WorldWideScience

Sample records for normal immune responses

  1. Angiogenesis for tumor vascular normalization of Endostar on hepatoma 22 tumor-bearing mice is involved in the immune response.

    Science.gov (United States)

    Xu, Qingyu; Gu, Junfei; Lv, You; Yuan, Jiarui; Yang, Nan; Chen, Juan; Wang, Chunfei; Hou, Xuefeng; Jia, Xiaobin; Feng, Liang; Yin, Guowen

    2018-03-01

    Tumor vascular normalization involved in immune response is beneficial to the chemotherapy of tumors. Recombinant human endostatin (Endostar), an angiogenesis inhibitor, has been demonstrated to be effective in hepatocellular cancer (HCC). However, its vascular normalization in HCC and the role of the immune response in angiogenesis were unclear. In the present study, effects of Endostar on tumor vascular normalization were evaluated in hepatoma 22 (H22) tumor-bearing mice. Endostar was able to inhibit the proliferation and infiltration of tumor cells and improve α-fetoprotein, tumor necrosis factor-α and cyclic adenosine 5'-phosphate levels in the serum of H22-bearing mice, as well as the protein expression levels of the immune factors interferon-γ and cluster of differentiation (CD)86 in liver tissue. Endostar also exhibited more marked downregulation of the levels of vascular endothelial growth factor, CD31, matrix metalloproteinase (MMP)-2, MMP-9 and interleukin-17 during day 3-9 treatment, resulting in short-term normalization of tumor blood vessels. The period of vascular normalization was 3-9 days. The results of the present study demonstrated that Endostar was able to induce the period of vascular normalization, contributing to a more efficacious means of HCC treatment combined with other chemotherapy, and this effect was associated with the immune response. It may be concluded that Endostar inhibited immunity-associated angiogenesis behaviors of vascular endothelial cells in response to HCC. The results of the present study provided more reasonable possibility for the combination therapy of Endostar for the treatment of HCC.

  2. Gastrointestinal immune responses in HIV infected subjects

    Directory of Open Access Journals (Sweden)

    LRR Castello-Branco

    1996-06-01

    Full Text Available The gut associated lymphoid tissue is responsible for specific responses to intestinal antigens. During HIV infection, mucosal immune deficiency may account for the gastrointestinal infections. In this review we describe the humoral and cellular mucosal immune responses in normal and HIV-infected subjects.

  3. Regulation of immune responses and tolerance: the microRNA perspective

    Science.gov (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

    2013-01-01

    Summary Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/ or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. PMID:23550642

  4. Regulation of immune responses and tolerance: the microRNA perspective.

    Science.gov (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

    2013-05-01

    Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. © 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  5. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

    1987-01-01

    The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

  6. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    International Nuclear Information System (INIS)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas

    2011-01-01

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses

  7. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    Energy Technology Data Exchange (ETDEWEB)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas, E-mail: tke@uams.edu [Winthrop P. Rockefeller Cancer Institute and Department of Pathology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States)

    2011-11-11

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses.

  8. T lymphocytes and normal tissue responses to radiation

    International Nuclear Information System (INIS)

    Schaue, Dörthe; McBride, William H.

    2012-01-01

    There is compelling evidence that lymphocytes are a recurring feature in radiation damaged normal tissues, but assessing their functional significance has proven difficult. Contradictory roles have been postulated in both tissue pathogenesis and protection, although these are not necessarily mutually exclusive as the immune system can display what may seem to be opposing faces at any one time. While the exact role of T lymphocytes in irradiated normal tissue responses may still be obscure, their accumulation after tissue damage suggests they may be critical targets for radiotherapeutic intervention and worthy of further study. This is accentuated by recent findings that pathologically damaged “self,” such as occurs after exposure to ionizing radiation, can generate danger signals with the ability to activate pathways similar to those that activate adoptive immunity to pathogens. In addition, the demonstration of T cell subsets with their recognition radars tuned to “self” moieties has revolutionized our ideas on how all immune responses are controlled and regulated. New concepts of autoimmunity have resulted based on the dissociation of immune functions between different subsets of immune cells. It is becoming axiomatic that the immune system has the power to regulate radiation-induced tissue damage, from failure of regeneration to fibrosis, to acute and chronic late effects, and even to carcinogenesis. Our understanding of the interplay between T lymphocytes and radiation-damaged tissue may still be rudimentary but this is a good time to re-examine their potential roles, their radiobiological and microenvironmental influences, and the possibilities for therapeutic manipulation. This review will discuss the yin and yang of T cell responses within the context of radiation exposures, how they might drive or protect against normal tissue side effects and what we may be able do about it.

  9. Suppression of adoptive antituberculosis immunity by normal recipient animals

    International Nuclear Information System (INIS)

    Lefford, M.J.

    1983-01-01

    Adoptive immunity is poorly expressed in normal syngeneic mice. This phenomenon was studied by using experimental antituberculosis immunity as a model system representing pure cell-mediated immunity. Expression of adoptive immunity was facilitated by pretreating recipients with sublethal ionizing radiation (500 rads) or high doses (200 mg/kg) of cyclophosphamide or by using adult thymectomized, lethally irradiated, bone-marrow-reconstituted (TXB) mice. Adult thymectomy was less effective, and a low dose of cyclophosphamide (20 mg/kg) was completely ineffective. The beneficial effect of sublethal irradiation was reduced over time; it persisted for 4 weeks and was absent after 8 weeks. Attempts to restore the suppressed state of normal mice to sublethally irradiated mice by using normal spleen or thymus cells did not succeed. Even in rats, which express adoptive antituberculosis immunity without immunosuppressive treatment, the use of sublethally irradiated or TXB recipients potentiated adoptive immunity. It was concluded that suppression of adoptive immunization in normal recipient mice is mediated predominantly, if not exclusively, by T lymphocytes that are sensitive to a number of immunosuppressive agents. The suppressor cells are long-lived and can be regenerated from precursors that are resistant to 500 but not to 900 rads of ionizing radiation

  10. Analysis and comparison of immune reactivity in guinea-pigs immunized with equivalent numbers of normal or radiation-attenuated cercariae of Schistosoma mansoni

    International Nuclear Information System (INIS)

    Rogers, M.V.; McLaren, D.J.

    1987-01-01

    Guinea-pigs immunized with equivalent numbers of normal or radiation-attenuated cercariae of Schistosoma mansoni develop close to complete resistance to reinfection at weeks 12 and 4.5 respectively. We here analyse and compare the immune responses induced by the two populations of cercariae. Both radiation-attenuated and normal parasites of S. mansoni elicited an extensive germinal centre response in guinea-pigs by week 4.5 post-immunization. The anti-parasite antibody titre and cytotoxic activity of serum from 4.5-week-vaccinated, or 4.5-week-infected guinea-pigs were approximately equal, but sera from 12-week-infected individuals had high titres of anti-parasite antibody, which promoted significant larvicidal activity in vitro. In all cases, larvicidal activity was mediated by the IgG 2 fraction of the immune serum. Lymphocyte transformation tests conducted on splenic lymphocytes from 4.5-week vaccinated guinea-pigs revealed maximal stimulation against cercarial, 2-week and 3-week worm antigens, whereas spleen cells from 4.5-week-infected guinea-pigs were maximally stimulated by cercarial and 6-week worm antigens. The splenic lymphocyte responses of 12-week infected animals were dramatic against antigens prepared from all life-stages of the parasite. (author)

  11. Heme oxygenase and the immune system in normal and pathological pregnancies

    Directory of Open Access Journals (Sweden)

    Maide eOzen

    2015-04-01

    Full Text Available Normal pregnancy is an immunotolerant state. Many factors, including environmental, socioeconomic, genetic, and immunologic changes by infection and/or other causes of inflammation, may contribute to inter-individual differences resulting in a normal or pathologic pregnancy. In particular, imbalances in the immune system can cause many pregnancy-related diseases, such as infertility, abortions, pre-eclampsia, and preterm labor, which result in maternal/fetal death, prematurity, or small-for-gestational age newborns. New findings imply that myeloid regulatory cells and regulatory T cells (Tregs may mediate immunotolerance during normal pregnancy. Effector T cells (Teffs have, in contrast, been implicated to cause adverse pregnancy outcomes. Furthermore, feto-maternal tolerance affects the developing fetus. It has been shown that the Treg/Teff balance affects litter size and adoptive transfer of pregnancy-induced Tregs can prevent fetal rejection in the mouse. Heme oxygenase-1 (HO-1 has a protective role in many conditions through its anti-inflammatory, anti-apoptotic, antioxidative, and anti-proliferative actions. HO-1 is highly expressed in the placenta and plays a role in angiogenesis and placental vascular development and in regulating vascular tone in pregnancy. In addition, HO-1 is a major regulator of immune homeostasis by mediating crosstalk between innate and adaptive immune systems. Moreover, HO-1 can inhibit inflammation-induced phenotypic maturation of immune effector cells and pro-inflammatory cytokine secretion and promote anti-inflammatory cytokine production. HO-1 may also be associated with T-cell activation and can limit immune-based tissue injury by promoting Treg suppression of effector responses. Thus, HO-1 and its byproducts may protect against pregnancy complications by its immunomodulatory effects, and the regulation of HO-1 or its downstream effects has the potential to prevent or treat pregnancy complications and

  12. The Lung Immune Response to Nontypeable Haemophilus influenzae (Lung Immunity to NTHi

    Directory of Open Access Journals (Sweden)

    Paul T. King

    2015-01-01

    Full Text Available Haemophilus influenzae is divided into typeable or nontypeable strains based on the presence or absence of a polysaccharide capsule. The typeable strains (such as type b are an important cause of systemic infection, whilst the nontypeable strains (designated as NTHi are predominantly respiratory mucosal pathogens. NTHi is present as part of the normal microbiome in the nasopharynx, from where it may spread down to the lower respiratory tract. In this context it is no longer a commensal and becomes an important respiratory pathogen associated with a range of common conditions including bronchitis, bronchiectasis, pneumonia, and particularly chronic obstructive pulmonary disease. NTHi induces a strong inflammatory response in the respiratory tract with activation of immune responses, which often fail to clear the bacteria from the lung. This results in recurrent/persistent infection and chronic inflammation with consequent lung pathology. This review will summarise the current literature about the lung immune response to nontypeable Haemophilus influenzae, a topic that has important implications for patient management.

  13. Immune responses to metastases

    International Nuclear Information System (INIS)

    Herberman, R.B.; Wiltrout, R.H.; Gorelik, E.

    1987-01-01

    The authors present the changes in the immune system in tumor-bearing hosts that may influence the development of progression of metastases. Included are mononuclear cell infiltration of metastases; alterations in natural resistance mediated by natural killer cells and macrophages; development of specific immunity mediated by T-lymphocytes or antibodies; modulation of tumor-associated antigen expression; and the down-regulation of the immune response to the tumor by several suppressor mechanisms; the augmentation of the immune response and its potential for therapeutic application; includes the prophylaxis of metastases formation by NK cells; the therapy of metastases by augmentation NK-, macrophage-, or T-lymphocyte-mediated responses by biological response modifiers; and the transfer of anticancer activity by cytoxic T-lymphocytes or immunoconjugates of monoclonal antibodies with specificity for tumors

  14. Induction of the immune response suppression in mice inoculated with Candida albicans.

    Science.gov (United States)

    Valdez, J C; Mesón, D E; Sirena, A; de Petrino, S F; Eugenia, M; de Jorrat, B B; de Valdex, M G

    1986-03-01

    There is a controversy in respect to the immunological response (humoral or cellular) concerning the defense against Candida albicans. Candidosis would induce sub-populations of suppressor cells in the host cell-immune response. This report tries to show the effect of different doses of C. albicans (alive or heat-killed) on the expression of cell-mediated and humoral immunity. The effect upon cell immunity was determined by inoculating different lots of singeneic mice, doses of varied concentration of C. albicans and checking for delayed-type hipersensitivity (D.T.H.). D.T.H. was also controlled in syngeneic normal mice which had previously been injected with inoculated mice spleen cells. Humoral immunity was assayed by measuring the induced blastogenesis by Pokeweed Mitogen on spleen mononuclear cells with different doses of C. albicans. Results obtained show that the different doses gave origin to: Suppression of humoral and cell response (10(8) alive); Suppression of only humoral response (10(6) alive); Suppression of cell response and increase of humoral response (10(9) dead); Increase of both responses (10(8) dead).

  15. Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

    Science.gov (United States)

    Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

    2015-06-23

    F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

  16. Immune Modulation in Normal Human Peripheral Blood Mononuclear Cells (PBMCs) (Lymphocytes) in Response to Benzofuran-2-Carboxylic Acid Derivative KMEG during Spaceflight

    Science.gov (United States)

    Okoro, Elvis; Mann, Vivek; Ellis, Ivory; Mansoor, Elvedina; Olamigoke, Loretta; Marriott, Karla Sue; Denkins, Pamela; Williams, Willie; Sundaresan, Alamelu

    2017-08-01

    Microgravity and radiation exposure during space flight have been widely reported to induce the suppression of normal immune system function, and increase the risk of cancer development in humans. These findings pose a serious risk to manned space missions. Interestingly, recent studies have shown that benzofuran-2-carboxylic acid derivatives can inhibit the progression of some of these devastating effects on earth and in modeled microgravity. However, these studies had not assessed the impacts of benzofuran-2- carboxylic acid and its derivatives on global gene expression under spaceflight conditions. In this study, the ability of a specific benzofuran-2-carboxylic acid derivative (KMEG) to confer protection from radiation and restore normal immune function was investigated following exposure to space flight conditions on the ISS. Normal human peripheral blood mononuclear cells (lymphocytes) treated with 10 µ g/ml of KMEG together with untreated control samples were flown on Nanoracks hardware on Spacex-3 flight. The Samples were returned one month later and gene expression was analyzed. A 1g-ground control experiment was performed in parallel at the Kennedy spaceflight center. The first overall subtractive unrestricted analysis revealed 78 genes, which were differentially expressed in space flight KMEG, untreated lymphocytes as compared to the corresponding ground controls. However, in KMEG-treated space flight lymphocytes, there was an increased expression of a group of genes that mediate increased transcription, translation and innate immune system mediating functions of lymphocytes as compared to KMEG-untreated samples. Analysis of genes related to T cell proliferation in spaceflight KMEG-treated lymphocytes compared to 1g-ground KMEG- treated lymphocytes revealed six T cell proliferation and signaling genes to be significantly upregulated (p trafficking, promote early response, mediating C-myc related proliferation, promote antiapoptotic activity and protects

  17. Protective immunization with B16 melanoma induces antibody response and not cytotoxic T cell response

    International Nuclear Information System (INIS)

    Sarzotti, M.; Sriyuktasuth, P.; Klimpel, G.R.; Cerny, J.

    1986-01-01

    C57BL/6 mice immunized with three intraperitoneal injections of syngeneic, irradiated B16 melanoma cells, became resistant to B16 tumor challenge. Immunized mice had high levels of serum antibody against a membrane antigen of B16 cells. The B16 antigen recognized by the anti-B16 sera formed a major band of 90 KD in gel electrophoresis. The anti-B16 antibody was partially protective when mixed with B16 cells and injected into normal recipient mice. Surprisingly, B16 resistance mice were incapable of generating cytotoxic T cells (CTL) specific for the B16 tumor. Both spleen and lymph node cell populations from immunized mice did not generate B16-specific CTL. Allogeneic mice (DBA/2 or C3H) were also unable to generate B16-specific CTL: however, alloreactive CTL produced in these strains of mice by immunization with C57BL/6 lymphocytes, did kill B16 target cells. Interestingly, spleen cells from syngeneic mice immunized with B16 tumor produced 6-fold more interleukin-2 (IL-2) than normal spleen cells, in vitro. These data suggest that immunization with B16 tumor activates a helper subset of T cells (for antibody and IL-2 production) but not the effector CTL response

  18. Immune oncology, immune responsiveness and the theory of everything.

    Science.gov (United States)

    Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue

    2018-06-05

    Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.

  19. Immune response to Sarcocystis neurona infection in naturally infected horses with equine protozoal myeloencephalitis.

    Science.gov (United States)

    Yang, Jibing; Ellison, Siobhan; Gogal, Robert; Norton, Heather; Lindsay, David S; Andrews, Frank; Ward, Daniel; Witonsky, Sharon

    2006-06-15

    Equine protozoal myeloencephalitis (EPM) is one of the most common neurologic diseases of horses in the United States. The primary etiologic agent is Sarcocystis neurona. Currently, there is limited knowledge regarding the protective or pathophysiologic immune response to S. neurona infection or the subsequent development of EPM. The objectives of this study were to determine whether S. neurona infected horses with clinical signs of EPM had altered or suppressed immune responses compared to neurologically normal horses and if blood sample storage would influence these findings. Twenty clinically normal horses and 22 horses with EPM, diagnosed by the presence of S. neurona specific antibodies in the serum and/or cerebrospinal (CSF) and clinical signs, were evaluated for differences in the immune cell subsets and function. Our results demonstrated that naturally infected horses had significantly (Pneurona in horses, as well as to determine the mechanism associated with suppressed in vitro proliferation responses. Finally, overnight storage of blood samples appears to alter T lymphocyte phenotypes and viability among leukocytes.

  20. The intestinal flora is required to support antibody responses to systemic immunization in infant and germ free mice.

    Science.gov (United States)

    Lamousé-Smith, Esi S; Tzeng, Alice; Starnbach, Michael N

    2011-01-01

    The presence of a complex and diverse intestinal flora is functionally important for regulating intestinal mucosal immune responses. However, the extent to which a balanced intestinal flora regulates systemic immune responses is still being defined. In order to specifically examine whether the acquisition of a less complex flora influences responses to immunization in the pre-weaning stages of life, we utilize a model in which infant mice acquire an intestinal flora from their mothers that has been altered by broad-spectrum antibiotics. In this model, pregnant dams are treated with a cocktail of antibiotics that alters both the density and microbial diversity of the intestinal flora. After challenge with a subcutaneous immunization, the antibiotic altered flora infant mice have lower antigen specific antibody titers compared to control age-matched mice. In a second model, we examined germ free (GF) mice to analyze how the complete lack of flora influences the ability to mount normal antibody responses following subcutaneous immunization. GF mice do not respond well to immunization and introduction of a normal flora into GF mice restores the capacity of these mice to respond. These results indicate that a gastrointestinal flora reduced in density and complexity at critical time points during development adversely impacts immune responses to systemic antigens.

  1. Regulation of Mucosal Immune Responses – The Missing Link in IBD?

    Directory of Open Access Journals (Sweden)

    Charles O Elson

    1996-01-01

    Full Text Available Although the etiology of inflammatory bowel disease (IBD remains unknown, a major working hypothesis is that it represents a dysregulated immune response to common enteric bacterial antigens. Until recently there has been a relative dearth of experimental models to study this hypothesis. However, exciting developments in experimental models of colitis, including spontaneous, transgenic and knockout mice, now allow this and other hypotheses to be tested. The regulation of mucosal immune responses is not well understood in the normal animal, much less in those with chronic intestinal inflammation. Clearly the CD4 Th1 and Th2 pathways are important in the host response to microbial pathogens, and recent data indicate that the intestinal mucosa seems to be a site of preferential Th2 responses toward exogenous antigens. Deletion of certain cytokine genes involved in maintaining this Th1/Th2 balance (interleukin [IL]-2, IL-10 resulted in colitis, although deletion of others (IL-4, interferon-gamma that are also involved did not. Whether these cytokine gene deletions cause a dysregulation of the mucosal immune response has yet to be shown. However, the importance of regulation can be demonstrated in a model in which a normal CD4+ T cell subset (CD45Rbhigh is transferred into syngeneic severe combined immunodeficiency syndrome recipients. This results in a striking colitis over the ensuing weeks with chronic diarrhea and wasting of the animals. If the reciprocal CD4+ subset (CD45Rblow is co-transferred or if whole CD4+ T cells are transferred no colitis ensues. Therefore, T cells capable of causing colitis are present in normal animals but are prevented from doing so by immunoregulatory mechanisms. The antigens that drive the colitis in several of these models (IL-2 knockout mouse, human leukocyte antigen B27/β2M transgenic rat appear to be those of the normal enteric bacterial flora because germ-free animals do not get the disease. Spontaneously

  2. Immune markers and correlates of protection for vaccine induced immune responses

    DEFF Research Database (Denmark)

    Thakur, Aneesh; Pedersen, Lasse Eggers; Jungersen, Gregers

    2012-01-01

    of an appropriate humoral response currently remain the best validated correlates of protective immunity after vaccination. Despite advancements in the field of immunology over the past few decades currently there are, however, no sufficiently validated immune correlates of vaccine induced protection against......-specific production of interferon-gamma (IFN-γ) has been promoted as a quantitative marker of protective cell-mediated immune responses over the past couple of decades. More recently, however, evidence from several infections has pointed towards the quality of the immune response, measured through increased levels...... of antigen-specific polyfunctional T cells capable of producing a triad of relevant cytokines, as a better correlate of sustained protective immunity against this type of infections. Also the possibilities to measure antigen-specific cytotoxic T cells (CTL) during infection or in response to vaccination...

  3. Cellular immune responses to respiratory viruses

    NARCIS (Netherlands)

    van Helden, M.J.G.

    2011-01-01

    When a respiratory virus successfully infects the lungs, cascades of immune responses are initiated aimed to remove the pathogen. Immediate non-specific protection is provided by the innate immune system and this reduces the viral load during the first days of infection. The adaptive immune response

  4. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  5. Antimicrobial peptides in innate immune responses

    DEFF Research Database (Denmark)

    Sorensen, O.E.; Borregaard, N.; Cole, A.M.

    2008-01-01

    Antimicrobial peptides (AMPs) are ancient effector molecules in the innate immune response of eukaryotes. These peptides are important for the antimicrobial efficacy of phagocytes and for the innate immune response mounted by epithelia of humans and other mammals. AMPs are generated either by de...... novo synthesis or by proteolytic cleavage from antimicrobially inactive proproteins. Studies of human diseases and animal studies have given important clues to the in vivo role of AMPs. It is now evident that dysregulation of the generation of AMPs in innate immune responses plays a role in certain...

  6. Immune responses to implanted human collagen graft in rats

    International Nuclear Information System (INIS)

    Quteish, D.; Dolby, A.E.

    1991-01-01

    Immunity to collagen implants may be mediated by cellular and humoral immune responses. To examine the possibility of such immunological reactivity and crossreactivity to collagen, 39 Sprague-Dawley rats (female, 10 weeks old, approximately 250 g wt) were implanted subcutaneously at thigh sites with crosslinked, freeze-dried human placental type I collagen grafts (4x4x2 mm) which had been irradiated (520 Gray) or left untreated. Blood was obtained by intracardiac sampling prior to implantation or from normal rats, and at various times afterwards when the animals were sacrificed. The sera from these animals were examined for circulating antibodies to human, bovine and rat tail (type I) collagens by enzyme-linked immunosorbent assay (ELISA). Also, the lymphoblastogenic responses of spleen lymphocytes from the irradiated collagen-implanted animals were assessed in culture by measuring thymidine uptake with autologous and normal rat sera in the presence of human bovine type I collagens. Implantation of the irradiated and non-irradiated collagen graft in rats led to a significant increase in the level of circulating antibodies to human collagen. Also antibody to bovine and rat tail collagens was detectable in the animals implanted with irradiated collagen grafts but at a lower level than the human collagen. There was a raised lymphoblastogenic response to both human and bovine collagens. The antibody level and lymphoblastogenesis to the tested collagens gradually decreased towards the end of the post-implantation period. (author)

  7. Immune response is required for the control of in vivo translocation and chronic toxicity of graphene oxide

    Science.gov (United States)

    Wu, Qiuli; Zhao, Yunli; Fang, Jianpeng; Wang, Dayong

    2014-05-01

    Graphene oxide (GO) shows great promise as a nanomaterial for medical applications; however, the mechanism for its long-term adverse effects is still largely unclear. Here, we show that chronic GO exposure not only caused damage on the function of both primary and secondary targeted organs but also induced severe accumulation of pathogenic microbial food (OP50) in the intestine of Caenorhabditis elegans, a non-mammalian alternative toxicity assay system. GO accumulated in the intestine could be largely co-localized with OP50 and induced decreased immune response of animals. In contrast, feeding with UV-treated OP50 suppressed GO toxicity and accumulation in the intestine and maintained the relatively normal immune response of animals. The severe accumulation of OP50 in the intestine might be partially due to the damage by GO on the development and function of AVL and DVB neurons controlling defecation behavior. Reduction of chronic GO toxicity by PEG surface modification largely resulted from the inhibition of OP50 accumulation in the intestine and the maintenance of normal immune response. Our results highlight the key role of innate immunity in regulating in vivo chronic GO toxicity, which will be helpful for our understanding of the interactions between nanomaterials and biological systems during the long-term development of animals.Graphene oxide (GO) shows great promise as a nanomaterial for medical applications; however, the mechanism for its long-term adverse effects is still largely unclear. Here, we show that chronic GO exposure not only caused damage on the function of both primary and secondary targeted organs but also induced severe accumulation of pathogenic microbial food (OP50) in the intestine of Caenorhabditis elegans, a non-mammalian alternative toxicity assay system. GO accumulated in the intestine could be largely co-localized with OP50 and induced decreased immune response of animals. In contrast, feeding with UV-treated OP50 suppressed GO

  8. Mannose Receptor Mediates the Immune Response to Ganoderma atrum Polysaccharides in Macrophages.

    Science.gov (United States)

    Li, Wen-Juan; Tang, Xiao-Fang; Shuai, Xiao-Xue; Jiang, Cheng-Jia; Liu, Xiang; Wang, Le-Feng; Yao, Yu-Fei; Nie, Shao-Ping; Xie, Ming-Yong

    2017-01-18

    The ability of mannose receptor (MR) to recognize the carbohydrate structures is well-established. Here, we reported that MR was crucial for the immune response to a Ganoderma atrum polysaccharide (PSG-1), as evidenced by elevation of MR in association with increase of phagocytosis and concentrations of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α) in normal macrophages. Elevation of MR triggered by PSG-1 also led to control lipopolysaccharide (LPS)-triggered inflammatory response via the increase of interleukin-10 (IL-10) and inhibition of phagocytosis and IL-1β. Anti-MR antibody partly attenuated PSG-1-mediated anti-inflammatory responses, while it could not affect TNF-α secretion, suggesting that another receptor was involved in PSG-1-triggered immunomodulatory effects. MR and toll-like receptor (TLR)4 coordinated the influences on the TLR4-mediated signaling cascade by the nuclear factor-κB (NF-κB) pathway in LPS-stimulated macrophages subjected to PSG-1. Collectively, immune response to PSG-1 required recognition by MR in macrophages. The NF-κB pathway served as a central role for the coordination of MR and TLR4 to elicit immune response to PSG-1.

  9. Immune response to H pylori

    Science.gov (United States)

    Suarez, Giovanni; Reyes, Victor E; Beswick, Ellen J

    2006-01-01

    The gastric mucosa separates the underlying tissue from the vast array of antigens that traffic through the stomach lumen. While the extreme pH of this environment is essential in aiding the activation of enzymes and food digestion, it also renders the gastric epithelium free from bacterial colonization, with the exception of one important human pathogen, H pylori. This bacterium has developed mechanisms to survive the harsh environment of the stomach, actively move through the mucosal layer, attach to the epithelium, evade immune responses, and achieve persistent colonization. While a hallmark of this infection is a marked inflammatory response with the infiltration of various immune cells into the infected gastric mucosa, the host immune response is unable to clear the infection and may actually contribute to the associated pathogenesis. Here, we review the host responses involved during infection with H pylori and how they are influenced by this bacterium. PMID:17007009

  10. Immune responses at brain barriers and implications for brain development and neurological function in later life

    Directory of Open Access Journals (Sweden)

    Helen B. Stolp

    2013-08-01

    Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

  11. Clinical dosing regimen of selinexor maintains normal immune homeostasis and T cell effector function in mice: implications for combination with immunotherapy

    Science.gov (United States)

    Tyler, Paul M.; Servos, Mariah M.; de Vries, Romy C.; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K.

    2017-01-01

    Selinexor (KPT-330) is a first in class nuclear transport inhibitor currently in clinical trials as an anti-cancer agent. To determine how selinexor might impact anti-tumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T cell development, a progressive loss of CD8 T cells and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T cell development and function. We determined the minimum concentration of selinexor required to block T cell activation, and showed that T cell inhibitory effects of selinexor occur at levels above 100nM, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 5 day drug holiday led to intratumoral IFNγ+, granzyme B+ cytotoxic CD8 T cells that were comparable to vehicle treated mice. Overall, selinexor treatment leads to transient inhibition of T cell activation but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T cell functioning and development of anti-tumor immunity. PMID:28148714

  12. Manipulations of the immune response in the chicken

    International Nuclear Information System (INIS)

    Bixler, G.S. Jr.

    1978-01-01

    The chicken with its dissociation of immune responses in cell-mediated immunity, dependent on the thymus, and humoral immunity, dependent on the bursa of Fabricius, provides a unique model for studying the two components of the immune system. While there are methods of obtaining selective, profound deficiency of humoral immunity, in this species, methods for obtaining a consistent, profound selective deficiency of cell-mediated immunity have been lacking. Oxisuran, 2[(methylsulfinyl)acetal] pyridine, has been reported to have the unique ability to differentially suppress cell-mediated immunity in several species of mammals without a concomitant reduction in antibody forming capacity. The effect of this compound on two parameters of cell-mediated immune responses in chickens was investigated. In further attempts to create a deficiency of both cell-mediated and humoral immunity, the effects of a combination of cyclophosphamide treatment and x-irradiation early in life on immune responses were studied

  13. Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response

    Science.gov (United States)

    Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J.; Repasky, Elizabeth A.; Hylander, Bonnie L.

    2018-01-01

    An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were

  14. The Immune Response of Maternally Immune Chicks to Vaccination ...

    African Journals Online (AJOL)

    The Immune Response of Maternally Immune Chicks to Vaccination with Newcastle Disease Virus. ... G A El-Tayeb, M Y El-Ttegani, I E Hajer, M A Mohammed ... This study was conducted to determine the persistence of maternally derived antibodies (MDA) to Newcastle disease virus (NDV) in newly hatched chicks and the ...

  15. Enhancement of Immune Memory Responses to Respiratory Infection

    Science.gov (United States)

    2017-08-01

    AWARD NUMBER: W81XWH-16-1-0360 TITLE: Enhancement of Immune Memory Responses to Respiratory Infection PRINCIPAL INVESTIGATORs: Dr Min Chen PhD...5a. CONTRACT NUMBER Enhancement of Immune Memory Responses to Respiratory Infection 5b. GRANT NUMBER W81XWH-16-1-0360 5c. PROGRAM ELEMENT NUMBER...entitled “ENHANCEMENT OF IMMUNE MEMORY RESPONSES TO RESPIRATORY INFECTION: AUTOPHAGY IN MEMORY B-CELLS RESPONSE TO INFLUENZA VACCINE (AMBRIV

  16. Clinical Dosing Regimen of Selinexor Maintains Normal Immune Homeostasis and T-cell Effector Function in Mice: Implications for Combination with Immunotherapy.

    Science.gov (United States)

    Tyler, Paul M; Servos, Mariah M; de Vries, Romy C; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K

    2017-03-01

    Selinexor (KPT-330) is a first-in-class nuclear transport inhibitor currently in clinical trials as an anticancer agent. To determine how selinexor might affect antitumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T-cell development, a progressive loss of CD8 T cells, and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T-cell development and function. We determined the minimum concentration of selinexor required to block T-cell activation and showed that T-cell-inhibitory effects of selinexor occur at levels above 100 nmol/L, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 4-day drug holiday led to intratumoral IFNγ + , granzyme B + cytotoxic CD8 T cells that were comparable with vehicle-treated mice. Overall, selinexor treatment leads to transient inhibition of T-cell activation, but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T-cell functioning and development of antitumor immunity. Mol Cancer Ther; 16(3); 428-39. ©2017 AACR See related article by Farren et al., p. 417 . ©2017 American Association for Cancer Research.

  17. Immune cells in the normal ovary and spontaneous ovarian tumors in the laying hen (Gallus domesticus) model of human ovarian cancer.

    Science.gov (United States)

    Bradaric, Michael J; Penumatsa, Krishna; Barua, Animesh; Edassery, Seby L; Yu, Yi; Abramowicz, Jacques S; Bahr, Janice M; Luborsky, Judith L

    2013-01-01

    Spontaneous ovarian cancer in chickens resembles human tumors both histologically and biochemically. The goal was to determine if there are differences in lymphocyte content between normal ovaries and ovarian tumors in chickens as a basis for further studies to understand the role of immunity in human ovarian cancer progression. Hens were selected using grey scale and color Doppler ultrasound to determine if they had normal or tumor morphology. Cells were isolated from ovaries (n = 6 hens) and lymphocyte numbers were determined by flow cytometry using antibodies to avian CD4 and CD8 T and B (Bu1a) cells. Ovarian sections from another set of hens (n = 26) were assessed to verify tumor type and stage and to count CD4, CD8 and Bu1a immunostained cells by morphometric analysis. T and B cells were more numerous in ovarian tumors than in normal ovaries by flow cytometry and immunohistochemistry. There were less CD4+ cells than CD8+ and Bu1a+ cells in normal ovaries or ovarian tumors. CD8+ cells were the dominant T cell sub-type in both ovarian stroma and in ovarian follicles compared to CD4+ cells. Bu1a+ cells were consistently found in the stroma of normal ovaries and ovarian tumors but were not associated with follicles. The number of immune cells was highest in late stage serous tumors compared to endometrioid and mucinous tumors. The results suggest that similar to human ovarian cancer there are comparatively more immune cells in chicken ovarian tumors than in normal ovaries, and the highest immune cell content occurs in serous tumors. Thus, this study establishes a foundation for further study of tumor immune responses in a spontaneous model of ovarian cancer which will facilitate studies of the role of immunity in early ovarian cancer progression and use of the hen in pre-clinical vaccine trials.

  18. Immune Response to Lipoproteins in Atherosclerosis

    Directory of Open Access Journals (Sweden)

    Sonia Samson

    2012-01-01

    Full Text Available Atherosclerosis, the underlying cause of cardiovascular disease, is characterized by chronic inflammation and altered immune response. Cholesterol is a well-known risk factor associated with the development of cardiovascular diseases. Elevated serum cholesterol is unique because it can lead to development of atherosclerosis in animals and humans even in the absence of other risk factors. Modifications of low-density lipoproteins mediated by oxidation, enzymatic degradation, and aggregation result in changes in their function and activate both innate and adaptive immune system. Oxidized low-density lipoprotein (LDL has been identified as one of the most important autoantigens in atherosclerosis. This escape from self-tolerance is dependent on the formation of oxidized phospholipids. The emerging understanding of the importance of immune responses against oxidized LDL in atherosclerosis has focused attention on the possibility of development of novel therapy for atherosclerosis. This review provides an overview of immune response to lipoproteins and the fascinating possibility of developing an immunomodulatory therapy for atherosclerosis.

  19. Cholinergic Modulation of Type 2 Immune Responses

    Directory of Open Access Journals (Sweden)

    Goele Bosmans

    2017-12-01

    Full Text Available In recent years, the bidirectional relationship between the nervous and immune system has become increasingly clear, and its role in both homeostasis and inflammation has been well documented over the years. Since the introduction of the cholinergic anti-inflammatory pathway, there has been an increased interest in parasympathetic regulation of both innate and adaptive immune responses, including T helper 2 responses. Increasing evidence has been emerging suggesting a role for the parasympathetic nervous system in the pathophysiology of allergic diseases, including allergic rhinitis, asthma, food allergy, and atopic dermatitis. In this review, we will highlight the role of cholinergic modulation by both nicotinic and muscarinic receptors in several key aspects of the allergic inflammatory response, including barrier function, innate and adaptive immune responses, and effector cells responses. A better understanding of these cholinergic processes mediating key aspects of type 2 immune disorders might lead to novel therapeutic approaches to treat allergic diseases.

  20. Immunocyto-adherence test for the detection of cell mediated immune response in lambs vaccinated with irradiated amphistome metacercariae (Cercariae indicae XXVI)

    International Nuclear Information System (INIS)

    Hafeez, Md.; Rao, B.V.; Krishnaswamy, S.

    1985-01-01

    Adherence of lymphocytes and peritoneal macrophages on amphistome metacercariae (Cercaries indicae XXVI) and Paramphistomum epiclitum adult flukes was observed with cells obtained from lambs immunized with either normal or irradiated amphistome metacercariae (Cercariae indicae XXVI). The cell adherence reaction around metacercariae and adult flukes was comparatively more pronounced with cells obtained from lambs immunized with 2.5 or 3 krad irradiated metacercariae in comparison to cells obtained from lambs immunized with normal of 2 krad irradiated metacercariae. Possibly better CMI response was involved in the operation of immunity against the amphistome in the former two groups of lambs. (author)

  1. Idiotypes as immunogens: facing the challenge of inducing strong therapeutic immune responses against the variable region of immunoglobulins

    International Nuclear Information System (INIS)

    López-Requena, Alejandro; Burrone, Oscar R.; Cesco-Gaspere, Michela

    2012-01-01

    Idiotype (Id)-based immunotherapy has been exploited as cancer treatment option. Conceived as therapy for malignancies bearing idiotypic antigens, it has been also extended to solid tumors because of the capacity of anti-idiotypic antibodies to mimic Id-unrelated antigens. In both these two settings, efforts are being made to overcome the poor immune responsiveness often experienced when using self immunoglobulins as immunogens. Despite bearing a unique gene combination, and thus particular epitopes, it is normally difficult to stimulate the immune response against antibody variable regions. Different strategies are currently used to strengthen Id immunogenicity, such as concomitant use of immune-stimulating molecules, design of Id-containing immunogenic recombinant proteins, specific targeting of relevant immune cells, and genetic immunization. This review focuses on the role of anti-Id vaccination in cancer management and on the current developments used to foster anti-idiotypic B and T cell responses.

  2. Idiotypes as immunogens: facing the challenge of inducing strong therapeutic immune responses against the variable region of immunoglobulins

    Energy Technology Data Exchange (ETDEWEB)

    López-Requena, Alejandro [Molecular Immunology Group, International Centre for Genetic Engineering and Biotechnology, Trieste (Italy); Immunobiology Division, Center of Molecular Immunology, Havana (Cuba); Bioengineering Research Institute, Biotech Pharmaceutical Co., Ltd, Beijing (China); Burrone, Oscar R.; Cesco-Gaspere, Michela, E-mail: cescogaspere@gmail.com [Molecular Immunology Group, International Centre for Genetic Engineering and Biotechnology, Trieste (Italy)

    2012-11-09

    Idiotype (Id)-based immunotherapy has been exploited as cancer treatment option. Conceived as therapy for malignancies bearing idiotypic antigens, it has been also extended to solid tumors because of the capacity of anti-idiotypic antibodies to mimic Id-unrelated antigens. In both these two settings, efforts are being made to overcome the poor immune responsiveness often experienced when using self immunoglobulins as immunogens. Despite bearing a unique gene combination, and thus particular epitopes, it is normally difficult to stimulate the immune response against antibody variable regions. Different strategies are currently used to strengthen Id immunogenicity, such as concomitant use of immune-stimulating molecules, design of Id-containing immunogenic recombinant proteins, specific targeting of relevant immune cells, and genetic immunization. This review focuses on the role of anti-Id vaccination in cancer management and on the current developments used to foster anti-idiotypic B and T cell responses.

  3. Chemical modulators of the innate immune response alter gypsy moth larval susceptibility to Bacillus thuringiensis

    Directory of Open Access Journals (Sweden)

    Broderick Nichole A

    2010-04-01

    Full Text Available Abstract Background The gut comprises an essential barrier that protects both invertebrate and vertebrate animals from invasion by microorganisms. Disruption of the balanced relationship between indigenous gut microbiota and their host can result in gut bacteria eliciting host responses similar to those caused by invasive pathogens. For example, ingestion of Bacillus thuringiensis by larvae of some species of susceptible Lepidoptera can result in normally benign enteric bacteria exerting pathogenic effects. Results We explored the potential role of the insect immune response in mortality caused by B. thuringiensis in conjunction with gut bacteria. Two lines of evidence support such a role. First, ingestion of B. thuringiensis by gypsy moth larvae led to the depletion of their hemocytes. Second, pharmacological agents that are known to modulate innate immune responses of invertebrates and vertebrates altered larval mortality induced by B. thuringiensis. Specifically, Gram-negative peptidoglycan pre-treated with lysozyme accelerated B. thuringiensis-induced killing of larvae previously made less susceptible due to treatment with antibiotics. Conversely, several inhibitors of the innate immune response (eicosanoid inhibitors and antioxidants increased the host's survival time following ingestion of B. thuringiensis. Conclusions This study demonstrates that B. thuringiensis infection provokes changes in the cellular immune response of gypsy moth larvae. The effects of chemicals known to modulate the innate immune response of many invertebrates and vertebrates, including Lepidoptera, also indicate a role of this response in B. thuringiensis killing. Interactions among B. thuringiensis toxin, enteric bacteria, and aspects of the gypsy moth immune response may provide a novel model to decipher mechanisms of sepsis associated with bacteria of gut origin.

  4. Immunomodulator-based enhancement of anti smallpox immune responses.

    Directory of Open Access Journals (Sweden)

    Osmarie Martínez

    Full Text Available The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists, and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein.We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation.The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections.These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.

  5. Immunomodulator-based enhancement of anti smallpox immune responses.

    Science.gov (United States)

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.

  6. Stress proteins and the immune response.

    Science.gov (United States)

    Moseley, P

    2000-07-25

    The heat shock or stress response is one of the most highly conserved adaptive responses in nature. In single cell organisms, the stress response confers tolerance to a variety of stresses including hyperthermia, hyperoxia, hypoxia, and other perturbations, which alter protein synthesis. This tolerance phenomenon is also extremely important in the multicellular organism, resulting in not only thermal tolerance, but also resistance to stresses of the whole organism such as ischemia-reperfusion injury. Moreover, recent data indicates that these stress proteins have the ability to modulate the cellular immune response. Although the terms heat shock proteins (HSPs) and stress proteins are often used interchangeably, the term stress proteins includes the HSPs, the glucose-regulated proteins (GRPs) and ubiquitin. The stress proteins may be grouped by molecular weight ranging from the large 110 kDa HSP110 to ubiquitin at 8 kDa. These proteins serve as cellular chaperones, participating in protein synthesis and transport through the various cellular compartments. Because these proteins have unique cellular localizations, the chaperone function of the stress proteins often involves a transfer of peptides between stress proteins as the peptide is moved between cellular compartments. For example, HSP70 is a cytosolic and nuclear chaperone, which is critical for the transfer of cellular peptides in the mitochondrion through a hand-off that involves mitochondrial HSP60 at the inner mitochondrial membrane. Similarly, cytosolic proteins are transferred from HSP70 to gp96 as they move into the endoplasmic reticulum. The central role of the stress proteins in the transfer of peptides through the cell may be responsible for the recently recognized importance of the stress proteins in the modulation of the immune system [Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61

  7. Maternal immunity enhances Mycoplasma hyopneumoniae vaccination induced cell-mediated immune responses in piglets.

    Science.gov (United States)

    Bandrick, Meggan; Theis, Kara; Molitor, Thomas W

    2014-06-05

    Passively acquired maternal derived immunity (MDI) is a double-edged sword. Maternal derived antibody-mediated immunity (AMI) and cell-mediated immunity (CMI) are critical immediate defenses for the neonate; however, MDI may interfere with the induction of active immunity in the neonate, i.e. passive interference. The effect of antigen-specific MDI on vaccine-induced AMI and CMI responses to Mycoplasma hyopneumoniae (M. hyopneumoniae) was assessed in neonatal piglets. To determine whether CMI and AMI responses could be induced in piglets with MDI, piglets with high and low levels of maternal M. hyopneumoniae-specific immunity were vaccinated against M. hyopneumoniae at 7 d of age. Piglet M. hyopneumoniae-specific antibody, lymphoproliferation, and delayed type hypersensitivity (DTH) responses were measured 7 d and 14 d post vaccination. Piglets with M. hyopneumoniae-specific MDI failed to show vaccine-induced AMI responses; there was no rise in M. hyopneumoniae antibody levels following vaccination of piglets in the presence of M. hyopneumoniae-specific MDI. However, piglets with M. hyopneumoniae-specific MDI had primary (antigen-specific lymphoproliferation) and secondary (DTH) M. hyopneumoniae-specific CMI responses following vaccination. In this study neonatal M. hyopneumoniae-specific CMI was not subject to passive interference by MDI. Further, it appears that both maternal derived and endogenous CMI contribute to M. hyopneumoniae-specific CMI responses in piglets vaccinated in the face of MDI.

  8. Role of levamisole immunotherapy as an adjuvant to radiotherapy in oral cancer - Immune responses

    International Nuclear Information System (INIS)

    Balaram, P.; Remani, P.; Padmanabhan, T.K.

    1988-01-01

    Investigations were carried out to assess the effect of levamisole immunotherapy as an adjuvant to radiotherapy, on the immune response of patients with squamous cell carcinoma of the oral cavity. Parameters assessed were leukocyte migration inhibition, response to PPD and oral cancer extract (OCA), lymphocyte transformation to PHA, circulating antibodies to OCA and circulating immune complexes (CIC). Comparisons were made between groups receiving levamisole, those receiving placebo and normal controls. The results of a thirty-month follow-up are presented. Radiotherapy resulted in a depression of cell-mediated functions, reduction in antibody titre also showed a gradual increase with time of follow-up. Levamisole, however, appeared to reduce the levels of CIC. (author). 2 figs., 1 tab., 38 refs

  9. Effects of fenbendazole on routine immune response parameters of BALB/c mice.

    Science.gov (United States)

    Cray, Carolyn; Villar, David; Zaias, Julia; Altman, Norman H

    2008-11-01

    Fenbendazole (FBZ) is an anthelmintic drug widely used to treat and prevent pinworm outbreaks in laboratory rodents. Although data in nonrodent species indicate possible effects of fenbendazole on the bone marrow and lymphocyte proliferation and function, little has been reported regarding possible effects on the rodent immune system. The purpose of the current study was to determine the effects of a therapeutic regimen of FBZ on immune parameters in BALB/c mice. Both 9-wk on-off and 5-wk continuous medicated feed protocols were assessed. No significant differences between normal and FBZ diet treated mice were observed in the following parameters: complete blood count, blood chemistry, quantitation of major T and B cell markers in spleen, quantitation of T cell markers in the thymus, spleen cell proliferation to T and B cell mitogens, bone marrow colony-forming cell assays, skin graft rejection, and primary and secondary humoral immune responses. These data indicate that FBZ treatment does not affect many standard broad measures of immune function.

  10. Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses

    Science.gov (United States)

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L.; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    Background The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. Methods We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. Results The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. Conclusion These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform. PMID:25875833

  11. Vitamin E, immunity, and infection

    Science.gov (United States)

    A normally functioning immune system is critical for the body to fight and eliminate invading pathogens from the environment. On the other hand, the immune system also protects the body from internal risks such as neoplasia growing within and autoimmune responses that attack self. The immune system ...

  12. Evaluation of mucosal and systemic immune responses elicited by GPI-0100- adjuvanted influenza vaccine delivered by different immunization strategies.

    Directory of Open Access Journals (Sweden)

    Heng Liu

    Full Text Available Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN or the intrapulmonary (IPL route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses.

  13. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100- Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    Science.gov (United States)

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066

  14. The nociception genes painless and Piezo are required for the cellular immune response of Drosophila larvae to wasp parasitization.

    Science.gov (United States)

    Tokusumi, Yumiko; Tokusumi, Tsuyoshi; Schulz, Robert A

    2017-05-13

    In vertebrates, interaction between the nervous system and immune system is important to protect a challenged host from stress inputs from external sources. In this study, we demonstrate that sensory neurons are involved in the cellular immune response elicited by wasp infestation of Drosophila larvae. Multidendritic class IV neurons sense contacts from external stimuli and induce avoidance behaviors for host defense. Our findings show that inactivation of these sensory neurons impairs the cellular response against wasp parasitization. We also demonstrate that the nociception genes encoding the mechanosensory receptors Painless and Piezo, both expressed in class IV neurons, are essential for the normal cellular immune response to parasite challenge. Copyright © 2017. Published by Elsevier Inc.

  15. Pleurodeles Waltl Humoral Immune Response under Spaceflight Conditions

    Science.gov (United States)

    Bascove, Matthieu; Touche, Nadege; Frippiat, Jean-Pol

    2008-06-01

    The immune system is an important regulatory mechanism affected by spaceflights. In a previous work, we performed a first study of the humoral immune response induced by the immunization of Pleurodeles waltl during a 5 months stay onboard the Mir space station. This analysis indicated that heavy-chain variable domains of specific IgM are encoded by genes of the VHII and VHVI families. However, the contributions of these two families to IgM heavy-chains are different in flown animals [1]. To better understand this immune response modification, we have now determined how individual VH genes have been used to build specific IgM binding sites in animals immunized on earth or in space. This new study revealed quantitative and qualitative modifications in VH genes expression. These data confirm that a spaceflight might affect the humoral response.

  16. The development of a fully-integrated immune response model (FIRM) simulator of the immune response through integration of multiple subset models.

    Science.gov (United States)

    Palsson, Sirus; Hickling, Timothy P; Bradshaw-Pierce, Erica L; Zager, Michael; Jooss, Karin; O'Brien, Peter J; Spilker, Mary E; Palsson, Bernhard O; Vicini, Paolo

    2013-09-28

    The complexity and multiscale nature of the mammalian immune response provides an excellent test bed for the potential of mathematical modeling and simulation to facilitate mechanistic understanding. Historically, mathematical models of the immune response focused on subsets of the immune system and/or specific aspects of the response. Mathematical models have been developed for the humoral side of the immune response, or for the cellular side, or for cytokine kinetics, but rarely have they been proposed to encompass the overall system complexity. We propose here a framework for integration of subset models, based on a system biology approach. A dynamic simulator, the Fully-integrated Immune Response Model (FIRM), was built in a stepwise fashion by integrating published subset models and adding novel features. The approach used to build the model includes the formulation of the network of interacting species and the subsequent introduction of rate laws to describe each biological process. The resulting model represents a multi-organ structure, comprised of the target organ where the immune response takes place, circulating blood, lymphoid T, and lymphoid B tissue. The cell types accounted for include macrophages, a few T-cell lineages (cytotoxic, regulatory, helper 1, and helper 2), and B-cell activation to plasma cells. Four different cytokines were accounted for: IFN-γ, IL-4, IL-10 and IL-12. In addition, generic inflammatory signals are used to represent the kinetics of IL-1, IL-2, and TGF-β. Cell recruitment, differentiation, replication, apoptosis and migration are described as appropriate for the different cell types. The model is a hybrid structure containing information from several mammalian species. The structure of the network was built to be physiologically and biochemically consistent. Rate laws for all the cellular fate processes, growth factor production rates and half-lives, together with antibody production rates and half-lives, are provided. The

  17. Modulation of the innate immune responses in the striped ...

    African Journals Online (AJOL)

    Thus, most of the innate non-specific immune responses are inducible though they are constitutive of fish immune system exhibiting a basal level of activity even in the absence of pathogen challenge. Keywords: Aeromonas hydrophila, Experimental challenge, Innate immune response, Striped snakehead murrel ...

  18. Adenovirus Vector-Derived VA-RNA-Mediated Innate Immune Responses

    Directory of Open Access Journals (Sweden)

    Hiroyuki Mizuguchi

    2011-07-01

    Full Text Available The major limitation of the clinical use of replication-incompetent adenovirus (Ad vectors is the interference by innate immune responses, including induction of inflammatory cytokines and interferons (IFN, following in vivo application of Ad vectors. Ad vector-induced production of inflammatory cytokines and IFNs also results in severe organ damage and efficient induction of acquired immune responses against Ad proteins and transgene products. Ad vector-induced innate immune responses are triggered by the recognition of Ad components by pattern recognition receptors (PRRs. In order to reduce the side effects by Ad vector-induced innate immune responses and to develop safer Ad vectors, it is crucial to clarify which PRRs and which Ad components are involved in Ad vector-induced innate immune responses. Our group previously demonstrated that myeloid differentiating factor 88 (MyD88 and toll-like receptor 9 (TLR9 play crucial roles in the Ad vector-induced inflammatory cytokine production in mouse bone marrow-derived dendritic cells. Furthermore, our group recently found that virus associated-RNAs (VA-RNAs, which are about 160 nucleotide-long non-coding small RNAs encoded in the Ad genome, are involved in IFN production through the IFN-β promoter stimulator-1 (IPS-1-mediated signaling pathway following Ad vector transduction. The aim of this review is to highlight the Ad vector-induced innate immune responses following transduction, especially VA-RNA-mediated innate immune responses. Our findings on the mechanism of Ad vector-induced innate immune responses should make an important contribution to the development of safer Ad vectors, such as an Ad vector lacking expression of VA-RNAs.

  19. Immune response induction in the central nervous system

    DEFF Research Database (Denmark)

    Owens, Trevor; Babcock, Alicia

    2002-01-01

    The primary function of the immune response is protection of the host against infection with pathogens, including viruses. Since viruses can infect any tissue of the body, including the central nervous system (CNS), it is logical that cells of the immune system should equally have access to all...... tissues. Nevertheless, the brain and spinal cord are noted for their lack of immune presence. Relative to other organ systems, the CNS appears immunologically privileged. Furthermore, when immune responses do occur in the CNS, they are frequently associated with deleterious effects such as inflammatory...

  20. Interplay between behavioural thermoregulation and immune response in mealworms.

    Science.gov (United States)

    Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco

    2012-11-01

    Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Immunization with Brucella VirB proteins reduces organ colonization in mice through a Th1-type immune response and elicits a similar immune response in dogs.

    Science.gov (United States)

    Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C

    2015-03-01

    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Humoral and cellular immune responses to Yersinia pestis Pla antigen in humans immunized with live plague vaccine.

    Science.gov (United States)

    Feodorova, Valentina A; Lyapina, Anna M; Khizhnyakova, Maria A; Zaitsev, Sergey S; Sayapina, Lidiya V; Arseneva, Tatiana E; Trukhachev, Alexey L; Lebedeva, Svetlana A; Telepnev, Maxim V; Ulianova, Onega V; Lyapina, Elena P; Ulyanov, Sergey S; Motin, Vladimir L

    2018-06-01

    To establish correlates of human immunity to the live plague vaccine (LPV), we analyzed parameters of cellular and antibody response to the plasminogen activator Pla of Y. pestis. This outer membrane protease is an essential virulence factor that is steadily expressed by Y. pestis. PBMCs and sera were obtained from a cohort of naïve (n = 17) and LPV-vaccinated (n = 34) donors. Anti-Pla antibodies of different classes and IgG subclasses were determined by ELISA and immunoblotting. The analysis of antibody response was complicated with a strong reactivity of Pla with normal human sera. The linear Pla B-cell epitopes were mapped using a library of 15-mer overlapping peptides. Twelve peptides that reacted specifically with sera of vaccinated donors were found together with a major cross-reacting peptide IPNISPDSFTVAAST located at the N-terminus. PBMCs were stimulated with recombinant Pla followed by proliferative analysis and cytokine profiling. The T-cell recall response was pronounced in vaccinees less than a year post-immunization, and became Th17-polarized over time after many rounds of vaccination. The Pla protein can serve as a biomarker of successful vaccination with LPV. The diagnostic use of Pla will require elimination of cross-reactive parts of the antigen.

  3. Immune response and anamnestic immune response in children after a 3-dose primary hepatitis b vaccination

    International Nuclear Information System (INIS)

    Afzal, M.F.; Sultan, M.A.; Saleemi, A.I.

    2017-01-01

    Diseases caused by Hepatitis B virus (HBV) have a worldwide distribution. Pakistan adopted the recommendations of World Health Organization (WHO) for routine universal infant vaccination against hepatitis B in 2002, currently being administered at 6, 10, and 14 weeks of age in a combination vaccine. This study was conducted to determine the immune response and anamnestic immune response in children, 9 months-10 years of age, after a 3-dose primary Hepatitis B vaccination. Methods: This cross sectional study was conducted in the Department of Paediatrics, King Edward Medical University/Mayo Hospital, Lahore, Pakistan, from January to June, 2014. A total of 200 children of either sex between the ages of 9 months to 10 years, docu mented to have received 3 doses of hepatitis B vaccines according to Expanded Program of Immunization (6,10,14 weeks) schedule in infancy, were recruited by consecutive sampling. The level of serum anti-HBsAb by ELIZA was measured. Children with anti-HBs titers =10 mIU/mL were considered to be immune. Those with anti-HBsAb levels <10 mIU/mL were offered a booster dose of infant recombinant hepatitis B vaccine. The second serum sample was obtained 21-28 days following the administration of the booster dose and the anamnestic immune response was measured. Data was analysed using SPSS 17 to determine the relation between time interval since last vaccination and antibody titer. Chi square test was applied. Results: Of the 200 children, protective antibody response was found in 58 percent. Median serological response was 18.60 (range 2.82-65.15). Antibody levels were found to have a statistically significant (p-value 0.019) negative correlation with the time since last administration of vaccine. A booster dose of Hepatitis B vaccine was administered to all non-responders, with each registering a statistically significant (p-value 0.00) anamnestic response. Conclusion: The vaccination schedule with short dosage interval was unable to provide

  4. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  5. Dynamic Nature of Noncoding RNA Regulation of Adaptive Immune Response

    Directory of Open Access Journals (Sweden)

    Franca Citarella

    2013-08-01

    Full Text Available Immune response plays a fundamental role in protecting the organism from infections; however, dysregulation often occurs and can be detrimental for the organism, leading to a variety of immune-mediated diseases. Recently our understanding of the molecular and cellular networks regulating the immune response, and, in particular, adaptive immunity, has improved dramatically. For many years, much of the focus has been on the study of protein regulators; nevertheless, recent evidence points to a fundamental role for specific classes of noncoding RNAs (ncRNAs in regulating development, activation and homeostasis of the immune system. Although microRNAs (miRNAs are the most comprehensive and well-studied, a number of reports suggest the exciting possibility that long ncRNAs (lncRNAs could mediate host response and immune function. Finally, evidence is also accumulating that suggests a role for miRNAs and other small ncRNAs in autocrine, paracrine and exocrine signaling events, thus highlighting an elaborate network of regulatory interactions mediated by different classes of ncRNAs during immune response. This review will explore the multifaceted roles of ncRNAs in the adaptive immune response. In particular, we will focus on the well-established role of miRNAs and on the emerging role of lncRNAs and circulating ncRNAs, which all make indispensable contributions to the understanding of the multilayered modulation of the adaptive immune response.

  6. Innate immune response development in nestling tree swallows

    Science.gov (United States)

    Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.

    2011-01-01

    We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.

  7. Long-chain inulin for stimulating an immune response

    NARCIS (Netherlands)

    de Vos, Paulus; Vogt, Leonie

    2017-01-01

    The invention relates to a long chain inulin for influencing the immune response against a pathogen. The invention also relates to a combination comprising a long chain inulin and a vaccine for influencing the immune response against a pathogen, wherein the long chain inulin is orally administrated.

  8. Immune Responses Involved in Mycobacterium Tuberculosis Infection

    Directory of Open Access Journals (Sweden)

    Roghayeh Teimourpour

    2016-09-01

    Full Text Available Background and Objectives: Mycobacterium tuberculosis is the causative agent of tuberculosis (TB. Approximately one-third of the world's population is infected with M. tuberculosis. Despite the availability of drug and vaccine, it remains one of the leading causes of death in humans especially in developing countries. Epidemiological studies have indicated that only 10-30% of people exposed to tubercle bacillus are infected with M. tuberculosis, and at least 90% of the infected people finally do not acquire TB. The studies have indicated that the host efficient immune system has essential roles in the control of TB infection such that the highest rate of mortality and morbidity is seen in immunocompromised patients such as people infected with HIV. M. tuberculosis is an obligatory intracellular bacterium. It enters the body mainly through the respiratory tract and alveolar macrophages combat this pathogen most commonly. In addition to alveolar macrophages, various T-cell subpopulations need to be activated to overcome this bacterium's resistance to the host defense systems. CD4+ T cells, through production of several cytokines such as IFN-γ and TNF-α, and CD8+ T cells, through cytotoxic activities and induction of apoptosis in infected cells, play critical roles in inducing appropriate immune responses against M. tuberculosis. Although cell-mediated immunity is the cornerstone of host responses against TB and the recent studies have provided evidence for the importance of humoral and innate immune system in the control of TB, a profound understanding of the immune responses would provide a basis for development of new generations of vaccines and drugs. The present study addresses immune responses involved in M. tuberculosis infection.

  9. Entirely Carbohydrate-Based Vaccines: An Emerging Field for Specific and Selective Immune Responses

    Directory of Open Access Journals (Sweden)

    Sharmeen Nishat

    2016-05-01

    Full Text Available Carbohydrates are regarded as promising targets for vaccine development against infectious disease because cell surface glycans on many infectious agents are attributed to playing an important role in pathogenesis. In addition, oncogenic transformation of normal cells, in many cases, is associated with aberrant glycosylation of the cell surface glycan generating tumor associated carbohydrate antigens (TACAs. Technological advances in glycobiology have added a new dimension to immunotherapy when considering carbohydrates as key targets in developing safe and effective vaccines to combat cancer, bacterial infections, viral infections, etc. Many consider effective vaccines induce T-cell dependent immunity with satisfactory levels of immunological memory that preclude recurrence. Unfortunately, carbohydrates alone are poorly immunogenic as they do not bind strongly to the MHCII complex and thus fail to elicit T-cell immunity. To increase immunogenicity, carbohydrates have been conjugated to carrier proteins, which sometimes can impede carbohydrate specific immunity as peptide-based immune responses can negate antibodies directed at the targeted carbohydrate antigens. To overcome many challenges in using carbohydrate-based vaccine design and development approaches targeting cancer and other diseases, zwitterionic polysaccharides (ZPSs, isolated from the capsule of commensal anaerobic bacteria, will be discussed as promising carriers of carbohydrate antigens to achieve desired immunological responses.

  10. Agouron and immune response to commercialize remune immune-based treatment.

    Science.gov (United States)

    James, J S

    1998-06-19

    Agouron Pharmaceuticals agreed in June to collaborate with The Immune Response Corporation on the final development and marketing of an immune-based treatment for HIV. Remune, the vaccine developed by Dr. Jonas Salk, is currently in Phase III randomized trials with 2,500 patients, and the trials are expected to be completed in April 1999. Immune-based treatments have been difficult to test, as there is no surrogate marker, like viral load, to determine if the drug is working. Agouron agreed to participate in the joint venture after reviewing encouraging results from preliminary trials in which remune was taken in combination with highly active antiretroviral drugs.

  11. Modulation of immune responses in stress by Yoga

    Directory of Open Access Journals (Sweden)

    Arora Sarika

    2008-01-01

    Full Text Available Stress is a constant factor in today′s fastpaced life that can jeopardize our health if left unchecked. It is only in the last half century that the role of stress in every ailment from the common cold to AIDS has been emphasized, and the mechanisms involved in this process have been studied. Stress influences the immune response presumably through the activation of the hypothalamic-pituitary adrenal axis, hypothalamic pituitary-gonadal axis, and the sympathetic-adrenal-medullary system. Various neurotransmitters, neuropeptides, hormones, and cytokines mediate these complex bidirectional interactions between the central nervous system (CNS and the immune system. The effects of stress on the immune responses result in alterations in the number of immune cells and cytokine dysregulation. Various stress management strategies such as meditation, yoga, hypnosis, and muscle relaxation have been shown to reduce the psychological and physiological effects of stress in cancers and HIV infection. This review aims to discuss the effect of stress on the immune system and examine how relaxation techniques such as Yoga and meditation could regulate the cytokine levels and hence, the immune responses during stress.

  12. A Protocol for the Comprehensive Flow Cytometric Analysis of Immune Cells in Normal and Inflamed Murine Non-Lymphoid Tissues

    Science.gov (United States)

    Yu, Yen-Rei A.; O’Koren, Emily G.; Hotten, Danielle F.; Kan, Matthew J.; Kopin, David; Nelson, Erik R.; Que, Loretta; Gunn, Michael D.

    2016-01-01

    Flow cytometry is used extensively to examine immune cells in non-lymphoid tissues. However, a method of flow cytometric analysis that is both comprehensive and widely applicable has not been described. We developed a protocol for the flow cytometric analysis of non-lymphoid tissues, including methods of tissue preparation, a 10-fluorochrome panel for cell staining, and a standardized gating strategy, that allows the simultaneous identification and quantification of all major immune cell types in a variety of normal and inflamed non-lymphoid tissues. We demonstrate that our basic protocol minimizes cell loss, reliably distinguishes macrophages from dendritic cells (DC), and identifies all major granulocytic and mononuclear phagocytic cell types. This protocol is able to accurately quantify 11 distinct immune cell types, including T cells, B cells, NK cells, neutrophils, eosinophils, inflammatory monocytes, resident monocytes, alveolar macrophages, resident/interstitial macrophages, CD11b- DC, and CD11b+ DC, in normal lung, heart, liver, kidney, intestine, skin, eyes, and mammary gland. We also characterized the expression patterns of several commonly used myeloid and macrophage markers. This basic protocol can be expanded to identify additional cell types such as mast cells, basophils, and plasmacytoid DC, or perform detailed phenotyping of specific cell types. In examining models of primary and metastatic mammary tumors, this protocol allowed the identification of several distinct tumor associated macrophage phenotypes, the appearance of which was highly specific to individual tumor cell lines. This protocol provides a valuable tool to examine immune cell repertoires and follow immune responses in a wide variety of tissues and experimental conditions. PMID:26938654

  13. Plasmodium berghei: immunosuppression of the cell-mediated immune response induced by nonviable antigenic preparations

    International Nuclear Information System (INIS)

    Gross, A.; Frankenburg, S.

    1989-01-01

    In this work, plasmodial antigens were examined for their ability to suppress the cellular immune response during lethal Plasmodium berghei infection. Splenic enlargement and the number and function of white spleen cells were assessed after injection of normal mice with irradiated parasitized erythrocytes (IPE) or with parasitized erythrocytes (PE) membranes. Both IPE and PE membranes caused splenomegaly and an increase in the number of splenic white cells with concurrent alteration of the relative proportions of T cells and macrophages. The percentage of T lymphocytes was fractionally diminished, but there was a marked increase in Lyt 2.2 positive (suppressor and cytotoxic) T subsets and in the number of splenic macrophage precursors. The pathological enlargement of the spleen was induced by various plasma membrane-derived antigens containing both proteins and carbohydrates. Splenocytes of mice injected with liposomes containing deoxycholate-treated PE or PE fractions showed both diminished interleukin 2 production and a decreased response to mitogen. It appears that some of the changes in the cellular immune response during P. berghei infection are a consequence of the massive provision of a wide spectrum of antigens, capable of suppressing the immune response. Thus, it may be appropriate to evaluate the possible negative effect of parasite epitopes that are candidates for vaccine

  14. Modulation of immune response by bacterial lipopolysaccharides

    Directory of Open Access Journals (Sweden)

    Gustavo Aldapa-Vega

    2016-08-01

    Full Text Available Lipopolysaccharide (LPS is a molecule that is profusely found on the outer membrane of Gram-negative bacteria and is also a potent stimulator of the immune response. As the main molecule on the bacterial surface, is also the most biologically active. The immune response of the host is activated by the recognition of LPS through Toll-like receptor 4 (TLR4 and this receptor-ligand interaction is closely linked to LPS structure. Microorganisms have evolved systems to control the expression and structure of LPS, producing structural variants that are used for modulating the host immune responses during infection. Examples of this include Helicobacter pylori, Francisella tularensis, Chlamydia trachomatis and Salmonella spp. High concentrations of LPS can cause fever, increased heart rate and lead to septic shock and death. However, at relatively low concentrations some LPS are highly active immunomodulators, which can induce non-specific resistance to invading microorganisms. The elucidation of the molecular and cellular mechanisms involved in the recognition of LPS and its structural variants has been fundamental to understand inflammation and is currently a pivotal field of research to understand the innate immune response, inflammation, the complex host-pathogen relationship and has important implications for the rational development of new immunomodulators and adjuvants.

  15. The immune response to sand fly salivary proteins and its influence on Leishmania immunity

    Directory of Open Access Journals (Sweden)

    Regis eGomes

    2012-05-01

    Full Text Available Leishmaniasis is a vector-borne disease transmitted by bites of phlebotomine sand flies. During Leishmania transmission, sand fly saliva is co-inoculated with parasites into the skin of the mammalian host. Sand fly saliva consists of roughly thirty different salivary proteins, many with known roles linked to blood feeding facilitation. Apart from the anti-hemostatic capacity of saliva, several sand fly salivary proteins have been shown to be immunogenic upon multiple contacts with a mammalian host. Immunization with single immunogenic salivary proteins or exposure to uninfected bites can produce protective immune responses against leishmaniasis. These sand fly salivary proteins induce cellular immune responses and/or antibodies. Antibodies to saliva are not required for protection in a mouse model against leishmaniasis. A strong body of evidence points to the role for saliva-specific T cells producing IFN-γ in the form of a delayed-type hypersensitivity reaction at the bite site as the main protective response. Herein, we review immunity to sand fly salivary proteins in the context of its vector-parasite-host combinations and vaccine potential, as well as some recent advances to shed light on the mechanism of how an immune response to sand fly saliva protects against leishmaniasis.

  16. Modulation of systemic immune responses through commensal gastrointestinal microbiota.

    Directory of Open Access Journals (Sweden)

    Kyle M Schachtschneider

    Full Text Available Colonization of the gastrointestinal (GI tract is initiated during birth and continually seeded from the individual's environment. Gastrointestinal microorganisms play a central role in developing and modulating host immune responses and have been the subject of investigation over the last decades. Animal studies have demonstrated the impact of GI tract microbiota on local gastrointestinal immune responses; however, the full spectrum of action of early gastrointestinal tract stimulation and subsequent modulation of systemic immune responses is poorly understood. This study explored the utility of an oral microbial inoculum as a therapeutic tool to affect porcine systemic immune responses. For this study a litter of 12 pigs was split into two groups. One group of pigs was inoculated with a non-pathogenic oral inoculum (modulated, while another group (control was not. DNA extracted from nasal swabs and fecal samples collected throughout the study was sequenced to determine the effects of the oral inoculation on GI and respiratory microbial communities. The effects of GI microbial modulation on systemic immune responses were evaluated by experimentally infecting with the pathogen Mycoplasma hyopneumoniae. Coughing levels, pathology, toll-like receptors 2 and 6, and cytokine production were measured throughout the study. Sequencing results show a successful modulation of the GI and respiratory microbiomes through oral inoculation. Delayed type hypersensitivity responses were stronger (p = 0.07, and the average coughing levels and respiratory TNF-α variance were significantly lower in the modulated group (p<0.0001 and p = 0.0153, respectively. The M. hyopneumoniae infection study showed beneficial effects of the oral inoculum on systemic immune responses including antibody production, severity of infection and cytokine levels. These results suggest that an oral microbial inoculation can be used to modulate microbial communities, as well as

  17. Sex hormones and the immune response in humans

    NARCIS (Netherlands)

    Bouman, Annechien; Heineman, Maas Jan; Faas, Marijke M.

    2005-01-01

    In addition to their effects on sexual differentiation and reproduction, sex hormones appear to influence the immune system. This results in a sexual dimorphism in the immune response in humans: for instance, females produce more vigorous cellular and more vigorous humoral immune reactions, are more

  18. Bovine immune response to inoculation with Neospora caninum surface antigen SRS2 lipopeptides mimics immune response to infection with live parasites.

    Science.gov (United States)

    Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor

    2008-04-01

    Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.

  19. The innate immune response during urinary tract infection and pyelonephritis.

    Science.gov (United States)

    Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S

    2014-07-01

    Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.

  20. Models for Immune Response and Immune Evasion in MSI Cancer and Lynch Syndrome

    OpenAIRE

    Özcan, Mine

    2017-01-01

    Microsatellite-unstable (MSI) cancers occurring in the context of the hereditary Lynch syndrome or as sporadic cancers elicit pronounced tumor-specific immune responses. The pronounced immune response was shown to be closely associated with frameshift peptides (FSP) that are generated as a result of deficiency in DNA mismatch repair system leading to insertion/deletion mutations in coding microsatellites (cMS). FSP neoantigens are long antigenic amino acid stretches that bear m...

  1. Immune and stress responses in oysters with insights on adaptation.

    Science.gov (United States)

    Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude

    2015-09-01

    Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Humoral Immunity to AAV-6, 8, and 9 in Normal and Dystrophic Dogs

    Science.gov (United States)

    Shin, Jin-Hong; Yue, Yongping; Smith, Bruce

    2012-01-01

    Abstract Adeno-associated virus (AAV)-6, 8, and 9 are promising gene-delivery vectors for testing novel Duchenne muscular dystrophy gene therapy in the canine model. Humoral immunity greatly influences in vivo AAV transduction. However, neutralizing antibodies to AAV-6, 8, and 9 have not been systemically examined in normal and dystrophic dogs. To gain information on the seroprevalence of antibodies to AAV-6, 8, and 9, we measured neutralizing antibody titers using an in vitro transduction inhibition assay. We examined 72 naive serum samples and 26 serum samples obtained from dogs that had received AAV gene transfer. Our data demonstrated that AAV-6 neutralizing antibody was the most prevalent antibody in dogs irrespective of age, gender, disease status (dystrophic or not), and prior parvovirus vaccination history. Surprisingly, high-level anti-AAV-6 antibody was detected at birth in newborn puppies. Further, a robust antibody response was induced in affected, but not normal newborn dogs following systemic AAV gene transfer. Taken together, our data have provided an important baseline on the seroprevalence of AAV-6, 8, and 9 neutralizing antibodies in normal and Duchenne muscular dystrophy dogs. These results will help guide translational AAV gene-therapy studies in dog models of muscular dystrophy. PMID:22040468

  3. Immunization with avian metapneumovirus harboring chicken Fc induces higher immune responses.

    Science.gov (United States)

    Paudel, Sarita; Easwaran, Maheswaran; Jang, Hyun; Jung, Ho-Kyoung; Kim, Joo-Hun; Shin, Hyun-Jin

    2016-07-15

    In this study, we evaluated the immune responses of avian metapneumovirus harboring chicken Fc molecule. Stable Vero cells expressing chicken Fc chimera on its surface (Vero-cFc) were established, and we confirmed that aMPV grown in Vero-cFc incorporated host derived chimera Fc into the aMPV virions. Immunization of chicken with aMPV-cFc induced higher level of antibodies and inflammatory cytokines; (Interferon (IFN)-γ and Interleukin (IL)-1β) compared to those of aMPV. The increased levels of antibodies and inflammatory cytokines in chicken immunized with aMPV-cFc were statistically significantly (p<0.05) to that of aMPV and control. The aMPV-cFc group also generated the highest neutralizing antibody response. After challenges, chickens immunized with aMPV-cFc showed much less pathological signs in nasal turbinates and trachea so that we could confirm aMPV-cFc induced higher protection than that of aMPV. The greater ability of aMPV harboring chicken Fc to that of aMPV presented it as a possible vaccine candidate. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Probiotics, antibiotics and the immune responses to vaccines.

    Science.gov (United States)

    Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep

    2015-06-19

    Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  5. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100-Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    NARCIS (Netherlands)

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery

  6. Characterization of host immune responses in Ebola virus infections.

    Science.gov (United States)

    Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo

    2014-06-01

    Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.

  7. Imunidade na gestação normal e na paciente com lúpus eritematoso sistêmico (LES Immunity in the normal pregnancy and in the patient with systemic lupus erythematosus (SLE

    Directory of Open Access Journals (Sweden)

    Alessandra Cardoso Pereira

    2005-06-01

    Full Text Available A gravidez é uma condição fisiológica na qual ocorrem várias mudanças imunoendócrinas com a finalidade de facilitar a imunossupressão e a tolerância aos antígenos paternos e fetais. Na gravidez humana normal existe uma relativa supressão de citocinas tipo Th1 na resposta dos linfócitos, levando a uma prevalência na resposta do tipo Th2. No LES, onde prevalece a resposta imune do tipo Th2, a gravidez pode estar relacionada com a ativação da doença. Este artigo é uma revisão dessas alterações relacionadas com a resposta imune durante a gestação normal e na da paciente com LES.Pregnancy is a physiologic condition where several immuno-endocrine changes take place with the aim of facilitating immunosuppression and tolerance towards paternal and fetal antigens. In normal human pregnancy there is a relative suppression of Th1 type cytokines in response to lymphocytes, leading to a Th2 type response. In SLE, where a Th2 type response prevails, pregnancy may exacerbate the disease. This article reviews the alterations related to the immune response during normal pregnancy and in SLE patients.

  8. Initiation of innate immune responses by surveillance of homeostasis perturbations.

    Science.gov (United States)

    Colaço, Henrique G; Moita, Luis F

    2016-07-01

    Pathogen recognition, signaling transduction pathways, and effector mechanisms are necessary steps of innate immune responses that play key roles in the early phase of defense and in the stimulation of the later specific response of adaptive immunity. Here, we argue that in addition to the direct recognition of conserved common structural and functional molecular signatures of microorganisms using pattern recognition receptors, hosts can mount an immune response following the sensing of disruption in homeostasis as proximal reporters for infections. Surveillance of disruption of core cellular activities leading to defense responses is a flexible strategy that requires few additional components and that can effectively detect relevant threats. It is likely to be evolutionarily very conserved and ancient because it is operational in organisms that lack pattern recognition triggered immunity. A homeostasis disruption model of immune response initiation and modulation has broad implications for pathophysiology and treatment of disease and might constitute an often overlooked but central component of a comprehensive conceptual framework for innate immunity. © 2016 Federation of European Biochemical Societies.

  9. Respons imun humoral pada pulpitis (Humoral immune response on pulpitis

    Directory of Open Access Journals (Sweden)

    Trijoedani Widodo

    2005-06-01

    Full Text Available Pulpitis is an inflammation process on dental pulp tissue, and usually as the continuous of caries. The microorganism in the caries is a potential immunogenic triggering the immune respons, both humoral and celluler immune responses. The aim of this research is to explain the humoral immune response changes in the dental pulp tissues of pulpitis. This research was done on three group samples: Irreversible pulpitis, Reversible pulpitis and sound teeth as the control group. The result showed that there were three pulpitis immunopathologic patterns: the sound teeth immunopathologic pattern showing a low humoral immune response, in a low level of IgG, IgA and IgM, the reversible pulpitis pattern showing that in a higher humoral immune response, IgG and IgA decreased but IgM increased, the irreversible pulpitis pattern showing that IgG and IgM increased, but it couldn't be repaired although it has highly immunity, and it showed an unusually low level of IgA. This low level of IgA meant that irreversible pulpitis had a low mucosal immunity.

  10. The body’s immune response in the induction and progression of cancer of the cervix uteri: possible mechanisms

    Directory of Open Access Journals (Sweden)

    O. V. Kurmyshkina

    2011-01-01

    Full Text Available Human papillomavirus (HPV that is a main cause of cancer of the cervix uteri (CCU has immunogenic properties, i.e. an abilityto activate antiviral immunity responses as adaptive HPV-specific and innate ones. For this reason, despite multiple mechanisms generated by HPV to avoid immunity responses, the human body can eliminate the infection in most cases. At the same time, CCU results from the combined influence of many factors of different nature, among which the factors that impair the normal course of an immune response are of vital importance.This review describes the major factors and mechanisms, which promote the establishment of persistent HPV infection and the progression of dysplasia to cancer, on the one hand, and allow the tumor cells in CCU to restrict the body’s immune reactions, on the other Immune disorders induced by the virus and/or tumor cells are considered at both local and systemic levels. Particular emphasis is placed on the molecular mechanisms that can change the population composition and functional activity of leukocytes and the cytokine profile of cells and can form the tumor suppressor microenvironment.

  11. Chemokine-mediated immune responses in the female genital tract mucosa.

    Science.gov (United States)

    Deruaz, Maud; Luster, Andrew D

    2015-04-01

    The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.

  12. Autonomous parvoviruses neither stimulate nor are inhibited by the type I interferon response in human normal or cancer cells.

    Science.gov (United States)

    Paglino, Justin C; Andres, Wells; van den Pol, Anthony N

    2014-05-01

    Members of the genus Parvovirus are small, nonenveloped single-stranded DNA viruses that are nonpathogenic in humans but have potential utility as cancer therapeutics. Because the innate immune response to parvoviruses has received relatively little attention, we compared the response to parvoviruses to that of several other types of viruses in human cells. In normal human glia, fibroblasts, or melanocytes, vesicular stomatitis virus evoked robust beta interferon (IFN-β) responses. Cytomegalovirus, pseudorabies virus, and Sindbis virus all evoked a 2-log-unit or greater upregulation of IFN-β in glia; in contrast, LuIII and MVMp parvoviruses did not evoke a detectable IFN-β or interferon-stimulated gene (ISG; MX1, oligoadenylate synthetase [OAS], IFIT-1) response in the same cell types. The lack of response raised the question of whether parvoviral infection can be attenuated by IFN; interestingly, we found that IFN did not decrease parvovirus (MVMp, LuIII, and H-1) infectivity in normal human glia, fibroblasts, or melanocytes. The same was true in human cancers, including glioma, sarcoma, and melanoma. Similarly, IFN failed to attenuate transduction by the dependovirus vector adeno-associated virus type 2. Progeny production of parvoviruses was also unimpaired by IFN in both glioma and melanoma, whereas vesicular stomatitis virus replication was blocked. Sarcoma cells with upregulated IFN signaling that show high levels of resistance to other viruses showed strong infection by LuIII. Unlike many other oncolytic viruses, we found no evidence that impairment of innate immunity in cancer cells plays a role in the oncoselectivity of parvoviruses in human cells. Parvoviral resistance to the effects of IFN in cancer cells may constitute an advantage in the virotherapy of some tumors. Understanding the interactions between oncolytic viruses and the innate immune system will facilitate employing these viruses as therapeutic agents in cancer patients. The cancer

  13. Risk factors for discordant immune response among HIV-infected ...

    African Journals Online (AJOL)

    Risk factors for discordant immune response among HIV-infected patients initiating antiretroviral therapy: A retrospective cohort study. ... Multivariate logistic regression models were used to estimate adjusted odds ratios (AORs) to determine associations between discordant immune response and clinical and demographic ...

  14. SjCRT, a recombinant Schistosoma japonicum calreticulin, induces maturation of dendritic cells and a Th1-polarized immune response in mice

    Directory of Open Access Journals (Sweden)

    Lizhen Ma

    2017-11-01

    Full Text Available Abstract Background It is well known that immunization of radiation-attenuated (RA schistosoma cercariae or schistosomula can induce high levels of protective immunity against schistosoma cercariae reinfection in many animals. Many studies have shown that the Th1 cellular immune response is crucial for the protective effect elicited by RA schistosomula. However, the molecular mechanism of this strong protective immunity remains unclear. Methods The expression profiles of Schistosoma japonicum calreticulin (SjCRT in RA and normal schistosoma-derived cells were investigated by flow cytometry. The effect of recombinant SjCRT (rSjCRT on mouse dendritic cells (DCs was determined by FACS, ELISA and RT-PCR analysis. We also analyzed the effects of SjCRT on the activation of spleen cells from mice immunized with rSjCRT by detecting lymphocyte proliferation and the cytokine profiles of splenocytes. Results We found that the expression level of SjCRT in the cells from RA larvae was significantly higher than that in cells from normal schistosomula at early stages of development (day 4. The results of effect of rSjCRT on mouse DCs showed that rSjCRT could induce phenotypic and functional maturation of DCs, and SjCRT bound to the surface of DCs through the CD91 receptor and could be engulfed by DCs. The results of activation of splenocytes from mice immunized with rSjCRT also demonstrate that rSjCRT can effectively stimulate the proliferative response of splenic lymphocytes, elicit splenocytes from immunized mice to secrete high levels of IFN-γ, TNF-α and IL-4, and activate CD4+ T cells to produce high levels of IFN-γ. Conclusion SjCRT is one of the immunostimulatory molecules released from RA schistosomula cells, might play a crucial role in conferring a Th1-polarized immune response induced by RA cercariae/schistosomula in mice, and is a candidate molecule responsible for the high levels of protective immunity induced by RA schistosomula.

  15. Sex differences in immune responses: Hormonal effects, antagonistic selection, and evolutionary consequences.

    Science.gov (United States)

    Roved, Jacob; Westerdahl, Helena; Hasselquist, Dennis

    2017-02-01

    Males and females differ in both parasite load and the strength of immune responses and these effects have been verified in humans and other vertebrates. Sex hormones act as important modulators of immune responses; the male sex hormone testosterone is generally immunosuppressive while the female sex hormone estrogen tends to be immunoenhancing. Different sets of T-helper cells (Th) have important roles in adaptive immunity, e.g. Th1 cells trigger type 1 responses which are primarily cell-mediated, and Th2 cells trigger type 2 responses which are primarily humoral responses. In our review of the literature, we find that estrogen and progesterone enhance type 2 and suppress type 1 responses in females, whereas testosterone suppresses type 2 responses and shows an inconsistent pattern for type 1 responses in males. When we combine these patterns of generally immunosuppressive and immunoenhancing effects of the sex hormones, our results imply that the sex differences in immune responses should be particularly strong in immune functions associated with type 2 responses, and less pronounced with type 1 responses. In general the hormone-mediated sex differences in immune responses may lead to genetic sexual conflicts on immunity. Thus, we propose the novel hypothesis that sexually antagonistic selection may act on immune genes shared by the sexes, and that the strength of this sexually antagonistic selection should be stronger for type 2- as compared with type 1-associated immune genes. Finally, we put the consequences of sex hormone-induced effects on immune responses into behavioral and ecological contexts, considering social mating system, sexual selection, geographical distribution of hosts, and parasite abundance. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. CD8(+)NKT-like cells regulate the immune response by killing antigen-bearing DCs.

    Science.gov (United States)

    Wang, Chao; Liu, Xi; Li, Zhengyuan; Chai, Yijie; Jiang, Yunfeng; Wang, Qian; Ji, Yewei; Zhu, Zhongli; Wan, Ying; Yuan, Zhenglong; Chang, Zhijie; Zhang, Minghui

    2015-09-15

    CD1d-dependent NKT cells have been extensively studied; however, the function of CD8(+)NKT-like cells, which are CD1d-independent T cells with NK markers, remains unknown. Here, we report that CD1d-independent CD8(+)NKT-like cells, which express both T cell markers (TCRβ and CD3) and NK cell receptors (NK1.1, CD49b and NKG2D), are activated and significantly expanded in mice immunized with GFP-expressing dendritic cells. Distinct from CD1d-dependent NKT cells, CD8(+)NKT-like cells possess a diverse repertoire of TCRs and secrete high levels of IFN-gamma but not IL-4. CD8(+)NKT-like cell development is normal in CD1d(-/-) mice, which suggests that CD8(+)NKT-like cells undergo a unique development pathway that differs from iNKT cells. Further functional analyses show that CD8(+)NKT-like cells suppress T-cell responses through elimination of dendritic cells in an antigen-specific manner. Adoptive transfer of antigen-specific CD8(+)NKT-like cells into RIP-OVA mice prevented subsequent development of diabetes in the animals induced by activated OT-I CD8 T cells. Our study suggests that CD8(+)NKT-like cells can function as antigen-specific suppressive cells to regulate the immune response through killing antigen-bearing DCs. Antigen-specific down regulation may provide an active and precise method for constraining an excessive immune response and avoiding bypass suppression of necessary immune responses to other antigens.

  17. CD8+NKT-like cells regulate the immune response by killing antigen-bearing DCs

    Science.gov (United States)

    Wang, Chao; Liu, Xi; Li, Zhengyuan; Chai, Yijie; Jiang, Yunfeng; Wang, Qian; Ji, Yewei; Zhu, Zhongli; Wan, Ying; Yuan, Zhenglong; Chang, Zhijie; Zhang, Minghui

    2015-01-01

    CD1d-dependent NKT cells have been extensively studied; however, the function of CD8+NKT-like cells, which are CD1d-independent T cells with NK markers, remains unknown. Here, we report that CD1d-independent CD8+NKT-like cells, which express both T cell markers (TCRβ and CD3) and NK cell receptors (NK1.1, CD49b and NKG2D), are activated and significantly expanded in mice immunized with GFP-expressing dendritic cells. Distinct from CD1d-dependent NKT cells, CD8+NKT-like cells possess a diverse repertoire of TCRs and secrete high levels of IFN-gamma but not IL-4. CD8+NKT-like cell development is normal in CD1d−/− mice, which suggests that CD8+NKT-like cells undergo a unique development pathway that differs from iNKT cells. Further functional analyses show that CD8+NKT-like cells suppress T-cell responses through elimination of dendritic cells in an antigen-specific manner. Adoptive transfer of antigen-specific CD8+NKT-like cells into RIP-OVA mice prevented subsequent development of diabetes in the animals induced by activated OT-I CD8 T cells. Our study suggests that CD8+NKT-like cells can function as antigen-specific suppressive cells to regulate the immune response through killing antigen-bearing DCs. Antigen-specific down regulation may provide an active and precise method for constraining an excessive immune response and avoiding bypass suppression of necessary immune responses to other antigens. PMID:26369936

  18. A simple non-linear model of immune response

    International Nuclear Information System (INIS)

    Gutnikov, Sergei; Melnikov, Yuri

    2003-01-01

    It is still unknown why the adaptive immune response in the natural immune system based on clonal proliferation of lymphocytes requires interaction of at least two different cell types with the same antigen. We present a simple mathematical model illustrating that the system with separate types of cells for antigen recognition and patogen destruction provides more robust adaptive immunity than the system where just one cell type is responsible for both recognition and destruction. The model is over-simplified as we did not have an intention of describing the natural immune system. However, our model provides a tool for testing the proposed approach through qualitative analysis of the immune system dynamics in order to construct more sophisticated models of the immune systems that exist in the living nature. It also opens a possibility to explore specific features of highly non-linear dynamics in nature-inspired computational paradigms like artificial immune systems and immunocomputing . We expect this paper to be of interest not only for mathematicians but also for biologists; therefore we made effort to explain mathematics in sufficient detail for readers without professional mathematical background

  19. Systems biology of neutrophil differentiation and immune response

    DEFF Research Database (Denmark)

    Theilgaard-Mönch, Kim; Porse, Bo T; Borregaard, Niels

    2005-01-01

    Systems biology has emerged as a new scientific field, which aims at investigating biological processes at the genomic and proteomic levels. Recent studies have unravelled aspects of neutrophil differentiation and immune responses at the systems level using high-throughput technologies. These stu......Systems biology has emerged as a new scientific field, which aims at investigating biological processes at the genomic and proteomic levels. Recent studies have unravelled aspects of neutrophil differentiation and immune responses at the systems level using high-throughput technologies....... These studies have identified a plethora of novel effector proteins stored in the granules of neutrophils. In addition, these studies provide evidence that neutrophil differentiation and immune response are governed by a highly coordinated transcriptional programme that regulates cellular fate and function...

  20. A Drosophila immune response against Ras-induced overgrowth

    Directory of Open Access Journals (Sweden)

    Thomas Hauling

    2014-03-01

    Full Text Available Our goal is to characterize the innate immune response against the early stage of tumor development. For this, animal models where genetic changes in specific cells and tissues can be performed in a controlled way have become increasingly important, including the fruitfly Drosophila melanogaster. Many tumor mutants in Drosophila affect the germline and, as a consequence, also the immune system itself, making it difficult to ascribe their phenotype to a specific tissue. Only during the past decade, mutations have been induced systematically in somatic cells to study the control of tumorous growth by neighboring cells and by immune cells. Here we show that upon ectopic expression of a dominant-active form of the Ras oncogene (RasV12, both imaginal discs and salivary glands are affected. Particularly, the glands increase in size, express metalloproteinases and display apoptotic markers. This leads to a strong cellular response, which has many hallmarks of the granuloma-like encapsulation reaction, usually mounted by the insect against larger foreign objects. RNA sequencing of the fat body reveals a characteristic humoral immune response. In addition we also identify genes that are specifically induced upon expression of RasV12. As a proof-of-principle, we show that one of the induced genes (santa-maria, which encodes a scavenger receptor, modulates damage to the salivary glands. The list of genes we have identified provides a rich source for further functional characterization. Our hope is that this will lead to a better understanding of the earliest stage of innate immune responses against tumors with implications for mammalian immunity.

  1. Costs of mounting an immune response during pregnancy in a lizard.

    Science.gov (United States)

    Meylan, Sandrine; Richard, Murielle; Bauer, Sophie; Haussy, Claudy; Miles, Donald

    2013-01-01

    Immune defenses are of great benefit to hosts, but reducing the impact of infection by mounting an immune response also entails costs. However, the physiological mechanisms that generate the costs of an immune response remain poorly understood. Moreover, the majority of studies investigating the consequences of an immune challenge in vertebrates have been conducted on mammals and birds. The aim of this study is to investigate the physiological costs of mounting an immune response during gestation in an ectothermic species. Indeed, because ectothermic species are unable to internally regulate their body temperature, the apportionment of resources to homeostatic activities in ectothermic species can differ from that in endothermic species. We conducted this study on the common lizard Zootoca vivipara. We investigated the costs of mounting an immune response by injecting females with sheep red blood cells and quantified the consequences to reproductive performance (litter mass and success) and physiological performance (standard metabolic rate, endurance, and phytohemagglutinin response). In addition, we measured basking behavior. Our analyses revealed that mounting an immune response affected litter mass, physiological performance, and basking behavior. Moreover, we demonstrated that the modulation of an immune challenge is impacted by intrinsic factors, such as body size and condition.

  2. Wallerian degeneration: the innate-immune response to traumatic nerve injury

    Directory of Open Access Journals (Sweden)

    Rotshenker Shlomo

    2011-08-01

    Full Text Available Abstract Traumatic injury to peripheral nerves results in the loss of neural functions. Recovery by regeneration depends on the cellular and molecular events of Wallerian degeneration that injury induces distal to the lesion site, the domain through which severed axons regenerate back to their target tissues. Innate-immunity is central to Wallerian degeneration since innate-immune cells, functions and molecules that are produced by immune and non-immune cells are involved. The innate-immune response helps to turn the peripheral nerve tissue into an environment that supports regeneration by removing inhibitory myelin and by upregulating neurotrophic properties. The characteristics of an efficient innate-immune response are rapid onset and conclusion, and the orchestrated interplay between Schwann cells, fibroblasts, macrophages, endothelial cells, and molecules they produce. Wallerian degeneration serves as a prelude for successful repair when these requirements are met. In contrast, functional recovery is poor when injury fails to produce the efficient innate-immune response of Wallerian degeneration.

  3. Multiscale modeling of mucosal immune responses

    Science.gov (United States)

    2015-01-01

    Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut

  4. Multiscale modeling of mucosal immune responses.

    Science.gov (United States)

    Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep

    2015-01-01

    Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T

  5. Suppressive influences in the immune response to cancer.

    Science.gov (United States)

    Bronte, Vincenzo; Mocellin, Simone

    2009-01-01

    Although much evidence has been gathered demonstrating that immune effectors can play a significant role in controlling tumor growth under natural conditions or in response to therapeutic manipulation, it is clear that malignant cells do evade immune surveillance in most cases. Considering that anticancer active specific immunotherapy seems to have reached a plateau of results and that currently no vaccination regimen is indicated as a standard anticancer therapy, the dissection of the molecular events underlying tumor immune escape is the necessary condition to make anticancer vaccines a therapeutic weapon effective enough to be implemented in the routine clinical setting. Recent years have witnessed significant advances in our understanding of the molecular mechanisms underlying tumor immune escape. These mechanistic insights are fostering the development of rationally designed therapeutics aimed to revert the immunosuppressive circuits that undermine an effective antitumor immune response. In this review, the best characterized mechanisms that allow cancer cells to evade immune surveillance are overviewed and the most debated controversies constellating this complex field are highlighted.

  6. Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis.

    Science.gov (United States)

    Lemieux, Maxime W; Sonzogni-Desautels, Karine; Ndao, Momar

    2017-12-24

    In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between T H 1/T H 2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.

  7. The Role of the Immune Response in Merkel Cell Carcinoma

    International Nuclear Information System (INIS)

    Triozzi, Pierre L.; Fernandez, Anthony P.

    2013-01-01

    Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer. The Merkel cell polyomavirus (MCPyV) is implicated in its pathogenesis. Immune mechanisms are also implicated. Patients who are immunosuppressed have an increased risk. There is evidence that high intratumoral T-cell counts and immune transcripts are associated with favorable survival. Spontaneous regressions implicate immune effector mechanisms. Immunogenicity is also supported by observation of autoimmune paraneoplastic syndromes. Case reports suggest that immune modulation, including reduction of immune suppression, can result in tumor regression. The relationships between MCPyV infection, the immune response, and clinical outcome, however, remain poorly understood. Circulating antibodies against MCPyV antigens are present in most individuals. MCPyV-reactive T cells have been detected in both MCC patients and control subjects. High intratumoral T-cell counts are also associated with favorable survival in MCPyV-negative MCC. That the immune system plays a central role in preventing and controlling MCC is supported by several observations. MCCs often develop, however, despite the presence of humoral and cellular immune responses. A better understanding on how MCPyV and MCC evade the immune response will be necessary to develop effective immunotherapies

  8. The Role of the Immune Response in Merkel Cell Carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Triozzi, Pierre L., E-mail: triozzp@ccf.org [Taussig Cancer Institute, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195 (United States); Fernandez, Anthony P. [Departments of Dermatology and Anatomic Pathology, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195 (United States)

    2013-02-28

    Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer. The Merkel cell polyomavirus (MCPyV) is implicated in its pathogenesis. Immune mechanisms are also implicated. Patients who are immunosuppressed have an increased risk. There is evidence that high intratumoral T-cell counts and immune transcripts are associated with favorable survival. Spontaneous regressions implicate immune effector mechanisms. Immunogenicity is also supported by observation of autoimmune paraneoplastic syndromes. Case reports suggest that immune modulation, including reduction of immune suppression, can result in tumor regression. The relationships between MCPyV infection, the immune response, and clinical outcome, however, remain poorly understood. Circulating antibodies against MCPyV antigens are present in most individuals. MCPyV-reactive T cells have been detected in both MCC patients and control subjects. High intratumoral T-cell counts are also associated with favorable survival in MCPyV-negative MCC. That the immune system plays a central role in preventing and controlling MCC is supported by several observations. MCCs often develop, however, despite the presence of humoral and cellular immune responses. A better understanding on how MCPyV and MCC evade the immune response will be necessary to develop effective immunotherapies.

  9. Early-life inflammation, immune response and ageing.

    Science.gov (United States)

    Khan, Imroze; Agashe, Deepa; Rolff, Jens

    2017-03-15

    Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. © 2017 The Author(s).

  10. 17D yellow fever vaccine elicits comparable long-term immune responses in healthy individuals and immune-compromised patients

    NARCIS (Netherlands)

    Wieten, R. W.; Goorhuis, A.; Jonker, E. F. F.; de Bree, G. J.; de Visser, A. W.; van Genderen, P. J. J.; Remmerswaal, E. B. M.; ten Berge, I. J. M.; Visser, L. G.; Grobusch, M. P.; van Leeuwen, E. M. M.

    2016-01-01

    The 17D live attenuated yellow fever (YF) vaccine is contra-indicated in immune-compromised individuals and may elicit a suboptimal immunologic response. The aim of this study is to assess whether long-term immune responses against the YF vaccine are impaired in immune-compromised patients. Fifteen

  11. Ovine model for studying pulmonary immune responses

    International Nuclear Information System (INIS)

    Joel, D.D.; Chanana, A.D.

    1984-01-01

    Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with 125 I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables

  12. Ovine model for studying pulmonary immune responses

    Energy Technology Data Exchange (ETDEWEB)

    Joel, D.D.; Chanana, A.D.

    1984-11-25

    Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with /sup 125/I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables.

  13. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens.

    OpenAIRE

    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H

    1994-01-01

    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The...

  14. Innate Immune Responses in Leprosy

    Science.gov (United States)

    Pinheiro, Roberta Olmo; Schmitz, Veronica; Silva, Bruno Jorge de Andrade; Dias, André Alves; de Souza, Beatriz Junqueira; de Mattos Barbosa, Mayara Garcia; de Almeida Esquenazi, Danuza; Pessolani, Maria Cristina Vidal; Sarno, Euzenir Nunes

    2018-01-01

    Leprosy is an infectious disease that may present different clinical forms depending on host immune response to Mycobacterium leprae. Several studies have clarified the role of various T cell populations in leprosy; however, recent evidences suggest that local innate immune mechanisms are key determinants in driving the disease to its different clinical manifestations. Leprosy is an ideal model to study the immunoregulatory role of innate immune molecules and its interaction with nervous system, which can affect homeostasis and contribute to the development of inflammatory episodes during the course of the disease. Macrophages, dendritic cells, neutrophils, and keratinocytes are the major cell populations studied and the comprehension of the complex networking created by cytokine release, lipid and iron metabolism, as well as antimicrobial effector pathways might provide data that will help in the development of new strategies for leprosy management. PMID:29643852

  15. Preexisting Salmonella-specific immunity interferes with the subsequent development of immune responses against the Salmonella strains delivering H9N2 hemagglutinin.

    Science.gov (United States)

    Hajam, Irshad Ahmed; Lee, John Hwa

    2017-06-01

    Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (pSalmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (pSalmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight

    Science.gov (United States)

    Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila

    2011-01-01

    Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297

  17. Innate immune responses of Drosophila melanogaster are altered by spaceflight.

    Directory of Open Access Journals (Sweden)

    Oana Marcu

    2011-01-01

    Full Text Available Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways.

  18. Quantitating cellular immune responses to cancer vaccines.

    Science.gov (United States)

    Lyerly, H Kim

    2003-06-01

    While the future of immunotherapy in the treatment of cancer is promising, it is difficult to compare the various approaches because monitoring assays have not been standardized in approach or technique. Common assays for measuring the immune response need to be established so that these assays can one day serve as surrogate markers for clinical response. Assays that accurately detect and quantitate T-cell-mediated, antigen-specific immune responses are particularly desired. However, to date, increases in the number of cytotoxic T cells through immunization have not been correlated with clinical tumor regression. Ideally, then, a T-cell assay not only needs to be sensitive, specific, reliable, reproducible, simple, and quick to perform, it must also demonstrate close correlation with clinical outcome. Assays currently used to measure T-cell response are delayed-type hypersensitivity testing, flow cytometry using peptide major histocompatibility complex tetramers, lymphoproliferation assay, enzyme-linked immunosorbant assay, enzyme-linked immunospot assay, cytokine flow cytometry, direct cytotoxicity assay, measurement of cytokine mRNA by quantitative reverse transcriptase polymerase chain reaction, and limiting dilution analysis. The purpose of this review is to describe the attributes of each test and compare their advantages and disadvantages.

  19. Immune responses in cattle vaccinated with gamma-irradiated Anaplasma marginale

    International Nuclear Information System (INIS)

    Sharma, S.P.; Bansal, G.C.

    1986-01-01

    The infectivity and immunogenecity of gamma-irradiated Anaplasma marginale organisms were studied in bovine calves. The severity of Anaplasma infection based on per cent infected red blood cells, haematological values and mortality was more in animals immunized with blood exposed to 60 kR in comparison to those inoculated with blood irradiated at 70, 80 and 90 kR. The immunizing controls demonstrated a significantly high parasitaemia, marked anaemia and more deaths. Marked and prolonged cell-mediated and humoral immune responses detectable in the first 3 weeks of post-immunization may be responsible for conferring of protective immunity. (author)

  20. Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis

    Directory of Open Access Journals (Sweden)

    Maxime W. Lemieux

    2017-12-01

    Full Text Available In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between TH1/TH2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.

  1. Optimal approximation of linear systems by artificial immune response

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    This paper puts forward a novel artificial immune response algorithm for optimal approximation of linear systems. A quaternion model of artificial immune response is proposed for engineering computing. The model abstracts four elements, namely, antigen, antibody, reaction rules among antibodies, and driving algorithm describing how the rules are applied to antibodies, to simulate the process of immune response. Some reaction rules including clonal selection rules, immunological memory rules and immune regulation rules are introduced. Using the theorem of Markov chain, it is proofed that the new model is convergent. The experimental study on the optimal approximation of a stable linear system and an unstable one show that the approximate models searched by the new model have better performance indices than those obtained by some existing algorithms including the differential evolution algorithm and the multi-agent genetic algorithm.

  2. Host translational inhibition by Pseudomonas aeruginosa Exotoxin A Triggers an immune response in Caenorhabditis elegans.

    Science.gov (United States)

    McEwan, Deborah L; Kirienko, Natalia V; Ausubel, Frederick M

    2012-04-19

    Intestinal epithelial cells are exposed to both innocuous and pathogenic microbes, which need to be distinguished to mount an effective immune response. To understand the mechanisms underlying pathogen recognition, we investigated how Pseudomonas aeruginosa triggers intestinal innate immunity in Caenorhabditis elegans, a process independent of Toll-like pattern recognition receptors. We show that the P. aeruginosa translational inhibitor Exotoxin A (ToxA), which ribosylates elongation factor 2 (EF2), upregulates a significant subset of genes normally induced by P. aeruginosa. Moreover, immune pathways involving the ATF-7 and ZIP-2 transcription factors, which protect C. elegans from P. aeruginosa, are required for preventing ToxA-mediated lethality. ToxA-responsive genes are not induced by enzymatically inactive ToxA protein but can be upregulated independently of ToxA by disruption of host protein translation. Thus, C. elegans has a surveillance mechanism to recognize ToxA through its effect on protein translation rather than by direct recognition of either ToxA or ribosylated EF2. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Future targets for immune therapy in colitis?

    DEFF Research Database (Denmark)

    Kristensen, Nanna Ny; Claesson, M H

    2008-01-01

    Crohn's disease and Ulcerative Colitis, collectively termed inflammatory bowel disease (IBD), are chronic inflammatory disorders of the bowel. It is generally accepted that the pathology associated with IBD is characterized by a hyper-reactive immune response in the gut wall directed against...... the commensal intestinal bacterial flora, and that the CD4+ T cells dominate the adaptive immune response. Chemokines are small proteins involved in the guidance of migration of immune cells during normal homeostasis and inflammation. Chemokines have been shown to play a central role in recruiting inflammatory...... cells from congenic normal mice are transplanted into immune deficient mice, which in turn develop a chronic lethal colitis within 1-2 months. By simultaneous transplantation of CD4+CD25+ regulatory T cells (Tregs) it is possible to hinder development of colitis. Thus the model is well suited...

  4. The role of radiotherapy for the induction of antitumor immune responses

    International Nuclear Information System (INIS)

    Multhoff, G.; Helmholtz-Zentrum Muenchen; Gaipl, U.S.; Niedermann, G.

    2012-01-01

    Effective radiotherapy is aimed to control the growth of the primary carcinoma and to induce a long-term specific antitumor immune response against the primary tumor, recurrence and metastases. The contribution covers the following issues: T cells and tumor specific immune responses, dendritic cells (DCs) start adaptive immune responses, NK (natural killer) cells for HLA independent tumor control, abscopal effects of radiotherapy, combination of radiotherapy and immune therapy, radiotherapy contribution to the induction of immunogenic cell death, combinability of radiotherapy and DC activation, combinability of radiotherapy and NK cell therapy. It turns out that the combination of radio-chemotherapy and immune therapy can change the microenvironment initiating antitumor immune reactions that inhibit the recurrence risk and the development of metastases.

  5. Immune responses to hair dyes containing toluene-2,5-diamine

    DEFF Research Database (Denmark)

    Schmidt, J D; Johansen, J D; Nielsen, M M

    2014-01-01

    BACKGROUND: Toluene-2,5-diamine (PTD) is the most frequently used dye in oxidative hair dyes on the Scandinavian market. However, little is known about immune responses to PTD-containing oxidative hair dyes. OBJECTIVES: To study immune responses induced by PTD-containing hair dyes in mice. METHODS......: Immune responses against two different permanent hair dye products containing 1·60% (w/w) and 0·48% (w/w) PTD within the colour gel, and various concentrations of pure PTD were studied. The local inflammatory response was measured by ear swelling and cell infiltration, and T- and B-cell infiltration...... and proliferation was determined in the draining lymph nodes. RESULTS: Concentration-dependent immune responses were seen to PTD both in the skin and draining lymph nodes. The hair dye containing 1·60% PTD induced strong local inflammation and caused T- and B-cell infiltration and proliferation as well...

  6. Trachoma: protective and pathogenic ocular immune responses to Chlamydia trachomatis.

    Directory of Open Access Journals (Sweden)

    Victor H Hu

    Full Text Available Trachoma, caused by Chlamydia trachomatis (Ct, is the leading infectious blinding disease worldwide. Chronic conjunctival inflammation develops in childhood and leads to eyelid scarring and blindness in adulthood. The immune response to Ct provides only partial protection against re-infection, which can be frequent. Moreover, the immune response is central to the development of scarring pathology, leading to loss of vision. Here we review the current literature on both protective and pathological immune responses in trachoma. The resolution of Ct infection in animal models is IFNγ-dependent, involving Th1 cells, but whether this is the case in human ocular infection still needs to be confirmed. An increasing number of studies indicate that innate immune responses arising from the epithelium and other innate immune cells, along with changes in matrix metalloproteinase activity, are important in the development of tissue damage and scarring. Current trachoma control measures, which are centred on repeated mass antibiotic treatment of populations, are logistically challenging and have the potential to drive antimicrobial resistance. A trachoma vaccine would offer significant advantages. However, limited understanding of the mechanisms of both protective immunity and immunopathology to Ct remain barriers to vaccine development.

  7. Bovine anaplasmosis with emphasis on immune responses and protection

    International Nuclear Information System (INIS)

    Ristic, M.

    1980-01-01

    Anaplasmosis is an infectious and transmissible disease manifested by progressive anaemia and the appearance of other characteristic disease symptoms. It is a world-wide tick-borne disease of cattle and some wild ruminants caused by the rickettsia Anaplasma marginale. By drawing on information obtained from studies of plasmodial cell cultures, a method has recently been developed for short-term in vitro cultivation of A. marginale. An attenuated Anaplasma organism capable of growth in both ovine and bovine erythrocytes was used to demonstrate that the in vitro system provided the necessary requirements for active transfer of the organism from cell to cell. Organismal antigens are found in the erythrocytes of infected animals, whereas soluble antigens are derived from their erythrocytes and serum. Serums from convalescing animals interact with these antigens in agglutination, complement fixation, fluorescent antibody and precipitation tests. Passive transfer of sera from immune to susceptible cattle, however, does not seem to confer protection against the infection and development of the disease. Studies that employed various tests for measuring cell-mediated immune (CMI) responses (leukocyte migration inhibition, blast transformation and cytotoxicity), in association with information collected simultaneously on antibody activity, have shown that both humoral and cellular immune responses are needed for the development of protective immunity in anaplasmosis. It was further shown that an active replication of Anaplasma is essential for induction of these two types of immune responses. Consequently, live virulent and attenuated immunogens fulfil requirements for induction of protective immunity. With the virulent agent, however, development of protective immunity is preceded by induction of auto-immune responses apparently associated with pathogenesis of anaemia in anaplasmosis. Inactivated immunogens derived from blood of infected cattle and used in combination with

  8. Anopheles gambiae antiviral immune response to systemic O'nyong-nyong infection.

    Directory of Open Access Journals (Sweden)

    Joanna Waldock

    Full Text Available Mosquito-borne viral diseases cause significant burden in much of the developing world. Although host-virus interactions have been studied extensively in the vertebrate host, little is known about mosquito responses to viral infection. In contrast to mosquitoes of the Aedes and Culex genera, Anopheles gambiae, the principal vector of human malaria, naturally transmits very few arboviruses, the most important of which is O'nyong-nyong virus (ONNV. Here we have investigated the A. gambiae immune response to systemic ONNV infection using forward and reverse genetic approaches.We have used DNA microarrays to profile the transcriptional response of A. gambiae inoculated with ONNV and investigate the antiviral function of candidate genes through RNAi gene silencing assays. Our results demonstrate that A. gambiae responses to systemic viral infection involve genes covering all aspects of innate immunity including pathogen recognition, modulation of immune signalling, complement-mediated lysis/opsonisation and other immune effector mechanisms. Patterns of transcriptional regulation and co-infections of A. gambiae with ONNV and the rodent malaria parasite Plasmodium berghei suggest that hemolymph immune responses to viral infection are diverted away from melanisation. We show that four viral responsive genes encoding two putative recognition receptors, a galectin and an MD2-like receptor, and two effector lysozymes, function in limiting viral load.This study is the first step in elucidating the antiviral mechanisms of A. gambiae mosquitoes, and has revealed interesting differences between A. gambiae and other invertebrates. Our data suggest that mechanisms employed by A. gambiae are distinct from described invertebrate antiviral immunity to date, and involve the complement-like branch of the humoral immune response, supressing the melanisation response that is prominent in anti-parasitic immunity. The antiviral immune response in A. gambiae is thus

  9. Dynamics of immune system vulnerabilities

    Science.gov (United States)

    Stromberg, Sean P.

    The adaptive immune system can be viewed as a complex system, which adapts, over time, to reflect the history of infections experienced by the organism. Understanding its operation requires viewing it in terms of tradeoffs under constraints and evolutionary history. It typically displays "robust, yet fragile" behavior, meaning common tasks are robust to small changes but novel threats or changes in environment can have dire consequences. In this dissertation we use mechanistic models to study several biological processes: the immune response, the homeostasis of cells in the lymphatic system, and the process that normally prevents autoreactive cells from entering the lymphatic system. Using these models we then study the effects of these processes interacting. We show that the mechanisms that regulate the numbers of cells in the immune system, in conjunction with the immune response, can act to suppress autoreactive cells from proliferating, thus showing quantitatively how pathogenic infections can suppress autoimmune disease. We also show that over long periods of time this same effect can thin the repertoire of cells that defend against novel threats, leading to an age correlated vulnerability. This vulnerability is shown to be a consequence of system dynamics, not due to degradation of immune system components with age. Finally, modeling a specific tolerance mechanism that normally prevents autoimmune disease, in conjunction with models of the immune response and homeostasis we look at the consequences of the immune system mistakenly incorporating pathogenic molecules into its tolerizing mechanisms. The signature of this dynamic matches closely that of the dengue virus system.

  10. Mechanisms Underlying the Immune Response Generated by an Oral Vibrio cholerae Vaccine

    Directory of Open Access Journals (Sweden)

    Danylo Sirskyj

    2016-07-01

    Full Text Available Mechanistic details underlying the resulting protective immune response generated by mucosal vaccines remain largely unknown. We investigated the involvement of Toll-like receptor signaling in the induction of humoral immune responses following oral immunization with Dukoral, comparing wild type mice with TLR-2-, TLR-4-, MyD88- and Trif-deficient mice. Although all groups generated similar levels of IgG antibodies, the proliferation of CD4+ T-cells in response to V. cholerae was shown to be mediated via MyD88/TLR signaling, and independently of Trif signaling. The results demonstrate differential requirements for generation of immune responses. These results also suggest that TLR pathways may be modulators of the quality of immune response elicited by the Dukoral vaccine. Determining the critical signaling pathways involved in the induction of immune response to this vaccine would be beneficial, and could contribute to more precisely-designed versions of other oral vaccines in the future.

  11. Anterior Chamber-Associated Immune Deviation (ACAID: An Acute Response to Ocular Insult Protects from Future Immune-Mediated Damage?

    Directory of Open Access Journals (Sweden)

    Robert E. Cone

    2009-01-01

    Full Text Available The “immune privilege” that inhibits immune defense mechanisms that could lead to damage to sensitive ocular tissue is based on the expression of immunosuppressive factors on ocular tissue and in ocular fluids. In addition to this environmental protection, the injection of antigen into the anterior chamber or infection in the anterior chamber induces a systemic suppression of potentially damaging cell-mediated and humoral responses to the antigen. Here we discuss evidence that suggests that Anterior Chamber-Associated Immune Deviation (ACAID a is initiated by an ocular response to moderate inflammation that leads to a systemic immunoregulatory response. Injection into the anterior chamber induces a rise in TNF-α and MCP-1 in aqueous humor and an infiltration of circulating F4/80 + monocytes that home to the iris. The induction of ACAID is dependent on this infiltration of circulating monocytes that eventually emigrate to the thymus and spleen where they induce regulatory T cells that inhibit the inductive or effector phases of a cell-mediated immune response. ACAID therefore protects the eye from the collateral damage of an immune response to infection by suppressing a future potentially damaging response to infection.

  12. Pretreatment antigen-specific immunity and regulation - association with subsequent immune response to anti-tumor DNA vaccination.

    Science.gov (United States)

    Johnson, Laura E; Olson, Brian M; McNeel, Douglas G

    2017-07-18

    Immunotherapies have demonstrated clinical benefit for many types of cancers, however many patients do not respond, and treatment-related adverse effects can be severe. Hence many efforts are underway to identify treatment predictive biomarkers. We have reported the results of two phase I trials using a DNA vaccine encoding prostatic acid phosphatase (PAP) in patients with biochemically recurrent prostate cancer. In both trials, persistent PAP-specific Th1 immunity developed in some patients, and this was associated with favorable changes in serum PSA kinetics. In the current study, we sought to determine if measures of antigen-specific or antigen non-specific immunity were present prior to treatment, and associated with subsequent immune response, to identify possible predictive immune biomarkers. Patients who developed persistent PAP-specific, IFNγ-secreting immune responses were defined as immune "responders." The frequency of peripheral T cell and B cell lymphocytes, natural killer cells, monocytes, dendritic cells, myeloid derived suppressor cells, and regulatory T cells were assessed by flow cytometry and clinical laboratory values. PAP-specific immune responses were evaluated by cytokine secretion in vitro, and by antigen-specific suppression of delayed-type hypersensitivity to a recall antigen in an in vivo SCID mouse model. The frequency of peripheral blood cell types did not differ between the immune responder and non-responder groups. Non-responder patients tended to have higher PAP-specific IL-10 production pre-vaccination (p = 0.09). Responder patients had greater preexisting PAP-specific bystander regulatory responses that suppressed DTH to a recall antigen (p = 0.016). While our study population was small (n = 38), these results suggest that different measures of antigen-specific tolerance or regulation might help predict immunological outcome from DNA vaccination. These will be prospectively evaluated in an ongoing randomized, phase II trial.

  13. SOCS2 and SOCS3 expression in ulcerative colitis and their correlation with inflammatory response and immune response

    Directory of Open Access Journals (Sweden)

    Le Huang1

    2017-05-01

    Full Text Available Objective: To study the correlation of SOCS2 and SOCS3 expression in ulcerative colitis tissue with inflammatory response and immune response. Methods: Ulcerative colitis lesions and normal mucosa from colonoscopic biopsy in Central Hospital of Zibo Mining Refco Group Ltd between May 2014 and July 2016 were selected and enrolled in UC group and control group respectively. RNA was extracted to determine mRNA expression of SOCS2 and SOCS3 as well as inflammatory response JAKs/STATs pathway molecules; protein was extracted to determine the contents of immune response cytokines. Results: SOCS2 mRNA expression in intestinal mucosa of UC group was not significantly different from that of control group, and SOCS3 mRNA expression was significantly lower than that of control group; JAK1, JAK2, JAK3, STAT1, STAT3 and STAT5 mRNA expression as well as IFN-γ and IL-17 protein contents in intestinal mucosa of UC group were significantly higher than those of control group while IL-4 and IL-10 protein contents were significantly lower than those of control group; JAK1, JAK2, JAK3, STAT1, STAT3 and STAT5 mRNA expression as well as IFN-γ and IL-17 protein contents in UC group of intestinal mucosa with low SOCS3 expression were significantly higher than those of intestinal mucosa with high SOCS3 expression while IL-4 and IL-10 protein contents were significantly lower than those of intestinal mucosa with high SOCS3 expression. Conclusion: Low expression of SOCS3 in ulcerative colitis can aggravate the inflammatory reaction and cause the imbalance of Th1/Th2 and Th17/Treg immune response.

  14. Aberrant Pregnancy Adaptations in the Peripheral Immune Response in Type 1 Diabetes: A Rat Model.

    Directory of Open Access Journals (Sweden)

    Bart Groen

    Full Text Available Despite tight glycemic control, pregnancy complication rate in type 1 diabetes patients is higher than in normal pregnancy. Other etiological factors may be responsible for the development of adverse pregnancy outcome. Acceptance of the semi-allogeneic fetus is accompanied by adaptations in the maternal immune-response. Maladaptations of the immune-response has been shown to contribute to pregnancy complications. We hypothesized that type 1 diabetes, as an autoimmune disease, may be associated with maladaptations of the immune-response to pregnancy, possibly resulting in pregnancy complications.We studied pregnancy outcome and pregnancy-induced immunological adaptations in a normoglycemic rat-model of type 1 diabetes, i.e. biobreeding diabetes-prone rats (BBDP; 5 non-pregnant rats, 7 pregnant day 10 rats and 6 pregnant day 18 rats , versus non-diabetic control rats (i.e. congenic non-diabetic biobreeding diabetes-resistant (BBDR; 6 non-pregnant rats, 6 pregnant day 10 rats and 6 pregnant day 18 rats and Wistar-rats (6 non-pregnant, 6 pregnant day 10 rats and 5 pregnant day 18 rats.We observed reduced litter size, lower fetal weight of viable fetuses and increased numbers of resorptions versus control rats. These complications are accompanied by various differences in the immune-response between BBDP and control rats in both pregnant and non-pregnant animals. The immune-response in non-pregnant BBDP-rats was characterized by decreased percentages of lymphocytes, increased percentages of effector T-cells, regulatory T-cells and natural killer cells, an increased Th1/Th2-ratio and activated monocytes versus Wistar and BBDR-rats. Furthermore, pregnancy-induced adaptations in BBDP-rats coincided with an increased Th1/Th2-ratio, a decreased mean fluorescence intensity CD161a/NKR-P1b ratio and no further activation of monocytes versus non-diabetic control rats.This study suggests that even in the face of strict normoglycemia, pregnancy complications

  15. Reprogramming Antitumor Immune Responses with microRNAs

    Science.gov (United States)

    2013-10-01

    disease, including cancer etiology (4) and the generation and inhibition of antitumor immune responses (5–9). Biologically active miRNAs bind to MREs...breast, colorectal, lung, pancreatic , and thyroid carcinomas and in liquid tumors including lymphomas and some acute myeloid leukemias (9, 35). The...immunity [9], underscoring the potential of targeting this major microenvironmental compartment. Accumulating evidence suggests that chronic

  16. Heavy metal pollution disturbs immune response in wild ant populations

    International Nuclear Information System (INIS)

    Sorvari, Jouni; Rantala, Liisa M.; Rantala, Markus J.; Hakkarainen, Harri; Eeva, Tapio

    2007-01-01

    Concern about the effects of environmental contaminants on immune function in both humans and wildlife is growing and practically nothing is known about this impact on terrestrial invertebrates, even though they are known to easily accumulate pollutants. We studied the effect of industrial heavy metal contamination on immune defense of a free-living wood ant (Formica aquilonia). To find out whether ants show an adapted immune function in a polluted environment, we compared encapsulation responses between local and translocated colonies. Local colonies showed higher heavy metal levels than the translocated ones but the encapsulation response was similar between the two groups, indicating that the immune system of local ants has not adapted to high contamination level. The encapsulation response was elevated in moderate whereas suppressed in high heavy metal levels suggesting higher risk for infections in heavily polluted areas. - Heavy metal pollution affects immune function in ants

  17. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus.

    Science.gov (United States)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete

    2009-07-30

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.

  18. Immune Response to Dengue and Zika.

    Science.gov (United States)

    Ngono, Annie Elong; Shresta, Sujan

    2018-04-26

    Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.

  19. Skin immunization by microneedle patch overcomes statin-induced suppression of immune responses to influenza vaccine.

    Science.gov (United States)

    Vassilieva, Elena V; Wang, Shelly; Li, Song; Prausnitz, Mark R; Compans, Richard W

    2017-12-19

    Recent studies indicated that in elderly individuals, statin therapy is associated with a reduced response to influenza vaccination. The present study was designed to determine effects on the immune response to influenza vaccination induced by statin administration in a mouse model, and investigate potential approaches to improve the outcome of vaccination on the background of statin therapy. We fed middle aged BALB/c mice a high fat "western" diet (WD) alone or supplemented with atorvastatin (AT) for 14 weeks, and control mice were fed with the regular rodent diet. Mice were immunized with a single dose of subunit A/Brisbane/59/07 (H1N1) vaccine, either systemically or with dissolving microneedle patches (MNPs). We observed that a greater age-dependent decline in the hemagglutinin inhibition titers occurred in systemically-immunized mice than in MNP- immunized mice. AT dampened the antibody response in the animals vaccinated by either route of vaccine delivery. However, the MNP-vaccinated AT-treated animals had ~20 times higher total antibody levels to the influenza vaccine than the systemically vaccinated group one month postvaccination. We propose that microneedle vaccination against influenza provides an approach to ameliorate the immunosuppressive effect of statin therapy observed with systemic immunization.

  20. The human immune response to streptococcal extracellular antigens: clinical, diagnostic, and potential pathogenetic implications.

    Science.gov (United States)

    Johnson, Dwight R; Kurlan, Roger; Leckman, James; Kaplan, Edward L

    2010-02-15

    Determination of an immune response to group A Streptococcus (GAS) antigens, frequently anti-streptolysin O and anti-DNase B, is crucial for documentation of bona fide GAS infection. Although the importance of immunologic confirmation of infection is widely accepted, the immediate and long-term immunokinetics of the human antibody response are incompletely documented and poorly understood. Pediatric study participants (n = 160) were followed during a 2-year study with monthly throat cultures (n = 3491) and blood samples (n = 1679) obtained every 13 weeks. Recovered GAS were characterized; serum anti-streptolysin O and anti-DNase B antibody titers were determined. Antibody titers and GAS culture results were temporally correlated and analyzed. The analyses clearly document, in some instances for the first time, that an increase in antibody titer more accurately defines infection than does an absolute titer (eg, "upper limit of normal"), that antibody titers can remain elevated for many months even without GAS, and that some individuals may harbor GAS continuously for months or years without symptoms of infection and without an associated immune response. Measuring 2 different antibodies is more accurate in defining infection. Single time-point cultures and single antibody titers are often misleading. Sequential samples more accurately define infection, allowing correlation of titer increases with temporal confirmation of GAS acquisition. Understanding kinetics of the immune response(s) to GAS infection is necessary in formulating accurate clinical diagnostic conclusions, to appropriate design of clinical and epidemiological studies examining the association of GAS with subsequent sequelae, and to providing insight into pathogenetic mechanisms associated with this important human pathogen.

  1. Eosinophils in mucosal immune responses

    Science.gov (United States)

    Travers, J; Rothenberg, M E

    2015-01-01

    Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184

  2. Functional characterization of Foxp3-specific spontaneous immune responses

    DEFF Research Database (Denmark)

    Larsen, Susanne Købke; Munir, S; Andersen, Anders Woetmann

    2013-01-01

    Tumor-infiltrating CD4+CD25+ regulatory T cells (Tregs) are associated with an impaired prognosis in several cancers. The transcription factor forkhead box P3 (Foxp3) is generally expressed in Tregs. Here, we identify and characterize spontaneous cytotoxic immune responses to Foxp3-expressing cel....... Consequently, induction of Foxp3-specific cytotoxic T-cell responses appears as an attractive tool to boost spontaneous or therapeutically provoked immune responses, for example, for the therapy of cancer....

  3. A multiherbal formulation influencing immune response in vitro.

    Science.gov (United States)

    Menghini, L; Leporini, L; Scanu, N; Pintore, G; Ferrante, C; Recinella, L; Orlando, G; Vacca, M; Brunetti, L

    2012-02-01

    Aim of this study was to evaluate the effects of phytocomplexes of Uncaria, Shiitake and Ribes in terms of viability and inflammatory response on immune cell-derived cultures. Standardized extracts of Uncaria, Shitake and Ribes and their commercial formulation were tested on cell lines PBMC, U937 and macrophage. The activity was evaluated in terms of cell viability (MTT test), variations of oxidative marker release (ROS and PGE2) and modulatory effects on immune response (gene expression of IL-6, IL-8 and TNFα, RT-PCR). Cell viability was not affected by extracts, except subtle variations observed only at higher doses (>250 µg/mL). The extract mixture was well tolerated, with no effects on cell viability up to doses of 500 µg/mL. Pre-treatment of macrophages with subtoxic doses of the extracts reduced the basal release of oxidative markers and enhanced the cell response to exogenous oxidant stimulation, as revealed by ROS and PGE2 release reduction. The same treatment on macrophage resulted in a selective modulation of the immune response, as shown by an increase of IL-6 mRNA and, partially, IL-8 mRNA, while a reduction was observed for TNFα mRNA. Data confirm that extracts and their formulations can act as regulator of the immune system with mechanisms involving the oxidative stress and the release of selected proinflammatory cytokines.

  4. DNA Damage Response and Immune Defence: Links and Mechanisms

    Directory of Open Access Journals (Sweden)

    Björn Schumacher

    2016-08-01

    Full Text Available DNA damage plays a causal role in numerous human pathologies including cancer, premature aging and chronic inflammatory conditions. In response to genotoxic insults, the DNA damage response (DDR orchestrates DNA damage checkpoint activation and facilitates the removal of DNA lesions. The DDR can also arouse the immune system by for example inducing the expression of antimicrobial peptides as well as ligands for receptors found on immune cells. The activation of immune signalling is triggered by different components of the DDR including DNA damage sensors, transducer kinases, and effectors. In this review, we describe recent advances on the understanding of the role of DDR in activating immune signalling. We highlight evidence gained into (i which molecular and cellular pathways of DDR activate immune signalling, (ii how DNA damage drives chronic inflammation, and (iii how chronic inflammation causes DNA damage and pathology in humans.

  5. Pathogen recognition in the innate immune response.

    Science.gov (United States)

    Kumar, Himanshu; Kawai, Taro; Akira, Shizuo

    2009-04-28

    Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.

  6. Modulation of the immune response by emotional stress

    NARCIS (Netherlands)

    Croiset, G; Heijnen, C J; Veldhuis, H D; de Wied, D; Ballieux, R E

    1987-01-01

    The influence of mild, emotional stress was investigated for its effect on the immune system by subjecting rats to the one-trial-learning passive avoidance test. The reactivity of the immune system was tested by determining the proliferative response after mitogenic stimulation in vitro as well as

  7. The sterile immune response during hepatic ischemia/reperfusion

    NARCIS (Netherlands)

    van Golen, Rowan F.; van Gulik, Thomas M.; Heger, Michal

    2012-01-01

    Hepatic ischemia and reperfusion elicits an immune response that lacks a microbial constituent yet poses a potentially lethal threat to the host. In this sterile setting, the immune system is alarmed by endogenous danger signals that are release by stressed and dying liver cells. The detection of

  8. Inflammatory cytokines in the brain: does the CNS shape immune responses?

    Science.gov (United States)

    Owens, T; Renno, T; Taupin, V; Krakowski, M

    1994-12-01

    Immune responses in the central nervous system (CNS) have traditionally been regarded as representing the intrusion of an unruly, ill-behaved mob of leukocytes into the well-ordered and organized domain of thought and reason. However, results accumulated over the past few years suggest that, far from being an immunologically privileged organ, T lymphocytes may be regular and frequent visitors to the CNS, for purposes of immune surveillance. Here, Trevor Owens and colleagues propose that the brain itself can regulate or shape immune responses therein. Furthermore, given that the immune cells may be subverted to autoimmunity, they suggest that the study of inflammatory autoimmune disease in the brain may shed light on the ability of the local environment to regulate immune responses.

  9. Influence of bedding type on mucosal immune responses.

    Science.gov (United States)

    Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E

    2002-10-01

    The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.

  10. Invitro immune responses in children following BCG vaccination

    Directory of Open Access Journals (Sweden)

    Vijayalakshmi V

    2006-01-01

    Full Text Available Introduction: There is still no consensus on the efficacy of BCG vaccine in the prevention of tuberculosis. This study therefore addressed the question of the magnitude of immunity afforded by BCG, by studying the effector mechanisms of protection in children. The main objectives were to assess the degree of immunity conferred by BCG vaccine in children and to identify the most immunogenic antigen(s of BCG by conducting in-vitro studies. Materials and methods: Children in the age-group of 1 to 10 years, were categorized: (A normal, and vaccinated with BCG during the first year, n=45, (B normal, without scar and with no evident history of vaccination, n=31: and (C children admitted in the hospital with a confirmed diagnosis of tuberculosis, n=31. Fractions of BCG were obtained by lysis, sonication, separation by gel chromatography, HPLC and confirmed by SDS-PAGE. In lymphoproliferative assays PBMC were cultured and stimulated with either Concanavalin-A or Tuberculin or the fractions of BCG. Stimulation indices (SI in lymphoproliferation, CD4/CD8 cells, levels of Interferon-γ (IFN- γ in the culture supernatants were measured by ELISA. Results: The vaccinated children displayed significantly high (P< 0.05 mean values of SI in LTT, CD4/CD8 cell ratio against the unfractionated, 67kDa fraction and BCG-CF Ags. While 100% of the vaccinated children had positive lymphoproliferation indices to BCG-CF, only 8.3% of the unvaccinated children were positive. Conclusion: Some of the components of BCG induced a strong Thl cell response in children. These immunogenic antigens were present in the whole cell lysate. The use of BCG vaccine for tuberculosis is worthwhile till a new vaccine is developed.

  11. Adrenaline influence on the immune response. I

    International Nuclear Information System (INIS)

    Depelchin, A.; Letesson, J.J.

    1981-01-01

    The intervention of adrenaline in the immunoregulation was investigated through the modification of the anti-SRBC PFC response of mice after its i.p. administration (4 μg) at various intervals before SRBC antigen. When the interval was less than 24 h, adrenaline accelerated the immune kinetics. This modification was apparent on both direct and indirect PFC, as well as on naive and immune mice. However, mice treated from 2 days showed a suppression of the response. The adrenaline affect subsisted on the adoptive response of spleen cells drug-treated either in vivo or in vitro. The mitogenic response after in vitro PHA or LPS stimulation of spleen cells from adrenaline-treated mice indicated that the T-cells were the drug target. The physiological role of the adrenaline and immunological influences of acute stress are discussed in the paper. The stress was provided by gamma irradiation. (Auth.)

  12. Respons imun humoral pada pulpitis (Humoral immune response on pulpitis)

    OpenAIRE

    Widodo, Trijoedani

    2005-01-01

    Pulpitis is an inflammation process on dental pulp tissue, and usually as the continuous of caries. The microorganism in the caries is a potential immunogenic triggering the immune respons, both humoral and celluler immune responses. The aim of this research is to explain the humoral immune response changes in the dental pulp tissues of pulpitis. This research was done on three group samples: Irreversible pulpitis, Reversible pulpitis and sound teeth as the control group. The result showed th...

  13. The host immune response to Clostridium difficile infection

    Science.gov (United States)

    2013-01-01

    Clostridium difficile infection (CDI) is the most common infectious cause of healthcare-acquired diarrhoea. Outcomes of C. difficile colonization are varied, from asymptomatic carriage to fulminant colitis and death, due in part to the interplay between the pathogenic virulence factors of the bacterium and the counteractive immune responses of the host. Secreted toxins A and B are the major virulence factors of C. difficile and induce a profound inflammatory response by intoxicating intestinal epithelial cells causing proinflammatory cytokine release. Host cell necrosis, vascular permeability and neutrophil infiltration lead to an elevated white cell count, profuse diarrhoea and in severe cases, dehydration, hypoalbuminaemia and toxic megacolon. Other bacterial virulence factors, including surface layer proteins and flagella proteins, are detected by host cell surface signal molecules that trigger downstream cell-mediated immune pathways. Human studies have identified a role for serum and faecal immunoglobulin levels in protection from disease, but the recent development of a mouse model of CDI has enabled studies into the precise molecular interactions that trigger the immune response during infection. Key effector molecules have been identified that can drive towards a protective anti-inflammatory response or a damaging proinflammatory response. The limitations of current antimicrobial therapies for CDI have led to the development of both active and passive immunotherapies, none of which have, as yet been formally approved for CDI. However, recent advances in our understanding of the molecular basis of host immune protection against CDI may provide an exciting opportunity for novel therapeutic developments in the future. PMID:25165542

  14. Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response.

    Science.gov (United States)

    Zhong, Hong; Ma, Minjuan; Liang, Tingming; Guo, Li

    2018-01-01

    In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.

  15. Tumor PDT-associated immune response: relevance of sphingolipids

    Science.gov (United States)

    Korbelik, Mladen; Merchant, Soroush; Separovic, Duska M.

    2010-02-01

    Sphingolipids have become recognized as essential effector molecules in signal transduction with involvement in various aspects of cell function and death, immune response and cancer treatment response. Major representatives of sphingolipids family, ceramide, sphingosine and sphingosine-1-phosphate (S1P), have attracted interest in their relevance to tumor response to photodynamic therapy (PDT) because of their roles as enhancers of apoptosis, mediators of cell growth and vasculogenesis, and regulators of immune response. Our recent in vivo studies with mouse tumor models have confirmed that PDT treatment has a pronounced impact on sphingolipid profile in the targeted tumor and that significant advances in therapeutic gain with PDT can be attained by combining this modality with adjuvant treatment with ceramide analog LCL29.

  16. Fibroblast activation protein is dispensable in the anti-influenza immune response in mice.

    Directory of Open Access Journals (Sweden)

    Sioh-Yang Tan

    Full Text Available Fibroblast activation protein alpha (FAP is a unique dual peptidase of the S9B serine protease family, being capable of both dipeptidyl peptidase and endopeptidase activities. FAP is expressed at low level in healthy adult organs including the pancreas, cervix, uterus, submaxillary gland and the skin, and highly upregulated in embryogenesis, chronic inflammation and tissue remodelling. It is also expressed by cancer-associated stromal fibroblasts in more than 90% of epithelial tumours. FAP has enzymatic and non-enzymatic functions in the growth, immunosuppression, invasion and cell signalling of tumour cells. FAP deficient mice are fertile and viable with no gross abnormality, but little data exist on the role of FAP in the immune system. FAP is upregulated in association with microbial stimulation and chronic inflammation, but its function in infection remains unknown. We showed that major populations of immune cells including CD4+ and CD8+ T cells, B cells, dendritic cells and neutrophils are generated and maintained normally in FAP knockout mice. Upon intranasal challenge with influenza virus, FAP mRNA was increased in the lungs and lung-draining lymph nodes. Nonetheless, FAP deficient mice showed similar pathologic kinetics to wildtype controls, and were capable of supporting normal anti-influenza T and B cell responses. There was no evidence of compensatory upregulation of other DPP4 family members in influenza-infected FAP-deficient mice. FAP appears to be dispensable in anti-influenza adaptive immunity.

  17. Transgenerational effects enhance specific immune response in a wild passerine

    Directory of Open Access Journals (Sweden)

    Juli Broggi

    2016-03-01

    Full Text Available Vertebrate mothers transfer diverse compounds to developing embryos that can affect their development and final phenotype (i.e., maternal effects. However, the way such effects modulate offspring phenotype, in particular their immunity, remains unclear. To test the impact of maternal effects on offspring development, we treated wild breeding house sparrows (Passer domesticus in Sevilla, SE Spain with Newcastle disease virus (NDV vaccine. Female parents were vaccinated when caring for first broods, eliciting a specific immune response to NDV. The immune response to the same vaccine, and to the PHA inflammatory test were measured in 11-day-old chicks from their following brood. Vaccinated chicks from vaccinated mothers developed a stronger specific response that was related to maternal NDV antibody concentration while rearing their chicks. The chicks’ carotenoid concentration and total antioxidant capacity in blood were negatively related to NDV antibody concentration, whereas no relation with PHA response was found. Specific NDV antibodies could not be detected in 11-day-old control chicks from vaccinated mothers, implying that maternally transmitted antibodies are not directly involved but may promote offspring specific immunity through a priming effect, while other immunity components remain unaffected. Maternally transmitted antibodies in the house sparrow are short-lived, depend on maternal circulation levels and enhance pre-fledging chick specific immunity when exposed to the same pathogens as the mothers.

  18. A specific primed immune response in Drosophila is dependent on phagocytes.

    Directory of Open Access Journals (Sweden)

    Linh N Pham

    2007-03-01

    Full Text Available Drosophila melanogaster, like other invertebrates, relies solely on its innate immune response to fight invading microbes; by definition, innate immunity lacks adaptive characteristics. However, we show here that priming Drosophila with a sublethal dose of Streptococcus pneumoniae protects against an otherwise-lethal second challenge of S. pneumoniae. This protective effect exhibits coarse specificity for S. pneumoniae and persists for the life of the fly. Although not all microbial challenges induced this specific primed response, we find that a similar specific protection can be elicited by Beauveria bassiana, a natural fly pathogen. To characterize this primed response, we focused on S. pneumoniae-induced protection. The mechanism underlying this protective effect requires phagocytes and the Toll pathway. However, activation of the Toll pathway is not sufficient for priming-induced protection. This work contradicts the paradigm that insect immune responses cannot adapt and will promote the search for similar responses overlooked in organisms with an adaptive immune response.

  19. Characterization and role of the immune response during ligament healing

    Science.gov (United States)

    Chamberlain, Connie S.

    Scar formation of ligaments after rupture remains a great challenge. Ligament healing involves a complex, coordinated series of events that form a neo-ligament, which is more disorganized and fibrotic in character than the native tissue. The repair process may extend from months to years, and the injured ligament never fully recovers its original mechanical properties. With little intrinsic healing potential, ruptures of the anterior cruciate ligament (ACL) are usually reconstructed. The "healed" tissues, however, do not regenerate native tissues or recapitulate their mechanical function. ACL grafts often lengthen (incidents range from 40-100%) and their strength can drop by ˜50% after remodeling. Reconstructed knees are often less stable and fail to restore normal joint kinematics. Our overall goal is to improve healing, making ligaments more regenerative. The first 2 studies characterized ligament healing in a spatial and temporal manner over 28 days. The experiments demonstrated creeping substitution and the potential role of the immune system to control the repair and/or regenerative process. From these studies, macrophages were identified as significant players during healing. Macrophages paralleled creeping substitution, were abundant within the healing ligament, and potentially played a destructive role via matrix phagocytosis. The role of macrophages during early ligament healing was then evaluated using liposome-encapsulated clodronate to inhibit phagocytosing macrophages. Clodronate attenuated the early infiltration of macrophages, resulting in delayed structural and functional healing. Macrophage re-infiltration into the wound resulted in continued ligament healing. These results suggested that early inhibition of phagocytosing macrophages is detrimental to ligament healing. The final experiment evaluated the effects of interleukin-4 on ligament healing. Interleukin-4 (IL-4) is reported to stimulate the Th2 lymphocyte/M2 macrophage pathway, reducing

  20. Immune responses of ducks infected with duck Tembusu virus

    Directory of Open Access Journals (Sweden)

    Ning eLi

    2015-05-01

    Full Text Available Duck Tembusu virus (DTMUV can cause serious disease in ducks, characterized by reduced egg production. Although the virus has been isolated and detection methods developed, the host immune responses to DTMUV infection are unclear. Therefore, we systematically examined the expression of immune-related genes and the viral distribution in DTMUV-infected ducks, using quantitative real-time PCR. Our results show that DTMUV replicates quickly in many tissues early in infection, with the highest viral titers in the spleen 1 day after infection. Rig-1, Mda5, and Tlr3 are involved in the host immune response to DTMUV, and the expression of proinflammatory cytokines (Il-1β, -2, -6, Cxcl8 and antiviral proteins (Mx, Oas, etc. are also upregulated early in infection. The expression of Il-6 increased most significantly in the tissues tested. The upregulation of Mhc-I was observed in the brain and spleen, but the expression of Mhc-II was upregulated in the brain and downregulated in the spleen. The expression of the interferons was also upregulated to different degrees in the spleen but that of the brain was various. Our study suggests that DTMUV replicates rapidly in various tissues and that the host immune responses are activated early in infection. However, the overexpression of cytokines may damage the host. These results extend our understanding of the immune responses of ducks to DTMUV infection, and provide insight into the pathogenesis of DTMUV attributable to host factors.

  1. The role of dehydroepiandrosterone on functional innate immune responses to acute stress.

    Science.gov (United States)

    Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P

    2017-12-01

    The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.

  2. Immunizations with hepatitis B viral antigens and a TLR7/8 agonist adjuvant induce antigen-specific immune responses in HBV-transgenic mice

    Directory of Open Access Journals (Sweden)

    Ying Wang

    2014-12-01

    Conclusions: Immunization with CL097-conjugated HBV-Ag reversed immune tolerance in HBV-Tg mice and induced antigen-specific immune responses. TLR7/8 agonists appear to be potent adjuvants for the induction of antigen-specific Th1 responses in an immune tolerant state.

  3. CD28 Aptamers as Powerful Immune Response Modulators

    Directory of Open Access Journals (Sweden)

    Fernando Pastor

    2013-01-01

    Full Text Available CD28 is one of the main costimulatory receptors responsible for the proper activation of T lymphocytes. We have isolated two aptamers that bind to the CD28 receptor. As a monomer, one of them interfered with the binding of CD28 to its ligand (B7, precluding the costimulatory signal, whereas the other one was inactive. However, dimerization of any of the anti-CD28 aptamers was sufficient to provide an artificial costimulatory signal. No antibody has featured a dual function (i.e., the ability to work as agonist and antagonist to date. Two different agonistic structures were engineered for each anti-CD28 aptamer. One showed remarkably improved costimulatory properties, surpassing the agonistic effect of an anti-CD28 antibody. Moreover, we showed in vivo that the CD28 agonistic aptamer is capable of enhancing the cellular immune response against a lymphoma idiotype and of prolonging survival of mice which receive the aptamer together with an idiotype vaccine. The CD28 aptamers described in this work could be used to modulate the immune response either blocking the interaction with B7 or enhancing vaccine-induced immune responses in cancer immunotherapy.

  4. Immune Response of Multiparous Hyper-Immunized Sows against Peptides from Non-Structural and Structural Proteins of PRRSV

    Directory of Open Access Journals (Sweden)

    Edgar Rascón-Castelo

    2015-11-01

    Full Text Available The purpose of this study was to evaluate the humoral and cellular responses of commercial multiparous and hyper-immunized sows against peptides from non-structural (nsp and structural proteins of porcine reproductive and respiratory syndrome virus (PRRSV. We selected sows with different numbers of parities from a commercial farm. Management practices on this farm include the use of the MLV commercial vaccine four times per year, plus two vaccinations during the acclimation period. The humoral response was evaluated via the antibody recognition of peptides from nsp and structural proteins, and the cellular response was assessed by measuring the frequency of peptide and PRRSV-specific IFN-gamma-secreting cells (IFNγ-SC. Our results show that sows with six parities have more antibodies against peptides from structural proteins than against peptides from nsp. The analysis of the cellular response revealed that the number of immunizations did not affect the frequency of IFNγ-SC and that the response was stronger against peptides from structural proteins (M protein than against nsp (nsp2. In summary, these results demonstrate that multiparous, hyper-immunized sows have a stronger immune humoral response to PRRSV structural peptides than nsp, but no differences in IFNγ-SC against the same peptides were observed.

  5. Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response

    Directory of Open Access Journals (Sweden)

    Hong Zhong

    2018-01-01

    Full Text Available In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.

  6. [Bone marrow stromal damage mediated by immune response activity].

    Science.gov (United States)

    Vojinović, J; Kamenov, B; Najman, S; Branković, Lj; Dimitrijević, H

    1994-01-01

    The aim of this work was to estimate influence of activated immune response on hematopoiesis in vitro, using the experimental model of BCG immunized BALB/c mice and in patients with chronic immunoactivation: long-lasting infections, autoimmunity or malignancy. We correlated changes in long term bone marrow cultures (Dexter) and NBT reduction with appearance of anemia in patients and experimental model of immunization by BCG. Increased spontaneous NBT reduction pointed out role of macrophage activation in bone marrow stroma damage. Long-term bone marrow cultures showed reduced number of hematopoietic cells, with predomination of fibroblasts and loss of fat cells. This results correlated with anemia and leucocytosis with stimulated myelopoiesis in peripheral blood. Activation of immune response, or acting of any agent that directly changes extracellular matrix and cellularity of bone marrow, may result in microenviroment bone marrow damage that modify hematopoiesis.

  7. Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response

    Directory of Open Access Journals (Sweden)

    Manns Michael P

    2007-06-01

    Full Text Available Abstract Spontaneous clearance of hepatitis C virus (HCV has frequently been associated with the presence of HCV-specific cellular immunity. However, there had been also reports in chimpanzees demonstrating clearance of HCV-viremia in the absence of significant levels of detectable HCV-specific cellular immune responses. We here report seven asymptomatic acute hepatitis C cases with peak HCV-RNA levels between 300 and 100.000 copies/ml who all cleared HCV-RNA spontaneously. Patients were identified by a systematic screening of 1176 consecutive new incoming offenders in a German young offender institution. Four of the seven patients never developed anti-HCV antibodies and had normal ALT levels throughout follow-up. Transient weak HCV-specific CD4+ T cell responses were detectable in five individuals which did not differ in strength and breadth from age- and sex-matched patients with chronic hepatitis C and long-term recovered patients. In contrast, HCV-specific MHC-class-I-tetramer-positive cells were found in 3 of 4 HLA-A2-positive patients. Thus, these cases highlight that clearance of low levels of HCV viremia is possible in the absence of a strong adaptive immune response which might explain the low seroconversion rate after occupational exposure to HCV.

  8. Primary immune system responders to nucleus pulposus cells: evidence for immune response in disc herniation

    Directory of Open Access Journals (Sweden)

    K Murai

    2010-01-01

    Full Text Available Although intervertebral disc herniation and associated sciatica is a common disease, its molecular pathogenesis is not well understood. Immune responses are thought to be involved. This study provides direct evidence that even non-degenerated nucleus pulposus (NP cells elicit immune responses. An in vitro colony forming inhibition assay demonstrated the suppressive effects of autologous spleen cells on NP cells and an in vitro cytotoxicity assay showed the positive cytotoxic effects of natural killer (NK cells and macrophages on NP cells. Non-degenerated rat NP tissues transplanted into wild type rats and immune-deficient mice demonstrated a significantly higher NP cell survival rate in immune-deficient mice. Immunohistochemical staining showed the presence of macrophages and NK cells in the transplanted NP tissues. These results suggest that even non-degenerated autologous NP cells are recognized by macrophages and NK cells, which may have an immunological function in the early phase of disc herniation. These findings contribute to understanding resorption and the inflammatory reaction to disc herniation.

  9. Humoral immune response of mice injected with tocopherol after exposure to X-radiation

    International Nuclear Information System (INIS)

    Roy, R.M.; Petrella, M.

    1987-01-01

    Serum haemagglutination (HA) titers have been determined for irradiated and non-irradiated mice responding to injection of two different concentrations of sheep red blood cells (SRBC) 24 to 48 hours after irradiation and immediate intraperitoneal injection of 2.5 mg DL alpha-tocopherol, the emulsifying vehicle, or saline. Mice maintained on tocopherol-deficient diets for 8 weeks post-weaning and those on regular diets exhibited increased IgG titers during peak response when injected with vitamin E. This partially alleviated the radiation-depression of the primary immune response induced by the smaller SRBC injection. This stimulatory effect was most significant in mice maintained on vitamin E-deficient diets. The HA titers of irradiated and non-irradiated mice maintained on normal rations were determined following a 10-fold increase in the SRBC inoculation. Antibody titer was greater following injection of the higher concentration of SRBC but post-irradiation injection of tocopherol immediately or 24 hours after irradiation did not enhance immune response. At the higher SRBC concentration maximum observed HA titers decreased with increasing dose of radiation; however, tocopherol had no significant dose-reducing effect. Tocopherol toxicity as manifested by depressed HA titers was observed occasionally in non-irradiated mice challenged with the higher concentration of SRBC

  10. DMPD: Innate immune responses during infection. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available va Correia J. Vaccine. 2004 Dec 6;22 Suppl 1:S25-30. (.png) (.svg) (.html) (.csml) Show Innate immune responses during infection. Pub...medID 15576198 Title Innate immune responses during infection. Authors Ulevitch RJ,

  11. Genetic constraints in the induction of the immune response to Ehrlich ascites tumor in mice

    International Nuclear Information System (INIS)

    Marusic, M.; Perkins, E.H.

    1981-01-01

    A single injection of irradiated Ehrlich ascites tumor (EAT) cells induces immunity in normal mice but fails to do so in T-cell-deficient-thymectomized, lethally irradiated, bone marrow-reconstituted (TIR) mice. TIR mice injected with normal syngeneic T cells develop an immune response to EAT when injected with irradiated EAT cells and reject a subsequent tumor cell challenge. In the present studies allogeneic T cells were unable to protect against EAT in TIR recipients even if harvested from donors tolerant to the recipient's transplantation antigens and injected into the TIR mice tolerant to the transplantation antigens of the injected T cells. Tolerance was produced by establishing long-term radiation chimeras of the P → F 1 type. Semiallogeneic T cells also failed to afford protection against EAT in TIR recipients. Whereas tolerance to other parental-strain transplantation antigens did not reverse the inability of parental T cells (cells from P → F 1 chimeric donors) to protect against EAT in F 1 TIR mice, it did enable F 1 T cells to afford protection in P → F 1 TIR mice

  12. Acquired and innate immunity to polyaromatic hydrocarbons

    International Nuclear Information System (INIS)

    Yusuf, Nabiha; Timares, Laura; Seibert, Megan D.; Xu Hui; Elmets, Craig A.

    2007-01-01

    Polyaromatic hydrocarbons are ubiquitous environmental pollutants that are potent mutagens and carcinogens. Researchers have taken advantage of these properties to investigate the mechanisms by which chemicals cause cancer of the skin and other organs. When applied to the skin of mice, several carcinogenic polyaromatic hydrocarbons have also been shown to interact with the immune system, stimulating immune responses and resulting in the development of antigen-specific T-cell-mediated immunity. Development of cell-mediated immunity is strain-specific and is governed by Ah receptor genes and by genes located within the major histocompatibility complex. CD8 + T cells are effector cells in the response, whereas CD4 + T cells down-regulate immunity. Development of an immune response appears to have a protective effect since strains of mice that develop a cell-mediated immune response to carcinogenic polyaromatic hydrocarbons are less likely to develop tumors when subjected to a polyaromatic hydrocarbon skin carcinogenesis protocol than mice that fail to develop an immune response. With respect to innate immunity, TLR4-deficient C3H/HeJ mice are more susceptible to polyaromatic hydrogen skin tumorigenesis than C3H/HeN mice in which TLR4 is normal. These findings support the hypothesis that immune responses, through their interactions with chemical carcinogens, play an active role in the prevention of chemical skin carcinogenesis during the earliest stages. Efforts to augment immune responses to the chemicals that cause tumors may be a productive approach to the prevention of tumors caused by these agents

  13. Enhancement of mucosal immune responses by chimeric influenza HA/SHIV virus-like particles

    International Nuclear Information System (INIS)

    Guo Lizheng; Lu Xiaoyan; Kang, S.-M.; Chen Changyi; Compans, Richard W.; Yao Qizhi

    2003-01-01

    To enhance mucosal immune responses using simian/human immunodeficiency virus-like particles (SHIV VLPs), we have produced novel phenotypically mixed chimeric influenza HA/SHIV VLPs and used them to immunize C57BL/6J mice intranasally. Antibody and cytotoxic T-cell (CTL) responses as well as cytokine production in both systemic and mucosal sites were compared after immunization with SHIV VLPs or chimeric HA/SHIV VLPs. By using enzyme-linked immunosorbent assay (ELISA), the levels of serum IgG and mucosal IgA to the HIV envelope protein (Env) were found to be highest in the group immunized with chimeric HA/SHIV VLPs. Furthermore, the highest titer of serum neutralizing antibody against HIV Env was found with the group immunized with chimeric HA/SHIV VLPs. Analysis of the IgG1/IgG2a ratio indicated that a T H 1-oriented immune response resulted from these VLP immunizations. HA/SHIV VLP-immunized mice also showed significantly higher CTL responses than those observed in SHIV VLP-immunized mice. Moreover, a MHC class I restricted T-cell activation ELISPOT assay showed a mixed type of T H 1/T H 2 cytokines in the HA/SHIV VLP-immunized mice, indicating that the chimeric VLPs can enhance both humoral and cellular immune responses to the HIV Env protein at multiple mucosal and systemic sites. The results indicate that incorporation of influenza HA into heterotypic VLPs may be highly effective for targeting vaccines to mucosal surfaces

  14. TIPE2, a negative regulator of innate and adaptive immunity that maintains immune homeostasis.

    Science.gov (United States)

    Sun, Honghong; Gong, Shunyou; Carmody, Ruaidhri J; Hilliard, Anja; Li, Li; Sun, Jing; Kong, Li; Xu, Lingyun; Hilliard, Brendan; Hu, Shimin; Shen, Hao; Yang, Xiaolu; Chen, Youhai H

    2008-05-02

    Immune homeostasis is essential for the normal functioning of the immune system, and its breakdown leads to fatal inflammatory diseases. We report here the identification of a member of the tumor necrosis factor-alpha-induced protein-8 (TNFAIP8) family, designated TIPE2, that is required for maintaining immune homeostasis. TIPE2 is preferentially expressed in lymphoid tissues, and its deletion in mice leads to multiorgan inflammation, splenomegaly, and premature death. TIPE2-deficient animals are hypersensitive to septic shock, and TIPE2-deficient cells are hyper-responsive to Toll-like receptor (TLR) and T cell receptor (TCR) activation. Importantly, TIPE2 binds to caspase-8 and inhibits activating protein-1 and nuclear factor-kappaB activation while promoting Fas-induced apoptosis. Inhibiting caspase-8 significantly blocks the hyper-responsiveness of TIPE2-deficient cells. These results establish that TIPE2 is an essential negative regulator of TLR and TCR function, and its selective expression in the immune system prevents hyperresponsiveness and maintains immune homeostasis.

  15. Sex-specific consequences of an induced immune response on reproduction in a moth.

    Science.gov (United States)

    Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T

    2015-12-16

    Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.

  16. Perillyl alcohol suppresses antigen-induced immune responses in the lung

    International Nuclear Information System (INIS)

    Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide; Nakagome, Kazuyuki; Harada, Hiroaki; Kawahata, Kimito; Tanaka, Ryoichi; Yamamoto, Kazuhiko; Dohi, Makoto

    2014-01-01

    Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4 + T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes, its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4 + T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects

  17. Effect of Scoparia dulcis on noise stress induced adaptive immunity and cytokine response in immunized Wistar rats

    Directory of Open Access Journals (Sweden)

    Loganathan Sundareswaran

    2017-01-01

    Conclusion: S. dulcis (SD has normalized and prevented the noise induced changes in cell-mediated and humoral immunity and it could be the presence of anti-stressor and immuno stimulant activity of the plant.

  18. Inter-donor variation in cell subset specific immune signaling responses in healthy individuals.

    Science.gov (United States)

    Longo, Diane M; Louie, Brent; Wang, Ena; Pos, Zoltan; Marincola, Francesco M; Hawtin, Rachael E; Cesano, Alessandra

    2012-01-01

    Single cell network profiling (SCNP) is a multi-parameter flow cytometry based approach that allows for the simultaneous interrogation of intracellular signaling pathways in multiple cell subpopulations within heterogeneous tissues, without the need for individual cell subset isolation. Thus, the technology is extremely well-suited for characterizing the multitude of interconnected signaling pathways and immune cell subpopulations that regulate the function of the immune system. Recently, SCNP was applied to generate a functional map of the healthy human immune cell signaling network by profiling immune signaling pathways downstream of 12 immunomodulators in 7 distinct immune cell subsets within peripheral blood mononuclear cells (PBMCs) from 60 healthy donors. In the study reported here, the degree of inter-donor variation in the magnitude of the immune signaling responses was analyzed. The highest inter-donor differences in immune signaling pathway activity occurred following perturbation of the immune signaling network, rather than in basal signaling. When examining the full panel of immune signaling responses, as one may expect, the overall degree of inter-donor variation was positively correlated (r = 0.727) with the magnitude of node response (i.e. a larger median signaling response was associated with greater inter-donor variation). However, when examining the degree of heterogeneity across cell subpopulations for individual signaling nodes, cell subset specificity in the degree of inter-donor variation was observed for several nodes. For such nodes, relatively weak correlations between inter-donor variation and the magnitude of the response were observed. Further, within the phenotypically distinct subpopulations, a fraction of the immune signaling responses had bimodal response profiles in which (a) only a portion of the cells had elevated phospho-protein levels following modulation and (b) the proportion of responsive cells varied by donor. These data

  19. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens.

    Science.gov (United States)

    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H

    1994-03-01

    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system.

  20. Behavioral Fever Drives Epigenetic Modulation of the Immune Response in Fish.

    Science.gov (United States)

    Boltana, Sebastian; Aguilar, Andrea; Sanhueza, Nataly; Donoso, Andrea; Mercado, Luis; Imarai, Monica; Mackenzie, Simon

    2018-01-01

    Ectotherms choose the best thermal conditions to mount a successful immune response, a phenomenon known as behavioral fever. The cumulative evidence suggests that behavioral fever impacts positively upon lymphocyte proliferation, inflammatory cytokine expression, and other immune functions. In this study, we have explored how thermal choice during infection impacts upon underpinning molecular processes and how temperature increase is coupled to the immune response. Our results show that behavioral fever results in a widespread, plastic imprint on gene regulation, and lymphocyte proliferation. We further explored the possible contribution of histone modification and identified global associations between temperature and histone changes that suggest epigenetic remodeling as a result of behavioral fever. Together, these results highlight the critical importance of thermal choice in mobile ectotherms, particularly in response to an infection, and demonstrate the key role of epigenetic modification to orchestrate the thermocoupling of the immune response during behavioral fever.

  1. Immune responses to influenza virus and its correlation to age and inherited factors

    Directory of Open Access Journals (Sweden)

    Azadeh Bahadoran

    2016-11-01

    Full Text Available Influenza viruses belong to the family Orthomyxoviridae of enveloped viruses and are an important cause of respiratory infections worldwide. The influenza virus is able to infect a wide variety species as diverse as poultry, marine, pigs, horses and humans. Upon infection with influenza virus the innate immunity plays a critical role in efficient and rapid control of viral infections as well as in adaptive immunity initiation. The humoral immune system produces antibodies against different influenza antigens, of which the HA-specific antibody is the most important for neutralization of the virus and thus prevention of illness. Cell mediated immunity including CD4+ helper T cells and CD8+ cytotoxic T cells are the other arms of adaptive immunity induced upon influenza virus infection. The complex inherited factors and age related changes are associated with the host immune responses. Here, we review the different components of immune responses against influenza virus. Additionally, the correlation of the immune response to age and inherited factors has been discussed. These determinations lead to a better understanding of the limitations of immune responses for developing improved vaccines to control influenza virus infection.

  2. Host control of malaria infections: constraints on immune and erythropoeitic response kinetics.

    Directory of Open Access Journals (Sweden)

    Philip G McQueen

    2008-08-01

    Full Text Available The two main agents of human malaria, Plasmodium vivax and Plasmodium falciparum, can induce severe anemia and provoke strong, complex immune reactions. Which dynamical behaviors of host immune and erythropoietic responses would foster control of infection, and which would lead to runaway parasitemia and/or severe anemia? To answer these questions, we developed differential equation models of interacting parasite and red blood cell (RBC populations modulated by host immune and erythropoietic responses. The model immune responses incorporate both a rapidly responding innate component and a slower-responding, long-term antibody component, with several parasite developmental stages considered as targets for each type of immune response. We found that simulated infections with the highest parasitemia tended to be those with ineffective innate immunity even if antibodies were present. We also compared infections with dyserythropoiesis (reduced RBC production during infection to those with compensatory erythropoiesis (boosted RBC production or a fixed basal RBC production rate. Dyserythropoiesis tended to reduce parasitemia slightly but at a cost to the host of aggravating anemia. On the other hand, compensatory erythropoiesis tended to reduce the severity of anemia but with enhanced parasitemia if the innate response was ineffective. For both parasite species, sharp transitions between the schizont and the merozoite stages of development (i.e., with standard deviation in intra-RBC development time immune response, though P. vivax attacks a much smaller subset of RBCs. Since most P. vivax infections are nonlethal (if debilitating clinically, this suggests that P

  3. Delicate regulation of the cGAS-MITA-mediated innate immune response.

    Science.gov (United States)

    Luo, Wei-Wei; Shu, Hong-Bing

    2018-02-19

    Although it has long been demonstrated that cytosolic DNA is a potent immune stimulant, it is only in recent years that the molecular mechanisms of DNA-stimulated innate immune responses have emerged. Studies have established critical roles for the DNA sensor cyclic GMP-AMP synthase (cGAS) and the adapter protein MITA/STING in the innate immune response to cytosolic DNA or DNA viruses. Although the regulation of cGAS-MITA/STING-mediated signaling remains to be fully investigated, understanding the processes involved may help to explain the mechanisms of innate immune signaling events and perhaps autoinflammatory diseases and to provide potential therapeutic targets for drug intervention. In this review, we summarize recent progress on the regulation of the cGAS-MITA/STING-mediated innate immune response to DNA viruses at the organelle-trafficking, post-translational and transcriptional levels.Cellular & Molecular Immunology advance online publication, 19 February 2018; doi:10.1038/cmi.2016.51.

  4. Modelling the innate immune response against avian influenza virus in chicken

    NARCIS (Netherlands)

    Hagenaars, T.J.; Fischer, E.A.J.; Jansen, C.A.; Rebel, J.M.J.; Spekreijse, D.; Vervelde, L.; Backer, J.A.; Jong, de M.C.M.; Koets, A.P.

    2016-01-01

    At present there is limited understanding of the host immune response to (low pathogenic) avian influenza virus infections in poultry. Here we develop a mathematical model for the innate immune response to avian influenza virus in chicken lung, describing the dynamics of viral load,

  5. Immune response at birth, long-term immune memory and 2 years follow-up after in-utero anti-HBV DNA immunization.

    Science.gov (United States)

    Fazio, V M; Ria, F; Franco, E; Rosati, P; Cannelli, G; Signori, E; Parrella, P; Zaratti, L; Iannace, E; Monego, G; Blogna, S; Fioretti, D; Iurescia, S; Filippetti, R; Rinaldi, M

    2004-03-01

    Infections occurring at the end of pregnancy, during birth or by breastfeeding are responsible for the high toll of death among first-week infants. In-utero DNA immunization has demonstrated the effectiveness in inducing specific immunity in newborns. A major contribution to infant immunization would be achieved if a vaccine proved able to be protective as early as at the birth, preventing the typical 'first-week infections'. To establish its potential for use in humans, in-utero DNA vaccination efficiency has to be evaluated for short- and long-term safety, protection at delivery, efficacy of boosts in adults and effective window/s for modulation of immune response during pregnancy, in an animal model suitable with human development. Here we show that a single intramuscular in-utero anti-HBV DNA immunization at two-thirds of pig gestation produces, at birth, antibody titers considered protective in humans. The boost of antibody titers in every animal following recall at 4 and 10 months demonstrates the establishment of immune memory. The safety of in-utero fetus manipulation is guaranteed by short-term (no fetus loss, lack of local alterations, at-term spontaneous delivery, breastfeeding) and long-term (2 years) monitoring. Treatment of fetuses closer to delivery results in immune ignorance without induction of tolerance. This result highlights the repercussion of selecting the appropriate time point when this approach is used to deliver therapeutic genes. All these findings illustrate the relevance of naked DNA-based vaccination technology in therapeutic efforts aimed to prevent the high toll of death among first-week infants.

  6. Escaping deleterious immune response in their hosts: lessons from trypanosomatids

    Directory of Open Access Journals (Sweden)

    Anne eGeiger

    2016-05-01

    Full Text Available The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, T. cruzi and Leishmania spp are important human pathogens causing Human African Trypanosomiasis (HAT or Sleeping Sickness, Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs or sandflies and affect millions of people worldwide.In humans, extracellular African trypanosomes (T. brucei evade the hosts’ immune defences, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response.This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite-host interactions and, will focus on: clinical and epidemiological importance of diseases; life cycles: parasites-hosts-vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation.

  7. Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids

    Science.gov (United States)

    Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe

    2016-01-01

    The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406

  8. Immune-mediated steroid-responsive epileptic spasms and epileptic encephalopathy associated with VGKC-complex antibodies.

    Science.gov (United States)

    Suleiman, Jehan; Brenner, Tanja; Gill, Deepak; Troedson, Christopher; Sinclair, Adriane J; Brilot, Fabienne; Vincent, Angela; Lang, Bethan; Dale, Russell C

    2011-11-01

    Autoantibodies that bind to voltage-gated potassium-channel complex proteins (VGKC-complex antibodies) occur frequently in adults with limbic encephalitis presenting with cognitive impairment and seizures. Recently, VGKC-complex antibodies have been described in a few children with limbic encephalitis, and children with unexplained encephalitis presenting with status epilepticus. We report a case of infantile-onset epileptic spasms and developmental delay compatible with epileptic encephalopathy. Our patient was a female infant, aged 4 months at presentation. She had evidence of immune activation in the central nervous system with elevated cerebrospinal fluid neopterin and mirrored oligoclonal bands, which prompted testing for autoantibodies. VGKC-complex antibodies were elevated (201 pmol/L, normalVGKC-complex antibodies might represent a marker of immune therapy responsiveness in a subgroup of patients with infantile epileptic encephalopathy. © The Authors. Developmental Medicine & Child Neurology © 2011 Mac Keith Press.

  9. Study of the integrated immune response induced by an inactivated EV71 vaccine.

    Directory of Open Access Journals (Sweden)

    Longding Liu

    Full Text Available Enterovirus 71 (EV71, a major causative agent of hand-foot-and-mouth disease (HFMD, causes outbreaks among children in the Asia-Pacific region. A vaccine is urgently needed. Based on successful pre-clinical work, phase I and II clinical trials of an inactivated EV71 vaccine, which included the participants of 288 and 660 respectively, have been conducted. In the present study, the immune response and the correlated modulation of gene expression in the peripheral blood mononuclear cells (PBMCs of 30 infants (6 to 11 months immunized with this vaccine or placebo and consented to join this study in the phase II clinical trial were analyzed. The results showed significantly greater neutralizing antibody and specific T cell responses in vaccine group after two inoculations on days 0 and 28. Additionally, more than 600 functional genes that were up- or down-regulated in PBMCs were identified by the microarray assay, and these genes included 68 genes associated with the immune response in vaccine group. These results emphasize the gene expression profile of the immune system in response to an inactivated EV71 vaccine in humans and confirmed that such an immune response was generated as the result of the positive mobilization of the immune system. Furthermore, the immune response was not accompanied by the development of a remarkable inflammatory response.NCT01391494 and NCT01512706.

  10. Modelling the Innate Immune Response against Avian Influenza Virus in Chicken

    NARCIS (Netherlands)

    Hagenaars, T J; Fischer, E A J; Jansen, C A; Rebel, J M J; Spekreijse, D; Vervelde, L; Backer, J A; de Jong, M.C.M.; Koets, A P

    2016-01-01

    At present there is limited understanding of the host immune response to (low pathogenic) avian influenza virus infections in poultry. Here we develop a mathematical model for the innate immune response to avian influenza virus in chicken lung, describing the dynamics of viral load, interferon-α, -β

  11. Immune response to uv-induced tumors: transplantation immunity and lymphocyte populations exhibiting anti-tumor activity

    International Nuclear Information System (INIS)

    Streeter, P.R.

    1985-01-01

    Ultraviolet light-induced murine skin tumors were analyzed for their ability to induce tumor-specific and cross-protective transplantation immunity in immunocompetent syngeneic mice. These studies revealed that progressor UV-tumors, like regressor UV-tumors, possess tumor-specific transplantation antigens. Cross-protective transplantation immunity to UV-tumors, however, was associated with sensitization to the serum used to culture the tumor lines rather than to cross-reactive or common determinants on UV-tumors. An analysis of the cytolytic activity of lymphocytes from the spleens of mice immunized with either regressor or progressor UV-tumors revealed a striking difference between the two immune splenocyte populations. From regressor tumor-immune animals, cytolytic T (Tc) lymphocytes with specificity for the immunizing tumor were found. However, the analysis of splenic lymphocytes from progressor tumor immune animals revealed no such effector cells. To more effectively examine those lymphocytes exhibiting cytolytic activity in vitro, T lymphocyte cloning technology was used as a means of isolating homogeneous lymphocyte populations with the effector activities described above. The mechanisms where NK cells and other nonspecific effector cells could be induced in tumor-immune animals are discussed in the context of class II restricted immune responses

  12. Role of IL-12 and IFN-γ in immune response to toxoplasma gondii infection

    International Nuclear Information System (INIS)

    Moawad, M.A.F.; ElGawish, M.A.M.

    2004-01-01

    Interlenkin 12 (IL-12) is a potent immunoregulatory molecule that is critically involved in a wide range of diseases. In several murine models of intracellular infection, endogenous IL-12 has been shown to be crucial for the generation of a protective Th1 response in a primary infection for a intracellular pathogens. Interferon-gamma (IFN-γ) is also an important mediator of cellular immunity against microbial pathogens and tumor cells due to its potent capacity to activate macrophages for enhanced cytotoxicity. The aim of the present study is to evaluate the immune response to toxoplasma gondii after primary inflection (infected groups and secondary infection (re-infected groups for over 19 weeks (the time of the experiment). the evaluation was assessed by measurements of levels of IL-12 and IFN-γ using ELISA technique in the sera of these infected rats. The results demonstrated that the primary immune response induced a fluctuation in the levels of IL-12 in the sera of infected rats, which reached maximum value of 122.6 ±1.4 pg/ml after 15 weeks of primary infection. While, in the challenged groups (secondary immune response, re-infected groups) the levels of IL-12 were generally lower than that of the primary immune response. On the other hand, IFN-γ levels increased significantly in the secondary immune response (re-infected groups) as compared to primary immune response 9 infected groups) In conclusion, the results suggest that IL-12 might have a role in the defense mechanism against intracellular infection with T-gondii especially in primary immune response than in the secondary immune response. This is in contrast to IFN-γ that takes the up-hand in secondary immune response to T-gondii infection

  13. Immune responses accelerate ageing: proof-of-principle in an insect model.

    Directory of Open Access Journals (Sweden)

    E Rhiannon Pursall

    Full Text Available The pathology of many of the world's most important infectious diseases is caused by the immune response. Additionally age-related disease is often attributed to inflammatory responses. Consequently a reduction in infections and hence inflammation early in life has been hypothesized to explain the rise in lifespan in industrialized societies. Here we demonstrate experimentally for the first time that eliciting an immune response early in life accelerates ageing. We use the beetle Tenebrio molitor as an inflammation model. We provide a proof of principle for the effects of early infection on morbidity late in life and demonstrate a long-lasting cost of immunopathology. Along with presenting a proof-of-principle study, we discuss a mechanism for the apparently counter-adaptive persistence of immunopathology in natural populations. If immunopathology from early immune response only becomes costly later in life, natural selection on reducing self-harm would be relaxed, which could explain the presence of immune self-harm in nature.

  14. Neonatal and Infantile Immune Responses to Encapsulated Bacteria and Conjugate Vaccines

    Directory of Open Access Journals (Sweden)

    Peter Klein Klouwenberg

    2008-01-01

    Full Text Available Encapsulated bacteria are responsible for the majority of mortality among neonates and infants. The major components on the surface of these bacteria are polysaccharides which are important virulence factors. Immunity against these components protects against disease. However, most of the polysaccharides are thymus-independent (TI-2 antigens which induce an inadequate immune response in neonates and infants. The mechanisms that are thought to play a role in the unresponsiveness of this age group to TI-2 stimuli will be discussed. The lack of immune response may be overcome by conjugating the polysaccharides to a carrier protein. This transforms bacterial polysaccharides from a TI-2 antigen into a thymus-dependent (TD antigen, thereby inducing an immune response and immunological memory in neonates and infants. Such conjugated vaccines have been shown to be effective against the most common causes of invasive disease caused by encapsulated bacteria in neonates and children. These and several other approaches in current vaccine development will be discussed.

  15. Natural functional SNPs in miR-155 alter its expression level, blood cell counts and immune responses

    Directory of Open Access Journals (Sweden)

    Congcong Li

    2016-08-01

    Full Text Available miR-155 has been confirmed to be a key factor in immune responses in humans and other mammals. Therefore, investigation of variations in miR-155 could be useful for understanding the differences in immunity between individuals. In this study, four SNPs in miR-155 were identified in mice (Mus musculus and humans (Homo sapiens. In mice, the four SNPs were closely linked and formed two miR-155 haplotypes (A and B. Ten distinct types of blood parameters were associated with miR-155 expression under normal conditions. Additionally, 4 and 14 blood parameters were significantly different between these two genotypes under normal and lipopolysaccharide (LPS stimulation conditions, respectively. Moreover, the expression levels of miR-155, the inflammatory response to LPS stimulation and the lethal ratio following Salmonella typhimurium infection were significantly increased in mice harboring the AA genotype. Further, two SNPs, one in the loop region and the other near the 3' terminal of pre-miR-155, were confirmed to be responsible for the differential expression of miR-155 in mice. Interestingly, two additional SNPs, one in the loop region and the other in the middle of miR-155*, modulated the function of miR-155 in humans. Predictions of secondary RNA structure using RNAfold showed that these SNPs affected the structure of miR-155 in both mice and humans. Our results provide novel evidence of the natural functional SNPs of miR-155 in both mice and humans, which may affect the expression levels of mature miR-155 by modulating its secondary structure. The SNPs of human miR-155 may be considered as causal mutations for some immune-related diseases in the clinic. The two genotypes of mice could be used as natural models for studying the mechanisms of immune diseases caused by abnormal expression of miR-155 in humans.

  16. Visible light induced changes in the immune response through an eye-brain mechanism (photoneuroimmunology).

    Science.gov (United States)

    Roberts, J E

    1995-07-01

    The immune system is susceptible to a variety of stresses. Recent work in neuroimmunology has begun to define how mood alteration, stress, the seasons, and daily rhythms can have a profound effect on immune response through hormonal modifications. Central to these factors may be light through an eye-brain hormonal modulation. In adult primates, only visible light (400-700 nm) is received by the retina. This photic energy is then transduced and delivered to the visual cortex and by an alternative pathway to the suprachiasmatic nucleus (SCN). The SCN is a part of the hypothalamic region in the brain believed to direct circadian rhythm. Visible light exposure also modulates the pituitary and pineal gland which leads to neuroendocrine changes. Melatonin, norepinephrine and acetylcholine decrease with light activation, while cortisol, serotonin, gaba and dopamine levels increase. The synthesis of vasoactive intestinal polypeptide (VIP), gastrin releasing peptide (GRP) and neuropeptide Y (NPY) in rat SCN has been shown to be modified by light. These induced neuroendocrine changes can lead to alterations in mood and circadian rhythm. All of these neuroendocrine changes can lead to immune modulation. An alternative pathway for immune modulation by light is through the skin. Visible light (400-700 nm) can penetrate epidermal and dermal layers of the skin and may directly interact with circulating lymphocytes to modulate immune function. However, even in the presence of phototoxic agents such as eosin and rose bengal, visible light did not produce suppression of contact hypersensitivity with suppresser cells. In contrast to visible light, in vivo exposure to UV-B (280-320 nm) and UV-A (320-400 nm) radiation can only alter normal human immune function by a skin mediated response. Each UV subgroup (B, A) induces an immunosuppressive response but by differing mechanisms involving the regulation of differing interleukins and growth factors. Some effects observed in humans are

  17. Humoral and cellular immune responses to modified hepatitis B ...

    African Journals Online (AJOL)

    Purpose: To evaluate the immunogenicity and types of immune response of a quality-controlled modified recombinant hepatitis B surface antigen (HBsAg) plasmid encoding HBsAg in mice. Methods: The characterized plasmid DNA was used in the immunization of Balb/c mice. Three groups of mice were intramuscularly ...

  18. Perillyl alcohol suppresses antigen-induced immune responses in the lung

    Energy Technology Data Exchange (ETDEWEB)

    Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide; Nakagome, Kazuyuki; Harada, Hiroaki; Kawahata, Kimito; Tanaka, Ryoichi; Yamamoto, Kazuhiko [Department of Allergy and Rheumatology, Graduate School of Medicine, The University of Tokyo, Tokyo (Japan); Dohi, Makoto, E-mail: mdohi-tky@umin.ac.jp [Department of Allergy and Rheumatology, Graduate School of Medicine, The University of Tokyo, Tokyo (Japan); Institute of Respiratory Immunology, Shibuya Clinic for Respiratory Diseases and Allergology, Tokyo (Japan)

    2014-01-03

    Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4{sup +} T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes, its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4{sup +} T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects.

  19. Mycobacterium tuberculosis co-operonic PE32/PPE65 proteins alter host immune responses by hampering Th1 response

    Directory of Open Access Journals (Sweden)

    Mohd eKhubaib

    2016-05-01

    Full Text Available PE/PPE genes, present in cluster with ESAT-6 like genes, are suspected to have a role in antigenic variation and virulence of Mycobacterium tuberculosis. Their roles in immune evasion and immune modulation of host are also well documented. We present evidence that PE32/PPE65 present within the RD8 region are co-operonic, co-transcribed and co-translated, and play role in modulating host immune responses. Experiments with macrophage cell lines revealed that this protein complex suppresses pro-inflammatory cytokines such as TNF-α and IL-6 whereas also inducing high expression of anti-inflammatory IL-10. Immunization of mice with these recombinant proteins dampens an effective Th1 response as evident from reduced frequency of IFN-g and IL-2 producing CD4+ and CD8+ T cells. IgG sub-typing from serum of immunized mice revealed high levels of IgG1 when compared with IgG2a and IgG2b. Further IgG1/IgG2a ratio clearly demonstrated that the protein complex manipulates the host immune response favourable to the pathogen. Our results demonstrate that the co-transcribed and co-translated PE32 and PPE65 antigens are involved specifically in modulating anti-mycobacterial host immune response by hampering Th1 response.

  20. A modified live canine parvovirus vaccine. II. Immune response.

    Science.gov (United States)

    Carmichael, L E; Joubert, J C; Pollock, R V

    1983-01-01

    The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.

  1. Nanotechnology, neuromodulation & the immune response: discourse, materiality & ethics.

    Science.gov (United States)

    Fins, Joseph J

    2015-04-01

    Drawing upon the American Pragmatic tradition in philosophy and the more recent work of philosopher Karen Barad, this paper examines how scientific problems are both obscured, and resolved by our use of language describing the natural world. Using the example of the immune response engendered by neural implants inserted in the brain, the author explains how this discourse has been altered by the advent of nanotechnology methods and devices which offer putative remedies that might temper the immune response in the central nervous system. This emergent nanotechnology has altered this problem space and catalyzed one scientific community to acknowledge a material reality that was always present, if not fully acknowledged.

  2. Cell mediated immune response in human antirabies revaccination

    Directory of Open Access Journals (Sweden)

    Débora Regina Veiga

    1987-04-01

    Full Text Available The occurrence of secondary cell mediated immune response (CMI in human antirabies immunization was studied. The Puenzalida & Palácios vaccine was used because it is routinely used in Brazil. CMI was evaluated by lymphoblastic transformation indices obtained in whole blood culture in the presence of rabies and control (nervous tissue antigens. Eleven volunteers submitted to revaccination constituted the group under study, while three other volunteers submitted primo vaccination were utilized as control group. A clear secondary CMI to rabies antigen was detected in all the revaccinated volunteers who showed earlier and more intense response than the control group. Response to the control antigen, however, present in all the components of the first group was not detectable in two out of the three primovaccinated and very low in the third one.

  3. High-dimensional analysis of the aging immune system: verification of age-associated differences in immune signaling responses in healthy donors.

    Science.gov (United States)

    Longo, Diane M; Louie, Brent; Ptacek, Jason; Friedland, Greg; Evensen, Erik; Putta, Santosh; Atallah, Michelle; Spellmeyer, David; Wang, Ena; Pos, Zoltan; Marincola, Francesco M; Schaeffer, Andrea; Lukac, Suzanne; Railkar, Radha; Beals, Chan R; Cesano, Alessandra; Carayannopoulos, Leonidas N; Hawtin, Rachael E

    2014-06-21

    Single-cell network profiling (SCNP) is a multiparametric flow cytometry-based approach that simultaneously measures evoked signaling in multiple cell subsets. Previously, using the SCNP approach, age-associated immune signaling responses were identified in a cohort of 60 healthy donors. In the current study, a high-dimensional analysis of intracellular signaling was performed by measuring 24 signaling nodes in 7 distinct immune cell subsets within PBMCs in an independent cohort of 174 healthy donors [144 elderly (>65 yrs); 30 young (25-40 yrs)]. Associations between age and 9 immune signaling responses identified in the previously published 60 donor cohort were confirmed in the current study. Furthermore, within the current study cohort, 48 additional immune signaling responses differed significantly between young and elderly donors. These associations spanned all profiled modulators and immune cell subsets. These results demonstrate that SCNP, a systems-based approach, can capture the complexity of the cellular mechanisms underlying immunological aging. Further, the confirmation of age associations in an independent donor cohort supports the use of SCNP as a tool for identifying reproducible predictive biomarkers in areas such as vaccine response and response to cancer immunotherapies.

  4. Secondary immune response of rainbow trout following repeated immersion vaccination

    DEFF Research Database (Denmark)

    Jaafar, R. M.; Al-Jubury, A.; Chettri, J. K.

    2017-01-01

    Teleosts are able to raise a protective immune response, comprising both innate and adaptive elements, against various pathogens. This is the basis for a widespread use of vaccines, administered as injection or immersion, in the aquaculture industry. It has been described that repeated injection...... vaccination of fish raises a secondary immune response, consisting of rapid, accelerated and increased antibody reaction. This study reports how rainbow trout responds to repeated immersion vaccination against yersiniosis (ERM) caused by the bacterial pathogen Yersinia ruckeri. It was found that rainbow trout...... does not raise a classical secondary response following repeated immersion vaccination. Serum antibody titres were merely slightly increased even after three immunizations, using 30-s immersion into a bacterin consisting of formalin-inactivated Y. ruckeri (serotype O1, biotypes 1 and 2), performed over...

  5. Secondary immune response of rainbow trout following repeated immersion vaccination

    DEFF Research Database (Denmark)

    Jaafar, R. M.; Al-Jubury, Azmi; Chettri, Jiwan Kumar

    2018-01-01

    Teleosts are able to raise a protective immune response, comprising both innate and adaptive elements, against various pathogens. This is the basis for a widespread use of vaccines, administered as injection or immersion, in the aquaculture industry. It has been described that repeated injection...... vaccination of fish raises a secondary immune response, consisting of rapid, accelerated and increased antibody reaction. This study reports how rainbow trout responds to repeated immersion vaccination against yersiniosis (ERM) caused by the bacterial pathogen Yersinia ruckeri. It was found that rainbow trout...... does not raise a classical secondary response following repeated immersion vaccination. Serum antibody titres were merely slightly increased even after three immunizations, using 30-s immersion into a bacterin consisting of formalin-inactivated Y. ruckeri (serotype O1, biotypes 1 and 2), performed over...

  6. [Comparison of immune response after oral and intranasal immunization with recombinant Lactobacillus casei expressing ETEC F41].

    Science.gov (United States)

    Liu, Jiankui; Wei, Chunhua; Hou, Xilin; Wang, Guihua; Yu, Liyun

    2009-04-01

    In order to represent a promising strategy for mucosal vaccination, oral or intranasal immunization of Specific Pathogen Free (SPF) BALB/c mice were performed. The mucosal immunity, systemic immune and protective immune responses were compared after immunization with the recombinant Lactobacillus casei (L. casei) harboring enterotoxigenic Escherichia coli (ETEC) F41. The recombinant fusion proteins were detected by Western blot. Surface localization of the fusion protein was verified by immunofluorescence microscopy and flow cytometry. Six-week-old female SPF BALB/c mice (160 heads) were divided into 4 groups for immunization and control. Oral and intranasal immunization of mice was performed with the recombinant strain L. casei harboring pLA-F41 or pLA. For oral immunization, the mice were inoculated daily on days 0 to 4, 7 to 11, 21 to 25, and 49 to 53. A lighter schedule was used for nasal immunization (days 0 to 2, 7 to 9, 21 and 49). Specific anti-F41 IgG antibody in the serum and specific anti-F41 secret immunoglobulin A (sIgA) antibody in the lung, intestines, vagina fluid and feces of mice were detected by indirect ELISA. The mice orally or intranasally immunized with pLA-F41/L. casei and pLA/IL. casei were challenged with standard-type ETEC F41 (C83919) (2 x 10(3) LD50). Mice immunized with pLA-F41/L. casei could produce remarkable anti-F41 antibody level. More than 90% survived in oral immunization group whereas more than 85% survived in intranasal immunization group after challenged with C83919, all dead in the control group. Ninety percent of the pups survived in oral immunization group whereas 80% survived in intranasal immunization group after challenged with C83919, but only a 5% survival rate for pups that were either immunized with a control pLA vector or unimmunized. Oral or intranasal immunization with recombinant L. casei displaying ETEC F41 antigens on the surface induced effective and similar systemic and mucosal immune responses against the

  7. Immune system development during early childhood in tropical Latin America: evidence for the age-dependent down regulation of the innate immune response.

    Science.gov (United States)

    Teran, Rommy; Mitre, Edward; Vaca, Maritza; Erazo, Silvia; Oviedo, Gisela; Hübner, Marc P; Chico, Martha E; Mattapallil, Joseph J; Bickle, Quentin; Rodrigues, Laura C; Cooper, Philip J

    2011-03-01

    The immune response that develops in early childhood underlies the development of inflammatory diseases such as asthma and there are few data from tropical Latin America (LA). This study investigated the effects of age on the development of immunity during the first 5 years of life by comparing innate and adaptive immune responses in Ecuadorian children aged 6-9 months, 22-26 months, and 48-60 months. Percentages of naïve CD4+ T cells declined with age while those of memory CD4(+) and CD8(+) T cells increased indicating active development of the immune system throughout the first five years. Young infants had greater innate immune responses to TLR agonists compared to older children while regulatory responses including SEB-induced IL-10 and percentages of FoxP3(+) T-regulatory cells decreased with age. Enhanced innate immunity in early life may be important for host defense against pathogens but may increase the risk of immunopathology. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. Cloning changes the response to obesity of innate immune factors in blood, liver, and adipose tissues in domestic pigs.

    Science.gov (United States)

    Rødgaard, Tina; Skovgaard, Kerstin; Stagsted, Jan; Heegaard, Peter M H

    2013-06-01

    The objective of this study was to evaluate the usefulness of cloned pigs as porcine obesity models reflecting obesity-associated changes in innate immune factor gene expression profiles. Liver and adipose tissue expression of 43 innate immune genes as well as serum concentrations of six immune factors were analyzed in lean and diet-induced obese cloned domestic pigs and compared to normal domestic pigs (obese and lean). The number of genes affected by obesity was lower in cloned animals than in control animals. All genes affected by obesity in adipose tissues of clones were downregulated; both upregulation and downregulation were observed in the controls. Cloning resulted in a less differentiated adipose tissue expression pattern. Finally, the serum concentrations of two acute-phase proteins (APPs), haptoglobin (HP) and orosomucoid (ORM), were increased in obese clones as compared to obese controls as well as lean clones and controls. Generally, the variation in phenotype between individual pigs was not reduced in cloned siblings as compared to normal siblings. Therefore, we conclude that cloning limits both the number of genes responding to obesity as well as the degree of tissue-differentiated gene expression, concomitantly with an increase in APP serum concentrations only seen in cloned, obese pigs. This may suggest that the APP response seen in obese, cloned pigs is a consequence of the characteristic skewed gene response to obesity in cloned pigs, as described in this work. This should be taken into consideration when using cloned animals as models for innate responses to obesity.

  9. DNA methylation patterns of genes related to immune response in the different clinical forms of oral lichen planus.

    Science.gov (United States)

    Cruz, Aline Fernanda; de Resende, Renata Gonçalves; de Lacerda, Júlio César Tanos; Pereira, Núbia Braga; Melo, Leonardo Augusto; Diniz, Marina Gonçalves; Gomes, Carolina Cavalieri; Gomez, Ricardo Santiago

    2018-01-01

    The oral lichen planus is a chronic inflammatory disease. Although its aetiology is not well understood, the role of T lymphocytes in its inflammatory events is recognised. Identifying the epigenetic mechanisms involved in the pathogenesis of this immune-mediated condition is fundamental for understanding the inflammatory reaction that occurs in the disease. The purpose of this work was to evaluate the methylation pattern of 21 immune response-related genes in the different clinical forms of oral lichen planus. A cross-sectional study was performed to analyse the DNA methylation patterns in three distinct groups of oral lichen planus: (i) reticular/plaque lesions; (ii) erosive lesions; (iii) normal oral mucosa (control group). After DNA extraction from biopsies, the samples were submitted to digestions by methylation-sensitive and methylation-dependent enzymes and double digestion. The relative percentage of methylated DNA for each gene was provided using real-time polymerase chain reaction arrays. Hypermethylation of the STAT5A gene was observed only in the control group (59.0%). A higher hypermethylation of the ELANE gene was found in reticular/plaque lesions (72.1%) compared to the erosive lesions (50.0%). Our results show variations in the methylation profile of immune response-related genes, according to the clinical type of oral lichen planus after comparing with the normal oral mucosa. Further studies are necessary to validate these findings using gene expression analysis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Vaxfectin enhances antigen specific antibody titers and maintains Th1 type immune responses to plasmid DNA immunization.

    Science.gov (United States)

    Reyes, L; Hartikka, J; Bozoukova, V; Sukhu, L; Nishioka, W; Singh, G; Ferrari, M; Enas, J; Wheeler, C J; Manthorpe, M; Wloch, M K

    2001-06-14

    Antigen specific immune responses were characterized after intramuscular immunization of BALB/c mice with 5 antigen encoding plasmid DNAs (pDNAs) complexed with Vaxfectin, a cationic lipid formulation. Vaxfectin increased IgG titers for all of the antigens with no effect on the CTL responses to the 2 antigens for which CTL assays were performed. Both antigen specific IgG1 and IgG2a were increased, although IgG2a remained greater than IgG1. Furthermore, Vaxfectin had no effect on IFN-gamma or IL-4 production by splenocytes re-stimulated with antigen, suggesting that the Th1 type responses typical of intramuscular pDNA immunization were not altered. Studies with IL-6 -/- mice suggest that the antibody enhancement is IL-6 dependent and results in a correlative increase in antigen specific antibody secreting cells.

  11. Roles of Zinc Signaling in the Immune System.

    Science.gov (United States)

    Hojyo, Shintaro; Fukada, Toshiyuki

    2016-01-01

    Zinc (Zn) is an essential micronutrient for basic cell activities such as cell growth, differentiation, and survival. Zn deficiency depresses both innate and adaptive immune responses. However, the precise physiological mechanisms of the Zn-mediated regulation of the immune system have been largely unclear. Zn homeostasis is tightly controlled by the coordinated activity of Zn transporters and metallothioneins, which regulate the transport, distribution, and storage of Zn. There is growing evidence that Zn behaves like a signaling molecule, facilitating the transduction of a variety of signaling cascades in response to extracellular stimuli. In this review, we highlight the emerging functional roles of Zn and Zn transporters in immunity, focusing on how crosstalk between Zn and immune-related signaling guides the normal development and function of immune cells.

  12. Innate immune responses to gut microbiota differ between oceanic and freshwater threespine stickleback populations

    Directory of Open Access Journals (Sweden)

    Kathryn Milligan-Myhre

    2016-02-01

    Full Text Available Animal hosts must co-exist with beneficial microbes while simultaneously being able to mount rapid, non-specific, innate immune responses to pathogenic microbes. How this balance is achieved is not fully understood, and disruption of this relationship can lead to disease. Excessive inflammatory responses to resident microbes are characteristic of certain gastrointestinal pathologies such as inflammatory bowel disease (IBD. The immune dysregulation of IBD has complex genetic underpinnings that cannot be fully recapitulated with single-gene-knockout models. A deeper understanding of the genetic regulation of innate immune responses to resident microbes requires the ability to measure immune responses in the presence and absence of the microbiota using vertebrate models with complex genetic variation. Here, we describe a new gnotobiotic vertebrate model to explore the natural genetic variation that contributes to differences in innate immune responses to microbiota. Threespine stickleback, Gasterosteus aculeatus, has been used to study the developmental genetics of complex traits during the repeated evolution from ancestral oceanic to derived freshwater forms. We established methods to rear germ-free stickleback larvae and gnotobiotic animals monoassociated with single bacterial isolates. We characterized the innate immune response of these fish to resident gut microbes by quantifying the neutrophil cells in conventionally reared monoassociated or germ-free stickleback from both oceanic and freshwater populations grown in a common intermediate salinity environment. We found that oceanic and freshwater fish in the wild and in the laboratory share many intestinal microbial community members. However, oceanic fish mount a strong immune response to residential microbiota, whereas freshwater fish frequently do not. A strong innate immune response was uniformly observed across oceanic families, but this response varied among families of freshwater fish

  13. Inhibition of the immune response to experimental fresh osteoarticular allografts

    International Nuclear Information System (INIS)

    Rodrigo, J.J.; Schnaser, A.M.; Reynolds, H.M. Jr.; Biggart, J.M. III; Leathers, M.W.; Chism, S.E.; Thorson, E.; Grotz, T.; Yang, Q.M.

    1989-01-01

    The immune response to osteoarticular allografts is capable of destroying the cartilage--a tissue that has antigens on its cells identical to those on the bone and marrow cells. Osteoarticular allografts of the distal femur were performed in rats using various methods to attempt to temporarily inhibit the antibody response. The temporary systemic immunosuppressant regimens investigated were cyclophosphamide, azathioprine and prednisolone, cyclosporine A, and total lymphoid irradiation. The most successful appeared to be cyclosporine A, but significant side effects were observed. To specifically inhibit the immune response in the allograft antigens without systemically inhibiting the entire immune system, passive enhancement and preadministration of donor blood were tried. Neither was as effective as coating the donor bone with biodegradable cements, a method previously found to be successful. Cyclosporine A was investigated in dogs in a preliminary study of medial compartmental knee allografts and was found to be successful in inhibiting the antibody response and in producing a more successful graft; however, some significant side effects were similarly observed

  14. The effects of BCG, cyclophosphamide and x-radiation on reticuloendothelial system and immune responsiveness in mice, 1

    International Nuclear Information System (INIS)

    Harada, Susumu

    1978-01-01

    The effects of BCG and x-radiation of sublethal dose on reticuloendothelial system (RES) were studied in mice. An attempt was also made to evaluate the action of BCG on the recovery of immune responsiveness in irradiated mice. Carbon clearance test and measurement of spread macrophage in peritoneal cells were used to assay the function of RES. The result of carbon clearance was in good accordance with the one of macrophage spreading test. Either intracutaneous or intravenous administration of BCG increased the activity of RES, and 3 to 5 weeks later, the functional levels of RES reached a maximum. When BCG was given intravenously, the highly increased level of phagocytic activity was obtained even one week after BCG injection. Whereas x-radiation of sublethal dose caused a marked reduction of the number of peritoneal cells, the decrease of RES activity was not found. Although x-radiation suppressed markedly the immune response to sheep red blood cells (SRBC), delayed type reactivity recovered quickly to a normal level. The production of plaque forming cells (PEC) in spleen also recovered within 2 weeks after x-radiation and thereafter increased rather, while PFC in the draining lymph node reduced markedly and its recovery was protracted. BCG inoculation in x-radiated mice could not increase the number of peritoneal cells while it increased the activity of RES and the immune responsiveness to SRBC. BCG inoculation made mice extremely susceptible to pseudomonas infection either 2 to 3 weeks after i.v. inoculation or 5 weeks after i.c. inoculation. But a marked resistance than normal controls was found 10 weeks after the i.c. inoculation of BCG. On the other hand, x-radiation caused a serious damage to protective activity against pseudomonas infection and no increase of resistance throughout experimental period. (auth.)

  15. Study of the immune response to thyroglobulin through a model of experimental autoimmune thyroiditis

    International Nuclear Information System (INIS)

    Santos Castro, M. dos.

    1981-01-01

    The cellular and humoral immune response to thyroglobulin of different species was studied in guinea pigs. The experiments described suggested that the immune system can be activated against self-determinants. Human and pork thyroglobulin were able to induce the experimental thyroiditis as well as some immune responses, such as in vitro proliferative response, delayed hypersensitivity and antibodies. Although guinea pig thyroglobulin was unable to induce specific T-lymphocyte proliferation in vitro, delayed hypersensitivity response and antibodies, it was very efficient in inducing the autoimmune thyroiditis. On the contrary, bovine thyroglobulin did not induce experimental autoimmune thyroiditis despite producing good responses as determined by similar in vitro proliferative response, delayed hypersensitivity and on the humoral level. These results suggest that the assays utilised were not able to evaluate the relevant immune response to genesis of the thyroiditis. The determinant selection mechanisms operating in these immune responses are probably selecting determinants not responsible for self-recognition in vivo. It was suggested that the macrophage could be the cell responsible for the presentation of these determinants to the lymphocyte in an immunogenic form. (Author) [pt

  16. Augmentation of antigen-specific immune responses using DNA-fusogenic liposome vaccine

    International Nuclear Information System (INIS)

    Yoshikawa, Tomoaki; Imazu, Susumu; Gao Jianqing; Hayashi, Kazuyuki; Tsuda, Yasuhiro; Shimokawa, Mariko; Sugita, Toshiki; Niwa, Takako; Oda, Atushi; Akashi, Mitsuru; Tsutsumi, Yasuo; Mayumi, Tadanori; Nakagawa, Shinsaku

    2004-01-01

    In an attempt to enhance the immunological efficacy of genetic immunization, we investigated a new biological means for delivering antigen gene directly to the cytoplasm via membrane fusion. In this context, we investigated fusogenic liposome (FL) encapsulating DNA as a possible genetic immunization vehicle. RT-PCR analysis indicated that a FL could introduce and express encapsulating OVA gene efficiently and rapidly in vitro. Consistent with this observation, an in vitro assay showed that FL-mediated antigen-gene delivery can induce potent presentation of antigen via the MHC class I-dependent pathway. Accordingly, immunization with FL containing the OVA-gene induced potent OVA-specific Th1 and Th2 cytokine production. Additionally, OVA-specific CTL responses and antibody production were also observed in systemic compartments including the spleen, upon immunization with the OVA-gene encapsulating FL. These findings suggest that FL is an effective genetic immunization carrier system for the stimulation of antigen-specific immune responses against its encoding antigen

  17. Immune response capacity after human splenic autotransplantation - Restoration of response to individual pneumococcal vaccine subtypes

    NARCIS (Netherlands)

    Leemans, R; Manson, W; Snijder, JAM; Smit, JW; Klasen, HJ; The, TH; Timens, W

    Objective To evaluate features of general immune function, in particular the restoration of the humoral immune response to pneumococcal capsular polysaccharides, in humans undergoing a spleen autotransplantation after splenectomy because of trauma. Summary Background Data After splenectomy, patients

  18. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus

    DEFF Research Database (Denmark)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter

    2009-01-01

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper...

  19. Evasion of adaptive and innate immune response mechanisms by γ-herpesviruses

    Science.gov (United States)

    Feng, Pinghui; Moses, Ashlee; Früh, Klaus

    2015-01-01

    γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies. PMID:23735334

  20. Induction of complex immune responses and strong protection against retrovirus challenge by adenovirus-based immunization depends on the order of vaccine delivery.

    Science.gov (United States)

    Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke

    2017-02-06

    In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.

  1. Ageing and the humoral immune response in mice

    International Nuclear Information System (INIS)

    Blankwater, M.J.

    1978-01-01

    The study presented in this thesis is concerned with changes in the humoral immune system as a function of age in different inbred mouse strains. Their capacity to develop humoral immune responses to experimentally given thymus-dependent and thymus-independent antigens under various conditions is compared. Furthermore, experiments employing thymus transplantation and thymic humoral factors which are directed at the restoration of the diminished T cell functions in old age are reported. (Auth.)

  2. Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.

    Science.gov (United States)

    Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna

    2014-01-01

    Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.

  3. Immune response and biochemistry of calves immunized with rMSP1a ( Anaplasma marginale using carbon nanotubes as carrier molecules

    Directory of Open Access Journals (Sweden)

    Bruna Torres Silvestre

    2018-05-01

    Full Text Available Abstract Vaccination against Anaplasma marginale has been considered an important control strategy for bovine anaplasmosis. Recently, mice immunized with rMSP1 a linked to carbon nanotubes (MWNT showed significant immune responses, generating a new possibility for use of an inactivated vaccine. The objective of this study was to investigate the cellular and humoral responses in calves immunized with MWNT+rMSP1a , associated with inactivated vaccine of A. marginale produced in vitro, and evaluate the toxic effects of the MWNT on renal and hepatic function. rMSP1a was covalently linked to MWNT. Inactivated vaccine (AmUFMG2 was produced by cultivating A. marginale in IDE8 cells. Twenty-four Holstein calves were divided (four groups and immunized subcutaneously with PBS and non-carboxylated MWNT (control, G1, AmUFMG2 (G2, MWNT+rMSP1a (G3, and AmUFMG2 with MWNT+rMSP1a (G4. Blood samples were collected for total leukocyte counts, biochemical profiling and evaluation of the cellular and humoral response. Immunization with MWNT+rMSP1a induced increase in the total number of leukocytes, NK cells, in the lymphocyte populations and higher levels of antibodies compared to calves immunized only with AmUFMG2. Furthermore, MWNT did not induce changes in the biochemical profile. These data indicate that MWNT+rMSP1a were able to induce the immune responses more efficiently than AmUFMG2 alone, without generating toxicity.

  4. Work stress and innate immune response.

    Science.gov (United States)

    Boscolo, P; Di Gioacchino, M; Reale, M; Muraro, R; Di Giampaolo, L

    2011-01-01

    Several reports highlight the relationship between blood NK cytotoxic activity and life style. Easy life style, including physical activity, healthy dietary habits as well as good mental health are characterized by an efficient immune response. Life style is related to the type of occupational activity since work has a central part in life either as source of income or contributing to represent the social identity. Not only occupational stress, but also job loss or insecurity are thus considered serious stressful situations, inducing emotional disorders which may affect both neuroendocrine and immune systems; reduced reactivity to mitogens and/or decreased blood NK cytotoxic activity was reported in unemployed workers or in those with a high perception of job insecurity and/or job stress. Although genetic factors have a key role in the pathogenesis of autoimmune disorders, occupational stress (as in night shifts) was reported associated to an increased incidence of autoimmune disorders. Monitoring blood NK response may thus be included in the health programs as an indirect index of stressful job and/or poor lifestyle.

  5. Non specific immune response in the African catfish ...

    African Journals Online (AJOL)

    Non specific immune response in the African catfish, Heterobranchus longifilis fed diets fortified with ethanolic extracts of selected traditional medicinal plants and disease resistance against Pseudomonas aeruginosa.

  6. Immune Response in Mussels To Environmental Pollution.

    Science.gov (United States)

    Pryor, Stephen C.; Facher, Evan

    1997-01-01

    Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)

  7. Muscles provide protection during microbial infection by activating innate immune response pathways in Drosophila and zebrafish

    Directory of Open Access Journals (Sweden)

    Arunita Chatterjee

    2016-06-01

    Full Text Available Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual.

  8. Enhanced responses to tumor immunization following total body irradiation are time-dependent.

    Directory of Open Access Journals (Sweden)

    Adi Diab

    Full Text Available The development of successful cancer vaccines is contingent on the ability to induce effective and persistent anti-tumor immunity against self-antigens that do not typically elicit immune responses. In this study, we examine the effects of a non-myeloablative dose of total body irradiation on the ability of tumor-naïve mice to respond to DNA vaccines against melanoma. We demonstrate that irradiation followed by lymphocyte infusion results in a dramatic increase in responsiveness to tumor vaccination, with augmentation of T cell responses to tumor antigens and tumor eradication. In irradiated mice, infused CD8(+ T cells expand in an environment that is relatively depleted in regulatory T cells, and this correlates with improved CD8(+ T cell functionality. We also observe an increase in the frequency of dendritic cells displaying an activated phenotype within lymphoid organs in the first 24 hours after irradiation. Intriguingly, both the relative decrease in regulatory T cells and increase in activated dendritic cells correspond with a brief window of augmented responsiveness to immunization. After this 24 hour window, the numbers of dendritic cells decline, as does the ability of mice to respond to immunizations. When immunizations are initiated within the period of augmented dendritic cell activation, mice develop anti-tumor responses that show increased durability as well as magnitude, and this approach leads to improved survival in experiments with mice bearing established tumors as well as in a spontaneous melanoma model. We conclude that irradiation can produce potent immune adjuvant effects independent of its ability to induce tumor ablation, and that the timing of immunization and lymphocyte infusion in the irradiated host are crucial for generating optimal anti-tumor immunity. Clinical strategies using these approaches must therefore optimize such parameters, as the correct timing of infusion and vaccination may mean the difference

  9. Immune responses against SARS-coronavirus nucleocapsid protein induced by DNA vaccine

    International Nuclear Information System (INIS)

    Zhao Ping; Cao Jie; Zhao Lanjuan; Qin Zhaolin; Ke Jinshan; Pan Wei; Ren Hao; Yu Jianguo; Qi Zhongtian

    2005-01-01

    The nucleocapsid (N) protein of SARS-coronavirus (SARS-CoV) is the key protein for the formation of the helical nucleocapsid during virion assembly. This protein is believed to be more conserved than other proteins of the virus, such as spike and membrane glycoprotein. In this study, the N protein of SARS-CoV was expressed in Escherichia coli DH5α and identified with pooled sera from patients in the convalescence phase of SARS. A plasmid pCI-N, encoding the full-length N gene of SARS-CoV, was constructed. Expression of the N protein was observed in COS1 cells following transfection with pCI-N. The immune responses induced by intramuscular immunization with pCI-N were evaluated in a murine model. Serum anti-N immunoglobulins and splenocytes proliferative responses against N protein were observed in immunized BALB/c mice. The major immunoglobulin G subclass recognizing N protein was immunoglobulin G2a, and stimulated splenocytes secreted high levels of gamma interferon and IL-2 in response to N protein. More importantly, the immunized mice produced strong delayed-type hypersensitivity (DTH) and CD8 + CTL responses to N protein. The study shows that N protein of SARS-CoV not only is an important B cell immunogen, but also can elicit broad-based cellular immune responses. The results indicate that the N protein may be of potential value in vaccine development for specific prophylaxis and treatment against SARS

  10. Indian Hedgehog Suppresses a Stromal Cell–Driven Intestinal Immune Response

    Directory of Open Access Journals (Sweden)

    B. Florien Westendorp

    2018-01-01

    Conclusions: We show that epithelium-derived Indian Hedgehog signals exclusively to fibroblasts in the intestine. Loss of Ihh leads to a rapid immune response with up-regulation of fibroblast-derived CXCL12, and migration of immune cells into the lamina propria.

  11. Memory B-Cell and Antibody Responses Induced by Plasmodium falciparum Sporozoite Immunization

    NARCIS (Netherlands)

    Nahrendorf, W.; Scholzen, A.; Bijker, E.M.; Teirlinck, A.C.; Bastiaens, G.J.H.; Schats, R.; Hermsen, C.C.; Visser, L.G.; Langhorne, J.; Sauerwein, R.W.

    2014-01-01

    BACKGROUND: Immunization of healthy volunteers during receipt of chemoprophylaxis with Plasmodium falciparum sporozoites (CPS-immunization) induces sterile protection from malaria. Antibody responses have long been known to contribute to naturally acquired immunity against malaria, but their

  12. Dietary Animal Plasma Proteins Improve the Intestinal Immune Response in Senescent Mice.

    Science.gov (United States)

    Miró, Lluïsa; Garcia-Just, Alba; Amat, Concepció; Polo, Javier; Moretó, Miquel; Pérez-Bosque, Anna

    2017-12-11

    Increased life expectancy has promoted research on healthy aging. Aging is accompanied by increased non-specific immune activation (inflammaging) which favors the appearance of several disorders. Here, we study whether dietary supplementation with spray-dried animal plasma (SDP), which has been shown to reduce the activation of gut-associated lymphoid tissue (GALT) in rodents challenged by S. aureus enterotoxin B (SEB), and can also prevent the effects of aging on immune system homeostasis. We first characterized GALT in a mouse model of accelerated senescence (SAMP8) at different ages (compared to mice resistant to accelerated senescence; SAMR1). Second, we analyzed the SDP effects on GALT response to an SEB challenge in SAMP8 mice. In GALT characterization, aging increased the cell number and the percentage of activated Th lymphocytes in mesenteric lymph nodes and Peyer's patches (all, p < 0.05), as well as the expression of IL-6 and TNF-α in intestinal mucosa (both, p < 0.05). With respect to GALT response to the SEB challenge, young mice showed increased expression of intestinal IL-6 and TNF-α, as well as lymphocyte recruitment and activation (all, p < 0.05). However, the immune response of senescent mice to the SEB challenge was weak, since SEB did not change cell recruitment or the percentage of activated Th lymphocytes. Mice supplemented with SDP showed improved capacity to respond to the SEB challenge, similar to the response of the young mice. These results indicate that senescent mice have an impaired mucosal immune response characterized by unspecific GALT activation and a weak specific immune response. SDP supplementation reduces non-specific basal immune activation, allowing for the generation of specific responses.

  13. The effect of zinc and vitamin C supplementation on hemoglobin and hematocrit levels and immune response in patients with Plasmodium vivax malaria.

    Science.gov (United States)

    Zen Rahfiludin, M; Ginandjar, Praba

    2013-09-01

    Plasmodium vivax infection in humans can relapse and is associated with iron deficiency. The immune response plays an important role in preventing relapse. In this study we analyzed the effect of zinc and vitamin C supplementation on hemoglobin and hematocrit levels and immune response in patients with P. vivax malaria. We measured immune response by examining interferon gamma (IFN-gamma) and interleukin-10 (IL-10) levels. Subjects were divided into either treatment or control groups. The treatment group received daily zinc and vitamin C supplementation for 45 days. Compliance with supplement consumption was recorded weekly. After 45 days of supplementation, IFN-gamma and IL-1 levels were remeasured. All study subjects in both groups had normal hemoglobin and hematocrit levels. The hemoglobin levels increased only in the supplementation group (p=0.011), while hematocrit levels increased in both the supplementation (p=0.001) and control (p=0.023) groups. IFN-gamma decreased slightly in the supplementation group, but the change was not significant (p=0.688). IL-10 increased slightly in both the supplementation and the control groups, but the change were not significant (p=0.421 and p=0.556, respectively), suggesting the elevated hemoglobin and hematocrit levels were unrelated to immune response.

  14. Predictors of responses to immune checkpoint blockade in advanced melanoma

    DEFF Research Database (Denmark)

    Jacquelot, N; Roberti, M P; Enot, D P

    2017-01-01

    Immune checkpoint blockers (ICB) have become pivotal therapies in the clinical armamentarium against metastatic melanoma (MMel). Given the frequency of immune related adverse events and increasing use of ICB, predictors of response to CTLA-4 and/or PD-1 blockade represent unmet clinical needs....... Using a systems biology-based approach to an assessment of 779 paired blood and tumor markers in 37 stage III MMel patients, we analyzed association between blood immune parameters and the functional immune reactivity of tumor-infiltrating cells after ex vivo exposure to ICB. Based on this assay, we...

  15. Evaluation value of intestinal flora detection for intestinal mucosal inflammation and immune response in patients with ulcerative colitis

    Directory of Open Access Journals (Sweden)

    Yan Zou

    2017-09-01

    Full Text Available Objective: To study the evaluation value of intestinal flora detection for intestinal mucosal inflammatory response and immune response in patients with ulcerative colitis. Methods: The patients who were diagnosed with ulcerative colitis in Zigong Fifth People’s Hospital between March 2015 and February 2017 were selected as the UC group, and those who were diagnosed with colonic polyps were selected as the control group. Fresh excreta were collected to detect the number of intestinal flora, and the diseased intestinal mucosa tissue was collected to detect the expression of inflammatory response molecules and immune cell transcription factors. Results: enterococcus contents in intestinal tract and TLR4, NF-kB, TNF-α, HMGB-1, T-bet and RORC mRNA expression levels in intestinal mucosa of UC group were significantly higher than those of control group while bifidobacteria contents in intestinal tract and SOCS2, SOCS3, Foxp3 and GATA-3 mRNA expression levels were significantly lower than those of control group; TLR4, NF-kB, TNF-α, HMGB-1, T-bet and RORC mRNA expression levels in intestinal mucosa of UC patients with grade II and grade III flora disturbance were significantly higher than those of UC patients with normal flora and grade I flora disturbance while SOCS2, SOCS3, Foxp3 and GATA-3 mRNA expression levels were significantly lower than those of UC patients with normal flora and grade I flora disturbance; TLR4, NF-kB, TNF-α, HMGB-1, T-bet and RORC mRNA expression levels in intestinal mucosa of UC patients with grade III flora disturbance were significantly higher than those of UC patients with grade II flora disturbance while SOCS2, SOCS3, Foxp3 and GATA-3 mRNA expression levels were significantly lower than those of UC patients with grade II flora disturbance. Conclusion: The intestinal flora disturbance in patients with ulcerative colitis can result in inflammatory response activation and immune response disorder.

  16. Effects of alcohol consumption on the allergen-specific immune response in mice

    DEFF Research Database (Denmark)

    Linneberg, Allan; Roursgaard, Martin; Hersoug, Lars-Georg

    2008-01-01

    There is evidence that chronic alcohol consumption impairs the T-helper 1 (Th1) lymphocyte-regulated cell-mediated immune response possibly favoring a Th2 deviation of the immune response. Moreover, a few epidemiological studies have linked alcohol consumption to allergen-specific IgE sensitization....

  17. The Basic Immune Simulator: An agent-based model to study the interactions between innate and adaptive immunity

    Directory of Open Access Journals (Sweden)

    Orosz Charles G

    2007-09-01

    Full Text Available Abstract Background We introduce the Basic Immune Simulator (BIS, an agent-based model created to study the interactions between the cells of the innate and adaptive immune system. Innate immunity, the initial host response to a pathogen, generally precedes adaptive immunity, which generates immune memory for an antigen. The BIS simulates basic cell types, mediators and antibodies, and consists of three virtual spaces representing parenchymal tissue, secondary lymphoid tissue and the lymphatic/humoral circulation. The BIS includes a Graphical User Interface (GUI to facilitate its use as an educational and research tool. Results The BIS was used to qualitatively examine the innate and adaptive interactions of the immune response to a viral infection. Calibration was accomplished via a parameter sweep of initial agent population size, and comparison of simulation patterns to those reported in the basic science literature. The BIS demonstrated that the degree of the initial innate response was a crucial determinant for an appropriate adaptive response. Deficiency or excess in innate immunity resulted in excessive proliferation of adaptive immune cells. Deficiency in any of the immune system components increased the probability of failure to clear the simulated viral infection. Conclusion The behavior of the BIS matches both normal and pathological behavior patterns in a generic viral infection scenario. Thus, the BIS effectively translates mechanistic cellular and molecular knowledge regarding the innate and adaptive immune response and reproduces the immune system's complex behavioral patterns. The BIS can be used both as an educational tool to demonstrate the emergence of these patterns and as a research tool to systematically identify potential targets for more effective treatment strategies for diseases processes including hypersensitivity reactions (allergies, asthma, autoimmunity and cancer. We believe that the BIS can be a useful addition to

  18. Persistence of the immune response induced by BCG vaccination

    Directory of Open Access Journals (Sweden)

    Blitz Rose

    2008-01-01

    Full Text Available Abstract Background Although BCG vaccination is recommended in most countries of the world, little is known of the persistence of BCG-induced immune responses. As novel TB vaccines may be given to boost the immunity induced by neonatal BCG vaccination, evidence concerning the persistence of the BCG vaccine-induced response would help inform decisions about when such boosting would be most effective. Methods A randomised control study of UK adolescents was carried out to investigate persistence of BCG immune responses. Adolescents were tested for interferon-gamma (IFN-γ response to Mycobacterium tuberculosis purified protein derivative (M.tb PPD in a whole blood assay before, 3 months, 12 months (n = 148 and 3 years (n = 19 after receiving teenage BCG vaccination or 14 years after receiving infant BCG vaccination (n = 16. Results A gradual reduction in magnitude of response was evident from 3 months to 1 year and from 1 year to 3 years following teenage vaccination, but responses 3 years after vaccination were still on average 6 times higher than before vaccination among vaccinees. Some individuals (11/86; 13% failed to make a detectable antigen-specific response three months after vaccination, or lost the response after 1 (11/86; 13% or 3 (3/19; 16% years. IFN-γ response to Ag85 was measured in a subgroup of adolescents and appeared to be better maintained with no decline from 3 to 12 months. A smaller group of adolescents were tested 14 years after receiving infant BCG vaccination and 13/16 (81% made a detectable IFN-γ response to M.tb PPD 14 years after infant vaccination as compared to 6/16 (38% matched unvaccinated controls (p = 0.012; teenagers vaccinated in infancy were 19 times more likely to make an IFN-γ response of > 500 pg/ml than unvaccinated teenagers. Conclusion BCG vaccination in infancy and adolescence induces immunological memory to mycobacterial antigens that is still present and measurable for at least 14 years in the

  19. [Effect of vitamine A on mice immune response induced by specific periodontal pathogenic bacteria-immunization].

    Science.gov (United States)

    Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai

    2010-12-01

    The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (Pvitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).

  20. F4+ ETEC infection and oral immunization with F4 fimbriae elicits an IL-17-dominated immune response.

    Science.gov (United States)

    Luo, Yu; Van Nguyen, Ut; de la Fe Rodriguez, Pedro Y; Devriendt, Bert; Cox, Eric

    2015-10-21

    Enterotoxigenic Escherichia coli (ETEC) are an important cause of post-weaning diarrhea (PWD) in piglets. Porcine-specific ETEC strains possess different fimbrial subtypes of which F4 fimbriae are the most frequently associated with ETEC-induced diarrhea in piglets. These F4 fimbriae are potent oral immunogens that induce protective F4-specific IgA antibody secreting cells at intestinal tissues. Recently, T-helper 17 (Th17) cells have been implicated in the protection of the host against extracellular pathogens. However, it remains unknown if Th17 effector responses are needed to clear ETEC infections. In the present study, we aimed to elucidate if ETEC elicits a Th17 response in piglets and if F4 fimbriae trigger a similar response. F4(+) ETEC infection upregulated IL-17A, IL-17F, IL-21 and IL-23p19, but not IL-12 and IFN-γ mRNA expression in the systemic and mucosal immune system. Similarly, oral immunization with F4 fimbriae triggered a Th17 signature evidenced by an upregulated mRNA expression of IL-17F, RORγt, IL-23p19 and IL-21 in the peripheral blood mononuclear cells (PBMCs). Intriguingly, IL-17A mRNA levels were unaltered. To further evaluate this difference between systemic and mucosal immune responses, we assayed the cytokine mRNA profile of F4 fimbriae stimulated PBMCs. F4 fimbriae induced IL-17A, IL-17F, IL-22 and IL-23p19, but downregulated IL-17B mRNA expression. Altogether, these data indicate a Th17 dominated response upon oral immunization with F4 fimbriae and F4(+) ETEC infection. Our work also highlights that IL-17B and IL-17F participate in the immune response to protect the host against F4(+) ETEC infection and could aid in the design of future ETEC vaccines.

  1. Inflammation and Immune Response in COPD: Where Do We Stand?

    Directory of Open Access Journals (Sweden)

    Nikoletta Rovina

    2013-01-01

    Full Text Available Increasing evidence indicates that chronic inflammatory and immune responses play key roles in the development and progression of COPD. Recent data provide evidence for a role in the NLRP3 inflammasome in the airway inflammation observed in COPD. Cigarette smoke activates innate immune cells by triggering pattern recognition receptors (PRRs to release “danger signal”. These signals act as ligands to Toll-like receptors (TLRs, triggering the production of cytokines and inducing innate inflammation. In smokers who develop COPD there appears to be a specific pattern of inflammation in the airways and parenchyma as a result of both innate and adaptive immune responses, with the predominance of CD8+ and CD4+ cells, and in the more severe disease, with the presence of lymphoid follicles containing B lymphocytes and T cells. Furthermore, viral and bacterial infections interfere with the chronic inflammation seen in stable COPD and exacerbations via pathogen-associated molecular patterns (PAMPs. Finally, autoimmunity is another novel aspect that may play a critical role in the pathogenesis of COPD. This review is un update of the currently discussed roles of inflammatory and immune responses in the pathogenesis of COPD.

  2. HIF-mediated innate immune responses: cell signaling and therapeutic implications

    Directory of Open Access Journals (Sweden)

    Harris AJ

    2014-05-01

    Full Text Available Alison J Harris, AA Roger Thompson, Moira KB Whyte, Sarah R Walmsley Academic Unit of Respiratory Medicine, Department of Infection and Immunity, University of Sheffield, Sheffield, UK Abstract: Leukocytes recruited to infected, damaged, or inflamed tissues during an immune response must adapt to oxygen levels much lower than those in the circulation. Hypoxia inducible factors (HIFs are key mediators of cellular responses to hypoxia and, as in other cell types, HIFs are critical for the upregulation of glycolysis, which enables innate immune cells to produce adenosine triphosphate anaerobically. An increasing body of evidence demonstrates that hypoxia also regulates many other innate immunological functions, including cell migration, apoptosis, phagocytosis of pathogens, antigen presentation and production of cytokines, chemokines, and angiogenic and antimicrobial factors. Many of these functions are mediated by HIFs, which are not only stabilized posttranslationally by hypoxia, but also transcriptionally upregulated by inflammatory signals. Here, we review the role of HIFs in the responses of innate immune cells to hypoxia, both in vitro and in vivo, with a particular focus on myeloid cells, on which the majority of studies have so far been carried out. Keywords: hypoxia, neutrophils, monocytes, macrophages

  3. Glycan-mediated modification of the immune response

    DEFF Research Database (Denmark)

    Madsen, Caroline B; Pedersen, Anders E; Wandall, Hans H

    2013-01-01

    Aberrantly glycosylated tumor antigens represent promising targets for the development of anti-cancer vaccines, yet how glycans influence immune responses is poorly understood. Recent studies have demonstrated that GalNAc-glycosylation enhances antigen uptake by dendritic cells as well as CD4(+) T......-cell and humoral responses, but prevents CD8(+) T-cell activation. Here, we briefly discuss the relevance of glycans as candidate targets for anti-cancer vaccines....

  4. Modulation of immune response by alloactivated suppressor T cells

    International Nuclear Information System (INIS)

    Bernstein, A.; Sopori, M.L.; Gose, J.E.; Sondel, P.M.

    1979-01-01

    These studies show that there may be several different kinds of suppressor cells, each activated by different pathways and able to suppress different parts of the immune response either specifically or nonspecifically. As such, the physiology of one type of suppressor cell need not necessarily apply to that of another type of suppressor. Thus we emphasize the trap that the suppressor cell option provides: that is, virtually any previously inexplicable in vitro and in vivo immune phenomenon can always be adequately accounted for by evoking a suppressor mechanism, either by suppressing the response or suppressing the suppressor

  5. The role of complement in the acquired immune response

    DEFF Research Database (Denmark)

    Nielsen, C H; Fischer, E M; Leslie, R G

    2000-01-01

    Studies over the past three decades have clearly established a central role for complement in the promotion of a humoral immune response. The primary function of complement, in this regard, is to opsonize antigen or immune complexes for uptake by complement receptor type 2 (CR2, CD21) expressed...... on B cells, follicular dendritic cells (FDC) and some T cells. A variety of mechanisms appear to be involved in complement-mediated promotion of the humoral response. These include: enhancement of antigen (Ag) uptake and processing by both Ag-specific and non-specific B cells for presentation...

  6. Babassu aqueous extract (BAE as an adjuvant for T helper (Th1-dependent immune responses in mice of a Th2 immune response-prone strain

    Directory of Open Access Journals (Sweden)

    Nascimento Flavia RF

    2011-01-01

    Full Text Available Abstract Background The aqueous extract of a Brazilian palm-tree fruit - the babassu - (BAE exerts a clear immunostimulative activity in vivo. In the present work, the possibility that BAE can promote Th1 immune responses in mice of a Th2 immune response-prone strain - the BALB/c was investigated. BAE itself, and preparations consisting of Leishmania amazonensis promastigote extract (LE, adsorbed or not to Al(OH3, and in the presence or not of BAE, were used as immunogens. LE and Al(OH3 have been shown to preferentially elicit Th2 immune responses. Results The addition of BAE to LE-containing immunogenic preparations, adsorbed or not to Al(OH3, clearly promoted the in vitro production of interferon γ (IFN-γ, a major Th1-dependent cytokine, and not of interleukin (IL-4 (a Th2-dependent cytokine, by LE-stimulated splenocytes of immunized BALB/c mice. It also promoted the in vivo formation of IgG2a anti-LE antibodies. However, immunization with LE by itself led to an increased production of IL-4 by LE-stimulated splenocytes, and this production, albeit not enhanced, was not reduced by the addition of BAE to the immunogen. On the other hand, the IL-4 production by LE-stimulated splenocytes was significantly lower in mice immunized with a preparation containing Al(OH3-adsorbed LE and BAE than in mice immunized with the control preparation of Al(OH3-adsorbed LE without BAE. Moreover, an increased production of IFN-γ, and not of IL-4, was observed in the culture supernatants of splenocytes, from BAE-immunized mice, which were in vitro stimulated with BAE or which received no specific in vitro stimulus. No differences in IL-10 (an immunoregulatory cytokine levels in the supernatants of splenocytes from mice that were injected with BAE, in relation to splenocytes from control mice, were observed. The spontaneous ex vivo production of NO by splenocytes of mice that had been injected with BAE was significantly higher than the production of NO by

  7. Oral polio vaccine influences the immune response to BCG vaccination. A natural experiment.

    Science.gov (United States)

    Sartono, Erliyani; Lisse, Ida M; Terveer, Elisabeth M; van de Sande, Paula J M; Whittle, Hilton; Fisker, Ane B; Roth, Adam; Aaby, Peter; Yazdanbakhsh, Maria; Benn, Christine S

    2010-05-21

    Oral polio vaccine (OPV) is recommended to be given at birth together with BCG vaccine. While we were conducting two trials including low-birth-weight (LBW) and normal-birth-weight (NBW) infants in Guinea-Bissau, OPV was not available during some periods and therefore some infants did not receive OPV at birth, but only BCG. We investigated the effect of OPV given simultaneously with BCG at birth on the immune response to BCG vaccine. We compared the in vitro and the in vivo response to PPD in the infants who received OPV and BCG with that of infants who received BCG only. At age 6 weeks, the in vitro cytokine response to purified protein derivate (PPD) of M. Tuberculosis was reduced in LBW and NBW infants who had received OPV with BCG. In a pooled analysis receiving OPV with BCG at birth was associated with significantly lower IL-13 (p = 0.041) and IFN-gamma (p = 0.004) and a tendency for lower IL-10 (p = 0.054) in response to PPD. Furthermore, OPV was associated with reduced in vivo response to PPD at age 2 months, the prevalence ratio (PR) of having a PPD reaction being 0.75 (0.58-0.98), p = 0.033, and with a tendency for reduced likelihood of having a BCG scar (0.95 (0.91-1.00), p = 0.057)). Among children with a scar, OPV was associated with reduced scar size, the regression coefficient being -0.24 (-0.43-0.05), p = 0.012. This study is the first to address the consequences for the immune response to BCG of simultaneous administration with OPV. Worryingly, the results indicate that the common practice in low-income countries of administering OPV together with BCG at birth may down-regulate the response to BCG vaccine.

  8. Oral polio vaccine influences the immune response to BCG vaccination. A natural experiment.

    Directory of Open Access Journals (Sweden)

    Erliyani Sartono

    Full Text Available BACKGROUND: Oral polio vaccine (OPV is recommended to be given at birth together with BCG vaccine. While we were conducting two trials including low-birth-weight (LBW and normal-birth-weight (NBW infants in Guinea-Bissau, OPV was not available during some periods and therefore some infants did not receive OPV at birth, but only BCG. We investigated the effect of OPV given simultaneously with BCG at birth on the immune response to BCG vaccine. METHODS AND FINDINGS: We compared the in vitro and the in vivo response to PPD in the infants who received OPV and BCG with that of infants who received BCG only. At age 6 weeks, the in vitro cytokine response to purified protein derivate (PPD of M. Tuberculosis was reduced in LBW and NBW infants who had received OPV with BCG. In a pooled analysis receiving OPV with BCG at birth was associated with significantly lower IL-13 (p = 0.041 and IFN-gamma (p = 0.004 and a tendency for lower IL-10 (p = 0.054 in response to PPD. Furthermore, OPV was associated with reduced in vivo response to PPD at age 2 months, the prevalence ratio (PR of having a PPD reaction being 0.75 (0.58-0.98, p = 0.033, and with a tendency for reduced likelihood of having a BCG scar (0.95 (0.91-1.00, p = 0.057. Among children with a scar, OPV was associated with reduced scar size, the regression coefficient being -0.24 (-0.43-0.05, p = 0.012. CONCLUSIONS: This study is the first to address the consequences for the immune response to BCG of simultaneous administration with OPV. Worryingly, the results indicate that the common practice in low-income countries of administering OPV together with BCG at birth may down-regulate the response to BCG vaccine.

  9. Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani.

    Directory of Open Access Journals (Sweden)

    Jia-Ying Zhu

    Full Text Available BACKGROUND: Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. METHODOLOGY/PRINCIPAL FINDINGS: In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26% showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. CONCLUSIONS/SIGNIFICANCE: obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular

  10. Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani.

    Science.gov (United States)

    Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin

    2013-01-01

    Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host-parasitoid interaction.

  11. Transcriptomic Immune Response of Tenebrio molitor Pupae to Parasitization by Scleroderma guani

    Science.gov (United States)

    Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin

    2013-01-01

    Background Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. Methodology/Principal Findings In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. Conclusions/Significance obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host

  12. Aspergillus-Associated Airway Disease, Inflammation, and the Innate Immune Response

    Science.gov (United States)

    Chotirmall, Sanjay H.; Al-Alawi, Mazen; Logan, P. Mark; Greene, Catherine M.; McElvaney, Noel G.

    2013-01-01

    Aspergillus moulds exist ubiquitously as spores that are inhaled in large numbers daily. Whilst most are removed by anatomical barriers, disease may occur in certain circumstances. Depending on the underlying state of the human immune system, clinical consequences can ensue ranging from an excessive immune response during allergic bronchopulmonary aspergillosis to the formation of an aspergilloma in the immunocompetent state. The severest infections occur in those who are immunocompromised where invasive pulmonary aspergillosis results in high mortality rates. The diagnosis of Aspergillus-associated pulmonary disease is based on clinical, radiological, and immunological testing. An understanding of the innate and inflammatory consequences of exposure to Aspergillus species is critical in accounting for disease manifestations and preventing sequelae. The major components of the innate immune system involved in recognition and removal of the fungus include phagocytosis, antimicrobial peptide production, and recognition by pattern recognition receptors. The cytokine response is also critical facilitating cell-to-cell communication and promoting the initiation, maintenance, and resolution of the host response. In the following review, we discuss the above areas with a focus on the innate and inflammatory response to airway Aspergillus exposure and how these responses may be modulated for therapeutic benefit. PMID:23971044

  13. Tailoring the Immune Response via Customization of Pathogen Gene Expression.

    Science.gov (United States)

    Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

  14. Differential and site specific impact of B cells in the protective immune response to Mycobacterium tuberculosis in the mouse.

    Directory of Open Access Journals (Sweden)

    Egídio Torrado

    Full Text Available Cell-mediated immune responses are known to be critical for control of mycobacterial infections whereas the role of B cells and humoral immunity is unclear. B cells can modulate immune responses by secretion of immunoglobulin, production of cytokines and antigen-presentation. To define the impact of B cells in the absence of secreted immunoglobulin, we analyzed the progression of Mycobacterium tuberculosis (Mtb infection in mice that have B cells but which lack secretory immunoglobulin (AID(-/-µS(-/-mice. AID(-/-µS(-/- mice accumulated a population of activated B cells in the lungs when infected and were more susceptible to aerosol Mtb when compared to wild type (C57BL/6 mice or indeed mice that totally lack B cells. The enhanced susceptibility of AID(-/-µS(-/- mice was not associated with defective T cell activation or expression of a type 1 immune response. While delivery of normal serum to AID(-/-µS(-/- mice did not reverse susceptibility, susceptibility in the spleen was dependent upon the presence of B cells and susceptibility in the lungs of AID(-/-µS(-/-mice was associated with elevated expression of the cytokines IL-6, GM-CSF, IL-10 and molecules made by alternatively activated macrophages. Blocking of IL-10 signaling resulted in reversal of susceptibility in the spleens and lungs of AID(-/-µS(-/- mice. These data support the hypothesis that B cells can modulate immunity to Mtb in an organ specific manner via the modulation of cytokine production and macrophage activation.

  15. The effect of cyclosporin A on the primary immune response to allogeneic red cells in rabbits.

    Science.gov (United States)

    Smith, G N

    1982-01-01

    Cyclosporin A (CSA) has been used in an attempt to suppress the primary immune response of HgA(A)-negative rabbits to A-positive red cells. The immune response was assessed by measuring the survival of a small intravenous (i.v.) dose of 51Cr-labelled A-positive cells and by testing the serum of the immunized rabbits for anti-A. In one experiment, eight A-negative rabbits were given a first i.v. injection of A-positive red cells, and CSA (25 mg/kg/day) in olive oil was given by mouth for 17-34 days. There was no evidence of impaired alloimmunization compared with the responses in control animals treated with olive oil alone. In a second experiment, eight A-negative rabbits were given a first injection of A-positive muscularly (i.m.), and CSA (25 mg/kg/day) in miglyol was given by im.m. injection for 10 days. Six of these rabbits were rendered unresponsive, and the remaining two, who showed impaired survival of the monitoring red cells, produced only low anit-A titres. Seven out of eight controls given i.m. miglyol without CSA responded with good anti-A production. Rabbits that were unresponsive to A-positive red cells responded normally to sheep red blood cells 15 weeks after CSA treatment. Higher serum levels of CSA were found following i.m. administration of the drug but treatment by this route as associated with severe toxicity in some rabbits. PMID:7056563

  16. Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.

    Science.gov (United States)

    Zhang, Jie; Liu, Huan; Wei, Bin

    Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.

  17. The immune system strikes back: cellular immune responses against indoleamine 2,3-dioxygenase

    DEFF Research Database (Denmark)

    Sørensen, Rikke Baek; Berge-Hansen, Linda; Junker, Niels

    2009-01-01

    BACKGROUND: The enzyme indoleamine 2,3-dioxygenase (IDO) exerts an well established immunosuppressive function in cancer. IDO is expressed within the tumor itself as well as in antigen-presenting cells in tumor-draining lymph nodes, where it promotes the establishment of peripheral immune tolerance...... to tumor antigens. In the present study, we tested the notion whether IDO itself may be subject to immune responses. METHODS AND FINDINGS: The presence of naturally occurring IDO-specific CD8 T cells in cancer patients was determined by MHC/peptide stainings as well as ELISPOT. Antigen specific cytotoxic T...... of the major immune suppressive cell populations. CONCLUSION: IDO may serve as an important and widely applicable target for anti-cancer immunotherapeutic strategies. Furthermore, as emerging evidence suggests that IDO constitutes a significant counter-regulatory mechanism induced by pro-inflammatory signals...

  18. Adoptive transfer of natural antibodies to non-immunized chickens affects subsequent antigen-specific humoral and cellular immune responses

    NARCIS (Netherlands)

    Lammers, A.; Klomp, M.E.V.; Nieuwland, M.G.B.; Savelkoul, H.F.J.; Parmentier, H.K.

    2004-01-01

    To determine a regulatory function of natural antibodies in the immune response of chickens, pooled plasma obtained from non-immunized (naive) 15 months old hens was subjected to keyhole limpet hemocyanin (KLH) antigen-affinity chromatography. Purified KLH-binding antibodies were adoptively

  19. Polysaccharides isolated from Açaí fruit induce innate immune responses.

    Directory of Open Access Journals (Sweden)

    Jeff Holderness

    2011-02-01

    Full Text Available The Açaí (Acai fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease.

  20. The Relationship Between Morphological Symmetry and Immune Response in Wild-Caught Adult Bush-Crickets

    Directory of Open Access Journals (Sweden)

    Åsa Berggren

    2009-09-01

    Full Text Available Despite interest in the relationship between fluctuating asymmetry (FA, immune response and ecological factors in insects, little data are available from wild populations. In this study we measured FA and immune response in 370 wild-caught male bush-crickets, Metrioptera roeseli, from 20 experimentally introduced populations in southern-central Sweden. Individuals with more-symmetric wings had a higher immune response as measured by the cellular encapsulation of a surgically-implanted nylon monofilament. However, we found no relationship between measures of FA in other organs (i.e. tibia and maxillary palp and immune response, suggesting that this pattern may reflect differing selection pressures.

  1. Augmenting Plant Immune Responses and Biological Control by Microbial Determinants

    Directory of Open Access Journals (Sweden)

    Sang Moo Lee

    2015-09-01

    Full Text Available Plant have developed sophisticated defence mechanisms against microbial pathogens. The recent accumulated information allow us to understand the nature of plant immune responses followed by recognition of microbial factors/determinants through cutting-edge genomics and multi-omics techniques. However, the practical approaches to sustain plant health using enhancement of plant immunity is yet to be fully appreciated. Here, we overviewed the general concept and representative examples on the plant immunity. The fungal, bacterial, and viral determinants that was previously reported as the triggers of plant immune responses are introduced and described as the potential protocol of biological control. Specifically, the role of chitin, glucan, lipopolysaccharides/extracellular polysaccharides, microbe/pathogen-associated molecular pattern, antibiotics, mimic-phytohormones, N-acyl homoserine lactone, harpin, vitamins, and volatile organic compounds are considered. We hope that this review stimulates scientific community and farmers to broaden their knowledge on the microbial determinant-based biological control and to apply the technology on the integrated pest management program.

  2. Dietary Animal Plasma Proteins Improve the Intestinal Immune Response in Senescent Mice

    Directory of Open Access Journals (Sweden)

    Lluïsa Miró

    2017-12-01

    Full Text Available Increased life expectancy has promoted research on healthy aging. Aging is accompanied by increased non-specific immune activation (inflammaging which favors the appearance of several disorders. Here, we study whether dietary supplementation with spray-dried animal plasma (SDP, which has been shown to reduce the activation of gut-associated lymphoid tissue (GALT in rodents challenged by S. aureus enterotoxin B (SEB, and can also prevent the effects of aging on immune system homeostasis. We first characterized GALT in a mouse model of accelerated senescence (SAMP8 at different ages (compared to mice resistant to accelerated senescence; SAMR1. Second, we analyzed the SDP effects on GALT response to an SEB challenge in SAMP8 mice. In GALT characterization, aging increased the cell number and the percentage of activated Th lymphocytes in mesenteric lymph nodes and Peyer’s patches (all, p < 0.05, as well as the expression of IL-6 and TNF-α in intestinal mucosa (both, p < 0.05. With respect to GALT response to the SEB challenge, young mice showed increased expression of intestinal IL-6 and TNF-α, as well as lymphocyte recruitment and activation (all, p < 0.05. However, the immune response of senescent mice to the SEB challenge was weak, since SEB did not change cell recruitment or the percentage of activated Th lymphocytes. Mice supplemented with SDP showed improved capacity to respond to the SEB challenge, similar to the response of the young mice. These results indicate that senescent mice have an impaired mucosal immune response characterized by unspecific GALT activation and a weak specific immune response. SDP supplementation reduces non-specific basal immune activation, allowing for the generation of specific responses.

  3. Qualitative and quantitative evaluation of donkeys responses to immunization by rabbits' IgG

    International Nuclear Information System (INIS)

    Hassan, A. M. E.; Saeed, A. M.

    2012-12-01

    In this study two apparently healthy donkeys were immunized with highly pure rabbit's 1gG using a revised protocol. Qualitative test using the same immuno gen was done as a primary test to eva lute the immune system response. However, the same 1gG was iodinated with 1 25I using chloramine T method and the labeled 1gG was used to quantitatively study the immune response. The two donkeys showed good response with the younger one having the best response. The obtained donkey anti rabbit sera was used as separating agent for RIA assay for human PRL. (Author)

  4. L-carnitine: a partner between immune response and lipid metabolism ?

    Directory of Open Access Journals (Sweden)

    Giuseppe Famularo

    1993-01-01

    Full Text Available The authors demonstrated that in vivo administered L-carnitine strongly ameliorated the immune response in both healthy individuals receiving Intralipid and ageing subjects with cardiovascular diseases, as shown by the enhancement of mixed lymphocyte reaction. Notably, in the latter group L-carnitine treatment also resulted in a significant reduction of serum levels of both cholesterol and triglycerides. Therefore, the hypothesis is that L-carnitine supplementation could ameliorate both the dysregulated immune response and the abnormal lipid metabolism in several conditions.

  5. Zymosan-induced immune challenge modifies the stress response of hypoxic air-breathing fish (Anabas testudineus Bloch): Evidence for reversed patterns of cortisol and thyroid hormone interaction, differential ion transporter functions and non-specific immune response.

    Science.gov (United States)

    Simi, S; Peter, Valsa S; Peter, M C Subhash

    2017-09-15

    Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential

  6. Differential immune responses to albumin adducts of reactive intermediates of trichloroethene in MRL+/+ mice

    International Nuclear Information System (INIS)

    Cai Ping; Koenig, Rolf; Khan, M. Firoze; Kaphalia, Bhupendra S.; Ansari, G.A.S.

    2007-01-01

    Trichloroethene (TCE) is an industrial degreasing solvent and widespread environmental contaminant. Exposure to TCE is associated with autoimmunity. The mode of action of TCE is via its oxidative metabolism, and most likely, immunotoxicity is mediated via haptenization of macromolecules and subsequent induction of immune responses. To better understand the role of protein haptenization through TCE metabolism, we immunized MRL+/+ mice with albumin adducts of various TCE reactive intermediates. Serum immunoglobulins and cytokine levels were measured to determine immune responses against haptenized albumin. We found antigen-specific IgG responses of the IgG subtypes IgG 1 , IgG 2a , and IgG 2b , with IgG 1 predominating. Serum levels of G-CSF were increased in immunized mice, suggesting macrophage activation. Liver histology revealed lymphocyte infiltration in the lobules and the portal area following immunization with formyl-albumin. Our findings suggest that proteins haptenized by metabolites of TCE may act as neo-antigens that can induce humoral immune responses and T cell-mediated hepatitis

  7. Characterization of the innate immune response to chronic aspiration in a novel rodent model

    Directory of Open Access Journals (Sweden)

    Lin Shu S

    2007-11-01

    Full Text Available Abstract Background Although chronic aspiration has been associated with several pulmonary diseases, the inflammatory response has not been characterized. A novel rodent model of chronic aspiration was therefore developed in order to investigate the resulting innate immune response in the lung. Methods Gastric fluid or normal saline was instilled into the left lung of rats (n = 48 weekly for 4, 8, 12, or 16 weeks (n = 6 each group. Thereafter, bronchoalveolar lavage specimens were collected and cellular phenotypes and cytokine concentrations of IL-1alpha, IL-1beta, IL-2, IL-4, IL-6, IL-10, GM-CSF, IFN-gamma, TNF-alpha, and TGF-beta were determined. Results Following the administration of gastric fluid but not normal saline, histologic specimens exhibited prominent evidence of giant cells, fibrosis, lymphocytic bronchiolitis, and obliterative bronchiolitis. Bronchoalveolar lavage specimens from the left (treated lungs exhibited consistently higher macrophages and T cells with an increased CD4:CD8 T cell ratio after treatment with gastric fluid compared to normal saline. The concentrations of IL-1alpha, IL-1beta, IL-2, TNF-alpha and TGF-beta were increased in bronchoalveolar lavage specimens following gastric fluid aspiration compared to normal saline. Conclusion This represents the first description of the pulmonary inflammatory response that results from chronic aspiration. Repetitive aspiration events can initiate an inflammatory response consisting of macrophages and T cells that is associated with increased TGF-beta, TNF-alpha, IL-1alpha, IL-1beta, IL-2 and fibrosis in the lung. Combined with the observation of gastric fluid-induced lymphocyitic bronchiolitis and obliterative bronchiolitis, these findings further support an association between chronic aspiration and pulmonary diseases, such as obliterative bronchiolitis, pulmonary fibrosis, and asthma.

  8. Immune responses to implants - a review of the implications for the design of immunomodulatory biomaterials.

    Science.gov (United States)

    Franz, Sandra; Rammelt, Stefan; Scharnweber, Dieter; Simon, Jan C

    2011-10-01

    A key for long-term survival and function of biomaterials is that they do not elicit a detrimental immune response. As biomaterials can have profound impacts on the host immune response the concept emerged to design biomaterials that are able to trigger desired immunological outcomes and thus support the healing process. However, engineering such biomaterials requires an in-depth understanding of the host inflammatory and wound healing response to implanted materials. One focus of this review is to outline the up-to-date knowledge on immune responses to biomaterials. Understanding the complex interactions of host response and material implants reveals the need for and also the potential of "immunomodulating" biomaterials. Based on this knowledge, we discuss strategies of triggering appropriate immune responses by functional biomaterials and highlight recent approaches of biomaterials that mimic the physiological extracellular matrix and modify cellular immune responses. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. big bang gene modulates gut immune tolerance in Drosophila.

    Science.gov (United States)

    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc

    2013-02-19

    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases.

  10. The nature of immune responses to urinary tract infections

    Science.gov (United States)

    Abraham, Soman N.; Miao, Yuxuan

    2016-01-01

    The urinary tract is constantly exposed to microorganisms that inhabit the gastrointestinal tract, but generally the urinary tract resists infection by gut microorganisms. This resistance to infection is mainly ascribed to the versatility of the innate immune defences in the urinary tract as the adaptive immune responses are limited, particularly when only the lower urinary tract is infected. In recent years, as the strengths and weaknesses of the immune system of the urinary tract have emerged and as the virulence attributes of uropathogens are recognized, several potentially effective and unconventional strategies to contain or prevent urinary tract infections have emerged. PMID:26388331

  11. Immune responses of pigs inoculated with a recombinant fowlpox ...

    African Journals Online (AJOL)

    Yomi

    2012-04-03

    Apr 3, 2012 ... Key words: PCV2, rFPV, FMDV, immune response, prime-boost. .... After 10 min in the dark at room temperature, the color reaction was terminated with 50 µl of ..... ponses and improve memory and/or effector cell responses ...

  12. Flavobacterium psychrophilum - Experimental challenge and immune response

    DEFF Research Database (Denmark)

    Henriksen, Maya Maria Mihályi

    the immune system of the fry is not fully developed. Theoretically, the infection pressure could be subdued by vaccinating larger fish, but no commercial vaccine is yet available. Diagnostic methods are well described and the disease is treated with antibiotics. To prevent disease outbreaks and subsequent......-time PCR (RT-PCR) was used to examine the immune response in the head kidney during the first eight days after infection, and enzyme-linked immunosorbent assay (ELISA) was used to evaluate the production of antibodies 50 days post-exposure. A pro-inflammatory response was observed in both groups infected...... of edemas, but in both cases the tissue was regenerating after 192 hours. However, when the fish had been exposed to both H2O2 and F. psychrophilum, the damage was still evident at this time point. The relative pathogen load measured as 16S rRNA was highest at the first sampling and decreased steadily...

  13. Immune responses of poultry to Newcastle disease virus.

    Science.gov (United States)

    Kapczynski, Darrell R; Afonso, Claudio L; Miller, Patti J

    2013-11-01

    Newcastle disease (ND) remains a constant threat to poultry producers worldwide, in spite of the availability and global employment of ND vaccinations since the 1950s. Strains of Newcastle disease virus (NDV) belong to the order Mononegavirales, family Paramyxoviridae, and genus Avulavirus, are contained in one serotype and are also known as avian paramyxovirus serotype-1 (APMV-1). They are pleomorphic in shape and are single-stranded, non-segmented, negative sense RNA viruses. The virus has been reported to infect most orders of birds and thus has a wide host range. Isolates are characterized by virulence in chickens and the presence of basic amino acids at the fusion protein cleavage site. Low virulent NDV typically produce subclinical disease with some morbidity, whereas virulent isolates can result in rapid, high mortality of birds. Virulent NDV are listed pathogens that require immediate notification to the Office of International Epizootics and outbreaks typically result in trade embargos. Protection against NDV is through the use of vaccines generated with low virulent NDV strains. Immunity is derived from neutralizing antibodies formed against the viral hemagglutinin and fusion glycoproteins, which are responsible for attachment and spread of the virus. However, new techniques and technologies have also allowed for more in depth analysis of the innate and cell-mediated immunity of poultry to NDV. Gene profiling experiments have led to the discovery of novel host genes modulated immediately after infection. Differences in virus virulence alter host gene response patterns have been demonstrated. Furthermore, the timing and contributions of cell-mediated immune responses appear to decrease disease and transmission potential. In view of recent reports of vaccine failure from many countries on the ability of classical NDV vaccines to stop spread of disease, renewed interest in a more complete understanding of the global immune response of poultry to NDV will be

  14. Immune Response among Patients Exposed to Molds

    Directory of Open Access Journals (Sweden)

    Jordan N. Fink

    2009-12-01

    Full Text Available Macrocyclic trichothecenes, mycotoxins produced by Stachybotrys chartarum, have been implicated in adverse reactions in individuals exposed to mold-contaminated environments. Cellular and humoral immune responses and the presence of trichothecenes were evaluated in patients with mold-related health complaints. Patients underwent history, physical examination, skin prick/puncture tests with mold extracts, immunological evaluations and their sera were analyzed for trichothecenes. T-cell proliferation, macrocyclic trichothecenes, and mold specific IgG and IgA levels were not significantly different than controls; however 70% of the patients had positive skin tests to molds. Thus, IgE mediated or other non-immune mechanisms could be the cause of their symptoms.

  15. Hepatitis B Virus Vaccine immune response in Egyptian children 15 ...

    African Journals Online (AJOL)

    Egypt J Pediatr Allergy Immunol 2015;13(2):45-48. 45. Hepatitis B Virus Vaccine immune response in Egyptian children 15-17 years after primary immunization; should we provide a booster dose? INTRODUCTION. Hepatitis B virus (HBV) infection is a global public health problem. With approximately 350 million hepatitis B ...

  16. THE IMPACT OF PERSISTENT HERPESVIRUS INFECTION ON IMMUNITY AND VACCINATION RESPONSE

    Directory of Open Access Journals (Sweden)

    Volyanskiy AYu

    2016-09-01

    Full Text Available In this review we summarize current knowledge on the ability of latent herpesviruses to modulate the immunity and response to vaccination. Nearly all humans are latently infected with multiple herpesviruses but little is known about virus-host interactions. Meanwhile, the study of the immune response to Epshtein-Barr virus (EBV and сytomegalovirus (CMV has revealed significant regulatory effects on the immune system. During the primary infection a human cytomegalovirus is predominately found in peripheral blood monocytes and polymorphonuclear leukocytes. However, the virus can not be replicated in these cells. CMV induces the survival and differentiation of infected monocytes into long-lived macrophages capable of supporting viral replication and the release of virions, which infect CD34+ myeloid progenitor cells. CMV latently persists in myeloid progenitor cells and monocytes and reactivates during their differentiation into macrophages. CMV-infected monocytes exhibit a unique reprogramming of their differentiation and secret both pro-inflammatory M1- and anti-inflammatory M2-associated cytokines. But cytomegalovirus induced macrophage phenotype skewed towards pro-inflammatory M1 type. MV has profound effects on the composition and function of both T cells and NK cells. CMV constantly reactivates during differentiation of monocytes into macrophages. Consequently, persons with latent CMV infection have substantially increased numbers and proportions of CD8+ T cells that lead to exhaustion and an early onset of immunosenescence. Also, it has been shown that the latent CMV virus infection markedly increases the proportion of NK cells expressing the activating NKG2C receptor. So, it has been proposed that CMV alters the composition of T cell and NK cell subsets and accelerates immune aging. Given the capacity of CMV to alter a macrophage, as well as NK and T cell responses it is reasonable to hypothesize that latent infection would alter the

  17. pH-Responsive Micelle-Based Cytoplasmic Delivery System for Induction of Cellular Immunity

    Directory of Open Access Journals (Sweden)

    Eiji Yuba

    2017-11-01

    Full Text Available (1 Background: Cytoplasmic delivery of antigens is crucial for the induction of cellular immunity, which is an important immune response for the treatment of cancer and infectious diseases. To date, fusogenic protein-incorporated liposomes and pH-responsive polymer-modified liposomes have been used to achieve cytoplasmic delivery of antigen via membrane rupture or fusion with endosomes. However, a more versatile cytoplasmic delivery system is desired for practical use. For this study, we developed pH-responsive micelles composed of dilauroyl phosphatidylcholine (DLPC and deoxycholic acid and investigated their cytoplasmic delivery performance and immunity-inducing capability. (2 Methods: Interaction of micelles with fluorescence dye-loaded liposomes, intracellular distribution of micelles, and antigenic proteins were observed. Finally, antigen-specific cellular immune response was evaluated in vivo using ELIspot assay. (3 Results: Micelles induced leakage of contents from liposomes via lipid mixing at low pH. Micelles were taken up by dendritic cells mainly via macropinocytosis and delivered ovalbumin (OVA into the cytosol. After intradermal injection of micelles and OVA, OVA-specific cellular immunity was induced in the spleen. (4 Conclusions: pH-responsive micelles composed of DLPC and deoxycholic acid are promising as enhancers of cytosol delivery of antigens and the induction capability of cellular immunity for the treatment of cancer immunotherapy and infectious diseases.

  18. Ebola Virus Glycoprotein Induces an Innate Immune Response In vivo via TLR4

    Directory of Open Access Journals (Sweden)

    Chih-Yun Lai

    2017-08-01

    Full Text Available Ebola virus (EBOV, a member of the Filoviridae family, causes the most severe form of viral hemorrhagic fever. Although no FDA licensed vaccine or treatment against Ebola virus disease (EVD is currently available, Ebola virus glycoprotein (GP is the major antigen used in all candidate Ebola vaccines. Recent reports of protection as quickly as within 6 days of administration of the rVSV-based vaccine expressing EBOV GP before robust humoral responses were generated suggests that the innate immune responses elicited early after vaccination may contribute to the protection. However, the innate immune responses induced by EBOV GP in the absence of viral vectors or adjuvants have not been fully characterized in vivo. Our recent studies demonstrated that immunization with highly purified recombinant GP in the absence of adjuvants induced a robust IgG response and partial protection against EBOV infection suggesting that GP alone can induce protective immunity. In this study we investigated the early immune response to purified EBOV GP alone in vitro and in vivo. We show that GP was efficiently internalized by antigen presenting cells and subsequently induced production of key inflammatory cytokines. In vivo, immunization of mice with EBOV GP triggered the production of key Th1 and Th2 innate immune cytokines and chemokines, which directly governed the recruitment of CD11b+ macrophages and CD11c+ dendritic cells to the draining lymph nodes (DLNs. Pre-treatment of mice with a TLR4 antagonist inhibited GP-induced cytokine production and recruitment of immune cells to the DLN. EBOV GP also upregulated the expression of costimulatory molecules in bone marrow derived macrophages suggesting its ability to enhance APC stimulatory capacity, which is critical for the induction of effective antigen-specific adaptive immunity. Collectively, these results provide the first in vivo evidence that early innate immune responses to EBOV GP are mediated via the TLR4

  19. Radiation-induced augmentation of the immune response

    International Nuclear Information System (INIS)

    Anderson, R.E.; Lefkovits, I.; Troup, G.M.

    1980-01-01

    Radiation-induced augmentation of the immune response has been shown to occur both in vivo and in vitro. Evidence is presented to implicate injury to an extremely radiosensitive T cell in the expression of this phenomenon. Experiments are outlined which could be employed to support or reflect this hypothesis

  20. Platelets in Immune Response to Virus and Immunopathology of Viral Infections

    Directory of Open Access Journals (Sweden)

    Eugenio D. Hottz

    2018-04-01

    Full Text Available Platelets are essential effector cells in hemostasis. Aside from their role in coagulation, platelets are now recognized as major inflammatory cells with key roles in the innate and adaptive arms of the immune system. Activated platelets have key thromboinflammatory functions linking coagulation to immune responses in various infections, including in response to virus. Recent studies have revealed that platelets exhibit several pattern recognition receptors (PRR including those from the toll-like receptor, NOD-like receptor, and C-type lectin receptor family and are first-line sentinels in detecting and responding to pathogens in the vasculature. Here, we review the main mechanisms of platelets interaction with viruses, including their ability to sustain viral infection and replication, their expression of specialized PRR, and activation of thromboinflammatory responses against viruses. Finally, we discuss the role of platelet-derived mediators and platelet interaction with vascular and immune cells in protective and pathophysiologic responses to dengue, influenza, and human immunodeficiency virus 1 infections.

  1. Isotope-based immunological techniques. Their use in assessment of immune competence and the study of immune responses to pathogens

    International Nuclear Information System (INIS)

    Duffus, W.P.H.

    1984-01-01

    The influence of isotope-based techniques on both assessment of immune competence and immune response to pathogens is discussed. Immunodeficiencies acquired as a result of factors like malnutrition and concomitant disease can severely affect not only attempts to intensify and improve production but also successful immune response against important vaccines such as rinderpest and foot-and-mouth disease. Isotope-based techniques, with their accuracy, speed and small sample volume, are ideally suited for assessing immunocompetence. One of the main drawbacks remains antigen purity, an area where research should now be concentrated. Lymphocyte transformation is widely used to assess cell-mediated immuno-competence but techniques to assess biological functions such as phagocytosis and cell-mediated cytotoxicity could more usefully reflect immune status. These latter techniques utilize isotopes such as 3 H, 14 C, 32 P and 125 I. Investigation of specific cell-mediated immune response often requires a labelled target. Suitable isotopes such as 51 Cr, 99 Tcsup(m), 75 Se and 3 H are compared for their capacity to label both mammalian and parasite targets. Suggestions are made on a number of areas of research that might usefully be encouraged and supported in order to improve applied veterinary immunology in tropical countries. (author)

  2. DMPD: Innate immune responses: crosstalk of signaling and regulation of genetranscription. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16753195 Innate immune responses: crosstalk of signaling and regulation of genetran...l) (.csml) Show Innate immune responses: crosstalk of signaling and regulation of genetranscription. PubmedI...D 16753195 Title Innate immune responses: crosstalk of signaling and regulation o

  3. The specificity of targeted vaccines for APC surface molecules influences the immune response phenotype.

    Directory of Open Access Journals (Sweden)

    Gunnveig Grødeland

    Full Text Available Different diseases require different immune responses for efficient protection. Thus, prophylactic vaccines should prime the immune system for the particular type of response needed for protection against a given infectious agent. We have here tested fusion DNA vaccines which encode proteins that bivalently target influenza hemagglutinins (HA to different surface molecules on antigen presenting cells (APC. We demonstrate that targeting to MHC class II molecules predominantly induced an antibody/Th2 response, whereas targeting to CCR1/3/5 predominantly induced a CD8(+/Th1 T cell response. With respect to antibodies, the polarizing effect was even more pronounced upon intramuscular (i.m delivery as compared to intradermal (i.d. vaccination. Despite these differences in induced immune responses, both vaccines protected against a viral challenge with influenza H1N1. Substitution of HA with ovalbumin (OVA demonstrated that polarization of immune responses, as a consequence of APC targeting specificity, could be extended to other antigens. Taken together, the results demonstrate that vaccination can be tailor-made to induce a particular phenotype of adaptive immune responses by specifically targeting different surface molecules on APCs.

  4. Aspergillus-Associated Airway Disease, Inflammation, and the Innate Immune Response

    Directory of Open Access Journals (Sweden)

    Sanjay H. Chotirmall

    2013-01-01

    Full Text Available Aspergillus moulds exist ubiquitously as spores that are inhaled in large numbers daily. Whilst most are removed by anatomical barriers, disease may occur in certain circumstances. Depending on the underlying state of the human immune system, clinical consequences can ensue ranging from an excessive immune response during allergic bronchopulmonary aspergillosis to the formation of an aspergilloma in the immunocompetent state. The severest infections occur in those who are immunocompromised where invasive pulmonary aspergillosis results in high mortality rates. The diagnosis of Aspergillus-associated pulmonary disease is based on clinical, radiological, and immunological testing. An understanding of the innate and inflammatory consequences of exposure to Aspergillus species is critical in accounting for disease manifestations and preventing sequelae. The major components of the innate immune system involved in recognition and removal of the fungus include phagocytosis, antimicrobial peptide production, and recognition by pattern recognition receptors. The cytokine response is also critical facilitating cell-to-cell communication and promoting the initiation, maintenance, and resolution of the host response. In the following review, we discuss the above areas with a focus on the innate and inflammatory response to airway Aspergillus exposure and how these responses may be modulated for therapeutic benefit.

  5. Interplay between immune responses to HLA and non-HLA self-antigens in allograft rejection.

    Science.gov (United States)

    Angaswamy, Nataraju; Tiriveedhi, Venkataswarup; Sarma, Nayan J; Subramanian, Vijay; Klein, Christina; Wellen, Jason; Shenoy, Surendra; Chapman, William C; Mohanakumar, T

    2013-11-01

    Recent studies strongly suggest an increasing role for immune responses against self-antigens (Ags) which are not encoded by the major histocompatibility complex in the immunopathogenesis of allograft rejection. Although, improved surgical techniques coupled with improved methods to detect and avoid sensitization against donor human leukocyte antigen (HLA) have improved the immediate and short term function of transplanted organs. However, acute and chronic rejection still remains a vexing problem for the long term function of the transplanted organ. Immediately following organ transplantation, several factors both immune and non immune mechanisms lead to the development of local inflammatory milieu which sets the stage for allograft rejection. Traditionally, development of antibodies (Abs) against mismatched donor HLA have been implicated in the development of Ab mediated rejection. However, recent studies from our laboratory and others have demonstrated that development of humoral and cellular immune responses against non-HLA self-Ags may contribute in the pathogenesis of allograft rejection. There are reports demonstrating that immune responses to self-Ags especially Abs to the self-Ags as well as cellular immune responses especially through IL17 has significant pro-fibrotic properties leading to chronic allograft failure. This review summarizes recent studies demonstrating the role for immune responses to self-Ags in allograft immunity leading to rejection as well as present recent evidence suggesting there is interplay between allo- and autoimmunity leading to allograft dysfunction. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  6. An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response

    Directory of Open Access Journals (Sweden)

    Katherine M. Buckley

    2017-10-01

    Full Text Available The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17, are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism.

  7. Hemagglutinating virus of Japan envelope (HVJ-E) can enhance the immune responses of swine immunized with killed PRRSV vaccine

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Zhihong [State Key Laboratory of Agrobiotechnology, College of Veterinary Medicine, China Agricultural University, Beijing 100094 (China); China Institute of Veterinary Drug Control, Beijing 100081 (China); Zhang, Quan [College of Veterinary Medicine, Yangzhou University, Yangzhou 225009 (China); Wang, Zaishi [China Institute of Veterinary Drug Control, Beijing 100081 (China); Zhang, Zhongqiu [State Key Laboratory of Agrobiotechnology, College of Veterinary Medicine, China Agricultural University, Beijing 100094 (China); Veterinary Bureau, Ministry of Agriculture of the People' s Republic of China, Beijing 100125 (China); Guo, Pengju [Institute of Veterinary Medicine, Guangdong Academy of Agricultural Sciences, Guangdong 510640 (China); Zhao, Deming, E-mail: zhaodm@cau.edu.cn [State Key Laboratory of Agrobiotechnology, College of Veterinary Medicine, China Agricultural University, Beijing 100094 (China)

    2011-11-11

    Highlights: Black-Right-Pointing-Pointer We investigated the immunoadjuvant effects of HVJ-E on killed PRRSV vaccine. Black-Right-Pointing-Pointer HVJ-E enhanced the humoral and cellular responses of the piglets to PRRSV. Black-Right-Pointing-Pointer It is suggested that HVJ-E could be developed as a new-type adjuvant for mammals. -- Abstract: Porcine reproductive and respiratory syndrome virus (PRRSV) is an economically detrimental pig pathogen that causes significant losses for the pig industry. The immunostimulatory effects of hemagglutinating virus of Japan envelope (HVJ-E) in cancer therapy and the adjuvant efficacy of HVJ-E have been previously evaluated. The objective of this study was to investigate the adjuvant effects of HVJ-E on immunization with killed PRRSV vaccine, and to evaluate the protective effects of this immunization strategy against virulent PRRSV infection in piglets. Next, the PRRSV-specific antibody response, lymphocyte proliferation, PRRSV-specific IL-2, IL-10 and IFN-{gamma} production, and the overall protection efficacy were evaluated to assess the immune responses of the piglets. The results showed that the piglets inoculated simultaneously with killed PRRSV vaccine and HVJ-E had a significantly stronger immune response than those inoculated with killed PRRSV vaccine alone. Our results suggest that HVJ-E could be employed as an effective adjuvant to enhance the humoral and cellular responses of piglets to PRRSV.

  8. Defective B cell response to T-dependent immunization in lupus-prone mice

    Science.gov (United States)

    Niu, Haitao; Sobel, Eric S.; Morel, Laurence

    2009-01-01

    Lupus anti-nuclear Abs show the characteristics of Ag-driven T cell-dependent (TD) humoral responses. If autoAgs elicit the same response as exogenous Ags, lupus should enhance humoral responses to immunization. Blunted responses to various immunizations have, however, been reported in a significant portion of lupus patients. In this study, we show that lupus-prone B6.Sle1.Sle2.Sle3 (B6.TC) mice produce significantly less Ab in response to TD immunization than congenic controls, while producing significantly more total Ig. This blunted Ab response to TD Ag could be reconstituted with B6.TC B and CD4+ T cells. Multiple defects were found in the B6.TC response to NP-KLH as compared to total Ig, including a smaller percentage of B cells participating to the NP-response, a reduced entry into germinal centers, and highly defective production of NP-specific long-lived plasma cells in the bone marrow. B6.TC plasma cells expressed reduced levels of FcγRIIb, which suggests that reduced apoptosis in resident plasma cells prevents the establishment of newly-formed NP-specific plasma cells in bone marrow niches. Overall, these results show that lupus-prone mice responded differently to auto- and exogenous antigens and suggest that low FcγRIIb, hypergammaglobulinemia and high autoantibody production would be predictive of a poor response to immunization in lupus patients. PMID:18924209

  9. Prevalence of local immune response against oral infection in a Drosophila/Pseudomonas infection model.

    Directory of Open Access Journals (Sweden)

    Peter Liehl

    2006-06-01

    Full Text Available Pathogens have developed multiple strategies that allow them to exploit host resources and resist the immune response. To study how Drosophila flies deal with infectious diseases in a natural context, we investigated the interactions between Drosophila and a newly identified entomopathogen, Pseudomonas entomophila. Flies orally infected with P. entomophila rapidly succumb despite the induction of both local and systemic immune responses, indicating that this bacterium has developed specific strategies to escape the fly immune response. Using a combined genetic approach on both host and pathogen, we showed that P. entomophila virulence is multi-factorial with a clear differentiation between factors that trigger the immune response and those that promote pathogenicity. We demonstrate that AprA, an abundant secreted metalloprotease produced by P. entomophila, is an important virulence factor. Inactivation of aprA attenuated both the capacity to persist in the host and pathogenicity. Interestingly, aprA mutants were able to survive to wild-type levels in immune-deficient Relish flies, indicating that the protease plays an important role in protection against the Drosophila immune response. Our study also reveals that the major contribution to the fly defense against P. entomophila is provided by the local, rather than the systemic immune response. More precisely, our data points to an important role for the antimicrobial peptide Diptericin against orally infectious Gram-negative bacteria, emphasizing the critical role of local antimicrobial peptide expression against food-borne pathogens.

  10. MECHANISMS OF IMMUNE RESPONSES IN CNIDARIANS

    Directory of Open Access Journals (Sweden)

    Iván Darío Ocampo

    2015-05-01

    Full Text Available The immune system maintains the integrity of the organisms through a complex network of molecules, cells, and tissues that recognize internal or external antigenic substances to neutralized and eliminate them. The mechanisms of immune response have evolved in a modular fashion, where members of a given module interact strongly among them, but weakly with members of other modules, providing robustness and evolvability to the immune system. Ancestral modules are the raw material for the generation of new modules through evolution. Thus, the study of immune systems in basal metazoans such as cnidarians seeks to determine the basic tool kit from which the metazoans started to construct their immune systems. In addition, understanding the immune mechanisms in cnidarians contributes to decipher the etiopathology of coral diseases of infectious nature that are affecting coral reefs worldwide. RESUMEN El sistema inmune mantiene la integridad de los organismos vivos por medio de una red compleja de moléculas, células y tejidos que reconocen sustancias antigénicas internas o externas para neutralizarlas y eliminarlas. Los mecanismos de respuesta inmune han evolucionado de una manera modular, en donde miembros de un módulo dado interactúan fuertemente entre sí, pero débilmente con componentes de otros módulos, otorgando así robustez y potencial evolutivo al sistema inmune. Módulos ancestrales representan el material básico para la generación de nuevos módulos durante el proceso evolutivo. Así, el estudio de sistemas inmunes en metazoarios basales como los cnidarios busca determinar cuales son los módulos ancestrales a partir de los cuales se constituyen los sistemas inmunes de animales derivados. Adicionalmente, el entendimiento de los mecanismos de respuesta inmune en cnidarios eventualmente contribuirá a descifrar la etiopatología de las enfermedades de corales de carácter infeccioso que está afectando los corales en el mundo.

  11. Hypocretin/orexin loss changes the hypothalamic immune response.

    Science.gov (United States)

    Tanaka, Susumu; Takizawa, Nae; Honda, Yoshiko; Koike, Taro; Oe, Souichi; Toyoda, Hiromi; Kodama, Tohru; Yamada, Hisao

    2016-10-01

    Hypocretin, also known as orexin, maintains the vigilance state and regulates various physiological processes, such as arousal, sleep, food intake, energy expenditure, and reward. Previously, we found that when wild-type mice and hypocretin/ataxin-3 littermates (which are depleted of hypothalamic hypocretin-expressing neurons postnatally) were administered lipopolysaccharide (LPS), the two genotypes exhibited significant differences in their sleep/wake cycle, including differences in the degree of increase in sleep periods and in recovery from sickness behaviour. In the present study, we examined changes in the hypothalamic vigilance system and in the hypothalamic expression of inflammatory factors in response to LPS in hypocretin/ataxin-3 mice. Peripheral immune challenge with LPS affected the hypothalamic immune response and vigilance states. This response was altered by the loss of hypocretin. Hypocretin expression was inhibited after LPS injection in both hypocretin/ataxin-3 mice and their wild-type littermates, but expression was completely abolished only in hypocretin/ataxin-3 mice. Increases in the number of histidine decarboxylase (HDC)-positive cells and in Hdc mRNA expression were found in hypocretin/ataxin-3 mice, and this increase was suppressed by LPS. Hypocretin loss did not impact the change in expression of hypothalamic inflammatory factors in response to LPS, except for interferon gamma and colony stimulating factor 3. The number of c-Fos-positive/HDC-positive cells in hypocretin/ataxin-3 mice administered LPS injections was elevated, even during the rest period, in all areas, suggesting that there is an increase in the activity of histaminergic neurons in hypocretin/ataxin-3 mice following LPS injection. Taken together, our results suggest a novel role for hypocretin in the hypothalamic response to peripheral immune challenge. Our findings contribute to the understanding of the pathophysiology of narcolepsy. Copyright © 2016 Elsevier Inc. All

  12. CAF01 potentiates immune responses and efficacy of an inactivated influenza vaccine in ferrets

    DEFF Research Database (Denmark)

    Martel, Cyril Jean-Marie; Agger, Else Marie; Poulsen, Julie Juul

    2011-01-01

    response, whereas the induction of cell-mediated immune responses is negligible. Recently, a cationic liposomal adjuvant (dimethyldioctadecylammonium/trehalose 6,6'-dibehenate, CAF01) was developed. CAF01 has proven to enhance both humoral and cell-mediated immune responses to a number of different...

  13. Systems Biology of Immune Response to Live and Inactivated Dengue Virus Vaccines

    Science.gov (United States)

    2017-09-01

    AWARD NUMBER: W81XWH-16-2-0032 TITLE: Systems Biology of Immune Response to Live and Inactivated Dengue Virus Vaccines PRINCIPAL INVESTIGATOR...CONTRACT NUMBER Systems Biology of Immune Response to Live and Inactivated Dengue Virus Vaccines 5b. GRANT NUMBER W81XWH-16-2-0032 5c. PROGRAM ELEMENT...cell) responses will be measured using molecular and cellular approaches and the data analyzed using a systems biology approach. During the first

  14. Cell-mediated immunity during syphilis. A review

    Science.gov (United States)

    Pavia, Charles S.; Folds, James D.; Baseman, Joel B.

    1978-01-01

    Evidence is presented which reinforces the complexity of the host-parasite interaction during the course of syphilis. Infection with Treponema pallidum evokes a complicated antibody response and an assortment of cell-mediated immune reactions in the host. It appears that humoral immunity plays a minor role towards the complete elimination of syphilitic infection while the cellular limb of the immune response may be an important host defence mechanism. Information now available indicates that a state of anergy, or immunosuppression, exists in the early stages of human and experimental rabbit syphilis based upon negative skin reactions to T. pallidum antigen(s), the abnormal histological appearance of lymphoid organs, and impaired in vitro lymphocyte reactivity. It is also evident that in the later stages of the disease cellular immunity becomes activated as delayed type skin reactions can normally be elicited in tertiary syphilitics and lymphocyte behaviour in cell culture appears normal. Several mechanisms have been invoked to explain the delay in an effective immune response against syphilitic infection and the duration of the disease: (1) a capsule-like substance on the outer surface of virulant T. pallidum may act as a barrier against treponemicidal antibody; (2) this material and other biological properties of virulent treponemes could enable spirochaetes to escape being engulfed by macrophages and other phagocytic cells; (3) antigenic competition among different treponemal antigens causing partial tolerance; (4) T. pallidum infection may bring about the elaboration of immunosuppressive substances of host or treponemal origin which inhibit the proper function of lymphocytes, macrophages, and other cell types. PMID:350348

  15. Transient expression of protein tyrosine phosphatases encoded in Cotesia plutellae bracovirus inhibits insect cellular immune responses

    Science.gov (United States)

    Ibrahim, Ahmed M. A.; Kim, Yonggyun

    2008-01-01

    Several immunosuppressive factors are associated with parasitism of an endoparasitoid wasp, Cotesia plutellae, on the diamondback moth, Plutella xylostella. C. plutellae bracovirus (CpBV) encodes a large number of putative protein tyrosine phosphatases (PTPs), which may play a role in inhibiting host cellular immunity. To address this inhibitory hypothesis of CpBV-PTPs, we performed transient expression of individual CpBV-PTPs in hemocytes of the beet armyworm, Spodoptera exigua, and analyzed their cellular immune responses. Two different forms of CpBV-PTPs were chosen and cloned into a eukaryotic expression vector under the control of the p10 promoter of baculovirus: one with the normal cysteine active site (CpBV-PTP1) and the other with a mutated active site (CpBV-PTP5). The hemocytes transfected with CpBV-PTP1 significantly increased in PTP activity compared to control hemocytes, but those with CpBV-PTP5 exhibited a significant decrease in the PTP activity. All transfected hemocytes exhibited a significant reduction in both cell spreading and encapsulation activities compared to control hemocytes. Co-transfection of CpBV-PTP1 together with its double-stranded RNA reduced the messenger RNA (mRNA) level of CpBV-PTP1 and resulted in recovery of both hemocyte behaviors. This is the first report demonstrating that the polydnaviral PTPs can manipulate PTP activity of the hemocytes to interrupt cellular immune responses.

  16. Indian Hedgehog Suppresses a Stromal Cell-Driven Intestinal Immune Response.

    Science.gov (United States)

    Westendorp, B Florien; Büller, Nikè V J A; Karpus, Olga N; van Dop, Willemijn A; Koster, Jan; Versteeg, Rogier; Koelink, Pim J; Snel, Clinton Y; Meisner, Sander; Roelofs, Joris J T H; Uhmann, Anja; Ver Loren van Themaat, Emiel; Heijmans, Jarom; Hahn, Heidi; Muncan, Vanesa; Wildenberg, Manon E; van den Brink, Gijs R

    2018-01-01

    Upon intestinal epithelial damage a complex wound healing response is initiated to restore epithelial integrity and defend against pathogenic invasion. Epithelium-derived Indian Hedgehog (Ihh) functions as a critical sensor in this process. Signaling occurs in a paracrine manner because the receptor for Ihh is expressed only in the mesenchyme, but the exact Hedgehog target cell has remained elusive. The aim of this study was to elucidate further the nature of this target cell in the context of intestinal inflammation. Hedgehog activity was modulated genetically in both cell type-specific and body-wide models and the resulting animals were analyzed for gene expression profiles and sensitivity for dextran sodium sulfate (DSS) colitis. To characterize the Hedgehog target cell, Gli1-CreERT2-Rosa26-ZsGreen animals were generated, which express ZsGreen in all Hedgehog-responsive cells. These cells were characterized using flow cytometry and immunofluorescence. Loss of Indian Hedgehog from the intestinal epithelium resulted in a rapid increase in expression of inflammation-related genes, accompanied by increased influx of immune cells. Animals with epithelium-specific deletion of Ihh or lacking the Hedgehog receptor Smoothened from Hedgehog target cells were more sensitive to DSS colitis. In contrast, specific deletion of Smoothened in the myeloid compartment did not alter the response to DSS. This suggests that Hedgehog signaling does not repress intestinal immunity through an effect on myeloid cells. Indeed, we found that Hedgehog-responsive cells expressed gp38, smooth muscle actin, and desmin, indicating a fibroblastic nature. Ihh signaling inhibited expression of C-X-C motif chemokine ligand 12 (CXCL12) in fibroblasts in vitro and in vivo, thereby impairing the recruitment of immune cells. We show that epithelium-derived Indian Hedgehog signals exclusively to fibroblasts in the intestine. Loss of Ihh leads to a rapid immune response with up-regulation of fibroblast

  17. Polysaccharides Isolated from Açaí Fruit Induce Innate Immune Responses

    OpenAIRE

    Holderness, Jeff; Schepetkin, Igor A.; Freedman, Brett; Kirpotina, Liliya N.; Quinn, Mark T.; Hedges, Jodi F.; Jutila, Mark A.

    2011-01-01

    The Açaí (Acai) fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fr...

  18. T cell-derived Lymphotoxin is Essential for anti-HSV-1 Humoral Immune Response.

    Science.gov (United States)

    Yang, Kaiting; Liang, Yong; Sun, Zhichen; Xue, Diyuan; Xu, Hairong; Zhu, Mingzhao; Fu, Yang-Xin; Peng, Hua

    2018-05-09

    B cell-derived lymphotoxin (LT) is required for the development of follicular dendritic cell clusters for the formation of primary and secondary lymphoid follicles, but the role of T cell-derived LT in antibody response has not been well demonstrated. We observed that lymphotoxin-β-receptor (LTβR) signaling is essential for optimal humoral immune response and protection against an acute HSV-1 infection. Blocking the LTβR pathway caused poor maintenance of germinal center B (GC-B) cells and follicular helper T (Tfh) cells. Using bone marrow chimeric mice and adoptive transplantation, we determined that T cell-derived LT played an indispensable role in the humoral immune response to HSV-1. Up-regulation of IFNγ by the LTβR-Ig blockade impairs the sustainability of Tfh-like cells, thus leading to an impaired humoral immune response. Our findings have identified a novel role of T cell-derived LT in the humoral immune response against HSV-1 infection. IMPORTANCE Immunocompromised people are susceptible for HSV-1 infection and lethal recurrence, which could be inhibited by anti-HSV-1 humoral immune response in the host. This study sought to explore the role of T cell-derived LT in the anti-HSV-1 humoral immune response using LT-LTβR signaling deficient mice and the LTβR-Ig blockade. The data indicate that the T cell-derived LT may play an essential role in sustaining Tfh-like cells and ensure Tfh-like cells' migration into primary or secondary follicles for further maturation. This study provides insights for vaccine development against infectious diseases. Copyright © 2018 American Society for Microbiology.

  19. Oncolytic Viral Therapy and the Immune System: A Double-Edged Sword Against Cancer.

    Science.gov (United States)

    Marelli, Giulia; Howells, Anwen; Lemoine, Nicholas R; Wang, Yaohe

    2018-01-01

    Oncolytic viral therapy is a new promising strategy against cancer. Oncolytic viruses (OVs) can replicate in cancer cells but not in normal cells, leading to lysis of the tumor mass. Beside this primary effect, OVs can also stimulate the immune system. Tumors are an immuno-suppressive environment in which the immune system is silenced in order to avoid the immune response against cancer cells. The delivery of OVs into the tumor wakes up the immune system so that it can facilitate a strong and durable response against the tumor itself. Both innate and adaptive immune responses contribute to this process, producing an immune response against tumor antigens and facilitating immunological memory. However, viruses are recognized by the immune system as pathogens and the consequent anti-viral response could represent a big hurdle for OVs. Finding a balance between anti-tumor and anti-viral immunity is, under this new light, a priority for researchers. In this review, we provide an overview of the various ways in which different components of the immune system can be allied with OVs. We have analyzed the different immune responses in order to highlight the new and promising perspectives leading to increased anti-tumor response and decreased immune reaction to the OVs.

  20. Effect of produced water on cod (Gadus morhua) immune responses

    Energy Technology Data Exchange (ETDEWEB)

    Hamoutene, D.; Mabrouk, G.; Samuelson, S.; Mansour, A.; Lee, K. [Fisheries and Oceans Canada, Dartmouth, NS (Canada). Maritimes Region, Ocean Sciences Division; Volkoff, H.; Parrish, C. [Memorial Univ. of Newfoundland, St. John' s, NL (Canada); Mathieu, A. [Oceans Ltd., St. John' s, NL (Canada)

    2007-07-01

    Studies have shown that produced water (PW) discharged from North Sea offshore platforms affects the biota at greater distances from operational platforms than originally presumed. According to PW dispersion simulations, dilution by at least 240 times occurs within 50-100 m, and up to 9000 times by 20 km from the discharge. In this study, the effect of PW on cod immunity was investigated by exposing fish to 0, 100 ppm (x 10,000 dilution) or 200 ppm (x 500) of PW for 76 days. Immune responses were evaluated at the end of the exposure. Fish from the 3 groups were injected with Aeromonas salmonicida lipopolysaccharides (LPS). Blood cell observation and flow cytometry were used to investigate the serum cortisol levels and gill histology along with ratios and respiratory burst (RB) responses of both circulating and head-kidney white blood cells (WBCs). The study revealed that baseline immunity and stress response were not affected by PW, other than an irritant-induced change in gill cells found in treated cod. In all groups, LPS injection resulted in a pronounced decrease in RB of head-kidney cells and an increase in serum cortisol and protein levels. However, the group exposed to 200 ppm of PW exhibited the most significant changes. LPS injection was also shown to influence WBC ratios, but further studies are needed to determine if this impact is stronger in fish exposed to PW. This study suggested an effect of PW on cod immunity after immune challenge with LPS.

  1. Tetranychus urticae mites do not mount an induced immune response against bacteria.

    Science.gov (United States)

    Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E; Zélé, Flore; Riga, Maria; Leitão, Alexandre B; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara; Sucena, Élio

    2017-06-14

    The genome of the spider mite Tetranychus urticae , a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae , infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei , a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. © 2017 The Authors.

  2. Immunization Strategies Producing a Humoral IgG Immune Response against Devil Facial Tumor Disease in the Majority of Tasmanian Devils Destined for Wild Release

    Directory of Open Access Journals (Sweden)

    Ruth Pye

    2018-02-01

    Full Text Available Devil facial tumor disease (DFTD is renowned for its successful evasion of the host immune system. Down regulation of the major histocompatabilty complex class I molecule (MHC-I on the DFTD cells is a primary mechanism of immune escape. Immunization trials on captive Tasmanian devils have previously demonstrated that an immune response against DFTD can be induced, and that immune-mediated tumor regression can occur. However, these trials were limited by their small sample sizes. Here, we describe the results of two DFTD immunization trials on cohorts of devils prior to their wild release as part of the Tasmanian Government’s Wild Devil Recovery project. 95% of the devils developed anti-DFTD antibody responses. Given the relatively large sample sizes of the trials (N = 19 and N = 33, these responses are likely to reflect those of the general devil population. DFTD cells manipulated to express MHC-I were used as the antigenic basis of the immunizations in both trials. Although the adjuvant composition and number of immunizations differed between trials, similar anti-DFTD antibody levels were obtained. The first trial comprised DFTD cells and the adjuvant combination of ISCOMATRIX™, polyIC, and CpG with up to four immunizations given at monthly intervals. This compared to the second trial whereby two immunizations comprising DFTD cells and the adjuvant combination ISCOMATRIX™, polyICLC (Hiltonol® and imiquimod were given a month apart, providing a shorter and, therefore, more practical protocol. Both trials incorporated a booster immunization given up to 5 months after the primary course. A key finding was that devils in the second trial responded more quickly and maintained their antibody levels for longer compared to devils in the first trial. The different adjuvant combination incorporating the RNAase resistant polyICLC and imiquimod used in the second trial is likely to be responsible. The seroconversion in the majority of

  3. Immunization Strategies Producing a Humoral IgG Immune Response against Devil Facial Tumor Disease in the Majority of Tasmanian Devils Destined for Wild Release

    Science.gov (United States)

    Pye, Ruth; Patchett, Amanda; McLennan, Elspeth; Thomson, Russell; Carver, Scott; Fox, Samantha; Pemberton, David; Kreiss, Alexandre; Baz Morelli, Adriana; Silva, Anabel; Pearse, Martin J.; Corcoran, Lynn M.; Belov, Katherine; Hogg, Carolyn J.; Woods, Gregory M; Lyons, A. Bruce

    2018-01-01

    Devil facial tumor disease (DFTD) is renowned for its successful evasion of the host immune system. Down regulation of the major histocompatabilty complex class I molecule (MHC-I) on the DFTD cells is a primary mechanism of immune escape. Immunization trials on captive Tasmanian devils have previously demonstrated that an immune response against DFTD can be induced, and that immune-mediated tumor regression can occur. However, these trials were limited by their small sample sizes. Here, we describe the results of two DFTD immunization trials on cohorts of devils prior to their wild release as part of the Tasmanian Government’s Wild Devil Recovery project. 95% of the devils developed anti-DFTD antibody responses. Given the relatively large sample sizes of the trials (N = 19 and N = 33), these responses are likely to reflect those of the general devil population. DFTD cells manipulated to express MHC-I were used as the antigenic basis of the immunizations in both trials. Although the adjuvant composition and number of immunizations differed between trials, similar anti-DFTD antibody levels were obtained. The first trial comprised DFTD cells and the adjuvant combination of ISCOMATRIX™, polyIC, and CpG with up to four immunizations given at monthly intervals. This compared to the second trial whereby two immunizations comprising DFTD cells and the adjuvant combination ISCOMATRIX™, polyICLC (Hiltonol®) and imiquimod were given a month apart, providing a shorter and, therefore, more practical protocol. Both trials incorporated a booster immunization given up to 5 months after the primary course. A key finding was that devils in the second trial responded more quickly and maintained their antibody levels for longer compared to devils in the first trial. The different adjuvant combination incorporating the RNAase resistant polyICLC and imiquimod used in the second trial is likely to be responsible. The seroconversion in the majority of devils in these anti

  4. The effect of doxycycline treatment on the postvaccinal immune response in pigs

    International Nuclear Information System (INIS)

    Pomorska-Mól, Małgorzata; Kwit, Krzysztof; Markowska-Daniel, Iwona; Pejsak, Zygmunt

    2014-01-01

    The effect of a seven-day antibiotic therapy with doxycycline was investigated on the postvaccinal humoral and cellular immune response in pigs. The selected parameters of non-specific immunity were also studied. Fifty pigs were used (control not vaccinated (C, n = 10), control vaccinated (CV, n = 20), and experimental — received doxycycline (DOXY, n = 20)). For vaccination live-attenuated vaccine against pseudorabies (PR) was used. From day − 1 to day 5 pigs from DOXY group received doxycycline orally with drinking water, at the recommended dose. Pigs from DOXY and CV groups were vaccinated at 8 and 10 weeks of age. The results of the present study showed that cell-mediated postvaccinal immune response can be modulated by oral treatment with doxycycline. Significantly lower values of stimulation index were observed after PRV restimulation in doxycycline-treated pigs. Moreover, in the DOXY group a significant decrease in IFN-γ production after PRV restimulation was noted. The significantly lower number of CD4+CD8 + cells was also observed in doxy-treated, vaccinated pigs, 2 weeks after final vaccination. Simultaneously, specific humoral response was not disturbed. This study demonstrated the importance of defining the immune modulatory activity of doxycycline because it may alter the immune responses to vaccines. The exact mechanism of T-cell response suppression by doxycycline remains to be elucidated, however the influence of doxycycline on the secretion of various cytokines, including IFN-γ, may be considered as a possible cause. The present observations should prompt further studies on the practical significance of such phenomena in terms of clinical implications. - Highlights: • We examine the postvaccinal immune response in pigs treated with doxycycline. • Doxycycline negatively influenced the specific proliferation after recall stimulation. • Doxycycline negatively influenced secretion of IFN-γ after recall stimulation. • The lower number of

  5. The effect of doxycycline treatment on the postvaccinal immune response in pigs

    Energy Technology Data Exchange (ETDEWEB)

    Pomorska-Mól, Małgorzata, E-mail: mpomorska@piwet.pulawy.pl; Kwit, Krzysztof; Markowska-Daniel, Iwona; Pejsak, Zygmunt

    2014-07-01

    The effect of a seven-day antibiotic therapy with doxycycline was investigated on the postvaccinal humoral and cellular immune response in pigs. The selected parameters of non-specific immunity were also studied. Fifty pigs were used (control not vaccinated (C, n = 10), control vaccinated (CV, n = 20), and experimental — received doxycycline (DOXY, n = 20)). For vaccination live-attenuated vaccine against pseudorabies (PR) was used. From day − 1 to day 5 pigs from DOXY group received doxycycline orally with drinking water, at the recommended dose. Pigs from DOXY and CV groups were vaccinated at 8 and 10 weeks of age. The results of the present study showed that cell-mediated postvaccinal immune response can be modulated by oral treatment with doxycycline. Significantly lower values of stimulation index were observed after PRV restimulation in doxycycline-treated pigs. Moreover, in the DOXY group a significant decrease in IFN-γ production after PRV restimulation was noted. The significantly lower number of CD4+CD8 + cells was also observed in doxy-treated, vaccinated pigs, 2 weeks after final vaccination. Simultaneously, specific humoral response was not disturbed. This study demonstrated the importance of defining the immune modulatory activity of doxycycline because it may alter the immune responses to vaccines. The exact mechanism of T-cell response suppression by doxycycline remains to be elucidated, however the influence of doxycycline on the secretion of various cytokines, including IFN-γ, may be considered as a possible cause. The present observations should prompt further studies on the practical significance of such phenomena in terms of clinical implications. - Highlights: • We examine the postvaccinal immune response in pigs treated with doxycycline. • Doxycycline negatively influenced the specific proliferation after recall stimulation. • Doxycycline negatively influenced secretion of IFN-γ after recall stimulation. • The lower number of

  6. Maternal nutritional status during pregnancy and infant immune response to routine childhood vaccinations.

    Science.gov (United States)

    Obanewa, Olayinka; Newell, Marie-Louise

    2017-09-01

    To systematically review the association between maternal nutritional status in pregnancy and infant immune response to childhood vaccines. We reviewed literature on maternal nutrition during pregnancy, fetal immune system and vaccines and possible relationships. Thereafter, we undertook a systematic review of the literature of maternal nutritional status and infant vaccine response, extracted relevant information, assessed quality of the nine papers identified and present findings in a narrative format. From limited evidence of average quality, intrauterine nutrition deficiency could lead to functional deficit in the infant's immune function; child vaccine response may thus be negatively affected by maternal malnutrition. Response to childhood vaccination may be associated with fetal and early life environment; evaluation of programs should take this into account.

  7. Immune response of cattle against fasciolopsis induced by inoculation of irradiated metacercariae of fasciola gigantic

    International Nuclear Information System (INIS)

    M-Arifin

    2006-01-01

    An experiment was carried out to study the immune response of cattle against fasciolopsis induced by inoculation of irradiated metacercariae of F. gigantic. Four groups of experimental cattle were used e.g: the first group (Vp) were inoculated by the unirradiated metacercariae as a positive control, the second group (Vi) were once inoculated with irradiated metacercariae and then challenged with the infected metacercariae three weeks later, the third group (Vii) were twice inoculated with irradiated metacercariae and then challenged with the infected metacercariae three weeks later, while the forth group (Vn), the negative control without any inoculation of metacercariae. Irradiation dose of 45 Gy was used, and each experimental animal received 700 live’s metacercariae of F. gigantic. The immune response towards fasciolopsis in cattle has been observed in the development of body weight, the number of red blood cells (RBC), the number of white blood cells (WBC), level of haemoglobin (Hb), percentages of Packed cell volume (PCV), the number of eosinophil cells, serological test by ELISA, pathology anatomic inspection and evaluation of the development of worm.The average every measurement of body weight development are Vp = 6 kg, Vi = 9 kg, Vii = 9 kg and Vn = 10 kg. The group of Vi, Vii and Vn were normal of their heart, but the group of Vp was disorder. The group of Vi, Vii and Vn were negative of adult worm’s, while the group of Vp was positive of adult worm’s. These results showed that inoculation of irradiated metacercariae F. gigantic could stimulate good immune response which was able to protect against the infectivity of the challenge in cattle. (author)

  8. A Mathematical Model of Skeletal Muscle Disease and Immune Response in the mdx Mouse

    Directory of Open Access Journals (Sweden)

    Abdul Salam Jarrah

    2014-01-01

    Full Text Available Duchenne muscular dystrophy (DMD is a genetic disease that results in the death of affected boys by early adulthood. The genetic defect responsible for DMD has been known for over 25 years, yet at present there is neither cure nor effective treatment for DMD. During early disease onset, the mdx mouse has been validated as an animal model for DMD and use of this model has led to valuable but incomplete insights into the disease process. For example, immune cells are thought to be responsible for a significant portion of muscle cell death in the mdx mouse; however, the role and time course of the immune response in the dystrophic process have not been well described. In this paper we constructed a simple mathematical model to investigate the role of the immune response in muscle degeneration and subsequent regeneration in the mdx mouse model of Duchenne muscular dystrophy. Our model suggests that the immune response contributes substantially to the muscle degeneration and regeneration processes. Furthermore, the analysis of the model predicts that the immune system response oscillates throughout the life of the mice, and the damaged fibers are never completely cleared.

  9. Metabolic and adaptive immune responses induced in mice infected ...

    African Journals Online (AJOL)

    This study investigated metabolic and immuno-inflammatory responses of mice infected with tissue-dwelling larvae of Trichinella zimbabwensis and explored the relationship between infection, metabolic parameters and Th1/Th17 immune responses. Sixty (60) female BALB/c mice aged between 6 to 8 weeks old were ...

  10. A Comparative Study of Peripheral Immune Responses to Taenia solium in Individuals with Parenchymal and Subarachnoid Neurocysticercosis.

    Directory of Open Access Journals (Sweden)

    Iskra Tuero

    2015-10-01

    Full Text Available The ability of Taenia solium to modulate the immune system likely contributes to their longevity in the human host. We tested the hypothesis that the nature of the immune response is related to the location of parasite and clinical manifestations of infection.Peripheral blood mononuclear cells (PBMC were obtained from untreated patients with neurocysticercosis (NCC, categorized as having parenchymal or subarachnoid infection by the presence of cysts exclusively within the parenchyma or in subarachnoid spaces of the brain, and from uninfected (control individuals matched by age and gender to each patient. Using multiplex detection technology, sera from NCC patients and controls and cytokine production by PBMC after T. solium antigen (TsAg stimulation were assayed for levels of inflammatory and regulatory cytokines. PBMC were phenotyped by flow cytometry ex vivo and following in vitro stimulation with TsAg.Sera from patients with parenchymal NCC demonstrated significantly higher Th1 (IFN-γ/IL-12 and Th2 (IL-4/IL-13 cytokine responses and trends towards higher levels of IL-1β/IL-8/IL-5 than those obtained from patients with subarachnoid NCC. Also higher in vitro antigen-driven TNF-β secretion was detected in PBMC supernatants from parenchymal than in subarachnoid NCC. In contrast, there was a significantly higher IL-10 response to TsAg stimulation in patients with subarachnoid NCC compared to parenchymal NCC. Although no differences in regulatory T cells (Tregs frequencies were found ex vivo, there was a trend towards greater expansion of Tregs upon TsAg stimulation in subarachnoid than in parenchymal NCC when data were normalized for the corresponding controls.T. solium infection of the subarachnoid space is associated with an enhanced regulatory immune response compared to infection in the parenchyma. The resulting anti-inflammatory milieu may represent a parasite strategy to maintain a permissive environment in the host or diminish

  11. Aberrant cellular immune responses in humans infected persistently with parvovirus B19

    DEFF Research Database (Denmark)

    Isa, Adiba; Norbeck, Oscar; Hirbod, Taha

    2006-01-01

    A subset of parvovirus B19 (B19) infected patients retains the infection for years, as defined by detection of B19 DNA in bone marrow. Thus far, analysis of B19-specific humoral immune responses and viral genome variations has not revealed a mechanism for the absent viral clearance. In this study......, ex-vivo cellular immune responses were assessed by enzyme linked immunospot assay mounted against the majority of the translated viral genome. Compared to seropositive healthy individuals, individuals with B19 persistence (2-8 years) showed larger number of responses to the structural proteins (P = 0.......0022), whereas responses to the non-structural protein were of lower magnitude (P = 0.012). These observations provide the first findings of immunological discrepancies between individuals with B19 persistence and healthy individuals, findings that may reflect both failed immunity and antigenic exhaustion....

  12. The immune response against Candida spp. and Sporothrix schenckii.

    Science.gov (United States)

    Martínez-Álvarez, José A; Pérez-García, Luis A; Flores-Carreón, Arturo; Mora-Montes, Héctor M

    2014-01-01

    Candida albicans is the main causative agent of systemic candidiasis, a condition with high mortality rates. The study of the interaction between C. albicans and immune system components has been thoroughly studied and nowadays there is a model for the anti-C. albicans immune response; however, little is known about the sensing of other pathogenic species of the Candida genus. Sporothrix schenckii is the causative agent of sporotrichosis, a subcutaneous mycosis, and thus far there is limited information about its interaction with the immune system. In this paper, we review the most recent information about the immune sensing of species from genus Candida and S. schenckii. Thoroughly searches in scientific journal databases were performed, looking for papers addressing either Candida- or Sporothrix-immune system interactions. There is a significant advance in the knowledge of non-C. albicans species of Candida and Sporothrix immune sensing; however, there are still relevant points to address, such as the specific contribution of pathogen-associated molecular patterns (PAMPs) for sensing by different immune cells and the immune receptors involved in such interactions. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  13. CHRONOVAC VOYAGEUR: A study of the immune response to yellow fever vaccine among infants previously immunized against measles.

    Science.gov (United States)

    Goujon, Catherine; Gougeon, Marie-Lise; Tondeur, Laura; Poirier, Béatrice; Seffer, Valérie; Desprès, Philippe; Consigny, Paul-Henri; Vray, Muriel

    2017-10-27

    For administration of multiple live attenuated vaccines, the Advisory Committee on Immunization Practices recommends either simultaneous immunization or period of at least 28days between vaccines, due to a possible reduction in the immune response to either vaccine. The main objective of this study was to compare the immune response to measles (alone or combined with mumps and rubella) and yellow fever vaccines among infants aged 6-24months living in a yellow fever non-endemic country who had receivedmeasles and yellow fever vaccines before travelling to a yellow fever endemic area. A retrospective, multicenter case-control study was carried out in 7 travel clinics in the Paris area from February 1st 2011 to march 31, 2015. Cases were defined as infants immunized with the yellow fever vaccine and with the measles vaccine, either alone or in combination with mumps and rubella vaccine, with a period of 1-27days between each immunization. For each case, two controls were matched based on sex and age: a first control group (control 1) was defined as infants having received the measles vaccine and the yellow fever vaccine simultaneously; a second control group (control 2) was defined as infants who had a period of more than 27days between receiving the measles vaccine and yellow fever vaccine. The primary endpoint of the study was the percentage of infants with protective immunity against yellow fever, measured by the titer of neutralizing antibodies in a venous blood sample. One hundred and thirty-one infants were included in the study (62 cases, 50 infants in control 1 and 19 infants in control 2). Of these, 127 (96%) were shown to have a protective titer of yellow fever antibodies. All 4 infants without a protective titer of yellow fever antibodies were part of control group 1. The measles vaccine, alone or combined with mumps and rubella vaccines, appears to have no influence on humoral immune response to the yellow fever vaccine when administered between 1 and 27

  14. FEATURES OF THE IMMUNE RESPONSE DURING INFECTION AND PROSPECTS FOR THE VACCINES CREATION

    Directory of Open Access Journals (Sweden)

    Davidova T.V.

    2015-12-01

    Full Text Available The influenza virus belongs to the family Orthomyxoviridae and is a major cause of respiratory infections in humans. Each year, influenza viruses cause, according to experts, 3-5 million severe course of the disease and 250 000-500 000 deaths. Influenza A viruses are divided into serotypes based on their surface glycoproteins - known currently 17 subtypes of HA and NA subtypes ten. Upon infection with an influenza virus, both innate and adaptive immune responses are inducing. In recent years the annual seasonal epidemics were causing strains of the virus A (H1N1 and H3N2 and virus B. This may be due to their ability to be unrecognizable virus specific antibodies due to antigenic drift (Figure 1. Seasonal flu vaccine, to be effective, must be updated almost annually, according to new epidemic strains. In this work will discuss various strategies used by influenza viruses to evade innate immune responses and recognition by components of the humoral and cellular immune response, which consequently may result in reduced clearing of the virus and virus-infected cells.The primary targets for influenza viruses are the epithelial cells that line the respiratory tract and which initiate an antiviral immune response upon detection of the virus. The first line of defense is formed by the innate immune system, which is quick but lacks specificity and memory. Innate immunity is formed by physical barriers and innate cellular immune responses. Here, we outline several of the innate defense mechanisms directed against influenza infections. During homeostasis, alveolar macrophages exhibit a relatively quiescent state, producing only low levels of cytokines, and suppress the induction of innate and adaptive immunity. Activated macrophages enhance their pro-inflammatory cytokine response, including IL-6 and TNF-α. Alveolar macrophages have a direct role in limiting viral spread by phagocytosis of apoptotic infected cells and by phagocyte

  15. A heteroscedastic generalized linear model with a non-normal speed factor for responses and response times.

    Science.gov (United States)

    Molenaar, Dylan; Bolsinova, Maria

    2017-05-01

    In generalized linear modelling of responses and response times, the observed response time variables are commonly transformed to make their distribution approximately normal. A normal distribution for the transformed response times is desirable as it justifies the linearity and homoscedasticity assumptions in the underlying linear model. Past research has, however, shown that the transformed response times are not always normal. Models have been developed to accommodate this violation. In the present study, we propose a modelling approach for responses and response times to test and model non-normality in the transformed response times. Most importantly, we distinguish between non-normality due to heteroscedastic residual variances, and non-normality due to a skewed speed factor. In a simulation study, we establish parameter recovery and the power to separate both effects. In addition, we apply the model to a real data set. © 2017 The Authors. British Journal of Mathematical and Statistical Psychology published by John Wiley & Sons Ltd on behalf of British Psychological Society.

  16. Immunization of neonatal mice with LAMP/p55 HIV gag DNA elicits robust immune responses that last to adulthood

    International Nuclear Information System (INIS)

    Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia; Piubelli, Orlando; Alves de Brito, Cyro; Fusaro, Ana Elisa; Eurico de Alencar, Liciana Xavier; August, Thomas; Torres Azevedo Marques, Ernesto; Silva Duarte, Alberto Jose da; Sato, Maria Notomi

    2010-01-01

    Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses, as measured by the breadth of the Gag peptide-specific IFN-γ, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.

  17. Perturbation of gut bacteria induces a coordinated cellular immune response in the purple sea urchin larva

    Science.gov (United States)

    CH Ho, Eric; Buckley, Katherine M; Schrankel, Catherine S; Schuh, Nicholas W; Hibino, Taku; Solek, Cynthia M; Bae, Koeun; Wang, Guizhi; Rast, Jonathan P

    2016-01-01

    The purple sea urchin (Strongylocentrotus purpuratus) genome sequence contains a complex repertoire of genes encoding innate immune recognition proteins and homologs of important vertebrate immune regulatory factors. To characterize how this immune system is deployed within an experimentally tractable, intact animal, we investigate the immune capability of the larval stage. Sea urchin embryos and larvae are morphologically simple and transparent, providing an organism-wide model to view immune response at cellular resolution. Here we present evidence for immune function in five mesenchymal cell types based on morphology, behavior and gene expression. Two cell types are phagocytic; the others interact at sites of microbial detection or injury. We characterize immune-associated gene markers for three cell types, including a perforin-like molecule, a scavenger receptor, a complement-like thioester-containing protein and the echinoderm-specific immune response factor 185/333. We elicit larval immune responses by (1) bacterial injection into the blastocoel and (2) seawater exposure to the marine bacterium Vibrio diazotrophicus to perturb immune state in the gut. Exposure at the epithelium induces a strong response in which pigment cells (one type of immune cell) migrate from the ectoderm to interact with the gut epithelium. Bacteria that accumulate in the gut later invade the blastocoel, where they are cleared by phagocytic and granular immune cells. The complexity of this coordinated, dynamic inflammatory program within the simple larval morphology provides a system in which to characterize processes that direct both aspects of the echinoderm-specific immune response as well as those that are shared with other deuterostomes, including vertebrates. PMID:27192936

  18. The Immune Response against Acinetobacter baumannii, an Emerging Pathogen in Nosocomial Infections

    Science.gov (United States)

    García-Patiño, María Guadalupe; García-Contreras, Rodolfo; Licona-Limón, Paula

    2017-01-01

    Acinetobacter baumannii is the etiologic agent of a wide range of nosocomial infections, including pneumonia, bacteremia, and skin infections. Over the last 45 years, an alarming increase in the antibiotic resistance of this opportunistic microorganism has been reported, a situation that hinders effective treatments. In order to develop effective therapies against A. baumannii it is crucial to understand the basis of host–bacterium interactions, especially those concerning the immune response of the host. Different innate immune cells such as monocytes, macrophages, dendritic cells, and natural killer cells have been identified as important effectors in the defense against A. baumannii; among them, neutrophils represent a key immune cell indispensable for the control of the infection. Several immune strategies to combat A. baumannii have been identified such as recognition of the bacteria by immune cells through pattern recognition receptors, specifically toll-like receptors, which trigger bactericidal mechanisms including oxidative burst and cytokine and chemokine production to amplify the immune response against the pathogen. However, a complete picture of the protective immune strategies activated by this bacteria and its potential therapeutic use remains to be determined and explored. PMID:28446911

  19. The Abscopal Effect Associated With a Systemic Anti-melanoma Immune Response

    International Nuclear Information System (INIS)

    Stamell, Emily F.; Wolchok, Jedd D.; Gnjatic, Sacha; Lee, Nancy Y.; Brownell, Isaac

    2013-01-01

    The clearance of nonirradiated tumors after localized radiation therapy is known as the abscopal effect. Activation of an antitumor immune response has been proposed as a mechanism for the abscopal effect. Here we report a patient with metastatic melanoma who received palliative radiation to his primary tumor with subsequent clearance of all his nonirradiated in-transit metastases. Anti-MAGEA3 antibodies were found upon serological testing, demonstrating an association between the abscopal effect and a systemic antitumor immune response. A brain recurrence was then treated with a combination of stereotactic radiosurgery and immunotherapy with ipilimumab. The patient experienced a complete remission that included resolution of nodal metastases, with a concomitant increase in MAGEA3 titers and a new response to the cancer antigen PASD1. This case supports the immune hypothesis for the abscopal effect, and illustrates the potential of combining radiotherapy and immunotherapy in the treatment of melanoma.

  20. The Abscopal Effect Associated With a Systemic Anti-melanoma Immune Response

    Energy Technology Data Exchange (ETDEWEB)

    Stamell, Emily F. [Division of Dermatology, Department of Medicine, Albert Einstein College of Medicine, Bronx, New York (United States); Wolchok, Jedd D. [Melanoma and Sarcoma Service, Department of Medicine, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Ludwig Institute for Cancer Research, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Ludwig Center for Cancer Immunotherapy, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Weill-Cornell Medical College, New York, New York (United States); Gnjatic, Sacha [Ludwig Institute for Cancer Research, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Ludwig Center for Cancer Immunotherapy, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Lee, Nancy Y. [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Brownell, Isaac, E-mail: Isaac.brownell@nih.gov [Dermatology Service, Department of Medicine, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Dermatology Branch, National Cancer Institute, Bethesda, Maryland (United States)

    2013-02-01

    The clearance of nonirradiated tumors after localized radiation therapy is known as the abscopal effect. Activation of an antitumor immune response has been proposed as a mechanism for the abscopal effect. Here we report a patient with metastatic melanoma who received palliative radiation to his primary tumor with subsequent clearance of all his nonirradiated in-transit metastases. Anti-MAGEA3 antibodies were found upon serological testing, demonstrating an association between the abscopal effect and a systemic antitumor immune response. A brain recurrence was then treated with a combination of stereotactic radiosurgery and immunotherapy with ipilimumab. The patient experienced a complete remission that included resolution of nodal metastases, with a concomitant increase in MAGEA3 titers and a new response to the cancer antigen PASD1. This case supports the immune hypothesis for the abscopal effect, and illustrates the potential of combining radiotherapy and immunotherapy in the treatment of melanoma.

  1. Immune activation alters cellular and humoral responses to yellow fever 17D vaccine.

    Science.gov (United States)

    Muyanja, Enoch; Ssemaganda, Aloysius; Ngauv, Pearline; Cubas, Rafael; Perrin, Helene; Srinivasan, Divya; Canderan, Glenda; Lawson, Benton; Kopycinski, Jakub; Graham, Amanda S; Rowe, Dawne K; Smith, Michaela J; Isern, Sharon; Michael, Scott; Silvestri, Guido; Vanderford, Thomas H; Castro, Erika; Pantaleo, Giuseppe; Singer, Joel; Gillmour, Jill; Kiwanuka, Noah; Nanvubya, Annet; Schmidt, Claudia; Birungi, Josephine; Cox, Josephine; Haddad, Elias K; Kaleebu, Pontiano; Fast, Patricia; Sekaly, Rafick-Pierre; Trautmann, Lydie; Gaucher, Denis

    2014-07-01

    Defining the parameters that modulate vaccine responses in African populations will be imperative to design effective vaccines for protection against HIV, malaria, tuberculosis, and dengue virus infections. This study aimed to evaluate the contribution of the patient-specific immune microenvironment to the response to the licensed yellow fever vaccine 17D (YF-17D) in an African cohort. We compared responses to YF-17D in 50 volunteers in Entebbe, Uganda, and 50 volunteers in Lausanne, Switzerland. We measured the CD8+ T cell and B cell responses induced by YF-17D and correlated them with immune parameters analyzed by flow cytometry prior to vaccination. We showed that YF-17D-induced CD8+ T cell and B cell responses were substantially lower in immunized individuals from Entebbe compared with immunized individuals from Lausanne. The impaired vaccine response in the Entebbe cohort associated with reduced YF-17D replication. Prior to vaccination, we observed higher frequencies of exhausted and activated NK cells, differentiated T and B cell subsets and proinflammatory monocytes, suggesting an activated immune microenvironment in the Entebbe volunteers. Interestingly, activation of CD8+ T cells and B cells as well as proinflammatory monocytes at baseline negatively correlated with YF-17D-neutralizing antibody titers after vaccination. Additionally, memory T and B cell responses in preimmunized volunteers exhibited reduced persistence in the Entebbe cohort but were boosted by a second vaccination. Together, these results demonstrate that an activated immune microenvironment prior to vaccination impedes efficacy of the YF-17D vaccine in an African cohort and suggest that vaccine regimens may need to be boosted in African populations to achieve efficient immunity. Registration is not required for observational studies. This study was funded by Canada's Global Health Research Initiative, Defense Threat Reduction Agency, National Institute of Allergy and Infectious Diseases

  2. Astaxanthin decreased oxidative stress and inflammation and enhanced immune response in humans

    Directory of Open Access Journals (Sweden)

    Line Larry L

    2010-03-01

    Full Text Available Abstract Background Astaxanthin modulates immune response, inhibits cancer cell growth, reduces bacterial load and gastric inflammation, and protects against UVA-induced oxidative stress in in vitro and rodent models. Similar clinical studies in humans are unavailable. Our objective is to study the action of dietary astaxanthin in modulating immune response, oxidative status and inflammation in young healthy adult female human subjects. Methods Participants (averaged 21.5 yr received 0, 2, or 8 mg astaxanthin (n = 14/diet daily for 8 wk in a randomized double-blind, placebo-controlled study. Immune response was assessed on wk 0, 4 and 8, and tuberculin test performed on wk 8. Results Plasma astaxanthin increased (P helper, Tcytotoxic or natural killer cells. A higher percentage of leukocytes expressed the LFA-1 marker in subjects given 2 mg astaxanthin on wk 8. Subjects fed 2 mg astaxanthin had a higher tuberculin response than unsupplemented subjects. There was no difference in TNF and IL-2 concentrations, but plasma IFN-γ and IL-6 increased on wk 8 in subjects given 8 mg astaxanthin. Conclusion Therefore, dietary astaxanthin decreases a DNA damage biomarker and acute phase protein, and enhances immune response in young healthy females.

  3. Balancing immune protection and immune pathology by CD8+ T cell responses to influenza infection

    Directory of Open Access Journals (Sweden)

    Susu eDuan

    2016-02-01

    Full Text Available Influenza A virus (IAV is a significant human pathogen causing annual epidemics and periodic pandemics. CD8+ cytotoxic T lymphocyte (CTL-mediated immunity contributes to clearance of virus-infected cells; CTL immunity targeting the conserved internal proteins of IAVs is a key protection mechanism when neutralizing antibodies are absent during heterosubtypic IAV infection. However, CTL infiltration into the airways, their cytotoxicity, and the effects of produced pro-inflammatory cytokines can cause severe lung tissue injury, thereby contributing to immunopathology. Studies have discovered complicated and exquisite stimulatory and inhibitory mechanisms that regulate CTL magnitude and effector activities during IAV infection. Here, we review the state of knowledge on the roles of IAV-specific CTLs in immune protection and immunopathology during IAV infection in animal models, highlighting the key findings of various requirements and constraints regulating the balance of immune protection and pathology involved in CTL immunity. We also discuss the evidence of cross-reactive CTL immunity as a positive correlate of cross-subtype protection during secondary IAV infection in both animal and human studies. We argue that the effects of CTL immunity on protection and immunopathology depend on multiple layers of host and viral factors, including complex host mechanisms to regulate CTL magnitude and effector activity, the pathogenic nature of the IAV, the innate response milieu, and the host historical immune context of influenza infection. Future efforts are needed to further understand these key host and viral factors, especially to differentiate those that constrain optimally effective CTL anti-viral immunity from those necessary to restrain CTL-mediated nonspecific immunopathology in the various contexts of IAV infection, in order to develop better vaccination and therapeutic strategies for modifying protective CTL immunity.

  4. Early Involvement of Immune/Inflammatory Response Genes in Retinal Degeneration in DBA/2J Mice

    Directory of Open Access Journals (Sweden)

    W. Fan

    2010-01-01

    Full Text Available Purpose The DBA/2J (D2 mouse carries mutations in two of its genes, Tyrp1 and Gpnmb. These alterations result in the development of an immune response in the iris, leading to iris atrophy and pigment dispersion. The development of elevated intraocular pressure (IOP in this model of glaucoma is considered to be a significant factor leading to the death of retinal ganglion cells (RGCs. Changes in gene expression in the retina have already been correlated with the appearance of elevated IOP in the D2 mouse. The purpose of the present study was to determine if any changes in gene expression occur prior to the development of IOP. Methods The IOP was measured monthly using a rebound tonometer in D2 and age-matched C57/BL6 (B6 mice (normal controls. D2 animals with normal IOP at 2 and 4 M were used. In addition, mice at the age of 6–7 M were included to look for any trends in gene expression that might develop during the progression of the disease. Separate RNA samples were prepared from each of three individual retinas for each age, and gene expression profiles were determined with the aid of mouse oligonucleotide arrays (Agilent. A subset of genes was examined with the aid of real-time PCR. Immunocytochemistry was used to visualize changes in the retina for some of the gene-products. Results Four hundred and thirteen oligonucleotide probes were differentially expressed in the retinas of 4 M versus 2 M old D2 mice. The most significantly up-regulated genes (181 were associated with immune responses including interferon signaling, the complement system and the antigen presentation pathway, whereas the down-regulated genes (232 were linked to pathways related to cell death and known neurological diseases/disorders. These particular changes were not revealed in the age-matched B6 mice. By 6 M, when IOP started to increase in many of the D2 mice, more robust changes of these same genes were observed. Changes in the levels of selected genes

  5. Early Involvement of Immune/Inflammatory Response Genes in Retinal Degeneration in DBA/2J Mice

    Directory of Open Access Journals (Sweden)

    W. Fan

    2010-03-01

    Full Text Available Purpose: The DBA/2J (D2 mouse carries mutations in two of its genes, Tyrp1 and Gpnmb. These alterations result in the development of an immune response in the iris, leading to iris atrophy and pigment dispersion. The development of elevated intraocular pressure (IOP in this model of glaucoma is considered to be a significant factor leading to the death of retinal ganglion cells (RGCs. Changes in gene expression in the retina have already been correlated with the appearance of elevated IOP in the D2 mouse. The purpose of the present study was to determine if any changes in gene expression occur prior to the development of IOP. Methods: The IOP was measured monthly using a rebound tonometer in D2 and age-matched C57/BL6 (B6 mice (normal controls. D2 animals with normal IOP at 2 and 4 M were used. In addition, mice at the age of 6–7 M were included to look for any trends in gene expression that might develop during the progression of the disease. Separate RNA samples were prepared from each of three individual retinas for each age, and gene expression profiles were determined with the aid of mouse oligonucleotide arrays (Agilent. A subset of genes was examined with the aid of real-time PCR. Immunocytochemistry was used to visualize changes in the retina for some of the gene-products. Results: Four hundred and thirteen oligonucleotide probes were differentially expressed in the retinas of 4 M versus 2 M old D2 mice. The most significantly up-regulated genes (181 were associated with immune responses including interferon signaling, the complement system and the antigen presentation pathway, whereas the down-regulated genes (232 were linked to pathways related to cell death and known neurological diseases/disorders. These particular changes were not revealed in the age-matched B6 mice. By 6 M, when IOP started to increase in many of the D2 mice, more robust changes of these same genes were observed. Changes in the levels of selected genes

  6. Immunization with Paracoccidioides brasiliensis radioattenuated yeast cells induces Th1 immune response in Balb/C mice

    Energy Technology Data Exchange (ETDEWEB)

    Martins, Estefania M.N.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN-CNEN/MG), Belo Horizonte, MG (Brazil)], e-mail: estefaniabio@yahoo.com.br, e-mail: antero@cdtn.br; Resende, Maria Aparecida de [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Microbiologia], e-mail: maresend@mono.icb.ufmg.br; Reis, Bernardo S.; Goes, Alfredo M. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Bioquimica e Imunologia], e-mail: goes@mono.icb.ufmg.br, e-mail: brsgarbi@mono.icb.ufmg.br

    2009-07-01

    Paracoccidioides brasiliensis is the agent of paracoccidioidomycosis, the most prevalent mycosis in Latin America. To date, there is no effective vaccine. In our laboratory yeast cells of P. brasiliensis were attenuated by gamma irradiation. We defined an absorbed dose in which the pathogen loses the reproductive ability, while retaining the morphology, the synthesis and secretion of proteins and the oxidative metabolism. The immunization with these cells was able to confer protection in BALB/c mice. The aim of the present work was evaluate the immune response pathway activated in mice immunized with P. brasiliensis radioattenuated yeast cells. The protector effect was evaluated in BALB/c mice groups immunized once or twice, respectively. Each group was divided in three sub groups that were challenge 30, 45 or 60 days after the immunization. These groups were called G1A, G1B and G1C in the group immunized once and G2A, G2B and G2C in the group immunized twice. Recovery of CFUs and cytokines determination (IFN - {gamma}, IL - 10 and IL IV 4) were performed three months post challenge. Quantitative RT-PCR was the method of choice used to quantify the expression of cytokines. The sera were collected weekly to evaluate the IgG antibody titers and the IgG1 and IgG2a pattern in the course of infection. A significant reduction in CFUs recovery was verified 90 days post challenge in mice submitted to one immunization: 73.0%, 96.0% and 76.3% for sub-groups G1A, G1B and G1C, respectively. In the group submitted to two immunizations, a remarkable increase in the protection was obtained. No CFUs was recovered from sub-groups G2B and G2C and very few CFUs (reduction of 98.6%) were recovered from the lungs of sub group G2A. In mice submitted to one immunization, Th1 and Th2 cytokines were simultaneously produced. In the group submitted to two immunizations, levels of IL-10 and IL-4 were very low, while IFN-{gamma} production was maintained indicating that a Th1 pattern was

  7. Immunization with Paracoccidioides brasiliensis radioattenuated yeast cells induces Th1 immune response in Balb/C mice

    International Nuclear Information System (INIS)

    Martins, Estefania M.N.; Andrade, Antero S.R.; Resende, Maria Aparecida de; Reis, Bernardo S.; Goes, Alfredo M.

    2009-01-01

    Paracoccidioides brasiliensis is the agent of paracoccidioidomycosis, the most prevalent mycosis in Latin America. To date, there is no effective vaccine. In our laboratory yeast cells of P. brasiliensis were attenuated by gamma irradiation. We defined an absorbed dose in which the pathogen loses the reproductive ability, while retaining the morphology, the synthesis and secretion of proteins and the oxidative metabolism. The immunization with these cells was able to confer protection in BALB/c mice. The aim of the present work was evaluate the immune response pathway activated in mice immunized with P. brasiliensis radioattenuated yeast cells. The protector effect was evaluated in BALB/c mice groups immunized once or twice, respectively. Each group was divided in three sub groups that were challenge 30, 45 or 60 days after the immunization. These groups were called G1A, G1B and G1C in the group immunized once and G2A, G2B and G2C in the group immunized twice. Recovery of CFUs and cytokines determination (IFN - γ, IL - 10 and IL IV 4) were performed three months post challenge. Quantitative RT-PCR was the method of choice used to quantify the expression of cytokines. The sera were collected weekly to evaluate the IgG antibody titers and the IgG1 and IgG2a pattern in the course of infection. A significant reduction in CFUs recovery was verified 90 days post challenge in mice submitted to one immunization: 73.0%, 96.0% and 76.3% for sub-groups G1A, G1B and G1C, respectively. In the group submitted to two immunizations, a remarkable increase in the protection was obtained. No CFUs was recovered from sub-groups G2B and G2C and very few CFUs (reduction of 98.6%) were recovered from the lungs of sub group G2A. In mice submitted to one immunization, Th1 and Th2 cytokines were simultaneously produced. In the group submitted to two immunizations, levels of IL-10 and IL-4 were very low, while IFN-γ production was maintained indicating that a Th1 pattern was dominant. For

  8. The serological response to heartwater immunization in cattle is an indicator of protective immunity

    DEFF Research Database (Denmark)

    Lawrence, J A; Tjørnehøj, Kirsten; Whiteland, A P

    1995-01-01

    A significant correlation was demonstrated in Friesian-cross steers between the serological response to previous vaccination with the Ball 3 strain of Cowdria ruminantium and the development of protective immunity against the Kalota isolate from Malawi. Of 10 animals which seroconverted after vac...

  9. Assessment of humoral immune responses to blood-stage malaria antigens following ChAd63-MVA immunization, controlled human malaria infection and natural exposure.

    Science.gov (United States)

    Biswas, Sumi; Choudhary, Prateek; Elias, Sean C; Miura, Kazutoyo; Milne, Kathryn H; de Cassan, Simone C; Collins, Katharine A; Halstead, Fenella D; Bliss, Carly M; Ewer, Katie J; Osier, Faith H; Hodgson, Susanne H; Duncan, Christopher J A; O'Hara, Geraldine A; Long, Carole A; Hill, Adrian V S; Draper, Simon J

    2014-01-01

    The development of protective vaccines against many difficult infectious pathogens will necessitate the induction of effective antibody responses. Here we assess humoral immune responses against two antigens from the blood-stage merozoite of the Plasmodium falciparum human malaria parasite--MSP1 and AMA1. These antigens were delivered to healthy malaria-naïve adult volunteers in Phase Ia clinical trials using recombinant replication-deficient viral vectors--ChAd63 to prime the immune response and MVA to boost. In subsequent Phase IIa clinical trials, immunized volunteers underwent controlled human malaria infection (CHMI) with P. falciparum to assess vaccine efficacy, whereby all but one volunteer developed low-density blood-stage parasitemia. Here we assess serum antibody responses against both the MSP1 and AMA1 antigens following i) ChAd63-MVA immunization, ii) immunization and CHMI, and iii) primary malaria exposure in the context of CHMI in unimmunized control volunteers. Responses were also assessed in a cohort of naturally-immune Kenyan adults to provide comparison with those induced by a lifetime of natural malaria exposure. Serum antibody responses against MSP1 and AMA1 were characterized in terms of i) total IgG responses before and after CHMI, ii) responses to allelic variants of MSP1 and AMA1, iii) functional growth inhibitory activity (GIA), iv) IgG avidity, and v) isotype responses (IgG1-4, IgA and IgM). These data provide the first in-depth assessment of the quality of adenovirus-MVA vaccine-induced antibody responses in humans, along with assessment of how these responses are modulated by subsequent low-density parasite exposure. Notable differences were observed in qualitative aspects of the human antibody responses against these malaria antigens depending on the means of their induction and/or exposure of the host to the malaria parasite. Given the continued clinical development of viral vectored vaccines for malaria and a range of other diseases

  10. Assessment of humoral immune responses to blood-stage malaria antigens following ChAd63-MVA immunization, controlled human malaria infection and natural exposure.

    Directory of Open Access Journals (Sweden)

    Sumi Biswas

    Full Text Available The development of protective vaccines against many difficult infectious pathogens will necessitate the induction of effective antibody responses. Here we assess humoral immune responses against two antigens from the blood-stage merozoite of the Plasmodium falciparum human malaria parasite--MSP1 and AMA1. These antigens were delivered to healthy malaria-naïve adult volunteers in Phase Ia clinical trials using recombinant replication-deficient viral vectors--ChAd63 to prime the immune response and MVA to boost. In subsequent Phase IIa clinical trials, immunized volunteers underwent controlled human malaria infection (CHMI with P. falciparum to assess vaccine efficacy, whereby all but one volunteer developed low-density blood-stage parasitemia. Here we assess serum antibody responses against both the MSP1 and AMA1 antigens following i ChAd63-MVA immunization, ii immunization and CHMI, and iii primary malaria exposure in the context of CHMI in unimmunized control volunteers. Responses were also assessed in a cohort of naturally-immune Kenyan adults to provide comparison with those induced by a lifetime of natural malaria exposure. Serum antibody responses against MSP1 and AMA1 were characterized in terms of i total IgG responses before and after CHMI, ii responses to allelic variants of MSP1 and AMA1, iii functional growth inhibitory activity (GIA, iv IgG avidity, and v isotype responses (IgG1-4, IgA and IgM. These data provide the first in-depth assessment of the quality of adenovirus-MVA vaccine-induced antibody responses in humans, along with assessment of how these responses are modulated by subsequent low-density parasite exposure. Notable differences were observed in qualitative aspects of the human antibody responses against these malaria antigens depending on the means of their induction and/or exposure of the host to the malaria parasite. Given the continued clinical development of viral vectored vaccines for malaria and a range of other

  11. Involvement of T- and B-lymphocytes in the immune response to the protein exotoxin and the lipopolysaccharide antigens of Vibrio cholerae

    International Nuclear Information System (INIS)

    Kateley, J.R.; Patel, C.B.; Friedman, H.

    1975-01-01

    The immune response at the level of individual immunocytes to the somatic lipopolysaccharide antigen derived from whole Vibrio cholerae and to the purified protein exotoxin from this organism were studied in terms of the role of T- and B-lymphocytes. By adoptive cell transfer studies with irradiated recipient mice, it was shown that normal spleen cells from normal syngeneic mice could readily transfer the capability of responding to both types of cholera antigens. However, when the spleen cells were depleted of T-cells with anti-theta serum and complement, antibody responsiveness to the LPS antigen, but not the exotoxin, could be achieved in recipients. Furthermore, by appropriate transfer of either bone marrow, thymus, or thymus-marrow cell mixtures to irradiated mice, it was shown that the response to the cholera somatic antigen was relatively independent of thymus cells, whereas the response to exotoxin required ''helper'' T-cells

  12. Effects of inhaled insoluble 239PuO2 on immune responses following lung immunization

    International Nuclear Information System (INIS)

    Bice, D.E.; Harris, D.L.; Brooks, A.L.; Mewhinney, J.A.

    1978-01-01

    To determine if inhaled 239 PuO 2 suppresses immunity in lung-associated lymph nodes, Chinese hamsters were exposed to a polydisperse aerosol of 239 PuO 2 produced at 1150 0 C. The mean lung burden of these animals was estimated to be 10 nCi at 8 days after exposure. At 128, 256 and 400 days after exposure, sham exposed controls and experimental animals were immunized by intratracheal instillation of 1 x 10 8 sheep red blood cells (SRBC). Six days later, they were sacrificed and the number of antibody forming cells (AFC) in lung-associated lymph nodes, spleen and cervical lymph nodes was evaluated. Results of these studies indicated that the number of AFC in lung-associated lymph modes was significantly lower in animals exposed to 239 PuO 2 . Only a few AFC were found in spleen and cervical lymph nodes after intratracheal immunization and the number in exposed animals was not significantly different than in the controls. These data indicate that even though the 239 PuO 2 exposure had suppressed immune responses in lung-associated lymph nodes, their filtering capacity was unaffected and antigen did not translocate to the spleen. We conclude that, at the sacrifice intervals evaluated, the immune function of lung-associated lymph nodes was suppressed and that distant lymphoid tissue (e.g., spleen and cervical lymph nodes) did not replace the immune function of the lung-associated lymph nodes

  13. Serotonergic Chemosensory Neurons Modify the C. elegans Immune Response by Regulating G-Protein Signaling in Epithelial Cells

    Science.gov (United States)

    Anderson, Alexandra; Laurenson-Schafer, Henry; Partridge, Frederick A.; Hodgkin, Jonathan; McMullan, Rachel

    2013-01-01

    The nervous and immune systems influence each other, allowing animals to rapidly protect themselves from changes in their internal and external environment. However, the complex nature of these systems in mammals makes it difficult to determine how neuronal signaling influences the immune response. Here we show that serotonin, synthesized in Caenorhabditis elegans chemosensory neurons, modulates the immune response. Serotonin released from these cells acts, directly or indirectly, to regulate G-protein signaling in epithelial cells. Signaling in these cells is required for the immune response to infection by the natural pathogen Microbacterium nematophilum. Here we show that serotonin signaling suppresses the innate immune response and limits the rate of pathogen clearance. We show that C. elegans uses classical neurotransmitters to alter the immune response. Serotonin released from sensory neurons may function to modify the immune system in response to changes in the animal's external environment such as the availability, or quality, of food. PMID:24348250

  14. Genetic polymorphism and immune response to tuberculosis in indigenous populations: a brief review

    Directory of Open Access Journals (Sweden)

    Renata Maronna Praça Longhi

    Full Text Available We systematically reviewed studies of the immune response to tuberculosis and the genetic polymorphisms associated with Th1-or Th2-mediated cytokine expression in indigenous populations. A bibliographic search was performed on the Medline and ISI databases and included studies published between January 1980 and October 2011. The search terms were tuberculosis, American Indians, Amerindian, indigenous, Indians, native people, aboriginal, immun*, host immune, immune response, cytokine*, polymorphism*, and gene. Regardless of their design, studies that evaluated immunoglobulin, cytokine levels and genetic polymorphisms that altered cytokine expression were included. Thirteen studies met the inclusion criteria. The majority of studies were performed in Latin America, and five investigated the Warao ethnic group of Venezuela. Most of the investigations indirectly evaluated the immune response. Higher anergy to the tuberculin skin test, higher IgG4 and IgM levels, higher IL-5 production and lower TNF-a, IL-12p40 and IFN-I production were found in the indigenous populations. The studies also reported a predominantly Th2-type response in these populations and a possibly higher susceptibility to tuberculosis. A better understanding of the relevant genetic polymorphisms and their role in immune regulation would help to clarify the immunogenetic mechanisms of TB infection in these populations. This information would be useful for identifying new treatments and preventing infection and progression to active disease.

  15. Behavioural fever is a synergic signal amplifying the innate immune response.

    Science.gov (United States)

    Boltaña, Sebastian; Rey, Sonia; Roher, Nerea; Vargas, Reynaldo; Huerta, Mario; Huntingford, Felicity Anne; Goetz, Frederick William; Moore, Janice; Garcia-Valtanen, Pablo; Estepa, Amparo; Mackenzie, S

    2013-09-07

    Behavioural fever, defined as an acute change in thermal preference driven by pathogen recognition, has been reported in a variety of invertebrates and ectothermic vertebrates. It has been suggested, but so far not confirmed, that such changes in thermal regime favour the immune response and thus promote survival. Here, we show that zebrafish display behavioural fever that acts to promote extensive and highly specific temperature-dependent changes in the brain transcriptome. The observed coupling of the immune response to fever acts at the gene-environment level to promote a robust, highly specific time-dependent anti-viral response that, under viral infection, increases survival. Fish that are not offered a choice of temperatures and that therefore cannot express behavioural fever show decreased survival under viral challenge. This phenomenon provides an underlying explanation for the varied functional responses observed during systemic fever. Given the effects of behavioural fever on survival and the fact that it exists across considerable phylogenetic space, such immunity-environment interactions are likely to be under strong positive selection.

  16. Spore load and immune response of honey bees naturally infected by Nosema ceranae.

    Science.gov (United States)

    Li, Wenfeng; Evans, Jay D; Li, Jianghong; Su, Songkun; Hamilton, Michele; Chen, Yanping

    2017-12-01

    Nosema ceranae causes widespread infection in adult workers of European honey bees, Apis mellifera, and has often been linked to honey bee colony losses worldwide. Previous investigations of honey bee immune response to N. ceranae infection were largely based on laboratory experiment, however, little is known about the immune response of honey bees that are naturally infected by N. ceranae. Here, we compared the infection levels of N. ceranae in three different categories of adult bees (emergent bees, nurses, and foragers) and detected the host immune response to the N. ceranae infection under natural conditions. Our studies showed that the Nosema spore load and infection prevalence varied among the different types of adult workers, and both of them increased as honey bees aged: No infection was detected in emergent bees, nurses had a medium spore load and prevalence, while foragers were with the highest Nosema infection level and prevalence. Quantification of the mRNA levels of antimicrobial peptides (abaecin, apidaecin, defensin-1, defensin-2, and hymenoptaecin) and microbial recognition proteins (PGRP-S1, PGRP-S2, PGRP-S3, PGRP-LC, GNBP1-1, and GNBP1-2) confirmed the involvement of the Toll and/or Imd immune pathways in the host response to N. ceranae infection, and revealed an activation of host immune response by N. ceranae infection under natural conditions. Additionally, the levels of immune response were positively correlated with the Nosema spore loads in the infected bees. The information gained from this study will be relevant to the predictive modeling of honey bee disease dynamics for Nosema disease prevention and management.

  17. ENDOCANNABINOIDS AND EICOSAMOIDS: BIOSYNTHESIS AND INTERACTIONS WITH IMMUNE RESPONSE

    Directory of Open Access Journals (Sweden)

    Yu. K. Karaman

    2013-01-01

    Full Text Available The review is dedicated to modern concepts of arachidonic acid metabolites, i.e., endocannabinoids and eicosanoids, their biosynthetic pathways, cross-talk mechanisms and participation in immune response. New information from literature and own results include data concerning overlapping enzymatic pathways controlling biosynthesis of endocannabinoids and eicosanoids. Impact of synthetic cannabinoid receptor ligands upon production rates of proinflammatory cytokines and eicosanoids is discussed, as like as relationships among immune system reactivity and expression levels of cannabinoid receptors.

  18. Role of Activin A in Immune Response to Breast Cancer

    Science.gov (United States)

    2016-12-01

    strategies are needed in order to eradicate metastatic breast cancer. In this respect, the activation of the immune system to elicit anti-tumor immune...responses represents one of the most promising approaches that have recently demonstrated some success in other diseases. However, clinically apparent...content/76/14_Supplement/4986 Advertisement Advanced Search search ! Clinical Research (Excluding Clinical Trials) Abstract 4986: Regulation of radiation

  19. Humoral and cell-mediated immune responses to influenza vaccination in equine metabolic syndrome (EMS) horses.

    Science.gov (United States)

    Elzinga, Sarah; Reedy, Stephanie; Barker, Virginia D; Chambers, Thomas M; Adams, Amanda A

    2018-05-01

    Obesity is an increasing problem in the equine population with recent reports indicating that the percentage of overweight horses may range anywhere from 20.6-51%. Obesity in horses has been linked to more serious health concerns such as equine metabolic syndrome (EMS). EMS is a serious problem in the equine industry given its defining characteristics of insulin dysregualtion and obesity, as well as the involvement of laminitis. Little research however has been conducted to determine the effects of EMS on routine healthcare of these horses, in particular how they respond to vaccination. It has been shown that obese humans and mice have decreased immune responses to vaccination. EMS may have similar effects on vaccine responses in horses. If this is the case, these animals may be more susceptible to disease, acting as unknown disease reservoirs. Therefore, we investigated the effects of EMS on immune responses to routine influenza vaccination. Twenty-five adult horses of mixed-sex and mixed-breed (8-21 years old) horses; 13 EMS and 12 non-EMS were selected. Within each group, 4 horses served as non-vaccinate saline controls and the remaining horses were vaccinated with a commercially available equine influenza vaccine. Vaccination (influenza or saline) was administered on weeks 0 and 3, and peripheral blood samples taken on week 0 prior to vaccination and on weeks 1, 2, 3, 4, and 5 post vaccination. Blood samples were used to measure hemagglutination inhibition (HI) titers and equine influenza specific IgGa, IgGb, and IgGT levels. Blood samples were also used to isolate peripheral blood mononuclear cells (PBMCs) for analysis of cell mediated immune (CMI) responses via real-time polymerase chain reaction (RT-PCR). All horses receiving influenza vaccination responded with significant increases (P equine influenza specific antibodies following vaccination compared to saline controls. EMS did not significantly affect (P > 0.05) humoral immune responses as measured

  20. Late effects of atomic bomb radiation on human immune responses, (10); Results on studies of immune responses to EB-virus

    Energy Technology Data Exchange (ETDEWEB)

    Kusunoki, Yoichiro; Kyoizumi, Seishi; Ozaki, Kyoko; Saito, Mayumi; Cologne, J.B.; Akiyama, Mitoshi (Radiation Effects Research Foundation, Hiroshima (Japan))

    1992-12-01

    Anti-Epstein-Barr (EV) virus antibody titers were measured in age- and sex-matched three groups of each 124 A-bomb survivors who had exposed to <0.01 Gy, 0.01-1 Gy, or >1 Gy. These serum samples showed positive antibodies against viral capsid antigens (VCA). Antibody titers to anti-VCA-IgM or anti-EA-IgG were significantly higher in the groups of 0.01-1 Gy and >1 Gy than in the group of <0.01 Gy, reflecting decreased immune response ability for EV virus. When precursor frequency of cytotoxic cells against autologous EB virus LCL was determined in 68 other A-bomb survivors, no definitive influence of A-bombing was observed. However, serological study revealed that there was inverse correlation between precursor frequency and anti-EA-IgG antibody titer. These findings suggest that the immune response ability for EB virus may have been damaged and that biological reactivity of EB virus may occur frequently in A-bomb survivors. (N.K.).

  1. Leptin, immune responses and autoimmune disease. Perspectives on the use of leptin antagonists.

    Science.gov (United States)

    Peelman, F; Iserentant, H; Eyckerman, S; Zabeau, L; Tavernier, J

    2005-01-01

    The pivotal role of leptin in regulating body weight and energy homeostasis is very well established. More recently, leptin also emerged as an important regulator of T-cell-dependent immunity. Reduced leptin levels, as observed during periods of starvation, correlate with an impaired cellular immune response, whereby especially the T(H)1 pro-inflammatory immune response appears to be affected. Physiologically, this could reflect the high energy demand of such processes, which are suppressed in animals or people with nutrient shortage. Several autoimmune diseases are T(H)1 T-cell dependent. In line with a pro-inflammatory role for leptin, animal models of leptin deficiency are markedly resistant to a variety of T-cell dependent autoimmune diseases. Here, we review the role of leptin in immune responses, with emphasis on autoimmune diseases. The design and potential use of leptin antagonists is also discussed.

  2. Effects of BRAF mutations and BRAF inhibition on immune responses to melanoma

    Science.gov (United States)

    Ilieva, Kristina M.; Correa, Isabel; Josephs, Debra H.; Karagiannis, Panagiotis; Egbuniwe, Isioma U.; Cafferkey, Michiala J.; Spicer, James F.; Harries, Mark; Nestle, Frank O.; Lacy, Katie E.; Karagiannis, Sophia N.

    2014-01-01

    Malignant melanoma is associated with poor clinical prognosis; however, novel molecular and immune therapies are now improving patient outcomes. Almost 50% of melanomas harbor targetable activating mutations of BRAF which promote RAS-RAF-MEK-ERK pathway activation and melanoma proliferation. Recent evidence also indicates that melanomas bearing mutant BRAF may also have altered immune responses, suggesting additional avenues for treatment of this patient group. The small molecule inhibitors selective for mutant BRAF induce significant but short-lived clinical responses in a proportion of patients, but also lead to immune stimulatory bystander events, which then subside with the emergence of resistance to inhibition. Simultaneous BRAF and MEK inhibition, and especially combination of BRAF inhibitors with new immunotherapies such as checkpoint blockade antibodies, may further enhance immune activation, or counteract immunosuppressive signals. Pre-clinical evaluation and ongoing clinical trials should provide novel insights into the role of immunity in the therapy of BRAF-mutant melanoma. PMID:25385327

  3. Cellular immune responses against CT7 (MAGE-C1) and humoral responses against other cancer-testis antigens in multiple myeloma patients.

    Science.gov (United States)

    Lendvai, Nikoletta; Gnjatic, Sacha; Ritter, Erika; Mangone, Michael; Austin, Wayne; Reyner, Karina; Jayabalan, David; Niesvizky, Ruben; Jagannath, Sundar; Bhardwaj, Nina; Chen-Kiang, Selina; Old, Lloyd J; Cho, Hearn Jay

    2010-01-29

    The type I melanoma antigen gene (MAGE) proteins CT7 (MAGE-C1) and MAGE-A3 are commonly expressed in multiple myeloma (MM), and their expression correlates with increased plasma cell proliferation and poor clinical outcome. They belong to the cancer-testis antigen (CTAg) group of tumor-associated proteins, some of which elicit spontaneous immune responses in cancer patients. CT7 and MAGE-A3 are promising antigenic targets for therapeutic tumor vaccines in myeloma; therefore, it is critical to determine if they are immunogenic in MM patients. We analyzed cellular and humoral immune responses against CTAgs in patients with plasma cell dyscrasias: MM, monoclonal gammopathy of undetermined significance (MGUS), and Waldenström's macroglobulinemia (WM). Bone marrow lymphocytes from two of four untreated MM patients exhibited CT7-specific cellular immune responses as measured by an autologous cellular immunity assay, the first such immune response to CT7 to be reported in cancer patients. Sera from 24 patients were screened by ELISA for humoral immune responses to CTAgs. Two patients with MM demonstrated positive titers, one for MAGE-A1 and the other for SSX1. These data demonstrate that CTAgs, particularly CT7, are immunogenic in MM patients and merit further exploration as targets of immunological therapy in MM.

  4. Efficacy of multiple anticancer therapies may depend on host immune response

    Directory of Open Access Journals (Sweden)

    Kritika Karri

    2017-06-01

    Full Text Available The host immune system is a key player in anticancer therapy response and resistance. Although the impact of host immune response in the ‘war against cancer’ has been studied and it has been the basis for immunotherapy, understanding of its role in attenuating the action of conventional anticancer therapies is an area that has not been fully explored. In spite of advances in systemic therapy, the 5-year survival rate for adenocarcinoma is still a mere 13% and the primary reason for treatment failure is believed to be due to acquired resistance to therapy. Hence, there is a need for identifying reliable biomarkers for guided treatment of lung and colon adenocarcinoma and to better predict the outcomes of specific anticancer therapies. In this work, gene expression data were analyzed using public resources and this study shows how host immune competence underscores the efficacy of various anticancer therapies. Additionally, the result provides insight on the regulation of certain biochemical pathways relating to the immune system, and suggests that smart chemotherapeutic intervention strategies could be based on a patient’s immune profile.

  5. An Immune-inspired Adaptive Automated Intrusion Response System Model

    Directory of Open Access Journals (Sweden)

    Ling-xi Peng

    2012-09-01

    Full Text Available An immune-inspired adaptive automated intrusion response system model, named as , is proposed. The descriptions of self, non-self, immunocyte, memory detector, mature detector and immature detector of the network transactions, and the realtime network danger evaluation equations are given. Then, the automated response polices are adaptively performed or adjusted according to the realtime network danger. Thus, not only accurately evaluates the network attacks, but also greatly reduces the response times and response costs.

  6. Sequential Immunization with gp140 Boosts Immune Responses Primed by Modified Vaccinia Ankara or DNA in HIV-Uninfected South African Participants.

    Directory of Open Access Journals (Sweden)

    Gavin Churchyard

    Full Text Available The safety and immunogenicity of SAAVI DNA-C2 (4 mg IM, SAAVI MVA-C (2.9 x 109 pfu IM and Novartis V2-deleted subtype C gp140 (100 mcg with MF59 adjuvant in various vaccination regimens was evaluated in HIV-uninfected adults in South Africa.Participants at three South African sites were randomized (1:1:1:1 to one of four vaccine regimens: MVA prime, sequential gp140 protein boost (M/M/P/P; concurrent MVA/gp140 (MP/MP; DNA prime, sequential MVA boost (D/D/M/M; DNA prime, concurrent MVA/gp140 boost (D/D/MP/MP or placebo. Peak HIV specific humoral and cellular responses were measured.184 participants were enrolled: 52% were female, all were Black/African, median age was 23 years (range, 18-42 years and 79% completed all vaccinations. 159 participants reported at least one adverse event, 92.5% were mild or moderate. Five, unrelated, serious adverse events were reported. The M/M/P/P and D/D/MP/MP regimens induced the strongest peak neutralizing and binding antibody responses and the greatest CD4+ T-cell responses to Env. All peak neutralizing and binding antibody responses decayed with time. The MVA, but not DNA, prime contributed to the humoral and cellular immune responses. The D/D/M/M regimen was poorly immunogenic overall but did induce modest CD4+ T-cell responses to Gag and Pol. CD8+ T-cell responses to any antigen were low for all regimens.The SAAVI DNA-C2, SAAVI MVA-C and Novartis gp140 with MF59 adjuvant in various combinations were safe and induced neutralizing and binding antibodies and cellular immune responses. Sequential immunization with gp140 boosted immune responses primed by MVA or DNA. The best overall immune responses were seen with the M/M/P/P regimen.ClinicalTrials.gov NCT01418235.

  7. Merck Ad5/HIV induces broad innate immune activation that predicts CD8⁺ T-cell responses but is attenuated by preexisting Ad5 immunity.

    Science.gov (United States)

    Zak, Daniel E; Andersen-Nissen, Erica; Peterson, Eric R; Sato, Alicia; Hamilton, M Kristina; Borgerding, Joleen; Krishnamurty, Akshay T; Chang, Joanne T; Adams, Devin J; Hensley, Tiffany R; Salter, Alexander I; Morgan, Cecilia A; Duerr, Ann C; De Rosa, Stephen C; Aderem, Alan; McElrath, M Juliana

    2012-12-11

    To better understand how innate immune responses to vaccination can lead to lasting protective immunity, we used a systems approach to define immune signatures in humans over 1 wk following MRKAd5/HIV vaccination that predicted subsequent HIV-specific T-cell responses. Within 24 h, striking increases in peripheral blood mononuclear cell gene expression associated with inflammation, IFN response, and myeloid cell trafficking occurred, and lymphocyte-specific transcripts decreased. These alterations were corroborated by marked serum inflammatory cytokine elevations and egress of circulating lymphocytes. Responses of vaccinees with preexisting adenovirus serotype 5 (Ad5) neutralizing antibodies were strongly attenuated, suggesting that enhanced HIV acquisition in Ad5-seropositive subgroups in the Step Study may relate to the lack of appropriate innate activation rather than to increased systemic immune activation. Importantly, patterns of chemoattractant cytokine responses at 24 h and alterations in 209 peripheral blood mononuclear cell transcripts at 72 h were predictive of subsequent induction and magnitude of HIV-specific CD8(+) T-cell responses. This systems approach provides a framework to compare innate responses induced by vectors, as shown here by contrasting the more rapid, robust response to MRKAd5/HIV with that to yellow fever vaccine. When applied iteratively, the findings may permit selection of HIV vaccine candidates eliciting innate immune response profiles more likely to drive HIV protective immunity.

  8. Humoral Immune Response Kinetics in Philander opossum and Didelphis marsupialis Infected and Immunized by Trypanosoma cruzi Employing an Immunofluorescence Antibody Test

    Directory of Open Access Journals (Sweden)

    Ana Paula Legey

    1999-05-01

    Full Text Available Philander opossum and Didelphis marsupialis considered the most ancient mammals and an evolutionary success, maintain parasitism by Trypanosoma cruzi without developing any apparent disease or important tissue lesion. In order to elucidate this well-balanced interaction, we decided to compare the humoral immune response kinetics of the two didelphids naturally and experimentally infected with T. cruzi and immunized by different schedules of parasite antigens, employing an indirect fluorescence antibody test (IFAT. Both didelphids responded with high serological titers to different immunization routes, while the earliest response occurred with the intradermic route. Serological titers of naturally infected P. opossum showed a significant individual variation, while those of D. marsupialis remained stable during the entire follow-up period. The serological titers of the experimentally infected animals varied according to the inoculated strain. Our data suggest that (1 IFAT was sensitive for follow-up of P. opossum in natural and experimental T. cruzi infections; (2 both P. opossum and D. marsupialis are able to mount an efficient humoral immune response as compared to placental mammals; (3 experimentally infected P. opossum and D. marsupialis present distinct patterns of infection, depending on the subpopulation of T. cruzi, (4 the differences observed in the humoral immune responses between P. opossum and D. marsupialis, probably, reflect distinct strategies selected by these animals during their coevolution with T. cruzi.

  9. A T-cell response to a liver-stage Plasmodium antigen is not boosted by repeated sporozoite immunizations

    Science.gov (United States)

    Murphy, Sean C.; Kas, Arnold; Stone, Brad C.; Bevan, Michael J.

    2013-01-01

    Development of an antimalarial subunit vaccine inducing protective cytotoxic T lymphocyte (CTL)-mediated immunity could pave the way for malaria eradication. Experimental immunization with sporozoites induces this type of protective response, but the extremely large number of proteins expressed by Plasmodium parasites has so far prohibited the identification of sufficient discrete T-cell antigens to develop subunit vaccines that produce sterile immunity. Here, using mice singly immunized with Plasmodium yoelii sporozoites and high-throughput screening, we identified a unique CTL response against the parasite ribosomal L3 protein. Unlike CTL responses to the circumsporozoite protein (CSP), the population of L3-specific CTLs was not expanded by multiple sporozoite immunizations. CSP is abundant in the sporozoite itself, whereas L3 expression does not increase until the liver stage. The response induced by a single immunization with sporozoites reduces the parasite load in the liver so greatly during subsequent immunizations that L3-specific responses are only generated during the primary exposure. Functional L3-specific CTLs can, however, be expanded by heterologous prime-boost regimens. Thus, although repeat sporozoite immunization expands responses to preformed antigens like CSP that are present in the sporozoite itself, this immunization strategy may not expand CTLs targeting parasite proteins that are synthesized later. Heterologous strategies may be needed to increase CTL responses across the entire spectrum of Plasmodium liver-stage proteins. PMID:23530242

  10. The intracellular cholesterol landscape: dynamic integrator of the immune response

    Science.gov (United States)

    Fessler, Michael B.

    2016-01-01

    Cholesterol has typically been considered an exogenous, disease-related factor in immunity; however, recent literature suggests that a paradigm shift is in order. Sterols are now recognized to ligate several immune receptors. Altered flux through the mevalonic acid synthesis pathway also appears to be a required event in the antiviral interferon response of macrophages and in the activation, proliferation, and differentiation of T cells. In this review, evidence is discussed that suggests an intrinsic, ‘professional’ role for sterols and oxysterols in macrophage and T cell immunity. Host defense may have been the original selection pressure behind the development of mechanisms for intracellular cholesterol homeostasis. Functional coupling between sterol metabolism and immunity has fundamental implications for health and disease. PMID:27692616

  11. Long term evolution of the immune response in the rat irradiated at mean and high doses

    International Nuclear Information System (INIS)

    Malarbet, J.L.; Veyrat, M.; Le Go, R.; Prudhomme, J.; Genest, L.; Castelnau, L.

    1977-01-01

    In irradiated animals, the lymphocytes, immunity vectors, are quickly and quantitatively depressed. Their ability to respond to an antigenic stimulus was tested in rats during post-irradiation lymphopenia and after restoration of normal lymphocytosis. The antigenic stimulus, sheep erythrocytes, was applied first 2 and 3 weeks, then 1, 2 and 3 months after exposures to 60 Co gamma rays (doses 300 and 600 rads). This study covered the 3rd through the 10th day after immunisation. Blood lymphocytes were separated by the Ficoll-Contrix gradient method and spleen lymphocytes were obtained by crushing. A lymphocyte sub-population separation was obtained from centrifugation on 4 discontinuous Ficoll-Contrix gradients. Size distribution spectra show that the lighter sub-population is made up of large-sized cells and that the heavier the cells, the smaller they are. The determination of surface immunoglobulins with fluorescent antigens shows that cells bearing immunoglobulins are predominant in the low-density sub-population. The measurement of electrophoretic mobility shows a low-mobility, low-density population and a higher density, faster mobility population which could reflect a higher proportion of B-cells in the low density population and of T-cells in the higher density population. The immune response was tested on the sub-populations. The rosette-forming ability was depressed during 1 month after irradiation then became progressively normal. The cellular plaque-forming ability was markedly suppressed 15 days after irradiation, but was soon active again. These results show the qualitative aspect of the post-irradiation immune defect [fr

  12. Nasal Immunization Confers High Avidity Neutralizing Antibody Response and Immunity to Primary and Recurrent Genital Herpes in Guinea Pigs

    Science.gov (United States)

    Persson, Josefine; Zhang, Yuan; Olafsdottir, Thorunn A.; Thörn, Karolina; Cairns, Tina M.; Wegmann, Frank; Sattentau, Quentin J.; Eisenberg, Roselyn J.; Cohen, Gary H.; Harandi, Ali M.

    2016-01-01

    Genital herpes is one of the most prevalent sexually transmitted infections in both the developing and developed world. Following infection, individuals experience life-long latency associated with sporadic ulcerative outbreaks. Despite many efforts, no vaccine has yet been licensed for human use. Herein, we demonstrated that nasal immunization with an adjuvanted HSV-2 gD envelope protein mounts significant protection to primary infection as well as the establishment of latency and recurrent genital herpes in guinea pigs. Nasal immunization was shown to elicit specific T cell proliferative and IFN-γ responses as well as systemic and vaginal gD-specific IgG antibody (Ab) responses. Furthermore, systemic IgG Abs displayed potent HSV-2 neutralizing properties and high avidity. By employing a competitive surface plasmon resonance (SPR) analysis combined with a battery of known gD-specific neutralizing monoclonal Abs (MAbs), we showed that nasal immunization generated IgG Abs directed to two major discontinuous neutralizing epitopes of gD. These results highlight the potential of nasal immunization with an adjuvanted HSV-2 envelope protein for induction of protective immunity to primary and recurrent genital herpes. PMID:28082979

  13. Nasal Immunization Confers High Avidity Neutralizing Antibody Response and Immunity to Primary and Recurrent Genital Herpes in Guinea Pigs.

    Science.gov (United States)

    Persson, Josefine; Zhang, Yuan; Olafsdottir, Thorunn A; Thörn, Karolina; Cairns, Tina M; Wegmann, Frank; Sattentau, Quentin J; Eisenberg, Roselyn J; Cohen, Gary H; Harandi, Ali M

    2016-01-01

    Genital herpes is one of the most prevalent sexually transmitted infections in both the developing and developed world. Following infection, individuals experience life-long latency associated with sporadic ulcerative outbreaks. Despite many efforts, no vaccine has yet been licensed for human use. Herein, we demonstrated that nasal immunization with an adjuvanted HSV-2 gD envelope protein mounts significant protection to primary infection as well as the establishment of latency and recurrent genital herpes in guinea pigs. Nasal immunization was shown to elicit specific T cell proliferative and IFN-γ responses as well as systemic and vaginal gD-specific IgG antibody (Ab) responses. Furthermore, systemic IgG Abs displayed potent HSV-2 neutralizing properties and high avidity. By employing a competitive surface plasmon resonance (SPR) analysis combined with a battery of known gD-specific neutralizing monoclonal Abs (MAbs), we showed that nasal immunization generated IgG Abs directed to two major discontinuous neutralizing epitopes of gD. These results highlight the potential of nasal immunization with an adjuvanted HSV-2 envelope protein for induction of protective immunity to primary and recurrent genital herpes.

  14. Mathematical modeling provides kinetic details of the human immune response to vaccination

    Directory of Open Access Journals (Sweden)

    Dustin eLe

    2015-01-01

    Full Text Available With major advances in experimental techniques to track antigen-specific immune responses many basic questions on the kinetics of virus-specific immunity in humans remain unanswered. To gain insights into kinetics of T and B cell responses in human volunteers we combine mathematical models and experimental data from recent studies employing vaccines against yellow fever and smallpox. Yellow fever virus-specific CD8 T cell population expanded slowly with the average doubling time of 2 days peaking 2.5 weeks post immunization. Interestingly, we found that the peak of the yellow fever-specific CD8 T cell response is determined by the rate of T cell proliferation and not by the precursor frequency of antigen-specific cells as has been suggested in several studies in mice. We also found that while the frequency of virus-specific T cells increases slowly, the slow increase can still accurately explain clearance of yellow fever virus in the blood. Our additional mathematical model describes well the kinetics of virus-specific antibody-secreting cell and antibody response to vaccinia virus in vaccinated individuals suggesting that most of antibodies in 3 months post immunization are derived from the population of circulating antibody-secreting cells. Taken together, our analysis provides novel insights into mechanisms by which live vaccines induce immunity to viral infections and highlight challenges of applying methods of mathematical modeling to the current, state-of-the-art yet limited immunological data.

  15. Mathematical modeling provides kinetic details of the human immune response to vaccination.

    Science.gov (United States)

    Le, Dustin; Miller, Joseph D; Ganusov, Vitaly V

    2014-01-01

    With major advances in experimental techniques to track antigen-specific immune responses many basic questions on the kinetics of virus-specific immunity in humans remain unanswered. To gain insights into kinetics of T and B cell responses in human volunteers we combined mathematical models and experimental data from recent studies employing vaccines against yellow fever and smallpox. Yellow fever virus-specific CD8 T cell population expanded slowly with the average doubling time of 2 days peaking 2.5 weeks post immunization. Interestingly, we found that the peak of the yellow fever-specific CD8 T cell response was determined by the rate of T cell proliferation and not by the precursor frequency of antigen-specific cells as has been suggested in several studies in mice. We also found that while the frequency of virus-specific T cells increased slowly, the slow increase could still accurately explain clearance of yellow fever virus in the blood. Our additional mathematical model described well the kinetics of virus-specific antibody-secreting cell and antibody response to vaccinia virus in vaccinated individuals suggesting that most of antibodies in 3 months post immunization were derived from the population of circulating antibody-secreting cells. Taken together, our analysis provided novel insights into mechanisms by which live vaccines induce immunity to viral infections and highlighted challenges of applying methods of mathematical modeling to the current, state-of-the-art yet limited immunological data.

  16. Genetic variations in non-specific immune response to ...

    African Journals Online (AJOL)

    Non-specific immune response in three strains of Heterobranchus bidorsalis challenged with the bacterium Aeromonas hydrophilia was evaluated. The study was undertaken in three strains of H. bidorsalis from different ecological zones in Nigeria and the percentage cumulative mortality was lowest and significantly ...

  17. A novel method of modifying immune responses by vaccination with lipiodol-siRNA mixtures

    Directory of Open Access Journals (Sweden)

    Yijian Li

    2006-01-01

    Full Text Available Abstract The dendritic cell (DC possesses the ability to stimulate both T helper 1 (Th1 and Th2 responses depending on activation stimuli. Although it is known that chemically or genetically modified DC can be used therapeutically to steer immune responses towards either Th1 or Th2, cellular therapy with ex vivo manipulated DC is clinically difficult. Here we demonstrate a novel method of switching immune responses from Th1 to Th2 through in vivo immune modulation by administration of siRNA. We demonstrate that siRNA targeting of the IL-12p35 gene leads to a Th2 bias in vitro through an IL-10 dependent mechanism. In vivo administration of siRNA admixed with the oil-based contrast agent lipiodol in the presence of antigen and adjuvant induced a deviation in recall response to reduced production of IFN-γ and augmented IL-4 response using either KLH or ovalbumin. This simple method of in vivo modification of immune response possesses therapeutic potential in Th1-mediated diseases such as multiple sclerosis and autoimmune diabetes.

  18. The Impact of Ultraviolet Radiation on Immune Responses (invited paper)

    International Nuclear Information System (INIS)

    Norval, M.

    2000-01-01

    In addition to its genotoxic and mutagenic effects, UV has the capacity to suppress immune responses. The mechanism involved is complex, beginning with chromophores located in the skin which absorb UV, this leading in turn to changes in the production of a range of immune mediators locally and systemically which then induce phenotypic and functional alterations in antigen presentation. The cascade ends with the promotion of a subset of T-cells downregulating cell-mediated immunity. The possible consequences of this immunomodulation for the control of tumours and infectious diseases require careful evaluation from laboratory and human studies. (author)

  19. Influence of Immune Responses in Gene/Stem Cell Therapies for Muscular Dystrophies

    Directory of Open Access Journals (Sweden)

    Andrea Farini

    2014-01-01

    Full Text Available Muscular dystrophies (MDs are a heterogeneous group of diseases, caused by mutations in different components of sarcolemma, extracellular matrix, or enzymes. Inflammation and innate or adaptive immune response activation are prominent features of MDs. Various therapies under development are directed toward rescuing the dystrophic muscle damage using gene transfer or cell therapy. Here we discussed current knowledge about involvement of immune system responses to experimental therapies in MDs.

  20. Effect of glucocorticoids on melatonin receptor expression under T-cell activated immune response

    International Nuclear Information System (INIS)

    Tauschanova, P.; Georgiev, G.; Manchev, S.; Konakchieva, R.

    2007-01-01

    The present study was aimed to explore the stress response in rats under conditions of T-cell antigen-activated immune function and to investigate the specific melatonin (MEL) receptor binding in primary and secondary immune tissue of rats employing 2-( 125 I)-iodo melatonin autoradiography and in vitro ligand binding assay. The study revealed that melatonin receptor binding was specifically expressed in discrete areas of the lymphoid sheath of the spleen and in a network of interdigitating cells of the experimental rats. Demonstration of the modulation of MEL receptor binding in the course of a primary immune response under hypercorticalemic conditions indicate that the pineal hormone might interfere in the processes of glucocorticoid-dependent immune competency. (authors)

  1. Immune Response to Electromagnetic Fields through Cybernetic Modeling

    International Nuclear Information System (INIS)

    Godina-Nava, J. J.; Segura, M. A. Rodriguez; Cadena, S. Reyes; Sierra, L. C. Gaitan

    2008-01-01

    We study the optimality of the humoral immune response through a mathematical model, which involves the effect of electromagnetic fields over the large lymphocytes proliferation. Are used the so called cybernetic variables in the context of the matching law of microeconomics or mathematical psychology, to measure the large lymphocytes population and to maximize the instantaneous antibody production rate in time during the immunologic response in order to most efficiently inactivate the antigen

  2. Immune Response to Electromagnetic Fields through Cybernetic Modeling

    Science.gov (United States)

    Godina-Nava, J. J.; Segura, M. A. Rodríguez; Cadena, S. Reyes; Sierra, L. C. Gaitán

    2008-08-01

    We study the optimality of the humoral immune response through a mathematical model, which involves the effect of electromagnetic fields over the large lymphocytes proliferation. Are used the so called cybernetic variables in the context of the matching law of microeconomics or mathematical psychology, to measure the large lymphocytes population and to maximize the instantaneous antibody production rate in time during the immunologic response in order to most efficiently inactivate the antigen.

  3. Evaluation of the immune response in Shitou geese (Anser anser domesticus) following immunization with GPV-VP1 DNA-based and live attenuated vaccines.

    Science.gov (United States)

    Deng, Shu-xuan; Cai, Ming-sheng; Cui, Wei; Huang, Jin-lu; Li, Mei-li

    2014-01-01

    Goose parvovirus (GPV) is a highly contagious and deadly disease for goslings and Muscovy ducklings. To compare the differences in immune response of geese immunized with GPV-VP1 DNA-based and live attenuated vaccines. Shitou geese were immunized once with either 20 μg pcDNA-GPV-VP1 DNA gene vaccine by gene gun bombardment via intramuscular injection, or 300 μg by i.m. injection, or 300 μL live attenuated vaccine by i.m. injection, whereas 300 μg pcDNA3.1 (+) i.m. or 300 μL saline i.m. were used as positive and negative controls, respectively. Each group comprised 28 animals. Peripheral blood samples were collected from 2-210 days after immunization and the proliferation of T lymphocytes, the number of CD4(+) and CD8(+) T cells and the level of IgG assessed. Statistical analysis was performed using a one-way analysis of variance with group multiple comparisons via Tukey's test. The pcDNA-GPV-VP1 DNA and attenuated vaccine induced cellular and humoral responses, and there were no differences between the 20 and 300 μg group in the responses of proliferation of T lymphocyte and the CD8(+) T-cell. However, as to CD4(+) T-cell response and humoral immunity, the 20 μg group performed better than the 300 μg group, which induced better cellular and humoral immunity than live attenuated vaccine. This study showed that it is possible to induce both cellular and humoral response using DNA-based vaccines and that the pcDNA-GPV-VP1 DNA gene vaccine induced better cellular and humoral immunity than live attenuated vaccine.

  4. Influences of large sets of environmental exposures on immune responses in healthy adult men.

    Science.gov (United States)

    Yi, Buqing; Rykova, Marina; Jäger, Gundula; Feuerecker, Matthias; Hörl, Marion; Matzel, Sandra; Ponomarev, Sergey; Vassilieva, Galina; Nichiporuk, Igor; Choukèr, Alexander

    2015-08-26

    Environmental factors have long been known to influence immune responses. In particular, clinical studies about the association between migration and increased risk of atopy/asthma have provided important information on the role of migration associated large sets of environmental exposures in the development of allergic diseases. However, investigations about environmental effects on immune responses are mostly limited in candidate environmental exposures, such as air pollution. The influences of large sets of environmental exposures on immune responses are still largely unknown. A simulated 520-d Mars mission provided an opportunity to investigate this topic. Six healthy males lived in a closed habitat simulating a spacecraft for 520 days. When they exited their "spacecraft" after the mission, the scenario was similar to that of migration, involving exposure to a new set of environmental pollutants and allergens. We measured multiple immune parameters with blood samples at chosen time points after the mission. At the early adaptation stage, highly enhanced cytokine responses were observed upon ex vivo antigen stimulations. For cell population frequencies, we found the subjects displayed increased neutrophils. These results may presumably represent the immune changes occurred in healthy humans when migrating, indicating that large sets of environmental exposures may trigger aberrant immune activity.

  5. Vaccine platforms combining circumsporozoite protein and potent immune modulators, rEA or EAT-2, paradoxically result in opposing immune responses.

    Directory of Open Access Journals (Sweden)

    Nathaniel J Schuldt

    Full Text Available Malaria greatly impacts the health and wellbeing of over half of the world's population. Promising malaria vaccine candidates have attempted to induce adaptive immune responses to Circumsporozoite (CS protein. Despite the inclusion of potent adjuvants, these vaccines have limited protective efficacy. Conventional recombinant adenovirus (rAd based vaccines expressing CS protein can induce CS protein specific immune responses, but these are essentially equivalent to those generated after use of the CS protein subunit based vaccines. In this study we combined the use of rAds expressing CS protein along with rAds expressing novel innate immune response modulating proteins in an attempt to significantly improve the induction of CS protein specific cell mediated immune (CMI responses.BALB/cJ mice were co-vaccinated with a rAd vectors expressing CS protein simultaneous with a rAd expressing either TLR agonist (rEA or SLAM receptors adaptor protein (EAT-2. Paradoxically, expression of the TLR agonist uncovered a potent immunosuppressive activity inherent to the combined expression of the CS protein and rEA. Fortunately, use of the rAd vaccine expressing EAT-2 circumvented CS protein's suppressive activity, and generated a fivefold increase in the number of CS protein responsive, IFNγ secreting splenocytes, as well as increased the breadth of T cells responsive to peptides present in the CS protein. These improvements were positively correlated with the induction of a fourfold improvement in CS protein specific CTL functional activity in vivo.Our results emphasize the need for caution when incorporating CS protein into malaria vaccine platforms expressing or containing other immunostimulatory compounds, as the immunological outcomes may be unanticipated and/or counter-productive. However, expressing the SLAM receptors derived signaling adaptor EAT-2 at the same time of vaccination with CS protein can overcome these concerns, as well as significantly

  6. Auto-immune hepatitis following delivery.

    Science.gov (United States)

    Saini, Vandana; Gupta, Mamta; Mishra, S K

    2013-05-01

    Auto-immune hepatitis first presenting in the early postpartum period is rare. Immunosuppressive effects of pregnancy result in delayed manifestation of auto-immune hepatitis, and in established cases, the spontaneous improvements are there. Auto-immune hepatitis should be considered in the differential diagnosis of liver dysfunction first presenting in the early postpartum period. A case of postpartum hepatitis of auto-immune aetiology is being presented here. It is disease of unknown aetiology, characterised by inflammation of liver (as evidenced by raised serum transaminases, presence of interface hepatitis on histological examination), hypergammaglobulinaemia (> 1.5 times normal), presence of auto-antibodies [(antinuclear antibodies (ANA)], smooth muscle antibody (SMA) and antibody to liver-kidney microsome type 1 (LKM1) in the absence of viral markers ie, hepatitis B (HBsAg) and C (AntiHCV) and excellent response to corticosteroid therapy.

  7. Peripheral dendritic cells are essential for both the innate and adaptive antiviral immune responses in the central nervous system

    International Nuclear Information System (INIS)

    Steel, Christina D.; Hahto, Suzanne M.; Ciavarra, Richard P.

    2009-01-01

    Intranasal application of vesicular stomatitis virus (VSV) causes acute infection of the central nervous system (CNS). However, VSV encephalitis is not invariably fatal, suggesting that the CNS may contain a professional antigen-presenting cell (APC) capable of inducing or propagating a protective antiviral immune response. To examine this possibility, we first characterized the cellular elements that infiltrate the brain as well as the activation status of resident microglia in the brains of normal and transgenic mice acutely ablated of peripheral dendritic cells (DCs) in vivo. VSV encephalitis was characterized by a pronounced infiltrate of myeloid cells (CD45 high CD11b + ) and CD8 + T cells containing a subset that was specific for the immunodominant VSV nuclear protein epitope. This T cell response correlated temporally with a rapid and sustained upregulation of MHC class I expression on microglia, whereas class II expression was markedly delayed. Ablation of peripheral DCs profoundly inhibited the inflammatory response as well as infiltration of virus-specific CD8 + T cells. Unexpectedly, the VSV-induced interferon-gamma (IFN-γ) response in the CNS remained intact in DC-deficient mice. Thus, both the inflammatory and certain components of the adaptive primary antiviral immune response in the CNS are dependent on peripheral DCs in vivo.

  8. The metabolic cost of mounting an immune response in male brown anoles (Anolis sagrei).

    Science.gov (United States)

    Cox, Christian L; Peaden, Robert T; Cox, Robert M

    2015-09-09

    The tradeoff between reproduction and survival is central to life-history theory and is thought to reflect underlying energetic tradeoffs between reproduction and self-maintenance. Immune responses to parasites and pathogens are important components of self-maintenance in many species, but whether these defenses impose significant energetic costs has only been tested in a handful of organisms. We tested for a metabolic cost of mounting an immune response in the male brown anole (Anolis sagrei), a lizard in which we have previously shown that reproduction causes a marked reduction in immune response to the novel antigen phytohaemagglutinin (PHA). We treated captive male anoles with a subcutaneous injection of either PHA, which induces an immune response that manifests as localized swelling, or saline vehicle as a control. Prior to injection and at 24, 48, and 72 hr post-injection, we measured swelling at the site of injection and whole-animal resting metabolic rate (RMR) using stop-flow respirometry. Although we detected a robust swelling response to PHA at 24, 48, and 72 hr post-injection, mean RMR did not differ between treatments at any of these time points. However, within the PHA treatment group, RMR increased with the extent of swelling, suggesting a variable metabolic cost that scales with the magnitude of the induced immune response. Although individual anoles varied considerably in the extent to which they responded to PHA challenge, our results suggest that an immune response can impose a substantial metabolic cost (potentially as much as 63% above baseline RMR) for individuals that do respond maximally. J. Exp. Zool. 9999A:XX-XX, 2015. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  9. MicroRNA-mediated networks underlie immune response regulation in papillary thyroid carcinoma

    Science.gov (United States)

    Huang, Chen-Tsung; Oyang, Yen-Jen; Huang, Hsuan-Cheng; Juan, Hsueh-Fen

    2014-09-01

    Papillary thyroid carcinoma (PTC) is a common endocrine malignancy with low death rate but increased incidence and recurrence in recent years. MicroRNAs (miRNAs) are small non-coding RNAs with diverse regulatory capacities in eukaryotes and have been frequently implied in human cancer. Despite current progress, however, a panoramic overview concerning miRNA regulatory networks in PTC is still lacking. Here, we analyzed the expression datasets of PTC from The Cancer Genome Atlas (TCGA) Data Portal and demonstrate for the first time that immune responses are significantly enriched and under specific regulation in the direct miRNA-target network among distinctive PTC variants to different extents. Additionally, considering the unconventional properties of miRNAs, we explore the protein-coding competing endogenous RNA (ceRNA) and the modulatory networks in PTC and unexpectedly disclose concerted regulation of immune responses from these networks. Interestingly, miRNAs from these conventional and unconventional networks share general similarities and differences but tend to be disparate as regulatory activities increase, coordinately tuning the immune responses that in part account for PTC tumor biology. Together, our systematic results uncover the intensive regulation of immune responses underlain by miRNA-mediated networks in PTC, opening up new avenues in the management of thyroid cancer.

  10. Chicken Immune Response after In Ovo Immunization with Chimeric TLR5 Activating Flagellin of Campylobacter jejuni.

    Directory of Open Access Journals (Sweden)

    Katarzyna A Radomska

    Full Text Available Campylobacter jejuni is the main cause of bacterial food-borne diseases in developed countries. Chickens are the most important source of human infection. Vaccination of poultry is an attractive strategy to reduce the number of C. jejuni in the intestinal tract of chickens. We investigated the immunogenicity and protective efficacy of a recombinant C. jejuni flagellin-based subunit vaccine with intrinsic adjuvant activity. Toll-like receptor activation assays demonstrated the purity and TLR5 stimulating (adjuvant activity of the vaccine. The antigen (20-40 μg was administered in ovo to 18 day-old chicken embryos. Serum samples and intestinal content were assessed for antigen-specific systemic and mucosal humoral immune responses. In ovo vaccination resulted in the successful generation of IgY and IgM serum antibodies against the flagellin-based subunit vaccine as determined by ELISA and Western blotting. Vaccination did not induce significant amounts of flagellin-specific secretory IgA in the chicken intestine. Challenge of chickens with C. jejuni yielded similar intestinal colonization levels for vaccinated and control animals. Our results indicate that in ovo delivery of recombinant C. jejuni flagellin subunit vaccine is a feasible approach to yield a systemic humoral immune response in chickens but that a mucosal immune response may be needed to reduce C. jejuni colonization.

  11. Type 2 responses at the interface between immunity and fat metabolism.

    Science.gov (United States)

    Odegaard, Justin I; Chawla, Ajay

    2015-10-01

    Adipose tissue resident leukocytes are often cast solely as the effectors of obesity and its attendant pathologies; however, recent observations have demonstrated that these cells support and effect 'healthy' physiologic function as well as pathologic dysfunction. Importantly, these two disparate outcomes are underpinned by similarly disparate immune programs; type 2 responses instruct and promote metabolic normalcy, while type 1 responses drive tissue dysfunction. In this Review, we summarize the literature regarding type 2 immunity's role in adipose tissue physiology and allude to its potential therapeutic implications. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Murine immune responses to oral BCG immunization in the presence or absence of prior BCG sensitization.

    Science.gov (United States)

    Cross, Martin L; Lambeth, Matthew R; Aldwell, Frank E

    2010-02-01

    Oral delivery of live Mycobacterium bovis BCG in a lipid matrix invokes cell-mediated immune (CMI) responses in mice and consequent protection against pulmonary challenge with virulent mycobacteria. To investigate the influence of prior BCG sensitization on oral vaccine efficacy, we assessed CMI responses and BCG colonization of the alimentary tract lymphatics 5 months after oral vaccination, in both previously naive mice and in mice that had been sensitized to BCG by injection 6 months previously. CMI responses did not differ significantly between mice that received subcutaneous BCG followed by oral BCG and those that received either injected or oral BCG alone. In vivo BCG colonization was predominant in the mesenteric lymph nodes after oral vaccination; this colonizing ability was not influenced by prior BCG sensitization. From this murine model study, we conclude that although prior parenteral-route BCG sensitization does not detrimentally affect BCG colonization after oral vaccination, there is no significant immune-boosting effect of the oral vaccine either.

  13. Children with asthma by school age display aberrant immune responses to pathogenic airway bacteria as infants

    DEFF Research Database (Denmark)

    Larsen, Jeppe Madura; Pedersen, Susanne Brix; Thysen, Anna Hammerich

    2014-01-01

    childhood asthma. We hypothesized that children with asthma have an abnormal immune response to pathogenic bacteria in infancy. ObjectiveWe aimed to assess the bacterial immune response in asymptomatic infants and the association with later development of asthma by age 7 years. MethodsThe Copenhagen...... was assessed based on the pattern of cytokines produced and T-cell activation. ResultsThe immune response to pathogenic bacteria was different in infants with asthma by 7 years of age (P = .0007). In particular, prospective asthmatic subjects had aberrant production of IL-5 (P = .008), IL-13 (P = .057), IL-17...... (P = .001), and IL-10 (P = .028), whereas there were no differences in T-cell activation or peripheral T-cell composition. ConclusionsChildren with asthma by school age exhibited an aberrant immune response to pathogenic bacteria in infancy. We propose that an abnormal immune response to pathogenic...

  14. Proteomic Mapping of the Immune Response to Gluten in Children with Autism

    Science.gov (United States)

    2015-10-01

    AWARD NUMBER: W81XWH-14-1-0293 TITLE: Proteomic Mapping of the Immune Response to Gluten in Children with Autism PRINCIPAL INVESTIGATOR...Sep 2014 – 29 Sep 2015 4. TITLE AND SUBTITLE Proteomic Mapping of the Immune Response to Gluten in Children with Autism 5a. CONTRACT NUMBER 5b. GRANT...gastrointestinal (GI) symptoms and defects in GI function in the context of autism . Our newly published data indicate that children with autism exhibit

  15. A Box-Cox normal model for response times.

    Science.gov (United States)

    Klein Entink, R H; van der Linden, W J; Fox, J-P

    2009-11-01

    The log-transform has been a convenient choice in response time modelling on test items. However, motivated by a dataset of the Medical College Admission Test where the lognormal model violated the normality assumption, the possibilities of the broader class of Box-Cox transformations for response time modelling are investigated. After an introduction and an outline of a broader framework for analysing responses and response times simultaneously, the performance of a Box-Cox normal model for describing response times is investigated using simulation studies and a real data example. A transformation-invariant implementation of the deviance information criterium (DIC) is developed that allows for comparing model fit between models with different transformation parameters. Showing an enhanced description of the shape of the response time distributions, its application in an educational measurement context is discussed at length.

  16. Cancer Immunotherapy and the Immune Response in Hodgkin Lymphoma

    Directory of Open Access Journals (Sweden)

    Christoph Renner

    2018-06-01

    Full Text Available Patients with classical Hodgkin lymphoma (cHL have an impaired cellular immune response as indicated by an anergic reaction against standard recall antigens and a diminished rejection reaction of allogeneic skin transplant. This clinical observation can be linked to the histopathological feature of cHL since the typical pattern of a cHL manifestation is characterized by sparse large CD30+ tumor-infiltrating Hodgkin–Reed–Sternberg (HRS cells that are surrounded by a dense inflammatory immune microenvironment with mixed cellularity. Despite this extensive polymorphous inflammatory infiltrate, there is only a poor antitumor immune response seen to the neoplastic HRS cells. This is primarily mediated by a high expression of PD-L1 and PD-L2 ligands on the HRS cell surface which in turn antagonizes the activity of programmed death-1 (PD-1 antigen-positive T cells. PD-L1/L2 overexpression is caused by gene amplification at the 9p24.1 locus and/or latent Epstein–Barr virus infection present in around 40% of cHL cases. The blockade of the PD-L1/L2–PD-1 pathway by monoclonal antibodies can restore local T cell activity and leads to impressive tumor responses, some of which are long lasting and eventually curative. Another feature of HRS cells is the high CD30 antigen expression. Monoclonal antibody technology allowed for the successful development of CD30-specific immunotoxins, bispecific antibodies, and reprogrammed autologous T cells with the first one already approved for the treatment of high risk or relapsed cHL. Altogether, the discovery of the described pathomechanism of immune suppression and the identification of preferential target antigens has rendered cHL to be a prime subject for the successful development of new immunotherapeutic approaches.

  17. Intranasal immunization with protective antigen of Bacillus anthracis induces a long-term immunological memory response.

    Science.gov (United States)

    Woo, Sun-Je; Kang, Seok-Seong; Park, Sung-Moo; Yang, Jae Seung; Song, Man Ki; Yun, Cheol-Heui; Han, Seung Hyun

    2015-10-01

    Although intranasal vaccination has been shown to be effective for the protection against inhalational anthrax, establishment of long-term immunity has yet to be achieved. Here, we investigated whether intranasal immunization with recombinant protective antigen (rPA) of Bacillus anthracis induces immunological memory responses in the mucosal and systemic compartments. Intranasal immunization with rPA plus cholera toxin (CT) sustained PA-specific antibody responses for 6 months in lung, nasal washes, and vaginal washes as well as serum. A significant induction of PA-specific memory B cells was observed in spleen, cervical lymph nodes (CLNs) and lung after booster immunization. Furthermore, intranasal immunization with rPA plus CT remarkably generated effector memory CD4(+) T cells in the lung. PA-specific CD4(+) T cells preferentially increased the expression of Th1- and Th17-type cytokines in lung, but not in spleen or CLNs. Collectively, the intranasal immunization with rPA plus CT promoted immunologic memory responses in the mucosal and systemic compartments, providing long-term immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Cellular immune responses to HPV-18, -31, and -53 in healthy volunteers immunized with recombinant HPV-16 L1 virus-like particles

    International Nuclear Information System (INIS)

    Pinto, Ligia A.; Viscidi, Raphael; Harro, Clayton D.; Kemp, Troy J.; Garcia-Pineres, Alfonso J.; Trivett, Matthew; Demuth, Franklin; Lowy, Douglas R.; Schiller, John T.; Berzofsky, Jay A.; Hildesheim, Allan

    2006-01-01

    Human papillomavirus-like particles (HPV VLP) are candidate vaccines that have shown to be efficacious in reducing infection and inducing robust antiviral immunity. Neutralizing antibodies generated by vaccination are largely type-specific, but little is known about the type-specificity of cellular immune responses to VLP vaccination. To determine whether vaccination with HPV-16 L1VLP induces cellular immunity to heterologous HPV types (HPV-18, HPV-31, and HPV-53), we examined proliferative and cytokine responses in vaccine (n = 11) and placebo (n = 5) recipients. Increased proliferative and cytokine responses to heterologous types were observed postvaccination in some individuals. The proportion of women responding to heterologous types postvaccination (36%-55%) was lower than that observed in response to HPV-16 (73%). Response to HPV-16 VLP predicted response to other types. The strongest correlations in response were observed between HPV-16 and HPV-31, consistent with their phylogenetic relatedness. In summary, PBMC from HPV-16 VLP vaccine recipients can respond to L1VLP from heterologous HPV types, suggesting the presence of conserved T cell epitopes

  19. Ebola Virus Altered Innate and Adaptive Immune Response Signalling Pathways: Implications for Novel Therapeutic Approaches.

    Science.gov (United States)

    Kumar, Anoop

    2016-01-01

    Ebola virus (EBOV) arise attention for their impressive lethality by the poor immune response and high inflammatory reaction in the patients. It causes a severe hemorrhagic fever with case fatality rates of up to 90%. The mechanism underlying this lethal outcome is poorly understood. In 2014, a major outbreak of Ebola virus spread amongst several African countries, including Leone, Sierra, and Guinea. Although infections only occur frequently in Central Africa, but the virus has the potential to spread globally. Presently, there is no vaccine or treatment is available to counteract Ebola virus infections due to poor understanding of its interaction with the immune system. Accumulating evidence indicates that the virus actively alters both innate and adaptive immune responses and triggers harmful inflammatory responses. In the literature, some reports have shown that alteration of immune signaling pathways could be due to the ability of EBOV to interfere with dendritic cells (DCs), which link innate and adaptive immune responses. On the other hand, some reports have demonstrated that EBOV, VP35 proteins act as interferon antagonists. So, how the Ebola virus altered the innate and adaptive immune response signaling pathways is still an open question for the researcher to be explored. Thus, in this review, I try to summarize the mechanisms of the alteration of innate and adaptive immune response signaling pathways by Ebola virus which will be helpful for designing effective drugs or vaccines against this lethal infection. Further, potential targets, current treatment and novel therapeutic approaches have also been discussed.

  20. Evolution and Function of Thioester-Containing Proteins and the Complement System in the Innate Immune Response

    Directory of Open Access Journals (Sweden)

    Upasana Shokal

    2017-06-01

    Full Text Available The innate immune response is evolutionary conserved among organisms. The complement system forms an important and efficient immune defense mechanism. It consists of plasma proteins that participate in microbial detection, which ultimately results in the production of various molecules with antimicrobial activity. Thioester-containing proteins (TEPs are a superfamily of secreted effector proteins. In vertebrates, certain TEPs act in the innate immune response by promoting recruitment of immune cells, phagocytosis, and direct lysis of microbial invaders. Insects are excellent models for dissecting the molecular basis of innate immune recognition and response to a wide range of microbial infections. Impressive progress in recent years has generated crucial information on the role of TEPs in the antibacterial and antiparasite response of the tractable model insect Drosophila melanogaster and the mosquito malaria vector Anopheles gambiae. This knowledge is critical for better understanding the evolution of TEPs and their involvement in the regulation of the host innate immune system.

  1. Contributions of immune responses to developmental resistance in Lymantria dispar challenged with baculovirus

    Science.gov (United States)

    James McNeil; Diana Cox-Foster; James Slavicek; Kelli. Hoover

    2010-01-01

    How the innate immune system functions to defend insects from viruses is an emerging field of study. We examined the impact of melanized encapsulation, a component of innate immunity that integrates both cellular and humoral immune responses, on the success of the baculovirus Lymantria dispar multiple nucleocapsid nucleopolyhedrovirus (LdMNPV) in its...

  2. Systems Biology of the Immune Response to Live and Inactivated Dengue Virus Vaccines

    Science.gov (United States)

    2017-09-01

    AWARD NUMBER: W81XWH-16-2-0031 TITLE: Systems Biology of the Immune Response to Live and Inactivated Dengue Virus Vaccines PRINCIPAL...SUBTITLE 5a. CONTRACT NUMBER Systems Biology of the Immune Response to Live and Inactivated Dengue Virus Vaccines 5b. GRANT NUMBER W81XWH-16-2-0031 5c...adaptive (T and B cell) responses will be measured using molecular and cellular approaches and the data analyzed using a systems biology approach

  3. In vivo Ebola virus infection leads to a strong innate response in circulating immune cells.

    Science.gov (United States)

    Caballero, Ignacio S; Honko, Anna N; Gire, Stephen K; Winnicki, Sarah M; Melé, Marta; Gerhardinger, Chiara; Lin, Aaron E; Rinn, John L; Sabeti, Pardis C; Hensley, Lisa E; Connor, John H

    2016-09-05

    Ebola virus is the causative agent of a severe syndrome in humans with a fatality rate that can approach 90 %. During infection, the host immune response is thought to become dysregulated, but the mechanisms through which this happens are not entirely understood. In this study, we analyze RNA sequencing data to determine the host response to Ebola virus infection in circulating immune cells. Approximately half of the 100 genes with the strongest early increases in expression were interferon-stimulated genes, such as ISG15, OAS1, IFIT2, HERC5, MX1 and DHX58. Other highly upregulated genes included cytokines CXCL11, CCL7, IL2RA, IL2R1, IL15RA, and CSF2RB, which have not been previously reported to change during Ebola virus infection. Comparing this response in two different models of exposure (intramuscular and aerosol) revealed a similar signature of infection. The strong innate response in the aerosol model was seen not only in circulating cells, but also in primary and secondary target tissues. Conversely, the innate immune response of vaccinated macaques was almost non-existent. This suggests that the innate response is a major aspect of the cellular response to Ebola virus infection in multiple tissues. Ebola virus causes a severe infection in humans that is associated with high mortality. The host immune response to virus infection is thought to be an important aspect leading to severe pathology, but the components of this overactive response are not well characterized. Here, we analyzed how circulating immune cells respond to the virus and found that there is a strong innate response dependent on active virus replication. This finding is in stark contrast to in vitro evidence showing a suppression of innate immune signaling, and it suggests that the strong innate response we observe in infected animals may be an important contributor to pathogenesis.

  4. Mitogen-stimulated phospholipid synthesis in normal and immune-deficient human B cells

    International Nuclear Information System (INIS)

    Chien, M.M.; Yokoyama, W.M.; Ashman, R.F.

    1986-01-01

    Eight patients with common variable panhypogammaglobulinemia were shown in the in vitro Ig biosynthesis assay to have defective B cell responses to pokeweed mitogen (PWM). Phospholipid synthesis was assessed in the B cell plus monocyte fraction (MB) and irradiated T cells (T*) of patients and paired normal controls. Cell populations were studied separately and in the four possible combinations (1:1), with and without PWM, to reveal the effect of cell interactions. At 16 to 20 hr the mean stimulation index (SI) +/- standard error for MB cells alone was 1.01 +/- 0.02 for eight patients and 0.99 +/- 0.02 for the paired normals; the T* cell SI was 1.25 +/- 0.04 for patients and 1.28 +/- 0.05 for normals. Combinations of normal MB cells with normal T* cells showed significantly higher SI when compared with the combinations of normal MB cells with patient T* cells (p less than 0.005). However, the combination of patient MB cells with patient T* cells and the combination of patient MB cells with normal T* cells were not significantly different in SI (0.05 less than p less than 0.1). Isolation of patient and normal B cells, T* cells, and monocytes after the choline pulse showed that patient B cells gave a higher SI with normal T* help than with patient T* help. Of greatest interest is the finding that patient B cells that were defective in PWM-stimulated Ig production nevertheless showed a phospholipid synthesis response to PWM in the normal range, suggesting that the maturation defect in these B cells occurs later than the phospholipid synthesis acceleration step, or on a different pathway

  5. HCV-specific immune responses induced by CIGB-230 in combination with IFN-α plus ribavirin

    Science.gov (United States)

    Amador-Cañizares, Yalena; Martínez-Donato, Gillian; Álvarez-Lajonchere, Liz; Vasallo, Claudia; Dausá, Mariacarla; Aguilar-Noriega, Daylen; Valenzuela, Carmen; Raíces, Ivette; Dubuisson, Jean; Wychowski, Czeslaw; Cinza-Estévez, Zurina; Castellanos, Marlén; Núñez, Magdalys; Armas, Anny; González, Yaimé; Revé, Ismariley; Guerra, Ivis; Pérez Aguiar, Ángel; Dueñas-Carrera, Santiago

    2014-01-01

    AIM: To analyze hepatitis C virus (HCV)-specific immune responses in chronically infected patients under triple therapy with interferon-α (IFN-α) plus ribavirin and CIGB-230. METHODS: CIGB-230 was administered in different schedules with respect to IFN-α plus ribavirin therapy. Paired serum and peripheral blood mononuclear cells (PBMC) samples from baseline and end of treatment were analyzed. The HCV-specific humoral response was tested by enzyme-linked immunosorbent assay, neutralizing antibodies were evaluated by cell culture HCV neutralization assays, PBMC proliferation was assayed by carboxyfluorescein succinimidyl ester staining and IFN-γ secretion was assessed by enzyme-linked immunospot. Data on virological and histological response and their association with immune variables are also provided. RESULTS: From week 12 to week 48, all groups of patients showed a significant reduction in mean leukocyte counts. Statistically significant reductions in antibody titers were frequent, but only individuals immunized with CIGB-230 as early add-on treatment sustained the core-IgG response, and the neutralizing antibody response was enhanced only in patients receiving CIGB-230. Cell-mediated immune responses also tended to decline, but significant reductions in IFN-γ secretion and total absence of core-specific lymphoproliferation were exclusive of the control group. Only CIGB-230-immunized individuals showed de novo induced lymphoproliferative responses against the structural antigens. Importantly, it was demonstrated that the quality of the CIGB-230-induced immune response depended on the number of doses and timing of administration in relation to the antiviral therapy. Specifically, the administration of 6 doses of CIGB-230 as late add-on to therapy increased the neutralizing antibody activity and the de novo core-specific IFN-γ secretion, both of which were associated with the sustained virological response. CONCLUSION: CIGB-230, combined with IFN

  6. Effects of radiotherapy on anti-cancer immune response: mathematical modeling

    International Nuclear Information System (INIS)

    Isaeva, O.G.; Osipov, V.A.

    2009-01-01

    The influence of radiotherapy on the tumor-immune dynamics is studied within our recent model. Simulation of the standard course of radiotherapy shows that in the case of weak immune response a few months after cure the tumor achieves the maximum size, whereas the strong immune system is able to handle the growth of survived tumor cells population. Simulation of vaccine therapy after radiotherapy has been carried out. The high efficiency of vaccination is found provided that it is assigned during a certain period of time after radiotherapy. Different strategies of radiotherapy have been considered. It is shown that hyper rectification is more effective for treatment in comparison with other cures

  7. The immune response of adult opossums (Didelphis virginiana) to the bacteriophage f2

    Science.gov (United States)

    Rowlands, D. T.

    1970-01-01

    Humoral immunity to the bacteriophage f2 was studied in adult opossums (Didelphis virginiana) and their responses were compared to those in New Zealand White rabbits. Antibodies were found in the serum of opossums 7 days after the subcutaneous injection of the antigen and peak antibody responses were observed between 10 and 21 days after immunization. A second injection of antigen resulted in increased antibody activity. In either case the level of serum antibody reached in opossums was less than that in rabbits. More striking, however, was the relatively slow conversion from γM to γG antibodies in opossums. The course of the immune response in adult opossums was more nearly like that of cold-blooded vertebrates than that of eutherian mammals. PMID:5416636

  8. Short communication: Cytokine profiles from blood mononuclear cells of dairy cows classified with divergent immune response phenotypes.

    Science.gov (United States)

    Martin, C E; Paibomesai, M A; Emam, S M; Gallienne, J; Hine, B C; Thompson-Crispi, K A; Mallard, B A

    2016-03-01

    Genetic selection for enhanced immune response has been shown to decrease disease occurrence in dairy cattle. Cows can be classified as high (H), average, or low responders based on antibody-mediated immune response (AMIR), predominated by type-2 cytokine production, and cell-mediated immune response (CMIR) through estimated breeding values for these traits. The purpose of this study was to identify in vitro tests that correlate with in vivo immune response phenotyping in dairy cattle. Blood mononuclear cells (BMC) isolated from cows classified as H-AMIR and H-CMIR through estimated breeding values for immune response traits were stimulated with concanavalin A (ConA; Sigma Aldrich, St. Louis, MO) and gene expression, cytokine production, and cell proliferation was determined at multiple time points. A repeated measures model, which included the effects of immune response group, parity, and stage of lactation, was used to compare differences between immune response phenotype groups. The H-AMIR cows produced more IL-4 protein than H-CMIR cows at 48 h; however, no difference in gene expression of type-2 transcription factor GATA3 or IL4 was noted. The BMC from H-CMIR cows had increased production of IFN-γ protein at 48, 72, and 96 h compared with H-AMIR animals. Further, H-CMIR cows had increased expression of the IFNG gene at 16, 24, and 48 h post-treatment with ConA, although expression of the type-1 transcription factor gene TBX21 did not differ between immune response groups. Although proliferation of BMC increased from 24 to 72 h after ConA stimulation, no differences were found between the immune response groups. Overall, stimulation of H-AMIR and H-CMIR bovine BMC with ConA resulted in distinct cytokine production profiles according to genetically defined groups. These distinct cytokine profiles could be used to define disease resistance phenotypes in dairy cows according to stimulation in vitro; however, other immune response phenotypes should be assessed

  9. Anti-gluten immune response following Toxoplasma gondii infection in mice.

    Directory of Open Access Journals (Sweden)

    Emily G Severance

    Full Text Available Gluten sensitivity may affect disease pathogenesis in a subset of individuals who have schizophrenia, bipolar disorder or autism. Exposure to Toxoplasma gondii is a known risk factor for the development of schizophrenia, presumably through a direct pathological effect of the parasite on brain and behavior. A co-association of antibodies to wheat gluten and to T. gondii in individuals with schizophrenia was recently uncovered, suggesting a coordinated gastrointestinal means by which T. gondii and dietary gluten might generate an immune response. Here, we evaluated the connection between these infectious- and food-based antigens in mouse models. BALB/c mice receiving a standard wheat-based rodent chow were infected with T. gondii via intraperitoneal, peroral and prenatal exposure methods. Significant increases in the levels of anti-gluten IgG were documented in all infected mice and in offspring from chronically infected dams compared to uninfected controls (repetitive measures ANOVAs, two-tailed t-tests, all p≤0.00001. Activation of the complement system accompanied this immune response (p≤0.002-0.00001. Perorally-infected females showed higher levels of anti-gluten IgG than males (p≤0.009 indicating that T. gondii-generated gastrointestinal infection led to a significant anti-gluten immune response in a sex-dependent manner. These findings support a gastrointestinal basis by which two risk factors for schizophrenia, T. gondii infection and sensitivity to dietary gluten, might be connected to produce the immune activation that is becoming an increasingly recognized pathology of psychiatric disorders.

  10. An overview of HCV molecular biology, replication and immune responses

    Directory of Open Access Journals (Sweden)

    Nawaz Zafar

    2011-04-01

    Full Text Available Abstract Hepatitis C virus (HCV causes acute and chronic hepatitis which can eventually lead to permanent liver damage, hepatocellular carcinoma and death. Currently, there is no vaccine available for prevention of HCV infection due to high degree of strain variation. The current treatment of care, Pegylated interferon α in combination with ribavirin is costly, has significant side effects and fails to cure about half of all infections. In this review, we summarize molecular virology, replication and immune responses against HCV and discussed how HCV escape from adaptive and humoral immune responses. This advance knowledge will be helpful for development of vaccine against HCV and discovery of new medicines both from synthetic chemistry and natural sources.

  11. A microculture method for the generation of primary immune responses in vitro.

    Science.gov (United States)

    Pike, B L

    1975-11-01

    A microculture method for the generation and study of the primary immune response of murine spleen cells to defined antigens in vitro is described. Many of the variable parameters which occur in culture systems have been studied in an attempt to define the optimal culture conditions for this system. Cultures of 10(6) CBA spleen cells consistently produced an immune response of 300-600 hapten-specific plaque-forming cells after 3 days of incubation with the T cell-independent antigens DNP-POL and NIP-POL. Cultures were set up in Microtest II tissue culture plates in a volume of 0.2 ml of medium containing 10(-4) M 2-mercaptoethanol. The system described has the advantages of being highly efficient and reproducible and utilises small amounts of cells, medium and antigen. It provides a simple, economic and reliable approach for the systematic study of the immune response in vitro.

  12. Maximizing Tumor Immunity With Fractionated Radiation

    International Nuclear Information System (INIS)

    Schaue, Dörthe; Ratikan, Josephine A.; Iwamoto, Keisuke S.; McBride, William H.

    2012-01-01

    Purpose: Technologic advances have led to increased clinical use of higher-sized fractions of radiation dose and higher total doses. How these modify the pathways involved in tumor cell death, normal tissue response, and signaling to the immune system has been inadequately explored. Here we ask how radiation dose and fraction size affect antitumor immunity, the suppression thereof, and how this might relate to tumor control. Methods and Materials: Mice bearing B16-OVA murine melanoma were treated with up to 15 Gy radiation given in various-size fractions, and tumor growth followed. The tumor-specific immune response in the spleen was assessed by interferon-γ enzyme-linked immunospot (ELISPOT) assay with ovalbumin (OVA) as the surrogate tumor antigen and the contribution of regulatory T cells (Tregs) determined by the proportion of CD4 + CD25 hi Foxp3 + T cells. Results: After single doses, tumor control increased with the size of radiation dose, as did the number of tumor-reactive T cells. This was offset at the highest dose by an increase in Treg representation. Fractionated treatment with medium-size radiation doses of 7.5 Gy/fraction gave the best tumor control and tumor immunity while maintaining low Treg numbers. Conclusions: Radiation can be an immune adjuvant, but the response varies with the size of dose per fraction. The ultimate challenge is to optimally integrate cancer immunotherapy into radiation therapy.

  13. Identification of immune response-related genes in the Chinese oak silkworm, Antheraea pernyi by suppression subtractive hybridization.

    Science.gov (United States)

    Liu, Qiu-Ning; Zhu, Bao-Jian; Wang, Lei; Wei, Guo-Qing; Dai, Li-Shang; Lin, Kun-Zhang; Sun, Yu; Qiu, Jian-Feng; Fu, Wei-Wei; Liu, Chao-Liang

    2013-11-01

    Insects possess an innate immune system that responds to invading microorganisms. In this study, a subtractive cDNA library was constructed to screen for immune response-related genes in the fat bodies of Antheraea pernyi (Lepidoptera: Saturniidae) pupa challenged with Escherichia coli. Four hundred putative EST clones were identified by suppression subtractive hybridization (SSH), including 50 immune response-related genes, three cytoskeleton genes, eight cell cycle and apoptosis genes, five respiration and energy metabolism genes, five transport genes, 40 metabolism genes, ten stress response genes, four transcription and translation regulation genes and 77 unknown genes. To verify the reliability of the SSH data, the transcription of a set of randomly selected immune response-related genes were confirmed by semi-quantitative reverse transcription-PCR (RT-PCR) and real-time quantitative reverse transcription-PCR (qRT-PCR). These identified immune response-related genes provide insight into understanding the innate immunity in A. pernyi. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. The Hepatitis C Virus Glycan Shield and Evasion of the Humoral Immune Response

    Directory of Open Access Journals (Sweden)

    Jean Dubuisson

    2011-10-01

    Full Text Available Despite the induction of effective immune responses, 80% of hepatitis C virus (HCV-infected individuals progress from acute to chronic hepatitis. In contrast to the cellular immune response, the role of the humoral immune response in HCV clearance is still subject to debate. Indeed, HCV escapes neutralizing antibodies in chronically infected patients and reinfection has been described in human and chimpanzee. Studies of antibody-mediated HCV neutralization have long been hampered by the lack of cell-culture-derived virus and the absence of a small animal model. However, the development of surrogate models and recent progress in HCV propagation in vitro now enable robust neutralization assays to be performed. These advances are beginning to shed some light on the mechanisms of HCV neutralization. This review summarizes the current state of knowledge of the viral targets of anti-HCV-neutralizing antibodies and the mechanisms that enable HCV to evade the humoral immune response. The recent description of the HCV glycan shield that reduces the immunogenicity of envelope proteins and masks conserved neutralizing epitopes at their surface constitutes the major focus of this review.

  15. Previous 60-Co radiation from Paratrygon aiereba mucus induces the production of highly responsive antibodies and a better immune response in mice

    Energy Technology Data Exchange (ETDEWEB)

    Thomazi, Gabriela Ortega Coelho; Alves, Glaucie Jussilane; Turíbio, Thompson de Oliveira; Rocha, André Moreira; Aires, Raquel da Silva; Jácome, Larissa Barros Silvestre; Spencer, Patrick Jack, E-mail: gabiortegacoelho@usp.br [Instituto de Pesquisas Energéticas e Nucleares (IPEN/CNEN-SP), São Paulo, SP (Brazil). Centro de Biotecnologia; Costa, Andrea da; Rodrigues, Jaqueline Pollizeli; Galisteo Júnior, Andrés Jimenez; Andrade Júnior, Heitor Franco de, E-mail: hfandrad@usp.br, E-mail: raquelaires@itpacporto.com.br [Universidade de São Paulo (USP), São Paulo, SP (Brazil). Laboratório de Protozoologia; Seibert, Carla Simone, E-mail: seibertcs@uft.edu.br [Universidade Federal do Tocantins (UFT), Porto Nacional, TO (Brazil)

    2017-07-01

    Wounds from stinging freshwater stingrays are painful, difficult to heal and cause extensive necrosis and systemic phenomena. The treatment is symptomatic, of low efficiency and there is no therapy, which causes more suffering to the injured. This study aimed to evaluate the immune response induced by the native or irradiated by 60-Co gamma from Paratrygon aiereba mucus. IPEN’s Committee on Ethics in the Use of Animals (n.º126/2013) and lanes captured under license from the Chico Mendes Institute for Biodiversity Conservation (n.º6781-1/2014) approved this research. For the assays, sera from Swiss mice previously immunized against native or irradiated mucus were used. The proliferation of splenic B cells in response to mucus was evaluated by the In Vitro Induced Antibody Production method and serum and splenic cytokines were also quantified. Our data demonstrate that the irradiated mucus of P. aiereba induces greater production of antibodies and more immunological memory in the mice. Spleen cells from animals immunized against irradiated mucus produced IFN-γ, TNF-α and IL-10, and serum TNF-α (immunized group against irradiated mucus) and IL-6 and IL-17 (immunized group against native mucus). The results corroborate the use of ionizing radiation, with production of highly responsive antibodies and better immune response, besides proving that Paratrygon aiereba mucus is capable of stimulating cellular and humoral adaptive immune response, contributing to the continuity of associated investigations. (author)

  16. Previous 60-Co radiation from Paratrygon aiereba mucus induces the production of highly responsive antibodies and a better immune response in mice

    International Nuclear Information System (INIS)

    Thomazi, Gabriela Ortega Coelho; Alves, Glaucie Jussilane; Turíbio, Thompson de Oliveira; Rocha, André Moreira; Aires, Raquel da Silva; Jácome, Larissa Barros Silvestre; Spencer, Patrick Jack

    2017-01-01

    Wounds from stinging freshwater stingrays are painful, difficult to heal and cause extensive necrosis and systemic phenomena. The treatment is symptomatic, of low efficiency and there is no therapy, which causes more suffering to the injured. This study aimed to evaluate the immune response induced by the native or irradiated by 60-Co gamma from Paratrygon aiereba mucus. IPEN’s Committee on Ethics in the Use of Animals (n.º126/2013) and lanes captured under license from the Chico Mendes Institute for Biodiversity Conservation (n.º6781-1/2014) approved this research. For the assays, sera from Swiss mice previously immunized against native or irradiated mucus were used. The proliferation of splenic B cells in response to mucus was evaluated by the In Vitro Induced Antibody Production method and serum and splenic cytokines were also quantified. Our data demonstrate that the irradiated mucus of P. aiereba induces greater production of antibodies and more immunological memory in the mice. Spleen cells from animals immunized against irradiated mucus produced IFN-γ, TNF-α and IL-10, and serum TNF-α (immunized group against irradiated mucus) and IL-6 and IL-17 (immunized group against native mucus). The results corroborate the use of ionizing radiation, with production of highly responsive antibodies and better immune response, besides proving that Paratrygon aiereba mucus is capable of stimulating cellular and humoral adaptive immune response, contributing to the continuity of associated investigations. (author)

  17. Effects of inbreeding on potential and realized immune responses in Tenebrio molitor.

    Science.gov (United States)

    Rantala, Markus J; Viitaniemi, Heidi; Roff, Derek A

    2011-06-01

    Although numerous studies on vertebrates suggest that inbreeding reduces their resistance against parasites and pathogens, studies in insects have found contradictory evidence. In this study we tested the effect of 1 generation of brother-sister mating (inbreeding) on potential and realized immune responses and other life-history traits in Tenebrio molitor. We found that inbreeding reduced adult mass, pre-adult survival and increased development time, suggesting that inbreeding reduced the condition of the adults and thus potentially made them more susceptible to physiological stress. However, we found no significant effect of inbreeding on the potential immune response (encapsulation response), but inbreeding reduced the realized immune response (resistance against the entomopathogenic fungi, Beauveria bassiana). There was a significant family effect on encapsulation response, but no family effect on the resistance against the entomopathogenic fungi. Given that this latter trait showed significant inbreeding depression and that the sample size for the family-effect analysis was small it is likely that the lack of a significant family effect is due to reduced statistical power, rather than the lack of a heritable basis to the trait. Our study highlights the importance of using pathogens and parasites in immunoecological studies.

  18. Intrinsic JNK-MAPK pathway involvement requires daf-16-mediated immune response during Shigella flexneri infection in C. elegans.

    Science.gov (United States)

    Marudhupandiyan, Shanmugam; Balamurugan, Krishnaswamy

    2017-06-01

    The c-Jun N-terminal kinase-mitogen-activated protein kinase (JNK-MAPK) pathway assists in modulating signals for growth, survival, and metabolism, thereby coordinating many cellular events during normal and stress conditions. To understand the role of the JNK-MAPK pathway during bacterial infection, an in vivo model organism Caenorhabditis elegans was used. In order to check the involvement of the JNK-MAPK pathway, the survival rate of C. elegans wild type (WT), and JNK-MAPK pathway mutant worms' upon exposure to selective Gram-positive and Gram-negative pathogenic bacteria, was studied. Among the pathogens, Shigella flexneri M9OT was found to efficiently colonize inside the WT and JNK-MAPK pathway mutant worms. qPCR studies had suggested that the above pathway-specific genes kgb-2 and jnk-1 were prominently responsible for the immune response elicited by the host during the M9OT infection. In addition, daf-16, which is a major transcription factor of the insulin/insulin growth factor-1 signaling (IIS) pathway, was also found to be involved during the host response. Crosstalk between IIS and JNK-MAPK pathways has probably been involved in the activation of the host immune system, which consequently leads to lifespan extension. Furthermore, it is also observed that daf-16 activation by JNK-MAPK pathway leads to antimicrobial response, by activating lys-7 expression. These findings suggest that JNK-MAPK is not the sole pathway that enhances the immunity of the host. Nonetheless, the IIS pathway bridges the JNK-MAPK pathway that influences in protecting the host in counter to the M9OT infection.

  19. DMPD: Cytosolic DNA recognition for triggering innate immune responses. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 18280611 Cytosolic DNA recognition for triggering innate immune responses. Takaoka ...A, Taniguchi T. Adv Drug Deliv Rev. 2008 Apr 29;60(7):847-57. Epub 2007 Dec 31. (.png) (.svg) (.html) (.csml) Show Cytosol...ic DNA recognition for triggering innate immune responses. PubmedID 18280611 Title Cytosolic D

  20. Obligate brood parasites show more functionally effective innate immune responses: an eco-immunological hypothesis

    Science.gov (United States)

    Hahn, D. Caldwell; Summers, Scott G.; Genovese, Kenneth J.; He, Haiqi; Kogut, Michael H.

    2013-01-01

    Immune adaptations of obligate brood parasites attracted interest when three New World cowbird species (Passeriformes, Icteridae, genus Molothrus) proved unusually resistant to West Nile virus. We have used cowbirds as models to investigate the eco-immunological hypothesis that species in parasite-rich environments characteristically have enhanced immunity as a life history adaptation. As part of an ongoing program to understand the cowbird immune system, in this study we measured degranulation and oxidative burst, two fundamental responses of the innate immune system. Innate immunity provides non-specific, fast-acting defenses against a variety of invading pathogens, and we hypothesized that innate immunity experiences particularly strong selection in cowbirds, because their life history strategy exposes them to diverse novel and unpredictable parasites. We compared the relative effectiveness of degranulation and oxidative burst responses in two cowbird species and one related, non-parasitic species. Both innate immune defenses were significantly more functionally efficient in the two parasitic cowbird species than in the non-parasitic red-winged blackbird (Icteridae, Agelaius phoeniceus). Additionally, both immune defenses were more functionally efficient in the brown-headed cowbird (M. ater), an extreme host-generalist brood parasite, than in the bronzed cowbird (M. aeneus), a moderate host-specialist with lower exposure to other species and their parasites. Thus the relative effectiveness of these two innate immune responses corresponds to the diversity of parasites in the niche of each species and to their relative resistance to WNV. This study is the first use of these two specialized assays in a comparative immunology study of wild avian species.

  1. Innate immune responses against foot-and-mouth disease virus: current understanding and future directions.

    Science.gov (United States)

    Summerfield, Artur; Guzylack-Piriou, Laurence; Harwood, Lisa; McCullough, Kenneth C

    2009-03-15

    Foot-and-mouth disease (FMD) represents one of the most economically important diseases of farm animals. The basis for the threat caused by this virus is the high speed of replication, short incubation time, high contagiousness, and high mutation rate resulting in constant antigenic changes. Thus, although protective immune responses against FMD virus (FMDV) can be efficacious, the rapidity of virus replication and spread can outpace immune defence development and overrun the immune system. FMDV can also evade innate immune responses through its ability to shut down cellular protein synthesis, including IFN type I, in susceptible epithelial cells. This is important for virus evolution, as FMDV is quite sensitive to the action of IFN. Despite this, innate immune responses are probably induced in vivo, although detailed studies on this subject are lacking. Accordingly, this interaction of FMDV with cells of the innate immune system is of particular interest. Dendritic cells (DC) can be infected by FMDV and support viral RNA replication, and viral protein synthesis but the latter is inefficient or abortive, leading most often to incomplete replication and progeny virus release. As a result DC can be activated, and particularly in the case of plasmacytoid DC (pDC), this is manifest in terms of IFN-alpha release. Our current state of knowledge on innate immune responses induced by FMDV is still only at a relatively early stage of understanding. As we progress, the investigations in this area will help to improve the design of current vaccines and the development of novel control strategies against FMD.

  2. Age-related immune response to experimental infection with Eimeria ninakohlyakimovae in goat kids.

    Science.gov (United States)

    Matos, L; Muñoz, M C; Molina, J M; Rodríguez, F; Pérez, D; López, A M; Hermosilla, C; Taubert, A; Ruiz, A

    2018-06-01

    Both the immune response developed in ruminants against Eimeria spp. and the ability to bear patent infections seems to be dependent on the age of the host. In the present study we have evaluated the influence of the age in the development of protective immune responses against Eimeria ninakohlyakimovae. For this purpose, 3, 4 and 5-week-old goat kids were infected with sporulated oocysts and subjected to a homologous challenge 3 weeks later. Goat kids primary infected at 6, 7 and 8 weeks of age served as challenge controls, and uninfected animals were used as negative controls. The protective immunity was assessed by clinical, haematological, parasitological, immunological and pathological parameters. Altogether, the results demonstrate that goat kids of either 3, 4 or 5 weeks of age are able to develop patent infections and immunoprotective responses against E. ninakohlyakimovae, as all age groups: (i) released significantly less oocysts after challenge, which was associated to milder clinical signs; (ii) displayed a local immune response, with significant increase of numerous cellular populations; and (iii) had increased levels of IgG and IgM, and mainly of local IgA. Nevertheless, detailed analysis of the data showed some differences between the three age groups, related both to the Eimeria infection outcome and the resulting immune response, suggesting that youngest goat kids are not fully immunocompetent. This finding may be of interest for the design of immunoprophylactic approaches and/or prophylactic/methaphylactic treatments against goat coccidiosis. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Arabidopsis ZED1-related kinases mediate the temperature-sensitive intersection of immune response and growth homeostasis.

    Science.gov (United States)

    Wang, Zhicai; Cui, Dayong; Liu, Jing; Zhao, Jingbo; Liu, Cheng; Xin, Wei; Li, Yuan; Liu, Na; Ren, Dongtao; Tang, Dingzhong; Hu, Yuxin

    2017-07-01

    Activation of the immune response in plants antagonizes growth and development in the absence of pathogens, and such an autoimmune phenotype is often suppressed by the elevation of ambient temperature. However, molecular regulation of the ambient temperature-sensitive intersection of immune response and growth is largely elusive. A genetic screen identified an Arabidopsis mutant, zed1-D, by its high temperature-dependent growth retardation. A combination of molecular, cytological and genetic approaches was used to investigate the molecular basis behind the temperature-sensitive growth and immune response in zed1-D. A dominant mutation in HOPZ-ETI-DEFICIENT 1 (ZED1) is responsible for a high temperature-dependent autoimmunity and growth retardation in zed1-D. The autoimmune phenotype in zed1-D is dependent on the HOPZ-ACTIVATED RESISTANCE 1 (ZAR1). ZED1 and some ZED1-related kinases (ZRKs) are induced by elevated temperature and function cooperatively to suppress the immune response by modulating the transcription of SUPPRESSOR OF NPR1-1 CONSTITUTIVE 1 (SNC1) in the absence of pathogens. Our data reveal a previously unidentified role of ZRKs in the ambient temperature-sensitive immune response in the absence of pathogens, and thus reveals a possible molecular mechanism underlying the temperature-mediated intersection of immune response and growth in plants. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  4. Cell-mediated immune responses in rainbow trout after DNA immunization against the viral hemorrhagic septicemia virus

    DEFF Research Database (Denmark)

    Utke, Katrin; Kock, Holger; Schuetze, Heike

    2008-01-01

    injection site rather than to injection sites of heterologous vaccines, suggesting the antigen specificity of homing. By demonstrating CMC responses to distinct viral proteins and homing in rainbow trout, these results substantially contribute to the understanding of the teleost immune system.......To identify viral proteins that induce cell-mediated cytotoxicity (CMC) against viral hemorrhagic septicemia virus (VHSV)-infected cells, rainbow trout were immunized with DNA vectors encoding the glycoprotein G or the nucleocapsid protein N of VHSV. The G protein was a more potent trigger...... of cytotoxic cells than the N protein. Peripheral blood leukocytes (PBL) isolated from trout immunized against the G protein killed both VHSV-infected MHC class I matched (RTG-2) and VHSV-infected xenogeneic (EPC) target cells, suggesting the involvement of both cytotoxic T lymphocytes (CTL) and NK cells...

  5. Synthetic Immunology: Hacking Immune Cells to Expand Their Therapeutic Capabilities.

    Science.gov (United States)

    Roybal, Kole T; Lim, Wendell A

    2017-04-26

    The ability of immune cells to survey tissues and sense pathologic insults and deviations makes them a unique platform for interfacing with the body and disease. With the rapid advancement of synthetic biology, we can now engineer and equip immune cells with new sensors and controllable therapeutic response programs to sense and treat diseases that our natural immune system cannot normally handle. Here we review the current state of engineered immune cell therapeutics and their unique capabilities compared to small molecules and biologics. We then discuss how engineered immune cells are being designed to combat cancer, focusing on how new synthetic biology tools are providing potential ways to overcome the major roadblocks for treatment. Finally, we give a long-term vision for the use of synthetic biology to engineer immune cells as a general sensor-response platform to precisely detect disease, to remodel disease microenvironments, and to treat a potentially wide range of challenging diseases.

  6. Multivariate statistical analyses demonstrate unique host immune responses to single and dual lentiviral infection.

    Directory of Open Access Journals (Sweden)

    Sunando Roy

    2009-10-01

    Full Text Available Feline immunodeficiency virus (FIV and human immunodeficiency virus (HIV are recently identified lentiviruses that cause progressive immune decline and ultimately death in infected cats and humans. It is of great interest to understand how to prevent immune system collapse caused by these lentiviruses. We recently described that disease caused by a virulent FIV strain in cats can be attenuated if animals are first infected with a feline immunodeficiency virus derived from a wild cougar. The detailed temporal tracking of cat immunological parameters in response to two viral infections resulted in high-dimensional datasets containing variables that exhibit strong co-variation. Initial analyses of these complex data using univariate statistical techniques did not account for interactions among immunological response variables and therefore potentially obscured significant effects between infection state and immunological parameters.Here, we apply a suite of multivariate statistical tools, including Principal Component Analysis, MANOVA and Linear Discriminant Analysis, to temporal immunological data resulting from FIV superinfection in domestic cats. We investigated the co-variation among immunological responses, the differences in immune parameters among four groups of five cats each (uninfected, single and dual infected animals, and the "immune profiles" that discriminate among them over the first four weeks following superinfection. Dual infected cats mount an immune response by 24 days post superinfection that is characterized by elevated levels of CD8 and CD25 cells and increased expression of IL4 and IFNgamma, and FAS. This profile discriminates dual infected cats from cats infected with FIV alone, which show high IL-10 and lower numbers of CD8 and CD25 cells.Multivariate statistical analyses demonstrate both the dynamic nature of the immune response to FIV single and dual infection and the development of a unique immunological profile in dual

  7. Expression of putative immune response genes during early ontogeny in the coral Acropora millepora.

    Directory of Open Access Journals (Sweden)

    Eneour Puill-Stephan

    Full Text Available Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals.Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR. Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A. millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria during winnowing processes as symbioses are fine-tuned.Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of these genes in alloimmune-challenged corals are

  8. Expression of putative immune response genes during early ontogeny in the coral Acropora millepora.

    Science.gov (United States)

    Puill-Stephan, Eneour; Seneca, François O; Miller, David J; van Oppen, Madeleine J H; Willis, Bette L

    2012-01-01

    Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals. Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes) were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR). Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A. millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria) during winnowing processes as symbioses are fine-tuned. Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of these genes in alloimmune-challenged corals are needed to further

  9. Humoral immune response to measles and varicella vaccination in former very low birth weight preterm infants

    OpenAIRE

    Carolina Schlindwein Mariano Ferreira; Maria Cristina Abrão Aued Perin; Maria Isabel de Moraes-Pinto; Raquel Maria Simão-Gurge; Ana Lucia Goulart; Lily Yin Weckx; Amélia Miyashiro Nunes dos Santos

    2018-01-01

    Introduction: Immune response to vaccination in infants born prematurely may be lower than in infants born at full-term. Some clinical factors might be associated with humoral immune response. Objectives: The objectives of this study were to compare the immune response to measles and varicella vaccination in infants born prematurely with those born at full-term and to analyze factors associated with measles and varicella antibody levels. Methods: Prospective study including two groups o...

  10. Salmonella fecal shedding and immune responses are dose- and serotype- dependent in pigs.

    Directory of Open Access Journals (Sweden)

    Renata Ivanek

    Full Text Available Despite the public health importance of Salmonella infection in pigs, little is known about the associated dynamics of fecal shedding and immunity. In this study, we investigated the transitions of pigs through the states of Salmonella fecal shedding and immune response post-Salmonella inoculation as affected by the challenge dose and serotype. Continuous-time multistate Markov models were developed using published experimental data. The model for shedding had four transient states, of which two were shedding (continuous and intermittent shedding and two non-shedding (latency and intermittent non-shedding, and one absorbing state representing permanent cessation of shedding. The immune response model had two transient states representing responses below and above the seroconversion level. The effects of two doses [low (0.65×10(6 CFU/pig and high (0.65×10(9 CFU/pig] and four serotypes (Salmonella Yoruba, Salmonella Cubana, Salmonella Typhimurium, and Salmonella Derby on the models' transition intensities were evaluated using a proportional intensities model. Results indicated statistically significant effects of the challenge dose and serotype on the dynamics of shedding and immune response. The time spent in the specific states was also estimated. Continuous shedding was on average 10-26 days longer, while intermittent non-shedding was 2-4 days shorter, in pigs challenged with the high compared to low dose. Interestingly, among pigs challenged with the high dose, the continuous and intermittent shedding states were on average up to 10-17 and 3-4 days longer, respectively, in pigs infected with S. Cubana compared to the other three serotypes. Pigs challenged with the high dose of S. Typhimurium or S. Derby seroconverted on average up to 8-11 days faster compared to the low dose. These findings highlight that Salmonella fecal shedding and immune response following Salmonella challenge are dose- and serotype-dependent and that the detection of

  11. Hsp90-downregulation influences the heat-shock response, innate immune response and onset of oocyte development in nematodes.

    Directory of Open Access Journals (Sweden)

    Julia Eckl

    Full Text Available Hsp90 is a molecular chaperone involved in the regulation and maturation of kinases and transcription factors. In Caenorhabditis elegans, it contributes to the development of fertility, maintenance of muscle structure, the regulation of heat-shock response and dauer state. To understand the consequences of Hsp90-depletion, we studied Hsp90 RNAi-treated nematodes by DNA microarrays and mass spectrometry. We find that upon development of phenotypes the levels of chaperones and Hsp90 cofactors are increased, while specific proteins related to the innate immune response are depleted. In microarrays, we further find many differentially expressed genes related to gonad and larval development. These genes form an expression cluster that is regulated independently from the immune response implying separate pathways of Hsp90-involvement. Using fluorescent reporter strains for the differentially expressed immune response genes skr-5, dod-24 and clec-60 we observe that their activity in intestinal tissues is influenced by Hsp90-depletion. Instead, effects on the development are evident in both gonad arms. After Hsp90-depletion, changes can be observed in early embryos and adults containing fluorescence-tagged versions of SEPA-1, CAV-1 or PUD-1, all of which are downregulated after Hsp90-depletion. Our observations identify molecular events for Hsp90-RNAi induced phenotypes during development and immune responses, which may help to separately investigate independent Hsp90-influenced processes that are relevant during the nematode's life and development.

  12. Children with asthma by school age display aberrant immune responses to pathogenic airway bacteria as infants.

    Science.gov (United States)

    Larsen, Jeppe Madura; Brix, Susanne; Thysen, Anna Hammerich; Birch, Sune; Rasmussen, Morten Arendt; Bisgaard, Hans

    2014-04-01

    Asthma is a highly prevalent chronic lung disease that commonly originates in early childhood. Colonization of neonatal airways with the pathogenic bacterial strains Haemophilus influenzae, Moraxella catarrhalis, and Streptococcus pneumoniae is associated with increased risk of later childhood asthma. We hypothesized that children with asthma have an abnormal immune response to pathogenic bacteria in infancy. We aimed to assess the bacterial immune response in asymptomatic infants and the association with later development of asthma by age 7 years. The Copenhagen Prospective Studies on Asthma in Childhood birth cohort was followed prospectively, and asthma was diagnosed at age 7 years. The immune response to H influenzae, M catarrhalis, and S pneumoniae was analyzed in 292 infants using PBMCs isolated and stored since the age of 6 months. The immune response was assessed based on the pattern of cytokines produced and T-cell activation. The immune response to pathogenic bacteria was different in infants with asthma by 7 years of age (P = .0007). In particular, prospective asthmatic subjects had aberrant production of IL-5 (P = .008), IL-13 (P = .057), IL-17 (P = .001), and IL-10 (P = .028), whereas there were no differences in T-cell activation or peripheral T-cell composition. Children with asthma by school age exhibited an aberrant immune response to pathogenic bacteria in infancy. We propose that an abnormal immune response to pathogenic bacteria colonizing the airways in early life might lead to chronic airway inflammation and childhood asthma. Copyright © 2014 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  13. IL-10 polymorphism and cell-mediated immune response to Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Öhman, H.; Tiitinen, A; Halttunen, M.

    2006-01-01

    background. To study a relationship between interleukin-10 (IL-10) promoter -1082 polymorphism and cell-mediated immune response during C trachomatis infection in vitro, lymphocyte proliferation and cytokine (IL-10, IFN-gamma, TNF-alpha, IL-2, IL-4 and IL-5) secretion were analysed in subjects with different...... IL-10 genotypes. Enhanced IL-10 secretion and reduced antigen-specific lymphocyte proliferative and IFN-gamma responses were found in subjects with IL-10 -1082 GG genotype when compared to those with -1082 AA genotype. CD14+ monocytes were main source of IL-10 indicating that these cells...... are important regulators of the antigen-specific cell-mediated responses during active C trachomatis infection. We conclude that impaired cell-mediated response to C trachomatis is associated with IL-10 genotype in subjects with high IL-10 producing capacity. A comparison of immune markers between subjects...

  14. γ-Oryzanol-Rich Black Rice Bran Extract Enhances the Innate Immune Response.

    Science.gov (United States)

    Shin, Soon Young; Kim, Heon-Woong; Jang, Hwan-Hee; Hwang, Yu-Jin; Choe, Jeong-Sook; Lim, Yoongho; Kim, Jung-Bong; Lee, Young Han

    2017-09-01

    The innate immune response is an important host primary defense system against pathogens. γ-Oryzanol is one of the nutritionally important phytoceutical components in rice bran oil. The goal of this study was to investigate the effect of γ-oryzanol-rich extract from black rice bran (γORE) on the activation of the innate immune system. In this study, we show that γORE increased the expression of CD14 and Toll-like receptor 4 and enhanced the phagocytic activity of RAW264.7 macrophages. Furthermore, γORE and its active ingredient γ-oryzanol promoted the secretion of innate cytokines, interleukin-8, and CCL2, which facilitate phagocytosis by RAW264.7 cells. These findings suggest that γ-oryzanol in the γORE enhances innate immune responses.

  15. Vascular endothelium as a target of immune response in renal transplant rejection

    Directory of Open Access Journals (Sweden)

    Giovanni ePiotti

    2014-10-01

    Full Text Available This review of clinical and experimental studies aims at analysing the interplay between graft endothelium and host immune system in renal transplantation, and how it affects the survival of the graft. Graft endothelium is indeed the first barrier between self and non-self that is encountered by host lymphocytes upon reperfusion of vascularised solid transplants. Endothelial cells express all the major sets of antigens that elicit host immune response, and therefore represent a preferential target in organ rejection.Some of the antigens expressed by endothelial cells are target of the antibody-mediated response, such as the AB0 blood group system, the HLA and MICA systems, and the endothelial cell-restricted antigens; for each of these systems, the mechanisms of interaction and damage of both preformed and de novo donor-specific antibodies are reviewed along with their impact on renal graft survival. Moreover the rejection process can force injured endothelial cells to expose cryptic self-antigens, toward which an auto-immune response mounts, overlapping to the allo-immune response in the damaging of the graft. Not only are endothelial cells a passive target of the host immune response, but also an active player in lymphocyte activation; therefore their interaction with allogenic T-cells is analysed on the basis of experimental in vitro and in vivo studies, according to the patterns of expression of the HLA class I and II and the co-stimulatory molecules specific for cytotoxic and helper T-cells.Finally, as the response that follows transplantation has proven to be not necessarily destructive, the factors that foster graft endothelium functioning in spite of rejection, and how they could be therapeutically harnessed to promote long-term graft acceptance, are described: accommodation that is resistance of endothelial cells to donor-specific antibodies, and endothelial cell ability to induce Foxp3+ Regulatory T-cells, that are crucial mediators of

  16. Contradictory Immune Response in Post Liver Transplantation Hepatitis B and C

    Directory of Open Access Journals (Sweden)

    Akinobu Takaki

    2014-01-01

    Full Text Available Hepatitis B and C often progress to decompensated liver cirrhosis requiring orthotopic liver transplantation (OLT. After OLT, hepatitis B recurrence is clinically controlled with a combination of hepatitis B immunoglobulin (HBIG and nucleos(tide analogues. Another approach is to induce self-producing anti-hepatitis B virus (HBV antibodies using a HBV envelope antigen vaccine. Patients who had not been HBV carriers such as acutely infected liver failure or who received liver from HBV self-limited donor are good candidate. For chronic HBV carrier patients, a successful response can only be achieved in selected patients such as those treated with experimentally reduced immunosuppression protocols or received an anti-HBV adaptive memory carrying donor liver. Hepatitis C virus (HCV reinfects transplanted livers at a rate of >90%. HCV reinfected patients show different severities of hepatitis, from mild and slowly progressing to severe and rapidly progressing, possibly resulting from different adaptive immune responses. More than half the patients require interferon treatment, although the success rate is low and carries risks for leukocytopenia and rejection. Managing the immune response has an important role in controlling recurrent hepatitis C. This study aimed to review the adaptive immune response in post-OLT hepatitis B and C.

  17. Immune Response to Sipuleucel-T in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    David I. Quinn

    2012-04-01

    Full Text Available Historically, chemotherapy has remained the most commonly utilized therapy in patients with metastatic cancers. In prostate cancer, chemotherapy has been reserved for patients whose metastatic disease becomes resistant to first line castration or androgen deprivation. While chemotherapy palliates, decreases serum prostate specific antigen and improves survival, it is associated with significant side effects and is only suitable for approximately 60% of patients with castrate-resistant prostate cancer. On that basis, exploration of other therapeutic options such as active secondary hormone therapy, bone targeted treatments and immunotherapy are important. Until recently, immunotherapy has had no role in the treatment of solid malignancies aside from renal cancer and melanoma. The FDA-approved autologous cellular immunotherapy sipuleucel-T has demonstrated efficacy in improving overall survival in patients with metastatic castrate-resistant prostate cancer in randomized clinical trials. The proposed mechanism of action is reliant on activating the patients’ own antigen presenting cells (APCs to prostatic acid phosphatase (PAP fused with granulocyte-macrophage colony stimulating factor (GM-CSF and subsequent triggered T-cell response to PAP on the surface of prostate cancer cells in the patients body. Despite significant prolongation of survival in Phase III trials, the challenge to health care providers remains the dissociation between objective changes in serum PSA or on imaging studies after sipleucel-T and survival benefit. On that basis there is an unmet need for markers of outcome and a quest to identify immunologic or clinical surrogates to fill this role. This review focuses on the impact of sipuleucel-T on the immune system, the T and B cells, and their responses to relevant antigens and prostate cancer. Other therapeutic modalities such as chemotherapy, corticosteroids and GM-CSF and host factors can also affect immune response. The

  18. Immune Response Augmentation in Metastasized Breast Cancer by Localized Therapy Utilizing Biocompatible Magnetic Fluids

    Science.gov (United States)

    2008-08-01

    SUBJECT TERMS Cancer therapy by localized immune response, Magneto -rehological Fluids 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT...Metastasized Breast Cancer by Localized Therapy utilizing Biocompatible Magnetic Fluids PRINCIPAL INVESTIGATOR: Cahit Evrensel...2008 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Immune Response Augmentation in Metastasized Breast Cancer by Localized Therapy utilizing

  19. [The humoral immune response in mice induced by recombinant Lactococcus lactis expressing HIV-1 gag].

    Science.gov (United States)

    Zhao, Xiaofei; Zhang, Cairong; Liu, Xiaojuan; Ma, Zhenghai

    2014-11-01

    To analyze the humoral immune response induced by recombinant Lactococcus lactis expressing HIV-1 gag in mice immunized orally, intranasally, subcutaneously or in the combined way of above three. Fifty BALB/c mice were randomly divided into 5 groups, 10 mice per group. The mice were immunized consecutively three times at two week intervals with 10(9) CFU of recombinant Lactococcus lactis expressing gag through oral, intranasal, subcutaneous administration or the mix of them. The mice that were immunized orally with Lactococcus lactis containing PMG36e served as a control group. The sera of mice were collected before primary immunization and 2 weeks after each immunization to detect the gag specific IgG by ELISA. Compared with the control group, the higher titer of serum gag specific IgG was detected in the four groups immunized with recombinant Lactococcus lactis expressing gag, and it was the highest in the mixed immunization group (PLactococcus lactis expressing gag can induce humoral immune response in mice by oral, intranasal, subcutaneous injection or the mix of them, and the mixed immunization can enhance the immune effects of Lactococcus lactis vector vaccine.

  20. The Pig as a Large Animal Model for Studying Anti-Tumor Immune Responses

    DEFF Research Database (Denmark)

    Overgaard, Nana Haahr

    but also generates a selective pressure, which may lead to selection of tumor cell variants with reduced immunogenicity; thereby, increasing the risk of tumor escape. Cancer immunotherapy includes treatment strategies aimed at activating anti-tumor immune responses or inhibiting suppressive and tumor......-favorable immune mechanisms. One of the promising arms of cancer immunotherapy is peptide-based therapeutic vaccines; yet, no such vaccine has been approved for use in human oncology. For many years, mouse models have provided invaluable understanding of complex immunological pathways; however, the majority...... tolerance towards IDO and the establishment of an antigen-specific cell-mediated immune (CMI) response. When comparing the different CAF09-formulated antigen doses, we demonstrate the induction of a CMI-dominant response upon exposure to a low endogenous peptide dose. In contrast, a mixed CMI and humoral...

  1. Effect of adjuvants on the humoral immune response to congopain in mice and cattle

    Directory of Open Access Journals (Sweden)

    Kateregga John

    2012-05-01

    Full Text Available Abstract Background We investigated several adjuvants for their effects on the humoral immune response in both mice and cattle using the central domain of congopain (C2, the major cysteine protease of Trypanosoma congolense, as a model for developing a vaccine against animal trypanosomosis. The magnitude and sustainability of the immune response against C2 and the occurrence of a booster effect of infection, an indirect measure of the presence of memory cells, were determined by ELISA, while spectrofluorometry was used to determine and measure the presence of enzyme-inhibiting antibodies. Results Mice immunized with recombinant C2 in TiterMax™, Adjuphos™, purified saponin Quil A™ or Gerbu™ showed the best response according to the evaluation criteria and the latter three were chosen for the cattle vaccination study. The cattle were challenged with T. congolense four and a half months after the last booster. Cattle immunized with recombinant C2 in purified saponin Quil A™ showed the best antibody response according to the measured parameters. Conclusions We identified purified saponin Quil A™ as a good adjuvant for immunizations with C2. The results from this study will be useful in future attempts to develop an effective anti-disease vaccine against African trypanosomosis.

  2. A unique dermal dendritic cell subset that skews the immune response toward Th2.

    Directory of Open Access Journals (Sweden)

    Ryuichi Murakami

    Full Text Available Dendritic cell (DC subsets in the skin and draining lymph nodes (LNs are likely to elicit distinct immune response types. In skin and skin-draining LNs, a dermal DC subset expressing macrophage galactose-type C-type lectin 2 (MGL2/CD301b was found distinct from migratory Langerhans cells (LCs or CD103(+ dermal DCs (dDCs. Lower expression levels of Th1-promoting and/or cross-presentation-related molecules were suggested by the transcriptome analysis and verified by the quantitative real-time PCR analysis in MGL2(+ dDCs than in CD103(+ dDCs. Transfer of MGL2(+ dDCs but not CD103(+ dDCs from FITC-sensitized mice induced a Th2-type immune response in vivo in a model of contact hypersensitivity. Targeting MGL2(+ dDCs with a rat monoclonal antibody against MGL2 efficiently induced a humoral immune response with Th2-type properties, as determined by the antibody subclass. We propose that the properties of MGL2(+ dDCs, are complementary to those of CD103(+ dDCs and skew the immune response toward a Th2-type response.

  3. Newborn Mice Vaccination with BCG.HIVA222 + MVA.HIVA Enhances HIV-1-Specific Immune Responses: Influence of Age and Immunization Routes

    Directory of Open Access Journals (Sweden)

    Narcís Saubi

    2011-01-01

    Full Text Available We have evaluated the influence of age and immunization routes for induction of HIV-1- and M. tuberculosis-specific immune responses after neonatal (7 days old and adult (7 weeks old BALB/c mice immunization with BCG.HIVA222 prime and MVA.HIVA boost. The specific HIV-1 cellular immune responses were analyzed in spleen cells. The body weight of the newborn mice was weekly recorded. The frequencies of HIV-specific CD8+ T cells producing IFN-γ were higher in adult mice vaccinated intradermally and lower in adult and newborn mice vaccinated subcutaneously. In all cases the IFN-γ production was significantly higher when mice were primed with BCG.HIVA222 compared with BCGwt. When the HIV-specific CTL activity was assessed, the frequencies of specific killing were higher in newborn mice than in adults. The prime-boost vaccination regimen which includes BCG.HIVA222 and MVA.HIVA was safe when inoculated to newborn mice. The administration of BCG.HIVA222 to newborn mice is safe and immunogenic and increased the HIV-specific responses induced by MVA.HIVA vaccine. It might be a good model for infant HIV and Tuberculosis bivalent vaccine.

  4. Newborn Mice Vaccination with BCG.HIVA222 + MVA.HIVA Enhances HIV-1-Specific Immune Responses: Influence of Age and Immunization Routes

    Science.gov (United States)

    Saubi, Narcís; Im, Eung-Jun; Fernández-Lloris, Raquel; Gil, Olga; Cardona, Pere-Joan; Gatell, Josep Maria; Hanke, Tomáš; Joseph, Joan

    2011-01-01

    We have evaluated the influence of age and immunization routes for induction of HIV-1- and M. tuberculosis-specific immune responses after neonatal (7 days old) and adult (7 weeks old) BALB/c mice immunization with BCG.HIVA222 prime and MVA.HIVA boost. The specific HIV-1 cellular immune responses were analyzed in spleen cells. The body weight of the newborn mice was weekly recorded. The frequencies of HIV-specific CD8+ T cells producing IFN-γ were higher in adult mice vaccinated intradermally and lower in adult and newborn mice vaccinated subcutaneously. In all cases the IFN-γ production was significantly higher when mice were primed with BCG.HIVA222 compared with BCGwt. When the HIV-specific CTL activity was assessed, the frequencies of specific killing were higher in newborn mice than in adults. The prime-boost vaccination regimen which includes BCG.HIVA222 and MVA.HIVA was safe when inoculated to newborn mice. The administration of BCG.HIVA222 to newborn mice is safe and immunogenic and increased the HIV-specific responses induced by MVA.HIVA vaccine. It might be a good model for infant HIV and Tuberculosis bivalent vaccine. PMID:21603216

  5. Anxiety and perceived psychological stress play an important role in the immune response after exercise.

    Science.gov (United States)

    Edwards, Jason P; Walsh, Neil P; Diment, Philip C; Roberts, Ross

    2018-01-01

    There are common pathways by which psychological stress and exercise stress alter immunity. However, it remains unknown whether psychological stress plays a role in the in vivo immune response to exercise. We examined the relationship between anxiety and perceived psychological stress reported before exercise and in vivo immunity after exercise using skin sensitisation with Diphenylcyclopropenone (DPCP). In a randomised design, sixty four, thoroughly familiarised, males completed widely used psychological instruments to assess state-anxiety and perceived psychological stress before exercise, and ran either 30 minutes at 60% (30MI) or 80% (30HI) V . O2peak, 120 minutes at 60% (120MI) V . O2peak or rested (CON) before DPCP sensitisation. Cutaneous recall to DPCP was measured as the dermal thickening response to a low-dose series DPCP challenge 4-weeks after sensitisation. After accounting for exercise (R2 = 0.20; P stress (ΔR2 = 0.13; P stress on in vivo immunity after exercise. Moreover, correlations were of comparable strength for the relationship between physiological stress (heart rate training impulse) and the summed dermal response to DPCP (r = -0.37; 95% CI: -0.05 to -0.62; P = 0.01), and state-anxiety and the summed dermal response to DPCP (r = 0.39; 95% CI: 0.08 to 0.63; P stress levels before exercise play animportant role in determining the strength of the in vivo immune response after exercise. These findings indicate a similar strength relationship for the level of state-anxiety prior to exercise and the level of physiological stress during exercise with the in vivo immune response after exercise. Future research is required to investigate exercise-immune responses in athletes, military personnel and others in physically demanding occupations experiencing higher levels of psychological stress than those reported in this study e.g. related to important competition, military operations and major life events. Nevertheless, the present findings support the

  6. Influence of Hesperidin on the Systemic and Intestinal Rat Immune Response

    Directory of Open Access Journals (Sweden)

    Mariona Camps-Bossacoma

    2017-06-01

    Full Text Available Polyphenols, widely found in edible plants, influence the immune system. Nevertheless, the immunomodulatory properties of hesperidin, the predominant flavanone in oranges, have not been deeply studied. To establish the effect of hesperidin on in vivo immune response, two different conditions of immune system stimulations in Lewis rats were applied. In the first experimental design, rats were intraperitoneally immunized with ovalbumin (OVA plus Bordetella pertussis toxin and alum as the adjuvants, and orally given 100 or 200 mg/kg hesperidin. In the second experimental design, rats were orally sensitized with OVA together with cholera toxin and fed a diet containing 0.5% hesperidin. In the first approach, hesperidin administration changed mesenteric lymph node lymphocyte (MLNL composition, increasing the TCRαβ+ cell percentage and decreasing that of B lymphocytes. Furthermore, hesperidin enhanced the interferon (IFN-γ production in stimulated MLNL. In the second approach, hesperidin intake modified the lymphocyte composition in the intestinal epithelium (TCRγδ+ cells and the lamina propria (TCRγδ+, CD45RA+, natural killer, natural killer T, TCRαβ+CD4+, and TCRαβ+CD8+ cells. Nevertheless, hesperidin did not modify the level of serum anti-OVA antibodies in either study. In conclusion, hesperidin does possess immunoregulatory properties in the intestinal immune response, but this effect is not able to influence the synthesis of specific antibodies.

  7. Activation of antitumor immune responses by Ganoderma formosanum polysaccharides in tumor-bearing mice.

    Science.gov (United States)

    Wang, Cheng-Li; Lu, Chiu-Ying; Hsueh, Ying-Chao; Liu, Wen-Hsiung; Chen, Chun-Jen

    2014-11-01

    Fungi of the genus Ganoderma are basidiomycetes that have been used as traditional medicine in Asia and have been shown to exhibit various pharmacological activities. We recently found that PS-F2, a polysaccharide fraction purified from the submerged culture broth of Ganoderma formosanum, stimulates the maturation of dendritic cells and primes a T helper 1 (Th1)-polarized adaptive immune response in vivo. In this study, we investigated whether the immune adjuvant function of PS-F2 can stimulate antitumor immune responses in tumor-bearing mice. Continuous intraperitoneal or oral administration of PS-F2 effectively suppressed the growth of colon 26 (C26) adenocarcinoma, B16 melanoma, and sarcoma 180 (S180) tumor cells in mice without adverse effects on the animals' health. PS-F2 did not cause direct cytotoxicity on tumor cells, and it lost the antitumor effect in mice with severe combined immunodeficiency (SCID). CD4(+) T cells, CD8(+) T cells, and serum from PS-F2-treated tumor-bearing mice all exhibited antitumor activities when adoptively transferred to naïve animals, indicating that PS-F2 treatment stimulates tumor-specific cellular and humoral immune responses. These data demonstrate that continuous administration of G. formosanum polysaccharide PS-F2 can activate host immune responses against ongoing tumor growth, suggesting that PS-F2 can potentially be developed into a preventive/therapeutic agent for cancer immunotherapy.

  8. Interleukin-4 Supports the Suppressive Immune Responses Elicited by Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Wei-Cheng Yang

    2017-11-01

    Full Text Available Interleukin-4 (IL-4 has been considered as one of the tolerogenic cytokines in many autoimmune animal models and clinical settings. Despite its role in antagonizing pathogenic Th1 responses, little is known about whether IL-4 possesses functions that affect regulatory T cells (Tregs. Tregs are specialized cells responsible for the maintenance of peripheral tolerance through their immune modulatory capabilities. Interestingly, it has been suggested that IL-4 supplement at a high concentration protects responder T cells (Tresps from Treg-mediated immune suppression. In addition, such supplement also impedes TGF-β-induced Treg differentiation in vitro. However, these phenomena may contradict the tolerogenic role of IL-4, and the effects of IL-4 on Tregs are therefore needed to be further elucidated. In this study, we utilized IL-4 knockout (KO mice to validate the role of IL-4 on Treg-mediated immune suppression. Although IL-4 KO and control animals harbor similar frequencies of Tregs, Tregs from IL-4 KO mice weakly suppressed autologous Tresp activation. In addition, IL-4 deprivation impaired the ability of Tregs to modulate immune response, whereas IL-4 supplementation reinforced IL-4 KO Tregs in their function in suppressing Tresps. Finally, the presence of IL-4 was associated with increased cell survival and granzyme expression of Tregs. These results suggest the essential role of IL-4 in supporting Treg-mediated immune suppression, which may benefit the development of therapeutic strategies for autoimmune diseases.

  9. Endometrial immune markers are potential predictors of normal fertility and pregnancy after in vitro fertilization.

    Science.gov (United States)

    Kofod, Louise; Lindhard, Anette; Bzorek, Michael; Eriksen, Jens Ole; Larsen, Lise Grupe; Hviid, Thomas Vauvert F

    2017-09-01

    Elucidating immune mechanisms in the endometrium, which lead to the success of implantation and pregnancy, is important in reproductive medicine. Studies of immune cell abundance have shown conflicting results, and the expression and importance of HLA class Ib proteins in pre-implantation endometrium have not yet been investigated. The study population consisted of four subgroups: a hydrosalpinx, a salpingectomy, an unexplained infertility, and a fertile control group. Endometrial samples were collected during the implantation window. Immune markers (CD56 + and CD16 + cells, FoxP3 + Tregs, HLA-G, HLA-F) were quantified in the samples. The outcome of the subsequent IVF treatment was recorded. Increased CD56 + uNK cells and high HLA-G expression served as predictor for successful pregnancy outcome. HLA-F expression was positively correlated with uNK cells, being indirectly predictive for achieving pregnancy. Endometrial uNK cell abundance in the pre-implantation endometrium seems to be important for normal fertility and pregnancy success, and they may be used as clinical markers to predict implantation success in IVF. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Modulation of innate immune responses by Yersinia type III secretion system translocators and effectors.

    Science.gov (United States)

    Bliska, James B; Wang, Xiaoying; Viboud, Gloria I; Brodsky, Igor E

    2013-10-01

    The innate immune system of mammals responds to microbial infection through detection of conserved molecular determinants called 'pathogen-associated molecular patterns' (PAMPs). Pathogens use virulence factors to counteract PAMP-directed responses. The innate immune system can in turn recognize signals generated by virulence factors, allowing for a heightened response to dangerous pathogens. Many Gram-negative bacterial pathogens encode type III secretion systems (T3SSs) that translocate effector proteins, subvert PAMP-directed responses and are critical for infection. A plasmid-encoded T3SS in the human-pathogenic Yersinia species translocates seven effectors into infected host cells. Delivery of effectors by the T3SS requires plasma membrane insertion of two translocators, which are thought to form a channel called a translocon. Studies of the Yersinia T3SS have provided key advances in our understanding of how innate immune responses are generated by perturbations in plasma membrane and other signals that result from translocon insertion. Additionally, studies in this system revealed that effectors function to inhibit innateimmune responses resulting from insertion of translocons into plasma membrane. Here, we review these advances with the goal of providing insight into how a T3SS can activate and inhibit innate immune responses, allowing a virulent pathogen to bypass host defences. © 2013 John Wiley & Sons Ltd.

  11. Influence of a cocoa-enriched diet on specific immune response in ovalbumin-sensitized rats.

    Science.gov (United States)

    Pérez-Berezo, Teresa; Ramiro-Puig, Emma; Pérez-Cano, Francisco J; Castellote, Cristina; Permanyer, Joan; Franch, Angels; Castell, Margarida

    2009-03-01

    Previous studies in young rats have reported the impact of 3 weeks of high cocoa intake on healthy immune status. The present article describes the effects of a longer-term cocoa-enriched diet (9 weeks) on the specific immune response to ovalbumin (OVA) in adult Wistar rats. At 4 weeks after immunization, control rats produced anti-OVA antibodies, which, according their amount and isotype, were arranged as follows: IgG1 > IgG2a > IgM > IgG2b > IgG2c. Both cocoa diets studied (4% and 10%) down-modulated OVA-specific antibody levels of IgG1 (main subclass associated with the Th2 immune response in rats), IgG2a, IgG2c and IgM isotypes. Conversely, cocoa-fed rats presented equal or higher levels of anti-OVA IgG2b antibodies (subclass linked to the Th1 response). Spleen and lymph node cells from OVA-immunized control and cocoa-fed animals proliferated similarly under OVA stimulation. However, spleen cells from cocoa-fed animals showed decreased interleukin-4 secretion (main Th2 cytokine), and lymph node cells from the same rats displayed higher interferon-gamma secretion (main Th1 cytokine). These changes were accompanied by a reduction in the number of anti-OVA IgG-secreting cells in spleen. In conclusion, cocoa diets induced attenuation of antibody synthesis that may be attributable to specific down-regulation of the Th2 immune response.

  12. Branched-chain amino acid supplementation and the immune response of long-distance athletes.

    Science.gov (United States)

    Bassit, Reinaldo A; Sawada, Letícia A; Bacurau, Reury F P; Navarro, Franciso; Martins, Eivor; Santos, Ronaldo V T; Caperuto, Erico C; Rogeri, Patrícia; Costa Rosa, Luís F B P

    2002-05-01

    Intense long-duration exercise has been associated with immunosuppression, which affects natural killer cells, lymphokine-activated killer cells, and lymphocytes. The mechanisms involved, however, are not fully determined and seem to be multifactorial, including endocrine changes and alteration of plasma glutamine concentration. Therefore, we evaluated the effect of branched-chain amino acid supplementation on the immune response of triathletes and long-distance runners. Peripheral blood was collected prior to and immediately after an Olympic Triathlon or a 30k run. Lymphocyte proliferation, cytokine production by cultured cells, and plasma glutamine were measured. After the exercise bout, athletes from the placebo group presented a decreased plasma glutamine concentration that was abolished by branched-chain amino acid supplementation and an increased proliferative response in their peripheral blood mononuclear cells. Those cells also produced, after exercise, less tumor necrosis factor, interleukins-1 and -4, and interferon and 48% more interleukin-2. Supplementation stimulated the production of interleukin-2 and interferon after exercise and a more pronounced decrease in the production of interleukin-4, indicating a diversion toward a Th1 type immune response. Our results indicate that branched-chain amino acid (BCAA) supplementation recovers the ability of peripheral blood mononuclear cells proliferate in response to mitogens after a long distance intense exercise, as well as plasma glutamine concentration. The amino acids also modify the pattern of cytokine production leading to a diversion of the immune response toward a Th1 type of immune response.

  13. Signalling through C-type lectin receptors: shaping immune responses

    NARCIS (Netherlands)

    Geijtenbeek, Teunis B. H.; Gringhuis, Sonja I.

    2009-01-01

    C-type lectin receptors (CLRs) expressed by dendritic cells are crucial for tailoring immune responses to pathogens. Following pathogen binding, CLRs trigger distinct signalling pathways that induce the expression of specific cytokines which determine T cell polarization fates. Some CLRs can induce

  14. Cocoa Diet and Antibody Immune Response in Preclinical Studies

    Directory of Open Access Journals (Sweden)

    Mariona Camps-Bossacoma

    2017-06-01

    Full Text Available The ability of cocoa to interact with the immune system in vitro and in vivo has been described. In the latter context, a cocoa-enriched diet in healthy rats was able to modify the immune system’s functionality. This fact could be observed in the composition and functionality of lymphoid tissues, such as the thymus, spleen, and lymph nodes. Consequently, immune effector mechanisms, such as antibody synthesis, were modified. A cocoa-enriched diet in young rats was able to attenuate the serum levels of immunoglobulin (Ig G, IgM, and IgA and also the intestinal IgM and IgA secretion. Moreover, in immunized rats, the intake of cocoa decreased specific IgG1, IgG2a, IgG2c, and IgM concentrations in serum. This immune-regulator potential was then tested in disease models in which antibodies play a pathogenic role. A cocoa-enriched diet was able to partially prevent the synthesis of autoantibodies in a model of autoimmune arthritis in rats and was also able to protect against IgE and T helper 2-related antibody synthesis in two rat models of allergy. Likewise, a cocoa-enriched diet prevented an oral sensitization process in young rats. In this review, we will focus on the influence of cocoa on the acquired branch of the immune function. Therefore, we will focus on how a cocoa diet influences lymphocyte function both in the systemic and intestinal immune system. Likewise, its potential role in preventing some antibody-induced immune diseases is also included. Although further studies must characterize the particular cocoa components responsible for such effects and nutritional studies in humans need to be carried out, cocoa has potential as a nutraceutical agent in some hypersensitivity status.

  15. Effect of partially purified fumonisins on cellular immune response in ...

    African Journals Online (AJOL)

    After 7 days, cellular immune response was evaluated by delayed-type hypersensitivity (DTH) and lymphoproliferative assays (LA) using spleen cells. Nitric oxide (NO) production by spleen cells was also evaluated. The specific LA response to Pb antigen was higher in group PB than in FB and CTR groups (p< 0.05) but not ...

  16. Curcumin prevents human dendritic cell response to immune stimulants

    International Nuclear Information System (INIS)

    Shirley, Shawna A.; Montpetit, Alison J.; Lockey, R.F.; Mohapatra, Shyam S.

    2008-01-01

    Curcumin, a compound found in the Indian spice turmeric, has anti-inflammatory and immunomodulatory properties, though the mechanism remains unclear. Dendritic cells (DCs) are important to generating an immune response and the effect of curcumin on human DCs has not been explored. The role curcumin in the DC response to bacterial and viral infection was investigated in vitro using LPS and Poly I:C as models of infection. CD14 + monocytes, isolated from human peripheral blood, were cultured in GM-CSF- and IL-4-supplemented medium to generate immature DCs. Cultures were incubated with curcumin, stimulated with LPS or Poly I:C and functional assays were performed. Curcumin prevents DCs from responding to immunostimulants and inducing CD4 + T cell proliferation by blocking maturation marker, cytokine and chemokine expression and reducing both migration and endocytosis. These data suggest a therapeutic role for curcumin as an immune suppressant

  17. Experimental demonstration of a parasite-induced immune response in wild birds: Darwin's finches and introduced nest flies.

    Science.gov (United States)

    Koop, Jennifer A H; Owen, Jeb P; Knutie, Sarah A; Aguilar, Maria A; Clayton, Dale H

    2013-08-01

    Ecological immunology aims to explain variation among hosts in the strength and efficacy of immunological defenses. However, a shortcoming has been the failure to link host immune responses to actual parasites under natural conditions. Here, we present one of the first experimental demonstrations of a parasite-induced immune response in a wild bird population. The recently introduced ectoparasitic nest fly Philornis downsi severely impacts the fitness of Darwin's finches and other land birds in the Galápagos Islands. An earlier study showed that female medium ground finches (Geospiza fortis) had P. downsi-binding antibodies correlating with presumed variation in fly exposure over time. In the current study, we experimentally manipulated fly abundance to test whether the fly does, in fact, cause changes in antibody levels. We manipulated P. downsi abundance in nests and quantified P. downsi-binding antibody levels of medium ground finch mothers, fathers, and nestlings. We also quantified host behaviors, such as preening, which can integrate with antibody-mediated defenses against ectoparasites. Philornis downsi-binding antibody levels were significantly higher among mothers at parasitized nests, compared to mothers at (fumigated) nonparasitized nests. Mothers with higher antibody levels tended to have fewer parasites in their nests, suggesting that antibodies play a role in defense against parasites. Mothers showed no behavioral changes that would enhance the effectiveness of the immune response. Neither adult males, nor nestlings, had P. downsi-induced immunological or behavioral responses that would enhance defense against flies. None of the parasitized nests fledged any offspring, despite the immune response by mothers. Thus, this study shows that, while the immune response of mothers appeared to be defensive, it was not sufficient to rescue current reproductive fitness. This study further shows the importance of testing the fitness consequences of immune

  18. Transcriptional Innate Immune Response of the Developing Chicken Embryo to Newcastle Disease Virus Infection

    Directory of Open Access Journals (Sweden)

    Megan A. Schilling

    2018-02-01

    Full Text Available Traditional approaches to assess the immune response of chickens to infection are through animal trials, which are expensive, require enhanced biosecurity, compromise welfare, and are frequently influenced by confounding variables. Since the chicken embryo becomes immunocompetent prior to hatch, we here characterized the transcriptional response of selected innate immune genes to Newcastle disease virus (NDV infection in chicken embryos at days 10, 14, and 18 of embryonic development. The results suggest that the innate immune response 72 h after challenge of 18-day chicken embryo is both consistent and robust. The expression of CCL5, Mx1, and TLR3 in lung tissues of NDV challenged chicken embryos from the outbred Kuroiler and Tanzanian local ecotype lines showed that their expression was several orders of magnitude higher in the Kuroiler than in the local ecotypes. Next, the expression patterns of three additional innate-immunity related genes, IL-8, IRF-1, and STAT1, were examined in the highly congenic Fayoumi (M5.1 and M15.2 and Leghorn (Ghs6 and Ghs13 sublines that differ only at the microchromosome bearing the major histocompatibility locus. The results show that the Ghs13 Leghorn subline had a consistently higher expression of all genes except IL-8 and expression seemed to be subline-dependent rather than breed-dependent, suggesting that the innate immune response of chicken embryos to NDV infection may be genetically controlled by the MHC-locus. Taken together, the results suggest that the chicken embryo may represent a promising model to studying the patterns and sources of variation of the avian innate immune response to infection with NDV and related pathogens.

  19. Transcriptional Innate Immune Response of the Developing Chicken Embryo to Newcastle Disease Virus Infection

    Science.gov (United States)

    Schilling, Megan A.; Katani, Robab; Memari, Sahar; Cavanaugh, Meredith; Buza, Joram; Radzio-Basu, Jessica; Mpenda, Fulgence N.; Deist, Melissa S.; Lamont, Susan J.; Kapur, Vivek

    2018-01-01

    Traditional approaches to assess the immune response of chickens to infection are through animal trials, which are expensive, require enhanced biosecurity, compromise welfare, and are frequently influenced by confounding variables. Since the chicken embryo becomes immunocompetent prior to hatch, we here characterized the transcriptional response of selected innate immune genes to Newcastle disease virus (NDV) infection in chicken embryos at days 10, 14, and 18 of embryonic development. The results suggest that the innate immune response 72 h after challenge of 18-day chicken embryo is both consistent and robust. The expression of CCL5, Mx1, and TLR3 in lung tissues of NDV challenged chicken embryos from the outbred Kuroiler and Tanzanian local ecotype lines showed that their expression was several orders of magnitude higher in the Kuroiler than in the local ecotypes. Next, the expression patterns of three additional innate-immunity related genes, IL-8, IRF-1, and STAT1, were examined in the highly congenic Fayoumi (M5.1 and M15.2) and Leghorn (Ghs6 and Ghs13) sublines that differ only at the microchromosome bearing the major histocompatibility locus. The results show that the Ghs13 Leghorn subline had a consistently higher expression of all genes except IL-8 and expression seemed to be subline-dependent rather than breed-dependent, suggesting that the innate immune response of chicken embryos to NDV infection may be genetically controlled by the MHC-locus. Taken together, the results suggest that the chicken embryo may represent a promising model to studying the patterns and sources of variation of the avian innate immune response to infection with NDV and related pathogens. PMID:29535762

  20. FOXO-dependent regulation of innate immune homeostasis.

    Science.gov (United States)

    Becker, Thomas; Loch, Gerrit; Beyer, Marc; Zinke, Ingo; Aschenbrenner, Anna C; Carrera, Pilar; Inhester, Therese; Schultze, Joachim L; Hoch, Michael

    2010-01-21

    The innate immune system represents an ancient host defence mechanism that protects against invading microorganisms. An important class of immune effector molecules to fight pathogen infections are antimicrobial peptides (AMPs) that are produced in plants and animals. In Drosophila, the induction of AMPs in response to infection is regulated through the activation of the evolutionarily conserved Toll and immune deficiency (IMD) pathways. Here we show that AMP activation can be achieved independently of these immunoregulatory pathways by the transcription factor FOXO, a key regulator of stress resistance, metabolism and ageing. In non-infected animals, AMP genes are activated in response to nuclear FOXO activity when induced by starvation, using insulin signalling mutants, or by applying small molecule inhibitors. AMP induction is lost in foxo null mutants but enhanced when FOXO is overexpressed. Expression of AMP genes in response to FOXO activity can also be triggered in animals unable to respond to immune challenges due to defects in both the Toll and IMD pathways. Molecular experiments at the Drosomycin promoter indicate that FOXO directly binds to its regulatory region, thereby inducing its transcription. In vivo studies in Drosophila, but also studies in human lung, gut, kidney and skin cells indicate that a FOXO-dependent regulation of AMPs is evolutionarily conserved. Our results indicate a new mechanism of cross-regulation of metabolism and innate immunity by which AMP genes can be activated under normal physiological conditions in response to the oscillating energy status of cells and tissues. This regulation seems to be independent of the pathogen-responsive innate immunity pathways whose activation is often associated with tissue damage and repair. The sparse production of AMPs in epithelial tissues in response to FOXO may help modulating the defence reaction without harming the host tissues, in particular when animals are suffering from energy shortage

  1. Flight performance of western sandpipers, Calidris mauri, remains uncompromised when mounting an acute phase immune response.

    Science.gov (United States)

    Nebel, Silke; Buehler, Deborah M; MacMillan, Alexander; Guglielmo, Christopher G

    2013-07-15

    Migratory birds have been implicated in the spread of some zoonotic diseases, but how well infected individuals can fly remains poorly understood. We used western sandpipers, Calidris mauri, to experimentally test whether flight is affected when long-distance migrants are mounting an immune response and whether migrants maintain immune defences during a flight in a wind tunnel. We measured five indicators of innate immunity in 'flown-healthy' birds (flying in a wind tunnel without mounting an immune response), 'flown-sick' birds (flying while mounting an acute phase response, which is part of induced innate immunity), and a non-flying control group ('not-flown'). Voluntary flight duration did not differ between flown-healthy and flown-sick birds, indicating that mounting an acute phase response to simulated infection did not hamper an individual's ability to fly for up to 3 h. However, in comparison to not-flown birds, bacterial killing ability of plasma was significantly reduced after flight in flown-sick birds. In flown-healthy birds, voluntary flight duration was positively correlated with bacterial killing ability and baseline haptoglobin concentration of the blood plasma measured 1-3 weeks before experimental flights, suggesting that high quality birds had strong immune systems and greater flight capacity. Our findings indicate that flight performance is not diminished by prior immune challenge, but that flight while mounting an acute phase response negatively affects other aspects of immune function. These findings have important implications for our understanding of the transmission of avian diseases, as they suggest that birds can still migrate while fighting an infection.

  2. 17D yellow fever vaccine elicits comparable long-term immune responses in healthy individuals and immune-compromised patients.

    Science.gov (United States)

    Wieten, R W; Goorhuis, A; Jonker, E F F; de Bree, G J; de Visser, A W; van Genderen, P J J; Remmerswaal, E B M; Ten Berge, I J M; Visser, L G; Grobusch, M P; van Leeuwen, E M M

    2016-06-01

    The 17D live attenuated yellow fever (YF) vaccine is contra-indicated in immune-compromised individuals and may elicit a suboptimal immunologic response. The aim of this study is to assess whether long-term immune responses against the YF vaccine are impaired in immune-compromised patients. Fifteen patients using different immunosuppressive drugs and 30 healthy individuals vaccinated 0-22 years ago were included. The serological response was measured using the plaque reduction neutralization test (PRNT). CD8(+) and CD4(+) T-cell responses were measured following proliferation and re-stimulation with YFV peptide pools. Phenotypic characteristics and cytokine responses of CD8(+) T-cells were determined using class I tetramers. The geometric mean titre of neutralizing antibodies was not different between the groups (p = 0.77). The presence of YFV-specific CD4(+) and CD8(+) T-cell did not differ between patients and healthy individuals (15/15, 100.0% vs. 29/30, 96.7%, p = 0.475). Time since vaccination correlated negatively with the number of YFV-specific CD8(+) T-cells (r = -0.66, p = 0.0045). Percentages of early-differentiated memory cells increased (r = 0.67, p = 0.017) over time. These results imply that YF vaccination is effective despite certain immunosuppressive drug regimens. An early-differentiated memory-like phenotype persisted, which is associated with effective expansion upon re-encounter with antigen, suggesting a potent memory T-cell pool remains. Copyright © 2016 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  3. Modulation of Immune Responses by Exosomes Derived from Antigen-Presenting Cells

    Directory of Open Access Journals (Sweden)

    Botros B. Shenoda

    2016-01-01

    Full Text Available Exosome-mediated signaling is important in mediating the inflammatory response. To exert their biological or pathophysiological functions in the recipient cells, exosomes deliver a diverse array of biomacromolecules including long and short coding and non-coding RNAs, proteins, and lipids. Exosomes secreted by antigen-presenting cells can confer therapeutic benefits by attenuating or stimulating the immune response. Exosomes play a crucial role in carrying and presenting functional major histocompatibility peptide complexes to modulate antigen-specific T cell responses. Exosomes from Dendritic Cells (DCs can activate T and B cells and have been explored for their immunostimulatory properties in cancer therapy. The immunosuppressive properties of exosomes derived from macrophages and DCs can reduce inflammation in animal models for several inflammatory disorders. This review focuses on the protective role of exosomes in attenuating inflammation or augmenting immune response, emphasizing studies on exosomes derived from DCs and macrophages.

  4. Multi-scale modeling of the CD8 immune response

    Energy Technology Data Exchange (ETDEWEB)

    Barbarroux, Loic, E-mail: loic.barbarroux@doctorant.ec-lyon.fr [Inria, Université de Lyon, UMR 5208, Institut Camille Jordan (France); Ecole Centrale de Lyon, 36 avenue Guy de Collongue, 69134 Ecully (France); Michel, Philippe, E-mail: philippe.michel@ec-lyon.fr [Inria, Université de Lyon, UMR 5208, Institut Camille Jordan (France); Ecole Centrale de Lyon, 36 avenue Guy de Collongue, 69134 Ecully (France); Adimy, Mostafa, E-mail: mostafa.adimy@inria.fr [Inria, Université de Lyon, UMR 5208, Université Lyon 1, Institut Camille Jordan, 43 Bd. du 11 novembre 1918, F-69200 Villeurbanne Cedex (France); Crauste, Fabien, E-mail: crauste@math.univ-lyon1.fr [Inria, Université de Lyon, UMR 5208, Université Lyon 1, Institut Camille Jordan, 43 Bd. du 11 novembre 1918, F-69200 Villeurbanne Cedex (France)

    2016-06-08

    During the primary CD8 T-Cell immune response to an intracellular pathogen, CD8 T-Cells undergo exponential proliferation and continuous differentiation, acquiring cytotoxic capabilities to address the infection and memorize the corresponding antigen. After cleaning the organism, the only CD8 T-Cells left are antigen-specific memory cells whose role is to respond stronger and faster in case they are presented this very same antigen again. That is how vaccines work: a small quantity of a weakened pathogen is introduced in the organism to trigger the primary response, generating corresponding memory cells in the process, giving the organism a way to defend himself in case it encounters the same pathogen again. To investigate this process, we propose a non linear, multi-scale mathematical model of the CD8 T-Cells immune response due to vaccination using a maturity structured partial differential equation. At the intracellular scale, the level of expression of key proteins is modeled by a delay differential equation system, which gives the speeds of maturation for each cell. The population of cells is modeled by a maturity structured equation whose speeds are given by the intracellular model. We focus here on building the model, as well as its asymptotic study. Finally, we display numerical simulations showing the model can reproduce the biological dynamics of the cell population for both the primary response and the secondary responses.

  5. Effect of Scoparia dulcis on noise stress induced adaptive immunity and cytokine response in immunized Wistar rats.

    Science.gov (United States)

    Sundareswaran, Loganathan; Srinivasan, Sakthivel; Wankhar, Wankupar; Sheeladevi, Rathinasamy

    Noise acts as a stressor and is reported to have impact on individual health depending on nature, type, intensity and perception. Modern medicine has no effective drugs or cure to prevent its consequences. Being an environmental stressor noise cannot be avoided; instead minimizing its exposure or consuming anti-stressor and adaptogens from plants can be considered. The present study was carried out to evaluate the anti-stressor, adaptogen and immunostimulatory activity of Scoparia dulcis against noise-induced stress in Wistar rat models. Noise stress in rats was created by broadband white noise generator, 100 dB A/4 h daily/15 days and S. dulcis (200 mg/kg b.w.) was administered orally. 8 groups of rats were used consisting of 6 animals each; 4 groups for unimmunized and 4 groups for immunized. For immunization, sheep red blood cells (5 × 10 9  cells/ml) were injected intraperitoneally. Sub-acute noise exposed rats showed a significant increase in corticosterone and IL-4 levels in both immunized and unimmunized rats whereas lymphocytes, antibody titration, soluble immune complex, IL-4 showed a marked increase with a significant decrease in IL-2, TNF-α, IFN-γ cytokines only in unimmunized rats. Immunized noise exposed rats presented increased leukocyte migration index and decreased foot pad thickness, IL-2, TNF-α, IFN-γ with no changes in the lymphocytes. S. dulcis (SD) has normalized and prevented the noise induced changes in cell-mediated and humoral immunity and it could be the presence of anti-stressor and immuno stimulant activity of the plant. Copyright © 2016 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Published by Elsevier B.V. All rights reserved.

  6. CAF01 potentiates immune responses and efficacy of an inactivated influenza vaccine in ferrets.

    Directory of Open Access Journals (Sweden)

    Cyril Jean-Marie Martel

    Full Text Available Trivalent inactivated vaccines (TIV against influenza are given to 350 million people every year. Most of these are non-adjuvanted vaccines whose immunogenicity and protective efficacy are considered suboptimal. Commercially available non-adjuvanted TIV are known to elicit mainly a humoral immune response, whereas the induction of cell-mediated immune responses is negligible. Recently, a cationic liposomal adjuvant (dimethyldioctadecylammonium/trehalose 6,6'-dibehenate, CAF01 was developed. CAF01 has proven to enhance both humoral and cell-mediated immune responses to a number of different experimental vaccine candidates. In this study, we compared the immune responses in ferrets to a commercially available TIV with the responses to the same vaccine mixed with the CAF01 adjuvant. Two recently circulating H1N1 viruses were used as challenge to test the vaccine efficacy. CAF01 improved the immunogenicity of the vaccine, with increased influenza-specific IgA and IgG levels. Additionally, CAF01 promoted cellular-mediated immunity as indicated by interferon-gamma expressing lymphocytes, measured by flow cytometry. CAF01 also enhanced the protection conferred by the vaccine by reducing the viral load measured in nasal washes by RT-PCR. Finally, CAF01 allowed for dose-reduction and led to higher levels of protection compared to TIV adjuvanted with a squalene emulsion. The data obtained in this human-relevant challenge model supports the potential of CAF01 in future influenza vaccines.

  7. Antigen modulation of the immune response. III. Evaluation of the hypothetical short-lived memory cell

    International Nuclear Information System (INIS)

    Feldbush, T.L.; Lande, I.; Bryan, B.; O'Neill, E.

    1974-01-01

    The putative short-lived memory cells, whose existence has been suggested by the results of secondary adoptive transfer experiments, were investigated. On the basis of the following evidences we have concluded that the short-lived memory cell is probably an artifact of the adoptive transfer technique: when immune thoracic duct lymphocytes, known to consist predominantly of long-lived memory cells, were transferred to irradiated recipients and challenged at various times after transfer, approximately 80 to 90 percent of the initial response was absent by Day 14 challenge; preirradiating adoptive recipients with increasing dose of x-irradiation tended to lengthen the observed half life of memory cells; single or multiple treatments of immune donors with 0.3 mg Vinblastin before transfer resulted in neither a depression of the initial secondary response nor an alteration in the rate of decline of the memory potential; reconstitution of irradiated hosts with normal spleen cells one day before transfer of memory cells and challenge resulted in inhibition of the adoptive secondary response; and the transfer of memory cells to antigen free intermediate hosts, in which they were allowed to reside for one day or fourteen days before transfer to irradiated recipients, resulted in only a slight decline in their capacity to respond. We propose that the rapid decline of memory potential in adoptive recipients challenged at various times after transfer is due to modulating effects by the hosts as it recovers from irradiation. These effects may be the result of cell crowding or the loss of irradiation-produced stimulatory factors. The relevance of these findings to adoptive transfer systems in general and the secondary response of intact animals is discussed

  8. The immune response of horses to tetanus toxoid.

    Science.gov (United States)

    Jansen, B C; Knoetze, P C

    1979-12-01

    An intramuscular injection of 8-16 Lf tetanus toxoid in water-in-oil emulsion protected adult horses against tetanus for at least 128 weeks. A booster dose of 8 Lf toxoid in aqueous solution protected them for a further period of at least 3 1/2 years. Colostral immunity protected foals for at least 10 weeks. An intramuscular injection of 8 Lf toxoid in water-in-oil emulsion given to foals from immune dams when they were 10-18 weeks old did not elicit any antibody response. They did respond, however, to a booster injection of 8 Lf toxoid in aqueous solution given 12 weeks after the first dose. New-born foals were shown to be inherently unable to respond to an injection of tetanus toxoid.

  9. The effect of local irradiation on the immune response in mice. I. Effect of sham-irradiation

    International Nuclear Information System (INIS)

    Gauci, C.L.; Gerber, M.; Dubois, J.-B.; Serrou, B.

    1979-01-01

    In C57BL/6 mice exposed to 1600 rads to the left foot pad, an important decrease of non-specific inflammatory responsiveness initiated by the injection of oyster glycogen into the peritoneal cavity was observed on the one hand and a diminution of the delayed hypersensitivity response following tuberculin injection, on the other hand. Nevertheless, the same immunosuppression was noted both in sham irradiated mice and in those receiving hydrocortisone. In irradiated mice this transient immunosuppression was related to a normal adrenal function. Bi-laterally adrenalectomised mice did not exhibit this reaction which reappeared after hydrocortisone administration. The reduction of delayed hypersensitivity is irrespective of the irradiated zone, but the duration of immune depression is longer in irradiated than in unirradiated tissue. During the depression of delayed hypersensitivity response an increase in the number of splenic B-lymphocytes and macrophages and a decrease of the number of splenic T-lymphocytes was observed these observations suggest that immunosuppression following irradiation is related to acute stress

  10. Autologous Stem Cell Transplantation Disrupts Adaptive Immune Responses during Rebound Simian/Human Immunodeficiency Virus Viremia.

    Science.gov (United States)

    Reeves, Daniel B; Peterson, Christopher W; Kiem, Hans-Peter; Schiffer, Joshua T

    2017-07-01

    Primary HIV-1 infection induces a virus-specific adaptive/cytolytic immune response that impacts the plasma viral load set point and the rate of progression to AIDS. Combination antiretroviral therapy (cART) suppresses plasma viremia to undetectable levels that rebound upon cART treatment interruption. Following cART withdrawal, the memory component of the virus-specific adaptive immune response may improve viral control compared to primary infection. Here, using primary infection and treatment interruption data from macaques infected with simian/human immunodeficiency virus (SHIV), we observe a lower peak viral load but an unchanged viral set point during viral rebound. The addition of an autologous stem cell transplant before cART withdrawal alters viral dynamics: we found a higher rebound set point but similar peak viral loads compared to the primary infection. Mathematical modeling of the data that accounts for fundamental immune parameters achieves excellent fit to heterogeneous viral loads. Analysis of model output suggests that the rapid memory immune response following treatment interruption does not ultimately lead to better viral containment. Transplantation decreases the durability of the adaptive immune response following cART withdrawal and viral rebound. Our model's results highlight the impact of the endogenous adaptive immune response during primary SHIV infection. Moreover, because we capture adaptive immune memory and the impact of transplantation, this model will provide insight into further studies of cure strategies inspired by the Berlin patient. IMPORTANCE HIV patients who interrupt combination antiretroviral therapy (cART) eventually experience viral rebound, the return of viral loads to pretreatment levels. However, the "Berlin patient" remained free of HIV rebound over a decade after stopping cART. His cure is attributed to leukemia treatment that included an HIV-resistant stem cell transplant. Inspired by this case, we studied the impact

  11. Characterization of humoral and cellular immune responses in patients with human papilloma virus

    International Nuclear Information System (INIS)

    Clares Pochet, Maria del Carmen; Ferrer Cosme, Belkis Maria; Dominguez Cardosa, Magda

    2012-01-01

    A descriptive and cross-sectional study was carried out in 30 females infected with the human papilloma virus, attended in the office of Immunology of the Specialty Polyclinic belonging to 'Saturnino Lora' Provincial Clinical Surgical Teaching Hospital in Santiago de Cuba, from June 2009 to June 2010, in order to characterize them according to immune response. To evaluate the humoral and cellular immune response rosetting assay and quantification of immunoglobulins were used respectively. Women between 25-36 years of age (40 %) infected with this virus, especially those coming from urban areas, prevailed in the series, and a significant decrease of the cellular response as compared to the humoral response was evidenced

  12. Interferon-Mediated Innate Immune Responses against Malaria Parasite Liver Stages

    Directory of Open Access Journals (Sweden)

    Jessica L. Miller

    2014-04-01

    Full Text Available Mosquito-transmitted malaria parasites infect hepatocytes and asymptomatically replicate as liver stages. Using RNA sequencing, we show that a rodent malaria liver-stage infection stimulates a robust innate immune response including type I interferon (IFN and IFNγ pathways. Liver-stage infection is suppressed by these infection-engendered innate responses. This suppression was abrogated in mice deficient in IFNγ, the type I IFN α/β receptor (IFNAR, and interferon regulatory factor 3. Natural killer and CD49b+CD3+ natural killer T (NKT cells increased in the liver after a primary infection, and CD1d-restricted NKT cells, which secrete IFNγ, were critical in reducing liver-stage burden of a secondary infection. Lack of IFNAR signaling abrogated the increase in NKT cell numbers in the liver, showing a link between type I IFN signaling, cell recruitment, and subsequent parasite elimination. Our findings demonstrate innate immune sensing of malaria parasite liver-stage infection and that the ensuing innate responses can eliminate the parasite.

  13. Human metapneumovirus M2-2 protein inhibits innate immune response in monocyte-derived dendritic cells.

    Directory of Open Access Journals (Sweden)

    Junping Ren

    Full Text Available Human metapneumovirus (hMPV is a leading cause of lower respiratory infection in young children, the elderly and immunocompromised patients. Repeated hMPV infections occur throughout life. However, immune evasion mechanisms of hMPV infection are largely unknown. Recently, our group has demonstrated that hMPV M2-2 protein, an important virulence factor, contributes to immune evasion in airway epithelial cells by targeting the mitochondrial antiviral-signaling protein (MAVS. Whether M2-2 regulates the innate immunity in human dendritic cells (DC, an important family of immune cells controlling antigen presenting, is currently unknown. We found that human DC infected with a virus lacking M2-2 protein expression (rhMPV-ΔM2-2 produced higher levels of cytokines, chemokines and IFNs, compared to cells infected with wild-type virus (rhMPV-WT, suggesting that M2-2 protein inhibits innate immunity in human DC. In parallel, we found that myeloid differentiation primary response gene 88 (MyD88, an essential adaptor for Toll-like receptors (TLRs, plays a critical role in inducing immune response of human DC, as downregulation of MyD88 by siRNA blocked the induction of immune regulatory molecules by hMPV. Since M2-2 is a cytoplasmic protein, we investigated whether M2-2 interferes with MyD88-mediated antiviral signaling. We found that indeed M2-2 protein associated with MyD88 and inhibited MyD88-dependent gene transcription. In this study, we also identified the domains of M2-2 responsible for its immune inhibitory function in human DC. In summary, our results demonstrate that M2-2 contributes to hMPV immune evasion by inhibiting MyD88-dependent cellular responses in human DC.

  14. Salmonella Typhimurium type III secretion effectors stimulate innate immune responses in cultured epithelial cells.

    Directory of Open Access Journals (Sweden)

    Vincent M Bruno

    2009-08-01

    Full Text Available Recognition of conserved bacterial products by innate immune receptors leads to inflammatory responses that control pathogen spread but that can also result in pathology. Intestinal epithelial cells are exposed to bacterial products and therefore must prevent signaling through innate immune receptors to avoid pathology. However, enteric pathogens are able to stimulate intestinal inflammation. We show here that the enteric pathogen Salmonella Typhimurium can stimulate innate immune responses in cultured epithelial cells by mechanisms that do not involve receptors of the innate immune system. Instead, S. Typhimurium stimulates these responses by delivering through its type III secretion system the bacterial effector proteins SopE, SopE2, and SopB, which in a redundant fashion stimulate Rho-family GTPases leading to the activation of mitogen-activated protein (MAP kinase and NF-kappaB signaling. These observations have implications for the understanding of the mechanisms by which Salmonella Typhimurium induces intestinal inflammation as well as other intestinal inflammatory pathologies.

  15. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

    Science.gov (United States)

    Ruiz, Lorena; Espinosa-Martos, Irene; García-Carral, Cristina; Manzano, Susana; McGuire, Michelle K.; Meehan, Courtney L.; McGuire, Mark A.; Williams, Janet E.; Foster, James; Sellen, Daniel W.; Kamau-Mbuthia, Elizabeth W.; Kamundia, Egidioh W.; Mbugua, Samwel; Moore, Sophie E.; Kvist, Linda J.; Otoo, Gloria E.; Lackey, Kimberly A.; Flores, Katherine; Pareja, Rossina G.; Bode, Lars; Rodríguez, Juan M.

    2017-01-01

    Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα), acquired immunity factors (IL2, IL4, IL10, IL13, IL17), chemokines (IL8, Groα, MCP1, MIP1β), growth factors [IL5, IL7, epidermal growth factor (EGF), granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM), in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not) common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid. Clinical Trial Registration: www.ClinicalTrials.gov, identifier NCT02670278. PMID:28713365

  16. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

    Directory of Open Access Journals (Sweden)

    Lorena Ruiz

    2017-06-01

    Full Text Available Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα, acquired immunity factors (IL2, IL4, IL10, IL13, IL17, chemokines (IL8, Groα, MCP1, MIP1β, growth factors [IL5, IL7, epidermal growth factor (EGF, granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM, in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid.Clinical Trial Registration:www.ClinicalTrials.gov, identifier NCT02670278.

  17. Nubbin isoform antagonism governs Drosophila intestinal immune homeostasis.

    Directory of Open Access Journals (Sweden)

    Bo G Lindberg

    2018-03-01

    Full Text Available Gut immunity is regulated by intricate and dynamic mechanisms to ensure homeostasis despite a constantly changing microbial environment. Several regulatory factors have been described to participate in feedback responses to prevent aberrant immune activity. Little is, however, known about how transcriptional programs are directly tuned to efficiently adapt host gut tissues to the current microbiome. Here we show that the POU/Oct gene nubbin (nub encodes two transcription factor isoforms, Nub-PB and Nub-PD, which antagonistically regulate immune gene expression in Drosophila. Global transcriptional profiling of adult flies overexpressing Nub-PB in immunocompetent tissues revealed that this form is a strong transcriptional activator of a large set of immune genes. Further genetic analyses showed that Nub-PB is sufficient to drive expression both independently and in conjunction with nuclear factor kappa B (NF-κB, JNK and JAK/STAT pathways. Similar overexpression of Nub-PD did, conversely, repress expression of the same targets. Strikingly, isoform co-overexpression normalized immune gene transcription, suggesting antagonistic activities. RNAi-mediated knockdown of individual nub transcripts in enterocytes confirmed antagonistic regulation by the two isoforms and that both are necessary for normal immune gene transcription in the midgut. Furthermore, enterocyte-specific Nub-PB expression levels had a strong impact on gut bacterial load as well as host lifespan. Overexpression of Nub-PB enhanced bacterial clearance of ingested Erwinia carotovora carotovora 15. Nevertheless, flies quickly succumbed to the infection, suggesting a deleterious immune response. In line with this, prolonged overexpression promoted a proinflammatory signature in the gut with induction of JNK and JAK/STAT pathways, increased apoptosis and stem cell proliferation. These findings highlight a novel regulatory mechanism of host-microbe interactions mediated by antagonistic

  18. Immune-Mediated Damage Completes the Parabola: Cryptococcus neoformans Pathogenesis Can Reflect the Outcome of a Weak or Strong Immune Response

    Directory of Open Access Journals (Sweden)

    Liise-anne Pirofski

    2017-12-01

    Full Text Available Cryptococcosis occurs most frequently in immunocompromised individuals. This has led to the prevailing view that this disease is the result of weak immune responses that cannot control the fungus. However, increasingly, clinical and experimental studies have revealed that the host immune response can contribute to cryptococcal pathogenesis, including the recent study of L. M. Neal et al. (mBio 8:e01415-17, 2017, https://doi.org/10.1128/mBio.01415-17 that reports that CD4+ T cells mediate tissue damage in experimental murine cryptococcosis. This finding has fundamental implications for our understanding of the pathogenesis of cryptococcal disease; it helps explain why immunotherapy has been largely unsuccessful in treatment and provides insight into the paradoxical observation that HIV-associated cryptococcosis may have a better prognosis than cryptococcosis in those with no known immune impairment. The demonstration that host-mediated damage can drive cryptococcal disease provides proof of concept that the parabola put forth in the damage-response framework has the flexibility to depict complex and changing outcomes of host-microbe interaction.

  19. NLRC5: a key regulator of MHC class I-dependent immune responses.

    Science.gov (United States)

    Kobayashi, Koichi S; van den Elsen, Peter J

    2012-12-01

    The expression of MHC class I molecules is crucial for the initiation and regulation of adaptive immune responses against pathogens. NOD-, LRR- and CARD-containing 5 (NLRC5) was recently identified as a specific transactivator of MHC class I genes (CITA). NLRC5 and the master regulator for MHC class II genes, class II transactivator (CIITA), interact with similar MHC promoter-bound factors. Here, we provide a broad overview of the molecular mechanisms behind MHC class I transcription and the role of the class I transactivator NLRC5 in MHC class I-dependent immune responses.

  20. Immune response of patients with recurrent aphthous stomatitis challenged with a symbiotic.

    Science.gov (United States)

    Mimura, Maria Angela Martins; Borra, Ricardo Carneiro; Hirata, Cleonice Hitomi Watashi; de Oliveira Penido, Norma

    2017-10-01

    There are indications that Th1 polarization of immune response plays an important role in the pathogenesis of recurrent aphthous stomatitis (RAS), and that the use of probiotics can stimulate immune regulatory activity, influencing the course of the disease. The aim of this study was to characterize the initial immune profile of RAS patients and evaluate clinical and serological response following a challenge with symbiotic treatment containing fructooligosaccharide, Lactobacillus, and Bifidobacterium. The immune responses of the 45 patients with RAS, submitted to symbiotic or placebo for 120 days, in relation to 30 RAS-free controls, were evaluated over a period of 6 months. Peripheral blood was collected from all patients at 0 (T0), 120 (T4), and 180 days (T6) after the start of treatment and Th1 (IL12-p70, IFN-γ), Th2 (IL-4), Treg (IL-10), Th17 (IL-17A), inflammatory (TNF-α, IL-6)-associated cytokines, and clinical parameters were quantified. At T0, significant differences were found in the serological levels of the IFN-γ, IL-4, and IL-6 cytokines of the RAS patients in comparison with the controls. It was observed that the cytokine profile of the RAS group was comprised of 2 distinct clusters: a pure Th2 and a Mixed (Th1/Th2) subtype and that symbiotic treatment induced an improvement in pain and an increase in IFN-γ levels, producing a reduction in Th2 response. In RAS, symbiotic treatment based on a fructooligosaccharide, Lactobacillus, and Bifidobacterium composition produced an alteration in the Th2 serological immune profile in the direction of Th1 and improved pain symptomatology. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Sculpting humoral immunity through dengue vaccination to enhance protective immunity

    Directory of Open Access Journals (Sweden)

    Wayne eCrill

    2012-11-01

    Full Text Available Dengue viruses (DENV are the most important mosquito transmitted viral pathogens infecting humans. DENV infection produces a spectrum of disease, most commonly causing a self-limiting flu-like illness known as dengue fever; yet with increased frequency, manifesting as life-threatening dengue hemorrhagic fever (DHF. Waning cross-protective immunity from any of the four dengue serotypes may enhance subsequent infection with another heterologous serotype to increase the probability of DHF. Decades of effort to develop dengue vaccines are reaching the finishing line with multiple candidates in clinical trials. Nevertheless, concerns remain that imbalanced immunity, due to the prolonged prime-boost schedules currently used in clinical trials, could leave some vaccinees temporarily unprotected or with increased susceptibility to enhanced disease. Here we develop a DENV serotype 1 (DENV-1 DNA vaccine with the immunodominant cross-reactive B cell epitopes associated with immune enhancement removed. We compare wild-type (WT with this cross-reactivity reduced (CRR vaccine and demonstrate that both vaccines are equally protective against lethal homologous DENV-1 challenge. Under conditions mimicking natural exposure prior to acquiring protective immunity, WT vaccinated mice enhanced a normally sub-lethal heterologous DENV-2 infection resulting in DHF-like disease and 95% mortality in AG129 mice. However, CRR vaccinated mice exhibited redirected serotype-specific and protective immunity, and significantly reduced morbidity and mortality not differing from naïve mice. Thus, we demonstrate in an in vivo DENV disease model, that non-protective vaccine-induced immunity can prime vaccinees for enhanced DHF-like disease and that CRR DNA immunization significantly reduces this potential vaccine safety concern. The sculpting of immune memory by the modified vaccine and resulting redirection of humoral immunity provide insight into DENV vaccine induced immune

  2. IL-10 polymorphism and cell-mediated immune response to Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Öhman, H.; Tiitinen, A; Halttunen, M.

    2006-01-01

    Chlamydia trachomatis infection induces an inflammatory response that is crucial in resolving acute infection but may also play a key role in the pathogenesis of C trachomatis associated infertility. The immune response is linked to cytokine secretion pattern which is influenced by the host genetic...

  3. Engineering intranasal mRNA vaccines to enhance lymph node trafficking and immune responses.

    Science.gov (United States)

    Li, Man; Li, You; Peng, Ke; Wang, Ying; Gong, Tao; Zhang, Zhirong; He, Qin; Sun, Xun

    2017-12-01

    Intranasal mRNA vaccination provides immediate immune protection against pandemic diseases. Recent studies have shown that diverse forms of polyethyleneimine (PEI) have potent mucosal adjuvant activity, which could significantly facilitate the delivery of intranasal mRNA vaccines. Nevertheless, optimizing the chemical structure of PEI to maximize its adjuvanticity and decrease its toxicity remains a challenge. Here we show that the chemical structure of PEI strongly influences how well nanocomplexes of PEI and mRNA migrate to the lymph nodes and elicit immune responses. Conjugating cyclodextrin (CD) with PEI600 or PEI2k yielded CP (CD-PEI) polymers with different CD/PEI ratios. We analyzed the delivery efficacy of CP600, CP2k, and PEI25k as intranasal mRNA vaccine carriers by evaluating the lymph nodes migration and immune responses. Among these polymers, CP2k/mRNA showed significantly higher in vitro transfection efficiency, stronger abilities to migrate to lymph nodes and stimulate dendritic cells maturation in vivo, which further led to potent humoral and cellular immune responses, and showed lower local and systemic toxicity than PEI25k/mRNA. These results demonstrate the potential of CD-PEI2k/mRNA nanocomplex as a self-adjuvanting vaccine delivery vehicle that traffics to lymph nodes with high efficiency. As we face outbreaks of pandemic diseases such as Zika virus, intranasal mRNA vaccination provides instant massive protection against highly variant viruses. Various polymer-based delivery systems have been successfully applied in intranasal vaccine delivery. However, the influence of molecular structure of the polymeric carriers on the lymph node trafficking and dendritic cell maturation is seldom studied for intranasal vaccination. Therefore, engineering polymer-based vaccine delivery system and elucidating the relationship between molecular structure and the intranasal delivery efficiency are essential for maximizing the immune responses. We hereby

  4. Mucosal immunization using proteoliposome and cochleate structures from Neisseria meningitidis serogroup B induce mucosal and systemic responses.

    Science.gov (United States)

    Campo, Judith Del; Zayas, Caridad; Romeu, Belkis; Acevedo, Reinaldo; González, Elizabeth; Bracho, Gustavo; Cuello, Maribel; Cabrera, Osmir; Balboa, Julio; Lastre, Miriam

    2009-12-01

    Most pathogens either invade the body or establish infection in mucosal tissues and represent an enormous challenge for vaccine development by the absence of good mucosal adjuvants. A proteoliposome-derived adjuvant from Neisseria meningitidis serogroup B (AFPL1, Adjuvant Finlay Proteoliposome 1) and its derived cochleate form (Co, AFCo1) contain multiple pathogen-associated molecular patterns as immunopotentiators, and can also serve as delivery systems to elicit a Th1-type immune response. The present studies demonstrate the ability of AFPL1and AFCo1 to induce mucosal and systemic immune responses by different mucosal immunizations routes and significant adjuvant activity for antibody responses of both structures: a microparticle and a nanoparticle with a heterologous antigen. Therefore, we used female mice immunized by intragastric, intravaginal, intranasal or intramuscular routes with both structures alone or incorporated with ovalbumin (OVA). High levels of specific IgG antibody were detected in all sera and in vaginal washes, but specific IgA antibody in external secretions was only detected in mucosally immunized mice. Furthermore, antigen specific IgG1 and IgG2a isotypes were all induced. AFPL1 and AFCo1 are capable of inducing IFN-gamma responses, and chemokine secretions, like MIP-1alpha and MIP-1beta. However, AFCo1 is a better alternative to induce immune responses at mucosal level. Even when we use a heterologous antigen, the AFCo1 response was better than with AFPL1 in inducing mucosal and systemic immune responses. These results support the use of AFCo1 as a potent Th1 inducing adjuvant particularly suitable for mucosal immunization.

  5. Transcriptomic Study on Ovine Immune Responses to Fasciola hepatica Infection.

    Directory of Open Access Journals (Sweden)

    Yan Fu

    2016-09-01

    Full Text Available Fasciola hepatica is not only responsible for major economic losses in livestock farming, but is also a major food-borne zoonotic agent, with 180 million people being at risk of infection worldwide. This parasite is sophisticated in manipulating the hosts' immune system to benefit its own survival. A better understanding of the mechanisms underpinning this immunomodulation is crucial for the development of control strategies such as vaccines.This in vivo study investigated the global gene expression changes of ovine peripheral blood mononuclear cells (PBMC response to both acute & chronic infection of F. hepatica, and revealed 6490 and 2364 differential expressed genes (DEGS, respectively. Several transcriptional regulators were predicted to be significantly inhibited (e.g. IL12 and IL18 or activated (e.g. miR155-5p in PBMC during infection. Ingenuity Pathway Analysis highlighted a series of immune-associated pathways involved in the response to infection, including 'Transforming Growth Factor Beta (TGFβ signaling', 'Production of Nitric Oxide in Macrophages', 'Toll-like Receptor (TLRs Signaling', 'Death Receptor Signaling' and 'IL17 Signaling'. We hypothesize that activation of pathways relevant to fibrosis in ovine chronic infection, may differ from those seen in cattle. Potential mechanisms behind immunomodulation in F. hepatica infection are a discussed.In conclusion, the present study performed global transcriptomic analysis of ovine PBMC, the primary innate/adaptive immune cells, in response to infection with F. hepatica, using deep-sequencing (RNAseq. This dataset provides novel information pertinent to understanding of the pathological processes in fasciolosis, as well as a base from which to further refine development of vaccines.

  6. Exercise and the Regulation of Immune Functions.

    Science.gov (United States)

    Simpson, Richard J; Kunz, Hawley; Agha, Nadia; Graff, Rachel

    2015-01-01

    Exercise has a profound effect on the normal functioning of the immune system. It is generally accepted that prolonged periods of intensive exercise training can depress immunity, while regular moderate intensity exercise is beneficial. Single bouts of exercise evoke a striking leukocytosis and a redistribution of effector cells between the blood compartment and the lymphoid and peripheral tissues, a response that is mediated by increased hemodynamics and the release of catecholamines and glucocorticoids following the activation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis. Single bouts of prolonged exercise may impair T-cell, NK-cell, and neutrophil function, alter the Type I and Type II cytokine balance, and blunt immune responses to primary and recall antigens in vivo. Elite athletes frequently report symptoms associated with upper respiratory tract infections (URTI) during periods of heavy training and competition that may be due to alterations in mucosal immunity, particularly reductions in secretory immunoglobulin A. In contrast, single bouts of moderate intensity exercise are "immuno-enhancing" and have been used to effectively increase vaccine responses in "at-risk" patients. Improvements in immunity due to regular exercise of moderate intensity may be due to reductions in inflammation, maintenance of thymic mass, alterations in the composition of "older" and "younger" immune cells, enhanced immunosurveillance, and/or the amelioration of psychological stress. Indeed, exercise is a powerful behavioral intervention that has the potential to improve immune and health outcomes in the elderly, the obese, and patients living with cancer and chronic viral infections such as HIV. © 2015 Elsevier Inc. All rights reserved.

  7. Maximizing Tumor Immunity With Fractionated Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Schaue, Doerthe, E-mail: dschaue@mednet.ucla.edu [Department of Radiation Oncology, David Geffen School of Medicine at UCLA, Los Angeles, CA (United States); Ratikan, Josephine A.; Iwamoto, Keisuke S.; McBride, William H. [Department of Radiation Oncology, David Geffen School of Medicine at UCLA, Los Angeles, CA (United States)

    2012-07-15

    Purpose: Technologic advances have led to increased clinical use of higher-sized fractions of radiation dose and higher total doses. How these modify the pathways involved in tumor cell death, normal tissue response, and signaling to the immune system has been inadequately explored. Here we ask how radiation dose and fraction size affect antitumor immunity, the suppression thereof, and how this might relate to tumor control. Methods and Materials: Mice bearing B16-OVA murine melanoma were treated with up to 15 Gy radiation given in various-size fractions, and tumor growth followed. The tumor-specific immune response in the spleen was assessed by interferon-{gamma} enzyme-linked immunospot (ELISPOT) assay with ovalbumin (OVA) as the surrogate tumor antigen and the contribution of regulatory T cells (Tregs) determined by the proportion of CD4{sup +}CD25{sup hi}Foxp3{sup +} T cells. Results: After single doses, tumor control increased with the size of radiation dose, as did the number of tumor-reactive T cells. This was offset at the highest dose by an increase in Treg representation. Fractionated treatment with medium-size radiation doses of 7.5 Gy/fraction gave the best tumor control and tumor immunity while maintaining low Treg numbers. Conclusions: Radiation can be an immune adjuvant, but the response varies with the size of dose per fraction. The ultimate challenge is to optimally integrate cancer immunotherapy into radiation therapy.

  8. Exposure to low infective doses of HCV induces cellular immune responses without consistently detectable viremia or seroconversion in chimpanzees

    International Nuclear Information System (INIS)

    Shata, Mohamed Tarek; Tricoche, Nancy; Perkus, Marion; Tom, Darley; Brotman, Betsy; McCormack, Patricia; Pfahler, Wolfram; Lee, Dong-Hun; Tobler, Leslie H.; Busch, Michael; Prince, Alfred M.

    2003-01-01

    In hepatitis C virus (HCV) infection, there is accumulating data suggesting the presence of cellular immune responses to HCV in exposed but seemingly uninfected populations. Some studies have suggested cross-reactive antigens rather than prior HCV exposure as the main reason for the immune responses. In this study we address this question by analyzing the immune response of chimpanzees that have been sequentially exposed to increasing doses of HCV virions. The level of viremia, as well as the immune responses to HCV at different times after virus inoculation, were examined. Our data indicate that HCV infective doses as low as 1-10 RNA (+) virions induce detectable cellular immune responses in chimpanzees without consistently detectable viremia or persistent seroconversion. However, increasing the infective doses of HCV to 100 RNA (+) virions overcame the low-inoculum-induced immune response and produced high-level viremia followed by seroconversion

  9. Sex-specific consequences of an induced immune response on reproduction in a moth

    NARCIS (Netherlands)

    Barthel, A.; Staudacher, H.; Schmalz, A.; Heckel, D.G.; Groot, A.T.

    2015-01-01

    Background Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life

  10. Specific gene expression responses to parasite genotypes reveal redundancy of innate immunity in vertebrates.

    Directory of Open Access Journals (Sweden)

    David Haase

    Full Text Available Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus. By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes.

  11. Giardiasis in mice: analysis of humoral and cellular immune responses to Giardia muris.

    Science.gov (United States)

    Anders, R F; Roberts-Thomson, I C; Mitchell, G F

    1982-01-01

    Humoral and cellular immune responses have been evaluated in two inbred strains of mice which differ markedly in their susceptibility to infection with Giardia muris. Serum IgG and IgA antibody levels and IgA levels in intestinal washes were determined by a solid-phase radioimmunoassay using G. muris antigen prepared by sonication of trophozoites, while cell-mediated immunity was assessed by a radiometric ear-assay for delayed-type hypersensitivity. Following infection of BALB/c mice (resistant) and C3H/He mice (susceptible), the IgG and IgA antibody levels in serum progressively increased over the period of study with C3H/He mice having significantly higher titres of IgA antibodies than BALB/c late in the infection. Systemic immunization with G. muris trophozoites resulted in high titres of IgG antibodies in the serum. IgA antibodies were detected in intestinal washes 2 weeks after infection with a subsequent fall in levels in BALB/c mice but a progressive increase levels in C3H/He mice. Prior immunization resulted in IgA antibodies being detected earlier in the intestinal washings after a challenge infection. Delayed-type hypersensitivity to G. muris antigens could not be detected during an infection but a positive response was elicited following antigen priming in mice pretreated with cyclophosphamide. The immune responses evaluated in this study were assessed using a whole G. muris trophozoite sonicate and variations in the quantitative aspects of the responses did not account for observed differences in the course of infection in the two strains of mice.

  12. The Unfolded Protein Response in Homeostasis and Modulation of Mammalian Immune Cells.

    Science.gov (United States)

    Martins, Ana Sofia; Alves, Inês; Helguero, Luisa; Domingues, Maria Rosário; Neves, Bruno Miguel

    2016-11-01

    The endoplasmic reticulum (ER) plays important roles in eukaryotic protein folding and lipid biosynthesis. Several exogenous and endogenous cellular sources of stress can perturb ER homeostasis leading to the accumulation of unfolded proteins in the lumen. Unfolded protein accumulation triggers a signal-transduction cascade known as the unfolded protein response (UPR), an adaptive mechanism which aims to protect cells from protein aggregates and to restore ER functions. Further to this protective mechanism, in immune cells, UPR molecular effectors have been shown to participate in a wide range of biological processes such as cell differentiation, survival and immunoglobulin and cytokine production. Recent findings also highlight the involvement of the UPR machinery in the maturational program and antigen presentation capacities of dendritic cells. UPR is therefore a key element in immune system homeostasis with direct implications on both adaptive and innate immune responses. The present review summarizes the knowledge on the emerging roles of UPR signaling cascades in mammalian immune cells as well as the consequences of their dysregulation in relation to the pathogenesis of several diseases.

  13. Position statement. Part one: Immune function and exercise

    DEFF Research Database (Denmark)

    Walsh, Neil P; Gleeson, Michael; Shephard, Roy J

    2011-01-01

    responses and falls in stimulated B cell Ig synthesis. The cause of this apparent depression in acquired immunity appears to be related to elevated circulating stress hormones, and alterations in the pro/anti-inflammatory cytokine balance in response to exercise. The clinical significance of these changes...... and immediately after exercise, proportional to exercise intensity and duration, with numbers of cells (T cells and to a lesser extent B cells) falling below pre-exercise levels during the early stages of recovery, before returning to resting values normally within 24 h. Mobilization of T and B cell subsets...... risk of URTI during heavy training. An important question for exercise immunologists remains: how does one measure immune function in a meaningful way? One approach to assessing immune function that extends beyond blood or salivary measures involves challenging study participants with antigenic stimuli...

  14. Immunization with Tc52 or its amino terminal domain adjuvanted with c-di-AMP induces Th17+Th1 specific immune responses and confers protection against Trypanosoma cruzi.

    Directory of Open Access Journals (Sweden)

    Marina N Matos

    2017-02-01

    Full Text Available The development of new adjuvants enables fine modulation of the elicited immune responses. Ideally, the use of one or more adjuvants should result in the induction of a protective immune response against the specific pathogen. We have evaluated the immune response and protection against Trypanosoma cruzi infection in mice vaccinated with recombinant Tc52 or its N- and C-terminal domains (NTc52 and CTc52 adjuvanted either with the STING (Stimulator of Interferon Genes agonist cyclic di-AMP (c-di-AMP, a pegylated derivative of α-galactosylceramide (αGC-PEG, or oligodeoxynucleotides containing unmethylated CpG motifs (ODN-CpG. All groups immunized with the recombinant proteins plus adjuvant: Tc52+c-di-AMP, NTc52+c-di-AMP, CTc52+c-di-AMP, NTc52+c-di-AMP+αGC-PEG, NTc52+CpG, developed significantly higher anti-Tc52 IgG titers than controls. Groups immunized with c-di-AMP and Tc52, NTc52 or CTc52 showed the highest Tc52-specific IgA titers in nasal lavages. All groups immunized with the recombinant proteins plus adjuvant developed a strong specific cellular immune response in splenocytes and lymph node cells with significant differences for groups immunized with c-di-AMP and Tc52, NTc52 or CTc52. These groups also showed high levels of Tc52-specific IL-17 and IFN-γ producing cells, while NTc52+CpG group only showed significant difference with control in IFN-γ producing cells. Groups immunized with c-di-AMP and Tc52, NTc52 or CTc52 developed predominantly a Th17 and Th1immune response, whereas for NTc52+CpG it was a dominant Th1 response. It was previously described that αGC-PEG inhibits Th17 differentiation by activating NKT cells. Thus, in this work we have also included a group immunized with both adjuvants (NTc52+c-di-AMP+αGC-PEG with the aim to modulate the Th17 response induced by c-di-AMP. This group showed a significant reduction in the number of Tc52-specific IL-17 producing splenocytes, as compared to the group NTc52+c-di-AMP, which has

  15. Humoral and cellular immune responses to modified hepatitis B ...

    African Journals Online (AJOL)

    These findings indicate that the vaccine induced both a humoral and cellular ... Keywords: Hepatitis B virus, Plasmid DNA, Vaccine, Spleen cytokines, Humoral and cellular immune responses ... produced in mice. ... were performed and HBsAg specific IgM and IgG ..... and protection elicited against Plasmodium berghei.

  16. Transfer of immunity by transfer of bone marrow cells: T-cell dependency

    International Nuclear Information System (INIS)

    Marusic, M.

    1978-01-01

    Thymectomized, lethally irradiated mice reconstituted with normal bone marrow cells succumbed when challenged ip with rat Yoshida ascites sarcoma (YAS) cells 40 days after irradiation and reconstitution. In contrast, thymectomized irradiated mice reconstituted with bone marrow cells from YAS-immune donors rejected the subsequent tumor challenge. Pretreatment of the bone marrow cells from immune donors with anti-Thy 1.2 antiserum and complement completely abolished the transfer of anti-YAS resistance. Bone marrow cells from donors thymectomized 2 months before immunization enabled almost all recipients to reject YAS, but bone marrow cells from donors thymectomized 8 months before immunization protected only 50 percent of the recipients. Further analysis showed that mice thymectomized 8 months before immunization failed to generate anti-YAS antibody response, whereas the antibody response of mice thymectomized 2 months before immunization did not differ from that of non-thymectomized age-matched control mice. The data suggest that the immune reaction of mice against xenogeneic YAS requires long-lived T 2 lymphocytes

  17. Anamnestic immune response to dengue and decreased severity of yellow fever

    Directory of Open Access Journals (Sweden)

    Ricardo O Izurieta

    2009-01-01

    Full Text Available A protective immunity against yellow fever, from cross-reactive dengue antibodies, has been hypothesized as an explanation for the absence of yellow fever in Southern Asia where dengue immunity is almost universal. This study evaluates the association between protective immunity from cross-reactive dengue antibodies with yellow fever infection and severity of the disease. The study population consisted of military personnel of a jungle garrison and its detachments located in the Ecuadorian Amazonian rainforest. The cross-sectional study employed interviews as well as seroepidemiological methods. Humoral immune response to yellow fever, Mayaro, Venezuelan equine encephalitis, Oropouche, and dengue 2 infections was assessed by evaluating IgM and IgG specific antibodies. Log-linear regression analysis was used to evaluate age and presence of antibodies, against dengue type 2 virus, as predictors of yellow fever infection or severe disease. During the seroepidemiological survey, presence of dengue antibodies among yellow fever cases were observed in 77.3% cases from the coastal region, where dengue is endemic, 14.3% cases from the Amazon and 16.7 % cases from the Andean region. Dengue cross-reactive antibodies were not significantly associated with yellow fever infection but significantly associated with severity of the disease. The findings of this study suggest that previous exposure to dengue infection may have induced an anamnestic immune response that did not prevent yellow fever infection but greatly reduced the severity of the disease.

  18. Population-expression models of immune response

    International Nuclear Information System (INIS)

    Stromberg, Sean P; Antia, Rustom; Nemenman, Ilya

    2013-01-01

    The immune response to a pathogen has two basic features. The first is the expansion of a few pathogen-specific cells to form a population large enough to control the pathogen. The second is the process of differentiation of cells from an initial naive phenotype to an effector phenotype which controls the pathogen, and subsequently to a memory phenotype that is maintained and responsible for long-term protection. The expansion and the differentiation have been considered largely independently. Changes in cell populations are typically described using ecologically based ordinary differential equation models. In contrast, differentiation of single cells is studied within systems biology and is frequently modeled by considering changes in gene and protein expression in individual cells. Recent advances in experimental systems biology make available for the first time data to allow the coupling of population and high dimensional expression data of immune cells during infections. Here we describe and develop population-expression models which integrate these two processes into systems biology on the multicellular level. When translated into mathematical equations, these models result in non-conservative, non-local advection-diffusion equations. We describe situations where the population-expression approach can make correct inference from data while previous modeling approaches based on common simplifying assumptions would fail. We also explore how model reduction techniques can be used to build population-expression models, minimizing the complexity of the model while keeping the essential features of the system. While we consider problems in immunology in this paper, we expect population-expression models to be more broadly applicable. (paper)

  19. RhIL-11 treatment normalized Th1/Th2 and T-bet/GATA-3 imbalance in in human immune thrombocytopenic purpura (ITP).

    Science.gov (United States)

    Lin, Ying; Zhou, Xieming; Guo, Wenjian; Li, Qianqian; Pan, Xiahui; Bao, Yunhua; He, Muqing; Zhu, Baoling; Lin, Xiaoji; Jin, Limin; Yao, Rongxin

    2016-09-01

    Immune thrombocytopenia (ITP) is an autoimmune hemorrhagic disorder characterized by reduction in platelet counts. T helper 1 (Th1) cells polarization with an increased shift of Th1/Th2 ratio has been reported in ITP. This shift is associated with transcription factor T-box expressed in T cells (T-bet) upregulation and GATA-binding protein 3 (GATA-3) downregulation, leading to an increased T-bet/GATA-3 ratio. Our previous in vitro study showed that recombinant human interleukin-11 (rhIL-11) could normalize Th1/Th2 imbalance in the peripheral blood mononuclear cells (PBMCs) isolated from adult ITP patients, which co-occurred with T-bet/GATA-3 ratio restoration. In this report, we investigated whether rhIL-11 had therapeutic effect in clinical ITP patients and whether rhIL-11 treatment could normalize Th1/Th2 and T-bet/GATA-3 levels in vivo. We found rhIL-11 treatment had a response rate of 67.7% and significantly decreased Th1 and T-bet levels but increased Th2 and GATA-3 levels in ITP patients who showed good response, normalizing Th1/Th2 and T-bet/GATA-3 ratios similar to that in healthy controls. Thus our study suggested rhIL-11 was effective with tolerable adverse effects in ITP. The treatment strategy warrants further clinical investigation. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Oral antibiotics enhance antibody responses to keyhole limpet hemocyanin in orally but not muscularly immunized chickens.

    Science.gov (United States)

    Murai, Atsushi; Kitahara, Kazuki; Okumura, Shouta; Kobayashi, Misato; Horio, Fumihiko

    2016-02-01

    Recent studies have emphasized the crucial role of gut microbiota in triggering and modulating immune response. We aimed to determine whether the modification of gut microbiota by oral co-administration of two antibiotics, ampicillin and neomycin, would lead to changes in the antibody response to antigens in chickens. Neonatal chickens were given or not given ampicillin and neomycin (0.25 and 0.5 g/L, respectively) in drinking water. At 2 weeks of age, the chicks were muscularly or orally immunized with antigenic keyhole limpet hemocyanin (KLH), and then serum anti-KLH antibody levels were examined by ELISA. In orally immunized chicks, oral antibiotics treatment enhanced antibody responses (IgM, IgA, IgY) by 2-3-fold compared with the antibiotics-free control, while the antibiotics did not enhance antibody responses in the muscularly immunized chicks. Concomitant with their enhancement of antibody responses, the oral antibiotics also lowered the Lactobacillus species in feces. Low doses of antibiotics (10-fold and 100-fold lower than the initial trial), which failed to change the fecal Lactobacillus population, did not modify any antibody responses when chicks were orally immunized with KLH. In conclusion, oral antibiotics treatment enhanced the antibody response to orally exposed antigens in chickens. This enhancement of antibody response was associated with a modification of the fecal Lactobacillus content, suggesting a possible link between gut microbiota and antibody response in chickens. © 2015 Japanese Society of Animal Science.

  1. Innate lymphoid cells: models of plasticity for immune homeostasis and rapid responsiveness in protection.

    Science.gov (United States)

    Almeida, F F; Belz, G T

    2016-09-01

    Innate lymphoid cells (ILCs) have stormed onto the immune landscape as "newly discovered" cell types. These tissue-resident sentinels are enriched at mucosal surfaces and engage in complex cross talk with elements of the adaptive immune system and microenvironment to orchestrate immune homeostasis. Many parallels exist between innate cells and T cells leading to the initial partitioning of ILCs into rather rigid subsets that reflect their "adaptive-like" effector cytokines profiles. ILCs themselves, however, have unique attributes that are only just beginning to be elucidated. These features result in complementarity with, rather than complete duplication of, functions of the adaptive immune system. Key transcription factors determine the pathway of differentiation of progenitors towards an ILC1, ILC2, or ILC3 subset. Once formed, flexibility in the responses of these subsets to stimuli unexpectedly allows transdifferentation between the different subsets and the acquisition of altered phenotypes and function. This provides a mechanism for rapid innate immune responsiveness. Here, we discuss the models of differentiation for maintenance and activation of tissue-resident ILCs in maintaining immune homeostasis and protection.

  2. The innate immune signaling in cancer and cardiometabolic diseases: Friends or foes?

    Science.gov (United States)

    Wang, Weijun; Zhang, Yaxing; Yang, Ling; Li, Hongliang

    2017-02-28

    The innate immune system is responsible for sensing pathogen-associated molecular patterns (PAMPs) or danger-associated molecular patterns (DAMPs) by several types of germline-encoded pattern-recognition receptors (PRRs). It has the capacity to help the human body maintain homeostasis under normal conditions. However, in pathological conditions, PAMPs or DAMPs trigger aberrant innate immune and inflammatory responses and thus negatively or positively influence the progression of cancer and cardiometabolic diseases. Interestingly, we found that some elements of innate immune signaling are involved in these diseases partially via immune-independent manners, indicating a deeper understanding of the function of innate immune signaling in these diseases is urgent. In this review, we summarize the primary innate immune signaling pathways and their association with cancer and cardiometabolic diseases, with the aim of providing effective therapies for these diseases. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  3. Redox rhythm reinforces the circadian clock to gate immune response.

    Science.gov (United States)

    Zhou, Mian; Wang, Wei; Karapetyan, Sargis; Mwimba, Musoki; Marqués, Jorge; Buchler, Nicolas E; Dong, Xinnian

    2015-07-23

    Recent studies have shown that in addition to the transcriptional circadian clock, many organisms, including Arabidopsis, have a circadian redox rhythm driven by the organism's metabolic activities. It has been hypothesized that the redox rhythm is linked to the circadian clock, but the mechanism and the biological significance of this link have only begun to be investigated. Here we report that the master immune regulator NPR1 (non-expressor of pathogenesis-related gene 1) of Arabidopsis is a sensor of the plant's redox state and regulates transcription of core circadian clock genes even in the absence of pathogen challenge. Surprisingly, acute perturbation in the redox status triggered by the immune signal salicylic acid does not compromise the circadian clock but rather leads to its reinforcement. Mathematical modelling and subsequent experiments show that NPR1 reinforces the circadian clock without changing the period by regulating both the morning and the evening clock genes. This balanced network architecture helps plants gate their immune responses towards the morning and minimize costs on growth at night. Our study demonstrates how a sensitive redox rhythm interacts with a robust circadian clock to ensure proper responsiveness to environmental stimuli without compromising fitness of the organism.

  4. Stochastic responses of tumor–immune system with periodic treatment

    International Nuclear Information System (INIS)

    Li Dong-Xi; Li Ying

    2017-01-01

    We investigate the stochastic responses of a tumor–immune system competition model with environmental noise and periodic treatment. Firstly, a mathematical model describing the interaction between tumor cells and immune system under external fluctuations and periodic treatment is established based on the stochastic differential equation. Then, sufficient conditions for extinction and persistence of the tumor cells are derived by constructing Lyapunov functions and Ito’s formula. Finally, numerical simulations are introduced to illustrate and verify the results. The results of this work provide the theoretical basis for designing more effective and precise therapeutic strategies to eliminate cancer cells, especially for combining the immunotherapy and the traditional tools. (paper)

  5. Duox2-induced innate immune responses in the respiratory epithelium and intranasal delivery of Duox2 DNA using polymer that mediates immunization.

    Science.gov (United States)

    Jeon, Yung Jin; Kim, Hyun Jik

    2018-05-01

    Respiratory mucosa especially nasal epithelium is well known as the first-line barrier of air-borne pathogens. High levels of reactive oxygen species (ROS) are detected in in vitro cultured human epithelial cells and in vivo lung. With identification of NADPH oxidase (Nox) system of respiratory epithelium, the antimicrobial role of ROS has been studied. Duox2 is the most abundant Nox isoform and produces the regulated amount of ROS in respiratory epithelium. Duox2-derived ROS are involved in antiviral innate immune responses but more studies are needed to verify the mechanism. In respiratory epithelium, Duox2-derived ROS is critical for recognition of virus through families retinoic acid-inducible gene-I (RIG-I) and melanoma differentiation-associated protein 5 (MDA5) at the early stage of antiviral innate immune responses. Various secreted interferons (IFNs) play essential roles for antiviral host defense by downstream cell signaling, and transcription of IFN-stimulated genes is started to suppress viral replication. Type I and type III IFNs are verified more responsible for influenza A virus (IAV) infection in respiratory epithelium and Duox2 is required to regulate IFN-related immune responses. Transient overexpression of Duox2 using cationic polymer polyethylenimine (PEI) induces secretion of type I and type III IFNs and significantly attenuated IAV replication in respiratory epithelium. Here, we discuss Duox2-mediated antiviral innate immune responses and the role of Duox2 as a mucosal vaccine to resist respiratory viral infection.

  6. A cascade reaction network mimicking the basic functional steps of acquired immune response

    Science.gov (United States)

    Han, Da; Wu, Cuichen; You, Mingxu; Zhang, Tao; Wan, Shuo; Chen, Tao; Qiu, Liping; Zheng, Zheng; Liang, Hao; Tan, Weihong

    2015-01-01

    Biological systems use complex ‘information processing cores’ composed of molecular networks to coordinate their external environment and internal states. An example of this is the acquired, or adaptive, immune system (AIS), which is composed of both humoral and cell-mediated components. Here we report the step-by-step construction of a prototype mimic of the AIS which we call Adaptive Immune Response Simulator (AIRS). DNA and enzymes are used as simple artificial analogues of the components of the AIS to create a system which responds to specific molecular stimuli in vitro. We show that this network of reactions can function in a manner which is superficially similar to the most basic responses of the vertebrate acquired immune system, including reaction sequences that mimic both humoral and cellular responses. As such, AIRS provides guidelines for the design and engineering of artificial reaction networks and molecular devices. PMID:26391084

  7. The type of adjuvant strongly influences the T-cell response during nanoparticle-based immunization

    Science.gov (United States)

    Knuschke, Torben; Epple, Matthias; Westendorf, Astrid M

    2014-01-01

    Potent vaccines require the ability to effectively induce immune responses. Especially for the control of infectious diseases with intracellular pathogens, like viruses or bacteria, potent T-cell responses are indispensable. Several delivery systems such as nanoparticles have been considered to boost the immunogenicity of pathogen derived peptides or subunits for the induction of potent T-cell responses. Since they can be further functionalized with immunostimulants, like Toll-like receptor (TLR) agonists, they improve the response by enhanced activation of the innate immune system. Currently, TLR agonists like unmethylated CpG oligonucleotides and the synthetic dsRNA derivate polyriboinosinic acid-polyribocytidylic acid (poly[I:C]) are widely used as vaccine adjuvants. CpG and poly(I:C) trigger different TLRs and therefore show differential signal transduction. Recently, we established biodegradable calcium phosphate (CaP) nanoparticles as potent T cell inducing vaccination vehicles. In this commentary we discuss the role of CpG and poly(I:C) for the effective induction of virus-specific T cells during immunization with CaP nanoparticles. The presented results underline the importance of the right formulation of vaccines for specific immunization purpose. PMID:23982325

  8. Effect of household pet ownership on infant immune response and subsequent sensitization

    Directory of Open Access Journals (Sweden)

    Angela Simpson

    2010-08-01

    Full Text Available Angela SimpsonManchester Academic Health Science Centre, NIHR Translational Research Facility in Respiratory Medicine, University Hospital of South Manchester NHS Foundation Trust, Manchester, UKAbstract: Sensitization to pets is a major risk factor for asthma. There are many reports on the relationship between household pets, sensitization to the pet, and sensitization to other allergens, often with conflicting results. Pet ownership is not random, and household pets are associated with exposures other than pet allergens. We will review some of the evidence regarding the effects of household pets on infant immune responses, focusing on data from birth cohort studies. It remains unclear precisely why some children develop specific sensitizations to pets whilst others do not in the face of equivalent exposures, but it is likely to be due to gene-environment interactions. Further long-term follow-up of children in whom neonatal and infant immune responses have been measured is necessary to understand how these events occur and how they relate to subsequent disease.Keywords: pets, sensitization, immune response

  9. Differential immune responses of Monochamus alternatus against symbiotic and entomopathogenic fungi.

    Science.gov (United States)

    Zhang, Wei; Meng, Jie; Ning, Jing; Qin, Peijun; Zhou, Jiao; Zou, Zhen; Wang, Yanhong; Jiang, Hong; Ahmad, Faheem; Zhao, Lilin; Sun, Jianghua

    2017-08-01

    Monochamus alternatus, the main vector beetles of invasive pinewood nematode, has established a symbiotic relationship with a native ectotrophic fungal symbiont, Sporothrix sp. 1, in China. The immune response of M. alternatus to S. sp. 1 in the coexistence of beetles and fungi is, however, unknown. Here, we report that immune responses of M. alternatus pupae to infection caused by ectotrophic symbiotic fungus S. sp. 1 and entomopathogenic fungus Beauveria bassiana differ significantly. The S. sp. 1 did not kill the beetles while B. bassiana killed all upon injection. The transcriptome results showed that the numbers of differentially expressed genes in M. alternatus infected with S. sp. 1 were 2-fold less than those infected with B. bassiana at 48 hours post infection. It was noticed that Toll and IMD pathways played a leading role in the beetle's immune system when infected by symbiotic fungus, but upon infection by entomopathogenic fungus, only the Toll pathway gets triggered actively. Furthermore, the beetles could tolerate the infection of symbiotic fungi by retracing their Toll and IMD pathways at 48 h. This study provided a comprehensive sequence resource of M. alternatus transcriptome for further study of the immune interactions between host and associated fungi.

  10. The Design of New Adjuvants for Mucosal Immunity to Neisseria meningitidis B in Nasally Primed Neonatal Mice for Adult Immune Response

    Directory of Open Access Journals (Sweden)

    Tatiane Ferreira

    2012-01-01

    Full Text Available The aim of this study was to determine the value of detoxified Shiga toxins Stx1 and Stx2 (toxoids of Escherichia coli as mucosal adjuvants in neonatal mice for immunogenicity against the outer membrane proteins (OMPs of Neisseria meningitidis B. Mucosal immunization has been shown to be effective for the induction of antigen-specific immune responses in both the systemic and mucosal compartments. Systemic antibody levels (IgG, IgG1, IgG2a, IgG2b, IgM, and IgA and mucosal IgM and IgA were measured by ELISA using an N. meningitidis as an antigen. In addition, IFN-γ and IL-6 production were measured after stimulated proliferation of immune cells. Intranasal administration elicited a higher anti-OMP IgA response in both saliva and vaginal fluids. Our results suggest that both Stx1 and Stx2 toxoids are effective mucosal adjuvants for the induction of Ag-specific IgG, IgM, and IgA antibodies. The toxoids significantly enhanced the IgG and IgM response against OMPs with a potency equivalent to CT, with the response being characterized by both IgG1 and IgG2a isotypes, and increased IFN-gamma production. Additionally, bactericidal activity was induced with IgG and IgM antibodies of high avidity. These results support the use of the new toxoids as potent inducing adjuvants that are particularly suitable for mucosal immunization.

  11. The Immune Response and the Pathogenesis of Idiopathic Inflammatory Myositis: a Critical Review.

    Science.gov (United States)

    Ceribelli, Angela; De Santis, Maria; Isailovic, Natasa; Gershwin, M Eric; Selmi, Carlo

    2017-02-01

    The pathogenesis of idiopathic inflammatory myositis (IIMs, including polymyositis and dermatomyositis) remains largely enigmatic, despite advances in the study of the role played by innate immunity, adaptive immunity, genetic predisposition, and environmental factors in an orchestrated response. Several factors are involved in the inflammatory state that characterizes the different forms of IIMs which share features and mechanisms but are clearly different with respect to the involved sites and characteristics of the inflammation. Cellular and non-cellular mechanisms of both the immune and non-immune systems have been identified as key regulators of inflammation in polymyositis/dermatomyositis, particularly at different stages of disease, leading to the fibrotic state that characterizes the end stage. Among these, a special role is played by an interferon signature and complement cascade with different mechanisms in polymyositis and dermatomyositis; these differences can be identified also histologically in muscle biopsies. Numerous cellular components of the adaptive and innate immune response are present in the site of tissue inflammation, and the complexity of idiopathic inflammatory myositis is further supported by the involvement of non-immune mechanisms such as hypoxia and autophagy. The aim of this comprehensive review is to describe the major pathogenic mechanisms involved in the onset of idiopathic inflammatory myositis and to report on the major working hypothesis with therapeutic implications.

  12. Immune responses of Helicoverpa armigera to different kinds of pathogens

    Directory of Open Access Journals (Sweden)

    Zhao Xiao-Fan

    2010-03-01

    Full Text Available Abstract Background Insects react against pathogens through innate immunity. The cotton bollworm Helicoverpa armigera (H. armigera is an important defoliator and an extremely destructive pest insect of many crops. The elucidation of the mechanism of the immune response of H. armigera to various pathogens can provide a theoretical basis for new approaches to biologically control this pest. Results Four kinds of pathogens Bacillus thuringiensis, Klebsiella pneumoniae, Candida albicans, and Autographa californica multiple nucleocapsid nucleopolyhedrovirus harbored green fluorescence protein and polyhedron (AcMNPV-GFP were used to challenge the insect. The cellular and humoral immune responses to the pathogens were analyzed in the challenged H. armigera. The results show that in the five kinds of haemocytes, only granulocytes phagocytized the Gram-negative and Gram-positive bacteria and fungi. All haemocytes can be infected by AcMNPV. Fourteen immune-related genes including pattern recognition receptors (PRRs such as peptidoglycan recognition proteins (HaPGRP and HaPGRP C and Gram-Negative Bacteria-Binding Protein (HaGNBP, and antimicrobial peptides (AMPs such as cecropin-1, 2 and 3 (HaCec-1, 2 and 3, lysozyme (HaLys, attacin (HaAtt, gallerimycin-like (HaGall, gloverin-like (HaGlo, moricin-like (HaMor, cobatoxin-like (HaCob, galiomicin-like (HaGali, and immune inducible protein (HaIip appeared in different expression profiles to different pathogen infections. The transcripts of 13 immune related genes (except HaPGRPC are obviously up-regulated by Gram-positive bacteria. HaCec-1 and 3, HaMor, HaAtt, HaLys, HaIip, HaPGRP and HaGNBP are greatly up-regulated after fungal infection. HaGNBP, HaCec-2, HaGall, HaGlo, HaMor, HaCob, HaGali obviously increased in Gram-negative bacterial infection. Only five genes, HaGNBP, HaCec-1, HaGali, HaGlo, and HaLys, are weakly up-regulated after viral infection. The AMP transcripts had higher expression levels than the

  13. Immune Responses following Stereotactic Body Radiotherapy for Stage I Primary Lung Cancer

    Directory of Open Access Journals (Sweden)

    Yoshiyasu Maehata

    2013-01-01

    Full Text Available Purpose. Immune responses following stereotactic body radiotherapy (SBRT for stage I non-small cell lung cancer (NSCLC were examined from the point of view of lymphocyte subset counts and natural killer cell activity (NKA. Patients and Methods. Peripheral blood samples were collected from 62 patients at 4 time points between pretreatment and 4 weeks post-treatment for analysis of the change of total lymphocyte counts (TLC and lymphocyte subset counts of CD3+, CD4+, CD8+, CD19+, CD56+, and NKA. In addition, the changes of lymphocyte subset counts were compared between patients with or without relapse. Further, the correlations between SBRT-related parameters and immune response were analyzed for the purpose of revealing the mechanisms of the immune response. Results. All lymphocyte subset counts and NKA at post-treatment and 1 week post-treatment were significantly lower than pre-treatment (P<0.01. No significant differences in the changes of lymphocyte subset counts were observed among patients with or without relapse. The volume of the vertebral body receiving radiation doses of 3 Gy or more (VV3 significantly correlated with the changes of nearly all lymphocyte subset counts. Conclusions. SBRT for stage I NSCLC induced significant immune suppression, and the decrease of lymphocyte subset counts may be associated with exposure of the vertebral bone marrow.

  14. Lipopolysaccharide contamination of beta-lactoglobulin affects the immune response against intraperitoneally and orally administered antigen

    DEFF Research Database (Denmark)

    Pedersen, Susanne Brix; Kjær, T.M.R.; Barkholt, Vibeke

    2004-01-01

    Microbial components in the environment are potent activators of the immune system with capacity to shift the active immune response towards priming of Th1 and/or Th2 cells. Lipopolysaccharide (LPS), a cell-wall component of Gram- negative bacteria, is extensively present in food products like co......-LG was contaminated with LPS. Conclusions: LPS contamination of an aqueous protein solution does not affect oral tolerance induction, whereas LPS present in emulsion prevents oral tolerance induction towards the food protein.......Microbial components in the environment are potent activators of the immune system with capacity to shift the active immune response towards priming of Th1 and/or Th2 cells. Lipopolysaccharide (LPS), a cell-wall component of Gram- negative bacteria, is extensively present in food products like cow......'s milk. It is not well established, however, how this presence of LPS affects oral tolerance induction. Methods: We studied the effect of LPS contamination in a commercial preparation of the cow milk protein beta-lactoglobulin (beta-LG) on antigen-specific immune responses. IgG1/IgG2a production upon...

  15. TYPES OF IMMUNE RESPONSE FOR VARIOUS ESTHTEIN-BARR FORMS OF VIRAL INFECTION

    Directory of Open Access Journals (Sweden)

    Lyadova T. I.

    2017-12-01

    Full Text Available In 321 patients with different forms of EBV infection in the age range from 19 to 57 years (mean age 33,1 ± 11,7 years different types of immune response were isolated and studied. All participants in the study were divided into groups of comparable sex and age: patients with infectious mononucleosis (n = 138; patients with various forms of chronic EBV infection (n = 183; clinically healthy volunteers (n = 20. During the study all ethical norms were observed in accordance with international and Ukrainian protocols. Clinical examination of patients and healthy volunteers included examining complaints, an epidemiological history, a history of illness and life, an objective examination, instrumental and laboratory studies in dynamics. Statistical processing of the results of the study was carried out by parametric and nonparametric methods using the program Statistika 6.0, for each variational series, the absolute values (n, the arithmetic mean (M, the mean error of the arithmetic mean (m were calculated. It was found that patients with different forms of EBV infection have a reliable cytokine imbalance. Four main types of immune response were identified: normoreactive, dissociative, hyporeactive and hyperreactive. The revealed types of immune response testify to inadequate cellular-humoral reactivity of the organism in conditions of prolonged persistence of EBV, which is manifested by a tendency to suppress cell-mediated and enhancing humoral mechanisms of the immune response and is reflected in the clinical and biochemical manifestations of the disease and leads to a protracted undulating course of the disease.

  16. Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route.

    Science.gov (United States)

    Carey, John B; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V S; Draper, Simon J; Moore, Anne C

    2014-08-21

    Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP1₄₂, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP1₄₂ also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP1₄₂ using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies.

  17. Microneedle-mediated immunization of an adenovirus-based malaria vaccine enhances antigen-specific antibody immunity and reduces anti-vector responses compared to the intradermal route

    Science.gov (United States)

    Carey, John B.; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V. S.; Draper, Simon J.; Moore, Anne C.

    2014-01-01

    Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP142, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP142 also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP142 using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies. PMID:25142082

  18. The role of recombinant IL-12 in enhancing immune responses induced by hepatitis B vaccine in mice

    International Nuclear Information System (INIS)

    Lu Qun; Zhou Lixia; Zhao Yanrong; Miao Xiaoguang; Jin Jie; Ke Jinshan; Qin Xuliang; He Zheng

    2007-01-01

    Objective: To study the role played by recombinant IL-12 in enhancing the intensity and quality of the immune response to hepatitis B vaccine in mice, and investigate the possibility of adding recombinant IL-12 as adjuvants to hepatitis B therapeutic vaccine. Methods: Recombinant IL-12 was injected together with hepatitis B vaccine into mice and special anti-HBsAb in the mice and the cellular immune responses were examined. Results: Recombinant IL-12 can obviously enhance T lymphocyte multiplication activity, accelerate excretion of cytokines IFN-γ and IL-2, and increase the IgG2a antibody in mice. Conclusion: Recombinant IL-12 can remarkably strengthen the cellular immune responses induced by the hepatitis B vaccine, and modulate the immune responses toward Thl. (authors)

  19. Modulation of Immune Functions by Foods

    Directory of Open Access Journals (Sweden)

    Shuichi Kaminogawa

    2004-01-01

    Full Text Available Evidence is rapidly accumulating as to the beneficial effects of foods. However, it is not always clear whether the information is based on data evaluated impartially in a scientific fashion. Human research into whether foods modulate immune functions in either intervention studies or randomized controlled trials can be classified into three categories according to the physical state of subjects enrolled for investigation: (i studies examining the effect of foods in healthy individuals; (ii studies analyzing the effect of foods on patients with hypersensitivity; and (iii studies checking the effect of foods on immunocompromized subjects, including patients who had undergone surgical resection of cancer and newborns. The systematization of reported studies has made it reasonable to conclude that foods are able to modulate immune functions manifesting as either innate immunity (phagocytic activity, NK cell activity or acquired immunity (T cell response, antibody production. Moreover, improvement of immune functions by foods can normalize the physical state of allergic patients or cancer patients, and may reduce the risk of diseases in healthy individuals. Therefore, it is valuable to assess the immune-modulating abilities of foods by measuring at least one parameter of either innate or acquired immunity.

  20. FORMATION OF INNATE AND ADAPTIVE IMMUNE RESPONSE UNDER THE INFLUENCE OF DIFFERENT FLAVIVIRUS VACCINES

    Directory of Open Access Journals (Sweden)

    N. V. Krylova

    2015-01-01

    Full Text Available The review examines in a comparative perspective the key moments of formation of innate and adaptive immune responses to different types of current flavivirus vaccines: live attenuated against yellow fever virus and inactivated whole virus against tick-borne encephalitis virus. Particular attention is paid to the ability of these different vaccines, containing exogenous pathogen-associated molecular structures, to stimulate innate immunity. Live attenuated vaccine by infecting several subtypes of dendritic cells activates them through various pattern-recognition receptors, such as Tolland RIG-I-like receptors, which leads to significant production of proinflammatory cytokines, including interferon-α primary mediator of innate antiviral immunity. By simulating natural viral infection, this vaccine quickly spreads over the vascular network, and the dendritic cells, activated by it, migrate to the draining lymph nodes and trigger multiple foci of Tand B-cell activation. Inactivated vaccine stimulates the innate immunity predominantly at the injection site, and for the sufficient activation requires the presence in its composition of an adjuvant (aluminum hydroxide, which effects the formation and activation of inflammasomes, ensuring the formation and secretion of IL-1β and IL-18 that, in turn, trigger a cascade of cellular and humoral innate immune responses. We demonstrated the possibility of involvement in the induction of innate immunity, mediated by the inactivated vaccine, endogenous pathogenassociated molecular patterns (uric acid and host cell DNA, forming at the vaccine injection site. We discuss the triggering of Band T-cell responses by flavivirus vaccines that determine various duration of protection against various pathogens. A single injection of the live vaccine against yellow fever virus induces polyvalent adaptive immune response, including the production of cytotoxic T-lymphocytes, Th1and Th2-cells and neutralizing antibodies