP in the taste receptor, Tas1r3, that underlies sucrose preference in the C57BL/6J strain. We also use Mouse SNP Miner to derive a list of candidate phenotype-causing mutations within a previously

  14. High-throughput SNP genotyping in the highly heterozygous genome of Eucalyptus: assay success, polymorphism and transferability across species

    Science.gov (United States)

    2011-01-01

    Background High-throughput SNP genotyping has become an essential requirement for molecular breeding and population genomics studies in plant species. Large scale SNP developments have been reported for several mainstream crops. A growing interest now exists to expand the speed and resolution of genetic analysis to outbred species with highly heterozygous genomes. When nucleotide diversity is high, a refined diagnosis of the target SNP sequence context is needed to convert queried SNPs into high-quality genotypes using the Golden Gate Genotyping Technology (GGGT). This issue becomes exacerbated when attempting to transfer SNPs across species, a scarcely explored topic in plants, and likely to become significant for population genomics and inter specific breeding applications in less domesticated and less funded plant genera. Results We have successfully developed the first set of 768 SNPs assayed by the GGGT for the highly heterozygous genome of Eucalyptus from a mixed Sanger/454 database with 1,164,695 ESTs and the preliminary 4.5X draft genome sequence for E. grandis. A systematic assessment of in silico SNP filtering requirements showed that stringent constraints on the SNP surrounding sequences have a significant impact on SNP genotyping performance and polymorphism. SNP assay success was high for the 288 SNPs selected with more rigorous in silico constraints; 93% of them provided high quality genotype calls and 71% of them were polymorphic in a diverse panel of 96 individuals of five different species. SNP reliability was high across nine Eucalyptus species belonging to three sections within subgenus Symphomyrtus and still satisfactory across species of two additional subgenera, although polymorphism declined as phylogenetic distance increased. Conclusions This study indicates that the GGGT performs well both within and across species of Eucalyptus notwithstanding its nucleotide diversity ≥2%. The development of a much larger array of informative SNPs across

  15. Prediction of disease causing non-synonymous SNPs by the Artificial Neural Network Predictor NetDiseaseSNP.

    Directory of Open Access Journals (Sweden)

    Morten Bo Johansen

    Full Text Available We have developed a sequence conservation-based artificial neural network predictor called NetDiseaseSNP which classifies nsSNPs as disease-causing or neutral. Our method uses the excellent alignment generation algorithm of SIFT to identify related sequences and a combination of 31 features assessing sequence conservation and the predicted surface accessibility to produce a single score which can be used to rank nsSNPs based on their potential to cause disease. NetDiseaseSNP classifies successfully disease-causing and neutral mutations. In addition, we show that NetDiseaseSNP discriminates cancer driver and passenger mutations satisfactorily. Our method outperforms other state-of-the-art methods on several disease/neutral datasets as well as on cancer driver/passenger mutation datasets and can thus be used to pinpoint and prioritize plausible disease candidates among nsSNPs for further investigation. NetDiseaseSNP is publicly available as an online tool as well as a web service: http://www.cbs.dtu.dk/services/NetDiseaseSNP.

  16. Use of Sequenom sample ID Plus® SNP genotyping in identification of FFPE tumor samples.

    Directory of Open Access Journals (Sweden)

    Jessica K Miller

    Full Text Available Short tandem repeat (STR analysis, such as the AmpFlSTR® Identifiler® Plus kit, is a standard, PCR-based human genotyping method used in the field of forensics. Misidentification of cell line and tissue DNA can be costly if not detected early; therefore it is necessary to have quality control measures such as STR profiling in place. A major issue in large-scale research studies involving archival formalin-fixed paraffin embedded (FFPE tissues is that varying levels of DNA degradation can result in failure to correctly identify samples using STR genotyping. PCR amplification of STRs of several hundred base pairs is not always possible when DNA is degraded. The Sample ID Plus® panel from Sequenom allows for human DNA identification and authentication using SNP genotyping. In comparison to lengthy STR amplicons, this multiplexing PCR assay requires amplification of only 76-139 base pairs, and utilizes 47 SNPs to discriminate between individual samples. In this study, we evaluated both STR and SNP genotyping methods of sample identification, with a focus on paired FFPE tumor/normal DNA samples intended for next-generation sequencing (NGS. The ability to successfully validate the identity of FFPE samples can enable cost savings by reducing rework.

  17. [C677T-SNP of methylenetetrahydrofolate reductase gene and breast cancer in Mexican women].

    Science.gov (United States)

    Calderón-Garcidueñas, Ana Laura; Cerda-Flores, Ricardo Martín; Castruita-Ávila, Ana Lilia; González-Guerrero, Juan Francisco; Barrera-Saldaña, Hugo Alberto

    2017-01-01

    Low-penetrance susceptibility genes such as 5,10-methylenetetrahydrofolate reductase gene (MTHFR) have been considered in the progression of breast cancer (BC). Cancer is a result of genetic, environmental and epigenetic interactions; therefore, these genes should be studied in environmental context, because the results can vary between populations and even within the same country. The objective was to analyze the allelic and genotypic frequencies of the MTHFR C667T SNP in Mexican Mestizo patients with BC and controls from Northeastern Mexico. 243 patients and 118 healthy women were studied. The analysis of the polymorphism was performed with a DNA microarray. Once the frequency of the polymorphism was obtained, Hardy-Weinberg equilibrium test was carried out for the genotypes. Chi square test was used to compare the distribution of frequencies. The allele frequency in patients was: C = 0.5406; T = 0.4594 and in controls C = 0.5678, T = 0.4322. Genotype in BC patients was: C / C = 29.9%, C / T = 48.3% and T / T = 21.8. The distribution in controls was: C / C = 31.4%, C / T = 50.8%, T / T = 17.8% (chi squared 0.77, p = 0.6801). Northeastern Mexican women in this study showed no association between MTFHR C667T SNP and the risk of BC. It seems that the contribution of this polymorphism to BC in Mexico varies depending on various factors, both genetic and environmental.

  18. Combining target enrichment with barcode multiplexing for high throughput SNP discovery

    Directory of Open Access Journals (Sweden)

    Lunke Sebastian

    2010-11-01

    Full Text Available Abstract Background The primary goal of genetic linkage analysis is to identify genes affecting a phenotypic trait. After localisation of the linkage region, efficient genetic dissection of the disease linked loci requires that functional variants are identified across the loci. These functional variations are difficult to detect due to extent of genetic diversity and, to date, incomplete cataloguing of the large number of variants present both within and between populations. Massively parallel sequencing platforms offer unprecedented capacity for variant discovery, however the number of samples analysed are still limited by cost per sample. Some progress has been made in reducing the cost of resequencing using either multiplexing methodologies or through the utilisation of targeted enrichment technologies which provide the ability to resequence genomic areas of interest rather that full genome sequencing. Results We developed a method that combines current multiplexing methodologies with a solution-based target enrichment method to further reduce the cost of resequencing where region-specific sequencing is required. Our multiplex/enrichment strategy produced high quality data with nominal reduction of sequencing depth. We undertook a genotyping study and were successful in the discovery of novel SNP alleles in all samples at uniplex, duplex and pentaplex levels. Conclusion Our work describes the successful combination of a targeted enrichment method and index barcode multiplexing to reduce costs, time and labour associated with processing large sample sets. Furthermore, we have shown that the sequencing depth obtained is adequate for credible SNP genotyping analysis at uniplex, duplex and pentaplex levels.

  19. Genome-wide SNP association-based localization of a dwarfism gene in Friesian dwarf horses.

    Science.gov (United States)

    Orr, N; Back, W; Gu, J; Leegwater, P; Govindarajan, P; Conroy, J; Ducro, B; Van Arendonk, J A M; MacHugh, D E; Ennis, S; Hill, E W; Brama, P A J

    2010-12-01

    The recent completion of the horse genome and commercial availability of an equine SNP genotyping array has facilitated the mapping of disease genes. We report putative localization of the gene responsible for dwarfism, a trait in Friesian horses that is thought to have a recessive mode of inheritance, to a 2-MB region of chromosome 14 using just 10 affected animals and 10 controls. We successfully genotyped 34,429 SNPs that were tested for association with dwarfism using chi-square tests. The most significant SNP in our study, BIEC2-239376 (P(2df)=4.54 × 10(-5), P(rec)=7.74 × 10(-6)), is located close to a gene implicated in human dwarfism. Fine-mapping and resequencing analyses did not aid in further localization of the causative variant, and replication of our findings in independent sample sets will be necessary to confirm these results. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.

  20. Genotyping-By-Sequencing for Plant Genetic Diversity Analysis: A Lab Guide for SNP Genotyping

    Directory of Open Access Journals (Sweden)

    Gregory W. Peterson

    2014-10-01

    Full Text Available Genotyping-by-sequencing (GBS has recently emerged as a promising genomic approach for exploring plant genetic diversity on a genome-wide scale. However, many uncertainties and challenges remain in the application of GBS, particularly in non-model species. Here, we present a GBS protocol we developed and use for plant genetic diversity analysis. It uses two restriction enzymes to reduce genome complexity, applies Illumina multiplexing indexes for barcoding and has a custom bioinformatics pipeline for genotyping. This genetic diversity-focused GBS (gd-GBS protocol can serve as an easy-to-follow lab guide to assist a researcher through every step of a GBS application with five main components: sample preparation, library assembly, sequencing, SNP calling and diversity analysis. Specifically, in this presentation, we provide a brief overview of the GBS approach, describe the gd-GBS procedures, illustrate it with an application to analyze genetic diversity in 20 flax (Linum usitatissimum L. accessions and discuss related issues in GBS application. Following these lab bench procedures and using the custom bioinformatics pipeline, one could generate genome-wide SNP genotype data for a conventional genetic diversity analysis of a non-model plant species.

  1. Catalase rs769214 SNP in elderly malnutrition and during renutrition: is glucagon to blame?

    Science.gov (United States)

    Hebert-Schuster, M; Cottart, C H; Laguillier-Morizot, C; Raynaud-Simon, A; Golmard, J L; Cynober, L; Beaudeux, J L; Fabre, E E; Nivet-Antoine, V

    2011-10-15

    Impaired glucose tolerance is common during aging. The transcription factor PAX6 is involved in glucose homeostasis. Computational promoter sequence analysis of the catalase gene highlighted a putative PAX6 binding site on the rs769214 polymorphism A allele. Creation of this binding site has been suggested to explain renutrition inefficiency in malnourished elderly patients. Our aim was to evaluate the link between the rs769214 polymorphism of the catalase gene and glucose homeostasis in malnourished elderly patients at inclusion and during renutrition. Thirty-three malnourished elderly Caucasian inpatients were recruited. Nutritional and inflammatory statuses were assessed and a multiplex adipokine analysis was conducted at inclusion and discharge from the Geriatric Nutritional Care Unit at Charles-Foix Hospital (Ivry-sur-Seine, France). Serum glucagon, PAI-1, and TNF-α levels were significantly lower in the A-allele carriers at inclusion. During renutrition, A-allele carriers exhibited increased serum glucagon, PAI-1, and TNF-α variation. After renutrition, levels of these parameters were similar for A-allele carriers and G-allele carriers. A logistic ordinal multivariate regression analysis linked only variation of glucagon to rs769214 SNP. These results support a role for catalase SNP in the efficiency of renutrition in malnourished elderly patients via the modulation of glucagon secretion, probably involving PAX6. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Diversity in 113 cowpea [Vigna unguiculata (L) Walp] accessions assessed with 458 SNP markers.

    Science.gov (United States)

    Egbadzor, Kenneth F; Ofori, Kwadwo; Yeboah, Martin; Aboagye, Lawrence M; Opoku-Agyeman, Michael O; Danquah, Eric Y; Offei, Samuel K

    2014-01-01

    Single Nucleotide Polymorphism (SNP) markers were used in characterization of 113 cowpea accessions comprising of 108 from Ghana and 5 from abroad. Leaf tissues from plants cultivated at the University of Ghana were genotyped at KBioscience in the United Kingdom. Data was generated for 477 SNPs, out of which 458 revealed polymorphism. The results were used to analyze genetic dissimilarity among the accessions using Darwin 5 software. The markers discriminated among all of the cowpea accessions and the dissimilarity values which ranged from 0.006 to 0.63 were used for factorial plot. Unexpected high levels of heterozygosity were observed on some of the accessions. Accessions known to be closely related clustered together in a dendrogram drawn with WPGMA method. A maximum length sub-tree which comprised of 48 core accessions was constructed. The software package structure was used to separate accessions into three groups, and the programme correctly identified varieties that were known hybrids. The hybrids were those accessions with numerous heterozygous loci. The structure plot showed closely related accessions with similar genome patterns. The SNP markers were more efficient in discriminating among the cowpea germplasm than morphological, seed protein polymorphism and simple sequence repeat studies reported earlier on the same collection.

  3. A genome wide survey of SNP variation reveals the genetic structure of sheep breeds.

    Directory of Open Access Journals (Sweden)

    James W Kijas

    Full Text Available The genetic structure of sheep reflects their domestication and subsequent formation into discrete breeds. Understanding genetic structure is essential for achieving genetic improvement through genome-wide association studies, genomic selection and the dissection of quantitative traits. After identifying the first genome-wide set of SNP for sheep, we report on levels of genetic variability both within and between a diverse sample of ovine populations. Then, using cluster analysis and the partitioning of genetic variation, we demonstrate sheep are characterised by weak phylogeographic structure, overlapping genetic similarity and generally low differentiation which is consistent with their short evolutionary history. The degree of population substructure was, however, sufficient to cluster individuals based on geographic origin and known breed history. Specifically, African and Asian populations clustered separately from breeds of European origin sampled from Australia, New Zealand, Europe and North America. Furthermore, we demonstrate the presence of stratification within some, but not all, ovine breeds. The results emphasize that careful documentation of genetic structure will be an essential prerequisite when mapping the genetic basis of complex traits. Furthermore, the identification of a subset of SNP able to assign individuals into broad groupings demonstrates even a small panel of markers may be suitable for applications such as traceability.

  4. Differentiation of drug and non-drug Cannabis using a single nucleotide polymorphism (SNP) assay.

    Science.gov (United States)

    Rotherham, D; Harbison, S A

    2011-04-15

    Cannabis sativa is both an illegal drug and a legitimate crop. The differentiation of illegal drug Cannabis from non-drug forms of Cannabis is relevant in the context of the growth of fibre and seed oil varieties of Cannabis for commercial purposes. This differentiation is currently determined based on the levels of tetrahydrocannabinol (THC) in adult plants. DNA based methods have the potential to assay Cannabis material unsuitable for analysis using conventional means including seeds, pollen and severely degraded material. The purpose of this research was to develop a single nucleotide polymorphism (SNP) assay for the differentiation of "drug" and "non-drug"Cannabis plants. An assay was developed based on four polymorphisms within a 399 bp fragment of the tetrahydrocannabinolic acid (THCA) synthase gene, utilising the snapshot multiplex kit. This SNP assay was tested on 94 Cannabis plants, which included 10 blind samples, and was able to differentiate between "drug" and "non-drug"Cannabis in all cases, while also differentiating between Cannabis and other species. Non-drug plants were found to be homozygous at the four sites assayed while drug Cannabis plants were either homozygous or heterozygous. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  5. Comparative analysis of core genome MLST and SNP typing within a European Salmonella serovar Enteritidis outbreak.

    Science.gov (United States)

    Pearce, Madison E; Alikhan, Nabil-Fareed; Dallman, Timothy J; Zhou, Zhemin; Grant, Kathie; Maiden, Martin C J

    2018-06-02

    Multi-country outbreaks of foodborne bacterial disease present challenges in their detection, tracking, and notification. As food is increasingly distributed across borders, such outbreaks are becoming more common. This increases the need for high-resolution, accessible, and replicable isolate typing schemes. Here we evaluate a core genome multilocus typing (cgMLST) scheme for the high-resolution reproducible typing of Salmonella enterica (S. enterica) isolates, by its application to a large European outbreak of S. enterica serovar Enteritidis. This outbreak had been extensively characterised using single nucleotide polymorphism (SNP)-based approaches. The cgMLST analysis was congruent with the original SNP-based analysis, the epidemiological data, and whole genome MLST (wgMLST) analysis. Combination of the cgMLST and epidemiological data confirmed that the genetic diversity among the isolates predated the outbreak, and was likely present at the infection source. There was consequently no link between country of isolation and genetic diversity, but the cgMLST clusters were congruent with date of isolation. Furthermore, comparison with publicly available Enteritidis isolate data demonstrated that the cgMLST scheme presented is highly scalable, enabling outbreaks to be contextualised within the Salmonella genus. The cgMLST scheme is therefore shown to be a standardised and scalable typing method, which allows Salmonella outbreaks to be analysed and compared across laboratories and jurisdictions. Copyright © 2018. Published by Elsevier B.V.

  6. Multiplex target enrichment using DNA indexing for ultra-high throughput SNP detection.

    LENUS (Irish Health Repository)

    Kenny, Elaine M

    2011-02-01

    Screening large numbers of target regions in multiple DNA samples for sequence variation is an important application of next-generation sequencing but an efficient method to enrich the samples in parallel has yet to be reported. We describe an advanced method that combines DNA samples using indexes or barcodes prior to target enrichment to facilitate this type of experiment. Sequencing libraries for multiple individual DNA samples, each incorporating a unique 6-bp index, are combined in equal quantities, enriched using a single in-solution target enrichment assay and sequenced in a single reaction. Sequence reads are parsed based on the index, allowing sequence analysis of individual samples. We show that the use of indexed samples does not impact on the efficiency of the enrichment reaction. For three- and nine-indexed HapMap DNA samples, the method was found to be highly accurate for SNP identification. Even with sequence coverage as low as 8x, 99% of sequence SNP calls were concordant with known genotypes. Within a single experiment, this method can sequence the exonic regions of hundreds of genes in tens of samples for sequence and structural variation using as little as 1 μg of input DNA per sample.

  7. Population structure of Atlantic Mackerel inferred from RAD-seq derived SNP markers: effects of sequence clustering parameters and hierarchical SNP selection

    KAUST Repository

    Rodríguez-Ezpeleta, Naiara

    2016-03-03

    Restriction-site associated DNA sequencing (RAD-seq) and related methods are revolutionizing the field of population genomics in non-model organisms as they allow generating an unprecedented number of single nucleotide polymorphisms (SNPs) even when no genomic information is available. Yet, RAD-seq data analyses rely on assumptions on nature and number of nucleotide variants present in a single locus, the choice of which may lead to an under- or overestimated number of SNPs and/or to incorrectly called genotypes. Using the Atlantic mackerel (Scomber scombrus L.) and a close relative, the Atlantic chub mackerel (Scomber colias), as case study, here we explore the sensitivity of population structure inferences to two crucial aspects in RAD-seq data analysis: the maximum number of mismatches allowed to merge reads into a locus and the relatedness of the individuals used for genotype calling and SNP selection. Our study resolves the population structure of the Atlantic mackerel, but, most importantly, provides insights into the effects of alternative RAD-seq data analysis strategies on population structure inferences that are directly applicable to other species.

  8. Lack of an association of miR-938 SNP in IDDM10 with human type 1 diabetes

    Directory of Open Access Journals (Sweden)

    Mi Xiaofan

    2011-10-01

    Full Text Available Abstract MicroRNAs (miRNAs are a newly discovered type of small non-protein coding RNA that function in the inhibition of effective mRNA translation, and may serve as susceptibility genes for various disease developments. The SNP rs12416605, located in human type 1 diabetes IDDM10 locus, changes the seeding sequence (UGU[G/A]CCC of miRNA miR-938 and potentially alters miR-938 targets, including IL-16 and IL-17A. In an attempt to test whether miR-938 may be a susceptibility gene for IDDM10, we assessed the possible association of the miR-938 SNP with T1D in an American Caucasian cohort of 622 patients and 723 healthy controls by TaqMan assay. Our current data do not support the association between the SNP in miR-938 and type 1 diabetes.

  9. SNP_tools: A compact tool package for analysis and conversion of genotype data for MS-Excel.

    Science.gov (United States)

    Chen, Bowang; Wilkening, Stefan; Drechsel, Marion; Hemminki, Kari

    2009-10-23

    Single nucleotide polymorphism (SNP) genotyping is a major activity in biomedical research. Scientists prefer to have a facile access to the results which may require conversions between data formats. First hand SNP data is often entered in or saved in the MS-Excel format, but this software lacks genetic and epidemiological related functions. A general tool to do basic genetic and epidemiological analysis and data conversion for MS-Excel is needed. The SNP_tools package is prepared as an add-in for MS-Excel. The code is written in Visual Basic for Application, embedded in the Microsoft Office package. This add-in is an easy to use tool for users with basic computer knowledge (and requirements for basic statistical analysis). Our implementation for Microsoft Excel 2000-2007 in Microsoft Windows 2000, XP, Vista and Windows 7 beta can handle files in different formats and converts them into other formats. It is a free software.

  10. Predicting the disease of Alzheimer with SNP biomarkers and clinical data using data mining classification approach: decision tree.

    Science.gov (United States)

    Erdoğan, Onur; Aydin Son, Yeşim

    2014-01-01

    Single Nucleotide Polymorphisms (SNPs) are the most common genomic variations where only a single nucleotide differs between individuals. Individual SNPs and SNP profiles associated with diseases can be utilized as biological markers. But there is a need to determine the SNP subsets and patients' clinical data which is informative for the diagnosis. Data mining approaches have the highest potential for extracting the knowledge from genomic datasets and selecting the representative SNPs as well as most effective and informative clinical features for the clinical diagnosis of the diseases. In this study, we have applied one of the widely used data mining classification methodology: "decision tree" for associating the SNP biomarkers and significant clinical data with the Alzheimer's disease (AD), which is the most common form of "dementia". Different tree construction parameters have been compared for the optimization, and the most accurate tree for predicting the AD is presented.

  11. A low-density SNP array for analyzing differential selection in freshwater and marine populations of threespine stickleback (Gasterosteus aculeatus)

    DEFF Research Database (Denmark)

    Ferchaud, Anne-Laure; Pedersen, Susanne H.; Bekkevold, Dorte

    2014-01-01

    for rapid and cost efficient analysis of genetic divergence between freshwater and marine sticklebacks, we generated a low-density SNP (Single Nucleotide Polymorphism) array encompassing markers of chromosome regions under putative directional selection, along with neutral markers for background. Results......: RAD (Restriction site Associated DNA) sequencing of sixty individuals representing two freshwater and one marine population led to the identification of 33,993 SNP markers. Ninety-six of these were chosen for the low-density SNP array, among which 70 represented SNPs under putatively directional...... selection in freshwater vs. marine environments, whereas 26 SNPs were assumed to be neutral. Annotation of these regions revealed several genes that are candidates for affecting stickleback phenotypic variation, some of which have been observed in previous studies whereas others are new. Conclusions: We...

  12. Publishing SNP genotypes of human embryonic stem cell lines: policy statement of the International Stem Cell Forum Ethics Working Party.

    Science.gov (United States)

    Knoppers, Bartha M; Isasi, Rosario; Benvenisty, Nissim; Kim, Ock-Joo; Lomax, Geoffrey; Morris, Clive; Murray, Thomas H; Lee, Eng Hin; Perry, Margery; Richardson, Genevra; Sipp, Douglas; Tanner, Klaus; Wahlström, Jan; de Wert, Guido; Zeng, Fanyi

    2011-09-01

    Novel methods and associated tools permitting individual identification in publicly accessible SNP databases have become a debatable issue. There is growing concern that current technical and ethical safeguards to protect the identities of donors could be insufficient. In the context of human embryonic stem cell research, there are no studies focusing on the probability that an hESC line donor could be identified by analyzing published SNP profiles and associated genotypic and phenotypic information. We present the International Stem Cell Forum (ISCF) Ethics Working Party's Policy Statement on "Publishing SNP Genotypes of Human Embryonic Stem Cell Lines (hESC)". The Statement prospectively addresses issues surrounding the publication of genotypic data and associated annotations of hESC lines in open access databases. It proposes a balanced approach between the goals of open science and data sharing with the respect for fundamental bioethical principles (autonomy, privacy, beneficence, justice and research merit and integrity).

  13. An updated meta-analysis on the association of MDM2 SNP309 polymorphism with colorectal cancer risk.

    Directory of Open Access Journals (Sweden)

    Xue Qin

    Full Text Available The mouse double minute 2 (MDM2 gene encodes a phosphoprotein that interacts with P53 and negatively regulates its activity. The SNP309 polymorphism (T-G in the promoter of MDM2 gene has been reported to be associated with enhanced MDM2 expression and tumor development. Studies investigating the association between MDM2 SNP309 polymorphism and colorectal cancer (CRC risk reported conflicting results. We performed a meta-analysis of all available studies to explore the association of this polymorphism with CRC risk.All studies published up to July 2013 on the association between MDM2 SNP309 polymorphism and CRC risk were identified by searching electronic databases PubMed, EMBASE, and Chinese Biomedical Literature database (CBM databases. The association between the MDM2 SNP309 polymorphism and CRC risk was assessed by odds ratios (ORs together with their 95% confidence intervals (CIs.A total of 14 case-control studies including 4460 CRC cases and 4828 controls were identified. We did not find a significant association between the MDM2 SNP309 polymorphism and CRC risk in all genetic models in overall population. However, in subgroup analysis by ethnicity, significant associations were found in Asians (TG vs. TT: OR = 1.197, 95% CI = 1.055-1.358, P=0.005; GG+TG vs. TT: OR = 1.246, 95% CI = 1.106-1.404, P=0.000 and Africans. When stratified by HWE in controls, significantly increased risk was also found among the studies consistent with HWE (TG vs. TT: OR = 1.166, 95% CI = 1.037-1.311, P= 0.010. In subgroup analysis according to p53 mutation status, and gender, no any significant association was detected.The present meta-analysis suggests that the MDM2 is a candidate gene for CRC susceptibility. The MDM2 SNP309 polymorphism may be a risk factor for CRC in Asians.

  14. Association between SNP and haplotypes in PPARGCl and adiponectin genes and bone mineral density in Chinese nuclear families

    Institute of Scientific and Technical Information of China (English)

    Zhen-lin ZHANG; Jin-wei HE; Yue-juan QIN; Yun-qiu HU; Miao LI; Yu-juan LIU; Hao ZHANG; Wei-wei HU

    2007-01-01

    Aim: To assess the contribution of single nucleotide polymorphisms (SNP) and haplotypes in the peroxisome proliferator-activated receptor-γ co-activator-1(PPARGC1) and adiponectin genes to normal bone mineral density (BMD) variation in healthy Chinese women and men. Methods: We performed population-based (ANOVA) and family-based (quantitative trait locus transmission disequi-librium test) association studies of PPARGC1 and adiponectin genes. SNP in the 2 genes were genotyped. BMD was measured using dual-energy X-ray absorptiometry in the lumbar spine and hip in 401 nuclear families with a total of1260 subjects, including 458 premenopausal women, 20-40 years of age; 401 post-menopausal women (mothers), 43-74 years of age; and 401 men (fathers), 49-76years of age. Results: Significant within-family association was found between the Thr394Thr polymorphism in the PPGAGC1 gene and peak BMD in the femoral neck (P=0.026). Subsequent permutations were in agreement with this significant within-family association result (P=0.016), but Thr394Thr SNP only accounted for0.7% of the variation in femoral neck peak BMD. However, no significant within-family association was detected between each SNP in the adiponect in gene and peak BMD. Although no significant association was found between BMD and SNP in the PPARGC1 and adiponectin genes in both men and postmenopausal women, haplotype 2 (T-T) in the adiponect in gene was associated with lumbar spine BMD in postmenopausal women (P=0.019). Conclusion: Our findings sug-gest that Thr394Thr SNP in the PPARGC1 gene was associated with peak BMD in the femoral neck in Chinese women. Confirmation of our results is needed in other populations and with more functional markers within and flanking the PPARGC1 or adiponectin genes region.

  15. Using Drosophila melanogaster as a model for genotoxic chemical mutational studies with a new program, SnpSift

    Directory of Open Access Journals (Sweden)

    Douglas Mark Ruden

    2012-03-01

    Full Text Available This paper describes a new program SnpSift for filtering differential DNA sequence variants between two or more experimental genomes after genotoxic chemical exposure. Here, we illustrate how SnpSift can be used to identify candidate phenotype-relevant variants including single nucleotide polymorphisms (SNPs, multiple nucleotide polymorphisms (MNPs, insertions and deletions (InDels in mutant strains isolated from genome-wide chemical mutagenesis of Drosophila melanogaster. First, the genomes of two independently-isolated mutant fly strains that are allelic for a novel recessive male-sterile locus generated by genotoxic chemical exposure were sequenced using the Illumina next-generation DNA sequencer to obtain 20- to 29-fold coverage of the euchromatic sequences. The sequencing reads were processed and variants were called using standard bioinformatic tools. Next, SnpEff was used to annotate all sequence variants and their potential mutational effects on associated genes. Then, SnpSift was used to filter and select differential variants that potentially disrupt a common gene in the two allelic mutant strains. The potential causative DNA lesions were partially validated by capillary sequencing of PCR-amplified DNA in the genetic interval as defined by meiotic mapping and deletions that remove defined regions of the chromosome. Of the five candidate genes located in the genetic interval, the Pka-like gene CG12069 was found to carry a separate premature stop codon mutation in each of the two allelic mutants whereas the other 4 candidate genes within the interval have wild-type sequences. The Pka-like gene is therefore a strong candidate gene for the male-sterile locus. These results demonstrate that combining SnpEff and SnpSift can expedite the identification of candidate phenotype-causative mutations in chemically-mutagenized Drosophila strains. This technique can also be used to characterize the variety of mutations generated by genotoxic

  16. Pacifiplex: an ancestry-informative SNP panel centred on Australia and the Pacific region.

    Science.gov (United States)

    Santos, Carla; Phillips, Christopher; Fondevila, Manuel; Daniel, Runa; van Oorschot, Roland A H; Burchard, Esteban G; Schanfield, Moses S; Souto, Luis; Uacyisrael, Jolame; Via, Marc; Carracedo, Ángel; Lareu, Maria V

    2016-01-01

    The analysis of human population variation is an area of considerable interest in the forensic, medical genetics and anthropological fields. Several forensic single nucleotide polymorphism (SNP) assays provide ancestry-informative genotypes in sensitive tests designed to work with limited DNA samples, including a 34-SNP multiplex differentiating African, European and East Asian ancestries. Although assays capable of differentiating Oceanian ancestry at a global scale have become available, this study describes markers compiled specifically for differentiation of Oceanian populations. A sensitive multiplex assay, termed Pacifiplex, was developed and optimized in a small-scale test applicable to forensic analyses. The Pacifiplex assay comprises 29 ancestry-informative marker SNPs (AIM-SNPs) selected to complement the 34-plex test, that in a combined set distinguish Africans, Europeans, East Asians and Oceanians. Nine Pacific region study populations were genotyped with both SNP assays, then compared to four reference population groups from the HGDP-CEPH human diversity panel. STRUCTURE analyses estimated population cluster membership proportions that aligned with the patterns of variation suggested for each study population's currently inferred demographic histories. Aboriginal Taiwanese and Philippine samples indicated high East Asian ancestry components, Papua New Guinean and Aboriginal Australians samples were predominantly Oceanian, while other populations displayed cluster patterns explained by the distribution of divergence amongst Melanesians, Polynesians and Micronesians. Genotype data from Pacifiplex and 34-plex tests is particularly well suited to analysis of Australian Aboriginal populations and when combined with Y and mitochondrial DNA variation will provide a powerful set of markers for ancestry inference applied to modern Australian demographic profiles. On a broader geographic scale, Pacifiplex adds highly informative data for inferring the ancestry

  17. In silico SNP analysis of the breast cancer antigen NY-BR-1.

    Science.gov (United States)

    Kosaloglu, Zeynep; Bitzer, Julia; Halama, Niels; Huang, Zhiqin; Zapatka, Marc; Schneeweiss, Andreas; Jäger, Dirk; Zörnig, Inka

    2016-11-18

    Breast cancer is one of the most common malignancies with increasing incidences every year and a leading cause of death among women. Although early stage breast cancer can be effectively treated, there are limited numbers of treatment options available for patients with advanced and metastatic disease. The novel breast cancer associated antigen NY-BR-1 was identified by SEREX analysis and is expressed in the majority (>70%) of breast tumors as well as metastases, in normal breast tissue, in testis and occasionally in prostate tissue. The biological function and regulation of NY-BR-1 is up to date unknown. We performed an in silico analysis on the genetic variations of the NY-BR-1 gene using data available in public SNP databases and the tools SIFT, Polyphen and Provean to find possible functional SNPs. Additionally, we considered the allele frequency of the found damaging SNPs and also analyzed data from an in-house sequencing project of 55 breast cancer samples for recurring SNPs, recorded in dbSNP. Over 2800 SNPs are recorded in the dbSNP and NHLBI ESP databases for the NY-BR-1 gene. Of these, 65 (2.07%) are synonymous SNPs, 191 (6.09%) are non-synoymous SNPs, and 2430 (77.48%) are noncoding intronic SNPs. As a result, 69 non-synoymous SNPs were predicted to be damaging by at least two, and 16 SNPs were predicted as damaging by all three of the used tools. The SNPs rs200639888, rs367841401 and rs377750885 were categorized as highly damaging by all three tools. Eight damaging SNPs are located in the ankyrin repeat domain (ANK), a domain known for its frequent involvement in protein-protein interactions. No distinctive features could be observed in the allele frequency of the analyzed SNPs. Considering these results we expect to gain more insights into the variations of the NY-BR-1 gene and their possible impact on giving rise to splice variants and therefore influence the function of NY-BR-1 in healthy tissue as well as in breast cancer.

  18. Genome wide SNP discovery in flax through next generation sequencing of reduced representation libraries

    Directory of Open Access Journals (Sweden)

    Kumar Santosh

    2012-12-01

    Full Text Available Abstract Background Flax (Linum usitatissimum L. is a significant fibre and oilseed crop. Current flax molecular markers, including isozymes, RAPDs, AFLPs and SSRs are of limited use in the construction of high density linkage maps and for association mapping applications due to factors such as low reproducibility, intense labour requirements and/or limited numbers. We report here on the use of a reduced representation library strategy combined with next generation Illumina sequencing for rapid and large scale discovery of SNPs in eight flax genotypes. SNP discovery was performed through in silico analysis of the sequencing data against the whole genome shotgun sequence assembly of flax genotype CDC Bethune. Genotyping-by-sequencing of an F6-derived recombinant inbred line population provided validation of the SNPs. Results Reduced representation libraries of eight flax genotypes were sequenced on the Illumina sequencing platform resulting in sequence coverage ranging from 4.33 to 15.64X (genome equivalents. Depending on the relatedness of the genotypes and the number and length of the reads, between 78% and 93% of the reads mapped onto the CDC Bethune whole genome shotgun sequence assembly. A total of 55,465 SNPs were discovered with the largest number of SNPs belonging to the genotypes with the highest mapping coverage percentage. Approximately 84% of the SNPs discovered were identified in a single genotype, 13% were shared between any two genotypes and the remaining 3% in three or more. Nearly a quarter of the SNPs were found in genic regions. A total of 4,706 out of 4,863 SNPs discovered in Macbeth were validated using genotyping-by-sequencing of 96 F6 individuals from a recombinant inbred line population derived from a cross between CDC Bethune and Macbeth, corresponding to a validation rate of 96.8%. Conclusions Next generation sequencing of reduced representation libraries was successfully implemented for genome-wide SNP discovery from

  19. PENURUNAN KADAR AFLATOKSIN B1 PADA SARI KEDELAI OLEH SEL HIDUP DAN SEL MATI Lactobacillus acidophilus SNP-2 [Reduction of Aflatoxin B1 in Soymilk by Viable and Heat-killed Lactobacillus acidophilus SNP-2

    Directory of Open Access Journals (Sweden)

    Tyas Utami1*

    2012-06-01

    Full Text Available Aflatoxins are carcinogenic mycotoxins that commonly contaminate foods and feed. There are many different forms of aflatoxin and its metabolites. Of these, aflatoxin B1 (AFB1 is the most prevalent and toxic. Lactobacillus acidophilus SNP-2 has previously been shown to remove AFB1 from liquid solution of phosphate saline buffer. However, the ability of lactic acid bacteria to reduce AFB1 content in soymilk has not been studied yet. The objective of this study was to investigate the ability of viable and heat-killed cells of L. acidophilus SNP-2 to reduce AFB1 in soymilk and fermented soymilk. Soymilk contaminated with Aspergillus flavus was inoculated with culture of L. acidophilus SNP-2, and incubated at 37C for 12 hours. Fermented soymilk, then, was heat sterilized and stored at cool room (4°C. Heat-killed cells were introduced to soy milk and then kept at cool room for 3 days. During soymilk fermentation, there was reduction of AFB1 content in soymilk related to the growth of lactic acid bacteria and the reduction of pH. The initial concentration of AFB1 in the soymilk was 4.9 ppb. Lactobacillus acidophilus SNP-2 reduced 67.58% of AFB1 in the soymilk after 12 hoursof fermentation. In cool environment, the binding of AFB1 to heat-killed cell after soymilk fermentation was relatively more stable than that of soymilk without fermentation.

  20. Using RNA-Seq to assemble a rose transcriptome with more than 13,000 full-length expressed genes and to develop the WagRhSNP 68k Axiom SNP array for rose (Rosa L.)

    NARCIS (Netherlands)

    Koning, C.F.S.; Esselink, G.; Vukosavljev, M.; Westende, van 't W.P.C.; Gitonga, V.W.; Krens, F.A.; Voorrips, R.E.; Weg, van de W.E.; Schulz, D.; Debener, T.; Maliepaard, C.A.; Arens, P.F.P.; Smulders, M.J.M.

    2015-01-01

    In order to develop a versatile and large SNP array for rose, we set out to mine ESTs from diverse sets of rose germplasm. For this RNA-Seq libraries containing about 700 million reads were generated from tetraploid cut and garden roses using Illumina paired-end sequencing, and from diploid Rosa

  1. SNP-based pathway enrichment analysis for genome-wide association studies

    Directory of Open Access Journals (Sweden)

    Potkin Steven G

    2011-04-01

    Full Text Available Abstract Background Recently we have witnessed a surge of interest in using genome-wide association studies (GWAS to discover the genetic basis of complex diseases. Many genetic variations, mostly in the form of single nucleotide polymorphisms (SNPs, have been identified in a wide spectrum of diseases, including diabetes, cancer, and psychiatric diseases. A common theme arising from these studies is that the genetic variations discovered by GWAS can only explain a small fraction of the genetic risks associated with the complex diseases. New strategies and statistical approaches are needed to address this lack of explanation. One such approach is the pathway analysis, which considers the genetic variations underlying a biological pathway, rather than separately as in the traditional GWAS studies. A critical challenge in the pathway analysis is how to combine evidences of association over multiple SNPs within a gene and multiple genes within a pathway. Most current methods choose the most significant SNP from each gene as a representative, ignoring the joint action of multiple SNPs within a gene. This approach leads to preferential identification of genes with a greater number of SNPs. Results We describe a SNP-based pathway enrichment method for GWAS studies. The method consists of the following two main steps: 1 for a given pathway, using an adaptive truncated product statistic to identify all representative (potentially more than one SNPs of each gene, calculating the average number of representative SNPs for the genes, then re-selecting the representative SNPs of genes in the pathway based on this number; and 2 ranking all selected SNPs by the significance of their statistical association with a trait of interest, and testing if the set of SNPs from a particular pathway is significantly enriched with high ranks using a weighted Kolmogorov-Smirnov test. We applied our method to two large genetically distinct GWAS data sets of schizophrenia, one

  2. [Genetic diversity analysis of Andrographis paniculata in China based on SRAP and SNP].

    Science.gov (United States)

    Chen, Rong; Wang, Xiao-Yun; Song, Yu-Ning; Zhu, Yun-feng; Wang, Peng-liang; Li, Min; Zhong, Guo-Yue

    2014-12-01

    In order to reveal genetic diversity of domestic Andrographis paniculata and its impact on quality, genetic backgrounds of 103 samples from 7 provinces in China were analyzed using SRAP marker and SNP marker. Genetic structures of the A. paniculata populations were estimated with Powermarker V 3.25 and Mega 6.0 software, and polymorphic SNPs were identified with CodonCode Aligner software. The results showed that the genetic distances of domestic A. paniculata germplasm ranged from 0. 01 to 0.09, and no polymorphic SNPs were discovered in coding sequence fragments of ent-copalyl diphosphate synthase. A. paniculata germplasm from various regions in China had poor genetic diversity. This phenomenon was closely related to strict self-fertilization and earlier introduction from the same origin. Therefore, genetic background had little impact on variable qualities of A. paniculata in domestic market. Mutation breeding, polyploid breeding and molecular breeding were proposed as promising strategies in germplasm innovation.

  3. Olive oil DNA fingerprinting by multiplex SNP genotyping on fluorescent microspheres.

    Science.gov (United States)

    Kalogianni, Despina P; Bazakos, Christos; Boutsika, Lemonia M; Targem, Mehdi Ben; Christopoulos, Theodore K; Kalaitzis, Panagiotis; Ioannou, Penelope C

    2015-04-01

    Olive oil cultivar verification is of primary importance for the competitiveness of the product and the protection of consumers and producers from fraudulence. Single-nucleotide polymorphisms (SNPs) have emerged as excellent DNA markers for authenticity testing. This paper reports the first multiplex SNP genotyping assay for olive oil cultivar identification that is performed on a suspension of fluorescence-encoded microspheres. Up to 100 sets of microspheres, with unique "fluorescence signatures", are available. Allele discrimination was accomplished by primer extension reaction. The reaction products were captured via hybridization on the microspheres and analyzed, within seconds, by a flow cytometer. The "fluorescence signature" of each microsphere is assigned to a specific allele, whereas the signal from a reporter fluorophore denotes the presence of the allele. As a model, a panel of three SNPs was chosen that enabled identification of five common Greek olive cultivars (Adramytini, Chondrolia Chalkidikis, Kalamon, Koroneiki, and Valanolia).

  4. Exome sequencing and SNP analysis detect novel compound heterozygosity in fatty acid hydroxylase-associated neurodegeneration

    Science.gov (United States)

    Pierson, Tyler Mark; Simeonov, Dimitre R; Sincan, Murat; Adams, David A; Markello, Thomas; Golas, Gretchen; Fuentes-Fajardo, Karin; Hansen, Nancy F; Cherukuri, Praveen F; Cruz, Pedro; Blackstone, Craig; Tifft, Cynthia; Boerkoel, Cornelius F; Gahl, William A

    2012-01-01

    Fatty acid hydroxylase-associated neurodegeneration due to fatty acid 2-hydroxylase deficiency presents with a wide range of phenotypes including spastic paraplegia, leukodystrophy, and/or brain iron deposition. All previously described families with this disorder were consanguineous, with homozygous mutations in the probands. We describe a 10-year-old male, from a non-consanguineous family, with progressive spastic paraplegia, dystonia, ataxia, and cognitive decline associated with a sural axonal neuropathy. The use of high-throughput sequencing techniques combined with SNP array analyses revealed a novel paternally derived missense mutation and an overlapping novel maternally derived ∼28-kb genomic deletion in FA2H. This patient provides further insight into the consistent features of this disorder and expands our understanding of its phenotypic presentation. The presence of a sural nerve axonal neuropathy had not been previously associated with this disorder and so may extend the phenotype. PMID:22146942

  5. To Cheat or Not To Cheat: Tryptophan Hydroxylase 2 SNP Variants Contribute to Dishonest Behavior.

    Science.gov (United States)

    Shen, Qiang; Teo, Meijun; Winter, Eyal; Hart, Einav; Chew, Soo H; Ebstein, Richard P

    2016-01-01

    Although, lying (bear false witness) is explicitly prohibited in the Decalogue and a focus of interest in philosophy and theology, more recently the behavioral and neural mechanisms of deception are gaining increasing attention from diverse fields especially economics, psychology, and neuroscience. Despite the considerable role of heredity in explaining individual differences in deceptive behavior, few studies have investigated which specific genes contribute to the heterogeneity of lying behavior across individuals. Also, little is known concerning which specific neurotransmitter pathways underlie deception. Toward addressing these two key questions, we implemented a neurogenetic strategy and modeled deception by an incentivized die-under-cup task in a laboratory setting. The results of this exploratory study provide provisional evidence that SNP variants across the tryptophan hydroxylase 2 (TPH2) gene, that encodes the rate-limiting enzyme in the biosynthesis of brain serotonin, contribute to individual differences in deceptive behavior.

  6. Design and synthesis of the superionic conductor Na10SnP2S12

    Science.gov (United States)

    Richards, William D.; Tsujimura, Tomoyuki; Miara, Lincoln J.; Wang, Yan; Kim, Jae Chul; Ong, Shyue Ping; Uechi, Ichiro; Suzuki, Naoki; Ceder, Gerbrand

    2016-03-01

    Sodium-ion batteries are emerging as candidates for large-scale energy storage due to their low cost and the wide variety of cathode materials available. As battery size and adoption in critical applications increases, safety concerns are resurfacing due to the inherent flammability of organic electrolytes currently in use in both lithium and sodium battery chemistries. Development of solid-state batteries with ionic electrolytes eliminates this concern, while also allowing novel device architectures and potentially improving cycle life. Here we report the computation-assisted discovery and synthesis of a high-performance solid-state electrolyte material: Na10SnP2S12, with room temperature ionic conductivity of 0.4 mS cm-1 rivalling the conductivity of the best sodium sulfide solid electrolytes to date. We also computationally investigate the variants of this compound where tin is substituted by germanium or silicon and find that the latter may achieve even higher conductivity.

  7. Biomek®-3000 and GenPlex SNP Genotyping in Forensic Genetics

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Tomas, Carmen; Hansen, Anders J.

    2008-01-01

    Single nucleotide polymorphism genotyping provides a supplement for conventional short tandem repeats-based kits currently used for human identification. GenPlex (Applied Biosystems (AB), Foster City, CA) is an SNP-genotyping kit based on a multiplex of 48 informative, autosomal SNPs from...... the SNPforID Consortium. Our objective was to setup, implement, and validate a small and affordable automated liquid-handling robot for forensic casework samples (buccal swaps on FTA-paper and Qiagen purified blood). The reaction scheme consisted of numerous steps and was cumbersome to perform consistently...... manually. Automation was accomplished with a Biomek-3000 (Beckmann Coulter) laboratory-automated workstation using five in-house-developed methods. All methods allowed the user to select the number of subsequent injections to the capillary electrophoresis instrument (ABI 3130xl, AB) enabling processing...

  8. To cheat or not to cheat: Tryptophan hydroxylase 2 SNP variants contribute to dishonest behavior

    Directory of Open Access Journals (Sweden)

    Qiang eShen

    2016-05-01

    Full Text Available Although lying (bear false witness is explicitly prohibited in the Decalogue and a focus of interest in philosophy and theology, more recently the behavioral and neural mechanisms of deception are gaining increasing attention from diverse fields especially economics, psychology and neuroscience. Despite the considerable role of heredity in explaining individual differences in deceptive behavior, few studies have investigated which specific genes contribute to the heterogeneity of lying behavior across individuals. Also, little is known concerning which specific neurotransmitter pathways underlie deception. Towards addressing these two key questions, we implemented a neurogenetic strategy and modeled deception by an incentivized die-under-cup task in a laboratory setting. The results of this exploratory study provide provisional evidence that SNP variants across the tryptophan hydroxylase 2 (TPH2 gene, that encodes the rate-limiting enzyme in the biosynthesis of brain serotonin, contribute to individual differences in deceptive behavior.

  9. Design and synthesis of the superionic conductor Na10SnP2S12.

    Science.gov (United States)

    Richards, William D; Tsujimura, Tomoyuki; Miara, Lincoln J; Wang, Yan; Kim, Jae Chul; Ong, Shyue Ping; Uechi, Ichiro; Suzuki, Naoki; Ceder, Gerbrand

    2016-03-17

    Sodium-ion batteries are emerging as candidates for large-scale energy storage due to their low cost and the wide variety of cathode materials available. As battery size and adoption in critical applications increases, safety concerns are resurfacing due to the inherent flammability of organic electrolytes currently in use in both lithium and sodium battery chemistries. Development of solid-state batteries with ionic electrolytes eliminates this concern, while also allowing novel device architectures and potentially improving cycle life. Here we report the computation-assisted discovery and synthesis of a high-performance solid-state electrolyte material: Na10SnP2S12, with room temperature ionic conductivity of 0.4 mS cm(-1) rivalling the conductivity of the best sodium sulfide solid electrolytes to date. We also computationally investigate the variants of this compound where tin is substituted by germanium or silicon and find that the latter may achieve even higher conductivity.

  10. Development and Evaluation of a Barley 50k iSelect SNP Array

    Directory of Open Access Journals (Sweden)

    Micha M. Bayer

    2017-10-01

    Full Text Available High-throughput genotyping arrays continue to be an attractive, cost-effective alternative to sequencing based approaches. We have developed a new 50k Illumina Infinium iSelect genotyping array for barley, a cereal crop species of major international importance. The majority of SNPs on the array have been extracted from variants called in exome capture data of a wide range of European barley germplasm. We used the recently published barley pseudomolecule assembly to map the exome capture data, which allowed us to generate markers with accurate physical positions and detailed gene annotation. Markers from an existing and widely used barley 9k Infinium iSelect array were carried over onto the 50k chip for backward compatibility. The array design featured 49,267 SNP markers that converted into 44,040 working assays, of which 43,461 were scorable in GenomeStudio. Of the working assays, 6,251 are from the 9k iSelect platform. We validated the SNPs by comparing the genotype calls from the new array to legacy datasets. Rates of agreement averaged 98.1 and 93.9% respectively for the legacy 9k iSelect SNP set (Comadran et al., 2012 and the exome capture SNPs. To test the utility of the 50k chip for genetic mapping, we genotyped a segregating population derived from a Golden Promise × Morex cross (Liu et al., 2014 and mapped over 14,000 SNPs to genetic positions which showed a near exact correspondence to their known physical positions. Manual adjustment of the cluster files used by the interpreting software for genotype scoring improved results substantially, but migration of cluster files between sites led to a deterioration of results, suggesting that local adjustment of cluster files is required on a site-per-site basis. Information relating to the markers on the chip is available online at https://ics.hutton.ac.uk/50k.

  11. Switchgrass genomic diversity, ploidy, and evolution: novel insights from a network-based SNP discovery protocol.

    Directory of Open Access Journals (Sweden)

    Fei Lu

    Full Text Available Switchgrass (Panicum virgatum L. is a perennial grass that has been designated as an herbaceous model biofuel crop for the United States of America. To facilitate accelerated breeding programs of switchgrass, we developed both an association panel and linkage populations for genome-wide association study (GWAS and genomic selection (GS. All of the 840 individuals were then genotyped using genotyping by sequencing (GBS, generating 350 GB of sequence in total. As a highly heterozygous polyploid (tetraploid and octoploid species lacking a reference genome, switchgrass is highly intractable with earlier methodologies of single nucleotide polymorphism (SNP discovery. To access the genetic diversity of species like switchgrass, we developed a SNP discovery pipeline based on a network approach called the Universal Network-Enabled Analysis Kit (UNEAK. Complexities that hinder single nucleotide polymorphism discovery, such as repeats, paralogs, and sequencing errors, are easily resolved with UNEAK. Here, 1.2 million putative SNPs were discovered in a diverse collection of primarily upland, northern-adapted switchgrass populations. Further analysis of this data set revealed the fundamentally diploid nature of tetraploid switchgrass. Taking advantage of the high conservation of genome structure between switchgrass and foxtail millet (Setaria italica (L. P. Beauv., two parent-specific, synteny-based, ultra high-density linkage maps containing a total of 88,217 SNPs were constructed. Also, our results showed clear patterns of isolation-by-distance and isolation-by-ploidy in natural populations of switchgrass. Phylogenetic analysis supported a general south-to-north migration path of switchgrass. In addition, this analysis suggested that upland tetraploid arose from upland octoploid. All together, this study provides unparalleled insights into the diversity, genomic complexity, population structure, phylogeny, phylogeography, ploidy, and evolutionary dynamics

  12. Development of a set of SNP markers present in expressed genes of the apple.

    Science.gov (United States)

    Chagné, David; Gasic, Ksenija; Crowhurst, Ross N; Han, Yuepeng; Bassett, Heather C; Bowatte, Deepa R; Lawrence, Timothy J; Rikkerink, Erik H A; Gardiner, Susan E; Korban, Schuyler S

    2008-11-01

    Molecular markers associated with gene coding regions are useful tools for bridging functional and structural genomics. Due to their high abundance in plant genomes, single nucleotide polymorphisms (SNPs) are present within virtually all genomic regions, including most coding sequences. The objective of this study was to develop a set of SNPs for the apple by taking advantage of the wealth of genomics resources available for the apple, including a large collection of expressed sequenced tags (ESTs). Using bioinformatics tools, a search for SNPs within an EST database of approximately 350,000 sequences developed from a variety of apple accessions was conducted. This resulted in the identification of a total of 71,482 putative SNPs. As the apple genome is reported to be an ancient polyploid, attempts were made to verify whether those SNPs detected in silico were attributable either to allelic polymorphisms or to gene duplication or paralogous or homeologous sequence variations. To this end, a set of 464 PCR primer pairs was designed, PCR was amplified using two subsets of plants, and the PCR products were sequenced. The SNPs retrieved from these sequences were then mapped onto apple genetic maps, including a newly constructed map of a Royal Gala x A689-24 cross and a Malling 9 x Robusta 5, map using a bin mapping strategy. The SNP genotyping was performed using the high-resolution melting (HRM) technique. A total of 93 new markers containing 210 coding SNPs were successfully mapped. This new set of SNP markers for the apple offers new opportunities for understanding the genetic control of important horticultural traits using quantitative trait loci (QTL) or linkage disequilibrium analysis. These also serve as useful markers for aligning physical and genetic maps, and as potential transferable markers across the Rosaceae family.

  13. Learning gene networks under SNP perturbations using eQTL datasets.

    Directory of Open Access Journals (Sweden)

    Lingxue Zhang

    2014-02-01

    Full Text Available The standard approach for identifying gene networks is based on experimental perturbations of gene regulatory systems such as gene knock-out experiments, followed by a genome-wide profiling of differential gene expressions. However, this approach is significantly limited in that it is not possible to perturb more than one or two genes simultaneously to discover complex gene interactions or to distinguish between direct and indirect downstream regulations of the differentially-expressed genes. As an alternative, genetical genomics study has been proposed to treat naturally-occurring genetic variants as potential perturbants of gene regulatory system and to recover gene networks via analysis of population gene-expression and genotype data. Despite many advantages of genetical genomics data analysis, the computational challenge that the effects of multifactorial genetic perturbations should be decoded simultaneously from data has prevented a widespread application of genetical genomics analysis. In this article, we propose a statistical framework for learning gene networks that overcomes the limitations of experimental perturbation methods and addresses the challenges of genetical genomics analysis. We introduce a new statistical model, called a sparse conditional Gaussian graphical model, and describe an efficient learning algorithm that simultaneously decodes the perturbations of gene regulatory system by a large number of SNPs to identify a gene network along with expression quantitative trait loci (eQTLs that perturb this network. While our statistical model captures direct genetic perturbations of gene network, by performing inference on the probabilistic graphical model, we obtain detailed characterizations of how the direct SNP perturbation effects propagate through the gene network to perturb other genes indirectly. We demonstrate our statistical method using HapMap-simulated and yeast eQTL datasets. In particular, the yeast gene network

  14. New algorithm improves fine structure of the barley consensus SNP map

    Directory of Open Access Journals (Sweden)

    Endelman Jeffrey B

    2011-08-01

    Full Text Available Abstract Background The need to integrate information from multiple linkage maps is a long-standing problem in genetics. One way to visualize the complex ordinal relationships is with a directed graph, where each vertex in the graph is a bin of markers. When there are no ordering conflicts between the linkage maps, the result is a directed acyclic graph, or DAG, which can then be linearized to produce a consensus map. Results New algorithms for the simplification and linearization of consensus graphs have been implemented as a package for the R computing environment called DAGGER. The simplified consensus graphs produced by DAGGER exactly capture the ordinal relationships present in a series of linkage maps. Using either linear or quadratic programming, DAGGER generates a consensus map with minimum error relative to the linkage maps while remaining ordinally consistent with them. Both linearization methods produce consensus maps that are compressed relative to the mean of the linkage maps. After rescaling, however, the consensus maps had higher accuracy (and higher marker density than the individual linkage maps in genetic simulations. When applied to four barley linkage maps genotyped at nearly 3000 SNP markers, DAGGER produced a consensus map with improved fine structure compared to the existing barley consensus SNP map. The root-mean-squared error between the linkage maps and the DAGGER map was 0.82 cM per marker interval compared to 2.28 cM for the existing consensus map. Examination of the barley hardness locus at the 5HS telomere, for which there is a physical map, confirmed that the DAGGER output was more accurate for fine structure analysis. Conclusions The R package DAGGER is an effective, freely available resource for integrating the information from a set of consistent linkage maps.

  15. EST-derived SNP discovery and selective pressure analysis in Pacific white shrimp ( Litopenaeus vannamei)

    Science.gov (United States)

    Liu, Chengzhang; Wang, Xia; Xiang, Jianhai; Li, Fuhua

    2012-09-01

    Pacific white shrimp has become a major aquaculture and fishery species worldwide. Although a large scale EST resource has been publicly available since 2008, the data have not yet been widely used for SNP discovery or transcriptome-wide assessment of selective pressure. In this study, a set of 155 411 expressed sequence tags (ESTs) from the NCBI database were computationally analyzed and 17 225 single nucleotide polymorphisms (SNPs) were predicted, including 9 546 transitions, 5 124 transversions and 2 481 indels. Among the 7 298 SNP substitutions located in functionally annotated contigs, 58.4% (4 262) are non-synonymous SNPs capable of introducing amino acid mutations. Two hundred and fifty nonsynonymous SNPs in genes associated with economic traits have been identified as candidates for markers in selective breeding. Diversity estimates among the synonymous nucleotides were on average 3.49 times greater than those in non-synonymous, suggesting negative selection. Distribution of non-synonymous to synonymous substitutions (Ka/Ks) ratio ranges from 0 to 4.01, (average 0.42, median 0.26), suggesting that the majority of the affected genes are under purifying selection. Enrichment analysis identified multiple gene ontology categories under positive or negative selection. Categories involved in innate immune response and male gamete generation are rich in positively selected genes, which is similar to reports in Drosophila and primates. This work is the first transcriptome-wide assessment of selective pressure in a Penaeid shrimp species. The functionally annotated SNPs provide a valuable resource of potential molecular markers for selective breeding.

  16. Individual patient data meta-analysis shows a significant association between the ATM rs1801516 SNP and toxicity after radiotherapy in 5456 breast and prostate cancer patients

    DEFF Research Database (Denmark)

    Andreassen, Christian Nicolaj; Rosenstein, Barry S; Kerns, Sarah L

    2016-01-01

    PURPOSE: Several small studies have indicated that the ATM rs1801516 SNP is associated with risk of normal tissue toxicity after radiotherapy. However, the findings have not been consistent. In order to test this SNP in a well-powered study, an individual patient data meta-analysis was carried ou...

  17. Forensic assays of ricin: development of snp assays to generate precise genetic signatures for mixed genotypes found in ricin preparations

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Paul J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Hill, Karen K. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2009-11-09

    The results outlined in this report provide the information for needed to apply a SNP-based forensic analysis to diverse ricin preparations. The same methods could be useful in castor breeding programs that seek to reduce or eliminate ricin in oil-producing R. communis cultivars.

  18. Identification, Characterization, and Mapping of a Novel SNP Associated with Body Color Transparency in Juvenile Red Sea Bream (Pagrus major).

    Science.gov (United States)

    Sawayama, Eitaro; Noguchi, Daiki; Nakayama, Kei; Takagi, Motohiro

    2018-03-23

    We previously reported a body color deformity in juvenile red sea bream, which shows transparency in the juvenile stage because of delayed chromatophore development compared with normal individuals, and this finding suggested a genetic cause based on parentage assessments. To conduct marker-assisted selection to eliminate broodstock inheriting the causative gene, developing DNA markers associated with the phenotype was needed. We first conducted SNP mining based on AFLP analysis using bulked-DNA from normal and transparent individuals. One SNP was identified from a transparent-specific AFLP fragment, which significantly associated with transparent individuals. Two alleles (A/G) were observed in this locus, and the genotype G/G was dominantly observed in the transparent groups (97.1%) collected from several production lots produced from different broodstock populations. A few normal individuals inherited the G/G genotype (5.0%), but the A/A and A/G genotypes were dominantly observed in the normal groups. The homologs region of the SNP was searched using a medaka genome database, and intron 12 of the Nell2a gene (located on chromosome 6 of the medaka genome) was highly matched. We also mapped the red sea bream Nell2a gene on the previously developed linkage maps, and this gene was mapped on a male linkage group, LG4-M. The newly found SNP was useful in eliminating broodstock possessing the causative gene of the body color transparency observed in juvenile stage of red sea bream.

  19. One-step isothermal detection of multiple KRAS mutations by forming SNP specific hairpins on a gold nanoshell.

    Science.gov (United States)

    Chung, Chan Ho; Kim, Joong Hyun

    2018-04-24

    We developed a one-step isothermal method for typing multiple KRAS mutations using a designed set of primers to form a hairpin on a gold nanoshell upon being ligated by a SNP specific DNA ligase after binding of targets. As a result, we could detect as low as 20 attomoles of KRAS mutations within 1 h.

  20. Presence of sequence and SNP variation in the IRF6 gene in healthy residents of Guangdong Province

    Directory of Open Access Journals (Sweden)

    Wu Wenli

    2016-01-01

    Full Text Available This study was to investigate the single nucleotide polymorphism (SNP in the interferon regulatory factor 6 (IRF6 gene in healthy residents of Guangdong Province, China, for further analysis of their associations with the development of cleft lip with or without palate (CL/P.

  1. Identification of novel single nucleotide polymorphisms (SNPs in deer (Odocoileus spp. using the BovineSNP50 BeadChip.

    Directory of Open Access Journals (Sweden)

    Gwilym D Haynes

    Full Text Available Single nucleotide polymorphisms (SNPs are growing in popularity as a genetic marker for investigating evolutionary processes. A panel of SNPs is often developed by comparing large quantities of DNA sequence data across multiple individuals to identify polymorphic sites. For non-model species, this is particularly difficult, as performing the necessary large-scale genomic sequencing often exceeds the resources available for the project. In this study, we trial the Bovine SNP50 BeadChip developed in cattle (Bos taurus for identifying polymorphic SNPs in cervids Odocoileus hemionus (mule deer and black-tailed deer and O. virginianus (white-tailed deer in the Pacific Northwest. We found that 38.7% of loci could be genotyped, of which 5% (n = 1068 were polymorphic. Of these 1068 polymorphic SNPs, a mixture of putatively neutral loci (n = 878 and loci under selection (n = 190 were identified with the F(ST-outlier method. A range of population genetic analyses were implemented using these SNPs and a panel of 10 microsatellite loci. The three types of deer could readily be distinguished with both the SNP and microsatellite datasets. This study demonstrates that commercially developed SNP chips are a viable means of SNP discovery for non-model organisms, even when used between very distantly related species (the Bovidae and Cervidae families diverged some 25.1-30.1 million years before present.

  2. Characterizing associations and SNP-environment interactions for GWAS-identified prostate cancer risk markers--results from BPC3.

    Directory of Open Access Journals (Sweden)

    Sara Lindstrom

    2011-02-01

    Full Text Available Genome-wide association studies (GWAS have identified multiple single nucleotide polymorphisms (SNPs associated with prostate cancer risk. However, whether these associations can be consistently replicated, vary with disease aggressiveness (tumor stage and grade and/or interact with non-genetic potential risk factors or other SNPs is unknown. We therefore genotyped 39 SNPs from regions identified by several prostate cancer GWAS in 10,501 prostate cancer cases and 10,831 controls from the NCI Breast and Prostate Cancer Cohort Consortium (BPC3. We replicated 36 out of 39 SNPs (P-values ranging from 0.01 to 10⁻²⁸. Two SNPs located near KLK3 associated with PSA levels showed differential association with Gleason grade (rs2735839, P = 0.0001 and rs266849, P = 0.0004; case-only test, where the alleles associated with decreasing PSA levels were inversely associated with low-grade (as defined by Gleason grade < 8 tumors but positively associated with high-grade tumors. No other SNP showed differential associations according to disease stage or grade. We observed no effect modification by SNP for association with age at diagnosis, family history of prostate cancer, diabetes, BMI, height, smoking or alcohol intake. Moreover, we found no evidence of pair-wise SNP-SNP interactions. While these SNPs represent new independent risk factors for prostate cancer, we saw little evidence for effect modification by other SNPs or by the environmental factors examined.

  3. Prediction of Disease Causing Non-Synonymous SNPs by the Artificial Neural Network Predictor NetDiseaseSNP

    DEFF Research Database (Denmark)

    Johansen, Morten Bo; Gonzalez-Izarzugaza, Jose Maria; Brunak, Søren

    2013-01-01

    We have developed a sequence conservation-based artificial neural network predictor called NetDiseaseSNP which classifies nsSNPs as disease-causing or neutral. Our method uses the excellent alignment generation algorithm of SIFT to identify related sequences and a combination of 31 features...

  4. ChIP on SNP-chip for genome-wide analysis of human histone H4 hyperacetylation

    Directory of Open Access Journals (Sweden)

    Porter Christopher J

    2007-09-01

    Full Text Available Abstract Background SNP microarrays are designed to genotype Single Nucleotide Polymorphisms (SNPs. These microarrays report hybridization of DNA fragments and therefore can be used for the purpose of detecting genomic fragments. Results Here, we demonstrate that a SNP microarray can be effectively used in this way to perform chromatin immunoprecipitation (ChIP on chip as an alternative to tiling microarrays. We illustrate this novel application by mapping whole genome histone H4 hyperacetylation in human myoblasts and myotubes. We detect clusters of hyperacetylated histone H4, often spanning across up to 300 kilobases of genomic sequence. Using complementary genome-wide analyses of gene expression by DNA microarray we demonstrate that these clusters of hyperacetylated histone H4 tend to be associated with expressed genes. Conclusion The use of a SNP array for a ChIP-on-chip application (ChIP on SNP-chip will be of great value to laboratories whose interest is the determination of general rules regarding the relationship of specific chromatin modifications to transcriptional status throughout the genome and to examine the asymmetric modification of chromatin at heterozygous loci.

  5. Improving accuracy of genomic prediction in Brangus cattle by adding animals with imputed low-density SNP genotypes.

    Science.gov (United States)

    Lopes, F B; Wu, X-L; Li, H; Xu, J; Perkins, T; Genho, J; Ferretti, R; Tait, R G; Bauck, S; Rosa, G J M

    2018-02-01

    Reliable genomic prediction of breeding values for quantitative traits requires the availability of sufficient number of animals with genotypes and phenotypes in the training set. As of 31 October 2016, there were 3,797 Brangus animals with genotypes and phenotypes. These Brangus animals were genotyped using different commercial SNP chips. Of them, the largest group consisted of 1,535 animals genotyped by the GGP-LDV4 SNP chip. The remaining 2,262 genotypes were imputed to the SNP content of the GGP-LDV4 chip, so that the number of animals available for training the genomic prediction models was more than doubled. The present study showed that the pooling of animals with both original or imputed 40K SNP genotypes substantially increased genomic prediction accuracies on the ten traits. By supplementing imputed genotypes, the relative gains in genomic prediction accuracies on estimated breeding values (EBV) were from 12.60% to 31.27%, and the relative gain in genomic prediction accuracies on de-regressed EBV was slightly small (i.e. 0.87%-18.75%). The present study also compared the performance of five genomic prediction models and two cross-validation methods. The five genomic models predicted EBV and de-regressed EBV of the ten traits similarly well. Of the two cross-validation methods, leave-one-out cross-validation maximized the number of animals at the stage of training for genomic prediction. Genomic prediction accuracy (GPA) on the ten quantitative traits was validated in 1,106 newly genotyped Brangus animals based on the SNP effects estimated in the previous set of 3,797 Brangus animals, and they were slightly lower than GPA in the original data. The present study was the first to leverage currently available genotype and phenotype resources in order to harness genomic prediction in Brangus beef cattle. © 2018 Blackwell Verlag GmbH.

  6. SNP discovery and chromosome anchoring provide the first physically-anchored hexaploid oat map and reveal synteny with model species.

    Directory of Open Access Journals (Sweden)

    Rebekah E Oliver

    Full Text Available A physically anchored consensus map is foundational to modern genomics research; however, construction of such a map in oat (Avena sativa L., 2n = 6x = 42 has been hindered by the size and complexity of the genome, the scarcity of robust molecular markers, and the lack of aneuploid stocks. Resources developed in this study include a modified SNP discovery method for complex genomes, a diverse set of oat SNP markers, and a novel chromosome-deficient SNP anchoring strategy. These resources were applied to build the first complete, physically-anchored consensus map of hexaploid oat. Approximately 11,000 high-confidence in silico SNPs were discovered based on nine million inter-varietal sequence reads of genomic and cDNA origin. GoldenGate genotyping of 3,072 SNP assays yielded 1,311 robust markers, of which 985 were mapped in 390 recombinant-inbred lines from six bi-parental mapping populations ranging in size from 49 to 97 progeny. The consensus map included 985 SNPs and 68 previously-published markers, resolving 21 linkage groups with a total map distance of 1,838.8 cM. Consensus linkage groups were assigned to 21 chromosomes using SNP deletion analysis of chromosome-deficient monosomic hybrid stocks. Alignments with sequenced genomes of rice and Brachypodium provide evidence for extensive conservation of genomic regions, and renewed encouragement for orthology-based genomic discovery in this important hexaploid species. These results also provide a framework for high-resolution genetic analysis in oat, and a model for marker development and map construction in other species with complex genomes and limited resources.

  7. Fine-mapping additive and dominant SNP effects using group-LASSO and Fractional Resample Model Averaging

    Science.gov (United States)

    Sabourin, Jeremy; Nobel, Andrew B.; Valdar, William

    2014-01-01

    Genomewide association studies sometimes identify loci at which both the number and identities of the underlying causal variants are ambiguous. In such cases, statistical methods that model effects of multiple SNPs simultaneously can help disentangle the observed patterns of association and provide information about how those SNPs could be prioritized for follow-up studies. Current multi-SNP methods, however, tend to assume that SNP effects are well captured by additive genetics; yet when genetic dominance is present, this assumption translates to reduced power and faulty prioritizations. We describe a statistical procedure for prioritizing SNPs at GWAS loci that efficiently models both additive and dominance effects. Our method, LLARRMA-dawg, combines a group LASSO procedure for sparse modeling of multiple SNP effects with a resampling procedure based on fractional observation weights; it estimates for each SNP the robustness of association with the phenotype both to sampling variation and to competing explanations from other SNPs. In producing a SNP prioritization that best identifies underlying true signals, we show that: our method easily outperforms a single marker analysis; when additive-only signals are present, our joint model for additive and dominance is equivalent to or only slightly less powerful than modeling additive-only effects; and, when dominance signals are present, even in combination with substantial additive effects, our joint model is unequivocally more powerful than a model assuming additivity. We also describe how performance can be improved through calibrated randomized penalization, and discuss how dominance in ungenotyped SNPs can be incorporated through either heterozygote dosage or multiple imputation. PMID:25417853

  8. Whole genome resequencing of black Angus and Holstein cattle for SNP and CNV discovery

    Directory of Open Access Journals (Sweden)

    Stothard Paul

    2011-11-01

    Full Text Available Abstract Background One of the goals of livestock genomics research is to identify the genetic differences responsible for variation in phenotypic traits, particularly those of economic importance. Characterizing the genetic variation in livestock species is an important step towards linking genes or genomic regions with phenotypes. The completion of the bovine genome sequence and recent advances in DNA sequencing technology allow for in-depth characterization of the genetic variations present in cattle. Here we describe the whole-genome resequencing of two Bos taurus bulls from distinct breeds for the purpose of identifying and annotating novel forms of genetic variation in cattle. Results The genomes of a Black Angus bull and a Holstein bull were sequenced to 22-fold and 19-fold coverage, respectively, using the ABI SOLiD system. Comparisons of the sequences with the Btau4.0 reference assembly yielded 7 million single nucleotide polymorphisms (SNPs, 24% of which were identified in both animals. Of the total SNPs found in Holstein, Black Angus, and in both animals, 81%, 81%, and 75% respectively are novel. In-depth annotations of the data identified more than 16 thousand distinct non-synonymous SNPs (85% novel between the two datasets. Alignments between the SNP-altered proteins and orthologues from numerous species indicate that many of the SNPs alter well-conserved amino acids. Several SNPs predicted to create or remove stop codons were also found. A comparison between the sequencing SNPs and genotyping results from the BovineHD high-density genotyping chip indicates a detection rate of 91% for homozygous SNPs and 81% for heterozygous SNPs. The false positive rate is estimated to be about 2% for both the Black Angus and Holstein SNP sets, based on follow-up genotyping of 422 and 427 SNPs, respectively. Comparisons of read depth between the two bulls along the reference assembly identified 790 putative copy-number variations (CNVs. Ten

  9. Genome-wide SNP data unveils the globalization of domesticated pigs.

    Science.gov (United States)

    Yang, Bin; Cui, Leilei; Perez-Enciso, Miguel; Traspov, Aleksei; Crooijmans, Richard P M A; Zinovieva, Natalia; Schook, Lawrence B; Archibald, Alan; Gatphayak, Kesinee; Knorr, Christophe; Triantafyllidis, Alex; Alexandri, Panoraia; Semiadi, Gono; Hanotte, Olivier; Dias, Deodália; Dovč, Peter; Uimari, Pekka; Iacolina, Laura; Scandura, Massimo; Groenen, Martien A M; Huang, Lusheng; Megens, Hendrik-Jan

    2017-09-21

    Pigs were domesticated independently in Eastern and Western Eurasia early during the agricultural revolution, and have since been transported and traded across the globe. Here, we present a worldwide survey on 60K genome-wide single nucleotide polymorphism (SNP) data for 2093 pigs, including 1839 domestic pigs representing 122 local and commercial breeds, 215 wild boars, and 39 out-group suids, from Asia, Europe, America, Oceania and Africa. The aim of this study was to infer global patterns in pig domestication and diversity related to demography, migration, and selection. A deep phylogeographic division reflects the dichotomy between early domestication centers. In the core Eastern and Western domestication regions, Chinese pigs show differentiation between breeds due to geographic isolation, whereas this is less pronounced in European pigs. The inferred European origin of pigs in the Americas, Africa, and Australia reflects European expansion during the sixteenth to nineteenth centuries. Human-mediated introgression, which is due, in particular, to importing Chinese pigs into the UK during the eighteenth and nineteenth centuries, played an important role in the formation of modern pig breeds. Inbreeding levels vary markedly between populations, from almost no runs of homozygosity (ROH) in a number of Asian wild boar populations, to up to 20% of the genome covered by ROH in a number of Southern European breeds. Commercial populations show moderate ROH statistics. For domesticated pigs and wild boars in Asia and Europe, we identified highly differentiated loci that include candidate genes related to muscle and body development, central nervous system, reproduction, and energy balance, which are putatively under artificial selection. Key events related to domestication, dispersal, and mixing of pigs from different regions are reflected in the 60K SNP data, including the globalization that has recently become full circle since Chinese pig breeders in the past

  10. Development of admixture mapping panels for African Americans from commercial high-density SNP arrays

    Directory of Open Access Journals (Sweden)

    Dunston Georgia M

    2010-07-01

    Full Text Available Abstract Background Admixture mapping is a powerful approach for identifying genetic variants involved in human disease that exploits the unique genomic structure in recently admixed populations. To use existing published panels of ancestry-informative markers (AIMs for admixture mapping, markers have to be genotyped de novo for each admixed study sample and samples representing the ancestral parental populations. The increased availability of dense marker data on commercial chips has made it feasible to develop panels wherein the markers need not be predetermined. Results We developed two panels of AIMs (~2,000 markers each based on the Affymetrix Genome-Wide Human SNP Array 6.0 for admixture mapping with African American samples. These two AIM panels had good map power that was higher than that of a denser panel of ~20,000 random markers as well as other published panels of AIMs. As a test case, we applied the panels in an admixture mapping study of hypertension in African Americans in the Washington, D.C. metropolitan area. Conclusions Developing marker panels for admixture mapping from existing genome-wide genotype data offers two major advantages: (1 no de novo genotyping needs to be done, thereby saving costs, and (2 markers can be filtered for various quality measures and replacement markers (to minimize gaps can be selected at no additional cost. Panels of carefully selected AIMs have two major advantages over panels of random markers: (1 the map power from sparser panels of AIMs is higher than that of ~10-fold denser panels of random markers, and (2 clusters can be labeled based on information from the parental populations. With current technology, chip-based genome-wide genotyping is less expensive than genotyping ~20,000 random markers. The major advantage of using random markers is the absence of ascertainment effects resulting from the process of selecting markers. The ability to develop marker panels informative for ancestry from

  11. A procedure for the detection of linkage with high density SNP arrays in a large pedigree with colorectal cancer

    International Nuclear Information System (INIS)

    Middeldorp, Anneke; Wijnen, Juul T; Wezel, Tom van; Jagmohan-Changur, Shantie; Helmer, Quinta; Klift, Heleen M van der; Tops, Carli MJ; Vasen, Hans FA; Devilee, Peter; Morreau, Hans; Houwing-Duistermaat, Jeanine J

    2007-01-01

    The apparent dominant model of colorectal cancer (CRC) inheritance in several large families, without mutations in known CRC susceptibility genes, suggests the presence of so far unidentified genes with strong or moderate effect on the development of CRC. Linkage analysis could lead to identification of susceptibility genes in such families. In comparison to classical linkage analysis with multi-allelic markers, single nucleotide polymorphism (SNP) arrays have increased information content and can be processed with higher throughput. Therefore, SNP arrays can be excellent tools for linkage analysis. However, the vast number of SNPs on the SNP arrays, combined with large informative pedigrees (e.g. >35–40 bits), presents us with a computational complexity that is challenging for existing statistical packages or even exceeds their capacity. We therefore setup a procedure for linkage analysis in large pedigrees and validated the method by genotyping using SNP arrays of a colorectal cancer family with a known MLH1 germ line mutation. Quality control of the genotype data was performed in Alohomora, Mega2 and SimWalk2, with removal of uninformative SNPs, Mendelian inconsistencies and Mendelian consistent errors, respectively. Linkage disequilibrium was measured by SNPLINK and Merlin. Parametric linkage analysis using two flanking markers was performed using MENDEL. For multipoint parametric linkage analysis and haplotype analysis, SimWalk2 was used. On chromosome 3, in the MLH1-region, a LOD score of 1.9 was found by parametric linkage analysis using two flanking markers. On chromosome 11 a small region with LOD 1.1 was also detected. Upon linkage disequilibrium removal, multipoint linkage analysis yielded a LOD score of 2.1 in the MLH1 region, whereas the LOD score dropped to negative values in the region on chromosome 11. Subsequent haplotype analysis in the MLH1 region perfectly matched the mutation status of the family members. We developed a workflow for linkage

  12. Quantitative analysis of low-density SNP data for parentage assignment and estimation of family contributions to pooled samples.

    Science.gov (United States)

    Henshall, John M; Dierens, Leanne; Sellars, Melony J

    2014-09-02

    While much attention has focused on the development of high-density single nucleotide polymorphism (SNP) assays, the costs of developing and running low-density assays have fallen dramatically. This makes it feasible to develop and apply SNP assays for agricultural species beyond the major livestock species. Although low-cost low-density assays may not have the accuracy of the high-density assays widely used in human and livestock species, we show that when combined with statistical analysis approaches that use quantitative instead of discrete genotypes, their utility may be improved. The data used in this study are from a 63-SNP marker Sequenom® iPLEX Platinum panel for the Black Tiger shrimp, for which high-density SNP assays are not currently available. For quantitative genotypes that could be estimated, in 5% of cases the most likely genotype for an individual at a SNP had a probability of less than 0.99. Matrix formulations of maximum likelihood equations for parentage assignment were developed for the quantitative genotypes and also for discrete genotypes perturbed by an assumed error term. Assignment rates that were based on maximum likelihood with quantitative genotypes were similar to those based on maximum likelihood with perturbed genotypes but, for more than 50% of cases, the two methods resulted in individuals being assigned to different families. Treating genotypes as quantitative values allows the same analysis framework to be used for pooled samples of DNA from multiple individuals. Resulting correlations between allele frequency estimates from pooled DNA and individual samples were consistently greater than 0.90, and as high as 0.97 for some pools. Estimates of family contributions to the pools based on quantitative genotypes in pooled DNA had a correlation of 0.85 with estimates of contributions from DNA-derived pedigree. Even with low numbers of SNPs of variable quality, parentage testing and family assignment from pooled samples are

  13. Population structure and genetic diversity characterization of a sunflower association mapping population using SSR and SNP markers.

    Science.gov (United States)

    Filippi, Carla V; Aguirre, Natalia; Rivas, Juan G; Zubrzycki, Jeremias; Puebla, Andrea; Cordes, Diego; Moreno, Maria V; Fusari, Corina M; Alvarez, Daniel; Heinz, Ruth A; Hopp, Horacio E; Paniego, Norma B; Lia, Veronica V

    2015-02-13

    Argentina has a long tradition of sunflower breeding, and its germplasm is a valuable genetic resource worldwide. However, knowledge of the genetic constitution and variability levels of the Argentinean germplasm is still scarce, rendering the global map of cultivated sunflower diversity incomplete. In this study, 42 microsatellite loci and 384 single nucleotide polymorphisms (SNPs) were used to characterize the first association mapping population used for quantitative trait loci mapping in sunflower, along with a selection of allied open-pollinated and composite populations from the germplasm bank of the National Institute of Agricultural Technology of Argentina. The ability of different kinds of markers to assess genetic diversity and population structure was also evaluated. The analysis of polymorphism in the set of sunflower accessions studied here showed that both the microsatellites and SNP markers were informative for germplasm characterization, although to different extents. In general, the estimates of genetic variability were moderate. The average genetic diversity, as quantified by the expected heterozygosity, was 0.52 for SSR loci and 0.29 for SNPs. Within SSR markers, those derived from non-coding regions were able to capture higher levels of diversity than EST-SSR. A significant correlation was found between SSR and SNP- based genetic distances among accessions. Bayesian and multivariate methods were used to infer population structure. Evidence for the existence of three different genetic groups was found consistently across data sets (i.e., SSR, SNP and SSR + SNP), with the maintainer/restorer status being the most prevalent characteristic associated with group delimitation. The present study constitutes the first report comparing the performance of SSR and SNP markers for population genetics analysis in cultivated sunflower. We show that the SSR and SNP panels examined here, either used separately or in conjunction, allowed consistent

  14. Whole-genome single-nucleotide polymorphism (SNP marker discovery and association analysis with the eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA content in Larimichthys crocea

    Directory of Open Access Journals (Sweden)

    Shijun Xiao

    2016-12-01

    Full Text Available Whole-genome single-nucleotide polymorphism (SNP markers are valuable genetic resources for the association and conservation studies. Genome-wide SNP development in many teleost species are still challenging because of the genome complexity and the cost of re-sequencing. Genotyping-By-Sequencing (GBS provided an efficient reduced representative method to squeeze cost for SNP detection; however, most of recent GBS applications were reported on plant organisms. In this work, we used an EcoRI-NlaIII based GBS protocol to teleost large yellow croaker, an important commercial fish in China and East-Asia, and reported the first whole-genome SNP development for the species. 69,845 high quality SNP markers that evenly distributed along genome were detected in at least 80% of 500 individuals. Nearly 95% randomly selected genotypes were successfully validated by Sequenom MassARRAY assay. The association studies with the muscle eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA content discovered 39 significant SNP markers, contributing as high up to ∼63% genetic variance that explained by all markers. Functional genes that involved in fat digestion and absorption pathway were identified, such as APOB, CRAT and OSBPL10. Notably, PPT2 Gene, previously identified in the association study of the plasma n-3 and n-6 polyunsaturated fatty acid level in human, was re-discovered in large yellow croaker. Our study verified that EcoRI-NlaIII based GBS could produce quality SNP markers in a cost-efficient manner in teleost genome. The developed SNP markers and the EPA and DHA associated SNP loci provided invaluable resources for the population structure, conservation genetics and genomic selection of large yellow croaker and other fish organisms.

  15. Development of a rapid SNP-typing assay to differentiate Bifidobacterium animalis ssp. lactis strains used in probiotic-supplemented dairy products.

    Science.gov (United States)

    Lomonaco, Sara; Furumoto, Emily J; Loquasto, Joseph R; Morra, Patrizia; Grassi, Ausilia; Roberts, Robert F

    2015-02-01

    Identification at the genus, species, and strain levels is desirable when a probiotic microorganism is added to foods. Strains of Bifidobacterium animalis ssp. lactis (BAL) are commonly used worldwide in dairy products supplemented with probiotic strains. However, strain discrimination is difficult because of the high degree of genome identity (99.975%) between different genomes of this subspecies. Typing of monomorphic species can be carried out efficiently by targeting informative single nucleotide polymorphisms (SNP). Findings from a previous study analyzing both reference and commercial strains of BAL identified SNP that could be used to discriminate common strains into 8 groups. This paper describes development of a minisequencing assay based on the primer extension reaction (PER) targeting multiple SNP that can allow strain differentiation of BAL. Based on previous data, 6 informative SNP were selected for further testing, and a multiplex preliminary PCR was optimized to amplify the DNA regions containing the selected SNP. Extension primers (EP) annealing immediately adjacent to the selected SNP were developed and tested in simplex and multiplex PER to evaluate their performance. Twenty-five strains belonging to 9 distinct genomic clusters of B. animalis ssp. lactis were selected and analyzed using the developed minisequencing assay, simultaneously targeting the 6 selected SNP. Fragment analysis was subsequently carried out in duplicate and demonstrated that the assay yielded 8 specific profiles separating the most commonly used commercial strains. This novel multiplex PER approach provides a simple, rapid, flexible SNP-based subtyping method for proper characterization and identification of commercial probiotic strains of BAL from fermented dairy products. To assess the usefulness of this method, DNA was extracted from yogurt manufactured with and without the addition of B. animalis ssp. lactis BB-12. Extracted DNA was then subjected to the minisequencing

  16. De novo SNP discovery in the Scandinavian brown bear (Ursus arctos.

    Directory of Open Access Journals (Sweden)

    Anita J Norman

    Full Text Available Information about relatedness between individuals in wild populations is advantageous when studying evolutionary, behavioural and ecological processes. Genomic data can be used to determine relatedness between individuals either when no prior knowledge exists or to confirm suspected relatedness. Here we present a set of 96 SNPs suitable for inferring relatedness for brown bears (Ursus arctos within Scandinavia. We sequenced reduced representation libraries from nine individuals throughout the geographic range. With consensus reads containing putative SNPs, we applied strict filtering criteria with the aim of finding only high-quality, highly-informative SNPs. We tested 150 putative SNPs of which 96% were validated on a panel of 68 individuals. Ninety-six of the validated SNPs with the highest minor allele frequency were selected. The final SNP panel includes four mitochondrial markers, two monomorphic Y-chromosome sex-determination markers, three X-chromosome SNPs and 87 autosomal SNPs. From our validation sample panel, we identified two previously known parent-offspring dyads with reasonable accuracy. This panel of SNPs is a promising tool for inferring relatedness in the brown bear population in Scandinavia.

  17. Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis.

    Science.gov (United States)

    Waterfall, C M; Cobb, B D

    2001-12-01

    Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a 'matrix-based' optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable.

  18. Design of a bovine low-density SNP array optimized for imputation.

    Directory of Open Access Journals (Sweden)

    Didier Boichard

    Full Text Available The Illumina BovineLD BeadChip was designed to support imputation to higher density genotypes in dairy and beef breeds by including single-nucleotide polymorphisms (SNPs that had a high minor allele frequency as well as uniform spacing across the genome except at the ends of the chromosome where densities were increased. The chip also includes SNPs on the Y chromosome and mitochondrial DNA loci that are useful for determining subspecies classification and certain paternal and maternal breed lineages. The total number of SNPs was 6,909. Accuracy of imputation to Illumina BovineSNP50 genotypes using the BovineLD chip was over 97% for most dairy and beef populations. The BovineLD imputations were about 3 percentage points more accurate than those from the Illumina GoldenGate Bovine3K BeadChip across multiple populations. The improvement was greatest when neither parent was genotyped. The minor allele frequencies were similar across taurine beef and dairy breeds as was the proportion of SNPs that were polymorphic. The new BovineLD chip should facilitate low-cost genomic selection in taurine beef and dairy cattle.

  19. Cathepsin D SNP associated with increased risk of variant Creutzfeldt-Jakob disease

    Directory of Open Access Journals (Sweden)

    Sanchez-Juan Pascual

    2008-04-01

    Full Text Available Abstract Background Variant Creutzfeldt-Jakob disease (vCJD originally resulted from the consumption of foodstuffs contaminated by bovine spongiform encephalopathy (BSE material, with 163 confirmed cases in the UK to date. Many thousands are likely to have been exposed to dietary infection and so it is important (for surveillance, epidemic modelling, public health and understanding pathogenesis to identify genetic factors that may affect individual susceptibility to infection. This study looked at a polymorphism in the cathepsin D gene (refSNP ID: rs17571 previously examined in Alzheimer's disease (AD. Methods Blood samples taken from 110 vCJD patients were tested for the C-T base change, and genotype data were compared with published frequencies for a control population using multiple logistic regression. Results There was a significant excess of the cathepsin D polymorphism TT genotype in the vCJD cohort compared to controls. The TT genotype was found to have a 9.75 fold increase in risk of vCJD compared to the CT genotype and a 10.92 fold increase compared to the CC genotype. Conclusion This mutation event has been observed to alter the protease activity of the cathepsin D protein and has been linked to an increase in amyloid beta plaque formation in AD. vCJD neuropathology is characterised by the presence of amyloid plaques, formed from the prion protein, and therefore alterations in the amyloid processing activity of cathepsin D may affect the neuropathogenesis of this disease.

  20. Use of direct and iterative solvers for estimation of SNP effects in genome-wide selection

    Directory of Open Access Journals (Sweden)

    Eduardo da Cruz Gouveia Pimentel

    2010-01-01

    Full Text Available The aim of this study was to compare iterative and direct solvers for estimation of marker effects in genomic selection. One iterative and two direct methods were used: Gauss-Seidel with Residual Update, Cholesky Decomposition and Gentleman-Givens rotations. For resembling different scenarios with respect to number of markers and of genotyped animals, a simulated data set divided into 25 subsets was used. Number of markers ranged from 1,200 to 5,925 and number of animals ranged from 1,200 to 5,865. Methods were also applied to real data comprising 3081 individuals genotyped for 45181 SNPs. Results from simulated data showed that the iterative solver was substantially faster than direct methods for larger numbers of markers. Use of a direct solver may allow for computing (covariances of SNP effects. When applied to real data, performance of the iterative method varied substantially, depending on the level of ill-conditioning of the coefficient matrix. From results with real data, Gentleman-Givens rotations would be the method of choice in this particular application as it provided an exact solution within a fairly reasonable time frame (less than two hours. It would indeed be the preferred method whenever computer resources allow its use.

  1. Genetic relationships among Vietnamese local pigs investigated using genome-wide SNP markers.

    Science.gov (United States)

    Ishihara, S; Arakawa, A; Taniguchi, M; Luu, Q M; Pham, D L; Nguyen, B V; Mikawa, S; Kikuchi, K

    2018-02-01

    Vietnam is one of the most important countries for pig domestication, and a total of 26 local breeds have been reported. In the present study, genetic relationships among the various pig breeds were investigated using 90 samples collected from local pigs (15 breeds) in 15 distantly separated, distinct areas of the country and six samples from Landrace pigs in Hanoi as an out-group of a common Western breed. All samples were genotyped using the Illumina Porcine SNP60 v2 Genotyping BeadChip. We used 15 160-15 217 SNPs that showed a high degree of polymorphism in the Vietnamese breeds for identifying genetic relationships among the Vietnamese breeds. Principal components analysis showed that most pigs indigenous to Vietnam formed clusters correlated with their original geographic locations. Some Vietnamese breeds formed a cluster that was genetically related to the Western breed Landrace, suggesting the possibility of crossbreeding. These findings will be useful for the conservation and management of Vietnamese local pig breeds. © 2018 Stichting International Foundation for Animal Genetics.

  2. SNPpy--database management for SNP data from genome wide association studies.

    Directory of Open Access Journals (Sweden)

    Faheem Mitha

    Full Text Available BACKGROUND: We describe SNPpy, a hybrid script database system using the Python SQLAlchemy library coupled with the PostgreSQL database to manage genotype data from Genome-Wide Association Studies (GWAS. This system makes it possible to merge study data with HapMap data and merge across studies for meta-analyses, including data filtering based on the values of phenotype and Single-Nucleotide Polymorphism (SNP data. SNPpy and its dependencies are open source software. RESULTS: The current version of SNPpy offers utility functions to import genotype and annotation data from two commercial platforms. We use these to import data from two GWAS studies and the HapMap Project. We then export these individual datasets to standard data format files that can be imported into statistical software for downstream analyses. CONCLUSIONS: By leveraging the power of relational databases, SNPpy offers integrated management and manipulation of genotype and phenotype data from GWAS studies. The analysis of these studies requires merging across GWAS datasets as well as patient and marker selection. To this end, SNPpy enables the user to filter the data and output the results as standardized GWAS file formats. It does low level and flexible data validation, including validation of patient data. SNPpy is a practical and extensible solution for investigators who seek to deploy central management of their GWAS data.

  3. dartr: An r package to facilitate analysis of SNP data generated from reduced representation genome sequencing.

    Science.gov (United States)

    Gruber, Bernd; Unmack, Peter J; Berry, Oliver F; Georges, Arthur

    2018-05-01

    Although vast technological advances have been made and genetic software packages are growing in number, it is not a trivial task to analyse SNP data. We announce a new r package, dartr, enabling the analysis of single nucleotide polymorphism data for population genomic and phylogenomic applications. dartr provides user-friendly functions for data quality control and marker selection, and permits rigorous evaluations of conformation to Hardy-Weinberg equilibrium, gametic-phase disequilibrium and neutrality. The package reports standard descriptive statistics, permits exploration of patterns in the data through principal components analysis and conducts standard F-statistics, as well as basic phylogenetic analyses, population assignment, isolation by distance and exports data to a variety of commonly used downstream applications (e.g., newhybrids, faststructure and phylogeny applications) outside of the r environment. The package serves two main purposes: first, a user-friendly approach to lower the hurdle to analyse such data-therefore, the package comes with a detailed tutorial targeted to the r beginner to allow data analysis without requiring deep knowledge of r. Second, we use a single, well-established format-genlight from the adegenet package-as input for all our functions to avoid data reformatting. By strictly using the genlight format, we hope to facilitate this format as the de facto standard of future software developments and hence reduce the format jungle of genetic data sets. The dartr package is available via the r CRAN network and GitHub. © 2017 John Wiley & Sons Ltd.

  4. Family-based multi-SNP X chromosome analysis using parental information

    Directory of Open Access Journals (Sweden)

    Alison S. Wise

    2016-02-01

    Full Text Available We propose a method for association analysis of haplotypes on the X chromosome that offers both improved power and robustness to population stratification in studies of affected offspring and their parents if all three have been genotyped. The method makes use of assumed parental haplotype exchangeability, a weaker assumption than Hardy-Weinberg equilibrium. Parental haplotype exchangeability requires that in the source population, of the three X chromosome haplotypes carried by the two parents, each is equally likely to be carried by the father. We propose a pseudo-sibling approach that exploits that exchangeability assumption. Our method extends the single-SNP PIX-LRT method to multiple SNPs in a high linkage block. We describe methods for testing the parental haplotype exchangeability assumption and also for determining how apparent violations can be distinguished from true fetal effects or maternally-mediated effects. We show results of simulations that demonstrate nominal type I error rate and good power. The methods are then applied to dbGaP data on the birth defect oral cleft, using both Asian and Caucasian families with cleft.

  5. Reducing Bias of Allele Frequency Estimates by Modeling SNP Genotype Data with Informative Missingness

    Directory of Open Access Journals (Sweden)

    Wan-Yu eLin

    2012-06-01

    Full Text Available The presence of missing single-nucleotide polymorphism (SNP genotypes is common in genetic data. For studies with low-density SNPs, the most commonly used approach to deal with genotype missingness is to simply remove the observations with missing genotypes from the analyses. This naïve method is straightforward but is appropriate only when the missingness is random. However, a given assay often has a different capability in genotyping heterozygotes and homozygotes, causing the phenomenon of ‘differential dropout’ in the sense that the missing rates of heterozygotes and homozygotes are different. In practice, differential dropout among genotypes exists in even carefully designed studies, such as the data from the HapMap project and the Wellcome Trust Case Control Consortium. In this study, we propose a statistical method to model the differential dropout among different genotypes. Compared with the naïve method, our method provides more accurate allele frequency estimates when the differential dropout is present. To demonstrate its practical use, we further apply our method to the HapMap data and a scleroderma data set.

  6. Genetic Diversity in Jatropha curcas L. Assessed with SSR and SNP Markers

    Directory of Open Access Journals (Sweden)

    Juan M. Montes

    2014-08-01

    Full Text Available Jatropha curcas L. (jatropha is an undomesticated plant that has recently received great attention for its utilization in biofuel production, rehabilitation of wasteland, and rural development. Knowledge of genetic diversity and marker-trait associations is urgently needed for the design of breeding strategies. The main goal of this study was to assess the genetic structure and diversity in jatropha germplasm with co-dominant markers (Simple Sequence Repeats (SSR and Single Nucleotide Polymorphism (SNP in a diverse, worldwide, germplasm panel of 70 accessions. We found a high level of homozygosis in the germplasm that does not correspond to the purely outcrossing mating system assumed to be present in jatropha. We hypothesize that the prevalent mating system of jatropha comprise a high level of self-fertilization and that the outcrossing rate is low. Genetic diversity in accessions from Central America and Mexico was higher than in accession from Africa, Asia, and South America. We identified makers associated with the presence of phorbol esters. We think that the utilization of molecular markers in breeding of jatropha will significantly accelerate the development of improved cultivars.

  7. Detecting selection signatures between Duroc and Duroc synthetic pig populations using high-density SNP chip.

    Science.gov (United States)

    Edea, Z; Hong, J-K; Jung, J-H; Kim, D-W; Kim, Y-M; Kim, E-S; Shin, S S; Jung, Y C; Kim, K-S

    2017-08-01

    The development of high throughput genotyping techniques has facilitated the identification of selection signatures of pigs. The detection of genomic selection signals in a population subjected to differential selection pressures may provide insights into the genes associated with economically and biologically important traits. To identify genomic regions under selection, we genotyped 488 Duroc (D) pigs and 155 D × Korean native pigs (DKNPs) using the Porcine SNP70K BeadChip. By applying the F ST and extended haplotype homozygosity (EHH-Rsb) methods, we detected genes under directional selection associated with growth/stature (DOCK7, PLCB4, HS2ST1, FBP2 and TG), carcass and meat quality (TG, COL14A1, FBXO5, NR3C1, SNX7, ARHGAP26 and DPYD), number of teats (LOC100153159 and LRRC1), pigmentation (MME) and ear morphology (SOX5), which are all mostly near or at fixation. These results could be a basis for investigating the underlying mutations associated with observed phenotypic variation. Validation using genome-wide association analysis would also facilitate the inclusion of some of these markers in genetic evaluation programs. © 2017 Stichting International Foundation for Animal Genetics.

  8. SNP Analysis and Whole Exome Sequencing: Their Application in the Analysis of a Consanguineous Pedigree Segregating Ataxia

    Directory of Open Access Journals (Sweden)

    Sarah L. Nickerson

    2015-10-01

    Full Text Available Autosomal recessive cerebellar ataxia encompasses a large and heterogeneous group of neurodegenerative disorders. We employed single nucleotide polymorphism (SNP analysis and whole exome sequencing to investigate a consanguineous Maori pedigree segregating ataxia. We identified a novel mutation in exon 10 of the SACS gene: c.7962T>G p.(Tyr2654*, establishing the diagnosis of autosomal recessive spastic ataxia of Charlevoix-Saguenay (ARSACS. Our findings expand both the genetic and phenotypic spectrum of this rare disorder, and highlight the value of high-density SNP analysis and whole exome sequencing as powerful and cost-effective tools in the diagnosis of genetically heterogeneous disorders such as the hereditary ataxias.

  9. Identification of T1D susceptibility genes within the MHC region by combining protein interaction networks and SNP genotyping data

    DEFF Research Database (Denmark)

    Brorsson, C.; Hansen, Niclas Tue; Hansen, Kasper Lage

    2009-01-01

    genes. We have developed a novel method that combines single nucleotide polymorphism (SNP) genotyping data with protein-protein interaction (ppi) networks to identify disease-associated network modules enriched for proteins encoded from the MHC region. Approximately 2500 SNPs located in the 4 Mb MHC......To develop novel methods for identifying new genes that contribute to the risk of developing type 1 diabetes within the Major Histocompatibility Complex (MHC) region on chromosome 6, independently of the known linkage disequilibrium (LD) between human leucocyte antigen (HLA)-DRB1, -DQA1, -DQB1...... region were analysed in 1000 affected offspring trios generated by the Type 1 Diabetes Genetics Consortium (T1DGC). The most associated SNP in each gene was chosen and genes were mapped to ppi networks for identification of interaction partners. The association testing and resulting interacting protein...

  10. GACT: a Genome build and Allele definition Conversion Tool for SNP imputation and meta-analysis in genetic association studies.

    Science.gov (United States)

    Sulovari, Arvis; Li, Dawei

    2014-07-19

    Genome-wide association studies (GWAS) have successfully identified genes associated with complex human diseases. Although much of the heritability remains unexplained, combining single nucleotide polymorphism (SNP) genotypes from multiple studies for meta-analysis will increase the statistical power to identify new disease-associated variants. Meta-analysis requires same allele definition (nomenclature) and genome build among individual studies. Similarly, imputation, commonly-used prior to meta-analysis, requires the same consistency. However, the genotypes from various GWAS are generated using different genotyping platforms, arrays or SNP-calling approaches, resulting in use of different genome builds and allele definitions. Incorrect assumptions of identical allele definition among combined GWAS lead to a large portion of discarded genotypes or incorrect association findings. There is no published tool that predicts and converts among all major allele definitions. In this study, we have developed a tool, GACT, which stands for Genome build and Allele definition Conversion Tool, that predicts and inter-converts between any of the common SNP allele definitions and between the major genome builds. In addition, we assessed several factors that may affect imputation quality, and our results indicated that inclusion of singletons in the reference had detrimental effects while ambiguous SNPs had no measurable effect. Unexpectedly, exclusion of genotypes with missing rate > 0.001 (40% of study SNPs) showed no significant decrease of imputation quality (even significantly higher when compared to the imputation with singletons in the reference), especially for rare SNPs. GACT is a new, powerful, and user-friendly tool with both command-line and interactive online versions that can accurately predict, and convert between any of the common allele definitions and between genome builds for genome-wide meta-analysis and imputation of genotypes from SNP-arrays or deep

  11. A low-density SNP array for analyzing differential selection in freshwater and marine populations of threespine stickleback (Gasterosteus aculeatus).

    Science.gov (United States)

    Ferchaud, Anne-Laure; Pedersen, Susanne H; Bekkevold, Dorte; Jian, Jianbo; Niu, Yongchao; Hansen, Michael M

    2014-10-06

    The threespine stickleback (Gasterosteus aculeatus) has become an important model species for studying both contemporary and parallel evolution. In particular, differential adaptation to freshwater and marine environments has led to high differentiation between freshwater and marine stickleback populations at the phenotypic trait of lateral plate morphology and the underlying candidate gene Ectodysplacin (EDA). Many studies have focused on this trait and candidate gene, although other genes involved in marine-freshwater adaptation may be equally important. In order to develop a resource for rapid and cost efficient analysis of genetic divergence between freshwater and marine sticklebacks, we generated a low-density SNP (Single Nucleotide Polymorphism) array encompassing markers of chromosome regions under putative directional selection, along with neutral markers for background. RAD (Restriction site Associated DNA) sequencing of sixty individuals representing two freshwater and one marine population led to the identification of 33,993 SNP markers. Ninety-six of these were chosen for the low-density SNP array, among which 70 represented SNPs under putatively directional selection in freshwater vs. marine environments, whereas 26 SNPs were assumed to be neutral. Annotation of these regions revealed several genes that are candidates for affecting stickleback phenotypic variation, some of which have been observed in previous studies whereas others are new. We have developed a cost-efficient low-density SNP array that allows for rapid screening of polymorphisms in threespine stickleback. The array provides a valuable tool for analyzing adaptive divergence between freshwater and marine stickleback populations beyond the well-established candidate gene Ectodysplacin (EDA).

  12. Conclusive evidence for hexasomic inheritance in chrysanthemum based on analysis of a 183 k SNP array.

    Science.gov (United States)

    van Geest, Geert; Voorrips, Roeland E; Esselink, Danny; Post, Aike; Visser, Richard Gf; Arens, Paul

    2017-08-07

    Cultivated chrysanthemum is an outcrossing hexaploid (2n = 6× = 54) with a disputed mode of inheritance. In this paper, we present a single nucleotide polymorphism (SNP) selection pipeline that was used to design an Affymetrix Axiom array with 183 k SNPs from RNA sequencing data (1). With this array, we genotyped four bi-parental populations (with sizes of 405, 53, 76 and 37 offspring plants respectively), and a cultivar panel of 63 genotypes. Further, we present a method for dosage scoring in hexaploids from signal intensities of the array based on mixture models (2) and validation of selection steps in the SNP selection pipeline (3). The resulting genotypic data is used to draw conclusions on the mode of inheritance in chrysanthemum (4), and to make an inference on allelic expression bias (5). With use of the mixture model approach, we successfully called the dosage of 73,936 out of 183,130 SNPs (40.4%) that segregated in any of the bi-parental populations. To investigate the mode of inheritance, we analysed markers that segregated in the large bi-parental population (n = 405). Analysis of segregation of duplex x nulliplex SNPs resulted in evidence for genome-wide hexasomic inheritance. This evidence was substantiated by the absence of strong linkage between markers in repulsion, which indicated absence of full disomic inheritance. We present the success rate of SNP discovery out of RNA sequencing data as affected by different selection steps, among which SNP coverage over genotypes and use of different types of sequence read mapping software. Genomic dosage highly correlated with relative allele coverage from the RNA sequencing data, indicating that most alleles are expressed according to their genomic dosage. The large population, genotyped with a very large number of markers, is a unique framework for extensive genetic analyses in hexaploid chrysanthemum. As starting point, we show conclusive evidence for genome-wide hexasomic inheritance.

  13. Snpdat: Easy and rapid annotation of results from de novo snp discovery projects for model and non-model organisms

    Directory of Open Access Journals (Sweden)

    Doran Anthony G

    2013-02-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the most abundant genetic variant found in vertebrates and invertebrates. SNP discovery has become a highly automated, robust and relatively inexpensive process allowing the identification of many thousands of mutations for model and non-model organisms. Annotating large numbers of SNPs can be a difficult and complex process. Many tools available are optimised for use with organisms densely sampled for SNPs, such as humans. There are currently few tools available that are species non-specific or support non-model organism data. Results Here we present SNPdat, a high throughput analysis tool that can provide a comprehensive annotation of both novel and known SNPs for any organism with a draft sequence and annotation. Using a dataset of 4,566 SNPs identified in cattle using high-throughput DNA sequencing we demonstrate the annotations performed and the statistics that can be generated by SNPdat. Conclusions SNPdat provides users with a simple tool for annotation of genomes that are either not supported by other tools or have a small number of annotated SNPs available. SNPdat can also be used to analyse datasets from organisms which are densely sampled for SNPs. As a command line tool it can easily be incorporated into existing SNP discovery pipelines and fills a niche for analyses involving non-model organisms that are not supported by many available SNP annotation tools. SNPdat will be of great interest to scientists involved in SNP discovery and analysis projects, particularly those with limited bioinformatics experience.

  14. A SNP resource for studying North American moose [version 1; referees: 2 approved, 1 approved with reservations

    Directory of Open Access Journals (Sweden)

    Theodore S. Kalbfleisch

    2018-01-01

    Full Text Available Background: Moose (Alces alces colonized the North American continent from Asia less than 15,000 years ago, and spread across the boreal forest regions of Canada and the northern United States (US.  Contemporary populations have low genetic diversity, due either to low number of individuals in the original migration (founder effect, and/or subsequent population bottlenecks in North America.  Genetic tests based on informative single nucleotide polymorphism (SNP markers are helpful in forensic and wildlife conservation activities, but have been difficult to develop for moose, due to the lack of a reference genome assembly and whole genome sequence (WGS data. Methods:  WGS data were generated for four individual moose from the US states of Alaska, Idaho, Wyoming, and Vermont with minimum and average genome coverage depths of 14- and 19-fold, respectively.  Cattle and sheep reference genomes were used for aligning sequence reads and identifying moose SNPs. Results:  Approximately 11% and 9% of moose WGS reads aligned to cattle and sheep genomes, respectively.  The reads clustered at genomic segments, where sequence identity between these species was greater than 95%.  In these segments, average mapped read depth was approximately 19-fold.  Sets of 46,005 and 36,934 high-confidence SNPs were identified from cattle and sheep comparisons, respectively, with 773 and 552 of those having minor allele frequency of 0.5 and conserved flanking sequences in all three species.  Among the four moose, heterozygosity and allele sharing of SNP genotypes were consistent with decreasing levels of moose genetic diversity from west to east.  A minimum set of 317 SNPs, informative across all four moose, was selected as a resource for future SNP assay design. Conclusions:  All SNPs and associated information are available, without restriction, to support development of SNP-based tests for animal identification, parentage determination, and estimating

  15. A high-density SNP map for accurate mapping of seed fibre QTL in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Liezhao Liu

    Full Text Available A high density genetic linkage map for the complex allotetraploid crop species Brassica napus (oilseed rape was constructed in a late-generation recombinant inbred line (RIL population, using genome-wide single nucleotide polymorphism (SNP markers assayed by the Brassica 60 K Infinium BeadChip Array. The linkage map contains 9164 SNP markers covering 1832.9 cM. 1232 bins account for 7648 of the markers. A subset of 2795 SNP markers, with an average distance of 0.66 cM between adjacent markers, was applied for QTL mapping of seed colour and the cell wall fiber components acid detergent lignin (ADL, cellulose and hemicellulose. After phenotypic analyses across four different environments a total of 11 QTL were detected for seed colour and fiber traits. The high-density map considerably improved QTL resolution compared to the previous low-density maps. A previously identified major QTL with very high effects on seed colour and ADL was pinpointed to a narrow genome interval on chromosome A09, while a minor QTL explaining 8.1% to 14.1% of variation for ADL was detected on chromosome C05. Five and three QTL accounting for 4.7% to 21.9% and 7.3% to 16.9% of the phenotypic variation for cellulose and hemicellulose, respectively, were also detected. To our knowledge this is the first description of QTL for seed cellulose and hemicellulose in B. napus, representing interesting new targets for improving oil content. The high density SNP genetic map enables navigation from interesting B. napus QTL to Brassica genome sequences, giving useful new information for understanding the genetics of key seed quality traits in rapeseed.

  16. Identification of a sex-linked SNP marker in the salmon louse (Lepeophtheirus salmonis using RAD sequencing.

    Directory of Open Access Journals (Sweden)

    Stephen N Carmichael

    Full Text Available The salmon louse (Lepeophtheirus salmonis (Krøyer, 1837 is a parasitic copepod that can, if untreated, cause considerable damage to Atlantic salmon (Salmo salar Linnaeus, 1758 and incurs significant costs to the Atlantic salmon mariculture industry. Salmon lice are gonochoristic and normally show sex ratios close to 1:1. While this observation suggests that sex determination in salmon lice is genetic, with only minor environmental influences, the mechanism of sex determination in the salmon louse is unknown. This paper describes the identification of a sex-linked Single Nucleotide Polymorphism (SNP marker, providing the first evidence for a genetic mechanism of sex determination in the salmon louse. Restriction site-associated DNA sequencing (RAD-seq was used to isolate SNP markers in a laboratory-maintained salmon louse strain. A total of 85 million raw Illumina 100 base paired-end reads produced 281,838 unique RAD-tags across 24 unrelated individuals. RAD marker Lsa101901 showed complete association with phenotypic sex for all individuals analysed, being heterozygous in females and homozygous in males. Using an allele-specific PCR assay for genotyping, this SNP association pattern was further confirmed for three unrelated salmon louse strains, displaying complete association with phenotypic sex in a total of 96 genotyped individuals. The marker Lsa101901 was located in the coding region of the prohibitin-2 gene, which showed a sex-dependent differential expression, with mRNA levels determined by RT-qPCR about 1.8-fold higher in adult female than adult male salmon lice. This study's observations of a novel sex-linked SNP marker are consistent with sex determination in the salmon louse being genetic and following a female heterozygous system. Marker Lsa101901 provides a tool to determine the genetic sex of salmon lice, and could be useful in the development of control strategies.

  17. SNP discovery and High Resolution Melting Analysis from massive transcriptome sequencing in the California red abalone Haliotis rufescens.

    Science.gov (United States)

    Valenzuela-Muñoz, Valentina; Araya-Garay, José Miguel; Gallardo-Escárate, Cristian

    2013-06-01

    The California red abalone, Haliotis rufescens that belongs to the Haliotidae family, is the largest species of abalone in the world that has sustained the major fishery and aquaculture production in the USA and Mexico. This native mollusk has not been evaluated or assigned a conservation category even though in the last few decades it was heavily exploited until it disappeared in some areas along the California coast. In Chile, the red abalone was introduced in the 1970s from California wild abalone stocks for the purposes of aquaculture. Considering the number of years that the red abalone has been cultivated in Chile crucial genetic information is scarce and critical issues remain unresolved. This study reports and validates novel single nucleotide polymorphisms (SNP) markers for the red abalone H. rufescens using cDNA pyrosequencing. A total of 622 high quality SNPs were identified in 146 sequences with an estimated frequency of 1 SNP each 1000bp. Forty-five SNPs markers with functional information for gene ontology were selected. Of these, 8 were polymorphic among the individuals screened: Heat shock protein 70 (HSP70), vitellogenin (VTG), lysin, alginate lyase enzyme (AL), Glucose-regulated protein 94 (GRP94), fructose-bisphosphate aldolase (FBA), sulfatase 1A precursor (S1AP) and ornithine decarboxylase antizyme (ODC). Two additional sequences were also identified with polymorphisms but no similarities with known proteins were achieved. To validate the putative SNP markers, High Resolution Melting Analysis (HRMA) was conducted in a wild and hatchery-bred population. Additionally, SNP cross-amplifications were tested in two further native abalone species, Haliotis fulgens and Haliotis corrugata. This study provides novel candidate genes that could be used to evaluate loss of genetic diversity due to hatchery selection or inbreeding effects. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Integrating milk metabolite profile information for the prediction of traditional milk traits based on SNP information for Holstein cows.

    Directory of Open Access Journals (Sweden)

    Nina Melzer

    Full Text Available In this study the benefit of metabolome level analysis for the prediction of genetic value of three traditional milk traits was investigated. Our proposed approach consists of three steps: First, milk metabolite profiles are used to predict three traditional milk traits of 1,305 Holstein cows. Two regression methods, both enabling variable selection, are applied to identify important milk metabolites in this step. Second, the prediction of these important milk metabolite from single nucleotide polymorphisms (SNPs enables the detection of SNPs with significant genetic effects. Finally, these SNPs are used to predict milk traits. The observed precision of predicted genetic values was compared to the results observed for the classical genotype-phenotype prediction using all SNPs or a reduced SNP subset (reduced classical approach. To enable a comparison between SNP subsets, a special invariable evaluation design was implemented. SNPs close to or within known quantitative trait loci (QTL were determined. This enabled us to determine if detected important SNP subsets were enriched in these regions. The results show that our approach can lead to genetic value prediction, but requires less than 1% of the total amount of (40,317 SNPs., significantly more important SNPs in known QTL regions were detected using our approach compared to the reduced classical approach. Concluding, our approach allows a deeper insight into the associations between the different levels of the genotype-phenotype map (genotype-metabolome, metabolome-phenotype, genotype-phenotype.

  19. CGH and SNP array using DNA extracted from fixed cytogenetic preparations and long-term refrigerated bone marrow specimens

    Directory of Open Access Journals (Sweden)

    MacKinnon Ruth N

    2012-02-01

    Full Text Available Abstract Background The analysis of nucleic acids is limited by the availability of archival specimens and the quality and amount of the extracted material. Archived cytogenetic preparations are stored in many laboratories and are a potential source of total genomic DNA for array karyotyping and other applications. Array CGH using DNA from fixed cytogenetic preparations has been described, but it is not known whether it can be used for SNP arrays. Diagnostic bone marrow specimens taken during the assessment of hematological malignancies are also a potential source of DNA, but it is generally assumed that DNA must be extracted, or the specimen frozen, within a day or two of collection, to obtain DNA suitable for further analysis. We have assessed DNA extracted from these materials for both SNP array and array CGH. Results We show that both SNP array and array CGH can be performed on genomic DNA extracted from cytogenetic specimens stored in Carnoy's fixative, and from bone marrow which has been stored unfrozen, at 4°C, for at least 36 days. We describe a procedure for extracting a usable concentration of total genomic DNA from cytogenetic suspensions of low cellularity. Conclusions The ability to use these archival specimens for DNA-based analysis increases the potential for retrospective genetic analysis of clinical specimens. Fixed cytogenetic preparations and long-term refrigerated bone marrow both provide DNA suitable for array karyotyping, and may be suitable for a wider range of analytical procedures.

  20. Effects of sodium nitroprusside (SNP) pretreatment on UV-B stress tolerance in lettuce (Lactuca sativa L.) seedlings.

    Science.gov (United States)

    Esringu, Aslıhan; Aksakal, Ozkan; Tabay, Dilruba; Kara, Ayse Aydan

    2016-01-01

    Ultraviolet-B (UV-B) radiation is one of the most important abiotic stress factors that could influence plant growth, development, and productivity. Nitric oxide (NO) is an important plant growth regulator involved in a wide variety of physiological processes. In the present study, the possibility of enhancing UV-B stress tolerance of lettuce seedlings by the exogenous application of sodium nitroprusside (SNP) was investigated. UV-B radiation increased the activities of superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), peroxidase (POD) and total phenolic concentrations, antioxidant capacity, and expression of phenylalanine ammonia lyase (PAL) gene in seedlings, but the combination of SNP pretreatment and UV-B enhanced antioxidant enzyme activities, total phenolic concentrations, antioxidant capacity, and PAL gene expression even more. Moreover, UV-B radiation significantly inhibited chlorophylls, carotenoid, gibberellic acid (GA), and indole-3-acetic acid (IAA) contents and increased the contents of abscisic acid (ABA), salicylic acid (SA), malondialdehyde (MDA), hydrogen peroxide (H2O2), and superoxide radical (O2•(-)) in lettuce seedlings. When SNP pretreatment was combined with the UV-B radiation, we observed alleviated chlorophylls, carotenoid, GA, and IAA inhibition and decreased content of ABA, SA, MDA, H2O2, and O2•(-) in comparison to non-pretreated stressed seedlings.

  1. Prediction of the optimum hybridization conditions of dot-blot-SNP analysis using estimated melting temperature of oligonucleotide probes.

    Science.gov (United States)

    Shiokai, Sachiko; Kitashiba, Hiroyasu; Nishio, Takeshi

    2010-08-01

    Although the dot-blot-SNP technique is a simple cost-saving technique suitable for genotyping of many plant individuals, optimization of hybridization and washing conditions for each SNP marker requires much time and labor. For prediction of the optimum hybridization conditions for each probe, we compared T (m) values estimated from nucleotide sequences using the DINAMelt web server, measured T (m) values, and hybridization conditions yielding allele-specific signals. The estimated T (m) values were comparable to the measured T (m) values with small differences of less than 3 degrees C for most of the probes. There were differences of approximately 14 degrees C between the specific signal detection conditions and estimated T (m) values. Change of one level of SSC concentrations of 0.1, 0.2, 0.5, and 1.0x SSC corresponded to a difference of approximately 5 degrees C in optimum signal detection temperature. Increasing the sensitivity of signal detection by shortening the exposure time to X-ray film changed the optimum hybridization condition for specific signal detection. Addition of competitive oligonucleotides to the hybridization mixture increased the suitable hybridization conditions by 1.8. Based on these results, optimum hybridization conditions for newly produced dot-blot-SNP markers will become predictable.

  2. Improved technique that allows the performance of large-scale SNP genotyping on DNA immobilized by FTA technology.

    Science.gov (United States)

    He, Hongbin; Argiro, Laurent; Dessein, Helia; Chevillard, Christophe

    2007-01-01

    FTA technology is a novel method designed to simplify the collection, shipment, archiving and purification of nucleic acids from a wide variety of biological sources. The number of punches that can normally be obtained from a single specimen card are often however, insufficient for the testing of the large numbers of loci required to identify genetic factors that control human susceptibility or resistance to multifactorial diseases. In this study, we propose an improved technique to perform large-scale SNP genotyping. We applied a whole genome amplification method to amplify DNA from buccal cell samples stabilized using FTA technology. The results show that using the improved technique it is possible to perform up to 15,000 genotypes from one buccal cell sample. Furthermore, the procedure is simple. We consider this improved technique to be a promising methods for performing large-scale SNP genotyping because the FTA technology simplifies the collection, shipment, archiving and purification of DNA, while whole genome amplification of FTA card bound DNA produces sufficient material for the determination of thousands of SNP genotypes.

  3. Ubiquitin-conjugating enzyme E2-like gene associated to pathogen response in Concholepas concholepas: SNP identification and transcription expression.

    Science.gov (United States)

    Núñez-Acuña, Gustavo; Aguilar-Espinoza, Andrea; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

    2012-10-01

    Ubiquitin-conjugated E2 enzyme (UBE2) is one of the main components of the proteasome degradation cascade. Previous studies have shown an increase of expression levels in individuals challenged to some pathogen organism such as virus and bacteria. The study was to characterize the immune response of UBE2 gene in the gastropod Concholepas concholepas through expression analysis and single nucleotide polymorphisms (SNP) discovery. Hence, UBE2 was identified from a cDNA library by 454 pyrosequencing, while SNP identification and validation were performed using De novo assembly and high resolution melting analysis. Challenge trials with Vibrio anguillarum was carried out to evaluate the relative transcript abundance of UBE2 gene from two to thirty-three hours post-treatment. The results showed a partial UBE2 sequence of 889 base pair (bp) with a partial coding region of 291 bp. SNP variation (A/C) was observed at the 546th position. Individuals challenged by V. anguillarum showed an overexpression of the UBE2 gene, the expression being significantly higher in homozygous individuals (AA) than (CC) or heterozygous individuals (A/C). This study contributes useful information relating to the UBE2 gene and its association with innate immune response in marine invertebrates. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Oceanographic profile temperature, salinity and other measurements collected using bottle from the SNP-1 in the Coastal South Pacific and South Pacific in 1976 (NODC Accession 0001483)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Temperature profile, nutrients, and meteorological data were collected using bottle casts from the SNP-1 in the South Pacific Ocean. Data were collected from 24...

  5. Detection of genomic signatures for pig hairlessness using high-density SNP data

    Directory of Open Access Journals (Sweden)

    Ying SU,Yi LONG,Xinjun LIAO,Huashui AI,Zhiyan ZHANG,Bin YANG,Shijun XIAO,Jianhong TANG,Wenshui XIN,Lusheng HUANG,Jun REN,Nengshui DING

    2014-12-01

    Full Text Available Hair provides thermal regulation for mammals and protects the skin from wounds, bites and ultraviolet (UV radiation, and is important in adaptation to volatile environments. Pigs in nature are divided into hairy and hairless, which provide a good model for deciphering the molecular mechanisms of hairlessness. We conducted a genomic scan for genetically differentiated regions between hairy and hairless pigs using 60K SNP data, with the aim to better understand the genetic basis for the hairless phenotype in pigs. A total of 38405 SNPs in 498 animals from 36 diverse breeds were used to detect genomic signatures for pig hairlessness by estimating between-population (FST values. Seven diversifying signatures between Yucatan hairless pig and hairy pigs were identified on pig chromosomes (SSC 1, 3, 7, 8, 10, 11 and 16, and the biological functions of two notable genes, RGS17 and RB1, were revealed. When Mexican hairless pigs were contrasted with hairypigs, strong signatures were detected on SSC1 and SSC10, which harbor two functionally plausible genes, REV3L and BAMBI. KEGG pathway analysis showed a subset of overrepresented genes involved in the T cell receptor signaling pathway, MAPK signaling pathway and the tight junction pathways. All of these pathways may be important in local adaptability of hairless pigs. The potential mechanisms underlying the hairless phenotype in pigs are reported for the first time. RB1 and BAMBI are interesting candidate genes for the hairless phenotype in Yucatan hairless and Mexico hairless pigs, respectively. RGS17, REV3L, ICOS and RASGRP1 as well as other genes involved in the MAPK and T cell receptor signaling pathways may be important in environmental adaption by improved tolerance to UV damage in hairless pigs. These findings improve our understanding of the genetic basis for inherited hairlessness in pigs.

  6. Simultaneous SNP identification and assessment of allele-specific bias from ChIP-seq data

    Directory of Open Access Journals (Sweden)

    Ni Yunyun

    2012-09-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs have been associated with many aspects of human development and disease, and many non-coding SNPs associated with disease risk are presumed to affect gene regulation. We have previously shown that SNPs within transcription factor binding sites can affect transcription factor binding in an allele-specific and heritable manner. However, such analysis has relied on prior whole-genome genotypes provided by large external projects such as HapMap and the 1000 Genomes Project. This requirement limits the study of allele-specific effects of SNPs in primary patient samples from diseases of interest, where complete genotypes are not readily available. Results In this study, we show that we are able to identify SNPs de novo and accurately from ChIP-seq data generated in the ENCODE Project. Our de novo identified SNPs from ChIP-seq data are highly concordant with published genotypes. Independent experimental verification of more than 100 sites estimates our false discovery rate at less than 5%. Analysis of transcription factor binding at de novo identified SNPs revealed widespread heritable allele-specific binding, confirming previous observations. SNPs identified from ChIP-seq datasets were significantly enriched for disease-associated variants, and we identified dozens of allele-specific binding events in non-coding regions that could distinguish between disease and normal haplotypes. Conclusions Our approach combines SNP discovery, genotyping and allele-specific analysis, but is selectively focused on functional regulatory elements occupied by transcription factors or epigenetic marks, and will therefore be valuable for identifying the functional regulatory consequences of non-coding SNPs in primary disease samples.

  7. Dissection of Recombination Attributes for Multiple Maize Populations Using a Common SNP Assay

    Directory of Open Access Journals (Sweden)

    Haiying Guan

    2017-11-01

    Full Text Available Recombination is a vital characteristic for quantitative trait loci mapping and breeding to enhance the yield potential of maize. However, recombination characteristics in globally used segregating populations have never been evaluated at similar genetic marker densities. This study aimed to divulge the characteristics of recombination events, recombinant chromosomal segments, and recombination frequency for four dissimilar populations. These populations were doubled haploid (DH, recombination inbred line (RIL, intermated B73xMo17 (IBM, and multi-parent advanced generation inter-cross (MAGIC, using the Illumina MaizeSNP50 BeadChip to provide markers. Our results revealed that the average number of recombination events was 16, 41, 72, and 86 per line in DH, RIL, IBM, and MAGIC populations, respectively. Accordingly, the average length of recombinant chromosomal segments was 84.8, 47.3, 29.2, and 20.4 Mb in DH, RIL, IBM, and MAGIC populations, respectively. Furtherly, the recombination frequency varied in different genomic regions and population types [DH (0–12.7 cM/Mb, RIL (0–15.5 cM/Mb, IBM (0–24.1 cM/Mb, MAGIC (0–42.3 cM/Mb]. Utilizing different sub-sets of lines, the recombination bin number and size were analyzed in each population. Additionally, different sub-sets of markers and lines were employed to estimate the recombination bin number and size via formulas for relationship in these populations. The relationship between recombination events and recombination bin length was also examined. Our results contribute to determining the most suitable number of genetic markers, lines in each population, and population type for successful mapping and breeding.

  8. Genome-wide SNP discovery in tetraploid alfalfa using 454 sequencing and high resolution melting analysis

    Directory of Open Access Journals (Sweden)

    Zhao Patrick X

    2011-07-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the most common type of sequence variation among plants and are often functionally important. We describe the use of 454 technology and high resolution melting analysis (HRM for high throughput SNP discovery in tetraploid alfalfa (Medicago sativa L., a species with high economic value but limited genomic resources. Results The alfalfa genotypes selected from M. sativa subsp. sativa var. 'Chilean' and M. sativa subsp. falcata var. 'Wisfal', which differ in water stress sensitivity, were used to prepare cDNA from tissue of clonally-propagated plants grown under either well-watered or water-stressed conditions, and then pooled for 454 sequencing. Based on 125.2 Mb of raw sequence, a total of 54,216 unique sequences were obtained including 24,144 tentative consensus (TCs sequences and 30,072 singletons, ranging from 100 bp to 6,662 bp in length, with an average length of 541 bp. We identified 40,661 candidate SNPs distributed throughout the genome. A sample of candidate SNPs were evaluated and validated using high resolution melting (HRM analysis. A total of 3,491 TCs harboring 20,270 candidate SNPs were located on the M. truncatula (MT 3.5.1 chromosomes. Gene Ontology assignments indicate that sequences obtained cover a broad range of GO categories. Conclusions We describe an efficient method to identify thousands of SNPs distributed throughout the alfalfa genome covering a broad range of GO categories. Validated SNPs represent valuable molecular marker resources that can be used to enhance marker density in linkage maps, identify potential factors involved in heterosis and genetic variation, and as tools for association mapping and genomic selection in alfalfa.

  9. Molecular diagnosis of known recessive ataxias by homozygosity mapping with SNP arrays.

    Science.gov (United States)

    H'mida-Ben Brahim, D; M'zahem, A; Assoum, M; Bouhlal, Y; Fattori, F; Anheim, M; Ali-Pacha, L; Ferrat, F; Chaouch, M; Lagier-Tourenne, C; Drouot, N; Thibaut, C; Benhassine, T; Sifi, Y; Stoppa-Lyonnet, D; N'Guyen, K; Poujet, J; Hamri, A; Hentati, F; Amouri, R; Santorelli, F M; Tazir, M; Koenig, M

    2011-01-01

    The diagnosis of rare inherited diseases is becoming more and more complex as an increasing number of clinical conditions appear to be genetically heterogeneous. Multigenic inheritance also applies to the autosomal recessive progressive cerebellar ataxias (ARCAs), for which 14 genes have been identified and more are expected to be discovered. We used homozygosity mapping as a guide for identification of the defective locus in patients with ARCA born from consanguineous parents. Patients from 97 families were analyzed with GeneChip Mapping 10K or 50K SNP Affymetrix microarrays. We identified six families homozygous for regions containing the autosomal recessive spastic ataxia of Charlevoix-Saguenay (ARSACS) gene, two families homozygous for the ataxia-telangiectasia gene (ATM), two families homozygous for the ataxia with oculomotor apraxia type 1 (AOA1) gene, and one family homozygous for the AOA type 2 (AOA2) gene. Upon direct gene testing, we were able to identify a disease-related mutation in all families but one of the two kindred homozygous at the ATM locus. Although linkage analyses pointed to a single locus on chromosome 11q22.1-q23.1 for this family, clinical features, normal levels of serum alpha-foetoprotein as well as absence of mutations in the ATM gene rather suggest the existence of an additional ARCA-related gene in that interval. While the use of homozygosity mapping was very effective at pointing to the correct gene, it also suggests that the majority of patients harbor mutations either in the genes of the rare forms of ARCA or in genes yet to be identified.

  10. SNP frequency, haplotype structure and linkage disequilibrium in elite maize inbred lines

    Directory of Open Access Journals (Sweden)

    Smith Oscar

    2002-10-01

    Full Text Available Abstract Background Recent studies of ancestral maize populations indicate that linkage disequilibrium tends to dissipate rapidly, sometimes within 100 bp. We set out to examine the linkage disequilibrium and diversity in maize elite inbred lines, which have been subject to population bottlenecks and intense selection by breeders. Such population events are expected to increase the amount of linkage disequilibrium, but reduce diversity. The results of this study will inform the design of genetic association studies. Results We examined the frequency and distribution of DNA polymorphisms at 18 maize genes in 36 maize inbreds, chosen to represent most of the genetic diversity in U.S. elite maize breeding pool. The frequency of nucleotide changes is high, on average one polymorphism per 31 bp in non-coding regions and 1 polymorphism per 124 bp in coding regions. Insertions and deletions are frequent in non-coding regions (1 per 85 bp, but rare in coding regions. A small number (2–8 of distinct and highly diverse haplotypes can be distinguished at all loci examined. Within genes, SNP loci comprising the haplotypes are in linkage disequilibrium with each other. Conclusions No decline of linkage disequilibrium within a few hundred base pairs was found in the elite maize germplasm. This finding, as well as the small number of haplotypes, relative to neutral expectation, is consistent with the effects of breeding-induced bottlenecks and selection on the elite germplasm pool. The genetic distance between haplotypes is large, indicative of an ancient gene pool and of possible interspecific hybridization events in maize ancestry.

  11. Development and validation of the Axiom(®) Apple480K SNP genotyping array.

    Science.gov (United States)

    Bianco, Luca; Cestaro, Alessandro; Linsmith, Gareth; Muranty, Hélène; Denancé, Caroline; Théron, Anthony; Poncet, Charles; Micheletti, Diego; Kerschbamer, Emanuela; Di Pierro, Erica A; Larger, Simone; Pindo, Massimo; Van de Weg, Eric; Davassi, Alessandro; Laurens, François; Velasco, Riccardo; Durel, Charles-Eric; Troggio, Michela

    2016-04-01

    Cultivated apple (Malus × domestica Borkh.) is one of the most important fruit crops in temperate regions, and has great economic and cultural value. The apple genome is highly heterozygous and has undergone a recent duplication which, combined with a rapid linkage disequilibrium decay, makes it difficult to perform genome-wide association (GWA) studies. Single nucleotide polymorphism arrays offer highly multiplexed assays at a relatively low cost per data point and can be a valid tool for the identification of the markers associated with traits of interest. Here, we describe the development and validation of a 487K SNP Affymetrix Axiom(®) genotyping array for apple and discuss its potential applications. The array has been built from the high-depth resequencing of 63 different cultivars covering most of the genetic diversity in cultivated apple. The SNPs were chosen by applying a focal points approach to enrich genic regions, but also to reach a uniform coverage of non-genic regions. A total of 1324 apple accessions, including the 92 progenies of two mapping populations, have been genotyped with the Axiom(®) Apple480K to assess the effectiveness of the array. A large majority of SNPs (359 994 or 74%) fell in the stringent class of poly high resolution polymorphisms. We also devised a filtering procedure to identify a subset of 275K very robust markers that can be safely used for germplasm surveys in apple. The Axiom(®) Apple480K has now been commercially released both for public and proprietary use and will likely be a reference tool for GWA studies in apple. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  12. A functional SNP associated with atopic dermatitis controls cell type-specific methylation of the VSTM1 gene locus

    Directory of Open Access Journals (Sweden)

    Dilip Kumar

    2017-02-01

    Full Text Available Abstract Background Expression quantitative trait loci (eQTL databases represent a valuable resource to link disease-associated SNPs to specific candidate genes whose gene expression is significantly modulated by the SNP under investigation. We previously identified signal inhibitory receptor on leukocytes-1 (SIRL-1 as a powerful regulator of human innate immune cell function. While it is constitutively high expressed on neutrophils, on monocytes the SIRL-1 surface expression varies strongly between individuals. The underlying mechanism of regulation, its genetic control as well as potential clinical implications had not been explored yet. Methods Whole blood eQTL data of a Chinese cohort was used to identify SNPs regulating the expression of VSTM1, the gene encoding SIRL-1. The genotype effect was validated by flow cytometry (cell surface expression, correlated with electrophoretic mobility shift assay (EMSA, chromatin immunoprecipitation (ChIP and bisulfite sequencing (C-methylation and its functional impact studied the inhibition of reactive oxygen species (ROS. Results We found a significant association of a single CpG-SNP, rs612529T/C, located in the promoter of VSTM1. Through flow cytometry analysis we confirmed that primarily in the monocytes the protein level of SIRL-1 is strongly associated with genotype of this SNP. In monocytes, the T allele of this SNP facilitates binding of the transcription factors YY1 and PU.1, of which the latter has been recently shown to act as docking site for modifiers of DNA methylation. In line with this notion rs612529T associates with a complete demethylation of the VSTM1 promoter correlating with the allele-specific upregulation of SIRL-1 expression. In monocytes, this upregulation strongly impacts the IgA-induced production of ROS by these cells. Through targeted association analysis we found a significant Meta P value of 1.14 × 10–6 for rs612529 for association to atopic dermatitis (AD

  13. Species trees from consensus single nucleotide polymorphism (SNP) data: Testing phylogenetic approaches with simulated and empirical data.

    Science.gov (United States)

    Schmidt-Lebuhn, Alexander N; Aitken, Nicola C; Chuah, Aaron

    2017-11-01

    Datasets of hundreds or thousands of SNPs (Single Nucleotide Polymorphisms) from multiple individuals per species are increasingly used to study population structure, species delimitation and shallow phylogenetics. The principal software tool to infer species or population trees from SNP data is currently the BEAST template SNAPP which uses a Bayesian coalescent analysis. However, it is computationally extremely demanding and tolerates only small amounts of missing data. We used simulated and empirical SNPs from plants (Australian Craspedia, Asteraceae, and Pelargonium, Geraniaceae) to compare species trees produced (1) by SNAPP, (2) using SVD quartets, and (3) using Bayesian and parsimony analysis with several different approaches to summarising data from multiple samples into one set of traits per species. Our aims were to explore the impact of tree topology and missing data on the results, and to test which data summarising and analyses approaches would best approximate the results obtained from SNAPP for empirical data. SVD quartets retrieved the correct topology from simulated data, as did SNAPP except in the case of a very unbalanced phylogeny. Both methods failed to retrieve the correct topology when large amounts of data were missing. Bayesian analysis of species level summary data scoring the two alleles of each SNP as independent characters and parsimony analysis of data scoring each SNP as one character produced trees with branch length distributions closest to the true trees on which SNPs were simulated. For empirical data, Bayesian inference and Dollo parsimony analysis of data scored allele-wise produced phylogenies most congruent with the results of SNAPP. In the case of study groups divergent enough for missing data to be phylogenetically informative (because of additional mutations preventing amplification of genomic fragments or bioinformatic establishment of homology), scoring of SNP data as a presence/absence matrix irrespective of allele

  14. Calmodulin-like protein 3 is an estrogen receptor alpha coregulator for gene expression and drug response in a SNP, estrogen, and SERM-dependent fashion.

    Science.gov (United States)

    Qin, Sisi; Ingle, James N; Liu, Mohan; Yu, Jia; Wickerham, D Lawrence; Kubo, Michiaki; Weinshilboum, Richard M; Wang, Liewei

    2017-08-18

    We previously performed a case-control genome-wide association study in women treated with selective estrogen receptor modulators (SERMs) for breast cancer prevention and identified single nucleotide polymorphisms (SNPs) in ZNF423 as potential biomarkers for response to SERM therapy. The ZNF423rs9940645 SNP, which is approximately 200 bp away from the estrogen response elements, resulted in the SNP, estrogen, and SERM-dependent regulation of ZNF423 expression and, "downstream", that of BRCA1. Electrophoretic mobility shift assay-mass spectrometry was performed to identify proteins binding to the ZNF423 SNP and coordinating with estrogen receptor alpha (ERα). Clustered, regularly interspaced short palindromic repeats (CRISPR)/Cas9 genome editing was applied to generate ZR75-1 breast cancer cells with different ZNF423 SNP genotypes. Both cultured cells and mouse xenograft models with different ZNF423 SNP genotypes were used to study the cellular responses to SERMs and poly(ADP-ribose) polymerase (PARP) inhibitors. We identified calmodulin-like protein 3 (CALML3) as a key sensor of this SNP and a coregulator of ERα, which contributes to differential gene transcription regulation in an estrogen and SERM-dependent fashion. Furthermore, using CRISPR/Cas9-engineered ZR75-1 breast cancer cells with different ZNF423 SNP genotypes, striking differences in cellular responses to SERMs and PARP inhibitors, alone or in combination, were observed not only in cells but also in a mouse xenograft model. Our results have demonstrated the mechanism by which the ZNF423 rs9940645 SNP might regulate gene expression and drug response as well as its potential role in achieving more highly individualized breast cancer therapy.

  15. Meta-analysis diagnostic accuracy of SNP-based pathogenicity detection tools: a case of UTG1A1 gene mutations.

    Science.gov (United States)

    Galehdari, Hamid; Saki, Najmaldin; Mohammadi-Asl, Javad; Rahim, Fakher

    2013-01-01

    Crigler-Najjar syndrome (CNS) type I and type II are usually inherited as autosomal recessive conditions that result from mutations in the UGT1A1 gene. The main objective of the present review is to summarize results of all available evidence on the accuracy of SNP-based pathogenicity detection tools compared to published clinical result for the prediction of in nsSNPs that leads to disease using prediction performance method. A comprehensive search was performed to find all mutations related to CNS. Database searches included dbSNP, SNPdbe, HGMD, Swissvar, ensemble, and OMIM. All the mutation related to CNS was extracted. The pathogenicity prediction was done using SNP-based pathogenicity detection tools include SIFT, PHD-SNP, PolyPhen2, fathmm, Provean, and Mutpred. Overall, 59 different SNPs related to missense mutations in the UGT1A1 gene, were reviewed. Comparing the diagnostic OR, PolyPhen2 and Mutpred have the highest detection 4.983 (95% CI: 1.24 - 20.02) in both, following by SIFT (diagnostic OR: 3.25, 95% CI: 1.07 - 9.83). The highest MCC of SNP-based pathogenicity detection tools, was belong to SIFT (34.19%) followed by Provean, PolyPhen2, and Mutpred (29.99%, 29.89%, and 29.89%, respectively). Hence the highest SNP-based pathogenicity detection tools ACC, was fit to SIFT (62.71%) followed by PolyPhen2, and Mutpred (61.02%, in both). Our results suggest that some of the well-established SNP-based pathogenicity detection tools can appropriately reflect the role of a disease-associated SNP in both local and global structures.

  16. Novel modeling of combinatorial miRNA targeting identifies SNP with potential role in bone density.

    Directory of Open Access Journals (Sweden)

    Claudia Coronnello

    Full Text Available MicroRNAs (miRNAs are post-transcriptional regulators that bind to their target mRNAs through base complementarity. Predicting miRNA targets is a challenging task and various studies showed that existing algorithms suffer from high number of false predictions and low to moderate overlap in their predictions. Until recently, very few algorithms considered the dynamic nature of the interactions, including the effect of less specific interactions, the miRNA expression level, and the effect of combinatorial miRNA binding. Addressing these issues can result in a more accurate miRNA:mRNA modeling with many applications, including efficient miRNA-related SNP evaluation. We present a novel thermodynamic model based on the Fermi-Dirac equation that incorporates miRNA expression in the prediction of target occupancy and we show that it improves the performance of two popular single miRNA target finders. Modeling combinatorial miRNA targeting is a natural extension of this model. Two other algorithms show improved prediction efficiency when combinatorial binding models were considered. ComiR (Combinatorial miRNA targeting, a novel algorithm we developed, incorporates the improved predictions of the four target finders into a single probabilistic score using ensemble learning. Combining target scores of multiple miRNAs using ComiR improves predictions over the naïve method for target combination. ComiR scoring scheme can be used for identification of SNPs affecting miRNA binding. As proof of principle, ComiR identified rs17737058 as disruptive to the miR-488-5p:NCOA1 interaction, which we confirmed in vitro. We also found rs17737058 to be significantly associated with decreased bone mineral density (BMD in two independent cohorts indicating that the miR-488-5p/NCOA1 regulatory axis is likely critical in maintaining BMD in women. With increasing availability of comprehensive high-throughput datasets from patients ComiR is expected to become an essential

  17. SNP-based linkage mapping for validation of QTLs for resistance to ascochyta blight in lentil

    Directory of Open Access Journals (Sweden)

    Shimna Sudheesh

    2016-11-01

    Full Text Available Lentil (Lens culinaris Medik. is a self-pollinating, diploid, annual, cool-season, food legume crop that is cultivated throughout the world. Ascochyta blight (AB, caused by Ascochyta lentis Vassilievsky, is an economically important and widespread disease of lentil. Development of cultivars with high levels of durable resistance provides an environmentally acceptable and economically feasible method for AB control. A detailed understanding of the genetic basis of AB resistance is hence highly desirable, in order to obtain insight into the number and influence of resistance genes. Genetic linkage maps based on single nucleotide polymorphisms (SNP and simple sequence repeat (SSR markers have been developed from three recombinant inbred line (RIL populations. The IH x NF map contained 460 loci across 1461.6 cM, while the IH x DIG map contained 329 loci across 1302.5 cM and the third map, NF x DIG contained 330 loci across 1914.1 cM. Data from these maps were combined with a map from a previously published study through use of bridging markers to generate a consensus linkage map containing 689 loci distributed across 7 linkage groups (LGs, with a cumulative length of 2429.61 cM at an average density of one marker per 3.5 cM. Trait dissection of AB resistance was performed for the RIL populations, identifying totals of two and three quantitative trait loci (QTLs explaining 52% and 69% of phenotypic variation for resistance to infection in the IH x DIG and IH x NF populations, respectively. Presence of common markers in the vicinity of the AB_IH1- and AB_IH2.1/AB_IH2.2-containing regions on both maps supports the inference that a common genomic region is responsible for conferring resistance and is associated with the resistant parent, Indianhead. The third QTL was derived from Northfield. Evaluation of markers associated with AB resistance across a diverse lentil germplasm panel revealed that the identity of alleles associated with AB_IH1 predicted

  18. Short Tree, Long Tree, Right Tree, Wrong Tree: New Acquisition Bias Corrections for Inferring SNP Phylogenies.

    Science.gov (United States)

    Leaché, Adam D; Banbury, Barbara L; Felsenstein, Joseph; de Oca, Adrián Nieto-Montes; Stamatakis, Alexandros

    2015-11-01

    Single nucleotide polymorphisms (SNPs) are useful markers for phylogenetic studies owing in part to their ubiquity throughout the genome and ease of collection. Restriction site associated DNA sequencing (RADseq) methods are becoming increasingly popular for SNP data collection, but an assessment of the best practises for using these data in phylogenetics is lacking. We use computer simulations, and new double digest RADseq (ddRADseq) data for the lizard family Phrynosomatidae, to investigate the accuracy of RAD loci for phylogenetic inference. We compare the two primary ways RAD loci are used during phylogenetic analysis, including the analysis of full sequences (i.e., SNPs together with invariant sites), or the analysis of SNPs on their own after excluding invariant sites. We find that using full sequences rather than just SNPs is preferable from the perspectives of branch length and topological accuracy, but not of computational time. We introduce two new acquisition bias corrections for dealing with alignments composed exclusively of SNPs, a conditional likelihood method and a reconstituted DNA approach. The conditional likelihood method conditions on the presence of variable characters only (the number of invariant sites that are unsampled but known to exist is not considered), while the reconstituted DNA approach requires the user to specify the exact number of unsampled invariant sites prior to the analysis. Under simulation, branch length biases increase with the amount of missing data for both acquisition bias correction methods, but branch length accuracy is much improved in the reconstituted DNA approach compared to the conditional likelihood approach. Phylogenetic analyses of the empirical data using concatenation or a coalescent-based species tree approach provide strong support for many of the accepted relationships among phrynosomatid lizards, suggesting that RAD loci contain useful phylogenetic signal across a range of divergence times despite the

  19. Whole genome SNP discovery and analysis of genetic diversity in Turkey (Meleagris gallopavo)

    Science.gov (United States)

    2012-01-01

    Background The turkey (Meleagris gallopavo) is an important agricultural species and the second largest contributor to the world’s poultry meat production. Genetic improvement is attributed largely to selective breeding programs that rely on highly heritable phenotypic traits, such as body size and breast muscle development. Commercial breeding with small effective population sizes and epistasis can result in loss of genetic diversity, which in turn can lead to reduced individual fitness and reduced response to selection. The presence of genomic diversity in domestic livestock species therefore, is of great importance and a prerequisite for rapid and accurate genetic improvement of selected breeds in various environments, as well as to facilitate rapid adaptation to potential changes in breeding goals. Genomic selection requires a large number of genetic markers such as e.g. single nucleotide polymorphisms (SNPs) the most abundant source of genetic variation within the genome. Results Alignment of next generation sequencing data of 32 individual turkeys from different populations was used for the discovery of 5.49 million SNPs, which subsequently were used for the analysis of genetic diversity among the different populations. All of the commercial lines branched from a single node relative to the heritage varieties and the South Mexican turkey population. Heterozygosity of all individuals from the different turkey populations ranged from 0.17-2.73 SNPs/Kb, while heterozygosity of populations ranged from 0.73-1.64 SNPs/Kb. The average frequency of heterozygous SNPs in individual turkeys was 1.07 SNPs/Kb. Five genomic regions with very low nucleotide variation were identified in domestic turkeys that showed state of fixation towards alleles different than wild alleles. Conclusion The turkey genome is much less diverse with a relatively low frequency of heterozygous SNPs as compared to other livestock species like chicken and pig. The whole genome SNP discovery

  20. Whole genome SNP discovery and analysis of genetic diversity in Turkey (Meleagris gallopavo

    Directory of Open Access Journals (Sweden)

    Aslam Muhammad L

    2012-08-01

    whole genome SNP discovery study in turkey resulted in the detection of 5.49 million putative SNPs compared to the reference genome. All commercial lines appear to share a common origin. Presence of different alleles/haplotypes in the SM population highlights that specific haplotypes have been selected in the modern domesticated turkey.

  1. QTL underlying some agronomic traits in barley detected by SNP markers.

    Science.gov (United States)

    Wang, Jibin; Sun, Genlou; Ren, Xifeng; Li, Chengdao; Liu, Lipan; Wang, Qifei; Du, Binbin; Sun, Dongfa

    2016-07-07

    Increasing the yield of barley (Hordeum vulgare L.) is a main breeding goal in developing barley cultivars. A high density genetic linkage map containing 1894 SNP and 68 SSR markers covering 1375.8 cM was constructed and used for mapping quantitative traits. A late-generation double haploid population (DH) derived from the Huaai 11 × Huadamai 6 cross was used to identify QTLs and QTL × environment interactions for ten traits affecting grain yield including length of main spike (MSL), spikelet number on main spike (SMS), spikelet number per plant (SLP), grain number per plant (GP), grain weight per plant (GWP), grain number per spike (GS), thousand grain weight (TGW), grain weight per spike (GWS), spike density (SPD) and spike number per plant (SP). In single environment analysis using composite interval mapping (CIM), a total of 221 QTLs underlying the ten traits were detected in five consecutive years (2009-2013). The QTLs detected in each year were 50, 48, 41, 41 and 41 for the year 2009 to 2013. The QTLs associated with these traits were generally clustered on chromosome 2H, 4H and 7H. In multi-environment analysis, a total of 111 significant QTLs including 18 for MSL, 16 for SMS, 15 for SPD, 5 for SP, 4 for SLP, 14 for TGW, 5 for GP, 11 for GS, 8 for GWP, and 15 for GWS were detected in the five years. Most QTLs showed significant QTL × environment interactions (QEI), nine QTLs (qIMSL3-1, qIMSL4-1, qIMSL4-2, qIMSL6-1, qISMS7-1, qISPD2-7, qISPD7-1, qITGW3-1 and qIGWS4-3) were detected with minimal QEI effects and stable in different years. Among 111 QTLs,71 (63.40 %) QTLs were detected in both single and multiple environments. Three main QTL cluster regions associated with the 10 agronomic traits on chromosome 2H, 4H and 7H were detected. The QTLs for SMS, SLP, GP and GWP were located in the region near Vrs1 on chromosome 2H. The QTLs underlying SMS, SPD and SLP were clustered on chromosome 4H. On the terminal of chromosome 7H, there was a QTL

  2. Nuclear Species-Diagnostic SNP Markers Mined from 454 Amplicon Sequencing Reveal Admixture Genomic Structure of Modern Citrus Varieties

    Science.gov (United States)

    Curk, Franck; Ancillo, Gema; Ollitrault, Frédérique; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Garcia-Lor, Andres; Navarro, Luis; Ollitrault, Patrick

    2015-01-01

    Most cultivated Citrus species originated from interspecific hybridisation between four ancestral taxa (C. reticulata, C. maxima, C. medica, and C. micrantha) with limited further interspecific recombination due to vegetative propagation. This evolution resulted in admixture genomes with frequent interspecific heterozygosity. Moreover, a major part of the phenotypic diversity of edible citrus results from the initial differentiation between these taxa. Deciphering the phylogenomic structure of citrus germplasm is therefore essential for an efficient utilization of citrus biodiversity in breeding schemes. The objective of this work was to develop a set of species-diagnostic single nucleotide polymorphism (SNP) markers for the four Citrus ancestral taxa covering the nine chromosomes, and to use these markers to infer the phylogenomic structure of secondary species and modern cultivars. Species-diagnostic SNPs were mined from 454 amplicon sequencing of 57 gene fragments from 26 genotypes of the four basic taxa. Of the 1,053 SNPs mined from 28,507 kb sequence, 273 were found to be highly diagnostic for a single basic taxon. Species-diagnostic SNP markers (105) were used to analyse the admixture structure of varieties and rootstocks. This revealed C. maxima introgressions in most of the old and in all recent selections of mandarins, and suggested that C. reticulata × C. maxima reticulation and introgression processes were important in edible mandarin domestication. The large range of phylogenomic constitutions between C. reticulata and C. maxima revealed in mandarins, tangelos, tangors, sweet oranges, sour oranges, grapefruits, and orangelos is favourable for genetic association studies based on phylogenomic structures of the germplasm. Inferred admixture structures were in agreement with previous hypotheses regarding the origin of several secondary species and also revealed the probable origin of several acid citrus varieties. The developed species-diagnostic SNP

  3. A single-tube 27-plex SNP assay for estimating individual ancestry and admixture from three continents.

    Science.gov (United States)

    Wei, Yi-Liang; Wei, Li; Zhao, Lei; Sun, Qi-Fan; Jiang, Li; Zhang, Tao; Liu, Hai-Bo; Chen, Jian-Gang; Ye, Jian; Hu, Lan; Li, Cai-Xia

    2016-01-01

    A single-tube multiplex assay of a small set of ancestry-informative markers (AIMs) for effectively estimating individual ancestry and admixture is an ideal forensic tool to trace the population origin of an unknown DNA sample. We present a newly developed 27-plex single nucleotide polymorphism (SNP) panel with highly robust and balanced differential power to perfectly assign individuals to African, European, and East Asian ancestries. Evaluating 968 previously described intercontinental AIMs from three HapMap population genotyping datasets (Yoruban in Ibadan, Nigeria (YRI); Utah residents with Northern and Western European ancestry from the Centre de'Etude du Polymorphism Humain (CEPH) collection (CEU); and Han Chinese in Beijing, China (CHB)), the best set of markers was selected on the basis of Hardy-Weinberg equilibrium (p > 0.00001), population-specific allele frequency (two of three δ values >0.5), according to linkage disequilibrium (r (2) ancestry of the 11 populations in the HapMap project. Then, we tested the 27-plex SNP assay with 1164 individuals from 17 additional populations. The results demonstrated that the SNP panel was successful for ancestry inference of individuals with African, European, and East Asian ancestry. Furthermore, the system performed well when inferring the admixture of Eurasians (EUR/EAS) after analyzing admixed populations from Xinjiang (Central Asian) as follows: Tajik (68:27), Uyghur (49:46), Kirgiz (40:57), and Kazak (36:60). For individual analyses, we interpreted each sample with a three-ancestry component percentage and a population match probability sequence. This multiplex assay is a convenient and cost-effective tool to assist in criminal investigations, as well as to correct for the effects of population stratification for case-control studies.

  4. High-density SNP genotyping of tomato (Solanum lycopersicum L. reveals patterns of genetic variation due to breeding.

    Directory of Open Access Journals (Sweden)

    Sung-Chur Sim

    Full Text Available The effects of selection on genome variation were investigated and visualized in tomato using a high-density single nucleotide polymorphism (SNP array. 7,720 SNPs were genotyped on a collection of 426 tomato accessions (410 inbreds and 16 hybrids and over 97% of the markers were polymorphic in the entire collection. Principal component analysis (PCA and pairwise estimates of F(st supported that the inbred accessions represented seven sub-populations including processing, large-fruited fresh market, large-fruited vintage, cultivated cherry, landrace, wild cherry, and S. pimpinellifolium. Further divisions were found within both the contemporary processing and fresh market sub-populations. These sub-populations showed higher levels of genetic diversity relative to the vintage sub-population. The array provided a large number of polymorphic SNP markers across each sub-population, ranging from 3,159 in the vintage accessions to 6,234 in the cultivated cherry accessions. Visualization of minor allele frequency revealed regions of the genome that distinguished three representative sub-populations of cultivated tomato (processing, fresh market, and vintage, particularly on chromosomes 2, 4, 5, 6, and 11. The PCA loadings and F(st outlier analysis between these three sub-populations identified a large number of candidate loci under positive selection on chromosomes 4, 5, and 11. The extent of linkage disequilibrium (LD was examined within each chromosome for these sub-populations. LD decay varied between chromosomes and sub-populations, with large differences reflective of breeding history. For example, on chromosome 11, decay occurred over 0.8 cM for processing accessions and over 19.7 cM for fresh market accessions. The observed SNP variation and LD decay suggest that different patterns of genetic variation in cultivated tomato are due to introgression from wild species and selection for market specialization.

  5. Design of a High Density SNP Genotyping Assay in the Pig Using SNPs Identified and Characterized by Next Generation Sequencing Technology

    Science.gov (United States)

    Ramos, Antonio M.; Crooijmans, Richard P. M. A.; Affara, Nabeel A.; Amaral, Andreia J.; Archibald, Alan L.; Beever, Jonathan E.; Bendixen, Christian; Churcher, Carol; Clark, Richard; Dehais, Patrick; Hansen, Mark S.; Hedegaard, Jakob; Hu, Zhi-Liang; Kerstens, Hindrik H.; Law, Andy S.; Megens, Hendrik-Jan; Milan, Denis; Nonneman, Danny J.; Rohrer, Gary A.; Rothschild, Max F.; Smith, Tim P. L.; Schnabel, Robert D.; Van Tassell, Curt P.; Taylor, Jeremy F.; Wiedmann, Ralph T.; Schook, Lawrence B.; Groenen, Martien A. M.

    2009-01-01

    Background The dissection of complex traits of economic importance to the pig industry requires the availability of a significant number of genetic markers, such as single nucleotide polymorphisms (SNPs). This study was conducted to discover several hundreds of thousands of porcine SNPs using next generation sequencing technologies and use these SNPs, as well as others from different public sources, to design a high-density SNP genotyping assay. Methodology/Principal Findings A total of 19 reduced representation libraries derived from four swine breeds (Duroc, Landrace, Large White, Pietrain) and a Wild Boar population and three restriction enzymes (AluI, HaeIII and MspI) were sequenced using Illumina's Genome Analyzer (GA). The SNP discovery effort resulted in the de novo identification of over 372K SNPs. More than 549K SNPs were used to design the Illumina Porcine 60K+SNP iSelect Beadchip, now commercially available as the PorcineSNP60. A total of 64,232 SNPs were included on the Beadchip. Results from genotyping the 158 individuals used for sequencing showed a high overall SNP call rate (97.5%). Of the 62,621 loci that could be reliably scored, 58,994 were polymorphic yielding a SNP conversion success rate of 94%. The average minor allele frequency (MAF) for all scorable SNPs was 0.274. Conclusions/Significance Overall, the results of this study indicate the utility of using next generation sequencing technologies to identify large numbers of reliable SNPs. In addition, the validation of the PorcineSNP60 Beadchip demonstrated that the assay is an excellent tool that will likely be used in a variety of future studies in pigs. PMID:19654876

  6. Genomic variation in myeloma: design, content, and initial application of the Bank On A Cure SNP Panel to detect associations with progression-free survival

    Directory of Open Access Journals (Sweden)

    Fang Gang

    2008-09-01

    Full Text Available Abstract Background We have engaged in an international program designated the Bank On A Cure, which has established DNA banks from multiple cooperative and institutional clinical trials, and a platform for examining the association of genetic variations with disease risk and outcomes in multiple myeloma. We describe the development and content of a novel custom SNP panel that contains 3404 SNPs in 983 genes, representing cellular functions and pathways that may influence disease severity at diagnosis, toxicity, progression or other treatment outcomes. A systematic search of national databases was used to identify non-synonymous coding SNPs and SNPs within transcriptional regulatory regions. To explore SNP associations with PFS we compared SNP profiles of short term (less than 1 year, n = 70 versus long term progression-free survivors (greater than 3 years, n = 73 in two phase III clinical trials. Results Quality controls were established, demonstrating an accurate and robust screening panel for genetic variations, and some initial racial comparisons of allelic variation were done. A variety of analytical approaches, including machine learning tools for data mining and recursive partitioning analyses, demonstrated predictive value of the SNP panel in survival. While the entire SNP panel showed genotype predictive association with PFS, some SNP subsets were identified within drug response, cellular signaling and cell cycle genes. Conclusion A targeted gene approach was undertaken to develop an SNP panel that can test for associations with clinical outcomes in myeloma. The initial analysis provided some predictive power, demonstrating that genetic variations in the myeloma patient population may influence PFS.

  7. Novel Quantitative Real-Time LCR for the Sensitive Detection of SNP Frequencies in Pooled DNA: Method Development, Evaluation and Application

    Science.gov (United States)

    Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios

    2011-01-01

    Background Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. Methods The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. Conclusions The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. Significance The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food. PMID:21283808

  8. Sex-specific association of rs16996148 SNP in the NCAN/CILP2/PBX4 and serum lipid levels in the Mulao and Han populations

    Directory of Open Access Journals (Sweden)

    Yan Ting-Ting

    2011-12-01

    Full Text Available Abstract Background The association of rs16996148 single nucleotide polymorphism (SNP in NCAN/CILP2/PBX4 and serum lipid levels is inconsistent. Furthermore, little is known about the association of rs16996148 SNP and serum lipid levels in the Chinese population. We therefore aimed to detect the association of rs16996148 SNP and several environmental factors with serum lipid levels in the Guangxi Mulao and Han populations. Method A total of 712 subjects of Mulao nationality and 736 participants of Han nationality were randomly selected from our stratified randomized cluster samples. Genotyping of the rs16996148 SNP was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. Results The levels of apolipoprotein (Apo B were higher in Mulao than in Han (P P 0.05; respectively. The frequencies of GG, GT and TT genotypes were 76.0%, 22.5% and 1.5% in Mulao, and 81.2%, 17.4% and 1.4% in Han (P 0.05; respectively. There were no significant differences in the genotypic and allelic frequencies between males and females in both ethnic groups. The levels of HDL-C, ApoAI, and the ratio of ApoAI to ApoB in Mulao were different between the GG and GT/TT genotypes in males but not in females (P P P P P Conclusions The genotypic and allelic frequencies of rs16996148 SNP and the associations of the SNP and serum lipid levels are different in the Mulao and Han populations. Sex (male-specific association of rs16996148 SNP in the NCAN/CILP2/PBX4 and serum lipid levels is also observed in the both ethnic groups.

  9. MDM2 SNP309 promoter polymorphism and p53 mutations in urinary bladder carcinoma stage T1

    Directory of Open Access Journals (Sweden)

    Olsson Hans

    2013-01-01

    Full Text Available Abstract Background Urinary bladder carcinoma stage T1 is an unpredictable disease that in some cases has a good prognosis with only local or no recurrence, but in others can appear as a more aggressive tumor with progression to more advanced stages. The aim here was to investigate stage T1 tumors regarding MDM2 promoter SNP309 polymorphism, mutations in the p53 gene, and expression of p53 and p16 measured by immunohistochemistry, and subsequently relate these changes to tumor recurrence and progression. We examined a cohort of patients with primary stage T1 urothelial carcinoma of the bladder and their tumors. Methods After re-evaluation of the original slides and exclusions, the study population comprised 141 patients, all with primary stage T1 urothelial carcinoma of the bladder. The hospital records were screened for clinical parameters and information concerning presence of histologically proven recurrence and progression. The paraffin-embedded tumor material was evaluated by immunohistochemistry. Any mutations found in the p53 gene were studied by single-strand conformation analysis and Sanger sequencing. The MDM2 SNP309 polymorphism was investigated by pyrosequencing. Multivariate analyses concerning association with prognosis were performed, and Kaplan-Meier analysis was conducted for a combination of changes and time to progression. Results Of the 141 patients, 82 had at least one MDM2 SNP309 G allele, and 53 had a mutation in the p53 gene, but neither of those anomalies was associated with a worse prognosis. A mutation in the p53 gene was associated with immunohistochemically visualized p53 protein expression at a cut-off value of 50%. In the group with p53 mutation Kaplan-Meier analysis showed higher rate of progression and shorter time to progression in patients with immunohistochemically abnormal p16 expression compared to them with normal p16 expression (p = 0.038. Conclusions MDM2 SNP309 promoter polymorphism and mutations in

  10. MDM4 SNP34091 (rs4245739) and its effect on breast-, colon-, lung- and prostate cancer risk.

    OpenAIRE

    Gansmo, Liv Beathe; Romundstad, Pål Richard; Birkeland, Einar Elvbakken; Hveem, Kristian; Vatten, Lars Johan; Knappskog, Stian; Lønning, Per Eystein

    2015-01-01

    The MDM4 protein plays an important part in the negative regulation of the tumor suppressor p53 through its interaction with MDM2. In line with this, MDM4 amplification has been observed in several tumor forms. A polymorphism (rs4245739 A>C; SNP34091) in the MDM4 3′ untranslated region has been reported to create a target site for hsa-miR- 191, resulting in decreased MDM4 mRNA levels. In this population-based case–control study, we examined the potential association...

  11. Association analysis of the FTO gene with obesity in children of Caucasian and African ancestry reveals a common tagging SNP.

    Directory of Open Access Journals (Sweden)

    Struan F A Grant

    2008-03-01

    Full Text Available Recently an association was demonstrated between the single nucleotide polymorphism (SNP, rs9939609, within the FTO locus and obesity as a consequence of a genome wide association (GWA study of type 2 diabetes in adults. We examined the effects of two perfect surrogates for this SNP plus 11 other SNPs at this locus with respect to our childhood obesity cohort, consisting of both Caucasians and African Americans (AA. Utilizing data from our ongoing GWA study in our cohort of 418 Caucasian obese children (BMI>or=95th percentile, 2,270 Caucasian controls (BMI<95th percentile, 578 AA obese children and 1,424 AA controls, we investigated the association of the previously reported variation at the FTO locus with the childhood form of this disease in both ethnicities. The minor allele frequencies (MAF of rs8050136 and rs3751812 (perfect surrogates for rs9939609 i.e. both r(2 = 1 in the Caucasian cases were 0.448 and 0.443 respectively while they were 0.391 and 0.386 in Caucasian controls respectively, yielding for both an odds ratio (OR of 1.27 (95% CI 1.08-1.47; P = 0.0022. Furthermore, the MAFs of rs8050136 and rs3751812 in the AA cases were 0.449 and 0.115 respectively while they were 0.436 and 0.090 in AA controls respectively, yielding an OR of 1.05 (95% CI 0.91-1.21; P = 0.49 and of 1.31 (95% CI 1.050-1.643; P = 0.017 respectively. Investigating all 13 SNPs present on the Illumina HumanHap550 BeadChip in this region of linkage disequilibrium, rs3751812 was the only SNP conferring significant risk in AA. We have therefore replicated and refined the association in an AA cohort and distilled a tag-SNP, rs3751812, which captures the ancestral origin of the actual mutation. As such, variants in the FTO gene confer a similar magnitude of risk of obesity to children as to their adult counterparts and appear to have a global impact.

  12. TPH2 -703G/T SNP may have important effect on susceptibility to suicidal behavior in major depression.

    Science.gov (United States)

    Yoon, Ho-Kyoung; Kim, Yong-Ku

    2009-04-30

    Serotonergic system-related genes can be good candidate genes for both major depressive disorder (MDD) and suicidal behavior. In this study, we aimed to investigate the association of serotonin 2A receptor gene -1438A/G SNP (HTR2A -1438A/G), tryptophan hydroxylase 2 gene -703G/T SNP (TPH2 -703G/T) and serotonin 1A receptor C-1019G (HTR1A C-1019G) with suicidal behavior. One hundred and eighty one suicidal depressed patients and 143 non-suicidal depressed patients who met DSM-IV criteria for major depressive disorder were recruited from patients who were admitted to Korea University Ansan Hospital. One hundred seventy six normal controls were healthy volunteers who were recruited by local advertisement. Patients and normal controls were genotyped for HTR2A -1438A/G, TPH2 -703G/T and 5-HT1A C-1019G. The suicidal depressed patients were evaluated by the lethality of individual suicide attempts using Weisman and Worden's risk-rescue rating (RRR) and the Lethality Suicide Attempt Rating Scale-updated (LSARS-II). In order to assess the severity of depressive symptoms of patients, Hamilton's Depression Rating Scale (HDRS) was administered. Genotype and allele frequencies were compared between groups by chi(2) statistics. Association of genotype of the candidate genes with the lethality of suicidal behavior was examined with ANOVA by comparing the mean scores of LSARS and RRR according to the genotype. There were statistically significant differences in the genotype distributions and allele frequencies of TPH2 -703G/T between the suicidal depressive group and the normal control group. The homozygous allele G (G/G genotype) frequency was significantly higher in suicidal depressed patients than in controls. However, no differences in either genotype distribution or in allele frequencies of HTR2A -1438A/G and HTR1A C-1019G were observed between the suicidal depressed patients, the non-suicidal depressed patients, and the normal controls. There were no differences in the

  13. Software for optimization of SNP and PCR-RFLP genotyping to discriminate many genomes with the fewest assays

    Directory of Open Access Journals (Sweden)

    Wagner Mark C

    2005-05-01

    Full Text Available Abstract Background Microbial forensics is important in tracking the source of a pathogen, whether the disease is a naturally occurring outbreak or part of a criminal investigation. Results A method and SPR Opt (SNP and PCR-RFLP Optimization software to perform a comprehensive, whole-genome analysis to forensically discriminate multiple sequences is presented. Tools for the optimization of forensic typing using Single Nucleotide Polymorphism (SNP and PCR-Restriction Fragment Length Polymorphism (PCR-RFLP analyses across multiple isolate sequences of a species are described. The PCR-RFLP analysis includes prediction and selection of optimal primers and restriction enzymes to enable maximum isolate discrimination based on sequence information. SPR Opt calculates all SNP or PCR-RFLP variations present in the sequences, groups them into haplotypes according to their co-segregation across those sequences, and performs combinatoric analyses to determine which sets of haplotypes provide maximal discrimination among all the input sequences. Those set combinations requiring that membership in the fewest haplotypes be queried (i.e. the fewest assays be performed are found. These analyses highlight variable regions based on existing sequence data. These markers may be heterogeneous among unsequenced isolates as well, and thus may be useful for characterizing the relationships among unsequenced as well as sequenced isolates. The predictions are multi-locus. Analyses of mumps and SARS viruses are summarized. Phylogenetic trees created based on SNPs, PCR-RFLPs, and full genomes are compared for SARS virus, illustrating that purported phylogenies based only on SNP or PCR-RFLP variations do not match those based on multiple sequence alignment of the full genomes. Conclusion This is the first software to optimize the selection of forensic markers to maximize information gained from the fewest assays, accepting whole or partial genome sequence data as input. As

  14. Using RNA-Seq to assemble a rose transcriptome with more than 13,000 full-length expressed genes and to develop the WagRhSNP 68k Axiom SNP array for rose (Rosa L.

    Directory of Open Access Journals (Sweden)

    Carole F S Koning-Boucoiran

    2015-04-01

    Full Text Available In order to develop a versatile and large SNP array for rose, we set out to mine ESTs from diverse sets of rose germplasm. For this RNA-Seq libraries containing about 700 million reads were generated from tetraploid cut and garden roses using Illumina paired-end sequencing, and from diploid Rosa multiflora using 454 sequencing. Separate de novo assemblies were performed in order to identify single nucleotide polymorphisms (SNPs within and between rose varieties. SNPs among tetraploid roses were selected for constructing a genotyping array that can be employed for genetic mapping and marker-trait association discovery in breeding programs based on tetraploid germplasm, both from cut roses and from garden roses. In total 68,893 SNPs were included on the WagRhSNP Axiom array.Next, an orthology-guided assembly was performed for the construction of a non-redundant rose transcriptome database. A total of 21,740 transcripts had significant hits with orthologous genes in the strawberry (Fragaria vesca L. genome. Of these 13,390 appeared to contain the full-length coding regions. This newly established transcriptome resource adds considerably to the currently available sequence resources for the Rosaceae family in general and the genus Rosa in particular.

  15. Using RNA-Seq to assemble a rose transcriptome with more than 13,000 full-length expressed genes and to develop the WagRhSNP 68k Axiom SNP array for rose (Rosa L.).

    Science.gov (United States)

    Koning-Boucoiran, Carole F S; Esselink, G Danny; Vukosavljev, Mirjana; van 't Westende, Wendy P C; Gitonga, Virginia W; Krens, Frans A; Voorrips, Roeland E; van de Weg, W Eric; Schulz, Dietmar; Debener, Thomas; Maliepaard, Chris; Arens, Paul; Smulders, Marinus J M

    2015-01-01

    In order to develop a versatile and large SNP array for rose, we set out to mine ESTs from diverse sets of rose germplasm. For this RNA-Seq libraries containing about 700 million reads were generated from tetraploid cut and garden roses using Illumina paired-end sequencing, and from diploid Rosa multiflora using 454 sequencing. Separate de novo assemblies were performed in order to identify single nucleotide polymorphisms (SNPs) within and between rose varieties. SNPs among tetraploid roses were selected for constructing a genotyping array that can be employed for genetic mapping and marker-trait association discovery in breeding programs based on tetraploid germplasm, both from cut roses and from garden roses. In total 68,893 SNPs were included on the WagRhSNP Axiom array. Next, an orthology-guided assembly was performed for the construction of a non-redundant rose transcriptome database. A total of 21,740 transcripts had significant hits with orthologous genes in the strawberry (Fragaria vesca L.) genome. Of these 13,390 appeared to contain the full-length coding regions. This newly established transcriptome resource adds considerably to the currently available sequence resources for the Rosaceae family in general and the genus Rosa in particular.

  16. SNP2Structure: A Public and Versatile Resource for Mapping and Three-Dimensional Modeling of Missense SNPs on Human Protein Structures

    Directory of Open Access Journals (Sweden)

    Difei Wang

    2015-01-01

    Full Text Available One of the long-standing challenges in biology is to understand how non-synonymous single nucleotide polymorphisms (nsSNPs change protein structure and further affect their function. While it is impractical to solve all the mutated protein structures experimentally, it is quite feasible to model the mutated structures in silico. Toward this goal, we built a publicly available structure database resource (SNP2Structure, https://apps.icbi.georgetown.edu/snp2structure focusing on missense mutations, msSNP. Compared with web portals with similar aims, SNP2Structure has the following major advantages. First, our portal offers direct comparison of two related 3D structures. Second, the protein models include all interacting molecules in the original PDB structures, so users are able to determine regions of potential interaction changes when a protein mutation occurs. Third, the mutated structures are available to download locally for further structural and functional analysis. Fourth, we used Jsmol package to display the protein structure that has no system compatibility issue. SNP2Structure provides reliable, high quality mapping of nsSNPs to 3D protein structures enabling researchers to explore the likely functional impact of human disease-causing mutations.

  17. A functional SNP in the regulatory region of the decay-accelerating factor gene associates with extraocular muscle pareses in myasthenia gravis

    KAUST Repository

    Heckmann, J M

    2009-08-13

    Complement activation in myasthenia gravis (MG) may damage muscle endplate and complement regulatory proteins such as decay-accelerating factor (DAF) or CD55 may be protective. We hypothesize that the increased prevalence of severe extraocular muscle (EOM) dysfunction among African MG subjects reported earlier may result from altered DAF expression. To test this hypothesis, we screened the DAF gene sequences relevant to the classical complement pathway and found an association between myasthenics with EOM paresis and the DAF regulatory region c.-198CG SNP (odds ratio8.6; P0.0003). This single nucleotide polymorphism (SNP) results in a twofold activation of a DAF 5?-flanking region luciferase reporter transfected into three different cell lines. Direct matching of the surrounding SNP sequence within the DAF regulatory region with the known transcription factor-binding sites suggests a loss of an Sp1-binding site. This was supported by the observation that the c.-198CG SNP did not show the normal lipopolysaccharide-induced DAF transcriptional upregulation in lymphoblasts from four patients. Our findings suggest that at critical periods during autoimmune MG, this SNP may result in inadequate DAF upregulation with consequent complement-mediated EOM damage. Susceptible individuals may benefit from anti-complement therapy in addition to immunosuppression. © 2010 Macmillan Publishers Limited. All rights reserved.

  18. Combination of RNAseq and SNP nanofluidic array reveals the center of genetic diversity of cacao pathogen Moniliophthora roreri in the upper Magdalena Valley of Colombia and its clonality

    Directory of Open Access Journals (Sweden)

    Shahin S Ali

    2015-08-01

    Full Text Available Moniliophthora roreri is the fungal pathogen that causes frosty pod rot (FPR disease of Theobroma cacao L., the source of chocolate. FPR occurs in most of the cacao producing countries in the Western Hemisphere, causing yield losses up to 80%. Genetic diversity within the FPR pathogen population may allow the population to adapt to changing environmental conditions and adapt to enhanced resistance in the host plant. The present study developed SNP markers from RNASeq results for 13 M. roreri isolates and validated the markers for their ability to reveal genetic diversity in an international M. roreri collection. The SNP resources reported herein represent the first study of RNASeq-derived SNP validation in M. roreri and demonstrates the utility of RNASeq as an approach for de novo SNP identification in M. roreri. A total of 88 polymorphic SNPs were used to evaluate the genetic diversity of 172 M. roreri cacao isolates resulting in 37 distinct genotypes (including 14 synonymous groups. Absence of heterozygosity for the 88 SNP markers indicates reproduction in M. roreri is clonal and likely due to a homothallic life style. The upper Magdalena Valley of Colombia showed the highest levels of genetic diversity with 20 distinct genotypes of which 13 were limited to this region, and indicates this region as the possible center of origin for M. roreri.

  19. Combination of RNAseq and SNP nanofluidic array reveals the center of genetic diversity of cacao pathogen Moniliophthora roreri in the upper Magdalena Valley of Colombia and its clonality.

    Science.gov (United States)

    Ali, Shahin S; Shao, Jonathan; Strem, Mary D; Phillips-Mora, Wilberth; Zhang, Dapeng; Meinhardt, Lyndel W; Bailey, Bryan A

    2015-01-01

    Moniliophthora roreri is the fungal pathogen that causes frosty pod rot (FPR) disease of Theobroma cacao L., the source of chocolate. FPR occurs in most of the cacao producing countries in the Western Hemisphere, causing yield losses up to 80%. Genetic diversity within the FPR pathogen population may allow the population to adapt to changing environmental conditions and adapt to enhanced resistance in the host plant. The present study developed single nucleotide polymorphism (SNP) markers from RNASeq results for 13 M. roreri isolates and validated the markers for their ability to reveal genetic diversity in an international M. roreri collection. The SNP resources reported herein represent the first study of RNA sequencing (RNASeq)-derived SNP validation in M. roreri and demonstrates the utility of RNASeq as an approach for de novo SNP identification in M. roreri. A total of 88 polymorphic SNPs were used to evaluate the genetic diversity of 172 M. roreri cacao isolates resulting in 37 distinct genotypes (including 14 synonymous groups). Absence of heterozygosity for the 88 SNP markers indicates reproduction in M. roreri is clonal and likely due to a homothallic life style. The upper Magdalena Valley of Colombia showed the highest levels of genetic diversity with 20 distinct genotypes of which 13 were limited to this region, and indicates this region as the possible center of origin for M. roreri.

  20. High-throughput bacterial SNP typing identifies distinct clusters of Salmonella Typhi causing typhoid in Nepalese children

    LENUS (Irish Health Repository)

    Holt, Kathryn E

    2010-05-31

    Abstract Background Salmonella Typhi (S. Typhi) causes typhoid fever, which remains an important public health issue in many developing countries. Kathmandu, the capital of Nepal, is an area of high incidence and the pediatric population appears to be at high risk of exposure and infection. Methods We recently defined the population structure of S. Typhi, using new sequencing technologies to identify nearly 2,000 single nucleotide polymorphisms (SNPs) that can be used as unequivocal phylogenetic markers. Here we have used the GoldenGate (Illumina) platform to simultaneously type 1,500 of these SNPs in 62 S. Typhi isolates causing severe typhoid in children admitted to Patan Hospital in Kathmandu. Results Eight distinct S. Typhi haplotypes were identified during the 20-month study period, with 68% of isolates belonging to a subclone of the previously defined H58 S. Typhi. This subclone was closely associated with resistance to nalidixic acid, with all isolates from this group demonstrating a resistant phenotype and harbouring the same resistance-associated SNP in GyrA (Phe83). A secondary clone, comprising 19% of isolates, was observed only during the second half of the study. Conclusions Our data demonstrate the utility of SNP typing for monitoring bacterial populations over a defined period in a single endemic setting. We provide evidence for genotype introduction and define a nalidixic acid resistant subclone of S. Typhi, which appears to be the dominant cause of severe pediatric typhoid in Kathmandu during the study period.

  1. Heap: a highly sensitive and accurate SNP detection tool for low-coverage high-throughput sequencing data

    KAUST Repository

    Kobayashi, Masaaki

    2017-04-20

    Recent availability of large-scale genomic resources enables us to conduct so called genome-wide association studies (GWAS) and genomic prediction (GP) studies, particularly with next-generation sequencing (NGS) data. The effectiveness of GWAS and GP depends on not only their mathematical models, but the quality and quantity of variants employed in the analysis. In NGS single nucleotide polymorphism (SNP) calling, conventional tools ideally require more reads for higher SNP sensitivity and accuracy. In this study, we aimed to develop a tool, Heap, that enables robustly sensitive and accurate calling of SNPs, particularly with a low coverage NGS data, which must be aligned to the reference genome sequences in advance. To reduce false positive SNPs, Heap determines genotypes and calls SNPs at each site except for sites at the both ends of reads or containing a minor allele supported by only one read. Performance comparison with existing tools showed that Heap achieved the highest F-scores with low coverage (7X) restriction-site associated DNA sequencing reads of sorghum and rice individuals. This will facilitate cost-effective GWAS and GP studies in this NGS era. Code and documentation of Heap are freely available from https://github.com/meiji-bioinf/heap (29 March 2017, date last accessed) and our web site (http://bioinf.mind.meiji.ac.jp/lab/en/tools.html (29 March 2017, date last accessed)).

  2. Genotyping of single spore isolates of a Pasteuria penetrans population occurring in Florida using SNP-based markers.

    Science.gov (United States)

    Joseph, S; Schmidt, L M; Danquah, W B; Timper, P; Mekete, T

    2017-02-01

    To generate single spore lines of a population of bacterial parasite of root-knot nematode (RKN), Pasteuria penetrans, isolated from Florida and examine genotypic variation and virulence characteristics exist within the population. Six single spore lines (SSP), 16SSP, 17SSP, 18SSP, 25SSP, 26SSP and 30SSP were generated. Genetic variability was evaluated by comparing single-nucleotide polymorphisms (SNPs) in six protein-coding genes and the 16S rRNA gene. An average of one SNP was observed for every 69 bp in the 16S rRNA, whereas no SNPs were observed in the protein-coding sequences. Hierarchical cluster analysis of 16S rRNA sequences placed the clones into three distinct clades. Bio-efficacy analysis revealed significant heterogeneity in the level virulence and host specificity between the individual clones. The SNP markers developed to the 5' hypervariable region of the 16S rRNA gene may be useful in biotype differentiation within a population of P. penetrans. This study demonstrates an efficient method for generating single spore lines of P. penetrans and gives a deep insight into genetic heterogeneity and varying level of virulence exists within a population parasitizing a specific Meloidogyne sp. host. The results also suggest that the application of generalist spore lines in nematode management may achieve broad RKN control. © 2016 The Society for Applied Microbiology.

  3. Murine Double Minute 2 SNP T309G Polymorphism and Urinary Tract Cancer Risk: A Meta-Analysis.

    Science.gov (United States)

    Ding, Hui; Dai, Yu; Ning, Zhongyun; Fan, Ning; Wang, Zhiping; Li, Pei; Zhang, Liyuan; Tao, Yan; Wang, Hanzhang

    2016-03-01

    Urinary tract cancer is a common cause of cancer-related death. The etiology and pathogenesis of urinary tract cancer remain unclear, with genetic and epigenetic factors playing an important role. Studies of the polymorphism of murine double minute 2 (MDM2) have shown inconclusive trends in the risk of urinary tract cancer.To clarify this inconsistency, we conducted updated meta-analyses to evaluate the role of MDM2 T309G polymorphism in urinary tract cancer susceptibility.Data sources were Pubmed (1966-May 2015), Chinese biomedicine literature database (1978-May 2015), and hand searching of the reference lists of included studies:(1) research categories case-control study or a nested case-control study; (2) information evaluating the association between the MDM2 SNP309 and urinary tract cancer risk; (3) studies with sufficient data to perform a meta-analysis.It included the use of odds ratios (ORs) to assess the strength of the association, and 95% confidence intervals (CIs) give a sense of the precision of the estimate. We used I for the assessment of between-study heterogeneity, and publication bias was assessed using the funnel plot and the Egger test. Statistical analyses were performed by Review Manage, version 5.0 and Stata 11.0.A total of 18 studies met the eligibility criteria and were included in our analyses. Overall, there was no statistical association between MDM2 SNP309 and prostate cancer risk for the allele contrast, the GG genotype, the recessive genetic model, the dominant genetic model, and prostate cancer risk in all subjects (OR = 0.96, 95% CI 0.87-1.05, P = 0.36; OR = 0.93, 95% CI 0.75-1.15, P = 0.50; OR = 1.00, 95% CI 0.87-1.15, P = 0.99; OR = 0.93, 95% CI 0.80-1.07, P = 0.30), and between MDM2 SNP309 and bladder cancer risk (the allele contrast: OR = 1.06, 95% CI 0.89-1.27, P = 0.50; the GG genotype: OR = 1.12, 95% CI 0.79-1.61, P = 0.52; the dominant genetic model: OR = 1.03, 95% CI 0

  4. OpenADAM: an open source genome-wide association data management system for Affymetrix SNP arrays

    Directory of Open Access Journals (Sweden)

    Sham P C

    2008-12-01

    Full Text Available Abstract Background Large scale genome-wide association studies have become popular since the introduction of high throughput genotyping platforms. Efficient management of the vast array of data generated poses many challenges. Description We have developed an open source web-based data management system for the large amount of genotype data generated from the Affymetrix GeneChip® Mapping Array and Affymetrix Genome-Wide Human SNP Array platforms. The database supports genotype calling using DM, BRLMM, BRLMM-P or Birdseed algorithms provided by the Affymetrix Power Tools. The genotype and corresponding pedigree data are stored in a relational database for efficient downstream data manipulation and analysis, such as calculation of allele and genotype frequencies, sample identity checking, and export of genotype data in various file formats for analysis using commonly-available software. A novel method for genotyping error estimation is implemented using linkage disequilibrium information from the HapMap project. All functionalities are accessible via a web-based user interface. Conclusion OpenADAM provides an open source database system for management of Affymetrix genome-wide association SNP data.

  5. Exploring germplasm diversity to understand the domestication process in Cicer spp. using SNP and DArT markers.

    Directory of Open Access Journals (Sweden)

    Manish Roorkiwal

    Full Text Available To estimate genetic diversity within and between 10 interfertile Cicer species (94 genotypes from the primary, secondary and tertiary gene pool, we analysed 5,257 DArT markers and 651 KASPar SNP markers. Based on successful allele calling in the tertiary gene pool, 2,763 DArT and 624 SNP markers that are polymorphic between genotypes from the gene pools were analyzed further. STRUCTURE analyses were consistent with 3 cultivated populations, representing kabuli, desi and pea-shaped seed types, with substantial admixture among these groups, while two wild populations were observed using DArT markers. AMOVA was used to partition variance among hierarchical sets of landraces and wild species at both the geographical and species level, with 61% of the variation found between species, and 39% within species. Molecular variance among the wild species was high (39% compared to the variation present in cultivated material (10%. Observed heterozygosity was higher in wild species than the cultivated species for each linkage group. Our results support the Fertile Crescent both as the center of domestication and diversification of chickpea. The collection used in the present study covers all the three regions of historical chickpea cultivation, with the highest diversity in the Fertile Crescent region. Shared alleles between different gene pools suggest the possibility of gene flow among these species or incomplete lineage sorting and could indicate complicated patterns of divergence and fusion of wild chickpea taxa in the past.

  6. Development of EST Intron-Targeting SNP Markers for Panax ginseng and Their Application to Cultivar Authentication.

    Science.gov (United States)

    Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun

    2016-06-04

    Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to "Gopoong" and "K-1" were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information.

  7. SNP8NRG433E1006 NEUREGULIN-1 GENETIC VARIATION IN BATAKS ETHNIC WITH SCHIZOPHRENIA PARANOID AND HEALTHY CONTROL

    Directory of Open Access Journals (Sweden)

    Elmeida Effendy

    2014-05-01

    Full Text Available The neuregulin 1 (NRG1 gene which influences the development of white matter connectivity has been associated with schizophrenia. It influences neuronal migration, synaptogenesis, gliogenesis, neuron-glia communication, myelination, and neurotransmission in the brain and others. NRG1 is located in 8p13, and it is frequently replicated in schizphrenia. SNP8NRG433E1006 gene NRG1 is one of core at risk haplotype of schizphrenia. This study looked forward differences SNP8NRG433E1006 neuregulin 1 between Bataks ethnic with schizophrenia paranoid and Bataks ethnic healthy control. Methods: Batak ethnic with schizophrenia paranoid were recruited and interviewed with semi-structured MINI ICD-X to establish the diagnosis. All the eligible subjects were requested their permission for blood sampling. Healthy Batak ethnic were also recruited by mathcing the age and gender. The blood samples went through DNA isolation, Nested PCR, and DNA sequencing. Results: Ninety three subjects were recruited, but only 74 blood samples were succesfully sequenced. We found three types of polymorphisms, i.e. G/A allele at base pair (bp 76, G/T allele at bp 112, and deletion at bp 110 in Batak ethnic with schizophrenia. There were two kind sequences at bp 113-116 in Batak ethnics, and Batak ethnics with ATCG were at higher risk for having schizophrenia. This study support that NRG1 is a schizophrenia-susceptibility gene.

  8. An economical mtDNA SNP assay detecting different mitochondrial haplogroups in identical HVR 1 samples of Caucasian ancestry.

    Science.gov (United States)

    Köhnemann, Stephan; Hohoff, Carsten; Pfeiffer, Heidi

    2009-09-01

    We had sequenced 329 Caucasian samples in Hypervariable Region 1 (HVR 1) and found that they belong to eleven different mitochondrial DNA (mtDNA) haplotypes. The sample set was further analysed by an mtDNA assay examining 32 single nucleotide polymorphisms (SNPs) for haplogroup discrimination. In a validation study on 160 samples of different origin it was shown that these SNPs were able to discriminate between the evolved superhaplogroups worldwide (L, M and N) and between the nine most common Caucasian haplogroups (H, I, J, K, T, U, V, W and X). The 32 mtDNA SNPs comprised 42 different SNP haplotypes instead of only eleven haplotypes after HVR 1 sequencing. The assay provided stable results in a range of 5ng genomic DNA down to virtually no genomic DNA per reaction. It was possible to detect samples of African, Asian and Eurasian ancestry, respectively. The 32 mtDNA SNP assay is a helpful adjunct to further distinguish between identical HVR 1 sequences of Caucasian origin. Our results suggest that haplogroup prediction using HVR 1 sequencing provides instable results. The use of coding region SNPs for haplogroup assignment is more suited than using HVR 1 haplotypes.

  9. A SNP and SSR Based Genetic Map of Asparagus Bean (Vigna. unguiculata ssp. sesquipedialis) and Comparison with the Broader Species

    Science.gov (United States)

    Xu, Pei; Wu, Xiaohua; Wang, Baogen; Liu, Yonghua; Ehlers, Jeffery D.; Close, Timothy J.; Roberts, Philip A.; Diop, Ndeye-Ndack; Qin, Dehui; Hu, Tingting; Lu, Zhongfu; Li, Guojing

    2011-01-01

    Asparagus bean (Vigna. unguiculata ssp. sesquipedialis) is a distinctive subspecies of cowpea [Vigna. unguiculata (L.) Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as ‘long beans’ or ‘asparagus beans’. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs), with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs) identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level. PMID:21253606

  10. Analysis of Single Nucleotide Polymorphism (SNP rs22114085 Associated with Canine Atopic Dermatitis by PCR-RFLP Method

    Directory of Open Access Journals (Sweden)

    Martina Miluchová

    2012-05-01

    Full Text Available Canine atopic dermatitis (cAD is a common inflammatory skin disease that is considered to be a naturally occurring, spontaneous model of human atopic dermatitis (eczema. The aim of the paper was to identify of the SNP rs22114085 in different dog breeds. The material involved 52 dogs from 5 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® and linear polyacrylamide (LPA carrier and from blood by using commercial kit NucleospinBlood and used in order to estimate rs22114085 SNP genotypes by PCR-RFLP method. The PCR products were digested with DdeI restriction enzyme. The C allele was distributed in Czech Pointer, Chihuahua, German Wirehaired Pointer with an allele frequency ranging from 0.4545 to 1.00. In the population of Czech Pointer we detected all genotypes CC, CT and TT with frequency in male 0.25, 0.5833 and 0.1667, and in female 0.2728, 0.3636 and 0.3636, subsequently. In German Wirehaired Pointer was detected homozygote genotype CC in male and heterozygote genotype CT in female with frequency 1 and 1. In Chihuahua was observed homozygote genotype CC and heterozygote genotype CT with frequency 0.3333 and 0.6667, subsequently. In Golden retriever and Pincher we detected genotype TT with frequency 1.

  11. A SNP and SSR based genetic map of asparagus bean (Vigna. unguiculata ssp. sesquipedialis and comparison with the broader species.

    Directory of Open Access Journals (Sweden)

    Pei Xu

    Full Text Available Asparagus bean (Vigna. unguiculata ssp. sesquipedialis is a distinctive subspecies of cowpea [Vigna. unguiculata (L. Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as 'long beans' or 'asparagus beans'. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs, with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level.

  12. Reference-free SNP discovery for the Eurasian beaver from restriction site-associated DNA paired-end data.

    Science.gov (United States)

    Senn, Helen; Ogden, Rob; Cezard, Timothee; Gharbi, Karim; Iqbal, Zamin; Johnson, Eric; Kamps-Hughes, Nick; Rosell, Frank; McEwing, Ross

    2013-06-01

    In this study, we used restriction site-associated DNA (RAD) sequencing to discover SNP markers suitable for population genetic and parentage analysis with the aim of using them for monitoring the reintroduction of the Eurasian beaver (Castor fibre) to Scotland. In the absence of a reference genome for beaver, we built contigs and discovered SNPs within them using paired-end RAD data, so as to have sufficient flanking region around the SNPs to conduct marker design. To do this, we used a simple pipeline which catalogued the Read 1 data in stacks and then used the assembler cortex_var to conduct de novo assembly and genotyping of multiple samples using the Read 2 data. The analysis of around 1.1 billion short reads of sequence data was reduced to a set of 2579 high-quality candidate SNP markers that were polymorphic in Norwegian and Bavarian beaver. Both laboratory validation of a subset of eight of the SNPs (1.3% error) and internal validation by confirming patterns of Mendelian inheritance in a family group (0.9% error) confirmed the success of this approach. © 2013 John Wiley & Sons Ltd.

  13. Leaf Transcriptome Sequencing for Identifying Genic-SSR Markers and SNP Heterozygosity in Crossbred Mango Variety 'Amrapali' (Mangifera indica L.).

    Science.gov (United States)

    Mahato, Ajay Kumar; Sharma, Nimisha; Singh, Akshay; Srivastav, Manish; Jaiprakash; Singh, Sanjay Kumar; Singh, Anand Kumar; Sharma, Tilak Raj; Singh, Nagendra Kumar

    2016-01-01

    Mango (Mangifera indica L.) is called "king of fruits" due to its sweetness, richness of taste, diversity, large production volume and a variety of end usage. Despite its huge economic importance genomic resources in mango are scarce and genetics of useful horticultural traits are poorly understood. Here we generated deep coverage leaf RNA sequence data for mango parental varieties 'Neelam', 'Dashehari' and their hybrid 'Amrapali' using next generation sequencing technologies. De-novo sequence assembly generated 27,528, 20,771 and 35,182 transcripts for the three genotypes, respectively. The transcripts were further assembled into a non-redundant set of 70,057 unigenes that were used for SSR and SNP identification and annotation. Total 5,465 SSR loci were identified in 4,912 unigenes with 288 type I SSR (n ≥ 20 bp). One hundred type I SSR markers were randomly selected of which 43 yielded PCR amplicons of expected size in the first round of validation and were designated as validated genic-SSR markers. Further, 22,306 SNPs were identified by aligning high quality sequence reads of the three mango varieties to the reference unigene set, revealing significantly enhanced SNP heterozygosity in the hybrid Amrapali. The present study on leaf RNA sequencing of mango varieties and their hybrid provides useful genomic resource for genetic improvement of mango.

  14. Analysis of single nucleotide polymorphism (SNP RS23472497 associated with canine atopic dermatitis by ACRS-PCR method

    Directory of Open Access Journals (Sweden)

    Martina Miluchová

    2014-05-01

    Full Text Available The aim of the paper was to identify of the SNP rs23472497 associated with canine atopic dermatitis (cAD. cAD is a common inflammatory skin disease that is considered to be a naturally occurring, spontaneous model of human atopic dermatitis (eczema. The material involved 60 dogs from 6 different breeds. Canine genomic DNA was isolated from saliva by modified method with using DNAzol® and linear polyacrylamide (LPA carrier and from blood by using commercial kit NucleospinBlood and used in order to estimate rs23472497 SNP genotypes by ACRS-PCR method. The PCR products were digested with NlaIII restriction enzyme. In the population of Czech Pointer and Slovak Wirehaired Pointer we detected all genotypes AA, AG and GG with frequency 0.0732, 0.5122 and 0.4146 for Czech Pointer and 0.1818, 0.5455 and 0.2727 for Slovak Wirehaired Pointer. In Border Collie was observed heterozygote genotype AG and homozygote genotype GG with frequency 0.6667 and 0.3333, subsequently. In German Wirehaired Pointer, Australian Shepherd dog and American Staffordshire terrier we detected only genotype AG with frequency 1. The A allele was distributed with an allele frequency ranging from 0.3293 to 0.5. The G allele was distributed with an allele frequency ranging from 0.5 to 0.6707.

  15. [Association Between SNP rs6007897 of CELSR1 and Acute Ischemic Stroke in Western China Han Population: a Case-control Study].

    Science.gov (United States)

    Qin, Feng-qin; Yu, Li-hua; Hu, Wen-ting; Guo, Jian; Chen, Ning; Guo, Jiang; Fang, Jing-huan; He, Li

    2015-07-01

    To investigate the relationship between single nucleotide polymorphism (SNP) rs6007897 of CELSR1 and acute ischemic stroke in Western China Han population. All subjects (759 acute ischemic stroke patients and 786 controls) were genotyped using ligation detection reaction (LDR). We analyzed the differences between SNP rs6007897 genotypes and allele frequencies between two groups. Two genotypes (AA, AG) of rs6007897 were found in both stroke and control group. There was no statistically significance between two groups about genotype and allele frequency. After adjusting for risk factors, we found there was no significant association between rs6007897 and ischemic stroke CP = 0.797, odds ratio (OR) = 0.886, 95% confidence interval (CI) = 0.352-2.227). SNP rs6007897 of CELSR1 was not significantly associated with ischemic stroke in Western China Han population.

  16. New Insights into the Geographic Distribution of Mycobacterium leprae SNP Genotypes Determined for Isolates from Leprosy Cases Diagnosed in Metropolitan France and French Territories.

    Science.gov (United States)

    Reibel, Florence; Chauffour, Aurélie; Brossier, Florence; Jarlier, Vincent; Cambau, Emmanuelle; Aubry, Alexandra

    2015-01-01

    Between 20 and 30 bacteriologically confirmed cases of leprosy are diagnosed each year at the French National Reference Center for mycobacteria. Patients are mainly immigrants from various endemic countries or living in French overseas territories. We aimed at expanding data regarding the geographical distribution of the SNP genotypes of the M. leprae isolates from these patients. Skin biopsies were obtained from 71 leprosy patients diagnosed between January 2009 and December 2013. Data regarding age, sex and place of birth and residence were also collected. Diagnosis of leprosy was confirmed by microscopic detection of acid-fast bacilli and/or amplification by PCR of the M. leprae-specific RLEP region. Single nucleotide polymorphisms (SNP), present in the M. leprae genome at positions 14 676, 1 642 875 and 2 935 685, were determined with an efficiency of 94% (67/71). Almost all patients were from countries other than France where leprosy is still prevalent (n = 31) or from French overseas territories (n = 36) where leprosy is not totally eradicated, while only a minority (n = 4) was born in metropolitan France but have lived in other countries. SNP type 1 was predominant (n = 33), followed by type 3 (n = 17), type 4 (n = 11) and type 2 (n = 6). SNP types were concordant with those previously reported as prevalent in the patients' countries of birth. SNP types found in patients born in countries other than France (Comoros, Haiti, Benin, Congo, Sri Lanka) and French overseas territories (French Polynesia, Mayotte and La Réunion) not covered by previous work correlated well with geographical location and history of human settlements. The phylogenic analysis of M. leprae strains isolated in France strongly suggests that French leprosy cases are caused by SNP types that are (a) concordant with the geographic origin or residence of the patients (non-French countries, French overseas territories, metropolitan France) or (b) more likely random in regions where diverse

  17. QualitySNP: a pipeline for detecting single nucleotide polymorphisms and insertions/deletions in EST data from diploid and polyploid species

    Directory of Open Access Journals (Sweden)

    Voorrips Roeland E

    2006-10-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are important tools in studying complex genetic traits and genome evolution. Computational strategies for SNP discovery make use of the large number of sequences present in public databases (in most cases as expressed sequence tags (ESTs and are considered to be faster and more cost-effective than experimental procedures. A major challenge in computational SNP discovery is distinguishing allelic variation from sequence variation between paralogous sequences, in addition to recognizing sequencing errors. For the majority of the public EST sequences, trace or quality files are lacking which makes detection of reliable SNPs even more difficult because it has to rely on sequence comparisons only. Results We have developed a new algorithm to detect reliable SNPs and insertions/deletions (indels in EST data, both with and without quality files. Implemented in a pipeline called QualitySNP, it uses three filters for the identification of reliable SNPs. Filter 1 screens for all potential SNPs and identifies variation between or within genotypes. Filter 2 is the core filter that uses a haplotype-based strategy to detect reliable SNPs. Clusters with potential paralogs as well as false SNPs caused by sequencing errors are identified. Filter 3 screens SNPs by calculating a confidence score, based upon sequence redundancy and quality. Non-synonymous SNPs are subsequently identified by detecting open reading frames of consensus sequences (contigs with SNPs. The pipeline includes a data storage and retrieval system for haplotypes, SNPs and alignments. QualitySNP's versatility is demonstrated by the identification of SNPs in EST datasets from potato, chicken and humans. Conclusion QualitySNP is an efficient tool for SNP detection, storage and retrieval in diploid as well as polyploid species. It is available for running on Linux or UNIX systems. The program, test data, and user manual are available at

  18. A custom correlation coefficient (CCC) approach for fast identification of multi-SNP association patterns in genome-wide SNPs data.

    Science.gov (United States)

    Climer, Sharlee; Yang, Wei; de las Fuentes, Lisa; Dávila-Román, Victor G; Gu, C Charles

    2014-11-01

    Complex diseases are often associated with sets of multiple interacting genetic factors and possibly with unique sets of the genetic factors in different groups of individuals (genetic heterogeneity). We introduce a novel concept of custom correlation coefficient (CCC) between single nucleotide polymorphisms (SNPs) that address genetic heterogeneity by measuring subset correlations autonomously. It is used to develop a 3-step process to identify candidate multi-SNP patterns: (1) pairwise (SNP-SNP) correlations are computed using CCC; (2) clusters of so-correlated SNPs identified; and (3) frequencies of these clusters in disease cases and controls compared to identify disease-associated multi-SNP patterns. This method identified 42 candidate multi-SNP associations with hypertensive heart disease (HHD), among which one cluster of 22 SNPs (six genes) included 13 in SLC8A1 (aka NCX1, an essential component of cardiac excitation-contraction coupling) and another of 32 SNPs had 29 from a different segment of SLC8A1. While allele frequencies show little difference between cases and controls, the cluster of 22 associated alleles were found in 20% of controls but no cases and the other in 3% of controls but 20% of cases. These suggest that both protective and risk effects on HHD could be exerted by combinations of variants in different regions of SLC8A1, modified by variants from other genes. The results demonstrate that this new correlation metric identifies disease-associated multi-SNP patterns overlooked by commonly used correlation measures. Furthermore, computation time using CCC is a small fraction of that required by other methods, thereby enabling the analyses of large GWAS datasets. © 2014 WILEY PERIODICALS, INC.

  19. Evaluation of inbreeding depression in Holstein cattle using whole-genome SNP markers and alternative measures of genomic inbreeding.

    Science.gov (United States)

    Bjelland, D W; Weigel, K A; Vukasinovic, N; Nkrumah, J D

    2013-07-01

    The effects of increased pedigree inbreeding in dairy cattle populations have been well documented and result in a negative impact on profitability. Recent advances in genotyping technology have allowed researchers to move beyond pedigree analysis and study inbreeding at a molecular level. In this study, 5,853 animals were genotyped for 54,001 single nucleotide polymorphisms (SNP); 2,913 cows had phenotypic records including a single lactation for milk yield (from either lactation 1, 2, 3, or 4), reproductive performance, and linear type conformation. After removing SNP with poor call rates, low minor allele frequencies, and departure from Hardy-Weinberg equilibrium, 33,025 SNP remained for analyses. Three measures of genomic inbreeding were evaluated: percent homozygosity (FPH), inbreeding calculated from runs of homozygosity (FROH), and inbreeding derived from a genomic relationship matrix (FGRM). Average FPH was 60.5±1.1%, average FROH was 3.8±2.1%, and average FGRM was 20.8±2.3%, where animals with larger values for each of the genomic inbreeding indices were considered more inbred. Decreases in total milk yield to 205d postpartum of 53, 20, and 47kg per 1% increase in FPH, FROH, and FGRM, respectively, were observed. Increases in days open per 1% increase in FPH (1.76 d), FROH (1.72 d), and FGRM (1.06 d) were also noted, as well as increases in maternal calving difficulty (0.09, 0.03, and 0.04 on a 5-point scale for FPH, FROH, and FGRM, respectively). Several linear type traits, such as strength (-0.40, -0.11, and -0.19), rear legs rear view (-0.35, -0.16, and -0.14), front teat placement (0.35, 0.25, 0.18), and teat length (-0.24, -0.14, and -0.13) were also affected by increases in FPH, FROH, and FGRM, respectively. Overall, increases in each measure of genomic inbreeding in this study were associated with negative effects on production and reproductive ability in dairy cows. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc

  20. Forensic genetic SNP typing of low-template DNA and highly degraded DNA from crime case samples.

    Science.gov (United States)

    Børsting, Claus; Mogensen, Helle Smidt; Morling, Niels

    2013-05-01

    Heterozygote imbalances leading to allele drop-outs and disproportionally large stutters leading to allele drop-ins are known stochastic phenomena related to STR typing of low-template DNA (LtDNA). The large stutters and the many drop-ins in typical STR stutter positions are artifacts from the PCR amplification of tandem repeats. These artifacts may be avoided by typing bi-allelic markers instead of STRs. In this work, the SNPforID multiplex assay was used to type LtDNA. A sensitized SNP typing protocol was introduced, that increased signal strengths without increasing noise and without affecting the heterozygote balance. Allele drop-ins were only observed in experiments with 25 pg of DNA and not in experiments with 50 and 100 pg of DNA. The allele drop-in rate in the 25 pg experiments was 0.06% or 100 times lower than what was previously reported for STR typing of LtDNA. A composite model and two different consensus models were used to interpret the SNP data. Correct profiles with 42-49 SNPs were generated from the 50 and 100 pg experiments, whereas a few incorrect genotypes were included in the generated profiles from the 25 pg experiments. With the strict consensus model, between 35 and 48 SNPs were correctly typed in the 25 pg experiments and only one allele drop-out (error rate: 0.07%) was observed in the consensus profiles. A total of 28 crime case samples were selected for typing with the sensitized SNPforID protocol. The samples were previously typed with old STR kits during the crime case investigation and only partial profiles (0-6 STRs) were obtained. Eleven of the samples could not be quantified with the Quantifiler™ Human DNA Quantification kit because of partial or complete inhibition of the PCR. For eight of these samples, SNP typing was only possible when the buffer and DNA polymerase used in the original protocol was replaced with the AmpFℓSTR(®) SEfiler Plus™ Master Mix, which was developed specifically for challenging forensic samples. All

  1. A meta-analysis of eNOS and ACE gene polymorphisms and risk of pre-eclampsia in women.

    Science.gov (United States)

    Shaik, A P; Sultana, A; Bammidi, V K; Sampathirao, K; Jamil, K

    2011-10-01

    A meta-analyses of endothelial nitric oxide synthase (eNOS) and angiotensin-converting enzyme (ACE) gene polymorphisms in pre-eclampsia was performed. We shortlisted 33 studies (17 for ACE; 16 for eNOS gene polymorphisms), of which 29 articles (16 for ACE and 15 for eNOS) were analysed. Overall, 1,620 cases with pre-eclampsia and 2,158 controls were analysed for intron 16 insertion-deletion polymorphism in ACE gene. A total of 1,610 subjects with pre-eclampsia and 2,875 controls were analysed for the Glu298Asp in eNOS gene. Overall, the random-effects odds ratio (OR) with Glu298Asp in eNOS gene was 0.958 (95% confidence intervals, CI 0.747-1.228, p > 0.05), and for the insertion-deletion/ACE polymorphism was 0.987 (95% CI 0.698-1.395, p > 0.05). Significant heterogeneity was observed in the studies that evaluated polymorphisms in ACE (Q value = 55.6; I(2) = 73; p value = 0.000); and eNOS (Q value = 37.2; I(2) = 62.4; p value = 0.001) polymorphisms. No significant risk of pre-eclampsia was observed in both eNOS and ACE genes with these polymorphisms.

  2. An evaluation of the genetic-matched pair study design using genome-wide SNP data from the European population

    DEFF Research Database (Denmark)

    Lu, Timothy Tehua; Lao, Oscar; Nothnagel, Michael

    2009-01-01

    of cases (76.0%), the BOM of a given individual, based on the complete marker set, came from a different recruitment site than the individual itself. A second marker set, specifically selected for ancestry sensitivity using singular value decomposition, performed even more poorly and was no more capable......Genetic matching potentially provides a means to alleviate the effects of incomplete Mendelian randomization in population-based gene-disease association studies. We therefore evaluated the genetic-matched pair study design on the basis of genome-wide SNP data (309,790 markers; Affymetrix Gene......Chip Human Mapping 500K Array) from 2457 individuals, sampled at 23 different recruitment sites across Europe. Using pair-wise identity-by-state (IBS) as a matching criterion, we tried to derive a subset of markers that would allow identification of the best overall matching (BOM) partner for a given...

  3. Model of personalised risk assessment of phytoestrogen intake based on 11 SNP in ESR1 and ESR2 genes

    Directory of Open Access Journals (Sweden)

    Radoslav Zidek

    2016-12-01

    Full Text Available Phytoestrogens can induce biological responses in vertebrates by mimicking or modulating the action or production of endogenous hormones, and because of their structural similarity with estradiol they have the ability to cause estrogenic or anti-estrogenic effects. Risk assessment of phytoestrogens intake may therefore provide important information useful in the adjustment of nutrients composition, as one of nutrigenomics approaches. Proper risk assessment is an essential part of good nutrient composition. The current risk assessment procedures does use an additive effect of genes, but the accumulation of relevant factors do not count with the distribution of risk in the European population. A combination of approaches based on genetic score, along with the use of the data bases like 1000 genomes and dbSNP is a powerful tool for population risk modelling that would provide reasonable results without needs of as testing a representative number of individual genetic profiles.

  4. Comparative Genomics of Methanopyrus sp. SNP6 and KOL6 Revealing Genomic Regions of Plasticity Implicated in Extremely Thermophilic Profiles

    Directory of Open Access Journals (Sweden)

    Zhiliang Yu

    2017-07-01

    Full Text Available Methanopyrus spp. are usually isolated from harsh niches, such as high osmotic pressure and extreme temperature. However, the molecular mechanisms for their environmental adaption are poorly understood. Archaeal species is commonly considered as primitive organism. The evolutional placement of archaea is a fundamental and intriguing scientific question. We sequenced the genomes of Methanopyrus strains SNP6 and KOL6 isolated from the Atlantic and Iceland, respectively. Comparative genomic analysis revealed genetic diversity and instability implicated in niche adaption, including a number of transporter- and integrase/transposase-related genes. Pan-genome analysis also defined the gene pool of Methanopyrus spp., in addition of ~120-Kb genomic region of plasticity impacting cognate genomic architecture. We believe that Methanopyrus genomics could facilitate efficient investigation/recognition of archaeal phylogenetic diverse patterns, as well as improve understanding of biological roles and significance of these versatile microbes.

  5. A Fast Method for DEFB1-44C/G SNP Genotyping in Brazilian Patients with Periodontitis

    Directory of Open Access Journals (Sweden)

    Rafael Rafael Amorim Cavalcanti de Siqueira

    2014-01-01

    Full Text Available Aim: Defensins are cationic antimicrobial peptides expressed in epithelial cells. Such peptides exhibit antibacterial, antifungal and antiviral properties, and are a component of the innate immune response. It has been suggested that they have a protective role in the oral cavity. This study evaluated the DEFB1 polymorphism in diabetic patients with or without periodontitis in comparison to healthy controls. Material and Methods: We used Hairpin-Shaped Primer (HP assay to study the distribution of the -44 C/G SNP (rs1800972 in 119 human DNAs obtained from diabetic patients and healthy control patients. Results: The results indicate that there are no differences in distribution between groups and that in diabetic periodontitis patients the homozygous mutant could be found more frequently. Conclusion: Further studies are necessary in order to investigate the role of DEFB1 polymorphisms in diabetic periodontitis patients and the influence of the peptide in periodontal pathogens.

  6. Whole-genome SNP association in the horse: identification of a deletion in myosin Va responsible for Lavender Foal Syndrome.

    Directory of Open Access Journals (Sweden)

    Samantha A Brooks

    2010-04-01

    Full Text Available Lavender Foal Syndrome (LFS is a lethal inherited disease of horses with a suspected autosomal recessive mode of inheritance. LFS has been primarily diagnosed in a subgroup of the Arabian breed, the Egyptian Arabian horse. The condition is characterized by multiple neurological abnormalities and a dilute coat color. Candidate genes based on comparative phenotypes in mice and humans include the ras-associated protein RAB27a (RAB27A and myosin Va (MYO5A. Here we report mapping of the locus responsible for LFS using a small set of 36 horses segregating for LFS. These horses were genotyped using a newly available single nucleotide polymorphism (SNP chip containing 56,402 discriminatory elements. The whole genome scan identified an associated region containing these two functional candidate genes. Exon sequencing of the MYO5A gene from an affected foal revealed a single base deletion in exon 30 that changes the reading frame and introduces a premature stop codon. A PCR-based Restriction Fragment Length Polymorphism (PCR-RFLP assay was designed and used to investigate the frequency of the mutant gene. All affected horses tested were homozygous for this mutation. Heterozygous carriers were detected in high frequency in families segregating for this trait, and the frequency of carriers in unrelated Egyptian Arabians was 10.3%. The mapping and discovery of the LFS mutation represents the first successful use of whole-genome SNP scanning in the horse for any trait. The RFLP assay can be used to assist breeders in avoiding carrier-to-carrier matings and thus in preventing the birth of affected foals.

  7. iLOCi: a SNP interaction prioritization technique for detecting epistasis in genome-wide association studies

    Directory of Open Access Journals (Sweden)

    Piriyapongsa Jittima

    2012-12-01

    Full Text Available Abstract Background Genome-wide association studies (GWAS do not provide a full account of the heritability of genetic diseases since gene-gene interactions, also known as epistasis are not considered in single locus GWAS. To address this problem, a considerable number of methods have been developed for identifying disease-associated gene-gene interactions. However, these methods typically fail to identify interacting markers explaining more of the disease heritability over single locus GWAS, since many of the interactions significant for disease are obscured by uninformative marker interactions e.g., linkage disequilibrium (LD. Results In this study, we present a novel SNP interaction prioritization algorithm, named iLOCi (Interacting Loci. This algorithm accounts for marker dependencies separately in case and control groups. Disease-associated interactions are then prioritized according to a novel ranking score calculated from the difference in marker dependencies for every possible pair between case and control groups. The analysis of a typical GWAS dataset can be completed in less than a day on a standard workstation with parallel processing capability. The proposed framework was validated using simulated data and applied to real GWAS datasets using the Wellcome Trust Case Control Consortium (WTCCC data. The results from simulated data showed the ability of iLOCi to identify various types of gene-gene interactions, especially for high-order interaction. From the WTCCC data, we found that among the top ranked interacting SNP pairs, several mapped to genes previously known to be associated with disease, and interestingly, other previously unreported genes with biologically related roles. Conclusion iLOCi is a powerful tool for uncovering true disease interacting markers and thus can provide a more complete understanding of the genetic basis underlying complex disease. The program is available for download at http://www4a.biotec.or.th/GI/tools/iloci.

  8. Double digest RADseq: an inexpensive method for de novo SNP discovery and genotyping in model and non-model species.

    Directory of Open Access Journals (Sweden)

    Brant K Peterson

    Full Text Available The ability to efficiently and accurately determine genotypes is a keystone technology in modern genetics, crucial to studies ranging from clinical diagnostics, to genotype-phenotype association, to reconstruction of ancestry and the detection of selection. To date, high capacity, low cost genotyping has been largely achieved via "SNP chip" microarray-based platforms which require substantial prior knowledge of both genome sequence and variability, and once designed are suitable only for those targeted variable nucleotide sites. This method introduces substantial ascertainment bias and inherently precludes detection of rare or population-specific variants, a major source of information for both population history and genotype-phenotype association. Recent developments in reduced-representation genome sequencing experiments on massively parallel sequencers (commonly referred to as RAD-tag or RADseq have brought direct sequencing to the problem of population genotyping, but increased cost and procedural and analytical complexity have limited their widespread adoption. Here, we describe a complete laboratory protocol, including a custom combinatorial indexing method, and accompanying software tools to facilitate genotyping across large numbers (hundreds or more of individuals for a range of markers (hundreds to hundreds of thousands. Our method requires no prior genomic knowledge and achieves per-site and per-individual costs below that of current SNP chip technology, while requiring similar hands-on time investment, comparable amounts of input DNA, and downstream analysis times on the order of hours. Finally, we provide empirical results from the application of this method to both genotyping in a laboratory cross and in wild populations. Because of its flexibility, this modified RADseq approach promises to be applicable to a diversity of biological questions in a wide range of organisms.

  9. Genetic dissection of powdery mildew resistance in interspecific half-sib grapevine families using SNP-based maps.

    Science.gov (United States)

    Teh, Soon Li; Fresnedo-Ramírez, Jonathan; Clark, Matthew D; Gadoury, David M; Sun, Qi; Cadle-Davidson, Lance; Luby, James J

    2017-01-01

    Quantitative trait locus (QTL) identification in perennial fruit crops is impeded largely by their lengthy generation time, resulting in costly and labor-intensive maintenance of breeding programs. In a grapevine (genus Vitis ) breeding program, although experimental families are typically unreplicated, the genetic backgrounds may contain similar progenitors previously selected due to their contribution of favorable alleles. In this study, we investigated the utility of joint QTL identification provided by analyzing half-sib families. The genetic control of powdery mildew was studied using two half-sib F 1 families, namely GE0711/1009 (MN1264 × MN1214; N  = 147) and GE1025 (MN1264 × MN1246; N  = 125) with multiple species in their ancestry. Maternal genetic maps consisting of 1077 and 1641 single nucleotide polymorphism (SNP) markers, respectively, were constructed using a pseudo-testcross strategy. Ratings of field resistance to powdery mildew were obtained based on whole-plant evaluation of disease severity. This 2-year analysis uncovered two QTLs that were validated on a consensus map in these half-sib families with improved precision relative to the parental maps. Examination of haplotype combinations based on the two QTL regions identified strong association of haplotypes inherited from 'Seyval blanc', through MN1264, with powdery mildew resistance. This investigation also encompassed the use of microsatellite markers to establish a correlation between 206-bp (UDV-015b) and 357-bp (VViv67) fragment sizes with resistance-carrying haplotypes. Our work is one of the first reports in grapevine demonstrating the use of SNP-based maps and haplotypes for QTL identification and tagging of powdery mildew resistance in half-sib families.

  10. Low cost, low tech SNP genotyping tools for resource-limited areas: Plague in Madagascar as a model.

    Science.gov (United States)

    Mitchell, Cedar L; Andrianaivoarimanana, Voahangy; Colman, Rebecca E; Busch, Joseph; Hornstra-O'Neill, Heidie; Keim, Paul S; Wagner, David M; Rajerison, Minoarisoa; Birdsell, Dawn N

    2017-12-01

    Genetic analysis of pathogenic organisms is a useful tool for linking human cases together and/or to potential environmental sources. The resulting data can also provide information on evolutionary patterns within a targeted species and phenotypic traits. However, the instruments often used to generate genotyping data, such as single nucleotide polymorphisms (SNPs), can be expensive and sometimes require advanced technologies to implement. This places many genotyping tools out of reach for laboratories that do not specialize in genetic studies and/or lack the requisite financial and technological resources. To address this issue, we developed a low cost and low tech genotyping system, termed agarose-MAMA, which combines traditional PCR and agarose gel electrophoresis to target phylogenetically informative SNPs. To demonstrate the utility of this approach for generating genotype data in a resource-constrained area (Madagascar), we designed an agarose-MAMA system targeting previously characterized SNPs within Yersinia pestis, the causative agent of plague. We then used this system to genetically type pathogenic strains of Y. pestis in a Malagasy laboratory not specialized in genetic studies, the Institut Pasteur de Madagascar (IPM). We conducted rigorous assay performance validations to assess potential variation introduced by differing research facilities, reagents, and personnel and found no difference in SNP genotyping results. These agarose-MAMA PCR assays are currently employed as an investigative tool at IPM, providing Malagasy researchers a means to improve the value of their plague epidemiological investigations by linking outbreaks to potential sources through genetic characterization of isolates and to improve understanding of disease ecology that may contribute to a long-term control effort. The success of our study demonstrates that the SNP-based genotyping capacity of laboratories in developing countries can be expanded with manageable financial cost for

  11. TNF-alpha 308 SNP Rs3091256 GG Genotype is Strongly Associated with Fibrosis in Patients with Chronic Hepatitis C

    Directory of Open Access Journals (Sweden)

    Özgür GÜNAL

    2017-12-01

    Full Text Available Objective: We aimed to review the influence of host genetic factors on the clinical course, treatment response as well as fibrosis progression in patients with viral hepatitis C genotype 1. Materials and Methods: Ninety-five patients with chronic hepatitis C virus (HCV infection and 97 controls were enrolled. The patients received pegylated interferon (Peg-IFN+ribavirin therapy for 48 weeks and were followed up for the next 48 weeks. Aspartat aminotransferase/platelet ratio (APRI was used to detect liver fibrosis DNA specimens were extracted from the peripheral blood mononuclear cells and the tumor necrosis factor-alpha (TNF-α 308 rs3091256 was genotyped by the polymerase chain reaction-restriction fragment length polymorphism method. Results: All patients included in the study were infected with HCV genotype 1. of the 95 HCV-positive patients, spontaneous viral clearence was observed in 25.5%, rapid viral response in 44.2%, early viral response in 91.8%, and sustained viral response was found in 73.3% of patients. The allele and genotype were not significant between patients and controls. There was no significant difference in virologic response as well. However, TNF-α-308 single nucleotide polymorphisms (SNP rs3091256 GG genotype was strongly associated with fibrosis and alanine aminotransferase (ALT levels (p=0.006 and p=0.017, respectively. Conclusion: TNF-α-308 polymorphisms may reveal different results among countries. Patients having SNP rs3091256 GG are prone to have higher ALT levels and fibrosis score but have better treatment outcome.

  12. Survey of SSC12 regions affecting fatty acid composition of intramuscular fat using high density SNP data

    Directory of Open Access Journals (Sweden)

    María eMuñoz

    2012-01-01

    Full Text Available Fatty acid composition is a critical aspect of pork because it affects sensorial and technological aspects of meat quality and it is relevant for human health. Previous studies identified significant QTLs in porcine chromosome 12 for fatty acid profile of backfat and intramuscular fat. In the present study, 374 SNPs mapped in SSC12 from the 60K Porcine SNP Beadchip were used. We have combined linkage and association analyses with expression data analysis in order to identify regions of SSC12 that could affect fatty acid composition of intramuscular fat in longissimus muscle. The QTL scan showed a region around the 60 cM position that significantly affects palmitic fatty acid and two related fatty acid indexes. The Iberian QTL allele increased the palmitic content (+2.6% of mean trait. This QTL does not match any of those reported in the previous study on fatty acid composition of backfat, suggesting different genetic control acting at both tissues. The SNP association analyses showed significant associations with linolenic and palmitic acids besides several indexes. Among the polymorphisms that affect palmitic fatty acid and match the QTL region at 60 cM, there were three that mapped in the Phosphatidylcholine Transfer Protein (PCTP gene and one in the Acetyl-CoA Carboxylase  gene (ACACA. Interestingly one of the PCTP SNPs also affected significantly unsaturated and double bound indexes and the ratio between polyunsaturated/monounsaturated fatty acids. Differential expression was assessed on longissimus muscle conditional on the genotype of the QTL and on the most significant SNPs, according to the results obtained in the former analyses. Results from the microarray expression analyses, validated by RT-qPCR, showed that PCTP expression levels significantly vary depending on the QTL as well as on the own PCTP genotype. The results obtained with the different approaches point out the PCTP gene as a powerful candidate underlying the QTL for

  13. Increasing Genome Sampling and Improving SNP Genotyping for Genotyping-by-Sequencing with New Combinations of Restriction Enzymes.

    Science.gov (United States)

    Fu, Yong-Bi; Peterson, Gregory W; Dong, Yibo

    2016-04-07

    Genotyping-by-sequencing (GBS) has emerged as a useful genomic approach for exploring genome-wide genetic variation. However, GBS commonly samples a genome unevenly and can generate a substantial amount of missing data. These technical features would limit the power of various GBS-based genetic and genomic analyses. Here we present software called IgCoverage for in silico evaluation of genomic coverage through GBS with an individual or pair of restriction enzymes on one sequenced genome, and report a new set of 21 restriction enzyme combinations that can be applied to enhance GBS applications. These enzyme combinations were developed through an application of IgCoverage on 22 plant, animal, and fungus species with sequenced genomes, and some of them were empirically evaluated with different runs of Illumina MiSeq sequencing in 12 plant species. The in silico analysis of 22 organisms revealed up to eight times more genome coverage for the new combinations consisted of pairing four- or five-cutter restriction enzymes than the commonly used enzyme combination PstI + MspI. The empirical evaluation of the new enzyme combination (HinfI + HpyCH4IV) in 12 plant species showed 1.7-6 times more genome coverage than PstI + MspI, and 2.3 times more genome coverage in dicots than monocots. Also, the SNP genotyping in 12 Arabidopsis and 12 rice plants revealed that HinfI + HpyCH4IV generated 7 and 1.3 times more SNPs (with 0-16.7% missing observations) than PstI + MspI, respectively. These findings demonstrate that these novel enzyme combinations can be utilized to increase genome sampling and improve SNP genotyping in various GBS applications. Copyright © 2016 Fu et al.

  14. Inter-laboratory evaluation of the EUROFORGEN Global ancestry-informative SNP panel by massively parallel sequencing using the Ion PGM™.

    Science.gov (United States)

    Eduardoff, M; Gross, T E; Santos, C; de la Puente, M; Ballard, D; Strobl, C; Børsting, C; Morling, N; Fusco, L; Hussing, C; Egyed, B; Souto, L; Uacyisrael, J; Syndercombe Court, D; Carracedo, Á; Lareu, M V; Schneider, P M; Parson, W; Phillips, C; Parson, W; Phillips, C

    2016-07-01

    The EUROFORGEN Global ancestry-informative SNP (AIM-SNPs) panel is a forensic multiplex of 128 markers designed to differentiate an individual's ancestry from amongst the five continental population groups of Africa, Europe, East Asia, Native America, and Oceania. A custom multiplex of AmpliSeq™ PCR primers was designed for the Global AIM-SNPs to perform massively parallel sequencing using the Ion PGM™ system. This study assessed individual SNP genotyping precision using the Ion PGM™, the forensic sensitivity of the multiplex using dilution series, degraded DNA plus simple mixtures, and the ancestry differentiation power of the final panel design, which required substitution of three original ancestry-informative SNPs with alternatives. Fourteen populations that had not been previously analyzed were genotyped using the custom multiplex and these studies allowed assessment of genotyping performance by comparison of data across five laboratories. Results indicate a low level of genotyping error can still occur from sequence misalignment caused by homopolymeric tracts close to the target SNP, despite careful scrutiny of candidate SNPs at the design stage. Such sequence misalignment required the exclusion of component SNP rs2080161 from the Global AIM-SNPs panel. However, the overall genotyping precision and sensitivity of this custom multiplex indicates the Ion PGM™ assay for the Global AIM-SNPs is highly suitable for forensic ancestry analysis with massively parallel sequencing. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Genomewide high-density SNP linkage analysis of non-BRCA1/2 breast cancer families identifies various candidate regions and has greater power than microsatellite studies

    NARCIS (Netherlands)

    A. González-Neira (Anna); J.M. Rosa-Rosa; A. Osorio (Ana); E. Gonzalez (Emilio); M.C. Southey (Melissa); O. Sinilnikova (Olga); H. Lynch (Henry); R.A. Oldenburg (Rogier); C.J. van Asperen (Christi); N. Hoogerbrugge (Nicoline); G. Pita (Guillermo); P. Devilee (Peter); D. Goldgar (David); J. Benítez (Javier)

    2007-01-01

    textabstractBackground: The recent development of new high-throughput technologies for SNP genotyping has opened the possibility of taking a genome-wide linkage approach to the search for new candidate genes involved in heredity diseases. The two major breast cancer susceptibility genes BRCA1 and

  16. Genomewide high-density SNP linkage analysis of non-BRCA1/2 breast cancer families identifies various candidate regions and has greater power than microsatellite studies

    Directory of Open Access Journals (Sweden)

    Gonzalez-Neira Anna

    2007-08-01

    Full Text Available Abstract Background The recent development of new high-throughput technologies for SNP genotyping has opened the possibility of taking a genome-wide linkage approach to the search for new candidate genes involved in heredity diseases. The two major breast cancer susceptibility genes BRCA1 and BRCA2 are involved in 30% of hereditary breast cancer cases, but the discovery of additional breast cancer predisposition genes for the non-BRCA1/2 breast cancer families has so far been unsuccessful. Results In order to evaluate the power improvement provided by using SNP markers in a real situation, we have performed a whole genome screen of 19 non-BRCA1/2 breast cancer families using 4720 genomewide SNPs with Illumina technology (Illumina's Linkage III Panel, with an average distance of 615 Kb/SNP. We identified six regions on chromosomes 2, 3, 4, 7, 11 and 14 as candidates to contain genes involved in breast cancer susceptibility, and additional fine mapping genotyping using microsatellite markers around linkage peaks confirmed five of them, excluding the region on chromosome 3. These results were consistent in analyses that excluded SNPs in high linkage disequilibrium. The results were compared with those obtained previously using a 10 cM microsatellite scan (STR-GWS and we found lower or not significant linkage signals with STR-GWS data compared to SNP data in all cases. Conclusion Our results show the power increase that SNPs can supply in linkage studies.

  17. Construction of an SNP-based high-density linkage map for flax (Linum usitatissimum L.) using specific length amplified fragment sequencing (SLAF-seq) technology.

    Science.gov (United States)

    Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui

    2017-01-01

    Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.

  18. The LPL S447X cSNP is associated with decreased blood pressure and plasma triglycerides, and reduced risk of coronary artery disease

    NARCIS (Netherlands)

    Clee, S. M.; Loubser, O.; Collins, J.; Kastelein, J. J.; Hayden, M. R.

    2001-01-01

    Linkage of the lipoprotein lipase (LPL) gene to blood pressure levels has been reported. The LPL S447X single nucleotide polymorphism (cSNP) has been associated with decreased triglycerides (TG), increased high density lipoprotein cholesterol, and a decreased risk of coronary artery disease (CAD),

  19. Inter-laboratory evaluation of the EUROFORGEN Global ancestry-informative SNP panel by massively parallel sequencing using the Ion PGM™

    DEFF Research Database (Denmark)

    Eduardoff, M; Gross, T E; Santos, C

    2016-01-01

    Seq™ PCR primers was designed for the Global AIM-SNPs to perform massively parallel sequencing using the Ion PGM™ system. This study assessed individual SNP genotyping precision using the Ion PGM™, the forensic sensitivity of the multiplex using dilution series, degraded DNA plus simple mixtures...

  20. Preliminary Study on the Single Nucleotide Polymorphism (SNP of XRCC1 Gene Identificationto Improve the Outcomes of Radiotherapy for Cervical Cancer

    Directory of Open Access Journals (Sweden)

    Devita Tetriana

    2015-09-01

    Full Text Available Cervical cancer is the most fatal disease among Indonesian women. In recognition of the substantial variation in the intrinsic response of individuals to radiation, an effort had been done to identify the genetic markers, primarily Single Nucleotide polymorphisms (SNPs, which are associated with responsiveness of cancer cells to radiation therapy. One of these SNPs is X-ray repair cross-complementing protein 1 (XRCC1 that is one of the most important genes in deoxyribonucleic acid (DNA repair pathways. Meta-analysis in the determination of the association of XRCC1 polymorphisms with cervical cancer revealed the potential role of XRCC1 polymorphisms in predicting cell response to radiotherapy.Our preliminary study with real-time polymerase chain reaction (RT-PCR showed that radiotherapy affected the XRCC1 gene analyzed in blood of cervical cancer patient. Other published study found three SNPs of XRCC1 (Arg194Trp, Arg280His, and Arg399Gln that cause amino acid substitutions. Arg194Trp is only SNPs that associated with high risk of cervical cancer but not others. Additionally, structure and function of this protein can be altered by functional SNPs, which may lead to the susceptibility of individuals to cancers. Anotherstudy found G399A polymorphisms. We concluded that SNP of this DNA repair genes have been found to be good predictors of efficacy of radiotherapy.Kanker serviks adalah penyakit yang paling fatal pada perempuan di Indonesia. Untuk memahami variasi substansial respon intrinsik individual terhadap radiasi, suatu usaha telah dilakukan untuk mengidentifikasi petanda genetik, terutama Single Nucleotide polymorphism (SNP, yang berkaitan dengan responsel kanker terhadap terapi radiasi. Satu dari SNP tersebut adalah X-ray repair cross-complementing protein 1 (XRCC1 yang merupakan satu dari gen paling penting dalam lajur perbaikan asam deoksiribonukleat (DNA. Meta-analysis dalam penentuan hubungan polimorfisme XRCC1 dengan kanker serviks

  1. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array.

    Science.gov (United States)

    Antanaviciute, Laima; Fernández-Fernández, Felicidad; Jansen, Johannes; Banchi, Elisa; Evans, Katherine M; Viola, Roberto; Velasco, Riccardo; Dunwell, Jim M; Troggio, Michela; Sargent, Daniel J

    2012-05-25

    A whole-genome genotyping array has previously been developed for Malus using SNP data from 28 Malus genotypes. This array offers the prospect of high throughput genotyping and linkage map development for any given Malus progeny. To test the applicability of the array for mapping in diverse Malus genotypes, we applied the array to the construction of a SNP-based linkage map of an apple rootstock progeny. Of the 7,867 Malus SNP markers on the array, 1,823 (23.2%) were heterozygous in one of the two parents of the progeny, 1,007 (12.8%) were heterozygous in both parental genotypes, whilst just 2.8% of the 921 Pyrus SNPs were heterozygous. A linkage map spanning 1,282.2 cM was produced comprising 2,272 SNP markers, 306 SSR markers and the S-locus. The length of the M432 linkage map was increased by 52.7 cM with the addition of the SNP markers, whilst marker density increased from 3.8 cM/marker to 0.5 cM/marker. Just three regions in excess of 10 cM remain where no markers were mapped. We compared the positions of the mapped SNP markers on the M432 map with their predicted positions on the 'Golden Delicious' genome sequence. A total of 311 markers (13.7% of all mapped markers) mapped to positions that conflicted with their predicted positions on the 'Golden Delicious' pseudo-chromosomes, indicating the presence of paralogous genomic regions or mis-assignments of genome sequence contigs during the assembly and anchoring of the genome sequence. We incorporated data for the 2,272 SNP markers onto the map of the M432 progeny and have presented the most complete and saturated map of the full 17 linkage groups of M. pumila to date. The data were generated rapidly in a high-throughput semi-automated pipeline, permitting significant savings in time and cost over linkage map construction using microsatellites. The application of the array will permit linkage maps to be developed for QTL analyses in a cost-effective manner, and the identification of SNPs that have been

  2. Marcadores SNP: conceitos básicos, aplicações no manejo e no melhoramento animal e perspectivas para o futuro SNP markers: basic concepts, applications in animal breeding and management and perspectives for the future

    Directory of Open Access Journals (Sweden)

    Alexandre Rodrigues Caetano

    2009-07-01

    Full Text Available Os primeiros estudos de identificação, caracterização e utilização de marcadores moleculares para a caracterização de recursos genéticos e geração de ferramentas para o melhoramento animal datam do final da década de 80. Nos últimos 20 anos as tecnologias para geração de dados moleculares passaram por vários ciclos de renovação. A última onda de inovações tecnológicas representa uma verdadeira revolução e trouxe metodologias para identificar e genotipar marcadores SNP (do inglês Single Nucleotide Polimorphism de maneira massal. Chips de DNA de alta densidade foram criados para genotipar de dezenas de milhares até centenas de milhares de marcadores SNP em um único ensaio. Além disso, outras tecnologias de média densidade permitem também a genotipagem de dezenas a centenas de marcadores, em números elevados de amostras, com altíssima velocidade e automação. Essas novas tecnologias permitiram a geração de novas aplicações, como as metodologias para avaliação genética e seleção com base no Valor Genômico (Genomic Estimated Breeding Value- GEBV. Os métodos estatísticos para avaliação e seleção genômica estão em pleno desenvolvimento, mas a tecnologia já se tornou uma realidade com o lançamento do primeiro sumário de touros para a raça Holandesa com GEBVs para características de produção e qualidade do leite em janeiro de 2009. Além disso, essas tecnologias também trouxeram novas opções para desenvolvimento de testes diagnósticos para confirmação de paternidade, identificação individual, rastreabilidade, etc. Além dessas inovações, as novas tecnologias de genotipagem de marcadores SNP facilitaram também o desenvolvimento de serviços terceirizados de geração de dados, permitindo que qualquer grupo realize pesquisas avançadas, sempre com as tecnologias mais avançadas, sem a necessidade de investimentos em equipamentos.The first studies to identify, characterize and use

  3. Rapid detection of SNP (c.309T>G in the MDM2 gene by the Duplex SmartAmp method.

    Directory of Open Access Journals (Sweden)

    Yasuaki Enokida

    Full Text Available BACKGROUND: Genetic polymorphisms in the human MDM2 gene are suggested to be a tumor susceptibility marker and a prognostic factor for cancer. It has been reported that a single nucleotide polymorphism (SNP c.309T>G in the MDM2 gene attenuates the tumor suppressor activity of p53 and accelerates tumor formation in humans. METHODOLOGY: In this study, to detect the SNP c.309T>G in the MDM2 gene, we have developed a new SNP detection method, named "Duplex SmartAmp," which enabled us to simultaneously detect both 309T and 309G alleles in one tube. To develop this new method, we introduced new primers i.e., nBP and oBPs, as well as two different fluorescent dyes that separately detect those genetic polymorphisms. RESULTS AND CONCLUSIONS: By the Duplex SmartAmp method, the genetic polymorphisms of the MDM2 gene were detected directly from a small amount of genomic DNA or blood samples. We used 96 genomic DNA and 24 blood samples to validate the Duplex SmartAmp by comparison with results of the conventional PCR-RFLP method; consequently, the Duplex SmartAmp results agreed totally with those of the PCR-RFLP method. Thus, the new SNP detection method is considered useful for detecting the SNP c.309T>G in the MDM2 gene so as to judge cancer susceptibility against some cellular stress in the clinical setting, and also to handle a large number of samples and enable rapid clinical diagnosis.

  4. Effect of MDM2 SNP309 and p53 codon 72 polymorphisms on lung cancer risk and survival among non-smoking Chinese women in Singapore

    Directory of Open Access Journals (Sweden)

    Sabapathy Kanaga

    2010-03-01

    Full Text Available Abstract Background Single nucleotide polymorphism (SNP 309 resulting in a T or G allele in the promoter of MDM2, the negative regulator of p53, has been suggested to affect cancer predisposition and age of onset, primarily in females. However, findings have been inconsistent in various cancers, and ethnicity appears to be a critical factor influencing the effects of the SNP on cancer risk. An increasing trend has been observed in the prevalence of lung cancers in non-smokers, especially females, though the underlying genetic basis is unclear. Methods We therefore examined the role of the SNPs in the p53 pathway (p53 codon 72 and MDM2 SNP309 on lung cancer risk and prognosis of a life-time non-smoking female Chinese population, in a hospital-based case-control study of 123 cases and 159 age-matched controls, by PCR analysis. Results Our findings reveal that the risk of lung cancer among individuals with the MDM2 SNP309 TT genotype was 2.1 (95% CI 1.01-4.36 relative to the GG genotype, contrary to initial expectations that the GG genotype with elevated MDM2 levels will increase cancer risk. Those who had this genotype in combination with the p53 Pro allele had a risk of 2.5 (95% CI 1.2-5.0. There was however no effect of either polymorphism on age at diagnosis of lung cancer or on overall survival. Conclusions The results thus demonstrate that the MDM2 SNP309 TT rather than the GG genotype is associated with increased risk of lung cancer in this population, suggesting that other mechanisms independent of increased MDM2 levels can influence cancer susceptibility.

  5. Clinical significance of SNP (rs2596542 in histocompatibility complex class I-related gene A promoter region among hepatitis C virus related hepatocellular carcinoma cases

    Directory of Open Access Journals (Sweden)

    Amal A. Mohamed

    2017-07-01

    Full Text Available The major histocompatibility complex class I-related gene A (MICA is an antigen induced by stress and performs an integral role in immune responses as an anti-infectious and antitumor agent. This work was designed to investigate whether (SNP rs2596542C/T in MICA promoter region is predictive of liver cirrhosis (LC and hepatocellular carcinoma (HCC or not. Forty-seven healthy controls and 94 HCV-infected patients, subdivided into 47 LC and 47 HCC subjects were enrolled in this study. SNP association was studied using real time PCR and soluble serum MICA concentration was measured using ELISA. Results showed that heterozygous genotype rs2596542CT was significantly (P = 0.022 distributed between HCC and LC related CHC patients. The sMICA was significantly higher (P = 0.0001 among HCC and LC. No significant association (P = 0.56 between rs2596542CT genotypes and sMICA levels was observed. Studying SNP rs2596542C/T association with HCC and LC susceptibility revealed that statistical significant differences (P = 0.013, P = 0.027 were only observed between SNP rs2596542C/T and each of HCC and LC, respectively, versus healthy controls, indicating that the rs2596542C/T genetic variation is not a significant contributor to HCC development in LC patients. Moreover, the T allele was considered a risk factor for HCC and LC vulnerability in HCV patients (OR = 1.93 and 2.1, respectively, while the C allele contributes to decreasing HCC risk. Therefore, SNP (rs2596542C/T in MICA promoter region and sMICA levels might be potential useful markers in the assessment of liver disease progression to LC and HCC.

  6. Expression Level of the DREB2-Type Gene, Identified with Amplifluor SNP Markers, Correlates with Performance, and Tolerance to Dehydration in Bread Wheat Cultivars from Northern Kazakhstan

    Science.gov (United States)

    Shavrukov, Yuri; Zhumalin, Aibek; Serikbay, Dauren; Botayeva, Makpal; Otemisova, Ainur; Absattarova, Aiman; Sereda, Grigoriy; Sereda, Sergey; Shvidchenko, Vladimir; Turbekova, Arysgul; Jatayev, Satyvaldy; Lopato, Sergiy; Soole, Kathleen; Langridge, Peter

    2016-01-01

    A panel of 89 local commercial cultivars of bread wheat was tested in field trials in the dry conditions of Northern Kazakhstan. Two distinct groups of cultivars (six cultivars in each group), which had the highest and the lowest grain yield under drought were selected for further experiments. A dehydration test conducted on detached leaves indicated a strong association between rates of water loss in plants from the first group with highest grain yield production in the dry environment relative to the second group. Modern high-throughput Amplifluor Single Nucleotide Polymorphism (SNP) technology was applied to study allelic variations in a series of drought-responsive genes using 19 SNP markers. Genotyping of an SNP in the TaDREB5 (DREB2-type) gene using the Amplifluor SNP marker KATU48 revealed clear allele distribution across the entire panel of wheat accessions, and distinguished between the two groups of cultivars with high and low yield under drought. Significant differences in expression levels of TaDREB5 were revealed by qRT-PCR. Most wheat plants from the first group of cultivars with high grain yield showed slight up-regulation in the TaDREB5 transcript in dehydrated leaves. In contrast, expression of TaDREB5 in plants from the second group of cultivars with low grain yield was significantly down-regulated. It was found that SNPs did not alter the amino acid sequence of TaDREB5 protein. Thus, a possible explanation is that alternative splicing and up-stream regulation of TaDREB5 may be affected by SNP, but these hypotheses require additional analysis (and will be the focus of future studies). PMID:27917186

  7. Expression level of the DREB2-type gene, identified with Amplifluor SNP markers, correlates with performance and tolerance to dehydration in bread wheat cultivars from Northern Kazakhstan

    Directory of Open Access Journals (Sweden)

    Yuri Shavrukov

    2016-11-01

    Full Text Available A panel of 89 local commercial cultivars of bread wheat was tested in field trials in the dry conditions of Northern Kazakhstan. Two distinct groups of cultivars (six cultivars in each group, which had the highest and the lowest grain yield under drought were selected for further experiments. A dehydration test conducted on detached leaves indicated a strong association between rates of water loss in plants from the first group with highest grain yield production in the dry environment relative to the second group. Modern high-throughput Amplifluor SNP technology was applied to study allelic variations in a series of drought-responsive genes using 19 SNP markers. Genotyping of an SNP in the TaDREB5 (DREB2-type gene using the Amplifluor SNP marker KATU48 revealed clear allele distribution across the entire panel of wheat accessions, and distinguished between the two groups of cultivars with high and low yield under drought. Significant differences in expression levels of TaDREB5 were revealed by qRT-PCR. Most wheat plants from the first group of cultivars with high grain yield showed strong up-regulation of TaDREB5 transcript in dehydrated leaves. In contrast, expression of TaDREB5 in plants from the second group of cultivars with low grain yield was significantly down-regulated. It was found that SNPs did not alter the amino acid sequence of TaDREB5 protein. Thus, a possible explanation is that alternative splicing and up-stream regulation of TaDREB5 may be affected by SNP, but these hypotheses require additional analysis (and will be the focus of future studies.

  8. The polymorphisms of P53 codon 72 and MDM2 SNP309 and renal cell carcinoma risk in a low arsenic exposure area

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Chao-Yuan [Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Department of Urology, National Taiwan University Hospital, College of Medicine National Taiwan University, Taipei, Taiwan (China); Su, Chien-Tien [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); Chu, Jan-Show [Graduate Institute of Clinical Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Department of Pathology, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Huang, Shu-Pin [Department of Urology, Kaohsiung Medical University Hospital, College of Medicine Kaohsiung Medical University, Kaohsiung, Taiwan (China); Pu, Yeong-Shiau [Department of Urology, National Taiwan University Hospital, College of Medicine National Taiwan University, Taipei, Taiwan (China); Yang, Hsiu-Yuan [School of Public Health, College of Public Health and Nutrition, Taipei Medical University, Taipei, Taiwan (China); Chung, Chi-Jung [Department of Medical Research, China Medical University Hospital, Taichung, Taiwan (China); Department of Health Risk Management, College of Public Health, China Medical University, Taichung, Taiwan (China); Wu, Chia-Chang [School of Public Health, College of Public Health and Nutrition, Taipei Medical University, Taipei, Taiwan (China); Department of Urology, Taipei Medical Universtiy-Shuang Ho Hospital, Taipei, Taiwan (China); Hsueh, Yu-Mei, E-mail: ymhsueh@tmu.edu.tw [School of Public Health, College of Public Health and Nutrition, Taipei Medical University, Taipei, Taiwan (China); Department of Public Health, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China)

    2011-12-15

    Our recent study demonstrated the increased risk of renal cell carcinoma (RCC) associated with high urinary total arsenic levels among people living in a low arsenic exposure area. Genomic instability is important in arsenic carcinogenesis. This study evaluated the relationship between the polymorphisms of p53, p21, and MDM2, which plays a role in gene stability, and the arsenic-related RCC risk. Here, we found that p53 Pro/Pro genotype and MDM2 SNP309 GG genotype significantly increased RCC risk compared to the p53 Arg/Arg genotype and MDM2 SNP309 TT genotype. RCC patients with the p53Arg/Arg genotype had a signicantly low percentage of inorganic arsenic, a low percentage of monomethylarsonic acid (MMA), and a high percentage of dimethylarsinic acid (DMA), which indicates efcient arsenic methylation capacity. Subjects with the p53 Arg/Pro + Pro/Pro genotype or MDM2 SNP309 TG + GG genotype, in conjunction with high urinary total arsenic ({>=} 14.02 {mu}g/L), had a signicantly higher RCC risk than those with the p53 Arg/Arg or MDM2 SNP309 TT genotypes and low urinary total arsenic. Taken together, this is the first study to show that a variant genotype of p53 Arg{sup 72}Pro or MDM2 SNP309 may modify the arsenic-related RCC risk even in a non-obvious arsenic exposure area. -- Highlights: Black-Right-Pointing-Pointer Subjects with p53 Pro/Pro or MDM2 GG genotype significantly increased RCC risk. Black-Right-Pointing-Pointer A significant multiplicative joint effect of p53 and p21 on RCC risk. Black-Right-Pointing-Pointer RCC patients with p53 Arg/Arg genotype had efficient arsenic methylation capacity. Black-Right-Pointing-Pointer Joint effect of p53 or MDM2 genotype and high urinary total arsenic on RCC risk.

  9. A study of associations between early DHA status and fatty acid desaturase (FADS) SNP and developmental outcomes in children of obese mothers.

    Science.gov (United States)

    Andersen, Karina R; Harsløf, Laurine B S; Schnurr, Theresia M; Hansen, Torben; Hellgren, Lars I; Michaelsen, Kim F; Lauritzen, Lotte

    2017-01-01

    DHA from diet or endogenous synthesis has been proposed to affect infant development, however, results are inconclusive. In this study, we aim to verify previously observed fatty acid desaturase gene cluster (FADS) SNP-specific associations with erythrocyte DHA status in 9-month-old children and sex-specific association with developmental outcomes. The study was performed in 166 children (55 % boys) of obese mothers. Erythrocyte fatty acid composition was analysed in blood-samples obtained at 9 months of age, and developmental outcomes assessed by the Ages and Stages Questionnaire at 3 years. Erythrocyte DHA level ranged from 4·4 to 9·9 % of fatty acids, but did not show any association with FADS SNP or other potential determinants. Regression analysis showed associations between erythrocyte DHA and scores for personal-social skills (β 1·8 (95 % CI 0·3, 3·3), P=0·019) and problem solving (β 3·4 (95 % CI 1·2, 5·6), P=0·003). A tendency was observed for an association in opposite direction between minor alleles (G-variant) of rs1535 and rs174575 and personal-social skills (P=0·062 and 0·068, respectively), which became significant when the SNP were combined based on their previously observed effect on erythrocyte DHA at 9 months of age (β 2·6 (95 % CI 0·01, 5·1), P=0·011). Sex-SNP interaction was indicated for rs174575 genotype on fine motor scores (P=0·016), due to higher scores among minor allele carrying girls (P=0·043), whereas no effect was seen among boys. In conclusion, DHA-increasing FADS SNP and erythrocyte DHA status were consistently associated with improved personal-social skills in this small cohort of children of obese mothers irrespective of sex, but the sample was too small to verify potential sex-specific effects.

  10. [SNP-19 genotypic variants of CAPN10 gene and its relation to diabetes mellitus type 2 in a population of Ciudad Juarez, Mexico].

    Science.gov (United States)

    Loya Méndez, Yolanda; Reyes Leal, Gilberto; Sánchez González, Adriana; Portillo Reyes, Verónica; Reyes Ruvalcaba, David; Bojórquez Rangel, Guillermo

    2014-09-28

    Diabetes Mellitus (DM) type 2 is a common pathology with multifactorial etiology, which exact genetic bases remain unknown. Some studies suggest that single nucleotides polymorphisms (SNPs) in the CAPN10 gene (Locus 2q37.3) could be associated with the development of this disease, including the insertion/deletion polymorphism SNP-19 (2R→3R). The present study determined the association between the SNP-19 and the risk of developing DM type 2 in Ciudad Juarez population. For this study 107 participants were selected: 43 diabetics type 2 (cases) and 64 non diabetics with no family history of DM type 2 in first grade (control). Anthropometric studies were realized as well as lipids, lipoproteins and serum glucose biochemical profiles. The genotypification of SNP-19 was performed using peripheral blood lymphocytes DNA, polymerase chain reactions (PCR), and electrophoretic analysis in agarose gels. Once obtained the genotypic and allelic frequencies, the Hardy-Weinberg equilibrium test (GenAlEx 6.4) was also performed. Using the X² analysis it was identified the genotypic differences between cases and control with higher frequency of the homozygous genotype 3R of SNP- 19 in the cases group (0.418) compared to control group (0.265). Also, it was observed an association between genotype 2R/3R with elevated weight, body mass index, and waist and hip circumferences, but only in the diabetic group (P=< 0.05). The findings in this study suggest that SNP-19 in CAPN10 may participate in the development of DM type 2 in the studied population. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  11. SNP variation in the promoter of the PRKAG3 gene and association with meat quality traits in pig.

    Science.gov (United States)

    Ryan, Marion T; Hamill, Ruth M; O'Halloran, Aisling M; Davey, Grace C; McBryan, Jean; Mullen, Anne M; McGee, Chris; Gispert, Marina; Southwood, Olwen I; Sweeney, Torres

    2012-07-25

    The PRKAG3 gene encodes the γ3 subunit of adenosine monophosphate activated protein kinase (AMPK), a protein that plays a key role in energy metabolism in skeletal muscle. Non-synonymous single nucleotide polymorphisms (SNPs) in this gene such as I199V are associated with important pork quality traits. The objective of this study was to investigate the relationship between gene expression of the PRKAG3 gene, SNP variation in the PRKAG3 promoter and meat quality phenotypes in pork. PRKAG3 gene expression was found to correlate with a number of traits relating to glycolytic potential (GP) and intramuscular fat (IMF) in three phenotypically diverse F1 crosses comprising of 31 Large White, 23 Duroc and 32 Pietrain sire breeds. The majority of associations were observed in the Large White cross. There was a significant association between genotype at the g.-311A>G locus and PRKAG3 gene expression in the Large White cross. In the same population, ten novel SNPs were identified within a 1.3 kb region spanning the promoter and from this three major haplotypes were inferred. Two tagging SNPs (g.-995A>G and g.-311A>G) characterised the haplotypes within the promoter region being studied. These two SNPs were subsequently genotyped in larger populations consisting of Large White (n = 98), Duroc (n = 99) and Pietrain (n = 98) purebreds. Four major haplotypes including promoter SNP's g.-995A>G and g.-311A>G and I199V were inferred. In the Large White breed, HAP1 was associated with IMF% in the M. longissmus thoracis et lumborum (LTL) and driploss%. HAP2 was associated with IMFL% GP-influenced traits pH at 24 hr in LTL (pHULT), pH at 45 min in LTL (pH(45)LT) and pH at 45 min in the M. semimembranosus muscle (pH(45)SM). HAP3 was associated with driploss%, pHULT pH(45)LT and b* Minolta. In the Duroc breed, associations were observed between HAP1 and driploss% and pHUSM. No associations were observed with the remaining haplotypes (HAP2, HAP3 and HAP4) in the Duroc breed. The

  12. Low cost, low tech SNP genotyping tools for resource-limited areas: Plague in Madagascar as a model.

    Directory of Open Access Journals (Sweden)

    Cedar L Mitchell

    2017-12-01

    Full Text Available Genetic analysis of pathogenic organisms is a useful tool for linking human cases together and/or to potential environmental sources. The resulting data can also provide information on evolutionary patterns within a targeted species and phenotypic traits. However, the instruments often used to generate genotyping data, such as single nucleotide polymorphisms (SNPs, can be expensive and sometimes require advanced technologies to implement. This places many genotyping tools out of reach for laboratories that do not specialize in genetic studies and/or lack the requisite financial and technological resources. To address this issue, we developed a low cost and low tech genotyping system, termed agarose-MAMA, which combines traditional PCR and agarose gel electrophoresis to target phylogenetically informative SNPs.To demonstrate the utility of this approach for generating genotype data in a resource-constrained area (Madagascar, we designed an agarose-MAMA system targeting previously characterized SNPs within Yersinia pestis, the causative agent of plague. We then used this system to genetically type pathogenic strains of Y. pestis in a Malagasy laboratory not specialized in genetic studies, the Institut Pasteur de Madagascar (IPM. We conducted rigorous assay performance validations to assess potential variation introduced by differing research facilities, reagents, and personnel and found no difference in SNP genotyping results. These agarose-MAMA PCR assays are currently employed as an investigative tool at IPM, providing Malagasy researchers a means to improve the value of their plague epidemiological investigations by linking outbreaks to potential sources through genetic characterization of isolates and to improve understanding of disease ecology that may contribute to a long-term control effort.The success of our study demonstrates that the SNP-based genotyping capacity of laboratories in developing countries can be expanded with manageable

  13. Population genomic structure and linkage disequilibrium analysis of South African goat breeds using genome-wide SNP data.

    Science.gov (United States)

    Mdladla, K; Dzomba, E F; Huson, H J; Muchadeyi, F C

    2016-08-01

    The sustainability of goat farming in marginal areas of southern Africa depends on local breeds that are adapted to specific agro-ecological conditions. Unimproved non-descript goats are the main genetic resources used for the development of commercial meat-type breeds of South Africa. Little is known about genetic diversity and the genetics of adaptation of these indigenous goat populations. This study investigated the genetic diversity, population structure and breed relations, linkage disequilibrium, effective population size and persistence of gametic phase in goat populations of South Africa. Three locally developed meat-type breeds of the Boer (n = 33), Savanna (n = 31), Kalahari Red (n = 40), a feral breed of Tankwa (n = 25) and unimproved non-descript village ecotypes (n = 110) from four goat-producing provinces of the Eastern Cape, KwaZulu-Natal, Limpopo and North West were assessed using the Illumina Goat 50K SNP Bead Chip assay. The proportion of SNPs with minor allele frequencies >0.05 ranged from 84.22% in the Tankwa to 97.58% in the Xhosa ecotype, with a mean of 0.32 ± 0.13 across populations. Principal components analysis, admixture and pairwise FST identified Tankwa as a genetically distinct population and supported clustering of the populations according to their historical origins. Genome-wide FST identified 101 markers potentially under positive selection in the Tankwa. Average linkage disequilibrium was highest in the Tankwa (r(2)  = 0.25 ± 0.26) and lowest in the village ecotypes (r(2) range = 0.09 ± 0.12 to 0.11 ± 0.14). We observed an effective population size of 100 kb with the exception of those in Savanna and Tswana populations. This study highlights the high level of genetic diversity in South African indigenous goats as well as the utility of the genome-wide SNP marker panels in genetic studies of these populations. © 2016 Stichting International Foundation for Animal Genetics.

  14. SNPranker 2.0: a gene-centric data mining tool for diseases associated SNP prioritization in GWAS.

    Science.gov (United States)

    Merelli, Ivan; Calabria, Andrea; Cozzi, Paolo; Viti, Federica; Mosca, Ettore; Milanesi, Luciano

    2013-01-01

    The capability of correlating specific genotypes with human diseases is a complex issue in spite of all advantages arisen from high-throughput technologies, such as Genome Wide Association Studies (GWAS). New tools for genetic variants interpretation and for Single Nucleotide Polymorphisms (SNPs) prioritization are actually needed. Given a list of the most relevant SNPs statistically associated to a specific pathology as result of a genotype study, a critical issue is the identification of genes that are effectively related to the disease by re-scoring the importance of the identified genetic variations. Vice versa, given a list of genes, it can be of great importance to predict which SNPs can be involved in the onset of a particular disease, in order to focus the research on their effects. We propose a new bioinformatics approach to support biological data mining in the analysis and interpretation of SNPs associated to pathologies. This system can be employed to design custom genotyping chips for disease-oriented studies and to re-score GWAS results. The proposed method relies (1) on the data integration of public resources using a gene-centric database design, (2) on the evaluation of a set of static biomolecular annotations, defined as features, and (3) on the SNP scoring function, which computes SNP scores using parameters and weights set by users. We employed a machine learning classifier to set default feature weights and an ontological annotation layer to enable the enrichment of the input gene set. We implemented our method as a web tool called SNPranker 2.0 (http://www.itb.cnr.it/snpranker), improving our first published release of this system. A user-friendly interface allows the input of a list of genes, SNPs or a biological process, and to customize the features set with relative weights. As result, SNPranker 2.0 returns a list of SNPs, localized within input and ontologically enriched genes, combined with their prioritization scores. Different

  15. Individual patient data meta-analysis shows no association between the SNP rs1800469 in TGFB and late radiotherapy toxicity

    International Nuclear Information System (INIS)

    Barnett, Gillian C.; Elliott, Rebecca M.; Alsner, Jan; Andreassen, Christian N.; Abdelhay, Osama; Burnet, Neil G.; Chang-Claude, Jenny; Coles, Charlotte E.; Gutiérrez-Enríquez, Sara; Fuentes-Raspall, Maria J.; Alonso-Muñoz, Maria C.; Kerns, Sarah; Raabe, Annette; Symonds, R. Paul; Seibold, Petra; Talbot, Chris J.; Wenz, Frederik; Wilkinson, Jennifer; Yarnold, John; Dunning, Alison M.

    2012-01-01

    Background and purpose: Reported associations between risk of radiation-induced normal tissue injury and single nucleotide polymorphisms (SNPs) in TGFB1, encoding the pro-fibrotic cytokine transforming growth factor-beta 1 (TGF-β1), remain controversial. To overcome publication bias, the international Radiogenomics Consortium collected and analysed individual patient level data from both published and unpublished studies. Materials and methods: TGFB1 SNP rs1800469 c.-1347T>C (previously known as C-509T) genotype, treatment-related data, and clinically-assessed fibrosis (measured at least 2 years after therapy) were available in 2782 participants from 11 cohorts. All received adjuvant breast radiotherapy. Associations between late fibrosis or overall toxicity, reported by STAT (Standardised Total Average Toxicity) score, and rs1800469 genotype were assessed. Results: No statistically significant associations between either fibrosis or overall toxicity and rs1800469 genotype were observed with univariate or multivariate regression analysis. The multivariate odds ratio (OR), obtained from meta-analysis, for an increase in late fibrosis grade with each additional rare allele of rs1800469 was 0.98 (95% Confidence Interval (CI) 0.85–1.11). This CI is sufficiently narrow to rule out any clinically relevant effect on toxicity risk in carriers vs. non-carriers with a high probability. Conclusion: This meta-analysis has not confirmed previous reports of association between fibrosis or overall toxicity and rs1800469 genotype in breast cancer patients. It has demonstrated successful collaboration within the Radiogenomics Consortium.

  16. Autosomal SNP typing of forensic samples with the GenPlex(TM) HID System: Results of a collaborative study

    DEFF Research Database (Denmark)

    Tomas, C.; Axler-DiPerte, G.; Budimlija, Z.M.

    2011-01-01

    in Europe and 5 in the US) in order to test the robustness and reliability of the GenPlex(TM) HID System on forensic samples. Three samples with partly degraded DNA and 10 samples with low amounts of DNA were analyzed in duplicates using various amounts of DNA. In order to compare the performance of the Gen......Plex(TM) HID System with the most commonly used STR kits, 500 pg of partly degraded DNA from three samples was typed by the laboratories using one or more STR kits. The median SNP typing success rate was 92.3% with 500 pg of partly degraded DNA. Three of the fourteen laboratories counted for more than two...... was the least successful. With the exception of the MiniFiler(TM) kit (AB), GenPlex(TM) HID performed better than five other tested STR kits. When partly degraded DNA was analyzed, GenPlex(TM) HID showed a very low mean mach probability, while all STR kits except MiniFiler(TM) had very limited discriminatory...

  17. Forensic genetic SNP typing of low-template DNA and highly degraded DNA from crime case samples

    DEFF Research Database (Denmark)

    Børsting, Claus; Mogensen, Helle Smidt; Morling, Niels

    2013-01-01

    the heterozygote balance. Allele drop-ins were only observed in experiments with 25 pg of DNA and not in experiments with 50 and 100 pg of DNA. The allele drop-in rate in the 25 pg experiments was 0.06% or 100 times lower than what was previously reported for STR typing of LtDNA. A composite model and two......Heterozygote imbalances leading to allele drop-outs and disproportionally large stutters leading to allele drop-ins are known stochastic phenomena related to STR typing of low-template DNA (LtDNA). The large stutters and the many drop-ins in typical STR stutter positions are artifacts from the PCR...... amplification of tandem repeats. These artifacts may be avoided by typing bi-allelic markers instead of STRs. In this work, the SNPforID multiplex assay was used to type LtDNA. A sensitized SNP typing protocol was introduced, that increased signal strengths without increasing noise and without affecting...

  18. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  19. Admixture patterns and genetic differentiation in negrito groups from West Malaysia estimated from genome-wide SNP data.

    Science.gov (United States)

    Jinam, Timothy A; Phipps, Maude E; Saitou, Naruya

    2013-01-01

    Southeast Asia houses various culturally and linguistically diverse ethnic groups. In Malaysia, where the Malay, Chinese, and Indian ethnic groups form the majority, there exist minority groups such as the "negritos" who are believed to be descendants of the earliest settlers of Southeast Asia. Here we report patterns of genetic substructure and admixture in two Malaysian negrito populations (Jehai and Kensiu), using ~50,000 genome-wide single-nucleotide polymorphism (SNP) data. We found traces of recent admixture in both the negrito populations, particularly in the Jehai, with the Malay through principal component analysis and STRUCTURE analysis software, which suggested that the admixture was as recent as one generation ago. We also identified significantly differentiated nonsynonymous SNPs and haplotype blocks related to intracellular transport, metabolic processes, and detection of stimulus. These results highlight the different levels of admixture experienced by the two Malaysian negritos. Delineating admixture and differentiated genomic regions should be of importance in designing and interpretation of molecular anthropology and disease association studies. Copyright © 2013 Wayne State University Press, Detroit, Michigan 48201-1309.

  20. Transcriptome analysis and SNP development can resolve population differentiation of Streblospio benedicti, a developmentally dimorphic marine annelid.

    Directory of Open Access Journals (Sweden)

    Christina Zakas

    Full Text Available Next-generation sequencing technology is now frequently being used to develop genomic tools for non-model organisms, which are generally important for advancing studies of evolutionary ecology. One such species, the marine annelid Streblospio benedicti, is an ideal system to study the evolutionary consequences of larval life history mode because the species displays a rare offspring dimorphism termed poecilogony, where females can produce either many small offspring or a few large ones. To further develop S. benedicti as a model system for studies of life history evolution, we apply 454 sequencing to characterize the transcriptome for embryos, larvae, and juveniles of this species, for which no genomic resources are currently available. Here we performed a de novo alignment of 336,715 reads generated by a quarter GS-FLX (Roche 454 run, which produced 7,222 contigs. We developed a novel approach for evaluating the site frequency spectrum across the transcriptome to identify potential signatures of selection. We also developed 84 novel single nucleotide polymorphism (SNP markers for this species that are used to distinguish coastal populations of S. benedicti. We validated the SNPs by genotyping individuals of different developmental modes using the BeadXPress Golden Gate assay (Illumina. This allowed us to evaluate markers that may be associated with life-history mode.

  1. Genetic diversity and structure of elite cotton germplasm (Gossypium hirsutum L.) using genome-wide SNP data.

    Science.gov (United States)

    Ai, XianTao; Liang, YaJun; Wang, JunDuo; Zheng, JuYun; Gong, ZhaoLong; Guo, JiangPing; Li, XueYuan; Qu, YanYing

    2017-10-01

    Cotton (Gossypium spp.) is the most important natural textile fiber crop, and Gossypium hirsutum L. is responsible for 90% of the annual cotton crop in the world. Information on cotton genetic diversity and population structure is essential for new breeding lines. In this study, we analyzed population structure and genetic diversity of 288 elite Gossypium hirsutum cultivar accessions collected from around the world, and especially from China, using genome-wide single nucleotide polymorphisms (SNP) markers. The average polymorphsim information content (PIC) was 0.25, indicating a relatively low degree of genetic diversity. Population structure analysis revealed extensive admixture and identified three subgroups. Phylogenetic analysis supported the subgroups identified by STRUCTURE. The results from both population structure and phylogenetic analysis were, for the most part, in agreement with pedigree information. Analysis of molecular variance revealed a larger amount of variation was due to diversity within the groups. Establishment of genetic diversity and population structure from this study could be useful for genetic and genomic analysis and systematic utilization of the standing genetic variation in upland cotton.

  2. Mapping of a major QTL for salt tolerance of mature field-grown maize plants based on SNP markers.

    Science.gov (United States)

    Luo, Meijie; Zhao, Yanxin; Zhang, Ruyang; Xing, Jinfeng; Duan, Minxiao; Li, Jingna; Wang, Naishun; Wang, Wenguang; Zhang, Shasha; Chen, Zhihui; Zhang, Huasheng; Shi, Zi; Song, Wei; Zhao, Jiuran

    2017-08-15

    Salt stress significantly restricts plant growth and production. Maize is an important food and economic crop but is also a salt sensitive crop. Identification of the genetic architecture controlling salt tolerance facilitates breeders to select salt tolerant lines. However, the critical quantitative trait loci (QTLs) responsible for the salt tolerance of field-grown maize plants are still unknown. To map the main genetic factors contributing to salt tolerance in mature maize, a double haploid population (240 individuals) and 1317 single nucleotide polymorphism (SNP) markers were employed to produce a genetic linkage map covering 1462.05 cM. Plant height of mature maize cultivated in the saline field (SPH) and plant height-based salt tolerance index (ratio of plant height between saline and control fields, PHI) were used to evaluate salt tolerance of mature maize plants. A major QTL for SPH was detected on Chromosome 1 with the LOD score of 22.4, which explained 31.2% of the phenotypic variation. In addition, the major QTL conditioning PHI was also mapped at the same position on Chromosome 1, and two candidate genes involving in ion homeostasis were identified within the confidence interval of this QTL. The detection of the major QTL in adult maize plant establishes the basis for the map-based cloning of genes associated with salt tolerance and provides a potential target for marker assisted selection in developing maize varieties with salt tolerance.

  3. SNP analyses of growth factor genes EGF, TGF{beta}-1, and HGF reveal haplotypic association of EGF with autism

    Energy Technology Data Exchange (ETDEWEB)

    Toyoda, Takao; Thanseem, Ismail; Kawai, Masayoshi; Sekine, Yoshimoto [Department of Psychiatry and Neurology, Hamamatsu University School of Medicine, Hamamatsu 431-3192 (Japan); Nakamura, Kazuhiko; Anitha, Ayyappan; Suda, Shiro [Department of Psychiatry and Neurology, Hamamatsu University School of Medicine, Hamamatsu 431-3192 (Japan); Yamada, Kazuo [Laboratory of Molecular Psychiatry, RIKEN Brain Science Institute, Saitama (Japan); Tsujii, Masatsugu [Faculty of Sociology, Chukyo University, Toyota, Aichi (Japan); [The Osaka-Hamamatsu Joint Research Center for Child Mental Development, Hamamatsu University School of Medicine, Hamamatsu (Japan); Iwayama, Yoshimi; Hattori, Eiji; Toyota, Tomoko; Yoshikawa, Takeo [Laboratory of Molecular Psychiatry, RIKEN Brain Science Institute, Saitama (Japan); Miyachi, Taishi; Tsuchiya, Kenji; Sugihara, Gen-ichi; Matsuzaki, Hideo [The Osaka-Hamamatsu Joint Research Center for Child Mental Development, Hamamatsu University School of Medicine, Hamamatsu (Japan); Iwata, Yasuhide; Suzuki, Katsuaki [Department of Psychiatry and Neurology, Hamamatsu University School of Medicine, Hamamatsu 431-3192 (Japan); Mori, Norio [Department of Psychiatry and Neurology, Hamamatsu University School of Medicine, Hamamatsu 431-3192 (Japan); [The Osaka-Hamamatsu Joint Research Center for Child Mental Development, Graduate School of Medicine, Osaka University (Japan); Ouchi, Yasuomi [The Osaka-Hamamatsu Joint Research Center for Child Mental Development, Hamamatsu University School of Medicine, Hamamatsu (Japan); [The Positron Medical Center, Hamamatsu Medical Center, Hamamatsu (Japan); Sugiyama, Toshiro [Aichi Children' s Health and Medical Center, Obu, Aichi (Japan); Takei, Nori [The Osaka-Hamamatsu Joint Research Center for Child Mental Development, Hamamatsu University School of Medicine, Hamamatsu (Japan)

    2007-09-07

    Autism is a pervasive neurodevelopmental disorder diagnosed in early childhood. Growth factors have been found to play a key role in the cellular differentiation and proliferation of the central and peripheral nervous systems. Epidermal growth factor (EGF) is detected in several regions of the developing and adult brain, where, it enhances the differentiation, maturation, and survival of a variety of neurons. Transforming growth factor-{beta} (TGF{beta}) isoforms play an important role in neuronal survival, and the hepatocyte growth factor (HGF) has been shown to exhibit neurotrophic activity. We examined the association of EGF, TGF{beta}1, and HGF genes with autism, in a trio association study, using DNA samples from families recruited to the Autism Genetic Resource Exchange; 252 trios with a male offspring scored for autism were selected for the study. Transmission disequilibrium test revealed significant haplotypic association of EGF with autism. No significant SNP or haplotypic associations were observed for TGF{beta}1 or HGF. Given the role of EGF in brain and neuronal development, we suggest a possible role of EGF in the pathogenesis of autism.

  4. Network-based regularization for high dimensional SNP data in the case-control study of Type 2 diabetes.

    Science.gov (United States)

    Ren, Jie; He, Tao; Li, Ye; Liu, Sai; Du, Yinhao; Jiang, Yu; Wu, Cen

    2017-05-16

    Over the past decades, the prevalence of type 2 diabetes mellitus (T2D) has been steadily increasing around the world. Despite large efforts devoted to better understand the genetic basis of the disease, the identified susceptibility loci can only account for a small portion of the T2D heritability. Some of the existing approaches proposed for the high dimensional genetic data from the T2D case-control study are limited by analyzing a few number of SNPs at a time from a large pool of SNPs, by ignoring the correlations among SNPs and by adopting inefficient selection techniques. We propose a network constrained regularization method to select important SNPs by taking the linkage disequilibrium into account. To accomodate the case control study, an iteratively reweighted least square algorithm has been developed within the coordinate descent framework where optimization of the regularized logistic loss function is performed with respect to one parameter at a time and iteratively cycle through all the parameters until convergence. In this article, a novel approach is developed to identify important SNPs more effectively through incorporating the interconnections among them in the regularized selection. A coordinate descent based iteratively reweighed least squares (IRLS) algorithm has been proposed. Both the simulation study and the analysis of the Nurses's Health Study, a case-control study of type 2 diabetes data with high dimensional SNP measurements, demonstrate the advantage of the network based approach over the competing alternatives.

  5. Glycine and a glycine dehydrogenase (GLDC) SNP as citalopram/escitalopram response biomarkers in depression: pharmacometabolomics-informed pharmacogenomics.

    Science.gov (United States)

    Ji, Y; Hebbring, S; Zhu, H; Jenkins, G D; Biernacka, J; Snyder, K; Drews, M; Fiehn, O; Zeng, Z; Schaid, D; Mrazek, D A; Kaddurah-Daouk, R; Weinshilboum, R M

    2011-01-01

    Major depressive disorder (MDD) is a common psychiatric disease. Selective serotonin reuptake inhibitors (SSRIs) are an important class of drugs used in the treatment of MDD. However, many patients do not respond adequately to SSRI therapy. We used a pharmacometabolomics-informed pharmacogenomic research strategy to identify citalopram/escitalopram treatment outcome biomarkers. Metabolomic assay of plasma samples from 20 escitalopram remitters and 20 nonremitters showed that glycine was negatively associated with treatment outcome (P = 0.0054). This observation was pursued by genotyping tag single-nucleotide polymorphisms (SNPs) for genes encoding glycine synthesis and degradation enzymes, using 529 DNA samples from SSRI-treated MDD patients. The rs10975641 SNP in the glycine dehydrogenase (GLDC) gene was associated with treatment outcome phenotypes. Genotyping for rs10975641 was carried out in 1,245 MDD patients in the Sequenced Treatment Alternatives to Relieve Depression (STAR*D) study, and its presence was significant (P = 0.02) in DNA taken from these patients. These results highlight a possible role for glycine in SSRI response and illustrate the use of pharmacometabolomics to "inform" pharmacogenomics.

  6. MiR-2964a-5p binding site SNP regulates ATM expression contributing to age-related cataract risk.

    Science.gov (United States)

    Rong, Han; Gu, Shanshan; Zhang, Guowei; Kang, Lihua; Yang, Mei; Zhang, Junfang; Shen, Xinyue; Guan, Huaijin

    2017-10-17

    This study was to explore the involvement of DNA repair genes in the pathogenesis of age-related cataract (ARC). We genotyped nine single nucleotide polymorphisms (SNPs) of genes responsible to DNA double strand breaks (DSBs) in 804 ARC cases and 804 controls in a cohort of eye diseases in Chinese population and found that the ataxia telangiectasia mutated ( ATM ) gene-rs4585:G>T was significantly associated with ARC risk. An in vitro functional test found that miR-2964a-5p specifically down-regulated luciferase reporter expression and ATM expression in the cell lines transfected with rs4585 T allele compared to rs4585 G allele. The molecular assay on human tissue samples discovered that ATM expression was down-regulated in majority of ARC tissues and correlated with ATM genotypes. In addition, the Comet assay of cellular DNA damage of peripheral lymphocytes indicated that individuals carrying the G allele (GG/GT) of ATM -rs4585 had lower DNA breaks compared to individuals with TT genotype. These findings suggested that the SNP rs4585 in ATM might affect ARC risk through modulating the regulatory affinity of miR-2964a-5p. The reduced DSBs repair might be involved in ARC pathogenesis.

  7. A re-evaluation of 32S(n,p) cross sections from threshold to 5 MeV

    International Nuclear Information System (INIS)

    Fu, C.Y.

    1989-01-01

    Two evaluations of the 32 S(n,p) reaction cross sections, currently being used for the Nagasaki and Hiroshima dosimetry studies, yielded results that differ significantly. These two evaluations were reviewed and both were found to be quite old and w