
Sample records for normal immune responses

  1. Angiogenesis for tumor vascular normalization of Endostar on hepatoma 22 tumor-bearing mice is involved in the immune response. (United States)

    Xu, Qingyu; Gu, Junfei; Lv, You; Yuan, Jiarui; Yang, Nan; Chen, Juan; Wang, Chunfei; Hou, Xuefeng; Jia, Xiaobin; Feng, Liang; Yin, Guowen


    Tumor vascular normalization involved in immune response is beneficial to the chemotherapy of tumors. Recombinant human endostatin (Endostar), an angiogenesis inhibitor, has been demonstrated to be effective in hepatocellular cancer (HCC). However, its vascular normalization in HCC and the role of the immune response in angiogenesis were unclear. In the present study, effects of Endostar on tumor vascular normalization were evaluated in hepatoma 22 (H22) tumor-bearing mice. Endostar was able to inhibit the proliferation and infiltration of tumor cells and improve α-fetoprotein, tumor necrosis factor-α and cyclic adenosine 5'-phosphate levels in the serum of H22-bearing mice, as well as the protein expression levels of the immune factors interferon-γ and cluster of differentiation (CD)86 in liver tissue. Endostar also exhibited more marked downregulation of the levels of vascular endothelial growth factor, CD31, matrix metalloproteinase (MMP)-2, MMP-9 and interleukin-17 during day 3-9 treatment, resulting in short-term normalization of tumor blood vessels. The period of vascular normalization was 3-9 days. The results of the present study demonstrated that Endostar was able to induce the period of vascular normalization, contributing to a more efficacious means of HCC treatment combined with other chemotherapy, and this effect was associated with the immune response. It may be concluded that Endostar inhibited immunity-associated angiogenesis behaviors of vascular endothelial cells in response to HCC. The results of the present study provided more reasonable possibility for the combination therapy of Endostar for the treatment of HCC.

  2. Immune responses to metastases

    International Nuclear Information System (INIS)

    Herberman, R.B.; Wiltrout, R.H.; Gorelik, E.


    The authors present the changes in the immune system in tumor-bearing hosts that may influence the development of progression of metastases. Included are mononuclear cell infiltration of metastases; alterations in natural resistance mediated by natural killer cells and macrophages; development of specific immunity mediated by T-lymphocytes or antibodies; modulation of tumor-associated antigen expression; and the down-regulation of the immune response to the tumor by several suppressor mechanisms; the augmentation of the immune response and its potential for therapeutic application; includes the prophylaxis of metastases formation by NK cells; the therapy of metastases by augmentation NK-, macrophage-, or T-lymphocyte-mediated responses by biological response modifiers; and the transfer of anticancer activity by cytoxic T-lymphocytes or immunoconjugates of monoclonal antibodies with specificity for tumors

  3. Gastrointestinal immune responses in HIV infected subjects

    Directory of Open Access Journals (Sweden)

    LRR Castello-Branco


    Full Text Available The gut associated lymphoid tissue is responsible for specific responses to intestinal antigens. During HIV infection, mucosal immune deficiency may account for the gastrointestinal infections. In this review we describe the humoral and cellular mucosal immune responses in normal and HIV-infected subjects.

  4. Immune Modulation in Normal Human Peripheral Blood Mononuclear Cells (PBMCs) (Lymphocytes) in Response to Benzofuran-2-Carboxylic Acid Derivative KMEG during Spaceflight (United States)

    Okoro, Elvis; Mann, Vivek; Ellis, Ivory; Mansoor, Elvedina; Olamigoke, Loretta; Marriott, Karla Sue; Denkins, Pamela; Williams, Willie; Sundaresan, Alamelu


    Microgravity and radiation exposure during space flight have been widely reported to induce the suppression of normal immune system function, and increase the risk of cancer development in humans. These findings pose a serious risk to manned space missions. Interestingly, recent studies have shown that benzofuran-2-carboxylic acid derivatives can inhibit the progression of some of these devastating effects on earth and in modeled microgravity. However, these studies had not assessed the impacts of benzofuran-2- carboxylic acid and its derivatives on global gene expression under spaceflight conditions. In this study, the ability of a specific benzofuran-2-carboxylic acid derivative (KMEG) to confer protection from radiation and restore normal immune function was investigated following exposure to space flight conditions on the ISS. Normal human peripheral blood mononuclear cells (lymphocytes) treated with 10 µ g/ml of KMEG together with untreated control samples were flown on Nanoracks hardware on Spacex-3 flight. The Samples were returned one month later and gene expression was analyzed. A 1g-ground control experiment was performed in parallel at the Kennedy spaceflight center. The first overall subtractive unrestricted analysis revealed 78 genes, which were differentially expressed in space flight KMEG, untreated lymphocytes as compared to the corresponding ground controls. However, in KMEG-treated space flight lymphocytes, there was an increased expression of a group of genes that mediate increased transcription, translation and innate immune system mediating functions of lymphocytes as compared to KMEG-untreated samples. Analysis of genes related to T cell proliferation in spaceflight KMEG-treated lymphocytes compared to 1g-ground KMEG- treated lymphocytes revealed six T cell proliferation and signaling genes to be significantly upregulated (p trafficking, promote early response, mediating C-myc related proliferation, promote antiapoptotic activity and protects

  5. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)


    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  6. Effect of endotoxin preparations (LPS) with irradiation decreased toxicity on the immune response of normal and irradiated rats

    Energy Technology Data Exchange (ETDEWEB)

    Elekes, E; Bertok, L [Orszagos Frederic Joliot-Curie Sugarbiologiai es Sugaregeszsegugyi Kutato Intezet, Budapest (Hungary)


    A comparison of the immunostimulating effect of parent and radiodetoxified with 50, 100, 150 and 200 kGy (5, 10, 15 and 20 Mrad) /sup 60/Co ..gamma..-rays endotoxin preparations in normal and irradiated rats is given. By increasing the dose of irradiation the immunostimulating effect decreased. The preparations detoxified even with the highest (200 kGy) dose is characterized by a pronounced adjuvant effect in irradiated animals.

  7. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats. (United States)

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi


    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  8. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.


    The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

  9. Immune response to H pylori (United States)

    Suarez, Giovanni; Reyes, Victor E; Beswick, Ellen J


    The gastric mucosa separates the underlying tissue from the vast array of antigens that traffic through the stomach lumen. While the extreme pH of this environment is essential in aiding the activation of enzymes and food digestion, it also renders the gastric epithelium free from bacterial colonization, with the exception of one important human pathogen, H pylori. This bacterium has developed mechanisms to survive the harsh environment of the stomach, actively move through the mucosal layer, attach to the epithelium, evade immune responses, and achieve persistent colonization. While a hallmark of this infection is a marked inflammatory response with the infiltration of various immune cells into the infected gastric mucosa, the host immune response is unable to clear the infection and may actually contribute to the associated pathogenesis. Here, we review the host responses involved during infection with H pylori and how they are influenced by this bacterium. PMID:17007009

  10. Suppression of adoptive antituberculosis immunity by normal recipient animals

    International Nuclear Information System (INIS)

    Lefford, M.J.


    Adoptive immunity is poorly expressed in normal syngeneic mice. This phenomenon was studied by using experimental antituberculosis immunity as a model system representing pure cell-mediated immunity. Expression of adoptive immunity was facilitated by pretreating recipients with sublethal ionizing radiation (500 rads) or high doses (200 mg/kg) of cyclophosphamide or by using adult thymectomized, lethally irradiated, bone-marrow-reconstituted (TXB) mice. Adult thymectomy was less effective, and a low dose of cyclophosphamide (20 mg/kg) was completely ineffective. The beneficial effect of sublethal irradiation was reduced over time; it persisted for 4 weeks and was absent after 8 weeks. Attempts to restore the suppressed state of normal mice to sublethally irradiated mice by using normal spleen or thymus cells did not succeed. Even in rats, which express adoptive antituberculosis immunity without immunosuppressive treatment, the use of sublethally irradiated or TXB recipients potentiated adoptive immunity. It was concluded that suppression of adoptive immunization in normal recipient mice is mediated predominantly, if not exclusively, by T lymphocytes that are sensitive to a number of immunosuppressive agents. The suppressor cells are long-lived and can be regenerated from precursors that are resistant to 500 but not to 900 rads of ionizing radiation

  11. Innate Immune Responses in Leprosy (United States)

    Pinheiro, Roberta Olmo; Schmitz, Veronica; Silva, Bruno Jorge de Andrade; Dias, André Alves; de Souza, Beatriz Junqueira; de Mattos Barbosa, Mayara Garcia; de Almeida Esquenazi, Danuza; Pessolani, Maria Cristina Vidal; Sarno, Euzenir Nunes


    Leprosy is an infectious disease that may present different clinical forms depending on host immune response to Mycobacterium leprae. Several studies have clarified the role of various T cell populations in leprosy; however, recent evidences suggest that local innate immune mechanisms are key determinants in driving the disease to its different clinical manifestations. Leprosy is an ideal model to study the immunoregulatory role of innate immune molecules and its interaction with nervous system, which can affect homeostasis and contribute to the development of inflammatory episodes during the course of the disease. Macrophages, dendritic cells, neutrophils, and keratinocytes are the major cell populations studied and the comprehension of the complex networking created by cytokine release, lipid and iron metabolism, as well as antimicrobial effector pathways might provide data that will help in the development of new strategies for leprosy management. PMID:29643852

  12. Eosinophils in mucosal immune responses (United States)

    Travers, J; Rothenberg, M E


    Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184

  13. Cellular immune responses to respiratory viruses

    NARCIS (Netherlands)

    van Helden, M.J.G.


    When a respiratory virus successfully infects the lungs, cascades of immune responses are initiated aimed to remove the pathogen. Immediate non-specific protection is provided by the innate immune system and this reduces the viral load during the first days of infection. The adaptive immune response

  14. The Immune Response of Maternally Immune Chicks to Vaccination ...

    African Journals Online (AJOL)

    The Immune Response of Maternally Immune Chicks to Vaccination with Newcastle Disease Virus. ... G A El-Tayeb, M Y El-Ttegani, I E Hajer, M A Mohammed ... This study was conducted to determine the persistence of maternally derived antibodies (MDA) to Newcastle disease virus (NDV) in newly hatched chicks and the ...

  15. Immune oncology, immune responsiveness and the theory of everything. (United States)

    Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue


    Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.

  16. Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae. (United States)

    Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric


    F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

  17. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    Energy Technology Data Exchange (ETDEWEB)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas, E-mail: [Winthrop P. Rockefeller Cancer Institute and Department of Pathology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States)


    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses.

  18. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    International Nuclear Information System (INIS)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas


    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses

  19. Antimicrobial peptides in innate immune responses

    DEFF Research Database (Denmark)

    Sorensen, O.E.; Borregaard, N.; Cole, A.M.


    Antimicrobial peptides (AMPs) are ancient effector molecules in the innate immune response of eukaryotes. These peptides are important for the antimicrobial efficacy of phagocytes and for the innate immune response mounted by epithelia of humans and other mammals. AMPs are generated either by de...... novo synthesis or by proteolytic cleavage from antimicrobially inactive proproteins. Studies of human diseases and animal studies have given important clues to the in vivo role of AMPs. It is now evident that dysregulation of the generation of AMPs in innate immune responses plays a role in certain...

  20. Cholinergic Modulation of Type 2 Immune Responses

    Directory of Open Access Journals (Sweden)

    Goele Bosmans


    Full Text Available In recent years, the bidirectional relationship between the nervous and immune system has become increasingly clear, and its role in both homeostasis and inflammation has been well documented over the years. Since the introduction of the cholinergic anti-inflammatory pathway, there has been an increased interest in parasympathetic regulation of both innate and adaptive immune responses, including T helper 2 responses. Increasing evidence has been emerging suggesting a role for the parasympathetic nervous system in the pathophysiology of allergic diseases, including allergic rhinitis, asthma, food allergy, and atopic dermatitis. In this review, we will highlight the role of cholinergic modulation by both nicotinic and muscarinic receptors in several key aspects of the allergic inflammatory response, including barrier function, innate and adaptive immune responses, and effector cells responses. A better understanding of these cholinergic processes mediating key aspects of type 2 immune disorders might lead to novel therapeutic approaches to treat allergic diseases.

  1. T lymphocytes and normal tissue responses to radiation

    International Nuclear Information System (INIS)

    Schaue, Dörthe; McBride, William H.


    There is compelling evidence that lymphocytes are a recurring feature in radiation damaged normal tissues, but assessing their functional significance has proven difficult. Contradictory roles have been postulated in both tissue pathogenesis and protection, although these are not necessarily mutually exclusive as the immune system can display what may seem to be opposing faces at any one time. While the exact role of T lymphocytes in irradiated normal tissue responses may still be obscure, their accumulation after tissue damage suggests they may be critical targets for radiotherapeutic intervention and worthy of further study. This is accentuated by recent findings that pathologically damaged “self,” such as occurs after exposure to ionizing radiation, can generate danger signals with the ability to activate pathways similar to those that activate adoptive immunity to pathogens. In addition, the demonstration of T cell subsets with their recognition radars tuned to “self” moieties has revolutionized our ideas on how all immune responses are controlled and regulated. New concepts of autoimmunity have resulted based on the dissociation of immune functions between different subsets of immune cells. It is becoming axiomatic that the immune system has the power to regulate radiation-induced tissue damage, from failure of regeneration to fibrosis, to acute and chronic late effects, and even to carcinogenesis. Our understanding of the interplay between T lymphocytes and radiation-damaged tissue may still be rudimentary but this is a good time to re-examine their potential roles, their radiobiological and microenvironmental influences, and the possibilities for therapeutic manipulation. This review will discuss the yin and yang of T cell responses within the context of radiation exposures, how they might drive or protect against normal tissue side effects and what we may be able do about it.

  2. Pathogen recognition in the innate immune response. (United States)

    Kumar, Himanshu; Kawai, Taro; Akira, Shizuo


    Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.

  3. Heme oxygenase and the immune system in normal and pathological pregnancies

    Directory of Open Access Journals (Sweden)

    Maide eOzen


    Full Text Available Normal pregnancy is an immunotolerant state. Many factors, including environmental, socioeconomic, genetic, and immunologic changes by infection and/or other causes of inflammation, may contribute to inter-individual differences resulting in a normal or pathologic pregnancy. In particular, imbalances in the immune system can cause many pregnancy-related diseases, such as infertility, abortions, pre-eclampsia, and preterm labor, which result in maternal/fetal death, prematurity, or small-for-gestational age newborns. New findings imply that myeloid regulatory cells and regulatory T cells (Tregs may mediate immunotolerance during normal pregnancy. Effector T cells (Teffs have, in contrast, been implicated to cause adverse pregnancy outcomes. Furthermore, feto-maternal tolerance affects the developing fetus. It has been shown that the Treg/Teff balance affects litter size and adoptive transfer of pregnancy-induced Tregs can prevent fetal rejection in the mouse. Heme oxygenase-1 (HO-1 has a protective role in many conditions through its anti-inflammatory, anti-apoptotic, antioxidative, and anti-proliferative actions. HO-1 is highly expressed in the placenta and plays a role in angiogenesis and placental vascular development and in regulating vascular tone in pregnancy. In addition, HO-1 is a major regulator of immune homeostasis by mediating crosstalk between innate and adaptive immune systems. Moreover, HO-1 can inhibit inflammation-induced phenotypic maturation of immune effector cells and pro-inflammatory cytokine secretion and promote anti-inflammatory cytokine production. HO-1 may also be associated with T-cell activation and can limit immune-based tissue injury by promoting Treg suppression of effector responses. Thus, HO-1 and its byproducts may protect against pregnancy complications by its immunomodulatory effects, and the regulation of HO-1 or its downstream effects has the potential to prevent or treat pregnancy complications and

  4. Stress proteins and the immune response. (United States)

    Moseley, P


    The heat shock or stress response is one of the most highly conserved adaptive responses in nature. In single cell organisms, the stress response confers tolerance to a variety of stresses including hyperthermia, hyperoxia, hypoxia, and other perturbations, which alter protein synthesis. This tolerance phenomenon is also extremely important in the multicellular organism, resulting in not only thermal tolerance, but also resistance to stresses of the whole organism such as ischemia-reperfusion injury. Moreover, recent data indicates that these stress proteins have the ability to modulate the cellular immune response. Although the terms heat shock proteins (HSPs) and stress proteins are often used interchangeably, the term stress proteins includes the HSPs, the glucose-regulated proteins (GRPs) and ubiquitin. The stress proteins may be grouped by molecular weight ranging from the large 110 kDa HSP110 to ubiquitin at 8 kDa. These proteins serve as cellular chaperones, participating in protein synthesis and transport through the various cellular compartments. Because these proteins have unique cellular localizations, the chaperone function of the stress proteins often involves a transfer of peptides between stress proteins as the peptide is moved between cellular compartments. For example, HSP70 is a cytosolic and nuclear chaperone, which is critical for the transfer of cellular peptides in the mitochondrion through a hand-off that involves mitochondrial HSP60 at the inner mitochondrial membrane. Similarly, cytosolic proteins are transferred from HSP70 to gp96 as they move into the endoplasmic reticulum. The central role of the stress proteins in the transfer of peptides through the cell may be responsible for the recently recognized importance of the stress proteins in the modulation of the immune system [Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61

  5. Immune Response to Dengue and Zika. (United States)

    Ngono, Annie Elong; Shresta, Sujan


    Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.

  6. Immune Responses Involved in Mycobacterium Tuberculosis Infection

    Directory of Open Access Journals (Sweden)

    Roghayeh Teimourpour


    Full Text Available Background and Objectives: Mycobacterium tuberculosis is the causative agent of tuberculosis (TB. Approximately one-third of the world's population is infected with M. tuberculosis. Despite the availability of drug and vaccine, it remains one of the leading causes of death in humans especially in developing countries. Epidemiological studies have indicated that only 10-30% of people exposed to tubercle bacillus are infected with M. tuberculosis, and at least 90% of the infected people finally do not acquire TB. The studies have indicated that the host efficient immune system has essential roles in the control of TB infection such that the highest rate of mortality and morbidity is seen in immunocompromised patients such as people infected with HIV. M. tuberculosis is an obligatory intracellular bacterium. It enters the body mainly through the respiratory tract and alveolar macrophages combat this pathogen most commonly. In addition to alveolar macrophages, various T-cell subpopulations need to be activated to overcome this bacterium's resistance to the host defense systems. CD4+ T cells, through production of several cytokines such as IFN-γ and TNF-α, and CD8+ T cells, through cytotoxic activities and induction of apoptosis in infected cells, play critical roles in inducing appropriate immune responses against M. tuberculosis. Although cell-mediated immunity is the cornerstone of host responses against TB and the recent studies have provided evidence for the importance of humoral and innate immune system in the control of TB, a profound understanding of the immune responses would provide a basis for development of new generations of vaccines and drugs. The present study addresses immune responses involved in M. tuberculosis infection.

  7. Immune Response in Mussels To Environmental Pollution. (United States)

    Pryor, Stephen C.; Facher, Evan


    Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)

  8. Modulation of immune response by bacterial lipopolysaccharides

    Directory of Open Access Journals (Sweden)

    Gustavo Aldapa-Vega


    Full Text Available Lipopolysaccharide (LPS is a molecule that is profusely found on the outer membrane of Gram-negative bacteria and is also a potent stimulator of the immune response. As the main molecule on the bacterial surface, is also the most biologically active. The immune response of the host is activated by the recognition of LPS through Toll-like receptor 4 (TLR4 and this receptor-ligand interaction is closely linked to LPS structure. Microorganisms have evolved systems to control the expression and structure of LPS, producing structural variants that are used for modulating the host immune responses during infection. Examples of this include Helicobacter pylori, Francisella tularensis, Chlamydia trachomatis and Salmonella spp. High concentrations of LPS can cause fever, increased heart rate and lead to septic shock and death. However, at relatively low concentrations some LPS are highly active immunomodulators, which can induce non-specific resistance to invading microorganisms. The elucidation of the molecular and cellular mechanisms involved in the recognition of LPS and its structural variants has been fundamental to understand inflammation and is currently a pivotal field of research to understand the innate immune response, inflammation, the complex host-pathogen relationship and has important implications for the rational development of new immunomodulators and adjuvants.

  9. Adrenaline influence on the immune response. I

    International Nuclear Information System (INIS)

    Depelchin, A.; Letesson, J.J.


    The intervention of adrenaline in the immunoregulation was investigated through the modification of the anti-SRBC PFC response of mice after its i.p. administration (4 μg) at various intervals before SRBC antigen. When the interval was less than 24 h, adrenaline accelerated the immune kinetics. This modification was apparent on both direct and indirect PFC, as well as on naive and immune mice. However, mice treated from 2 days showed a suppression of the response. The adrenaline affect subsisted on the adoptive response of spleen cells drug-treated either in vivo or in vitro. The mitogenic response after in vitro PHA or LPS stimulation of spleen cells from adrenaline-treated mice indicated that the T-cells were the drug target. The physiological role of the adrenaline and immunological influences of acute stress are discussed in the paper. The stress was provided by gamma irradiation. (Auth.)

  10. Humoral immune response to AAV

    Directory of Open Access Journals (Sweden)

    Roberto eCalcedo


    Full Text Available Adeno-associated virus (AAV is a member of the family parvoviridae that has been widely used as a vector for gene therapy because of its safety profile, its ability to transduce both dividing and non-dividing cells, and its low immunogenicity. AAV has been detected in many different tissues of several animal species but has not been associated with any disease. As a result of natural infections, antibodies to AAV can be found in many animals including humans. It has been shown that pre-existing AAV antibodies can modulate the safety and efficacy of AAV vector-mediated gene therapy by blocking vector transduction or by redirecting distribution of AAV vectors to tissues other than the target organ. This review will summarize antibody responses against natural AAV infections, as well as AAV gene therapy vectors and their impact in the clinical development of AAV vectors for gene therapy. We will also review and discuss the various methods used for AAV antibody detection and strategies to overcome neutralizing antibodies in AAV-mediated gene therapy.

  11. Immune Response to Lipoproteins in Atherosclerosis

    Directory of Open Access Journals (Sweden)

    Sonia Samson


    Full Text Available Atherosclerosis, the underlying cause of cardiovascular disease, is characterized by chronic inflammation and altered immune response. Cholesterol is a well-known risk factor associated with the development of cardiovascular diseases. Elevated serum cholesterol is unique because it can lead to development of atherosclerosis in animals and humans even in the absence of other risk factors. Modifications of low-density lipoproteins mediated by oxidation, enzymatic degradation, and aggregation result in changes in their function and activate both innate and adaptive immune system. Oxidized low-density lipoprotein (LDL has been identified as one of the most important autoantigens in atherosclerosis. This escape from self-tolerance is dependent on the formation of oxidized phospholipids. The emerging understanding of the importance of immune responses against oxidized LDL in atherosclerosis has focused attention on the possibility of development of novel therapy for atherosclerosis. This review provides an overview of immune response to lipoproteins and the fascinating possibility of developing an immunomodulatory therapy for atherosclerosis.

  12. Ovine model for studying pulmonary immune responses

    International Nuclear Information System (INIS)

    Joel, D.D.; Chanana, A.D.


    Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with 125 I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables

  13. Ovine model for studying pulmonary immune responses

    Energy Technology Data Exchange (ETDEWEB)

    Joel, D.D.; Chanana, A.D.


    Anatomical features of the sheep lung make it an excellent model for studying pulmonary immunity. Four specific lung segments were identified which drain exclusively to three separate lymph nodes. One of these segments, the dorsal basal segment of the right lung, is drained by the caudal mediastinal lymph node (CMLN). Cannulation of the efferent lymph duct of the CMLN along with highly localized intrabronchial instillation of antigen provides a functional unit with which to study factors involved in development of pulmonary immune responses. Following intrabronchial immunization there was an increased output of lymphoblasts and specific antibody-forming cells in efferent CMLN lymph. Continuous divergence of efferent lymph eliminated the serum antibody response but did not totally eliminate the appearance of specific antibody in fluid obtained by bronchoalveolar lavage. In these studies localized immunization of the right cranial lobe served as a control. Efferent lymphoblasts produced in response to intrabronchial antigen were labeled with /sup 125/I-iododeoxyuridine and their migrational patterns and tissue distribution compared to lymphoblasts obtained from the thoracic duct. The results indicated that pulmonary immunoblasts tend to relocate in lung tissue and reappear with a higher specific activity in pulmonary lymph than in thoracic duct lymph. The reverse was observed with labeled intestinal lymphoblasts. 35 references, 2 figures, 3 tables.

  14. Multiscale modeling of mucosal immune responses (United States)


    Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut

  15. Multiscale modeling of mucosal immune responses. (United States)

    Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep


    Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T

  16. Quantitating cellular immune responses to cancer vaccines. (United States)

    Lyerly, H Kim


    While the future of immunotherapy in the treatment of cancer is promising, it is difficult to compare the various approaches because monitoring assays have not been standardized in approach or technique. Common assays for measuring the immune response need to be established so that these assays can one day serve as surrogate markers for clinical response. Assays that accurately detect and quantitate T-cell-mediated, antigen-specific immune responses are particularly desired. However, to date, increases in the number of cytotoxic T cells through immunization have not been correlated with clinical tumor regression. Ideally, then, a T-cell assay not only needs to be sensitive, specific, reliable, reproducible, simple, and quick to perform, it must also demonstrate close correlation with clinical outcome. Assays currently used to measure T-cell response are delayed-type hypersensitivity testing, flow cytometry using peptide major histocompatibility complex tetramers, lymphoproliferation assay, enzyme-linked immunosorbant assay, enzyme-linked immunospot assay, cytokine flow cytometry, direct cytotoxicity assay, measurement of cytokine mRNA by quantitative reverse transcriptase polymerase chain reaction, and limiting dilution analysis. The purpose of this review is to describe the attributes of each test and compare their advantages and disadvantages.

  17. Flavobacterium psychrophilum - Experimental challenge and immune response

    DEFF Research Database (Denmark)

    Henriksen, Maya Maria Mihályi

    the immune system of the fry is not fully developed. Theoretically, the infection pressure could be subdued by vaccinating larger fish, but no commercial vaccine is yet available. Diagnostic methods are well described and the disease is treated with antibiotics. To prevent disease outbreaks and subsequent......-time PCR (RT-PCR) was used to examine the immune response in the head kidney during the first eight days after infection, and enzyme-linked immunosorbent assay (ELISA) was used to evaluate the production of antibodies 50 days post-exposure. A pro-inflammatory response was observed in both groups infected...... of edemas, but in both cases the tissue was regenerating after 192 hours. However, when the fish had been exposed to both H2O2 and F. psychrophilum, the damage was still evident at this time point. The relative pathogen load measured as 16S rRNA was highest at the first sampling and decreased steadily...

  18. Regulation of immune responses and tolerance: the microRNA perspective (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina


    Summary Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/ or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. PMID:23550642

  19. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100-Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    NARCIS (Netherlands)

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke


    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery

  20. Immune Response among Patients Exposed to Molds

    Directory of Open Access Journals (Sweden)

    Jordan N. Fink


    Full Text Available Macrocyclic trichothecenes, mycotoxins produced by Stachybotrys chartarum, have been implicated in adverse reactions in individuals exposed to mold-contaminated environments. Cellular and humoral immune responses and the presence of trichothecenes were evaluated in patients with mold-related health complaints. Patients underwent history, physical examination, skin prick/puncture tests with mold extracts, immunological evaluations and their sera were analyzed for trichothecenes. T-cell proliferation, macrocyclic trichothecenes, and mold specific IgG and IgA levels were not significantly different than controls; however 70% of the patients had positive skin tests to molds. Thus, IgE mediated or other non-immune mechanisms could be the cause of their symptoms.

  1. Manipulations of the immune response in the chicken

    International Nuclear Information System (INIS)

    Bixler, G.S. Jr.


    The chicken with its dissociation of immune responses in cell-mediated immunity, dependent on the thymus, and humoral immunity, dependent on the bursa of Fabricius, provides a unique model for studying the two components of the immune system. While there are methods of obtaining selective, profound deficiency of humoral immunity, in this species, methods for obtaining a consistent, profound selective deficiency of cell-mediated immunity have been lacking. Oxisuran, 2[(methylsulfinyl)acetal] pyridine, has been reported to have the unique ability to differentially suppress cell-mediated immunity in several species of mammals without a concomitant reduction in antibody forming capacity. The effect of this compound on two parameters of cell-mediated immune responses in chickens was investigated. In further attempts to create a deficiency of both cell-mediated and humoral immunity, the effects of a combination of cyclophosphamide treatment and x-irradiation early in life on immune responses were studied


    Directory of Open Access Journals (Sweden)

    Iván Darío Ocampo


    Full Text Available The immune system maintains the integrity of the organisms through a complex network of molecules, cells, and tissues that recognize internal or external antigenic substances to neutralized and eliminate them. The mechanisms of immune response have evolved in a modular fashion, where members of a given module interact strongly among them, but weakly with members of other modules, providing robustness and evolvability to the immune system. Ancestral modules are the raw material for the generation of new modules through evolution. Thus, the study of immune systems in basal metazoans such as cnidarians seeks to determine the basic tool kit from which the metazoans started to construct their immune systems. In addition, understanding the immune mechanisms in cnidarians contributes to decipher the etiopathology of coral diseases of infectious nature that are affecting coral reefs worldwide. RESUMEN El sistema inmune mantiene la integridad de los organismos vivos por medio de una red compleja de moléculas, células y tejidos que reconocen sustancias antigénicas internas o externas para neutralizarlas y eliminarlas. Los mecanismos de respuesta inmune han evolucionado de una manera modular, en donde miembros de un módulo dado interactúan fuertemente entre sí, pero débilmente con componentes de otros módulos, otorgando así robustez y potencial evolutivo al sistema inmune. Módulos ancestrales representan el material básico para la generación de nuevos módulos durante el proceso evolutivo. Así, el estudio de sistemas inmunes en metazoarios basales como los cnidarios busca determinar cuales son los módulos ancestrales a partir de los cuales se constituyen los sistemas inmunes de animales derivados. Adicionalmente, el entendimiento de los mecanismos de respuesta inmune en cnidarios eventualmente contribuirá a descifrar la etiopatología de las enfermedades de corales de carácter infeccioso que está afectando los corales en el mundo.

  3. Analysis and comparison of immune reactivity in guinea-pigs immunized with equivalent numbers of normal or radiation-attenuated cercariae of Schistosoma mansoni

    International Nuclear Information System (INIS)

    Rogers, M.V.; McLaren, D.J.


    Guinea-pigs immunized with equivalent numbers of normal or radiation-attenuated cercariae of Schistosoma mansoni develop close to complete resistance to reinfection at weeks 12 and 4.5 respectively. We here analyse and compare the immune responses induced by the two populations of cercariae. Both radiation-attenuated and normal parasites of S. mansoni elicited an extensive germinal centre response in guinea-pigs by week 4.5 post-immunization. The anti-parasite antibody titre and cytotoxic activity of serum from 4.5-week-vaccinated, or 4.5-week-infected guinea-pigs were approximately equal, but sera from 12-week-infected individuals had high titres of anti-parasite antibody, which promoted significant larvicidal activity in vitro. In all cases, larvicidal activity was mediated by the IgG 2 fraction of the immune serum. Lymphocyte transformation tests conducted on splenic lymphocytes from 4.5-week vaccinated guinea-pigs revealed maximal stimulation against cercarial, 2-week and 3-week worm antigens, whereas spleen cells from 4.5-week-infected guinea-pigs were maximally stimulated by cercarial and 6-week worm antigens. The splenic lymphocyte responses of 12-week infected animals were dramatic against antigens prepared from all life-stages of the parasite. (author)

  4. Protective immunization with B16 melanoma induces antibody response and not cytotoxic T cell response

    International Nuclear Information System (INIS)

    Sarzotti, M.; Sriyuktasuth, P.; Klimpel, G.R.; Cerny, J.


    C57BL/6 mice immunized with three intraperitoneal injections of syngeneic, irradiated B16 melanoma cells, became resistant to B16 tumor challenge. Immunized mice had high levels of serum antibody against a membrane antigen of B16 cells. The B16 antigen recognized by the anti-B16 sera formed a major band of 90 KD in gel electrophoresis. The anti-B16 antibody was partially protective when mixed with B16 cells and injected into normal recipient mice. Surprisingly, B16 resistance mice were incapable of generating cytotoxic T cells (CTL) specific for the B16 tumor. Both spleen and lymph node cell populations from immunized mice did not generate B16-specific CTL. Allogeneic mice (DBA/2 or C3H) were also unable to generate B16-specific CTL: however, alloreactive CTL produced in these strains of mice by immunization with C57BL/6 lymphocytes, did kill B16 target cells. Interestingly, spleen cells from syngeneic mice immunized with B16 tumor produced 6-fold more interleukin-2 (IL-2) than normal spleen cells, in vitro. These data suggest that immunization with B16 tumor activates a helper subset of T cells (for antibody and IL-2 production) but not the effector CTL response

  5. immune response can measuring immunity to hiv during ...

    African Journals Online (AJOL)


    Nov 1, 2005 ... inhibitors (PIs), have resulted in significant suppression of viral replication. ... thymus, with the potential for immune reconstitution when ..... HIV-exposed but uninfected Gambian women [published erratum appears in. Nat Med ...

  6. Modulation of the innate immune responses in the striped ...

    African Journals Online (AJOL)

    Thus, most of the innate non-specific immune responses are inducible though they are constitutive of fish immune system exhibiting a basal level of activity even in the absence of pathogen challenge. Keywords: Aeromonas hydrophila, Experimental challenge, Innate immune response, Striped snakehead murrel ...

  7. Work stress and innate immune response. (United States)

    Boscolo, P; Di Gioacchino, M; Reale, M; Muraro, R; Di Giampaolo, L


    Several reports highlight the relationship between blood NK cytotoxic activity and life style. Easy life style, including physical activity, healthy dietary habits as well as good mental health are characterized by an efficient immune response. Life style is related to the type of occupational activity since work has a central part in life either as source of income or contributing to represent the social identity. Not only occupational stress, but also job loss or insecurity are thus considered serious stressful situations, inducing emotional disorders which may affect both neuroendocrine and immune systems; reduced reactivity to mitogens and/or decreased blood NK cytotoxic activity was reported in unemployed workers or in those with a high perception of job insecurity and/or job stress. Although genetic factors have a key role in the pathogenesis of autoimmune disorders, occupational stress (as in night shifts) was reported associated to an increased incidence of autoimmune disorders. Monitoring blood NK response may thus be included in the health programs as an indirect index of stressful job and/or poor lifestyle.

  8. Immune responses to implanted human collagen graft in rats

    International Nuclear Information System (INIS)

    Quteish, D.; Dolby, A.E.


    Immunity to collagen implants may be mediated by cellular and humoral immune responses. To examine the possibility of such immunological reactivity and crossreactivity to collagen, 39 Sprague-Dawley rats (female, 10 weeks old, approximately 250 g wt) were implanted subcutaneously at thigh sites with crosslinked, freeze-dried human placental type I collagen grafts (4x4x2 mm) which had been irradiated (520 Gray) or left untreated. Blood was obtained by intracardiac sampling prior to implantation or from normal rats, and at various times afterwards when the animals were sacrificed. The sera from these animals were examined for circulating antibodies to human, bovine and rat tail (type I) collagens by enzyme-linked immunosorbent assay (ELISA). Also, the lymphoblastogenic responses of spleen lymphocytes from the irradiated collagen-implanted animals were assessed in culture by measuring thymidine uptake with autologous and normal rat sera in the presence of human bovine type I collagens. Implantation of the irradiated and non-irradiated collagen graft in rats led to a significant increase in the level of circulating antibodies to human collagen. Also antibody to bovine and rat tail collagens was detectable in the animals implanted with irradiated collagen grafts but at a lower level than the human collagen. There was a raised lymphoblastogenic response to both human and bovine collagens. The antibody level and lymphoblastogenesis to the tested collagens gradually decreased towards the end of the post-implantation period. (author)

  9. Enhancement of Immune Memory Responses to Respiratory Infection (United States)


    AWARD NUMBER: W81XWH-16-1-0360 TITLE: Enhancement of Immune Memory Responses to Respiratory Infection PRINCIPAL INVESTIGATORs: Dr Min Chen PhD...5a. CONTRACT NUMBER Enhancement of Immune Memory Responses to Respiratory Infection 5b. GRANT NUMBER W81XWH-16-1-0360 5c. PROGRAM ELEMENT NUMBER...entitled “ENHANCEMENT OF IMMUNE MEMORY RESPONSES TO RESPIRATORY INFECTION: AUTOPHAGY IN MEMORY B-CELLS RESPONSE TO INFLUENZA VACCINE (AMBRIV

  10. Humoral Immunity to AAV-6, 8, and 9 in Normal and Dystrophic Dogs (United States)

    Shin, Jin-Hong; Yue, Yongping; Smith, Bruce


    Abstract Adeno-associated virus (AAV)-6, 8, and 9 are promising gene-delivery vectors for testing novel Duchenne muscular dystrophy gene therapy in the canine model. Humoral immunity greatly influences in vivo AAV transduction. However, neutralizing antibodies to AAV-6, 8, and 9 have not been systemically examined in normal and dystrophic dogs. To gain information on the seroprevalence of antibodies to AAV-6, 8, and 9, we measured neutralizing antibody titers using an in vitro transduction inhibition assay. We examined 72 naive serum samples and 26 serum samples obtained from dogs that had received AAV gene transfer. Our data demonstrated that AAV-6 neutralizing antibody was the most prevalent antibody in dogs irrespective of age, gender, disease status (dystrophic or not), and prior parvovirus vaccination history. Surprisingly, high-level anti-AAV-6 antibody was detected at birth in newborn puppies. Further, a robust antibody response was induced in affected, but not normal newborn dogs following systemic AAV gene transfer. Taken together, our data have provided an important baseline on the seroprevalence of AAV-6, 8, and 9 neutralizing antibodies in normal and Duchenne muscular dystrophy dogs. These results will help guide translational AAV gene-therapy studies in dog models of muscular dystrophy. PMID:22040468

  11. Adrenaline influence on the immune response. II

    International Nuclear Information System (INIS)

    Depelchin, A.; Letesson, J.J.


    Experiments were carried out to specify the adrenaline target among the immunocompetent cells. Adrenaline administered for some hours exerted opposite effects on the natural PFC and RFC: the first were enhanced and the second significantly reduced. These paradoxical results were interpreted as a consequence of the inhibition of the suppressor T-cells in the resting status. Adrenaline appeared to act on the sensitive cells through beta- rather than through alpha-receptors. Further experiments on the adrenaline influence on the syngeneic barrier phenomenon and on the cellular balance at its termination seemed to indicate that adrenaline was directly inhibitory for the Ts but not for their precursors. These results are discussed in the light of the cellular networks regulating the immune response. Irradiated mice were compared with non-irradiated mice as described in the previous article. (Auth.)

  12. Population-expression models of immune response

    International Nuclear Information System (INIS)

    Stromberg, Sean P; Antia, Rustom; Nemenman, Ilya


    The immune response to a pathogen has two basic features. The first is the expansion of a few pathogen-specific cells to form a population large enough to control the pathogen. The second is the process of differentiation of cells from an initial naive phenotype to an effector phenotype which controls the pathogen, and subsequently to a memory phenotype that is maintained and responsible for long-term protection. The expansion and the differentiation have been considered largely independently. Changes in cell populations are typically described using ecologically based ordinary differential equation models. In contrast, differentiation of single cells is studied within systems biology and is frequently modeled by considering changes in gene and protein expression in individual cells. Recent advances in experimental systems biology make available for the first time data to allow the coupling of population and high dimensional expression data of immune cells during infections. Here we describe and develop population-expression models which integrate these two processes into systems biology on the multicellular level. When translated into mathematical equations, these models result in non-conservative, non-local advection-diffusion equations. We describe situations where the population-expression approach can make correct inference from data while previous modeling approaches based on common simplifying assumptions would fail. We also explore how model reduction techniques can be used to build population-expression models, minimizing the complexity of the model while keeping the essential features of the system. While we consider problems in immunology in this paper, we expect population-expression models to be more broadly applicable. (paper)

  13. Sex hormones and the immune response in humans

    NARCIS (Netherlands)

    Bouman, Annechien; Heineman, Maas Jan; Faas, Marijke M.


    In addition to their effects on sexual differentiation and reproduction, sex hormones appear to influence the immune system. This results in a sexual dimorphism in the immune response in humans: for instance, females produce more vigorous cellular and more vigorous humoral immune reactions, are more

  14. The Lung Immune Response to Nontypeable Haemophilus influenzae (Lung Immunity to NTHi

    Directory of Open Access Journals (Sweden)

    Paul T. King


    Full Text Available Haemophilus influenzae is divided into typeable or nontypeable strains based on the presence or absence of a polysaccharide capsule. The typeable strains (such as type b are an important cause of systemic infection, whilst the nontypeable strains (designated as NTHi are predominantly respiratory mucosal pathogens. NTHi is present as part of the normal microbiome in the nasopharynx, from where it may spread down to the lower respiratory tract. In this context it is no longer a commensal and becomes an important respiratory pathogen associated with a range of common conditions including bronchitis, bronchiectasis, pneumonia, and particularly chronic obstructive pulmonary disease. NTHi induces a strong inflammatory response in the respiratory tract with activation of immune responses, which often fail to clear the bacteria from the lung. This results in recurrent/persistent infection and chronic inflammation with consequent lung pathology. This review will summarise the current literature about the lung immune response to nontypeable Haemophilus influenzae, a topic that has important implications for patient management.

  15. Non specific immune response in the African catfish ...

    African Journals Online (AJOL)

    Non specific immune response in the African catfish, Heterobranchus longifilis fed diets fortified with ethanolic extracts of selected traditional medicinal plants and disease resistance against Pseudomonas aeruginosa.

  16. Immune response and anamnestic immune response in children after a 3-dose primary hepatitis b vaccination

    International Nuclear Information System (INIS)

    Afzal, M.F.; Sultan, M.A.; Saleemi, A.I.


    Diseases caused by Hepatitis B virus (HBV) have a worldwide distribution. Pakistan adopted the recommendations of World Health Organization (WHO) for routine universal infant vaccination against hepatitis B in 2002, currently being administered at 6, 10, and 14 weeks of age in a combination vaccine. This study was conducted to determine the immune response and anamnestic immune response in children, 9 months-10 years of age, after a 3-dose primary Hepatitis B vaccination. Methods: This cross sectional study was conducted in the Department of Paediatrics, King Edward Medical University/Mayo Hospital, Lahore, Pakistan, from January to June, 2014. A total of 200 children of either sex between the ages of 9 months to 10 years, docu mented to have received 3 doses of hepatitis B vaccines according to Expanded Program of Immunization (6,10,14 weeks) schedule in infancy, were recruited by consecutive sampling. The level of serum anti-HBsAb by ELIZA was measured. Children with anti-HBs titers =10 mIU/mL were considered to be immune. Those with anti-HBsAb levels <10 mIU/mL were offered a booster dose of infant recombinant hepatitis B vaccine. The second serum sample was obtained 21-28 days following the administration of the booster dose and the anamnestic immune response was measured. Data was analysed using SPSS 17 to determine the relation between time interval since last vaccination and antibody titer. Chi square test was applied. Results: Of the 200 children, protective antibody response was found in 58 percent. Median serological response was 18.60 (range 2.82-65.15). Antibody levels were found to have a statistically significant (p-value 0.019) negative correlation with the time since last administration of vaccine. A booster dose of Hepatitis B vaccine was administered to all non-responders, with each registering a statistically significant (p-value 0.00) anamnestic response. Conclusion: The vaccination schedule with short dosage interval was unable to provide

  17. Respons imun humoral pada pulpitis (Humoral immune response on pulpitis)


    Widodo, Trijoedani


    Pulpitis is an inflammation process on dental pulp tissue, and usually as the continuous of caries. The microorganism in the caries is a potential immunogenic triggering the immune respons, both humoral and celluler immune responses. The aim of this research is to explain the humoral immune response changes in the dental pulp tissues of pulpitis. This research was done on three group samples: Irreversible pulpitis, Reversible pulpitis and sound teeth as the control group. The result showed th...

  18. Innate immune response development in nestling tree swallows (United States)

    Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.


    We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.

  19. Regulation of immune responses and tolerance: the microRNA perspective. (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina


    Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. © 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  20. Dynamic Nature of Noncoding RNA Regulation of Adaptive Immune Response

    Directory of Open Access Journals (Sweden)

    Franca Citarella


    Full Text Available Immune response plays a fundamental role in protecting the organism from infections; however, dysregulation often occurs and can be detrimental for the organism, leading to a variety of immune-mediated diseases. Recently our understanding of the molecular and cellular networks regulating the immune response, and, in particular, adaptive immunity, has improved dramatically. For many years, much of the focus has been on the study of protein regulators; nevertheless, recent evidence points to a fundamental role for specific classes of noncoding RNAs (ncRNAs in regulating development, activation and homeostasis of the immune system. Although microRNAs (miRNAs are the most comprehensive and well-studied, a number of reports suggest the exciting possibility that long ncRNAs (lncRNAs could mediate host response and immune function. Finally, evidence is also accumulating that suggests a role for miRNAs and other small ncRNAs in autocrine, paracrine and exocrine signaling events, thus highlighting an elaborate network of regulatory interactions mediated by different classes of ncRNAs during immune response. This review will explore the multifaceted roles of ncRNAs in the adaptive immune response. In particular, we will focus on the well-established role of miRNAs and on the emerging role of lncRNAs and circulating ncRNAs, which all make indispensable contributions to the understanding of the multilayered modulation of the adaptive immune response.

  1. Tetraspanins in the immune response against cancer

    NARCIS (Netherlands)

    Veenbergen, S.; van Spriel, A.B.


    The role of the immune system in the defense against cancer, a process termed tumor immunosurveillance, has been extensively studied. Evidence is accumulating that the molecular organization of proteins and lipids in the plasma membrane of immune cells is of critical importance. Tetraspanin proteins

  2. Frequent adaptive immune responses against arginase-1

    DEFF Research Database (Denmark)

    Martinenaite, Evelina; Mortensen, Rasmus Erik Johansson; Hansen, Morten


    The enzyme arginase-1 reduces the availability of arginine to tumor-infiltrating immune cells, thus reducing T-cell functionality in the tumor milieu. Arginase-1 is expressed by some cancer cells and by immune inhibitory cells, such as myeloid-derived suppressor cells (MDSCs) and tumor-associated...

  3. Long-chain inulin for stimulating an immune response

    NARCIS (Netherlands)

    de Vos, Paulus; Vogt, Leonie


    The invention relates to a long chain inulin for influencing the immune response against a pathogen. The invention also relates to a combination comprising a long chain inulin and a vaccine for influencing the immune response against a pathogen, wherein the long chain inulin is orally administrated.

  4. Risk factors for discordant immune response among HIV-infected ...

    African Journals Online (AJOL)

    Risk factors for discordant immune response among HIV-infected patients initiating antiretroviral therapy: A retrospective cohort study. ... Multivariate logistic regression models were used to estimate adjusted odds ratios (AORs) to determine associations between discordant immune response and clinical and demographic ...

  5. Importins and Exportins Regulating Allergic Immune Responses

    Directory of Open Access Journals (Sweden)

    Ankita Aggarwal


    Full Text Available Nucleocytoplasmic shuttling of macromolecules is a well-controlled process involving importins and exportins. These karyopherins recognize and bind to receptor-mediated intracellular signals through specific signal sequences that are present on cargo proteins and transport into and out of the nucleus through nuclear pore complexes. Nuclear localization signals (NLS present on cargo molecules to be imported while nuclear export signals (NES on the molecules to be exported are recognized by importins and exportins, respectively. The classical NLS are found on many transcription factors and molecules that are involved in the pathogenesis of allergic diseases. In addition, several immune modulators, including corticosteroids and vitamin D, elicit their cellular responses by regulating the expression and activity of importin molecules. In this review article, we provide a comprehensive list of importin and exportin molecules and their specific cargo that shuttled between cytoplasm and the nucleus. We also critically review the role and regulation of specific importin and exportin involved in the transport of activated transcription factors in allergic diseases, the underlying molecular mechanisms, and the potential target sites for developing better therapeutic approaches.

  6. Linear ubiquitination signals in adaptive immune responses. (United States)

    Ikeda, Fumiyo


    Ubiquitin can form eight different linkage types of chains using the intrinsic Met 1 residue or one of the seven intrinsic Lys residues. Each linkage type of ubiquitin chain has a distinct three-dimensional topology, functioning as a tag to attract specific signaling molecules, which are so-called ubiquitin readers, and regulates various biological functions. Ubiquitin chains linked via Met 1 in a head-to-tail manner are called linear ubiquitin chains. Linear ubiquitination plays an important role in the regulation of cellular signaling, including the best-characterized tumor necrosis factor (TNF)-induced canonical nuclear factor-κB (NF-κB) pathway. Linear ubiquitin chains are specifically generated by an E3 ligase complex called the linear ubiquitin chain assembly complex (LUBAC) and hydrolyzed by a deubiquitinase (DUB) called ovarian tumor (OTU) DUB with linear linkage specificity (OTULIN). LUBAC linearly ubiquitinates critical molecules in the TNF pathway, such as NEMO and RIPK1. The linear ubiquitin chains are then recognized by the ubiquitin readers, including NEMO, which control the TNF pathway. Accumulating evidence indicates an importance of the LUBAC complex in the regulation of apoptosis, development, and inflammation in mice. In this article, I focus on the role of linear ubiquitin chains in adaptive immune responses with an emphasis on the TNF-induced signaling pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Immune markers and correlates of protection for vaccine induced immune responses

    DEFF Research Database (Denmark)

    Thakur, Aneesh; Pedersen, Lasse Eggers; Jungersen, Gregers


    of an appropriate humoral response currently remain the best validated correlates of protective immunity after vaccination. Despite advancements in the field of immunology over the past few decades currently there are, however, no sufficiently validated immune correlates of vaccine induced protection against......-specific production of interferon-gamma (IFN-γ) has been promoted as a quantitative marker of protective cell-mediated immune responses over the past couple of decades. More recently, however, evidence from several infections has pointed towards the quality of the immune response, measured through increased levels...... of antigen-specific polyfunctional T cells capable of producing a triad of relevant cytokines, as a better correlate of sustained protective immunity against this type of infections. Also the possibilities to measure antigen-specific cytotoxic T cells (CTL) during infection or in response to vaccination...

  8. Immune response induction in the central nervous system

    DEFF Research Database (Denmark)

    Owens, Trevor; Babcock, Alicia


    The primary function of the immune response is protection of the host against infection with pathogens, including viruses. Since viruses can infect any tissue of the body, including the central nervous system (CNS), it is logical that cells of the immune system should equally have access to all...... tissues. Nevertheless, the brain and spinal cord are noted for their lack of immune presence. Relative to other organ systems, the CNS appears immunologically privileged. Furthermore, when immune responses do occur in the CNS, they are frequently associated with deleterious effects such as inflammatory...

  9. The innate immune response during urinary tract infection and pyelonephritis. (United States)

    Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S


    Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.

  10. Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight (United States)

    Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila


    Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297

  11. Innate immune responses of Drosophila melanogaster are altered by spaceflight.

    Directory of Open Access Journals (Sweden)

    Oana Marcu


    Full Text Available Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways.

  12. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens.


    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H


    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The...

  13. Immunomodulator-based enhancement of anti smallpox immune responses. (United States)

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel


    The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.

  14. Interplay between behavioural thermoregulation and immune response in mealworms. (United States)

    Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco


    Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Functional characterization of Foxp3-specific spontaneous immune responses

    DEFF Research Database (Denmark)

    Larsen, Susanne Købke; Munir, S; Andersen, Anders Woetmann


    Tumor-infiltrating CD4+CD25+ regulatory T cells (Tregs) are associated with an impaired prognosis in several cancers. The transcription factor forkhead box P3 (Foxp3) is generally expressed in Tregs. Here, we identify and characterize spontaneous cytotoxic immune responses to Foxp3-expressing cel....... Consequently, induction of Foxp3-specific cytotoxic T-cell responses appears as an attractive tool to boost spontaneous or therapeutically provoked immune responses, for example, for the therapy of cancer....

  16. The Role of the Immune Response in Merkel Cell Carcinoma

    International Nuclear Information System (INIS)

    Triozzi, Pierre L.; Fernandez, Anthony P.


    Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer. The Merkel cell polyomavirus (MCPyV) is implicated in its pathogenesis. Immune mechanisms are also implicated. Patients who are immunosuppressed have an increased risk. There is evidence that high intratumoral T-cell counts and immune transcripts are associated with favorable survival. Spontaneous regressions implicate immune effector mechanisms. Immunogenicity is also supported by observation of autoimmune paraneoplastic syndromes. Case reports suggest that immune modulation, including reduction of immune suppression, can result in tumor regression. The relationships between MCPyV infection, the immune response, and clinical outcome, however, remain poorly understood. Circulating antibodies against MCPyV antigens are present in most individuals. MCPyV-reactive T cells have been detected in both MCC patients and control subjects. High intratumoral T-cell counts are also associated with favorable survival in MCPyV-negative MCC. That the immune system plays a central role in preventing and controlling MCC is supported by several observations. MCCs often develop, however, despite the presence of humoral and cellular immune responses. A better understanding on how MCPyV and MCC evade the immune response will be necessary to develop effective immunotherapies

  17. The Role of the Immune Response in Merkel Cell Carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Triozzi, Pierre L., E-mail: [Taussig Cancer Institute, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195 (United States); Fernandez, Anthony P. [Departments of Dermatology and Anatomic Pathology, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195 (United States)


    Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer. The Merkel cell polyomavirus (MCPyV) is implicated in its pathogenesis. Immune mechanisms are also implicated. Patients who are immunosuppressed have an increased risk. There is evidence that high intratumoral T-cell counts and immune transcripts are associated with favorable survival. Spontaneous regressions implicate immune effector mechanisms. Immunogenicity is also supported by observation of autoimmune paraneoplastic syndromes. Case reports suggest that immune modulation, including reduction of immune suppression, can result in tumor regression. The relationships between MCPyV infection, the immune response, and clinical outcome, however, remain poorly understood. Circulating antibodies against MCPyV antigens are present in most individuals. MCPyV-reactive T cells have been detected in both MCC patients and control subjects. High intratumoral T-cell counts are also associated with favorable survival in MCPyV-negative MCC. That the immune system plays a central role in preventing and controlling MCC is supported by several observations. MCCs often develop, however, despite the presence of humoral and cellular immune responses. A better understanding on how MCPyV and MCC evade the immune response will be necessary to develop effective immunotherapies.

  18. Pleurodeles Waltl Humoral Immune Response under Spaceflight Conditions (United States)

    Bascove, Matthieu; Touche, Nadege; Frippiat, Jean-Pol


    The immune system is an important regulatory mechanism affected by spaceflights. In a previous work, we performed a first study of the humoral immune response induced by the immunization of Pleurodeles waltl during a 5 months stay onboard the Mir space station. This analysis indicated that heavy-chain variable domains of specific IgM are encoded by genes of the VHII and VHVI families. However, the contributions of these two families to IgM heavy-chains are different in flown animals [1]. To better understand this immune response modification, we have now determined how individual VH genes have been used to build specific IgM binding sites in animals immunized on earth or in space. This new study revealed quantitative and qualitative modifications in VH genes expression. These data confirm that a spaceflight might affect the humoral response.

  19. Heavy metal pollution disturbs immune response in wild ant populations

    International Nuclear Information System (INIS)

    Sorvari, Jouni; Rantala, Liisa M.; Rantala, Markus J.; Hakkarainen, Harri; Eeva, Tapio


    Concern about the effects of environmental contaminants on immune function in both humans and wildlife is growing and practically nothing is known about this impact on terrestrial invertebrates, even though they are known to easily accumulate pollutants. We studied the effect of industrial heavy metal contamination on immune defense of a free-living wood ant (Formica aquilonia). To find out whether ants show an adapted immune function in a polluted environment, we compared encapsulation responses between local and translocated colonies. Local colonies showed higher heavy metal levels than the translocated ones but the encapsulation response was similar between the two groups, indicating that the immune system of local ants has not adapted to high contamination level. The encapsulation response was elevated in moderate whereas suppressed in high heavy metal levels suggesting higher risk for infections in heavily polluted areas. - Heavy metal pollution affects immune function in ants

  20. Hepatitis B Virus Vaccine immune response in Egyptian children 15 ...

    African Journals Online (AJOL)

    Egypt J Pediatr Allergy Immunol 2015;13(2):45-48. 45. Hepatitis B Virus Vaccine immune response in Egyptian children 15-17 years after primary immunization; should we provide a booster dose? INTRODUCTION. Hepatitis B virus (HBV) infection is a global public health problem. With approximately 350 million hepatitis B ...

  1. Humoral and cellular immune responses to modified hepatitis B ...

    African Journals Online (AJOL)

    Purpose: To evaluate the immunogenicity and types of immune response of a quality-controlled modified recombinant hepatitis B surface antigen (HBsAg) plasmid encoding HBsAg in mice. Methods: The characterized plasmid DNA was used in the immunization of Balb/c mice. Three groups of mice were intramuscularly ...

  2. Modulation of the immune response by emotional stress

    NARCIS (Netherlands)

    Croiset, G; Heijnen, C J; Veldhuis, H D; de Wied, D; Ballieux, R E


    The influence of mild, emotional stress was investigated for its effect on the immune system by subjecting rats to the one-trial-learning passive avoidance test. The reactivity of the immune system was tested by determining the proliferative response after mitogenic stimulation in vitro as well as

  3. Reprogramming Antitumor Immune Responses with microRNAs (United States)


    disease, including cancer etiology (4) and the generation and inhibition of antitumor immune responses (5–9). Biologically active miRNAs bind to MREs...breast, colorectal, lung, pancreatic , and thyroid carcinomas and in liquid tumors including lymphomas and some acute myeloid leukemias (9, 35). The...immunity [9], underscoring the potential of targeting this major microenvironmental compartment. Accumulating evidence suggests that chronic

  4. The sterile immune response during hepatic ischemia/reperfusion

    NARCIS (Netherlands)

    van Golen, Rowan F.; van Gulik, Thomas M.; Heger, Michal


    Hepatic ischemia and reperfusion elicits an immune response that lacks a microbial constituent yet poses a potentially lethal threat to the host. In this sterile setting, the immune system is alarmed by endogenous danger signals that are release by stressed and dying liver cells. The detection of

  5. Immune and stress responses in oysters with insights on adaptation. (United States)

    Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude


    Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Models for Immune Response and Immune Evasion in MSI Cancer and Lynch Syndrome


    Özcan, Mine


    Microsatellite-unstable (MSI) cancers occurring in the context of the hereditary Lynch syndrome or as sporadic cancers elicit pronounced tumor-specific immune responses. The pronounced immune response was shown to be closely associated with frameshift peptides (FSP) that are generated as a result of deficiency in DNA mismatch repair system leading to insertion/deletion mutations in coding microsatellites (cMS). FSP neoantigens are long antigenic amino acid stretches that bear m...

  7. Predictors of responses to immune checkpoint blockade in advanced melanoma

    DEFF Research Database (Denmark)

    Jacquelot, N; Roberti, M P; Enot, D P


    Immune checkpoint blockers (ICB) have become pivotal therapies in the clinical armamentarium against metastatic melanoma (MMel). Given the frequency of immune related adverse events and increasing use of ICB, predictors of response to CTLA-4 and/or PD-1 blockade represent unmet clinical needs....... Using a systems biology-based approach to an assessment of 779 paired blood and tumor markers in 37 stage III MMel patients, we analyzed association between blood immune parameters and the functional immune reactivity of tumor-infiltrating cells after ex vivo exposure to ICB. Based on this assay, we...

  8. A Protocol for the Comprehensive Flow Cytometric Analysis of Immune Cells in Normal and Inflamed Murine Non-Lymphoid Tissues (United States)

    Yu, Yen-Rei A.; O’Koren, Emily G.; Hotten, Danielle F.; Kan, Matthew J.; Kopin, David; Nelson, Erik R.; Que, Loretta; Gunn, Michael D.


    Flow cytometry is used extensively to examine immune cells in non-lymphoid tissues. However, a method of flow cytometric analysis that is both comprehensive and widely applicable has not been described. We developed a protocol for the flow cytometric analysis of non-lymphoid tissues, including methods of tissue preparation, a 10-fluorochrome panel for cell staining, and a standardized gating strategy, that allows the simultaneous identification and quantification of all major immune cell types in a variety of normal and inflamed non-lymphoid tissues. We demonstrate that our basic protocol minimizes cell loss, reliably distinguishes macrophages from dendritic cells (DC), and identifies all major granulocytic and mononuclear phagocytic cell types. This protocol is able to accurately quantify 11 distinct immune cell types, including T cells, B cells, NK cells, neutrophils, eosinophils, inflammatory monocytes, resident monocytes, alveolar macrophages, resident/interstitial macrophages, CD11b- DC, and CD11b+ DC, in normal lung, heart, liver, kidney, intestine, skin, eyes, and mammary gland. We also characterized the expression patterns of several commonly used myeloid and macrophage markers. This basic protocol can be expanded to identify additional cell types such as mast cells, basophils, and plasmacytoid DC, or perform detailed phenotyping of specific cell types. In examining models of primary and metastatic mammary tumors, this protocol allowed the identification of several distinct tumor associated macrophage phenotypes, the appearance of which was highly specific to individual tumor cell lines. This protocol provides a valuable tool to examine immune cell repertoires and follow immune responses in a wide variety of tissues and experimental conditions. PMID:26938654

  9. Invitro immune responses in children following BCG vaccination

    Directory of Open Access Journals (Sweden)

    Vijayalakshmi V


    Full Text Available Introduction: There is still no consensus on the efficacy of BCG vaccine in the prevention of tuberculosis. This study therefore addressed the question of the magnitude of immunity afforded by BCG, by studying the effector mechanisms of protection in children. The main objectives were to assess the degree of immunity conferred by BCG vaccine in children and to identify the most immunogenic antigen(s of BCG by conducting in-vitro studies. Materials and methods: Children in the age-group of 1 to 10 years, were categorized: (A normal, and vaccinated with BCG during the first year, n=45, (B normal, without scar and with no evident history of vaccination, n=31: and (C children admitted in the hospital with a confirmed diagnosis of tuberculosis, n=31. Fractions of BCG were obtained by lysis, sonication, separation by gel chromatography, HPLC and confirmed by SDS-PAGE. In lymphoproliferative assays PBMC were cultured and stimulated with either Concanavalin-A or Tuberculin or the fractions of BCG. Stimulation indices (SI in lymphoproliferation, CD4/CD8 cells, levels of Interferon-γ (IFN- γ in the culture supernatants were measured by ELISA. Results: The vaccinated children displayed significantly high (P< 0.05 mean values of SI in LTT, CD4/CD8 cell ratio against the unfractionated, 67kDa fraction and BCG-CF Ags. While 100% of the vaccinated children had positive lymphoproliferation indices to BCG-CF, only 8.3% of the unvaccinated children were positive. Conclusion: Some of the components of BCG induced a strong Thl cell response in children. These immunogenic antigens were present in the whole cell lysate. The use of BCG vaccine for tuberculosis is worthwhile till a new vaccine is developed.

  10. Immune responses to red blood cell antigens

    NARCIS (Netherlands)

    Stegmann, T.C.


    The research described in this thesis is aimed towards elucidation of the mechanism of action of anti-D. Anti-D is administered prophylactivly to prevent alloimmunization against the immunogenic D-antigen to D⁻ pregnant women carrying a D⁺ fetus. The plasma of women who became immunized during

  11. Immune response capacity after human splenic autotransplantation - Restoration of response to individual pneumococcal vaccine subtypes

    NARCIS (Netherlands)

    Leemans, R; Manson, W; Snijder, JAM; Smit, JW; Klasen, HJ; The, TH; Timens, W

    Objective To evaluate features of general immune function, in particular the restoration of the humoral immune response to pneumococcal capsular polysaccharides, in humans undergoing a spleen autotransplantation after splenectomy because of trauma. Summary Background Data After splenectomy, patients

  12. [Effect of vitamine A on mice immune response induced by specific periodontal pathogenic bacteria-immunization]. (United States)

    Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai


    The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (Pvitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).

  13. DNA Damage Response and Immune Defence: Links and Mechanisms

    Directory of Open Access Journals (Sweden)

    Björn Schumacher


    Full Text Available DNA damage plays a causal role in numerous human pathologies including cancer, premature aging and chronic inflammatory conditions. In response to genotoxic insults, the DNA damage response (DDR orchestrates DNA damage checkpoint activation and facilitates the removal of DNA lesions. The DDR can also arouse the immune system by for example inducing the expression of antimicrobial peptides as well as ligands for receptors found on immune cells. The activation of immune signalling is triggered by different components of the DDR including DNA damage sensors, transducer kinases, and effectors. In this review, we describe recent advances on the understanding of the role of DDR in activating immune signalling. We highlight evidence gained into (i which molecular and cellular pathways of DDR activate immune signalling, (ii how DNA damage drives chronic inflammation, and (iii how chronic inflammation causes DNA damage and pathology in humans.

  14. Characterization and role of the immune response during ligament healing (United States)

    Chamberlain, Connie S.

    Scar formation of ligaments after rupture remains a great challenge. Ligament healing involves a complex, coordinated series of events that form a neo-ligament, which is more disorganized and fibrotic in character than the native tissue. The repair process may extend from months to years, and the injured ligament never fully recovers its original mechanical properties. With little intrinsic healing potential, ruptures of the anterior cruciate ligament (ACL) are usually reconstructed. The "healed" tissues, however, do not regenerate native tissues or recapitulate their mechanical function. ACL grafts often lengthen (incidents range from 40-100%) and their strength can drop by ˜50% after remodeling. Reconstructed knees are often less stable and fail to restore normal joint kinematics. Our overall goal is to improve healing, making ligaments more regenerative. The first 2 studies characterized ligament healing in a spatial and temporal manner over 28 days. The experiments demonstrated creeping substitution and the potential role of the immune system to control the repair and/or regenerative process. From these studies, macrophages were identified as significant players during healing. Macrophages paralleled creeping substitution, were abundant within the healing ligament, and potentially played a destructive role via matrix phagocytosis. The role of macrophages during early ligament healing was then evaluated using liposome-encapsulated clodronate to inhibit phagocytosing macrophages. Clodronate attenuated the early infiltration of macrophages, resulting in delayed structural and functional healing. Macrophage re-infiltration into the wound resulted in continued ligament healing. These results suggested that early inhibition of phagocytosing macrophages is detrimental to ligament healing. The final experiment evaluated the effects of interleukin-4 on ligament healing. Interleukin-4 (IL-4) is reported to stimulate the Th2 lymphocyte/M2 macrophage pathway, reducing

  15. Respons imun humoral pada pulpitis (Humoral immune response on pulpitis

    Directory of Open Access Journals (Sweden)

    Trijoedani Widodo


    Full Text Available Pulpitis is an inflammation process on dental pulp tissue, and usually as the continuous of caries. The microorganism in the caries is a potential immunogenic triggering the immune respons, both humoral and celluler immune responses. The aim of this research is to explain the humoral immune response changes in the dental pulp tissues of pulpitis. This research was done on three group samples: Irreversible pulpitis, Reversible pulpitis and sound teeth as the control group. The result showed that there were three pulpitis immunopathologic patterns: the sound teeth immunopathologic pattern showing a low humoral immune response, in a low level of IgG, IgA and IgM, the reversible pulpitis pattern showing that in a higher humoral immune response, IgG and IgA decreased but IgM increased, the irreversible pulpitis pattern showing that IgG and IgM increased, but it couldn't be repaired although it has highly immunity, and it showed an unusually low level of IgA. This low level of IgA meant that irreversible pulpitis had a low mucosal immunity.

  16. Immune responses at brain barriers and implications for brain development and neurological function in later life

    Directory of Open Access Journals (Sweden)

    Helen B. Stolp


    Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

  17. Human Immune Response to Dengue Infections (United States)


    had been immunized with yellow fever vaccine and later became infected with dengue 3 virus, responded best to dengue 3 antigen but also responded to...effective dengue virus subunit vaccines . We found evidence of marked T cell activation in patients with DHF. T cell activation in patients with DF was similar...Treatment and Control of Dengue Hemorrhagic Fever. World Health Organization, Geneva, Switzerland 7. Sabin AB (1952) Research on dengue during World

  18. Evaluation of mucosal and systemic immune responses elicited by GPI-0100- adjuvanted influenza vaccine delivered by different immunization strategies.

    Directory of Open Access Journals (Sweden)

    Heng Liu

    Full Text Available Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN or the intrapulmonary (IPL route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses.

  19. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100- Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies (United States)

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke


    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066

  20. Optimal approximation of linear systems by artificial immune response

    Institute of Scientific and Technical Information of China (English)


    This paper puts forward a novel artificial immune response algorithm for optimal approximation of linear systems. A quaternion model of artificial immune response is proposed for engineering computing. The model abstracts four elements, namely, antigen, antibody, reaction rules among antibodies, and driving algorithm describing how the rules are applied to antibodies, to simulate the process of immune response. Some reaction rules including clonal selection rules, immunological memory rules and immune regulation rules are introduced. Using the theorem of Markov chain, it is proofed that the new model is convergent. The experimental study on the optimal approximation of a stable linear system and an unstable one show that the approximate models searched by the new model have better performance indices than those obtained by some existing algorithms including the differential evolution algorithm and the multi-agent genetic algorithm.

  1. Characterization of host immune responses in Ebola virus infections. (United States)

    Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo


    Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.

  2. Maternal immunity enhances Mycoplasma hyopneumoniae vaccination induced cell-mediated immune responses in piglets. (United States)

    Bandrick, Meggan; Theis, Kara; Molitor, Thomas W


    Passively acquired maternal derived immunity (MDI) is a double-edged sword. Maternal derived antibody-mediated immunity (AMI) and cell-mediated immunity (CMI) are critical immediate defenses for the neonate; however, MDI may interfere with the induction of active immunity in the neonate, i.e. passive interference. The effect of antigen-specific MDI on vaccine-induced AMI and CMI responses to Mycoplasma hyopneumoniae (M. hyopneumoniae) was assessed in neonatal piglets. To determine whether CMI and AMI responses could be induced in piglets with MDI, piglets with high and low levels of maternal M. hyopneumoniae-specific immunity were vaccinated against M. hyopneumoniae at 7 d of age. Piglet M. hyopneumoniae-specific antibody, lymphoproliferation, and delayed type hypersensitivity (DTH) responses were measured 7 d and 14 d post vaccination. Piglets with M. hyopneumoniae-specific MDI failed to show vaccine-induced AMI responses; there was no rise in M. hyopneumoniae antibody levels following vaccination of piglets in the presence of M. hyopneumoniae-specific MDI. However, piglets with M. hyopneumoniae-specific MDI had primary (antigen-specific lymphoproliferation) and secondary (DTH) M. hyopneumoniae-specific CMI responses following vaccination. In this study neonatal M. hyopneumoniae-specific CMI was not subject to passive interference by MDI. Further, it appears that both maternal derived and endogenous CMI contribute to M. hyopneumoniae-specific CMI responses in piglets vaccinated in the face of MDI.

  3. Initiation of innate immune responses by surveillance of homeostasis perturbations. (United States)

    Colaço, Henrique G; Moita, Luis F


    Pathogen recognition, signaling transduction pathways, and effector mechanisms are necessary steps of innate immune responses that play key roles in the early phase of defense and in the stimulation of the later specific response of adaptive immunity. Here, we argue that in addition to the direct recognition of conserved common structural and functional molecular signatures of microorganisms using pattern recognition receptors, hosts can mount an immune response following the sensing of disruption in homeostasis as proximal reporters for infections. Surveillance of disruption of core cellular activities leading to defense responses is a flexible strategy that requires few additional components and that can effectively detect relevant threats. It is likely to be evolutionarily very conserved and ancient because it is operational in organisms that lack pattern recognition triggered immunity. A homeostasis disruption model of immune response initiation and modulation has broad implications for pathophysiology and treatment of disease and might constitute an often overlooked but central component of a comprehensive conceptual framework for innate immunity. © 2016 Federation of European Biochemical Societies.

  4. Agouron and immune response to commercialize remune immune-based treatment. (United States)

    James, J S


    Agouron Pharmaceuticals agreed in June to collaborate with The Immune Response Corporation on the final development and marketing of an immune-based treatment for HIV. Remune, the vaccine developed by Dr. Jonas Salk, is currently in Phase III randomized trials with 2,500 patients, and the trials are expected to be completed in April 1999. Immune-based treatments have been difficult to test, as there is no surrogate marker, like viral load, to determine if the drug is working. Agouron agreed to participate in the joint venture after reviewing encouraging results from preliminary trials in which remune was taken in combination with highly active antiretroviral drugs.

  5. Modulation of systemic immune responses through commensal gastrointestinal microbiota.

    Directory of Open Access Journals (Sweden)

    Kyle M Schachtschneider

    Full Text Available Colonization of the gastrointestinal (GI tract is initiated during birth and continually seeded from the individual's environment. Gastrointestinal microorganisms play a central role in developing and modulating host immune responses and have been the subject of investigation over the last decades. Animal studies have demonstrated the impact of GI tract microbiota on local gastrointestinal immune responses; however, the full spectrum of action of early gastrointestinal tract stimulation and subsequent modulation of systemic immune responses is poorly understood. This study explored the utility of an oral microbial inoculum as a therapeutic tool to affect porcine systemic immune responses. For this study a litter of 12 pigs was split into two groups. One group of pigs was inoculated with a non-pathogenic oral inoculum (modulated, while another group (control was not. DNA extracted from nasal swabs and fecal samples collected throughout the study was sequenced to determine the effects of the oral inoculation on GI and respiratory microbial communities. The effects of GI microbial modulation on systemic immune responses were evaluated by experimentally infecting with the pathogen Mycoplasma hyopneumoniae. Coughing levels, pathology, toll-like receptors 2 and 6, and cytokine production were measured throughout the study. Sequencing results show a successful modulation of the GI and respiratory microbiomes through oral inoculation. Delayed type hypersensitivity responses were stronger (p = 0.07, and the average coughing levels and respiratory TNF-α variance were significantly lower in the modulated group (p<0.0001 and p = 0.0153, respectively. The M. hyopneumoniae infection study showed beneficial effects of the oral inoculum on systemic immune responses including antibody production, severity of infection and cytokine levels. These results suggest that an oral microbial inoculation can be used to modulate microbial communities, as well as

  6. Flavobacterium psychrophilum, prevention and immune response

    DEFF Research Database (Denmark)

    Henriksen, Maya Maria Mihályi; Dalsgaard, Inger

    The fish pathogen Flavobacterium psychrophilum is one of the main causes of mortality in farmed rainbow trout and other salmonid fish. The disease following infection is often called bacterial coldwater disease (BCWD) in USA or rainbow trout fry syndrome (RTFS) in Europe. An infected farm can exp...... goal is to examine gene expression and location of transcription products in rainbow trout fry, in order to optimize vaccination or immune-stimulation. The presentation will focus on the future plans for the project, since no data have yet been obtained....

  7. Immunomodulator-based enhancement of anti smallpox immune responses.

    Directory of Open Access Journals (Sweden)

    Osmarie Martínez

    Full Text Available The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists, and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein.We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation.The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections.These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.

  8. Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses (United States)

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L.; Ríos-Olivares, Eddy; Otero, Miguel


    Background The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. Methods We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. Results The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. Conclusion These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform. PMID:25875833

  9. Trachoma: protective and pathogenic ocular immune responses to Chlamydia trachomatis.

    Directory of Open Access Journals (Sweden)

    Victor H Hu

    Full Text Available Trachoma, caused by Chlamydia trachomatis (Ct, is the leading infectious blinding disease worldwide. Chronic conjunctival inflammation develops in childhood and leads to eyelid scarring and blindness in adulthood. The immune response to Ct provides only partial protection against re-infection, which can be frequent. Moreover, the immune response is central to the development of scarring pathology, leading to loss of vision. Here we review the current literature on both protective and pathological immune responses in trachoma. The resolution of Ct infection in animal models is IFNγ-dependent, involving Th1 cells, but whether this is the case in human ocular infection still needs to be confirmed. An increasing number of studies indicate that innate immune responses arising from the epithelium and other innate immune cells, along with changes in matrix metalloproteinase activity, are important in the development of tissue damage and scarring. Current trachoma control measures, which are centred on repeated mass antibiotic treatment of populations, are logistically challenging and have the potential to drive antimicrobial resistance. A trachoma vaccine would offer significant advantages. However, limited understanding of the mechanisms of both protective immunity and immunopathology to Ct remain barriers to vaccine development.

  10. Transgenerational effects enhance specific immune response in a wild passerine

    Directory of Open Access Journals (Sweden)

    Juli Broggi


    Full Text Available Vertebrate mothers transfer diverse compounds to developing embryos that can affect their development and final phenotype (i.e., maternal effects. However, the way such effects modulate offspring phenotype, in particular their immunity, remains unclear. To test the impact of maternal effects on offspring development, we treated wild breeding house sparrows (Passer domesticus in Sevilla, SE Spain with Newcastle disease virus (NDV vaccine. Female parents were vaccinated when caring for first broods, eliciting a specific immune response to NDV. The immune response to the same vaccine, and to the PHA inflammatory test were measured in 11-day-old chicks from their following brood. Vaccinated chicks from vaccinated mothers developed a stronger specific response that was related to maternal NDV antibody concentration while rearing their chicks. The chicks’ carotenoid concentration and total antioxidant capacity in blood were negatively related to NDV antibody concentration, whereas no relation with PHA response was found. Specific NDV antibodies could not be detected in 11-day-old control chicks from vaccinated mothers, implying that maternally transmitted antibodies are not directly involved but may promote offspring specific immunity through a priming effect, while other immunity components remain unaffected. Maternally transmitted antibodies in the house sparrow are short-lived, depend on maternal circulation levels and enhance pre-fledging chick specific immunity when exposed to the same pathogens as the mothers.

  11. Balancing immune protection and immune pathology by CD8+ T cell responses to influenza infection

    Directory of Open Access Journals (Sweden)

    Susu eDuan


    Full Text Available Influenza A virus (IAV is a significant human pathogen causing annual epidemics and periodic pandemics. CD8+ cytotoxic T lymphocyte (CTL-mediated immunity contributes to clearance of virus-infected cells; CTL immunity targeting the conserved internal proteins of IAVs is a key protection mechanism when neutralizing antibodies are absent during heterosubtypic IAV infection. However, CTL infiltration into the airways, their cytotoxicity, and the effects of produced pro-inflammatory cytokines can cause severe lung tissue injury, thereby contributing to immunopathology. Studies have discovered complicated and exquisite stimulatory and inhibitory mechanisms that regulate CTL magnitude and effector activities during IAV infection. Here, we review the state of knowledge on the roles of IAV-specific CTLs in immune protection and immunopathology during IAV infection in animal models, highlighting the key findings of various requirements and constraints regulating the balance of immune protection and pathology involved in CTL immunity. We also discuss the evidence of cross-reactive CTL immunity as a positive correlate of cross-subtype protection during secondary IAV infection in both animal and human studies. We argue that the effects of CTL immunity on protection and immunopathology depend on multiple layers of host and viral factors, including complex host mechanisms to regulate CTL magnitude and effector activity, the pathogenic nature of the IAV, the innate response milieu, and the host historical immune context of influenza infection. Future efforts are needed to further understand these key host and viral factors, especially to differentiate those that constrain optimally effective CTL anti-viral immunity from those necessary to restrain CTL-mediated nonspecific immunopathology in the various contexts of IAV infection, in order to develop better vaccination and therapeutic strategies for modifying protective CTL immunity.

  12. The immune response against Candida spp. and Sporothrix schenckii. (United States)

    Martínez-Álvarez, José A; Pérez-García, Luis A; Flores-Carreón, Arturo; Mora-Montes, Héctor M


    Candida albicans is the main causative agent of systemic candidiasis, a condition with high mortality rates. The study of the interaction between C. albicans and immune system components has been thoroughly studied and nowadays there is a model for the anti-C. albicans immune response; however, little is known about the sensing of other pathogenic species of the Candida genus. Sporothrix schenckii is the causative agent of sporotrichosis, a subcutaneous mycosis, and thus far there is limited information about its interaction with the immune system. In this paper, we review the most recent information about the immune sensing of species from genus Candida and S. schenckii. Thoroughly searches in scientific journal databases were performed, looking for papers addressing either Candida- or Sporothrix-immune system interactions. There is a significant advance in the knowledge of non-C. albicans species of Candida and Sporothrix immune sensing; however, there are still relevant points to address, such as the specific contribution of pathogen-associated molecular patterns (PAMPs) for sensing by different immune cells and the immune receptors involved in such interactions. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  13. A modified live canine parvovirus vaccine. II. Immune response. (United States)

    Carmichael, L E; Joubert, J C; Pollock, R V


    The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.

  14. A simple non-linear model of immune response

    International Nuclear Information System (INIS)

    Gutnikov, Sergei; Melnikov, Yuri


    It is still unknown why the adaptive immune response in the natural immune system based on clonal proliferation of lymphocytes requires interaction of at least two different cell types with the same antigen. We present a simple mathematical model illustrating that the system with separate types of cells for antigen recognition and patogen destruction provides more robust adaptive immunity than the system where just one cell type is responsible for both recognition and destruction. The model is over-simplified as we did not have an intention of describing the natural immune system. However, our model provides a tool for testing the proposed approach through qualitative analysis of the immune system dynamics in order to construct more sophisticated models of the immune systems that exist in the living nature. It also opens a possibility to explore specific features of highly non-linear dynamics in nature-inspired computational paradigms like artificial immune systems and immunocomputing . We expect this paper to be of interest not only for mathematicians but also for biologists; therefore we made effort to explain mathematics in sufficient detail for readers without professional mathematical background

  15. [Bone marrow stromal damage mediated by immune response activity]. (United States)

    Vojinović, J; Kamenov, B; Najman, S; Branković, Lj; Dimitrijević, H


    The aim of this work was to estimate influence of activated immune response on hematopoiesis in vitro, using the experimental model of BCG immunized BALB/c mice and in patients with chronic immunoactivation: long-lasting infections, autoimmunity or malignancy. We correlated changes in long term bone marrow cultures (Dexter) and NBT reduction with appearance of anemia in patients and experimental model of immunization by BCG. Increased spontaneous NBT reduction pointed out role of macrophage activation in bone marrow stroma damage. Long-term bone marrow cultures showed reduced number of hematopoietic cells, with predomination of fibroblasts and loss of fat cells. This results correlated with anemia and leucocytosis with stimulated myelopoiesis in peripheral blood. Activation of immune response, or acting of any agent that directly changes extracellular matrix and cellularity of bone marrow, may result in microenviroment bone marrow damage that modify hematopoiesis.

  16. The Impact of Ultraviolet Radiation on Immune Responses (invited paper)

    International Nuclear Information System (INIS)

    Norval, M.


    In addition to its genotoxic and mutagenic effects, UV has the capacity to suppress immune responses. The mechanism involved is complex, beginning with chromophores located in the skin which absorb UV, this leading in turn to changes in the production of a range of immune mediators locally and systemically which then induce phenotypic and functional alterations in antigen presentation. The cascade ends with the promotion of a subset of T-cells downregulating cell-mediated immunity. The possible consequences of this immunomodulation for the control of tumours and infectious diseases require careful evaluation from laboratory and human studies. (author)

  17. The nature of immune responses to urinary tract infections (United States)

    Abraham, Soman N.; Miao, Yuxuan


    The urinary tract is constantly exposed to microorganisms that inhabit the gastrointestinal tract, but generally the urinary tract resists infection by gut microorganisms. This resistance to infection is mainly ascribed to the versatility of the innate immune defences in the urinary tract as the adaptive immune responses are limited, particularly when only the lower urinary tract is infected. In recent years, as the strengths and weaknesses of the immune system of the urinary tract have emerged and as the virulence attributes of uropathogens are recognized, several potentially effective and unconventional strategies to contain or prevent urinary tract infections have emerged. PMID:26388331

  18. Ageing and the humoral immune response in mice

    International Nuclear Information System (INIS)

    Blankwater, M.J.


    The study presented in this thesis is concerned with changes in the humoral immune system as a function of age in different inbred mouse strains. Their capacity to develop humoral immune responses to experimentally given thymus-dependent and thymus-independent antigens under various conditions is compared. Furthermore, experiments employing thymus transplantation and thymic humoral factors which are directed at the restoration of the diminished T cell functions in old age are reported. (Auth.)


    Directory of Open Access Journals (Sweden)

    Yu. K. Karaman


    Full Text Available The review is dedicated to modern concepts of arachidonic acid metabolites, i.e., endocannabinoids and eicosanoids, their biosynthetic pathways, cross-talk mechanisms and participation in immune response. New information from literature and own results include data concerning overlapping enzymatic pathways controlling biosynthesis of endocannabinoids and eicosanoids. Impact of synthetic cannabinoid receptor ligands upon production rates of proinflammatory cytokines and eicosanoids is discussed, as like as relationships among immune system reactivity and expression levels of cannabinoid receptors.

  20. Role of Activin A in Immune Response to Breast Cancer (United States)


    strategies are needed in order to eradicate metastatic breast cancer. In this respect, the activation of the immune system to elicit anti-tumor immune...responses represents one of the most promising approaches that have recently demonstrated some success in other diseases. However, clinically apparent...content/76/14_Supplement/4986 Advertisement Advanced Search search ! Clinical Research (Excluding Clinical Trials) Abstract 4986: Regulation of radiation

  1. Bovine anaplasmosis with emphasis on immune responses and protection

    International Nuclear Information System (INIS)

    Ristic, M.


    Anaplasmosis is an infectious and transmissible disease manifested by progressive anaemia and the appearance of other characteristic disease symptoms. It is a world-wide tick-borne disease of cattle and some wild ruminants caused by the rickettsia Anaplasma marginale. By drawing on information obtained from studies of plasmodial cell cultures, a method has recently been developed for short-term in vitro cultivation of A. marginale. An attenuated Anaplasma organism capable of growth in both ovine and bovine erythrocytes was used to demonstrate that the in vitro system provided the necessary requirements for active transfer of the organism from cell to cell. Organismal antigens are found in the erythrocytes of infected animals, whereas soluble antigens are derived from their erythrocytes and serum. Serums from convalescing animals interact with these antigens in agglutination, complement fixation, fluorescent antibody and precipitation tests. Passive transfer of sera from immune to susceptible cattle, however, does not seem to confer protection against the infection and development of the disease. Studies that employed various tests for measuring cell-mediated immune (CMI) responses (leukocyte migration inhibition, blast transformation and cytotoxicity), in association with information collected simultaneously on antibody activity, have shown that both humoral and cellular immune responses are needed for the development of protective immunity in anaplasmosis. It was further shown that an active replication of Anaplasma is essential for induction of these two types of immune responses. Consequently, live virulent and attenuated immunogens fulfil requirements for induction of protective immunity. With the virulent agent, however, development of protective immunity is preceded by induction of auto-immune responses apparently associated with pathogenesis of anaemia in anaplasmosis. Inactivated immunogens derived from blood of infected cattle and used in combination with

  2. The immune response to sand fly salivary proteins and its influence on Leishmania immunity

    Directory of Open Access Journals (Sweden)

    Regis eGomes


    Full Text Available Leishmaniasis is a vector-borne disease transmitted by bites of phlebotomine sand flies. During Leishmania transmission, sand fly saliva is co-inoculated with parasites into the skin of the mammalian host. Sand fly saliva consists of roughly thirty different salivary proteins, many with known roles linked to blood feeding facilitation. Apart from the anti-hemostatic capacity of saliva, several sand fly salivary proteins have been shown to be immunogenic upon multiple contacts with a mammalian host. Immunization with single immunogenic salivary proteins or exposure to uninfected bites can produce protective immune responses against leishmaniasis. These sand fly salivary proteins induce cellular immune responses and/or antibodies. Antibodies to saliva are not required for protection in a mouse model against leishmaniasis. A strong body of evidence points to the role for saliva-specific T cells producing IFN-γ in the form of a delayed-type hypersensitivity reaction at the bite site as the main protective response. Herein, we review immunity to sand fly salivary proteins in the context of its vector-parasite-host combinations and vaccine potential, as well as some recent advances to shed light on the mechanism of how an immune response to sand fly saliva protects against leishmaniasis.

  3. An Immune-inspired Adaptive Automated Intrusion Response System Model

    Directory of Open Access Journals (Sweden)

    Ling-xi Peng


    Full Text Available An immune-inspired adaptive automated intrusion response system model, named as , is proposed. The descriptions of self, non-self, immunocyte, memory detector, mature detector and immature detector of the network transactions, and the realtime network danger evaluation equations are given. Then, the automated response polices are adaptively performed or adjusted according to the realtime network danger. Thus, not only accurately evaluates the network attacks, but also greatly reduces the response times and response costs.

  4. Modulation of immune responses in stress by Yoga

    Directory of Open Access Journals (Sweden)

    Arora Sarika


    Full Text Available Stress is a constant factor in today′s fastpaced life that can jeopardize our health if left unchecked. It is only in the last half century that the role of stress in every ailment from the common cold to AIDS has been emphasized, and the mechanisms involved in this process have been studied. Stress influences the immune response presumably through the activation of the hypothalamic-pituitary adrenal axis, hypothalamic pituitary-gonadal axis, and the sympathetic-adrenal-medullary system. Various neurotransmitters, neuropeptides, hormones, and cytokines mediate these complex bidirectional interactions between the central nervous system (CNS and the immune system. The effects of stress on the immune responses result in alterations in the number of immune cells and cytokine dysregulation. Various stress management strategies such as meditation, yoga, hypnosis, and muscle relaxation have been shown to reduce the psychological and physiological effects of stress in cancers and HIV infection. This review aims to discuss the effect of stress on the immune system and examine how relaxation techniques such as Yoga and meditation could regulate the cytokine levels and hence, the immune responses during stress.

  5. Effect of partially purified fumonisins on cellular immune response in ...

    African Journals Online (AJOL)

    After 7 days, cellular immune response was evaluated by delayed-type hypersensitivity (DTH) and lymphoproliferative assays (LA) using spleen cells. Nitric oxide (NO) production by spleen cells was also evaluated. The specific LA response to Pb antigen was higher in group PB than in FB and CTR groups (p< 0.05) but not ...

  6. Metabolic and adaptive immune responses induced in mice infected ...

    African Journals Online (AJOL)

    This study investigated metabolic and immuno-inflammatory responses of mice infected with tissue-dwelling larvae of Trichinella zimbabwensis and explored the relationship between infection, metabolic parameters and Th1/Th17 immune responses. Sixty (60) female BALB/c mice aged between 6 to 8 weeks old were ...

  7. Immune responses of pigs inoculated with a recombinant fowlpox ...

    African Journals Online (AJOL)



    Apr 3, 2012 ... Key words: PCV2, rFPV, FMDV, immune response, prime-boost. .... After 10 min in the dark at room temperature, the color reaction was terminated with 50 µl of ..... ponses and improve memory and/or effector cell responses ...

  8. 17D yellow fever vaccine elicits comparable long-term immune responses in healthy individuals and immune-compromised patients

    NARCIS (Netherlands)

    Wieten, R. W.; Goorhuis, A.; Jonker, E. F. F.; de Bree, G. J.; de Visser, A. W.; van Genderen, P. J. J.; Remmerswaal, E. B. M.; ten Berge, I. J. M.; Visser, L. G.; Grobusch, M. P.; van Leeuwen, E. M. M.


    The 17D live attenuated yellow fever (YF) vaccine is contra-indicated in immune-compromised individuals and may elicit a suboptimal immunologic response. The aim of this study is to assess whether long-term immune responses against the YF vaccine are impaired in immune-compromised patients. Fifteen

  9. Skin immunization by microneedle patch overcomes statin-induced suppression of immune responses to influenza vaccine. (United States)

    Vassilieva, Elena V; Wang, Shelly; Li, Song; Prausnitz, Mark R; Compans, Richard W


    Recent studies indicated that in elderly individuals, statin therapy is associated with a reduced response to influenza vaccination. The present study was designed to determine effects on the immune response to influenza vaccination induced by statin administration in a mouse model, and investigate potential approaches to improve the outcome of vaccination on the background of statin therapy. We fed middle aged BALB/c mice a high fat "western" diet (WD) alone or supplemented with atorvastatin (AT) for 14 weeks, and control mice were fed with the regular rodent diet. Mice were immunized with a single dose of subunit A/Brisbane/59/07 (H1N1) vaccine, either systemically or with dissolving microneedle patches (MNPs). We observed that a greater age-dependent decline in the hemagglutinin inhibition titers occurred in systemically-immunized mice than in MNP- immunized mice. AT dampened the antibody response in the animals vaccinated by either route of vaccine delivery. However, the MNP-vaccinated AT-treated animals had ~20 times higher total antibody levels to the influenza vaccine than the systemically vaccinated group one month postvaccination. We propose that microneedle vaccination against influenza provides an approach to ameliorate the immunosuppressive effect of statin therapy observed with systemic immunization.

  10. Immune cells in the normal ovary and spontaneous ovarian tumors in the laying hen (Gallus domesticus) model of human ovarian cancer. (United States)

    Bradaric, Michael J; Penumatsa, Krishna; Barua, Animesh; Edassery, Seby L; Yu, Yi; Abramowicz, Jacques S; Bahr, Janice M; Luborsky, Judith L


    Spontaneous ovarian cancer in chickens resembles human tumors both histologically and biochemically. The goal was to determine if there are differences in lymphocyte content between normal ovaries and ovarian tumors in chickens as a basis for further studies to understand the role of immunity in human ovarian cancer progression. Hens were selected using grey scale and color Doppler ultrasound to determine if they had normal or tumor morphology. Cells were isolated from ovaries (n = 6 hens) and lymphocyte numbers were determined by flow cytometry using antibodies to avian CD4 and CD8 T and B (Bu1a) cells. Ovarian sections from another set of hens (n = 26) were assessed to verify tumor type and stage and to count CD4, CD8 and Bu1a immunostained cells by morphometric analysis. T and B cells were more numerous in ovarian tumors than in normal ovaries by flow cytometry and immunohistochemistry. There were less CD4+ cells than CD8+ and Bu1a+ cells in normal ovaries or ovarian tumors. CD8+ cells were the dominant T cell sub-type in both ovarian stroma and in ovarian follicles compared to CD4+ cells. Bu1a+ cells were consistently found in the stroma of normal ovaries and ovarian tumors but were not associated with follicles. The number of immune cells was highest in late stage serous tumors compared to endometrioid and mucinous tumors. The results suggest that similar to human ovarian cancer there are comparatively more immune cells in chicken ovarian tumors than in normal ovaries, and the highest immune cell content occurs in serous tumors. Thus, this study establishes a foundation for further study of tumor immune responses in a spontaneous model of ovarian cancer which will facilitate studies of the role of immunity in early ovarian cancer progression and use of the hen in pre-clinical vaccine trials.

  11. [Human milk, immune responses and health effects]. (United States)

    Løland, Beate Fossum; Baerug, Anne B; Nylander, Gro


    Besides providing optimal nutrition to infants, human milk contains a multitude of immunological components. These components are important for protection against infections and also support the development and maturation of the infant's own immune system. This review focuses on the function of some classical immunocomponents of human milk. Relevant studies are presented that describe health benefits of human milk for the child and of lactation for the mother. Relevant articles were found mainly by searching PubMed. Humoral and cellular components of human milk confer protection against infections in the respiratory--, gastrointestinal--and urinary tract. Human milk also protects premature children from neonatal sepsis and necrotizing enterocolitis. There is evidence that human milk may confer long-term benefits such as lower risk of certain autoimmune diseases, inflammatory bowel disease and probably some malignancies. Human milk possibly affects components of the metabolic syndrome. Recent studies demonstrate long-term health benefits of lactation also for the mother. A reduced incidence of breast cancer is best documented. An increasing number of studies indicate protection against ovarian cancer, rheumatoid arthritis and type II diabetes.

  12. Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response (United States)

    Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J.; Repasky, Elizabeth A.; Hylander, Bonnie L.


    An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were

  13. Immune responses of ducks infected with duck Tembusu virus

    Directory of Open Access Journals (Sweden)

    Ning eLi


    Full Text Available Duck Tembusu virus (DTMUV can cause serious disease in ducks, characterized by reduced egg production. Although the virus has been isolated and detection methods developed, the host immune responses to DTMUV infection are unclear. Therefore, we systematically examined the expression of immune-related genes and the viral distribution in DTMUV-infected ducks, using quantitative real-time PCR. Our results show that DTMUV replicates quickly in many tissues early in infection, with the highest viral titers in the spleen 1 day after infection. Rig-1, Mda5, and Tlr3 are involved in the host immune response to DTMUV, and the expression of proinflammatory cytokines (Il-1β, -2, -6, Cxcl8 and antiviral proteins (Mx, Oas, etc. are also upregulated early in infection. The expression of Il-6 increased most significantly in the tissues tested. The upregulation of Mhc-I was observed in the brain and spleen, but the expression of Mhc-II was upregulated in the brain and downregulated in the spleen. The expression of the interferons was also upregulated to different degrees in the spleen but that of the brain was various. Our study suggests that DTMUV replicates rapidly in various tissues and that the host immune responses are activated early in infection. However, the overexpression of cytokines may damage the host. These results extend our understanding of the immune responses of ducks to DTMUV infection, and provide insight into the pathogenesis of DTMUV attributable to host factors.

  14. Probiotics, antibiotics and the immune responses to vaccines. (United States)

    Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep


    Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  15. Systems biology of neutrophil differentiation and immune response

    DEFF Research Database (Denmark)

    Theilgaard-Mönch, Kim; Porse, Bo T; Borregaard, Niels


    Systems biology has emerged as a new scientific field, which aims at investigating biological processes at the genomic and proteomic levels. Recent studies have unravelled aspects of neutrophil differentiation and immune responses at the systems level using high-throughput technologies. These stu......Systems biology has emerged as a new scientific field, which aims at investigating biological processes at the genomic and proteomic levels. Recent studies have unravelled aspects of neutrophil differentiation and immune responses at the systems level using high-throughput technologies....... These studies have identified a plethora of novel effector proteins stored in the granules of neutrophils. In addition, these studies provide evidence that neutrophil differentiation and immune response are governed by a highly coordinated transcriptional programme that regulates cellular fate and function...

  16. Secondary immune response of rainbow trout following repeated immersion vaccination

    DEFF Research Database (Denmark)

    Jaafar, R. M.; Al-Jubury, A.; Chettri, J. K.


    Teleosts are able to raise a protective immune response, comprising both innate and adaptive elements, against various pathogens. This is the basis for a widespread use of vaccines, administered as injection or immersion, in the aquaculture industry. It has been described that repeated injection...... vaccination of fish raises a secondary immune response, consisting of rapid, accelerated and increased antibody reaction. This study reports how rainbow trout responds to repeated immersion vaccination against yersiniosis (ERM) caused by the bacterial pathogen Yersinia ruckeri. It was found that rainbow trout...... does not raise a classical secondary response following repeated immersion vaccination. Serum antibody titres were merely slightly increased even after three immunizations, using 30-s immersion into a bacterin consisting of formalin-inactivated Y. ruckeri (serotype O1, biotypes 1 and 2), performed over...

  17. Secondary immune response of rainbow trout following repeated immersion vaccination

    DEFF Research Database (Denmark)

    Jaafar, R. M.; Al-Jubury, Azmi; Chettri, Jiwan Kumar


    Teleosts are able to raise a protective immune response, comprising both innate and adaptive elements, against various pathogens. This is the basis for a widespread use of vaccines, administered as injection or immersion, in the aquaculture industry. It has been described that repeated injection...... vaccination of fish raises a secondary immune response, consisting of rapid, accelerated and increased antibody reaction. This study reports how rainbow trout responds to repeated immersion vaccination against yersiniosis (ERM) caused by the bacterial pathogen Yersinia ruckeri. It was found that rainbow trout...... does not raise a classical secondary response following repeated immersion vaccination. Serum antibody titres were merely slightly increased even after three immunizations, using 30-s immersion into a bacterin consisting of formalin-inactivated Y. ruckeri (serotype O1, biotypes 1 and 2), performed over...

  18. Suppressive influences in the immune response to cancer. (United States)

    Bronte, Vincenzo; Mocellin, Simone


    Although much evidence has been gathered demonstrating that immune effectors can play a significant role in controlling tumor growth under natural conditions or in response to therapeutic manipulation, it is clear that malignant cells do evade immune surveillance in most cases. Considering that anticancer active specific immunotherapy seems to have reached a plateau of results and that currently no vaccination regimen is indicated as a standard anticancer therapy, the dissection of the molecular events underlying tumor immune escape is the necessary condition to make anticancer vaccines a therapeutic weapon effective enough to be implemented in the routine clinical setting. Recent years have witnessed significant advances in our understanding of the molecular mechanisms underlying tumor immune escape. These mechanistic insights are fostering the development of rationally designed therapeutics aimed to revert the immunosuppressive circuits that undermine an effective antitumor immune response. In this review, the best characterized mechanisms that allow cancer cells to evade immune surveillance are overviewed and the most debated controversies constellating this complex field are highlighted.

  19. Escaping deleterious immune response in their hosts: lessons from trypanosomatids

    Directory of Open Access Journals (Sweden)

    Anne eGeiger


    Full Text Available The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, T. cruzi and Leishmania spp are important human pathogens causing Human African Trypanosomiasis (HAT or Sleeping Sickness, Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs or sandflies and affect millions of people worldwide.In humans, extracellular African trypanosomes (T. brucei evade the hosts’ immune defences, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response.This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite-host interactions and, will focus on: clinical and epidemiological importance of diseases; life cycles: parasites-hosts-vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation.

  20. Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids (United States)

    Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe


    The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406

  1. Induction of the immune response suppression in mice inoculated with Candida albicans. (United States)

    Valdez, J C; Mesón, D E; Sirena, A; de Petrino, S F; Eugenia, M; de Jorrat, B B; de Valdex, M G


    There is a controversy in respect to the immunological response (humoral or cellular) concerning the defense against Candida albicans. Candidosis would induce sub-populations of suppressor cells in the host cell-immune response. This report tries to show the effect of different doses of C. albicans (alive or heat-killed) on the expression of cell-mediated and humoral immunity. The effect upon cell immunity was determined by inoculating different lots of singeneic mice, doses of varied concentration of C. albicans and checking for delayed-type hipersensitivity (D.T.H.). D.T.H. was also controlled in syngeneic normal mice which had previously been injected with inoculated mice spleen cells. Humoral immunity was assayed by measuring the induced blastogenesis by Pokeweed Mitogen on spleen mononuclear cells with different doses of C. albicans. Results obtained show that the different doses gave origin to: Suppression of humoral and cell response (10(8) alive); Suppression of only humoral response (10(6) alive); Suppression of cell response and increase of humoral response (10(9) dead); Increase of both responses (10(8) dead).

  2. The intracellular cholesterol landscape: dynamic integrator of the immune response (United States)

    Fessler, Michael B.


    Cholesterol has typically been considered an exogenous, disease-related factor in immunity; however, recent literature suggests that a paradigm shift is in order. Sterols are now recognized to ligate several immune receptors. Altered flux through the mevalonic acid synthesis pathway also appears to be a required event in the antiviral interferon response of macrophages and in the activation, proliferation, and differentiation of T cells. In this review, evidence is discussed that suggests an intrinsic, ‘professional’ role for sterols and oxysterols in macrophage and T cell immunity. Host defense may have been the original selection pressure behind the development of mechanisms for intracellular cholesterol homeostasis. Functional coupling between sterol metabolism and immunity has fundamental implications for health and disease. PMID:27692616

  3. Chemical modulators of the innate immune response alter gypsy moth larval susceptibility to Bacillus thuringiensis

    Directory of Open Access Journals (Sweden)

    Broderick Nichole A


    Full Text Available Abstract Background The gut comprises an essential barrier that protects both invertebrate and vertebrate animals from invasion by microorganisms. Disruption of the balanced relationship between indigenous gut microbiota and their host can result in gut bacteria eliciting host responses similar to those caused by invasive pathogens. For example, ingestion of Bacillus thuringiensis by larvae of some species of susceptible Lepidoptera can result in normally benign enteric bacteria exerting pathogenic effects. Results We explored the potential role of the insect immune response in mortality caused by B. thuringiensis in conjunction with gut bacteria. Two lines of evidence support such a role. First, ingestion of B. thuringiensis by gypsy moth larvae led to the depletion of their hemocytes. Second, pharmacological agents that are known to modulate innate immune responses of invertebrates and vertebrates altered larval mortality induced by B. thuringiensis. Specifically, Gram-negative peptidoglycan pre-treated with lysozyme accelerated B. thuringiensis-induced killing of larvae previously made less susceptible due to treatment with antibiotics. Conversely, several inhibitors of the innate immune response (eicosanoid inhibitors and antioxidants increased the host's survival time following ingestion of B. thuringiensis. Conclusions This study demonstrates that B. thuringiensis infection provokes changes in the cellular immune response of gypsy moth larvae. The effects of chemicals known to modulate the innate immune response of many invertebrates and vertebrates, including Lepidoptera, also indicate a role of this response in B. thuringiensis killing. Interactions among B. thuringiensis toxin, enteric bacteria, and aspects of the gypsy moth immune response may provide a novel model to decipher mechanisms of sepsis associated with bacteria of gut origin.

  4. Endometrial immune markers are potential predictors of normal fertility and pregnancy after in vitro fertilization. (United States)

    Kofod, Louise; Lindhard, Anette; Bzorek, Michael; Eriksen, Jens Ole; Larsen, Lise Grupe; Hviid, Thomas Vauvert F


    Elucidating immune mechanisms in the endometrium, which lead to the success of implantation and pregnancy, is important in reproductive medicine. Studies of immune cell abundance have shown conflicting results, and the expression and importance of HLA class Ib proteins in pre-implantation endometrium have not yet been investigated. The study population consisted of four subgroups: a hydrosalpinx, a salpingectomy, an unexplained infertility, and a fertile control group. Endometrial samples were collected during the implantation window. Immune markers (CD56 + and CD16 + cells, FoxP3 + Tregs, HLA-G, HLA-F) were quantified in the samples. The outcome of the subsequent IVF treatment was recorded. Increased CD56 + uNK cells and high HLA-G expression served as predictor for successful pregnancy outcome. HLA-F expression was positively correlated with uNK cells, being indirectly predictive for achieving pregnancy. Endometrial uNK cell abundance in the pre-implantation endometrium seems to be important for normal fertility and pregnancy success, and they may be used as clinical markers to predict implantation success in IVF. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Effects of inhaled insoluble 239PuO2 on immune responses following lung immunization

    International Nuclear Information System (INIS)

    Bice, D.E.; Harris, D.L.; Brooks, A.L.; Mewhinney, J.A.


    To determine if inhaled 239 PuO 2 suppresses immunity in lung-associated lymph nodes, Chinese hamsters were exposed to a polydisperse aerosol of 239 PuO 2 produced at 1150 0 C. The mean lung burden of these animals was estimated to be 10 nCi at 8 days after exposure. At 128, 256 and 400 days after exposure, sham exposed controls and experimental animals were immunized by intratracheal instillation of 1 x 10 8 sheep red blood cells (SRBC). Six days later, they were sacrificed and the number of antibody forming cells (AFC) in lung-associated lymph nodes, spleen and cervical lymph nodes was evaluated. Results of these studies indicated that the number of AFC in lung-associated lymph modes was significantly lower in animals exposed to 239 PuO 2 . Only a few AFC were found in spleen and cervical lymph nodes after intratracheal immunization and the number in exposed animals was not significantly different than in the controls. These data indicate that even though the 239 PuO 2 exposure had suppressed immune responses in lung-associated lymph nodes, their filtering capacity was unaffected and antigen did not translocate to the spleen. We conclude that, at the sacrifice intervals evaluated, the immune function of lung-associated lymph nodes was suppressed and that distant lymphoid tissue (e.g., spleen and cervical lymph nodes) did not replace the immune function of the lung-associated lymph nodes

  6. Modulation of immune response by alloactivated suppressor T cells

    International Nuclear Information System (INIS)

    Bernstein, A.; Sopori, M.L.; Gose, J.E.; Sondel, P.M.


    These studies show that there may be several different kinds of suppressor cells, each activated by different pathways and able to suppress different parts of the immune response either specifically or nonspecifically. As such, the physiology of one type of suppressor cell need not necessarily apply to that of another type of suppressor. Thus we emphasize the trap that the suppressor cell option provides: that is, virtually any previously inexplicable in vitro and in vivo immune phenomenon can always be adequately accounted for by evoking a suppressor mechanism, either by suppressing the response or suppressing the suppressor

  7. Nanotechnology, neuromodulation & the immune response: discourse, materiality & ethics. (United States)

    Fins, Joseph J


    Drawing upon the American Pragmatic tradition in philosophy and the more recent work of philosopher Karen Barad, this paper examines how scientific problems are both obscured, and resolved by our use of language describing the natural world. Using the example of the immune response engendered by neural implants inserted in the brain, the author explains how this discourse has been altered by the advent of nanotechnology methods and devices which offer putative remedies that might temper the immune response in the central nervous system. This emergent nanotechnology has altered this problem space and catalyzed one scientific community to acknowledge a material reality that was always present, if not fully acknowledged.

  8. The role of complement in the acquired immune response

    DEFF Research Database (Denmark)

    Nielsen, C H; Fischer, E M; Leslie, R G


    Studies over the past three decades have clearly established a central role for complement in the promotion of a humoral immune response. The primary function of complement, in this regard, is to opsonize antigen or immune complexes for uptake by complement receptor type 2 (CR2, CD21) expressed...... on B cells, follicular dendritic cells (FDC) and some T cells. A variety of mechanisms appear to be involved in complement-mediated promotion of the humoral response. These include: enhancement of antigen (Ag) uptake and processing by both Ag-specific and non-specific B cells for presentation...

  9. A Box-Cox normal model for response times

    NARCIS (Netherlands)

    Klein Entink, R.H.; Fox, J.P.; Linden, W.J. van der


    The log-transform has been a convenient choice in response time modelling on test items. However, motivated by a dataset of the Medical College Admission Test where the lognormal model violated the normality assumption, the possibilities of the broader class of Box–Cox transformations for response

  10. Clinical Dosing Regimen of Selinexor Maintains Normal Immune Homeostasis and T-cell Effector Function in Mice: Implications for Combination with Immunotherapy. (United States)

    Tyler, Paul M; Servos, Mariah M; de Vries, Romy C; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K


    Selinexor (KPT-330) is a first-in-class nuclear transport inhibitor currently in clinical trials as an anticancer agent. To determine how selinexor might affect antitumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T-cell development, a progressive loss of CD8 T cells, and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T-cell development and function. We determined the minimum concentration of selinexor required to block T-cell activation and showed that T-cell-inhibitory effects of selinexor occur at levels above 100 nmol/L, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 4-day drug holiday led to intratumoral IFNγ + , granzyme B + cytotoxic CD8 T cells that were comparable with vehicle-treated mice. Overall, selinexor treatment leads to transient inhibition of T-cell activation, but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T-cell functioning and development of antitumor immunity. Mol Cancer Ther; 16(3); 428-39. ©2017 AACR See related article by Farren et al., p. 417 . ©2017 American Association for Cancer Research.

  11. Clinical dosing regimen of selinexor maintains normal immune homeostasis and T cell effector function in mice: implications for combination with immunotherapy (United States)

    Tyler, Paul M.; Servos, Mariah M.; de Vries, Romy C.; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K.


    Selinexor (KPT-330) is a first in class nuclear transport inhibitor currently in clinical trials as an anti-cancer agent. To determine how selinexor might impact anti-tumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T cell development, a progressive loss of CD8 T cells and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T cell development and function. We determined the minimum concentration of selinexor required to block T cell activation, and showed that T cell inhibitory effects of selinexor occur at levels above 100nM, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 5 day drug holiday led to intratumoral IFNγ+, granzyme B+ cytotoxic CD8 T cells that were comparable to vehicle treated mice. Overall, selinexor treatment leads to transient inhibition of T cell activation but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T cell functioning and development of anti-tumor immunity. PMID:28148714

  12. The serological response to heartwater immunization in cattle is an indicator of protective immunity

    DEFF Research Database (Denmark)

    Lawrence, J A; Tjørnehøj, Kirsten; Whiteland, A P


    A significant correlation was demonstrated in Friesian-cross steers between the serological response to previous vaccination with the Ball 3 strain of Cowdria ruminantium and the development of protective immunity against the Kalota isolate from Malawi. Of 10 animals which seroconverted after vac...

  13. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens. (United States)

    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H


    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system.

  14. Effect of produced water on cod (Gadus morhua) immune responses

    Energy Technology Data Exchange (ETDEWEB)

    Hamoutene, D.; Mabrouk, G.; Samuelson, S.; Mansour, A.; Lee, K. [Fisheries and Oceans Canada, Dartmouth, NS (Canada). Maritimes Region, Ocean Sciences Division; Volkoff, H.; Parrish, C. [Memorial Univ. of Newfoundland, St. John' s, NL (Canada); Mathieu, A. [Oceans Ltd., St. John' s, NL (Canada)


    Studies have shown that produced water (PW) discharged from North Sea offshore platforms affects the biota at greater distances from operational platforms than originally presumed. According to PW dispersion simulations, dilution by at least 240 times occurs within 50-100 m, and up to 9000 times by 20 km from the discharge. In this study, the effect of PW on cod immunity was investigated by exposing fish to 0, 100 ppm (x 10,000 dilution) or 200 ppm (x 500) of PW for 76 days. Immune responses were evaluated at the end of the exposure. Fish from the 3 groups were injected with Aeromonas salmonicida lipopolysaccharides (LPS). Blood cell observation and flow cytometry were used to investigate the serum cortisol levels and gill histology along with ratios and respiratory burst (RB) responses of both circulating and head-kidney white blood cells (WBCs). The study revealed that baseline immunity and stress response were not affected by PW, other than an irritant-induced change in gill cells found in treated cod. In all groups, LPS injection resulted in a pronounced decrease in RB of head-kidney cells and an increase in serum cortisol and protein levels. However, the group exposed to 200 ppm of PW exhibited the most significant changes. LPS injection was also shown to influence WBC ratios, but further studies are needed to determine if this impact is stronger in fish exposed to PW. This study suggested an effect of PW on cod immunity after immune challenge with LPS.

  15. The host immune response to Clostridium difficile infection (United States)


    Clostridium difficile infection (CDI) is the most common infectious cause of healthcare-acquired diarrhoea. Outcomes of C. difficile colonization are varied, from asymptomatic carriage to fulminant colitis and death, due in part to the interplay between the pathogenic virulence factors of the bacterium and the counteractive immune responses of the host. Secreted toxins A and B are the major virulence factors of C. difficile and induce a profound inflammatory response by intoxicating intestinal epithelial cells causing proinflammatory cytokine release. Host cell necrosis, vascular permeability and neutrophil infiltration lead to an elevated white cell count, profuse diarrhoea and in severe cases, dehydration, hypoalbuminaemia and toxic megacolon. Other bacterial virulence factors, including surface layer proteins and flagella proteins, are detected by host cell surface signal molecules that trigger downstream cell-mediated immune pathways. Human studies have identified a role for serum and faecal immunoglobulin levels in protection from disease, but the recent development of a mouse model of CDI has enabled studies into the precise molecular interactions that trigger the immune response during infection. Key effector molecules have been identified that can drive towards a protective anti-inflammatory response or a damaging proinflammatory response. The limitations of current antimicrobial therapies for CDI have led to the development of both active and passive immunotherapies, none of which have, as yet been formally approved for CDI. However, recent advances in our understanding of the molecular basis of host immune protection against CDI may provide an exciting opportunity for novel therapeutic developments in the future. PMID:25165542

  16. A Box-Cox normal model for response times. (United States)

    Klein Entink, R H; van der Linden, W J; Fox, J-P


    The log-transform has been a convenient choice in response time modelling on test items. However, motivated by a dataset of the Medical College Admission Test where the lognormal model violated the normality assumption, the possibilities of the broader class of Box-Cox transformations for response time modelling are investigated. After an introduction and an outline of a broader framework for analysing responses and response times simultaneously, the performance of a Box-Cox normal model for describing response times is investigated using simulation studies and a real data example. A transformation-invariant implementation of the deviance information criterium (DIC) is developed that allows for comparing model fit between models with different transformation parameters. Showing an enhanced description of the shape of the response time distributions, its application in an educational measurement context is discussed at length.

  17. Mitogen-stimulated phospholipid synthesis in normal and immune-deficient human B cells

    International Nuclear Information System (INIS)

    Chien, M.M.; Yokoyama, W.M.; Ashman, R.F.


    Eight patients with common variable panhypogammaglobulinemia were shown in the in vitro Ig biosynthesis assay to have defective B cell responses to pokeweed mitogen (PWM). Phospholipid synthesis was assessed in the B cell plus monocyte fraction (MB) and irradiated T cells (T*) of patients and paired normal controls. Cell populations were studied separately and in the four possible combinations (1:1), with and without PWM, to reveal the effect of cell interactions. At 16 to 20 hr the mean stimulation index (SI) +/- standard error for MB cells alone was 1.01 +/- 0.02 for eight patients and 0.99 +/- 0.02 for the paired normals; the T* cell SI was 1.25 +/- 0.04 for patients and 1.28 +/- 0.05 for normals. Combinations of normal MB cells with normal T* cells showed significantly higher SI when compared with the combinations of normal MB cells with patient T* cells (p less than 0.005). However, the combination of patient MB cells with patient T* cells and the combination of patient MB cells with normal T* cells were not significantly different in SI (0.05 less than p less than 0.1). Isolation of patient and normal B cells, T* cells, and monocytes after the choline pulse showed that patient B cells gave a higher SI with normal T* help than with patient T* help. Of greatest interest is the finding that patient B cells that were defective in PWM-stimulated Ig production nevertheless showed a phospholipid synthesis response to PWM in the normal range, suggesting that the maturation defect in these B cells occurs later than the phospholipid synthesis acceleration step, or on a different pathway

  18. Influence of bedding type on mucosal immune responses. (United States)

    Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E


    The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.

  19. Idiotypes as immunogens: facing the challenge of inducing strong therapeutic immune responses against the variable region of immunoglobulins

    International Nuclear Information System (INIS)

    López-Requena, Alejandro; Burrone, Oscar R.; Cesco-Gaspere, Michela


    Idiotype (Id)-based immunotherapy has been exploited as cancer treatment option. Conceived as therapy for malignancies bearing idiotypic antigens, it has been also extended to solid tumors because of the capacity of anti-idiotypic antibodies to mimic Id-unrelated antigens. In both these two settings, efforts are being made to overcome the poor immune responsiveness often experienced when using self immunoglobulins as immunogens. Despite bearing a unique gene combination, and thus particular epitopes, it is normally difficult to stimulate the immune response against antibody variable regions. Different strategies are currently used to strengthen Id immunogenicity, such as concomitant use of immune-stimulating molecules, design of Id-containing immunogenic recombinant proteins, specific targeting of relevant immune cells, and genetic immunization. This review focuses on the role of anti-Id vaccination in cancer management and on the current developments used to foster anti-idiotypic B and T cell responses.

  20. Idiotypes as immunogens: facing the challenge of inducing strong therapeutic immune responses against the variable region of immunoglobulins

    Energy Technology Data Exchange (ETDEWEB)

    López-Requena, Alejandro [Molecular Immunology Group, International Centre for Genetic Engineering and Biotechnology, Trieste (Italy); Immunobiology Division, Center of Molecular Immunology, Havana (Cuba); Bioengineering Research Institute, Biotech Pharmaceutical Co., Ltd, Beijing (China); Burrone, Oscar R.; Cesco-Gaspere, Michela, E-mail: [Molecular Immunology Group, International Centre for Genetic Engineering and Biotechnology, Trieste (Italy)


    Idiotype (Id)-based immunotherapy has been exploited as cancer treatment option. Conceived as therapy for malignancies bearing idiotypic antigens, it has been also extended to solid tumors because of the capacity of anti-idiotypic antibodies to mimic Id-unrelated antigens. In both these two settings, efforts are being made to overcome the poor immune responsiveness often experienced when using self immunoglobulins as immunogens. Despite bearing a unique gene combination, and thus particular epitopes, it is normally difficult to stimulate the immune response against antibody variable regions. Different strategies are currently used to strengthen Id immunogenicity, such as concomitant use of immune-stimulating molecules, design of Id-containing immunogenic recombinant proteins, specific targeting of relevant immune cells, and genetic immunization. This review focuses on the role of anti-Id vaccination in cancer management and on the current developments used to foster anti-idiotypic B and T cell responses.

  1. A Drosophila immune response against Ras-induced overgrowth

    Directory of Open Access Journals (Sweden)

    Thomas Hauling


    Full Text Available Our goal is to characterize the innate immune response against the early stage of tumor development. For this, animal models where genetic changes in specific cells and tissues can be performed in a controlled way have become increasingly important, including the fruitfly Drosophila melanogaster. Many tumor mutants in Drosophila affect the germline and, as a consequence, also the immune system itself, making it difficult to ascribe their phenotype to a specific tissue. Only during the past decade, mutations have been induced systematically in somatic cells to study the control of tumorous growth by neighboring cells and by immune cells. Here we show that upon ectopic expression of a dominant-active form of the Ras oncogene (RasV12, both imaginal discs and salivary glands are affected. Particularly, the glands increase in size, express metalloproteinases and display apoptotic markers. This leads to a strong cellular response, which has many hallmarks of the granuloma-like encapsulation reaction, usually mounted by the insect against larger foreign objects. RNA sequencing of the fat body reveals a characteristic humoral immune response. In addition we also identify genes that are specifically induced upon expression of RasV12. As a proof-of-principle, we show that one of the induced genes (santa-maria, which encodes a scavenger receptor, modulates damage to the salivary glands. The list of genes we have identified provides a rich source for further functional characterization. Our hope is that this will lead to a better understanding of the earliest stage of innate immune responses against tumors with implications for mammalian immunity.

  2. Radiation, Inflammation, and Immune Responses in Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Multhoff, Gabriele [Department of Radiation Oncology, Klinikum rechts der Isar, Technische Universität München, Munich (Germany); Helmholtz Zentrum München, Clinical Cooperation Group Innate Immunity in Tumor Biology, Munich (Germany); Radons, Jürgen, E-mail: [multimmune GmbH, Munich (Germany)


    Chronic inflammation has emerged as one of the hallmarks of cancer. Inflammation also plays a pivotal role in modulating radiation responsiveness of tumors. As discussed in this review, ionizing radiation (IR) leads to activation of several transcription factors modulating the expression of numerous mediators in tumor cells and cells of the microenvironment promoting cancer development. Novel therapeutic approaches thus aim to interfere with the activity or expression of these factors, either in single-agent or combinatorial treatment or as supplements of the existing therapeutic concepts. Among them, NF-κB, STAT-3, and HIF-1 play a crucial role in radiation-induced inflammatory responses embedded in a complex inflammatory network. A great variety of classical or novel drugs including nutraceuticals such as plant phytochemicals have the capacity to interfere with the inflammatory network in cancer and are considered as putative radiosensitizers. Thus, targeting the inflammatory signaling pathways induced by IR offers the opportunity to improve the clinical outcome of radiation therapy by enhancing radiosensitivity and decreasing putative metabolic effects. Since inflammation and sex steroids also impact tumorigenesis, a therapeutic approach targeting glucocorticoid receptors and radiation-induced production of tumorigenic factors might be effective in sensitizing certain tumors to IR.

  3. Radiation, Inflammation, and Immune Responses in Cancer

    International Nuclear Information System (INIS)

    Multhoff, Gabriele; Radons, Jürgen


    Chronic inflammation has emerged as one of the hallmarks of cancer. Inflammation also plays a pivotal role in modulating radiation responsiveness of tumors. As discussed in this review, ionizing radiation (IR) leads to activation of several transcription factors modulating the expression of numerous mediators in tumor cells and cells of the microenvironment promoting cancer development. Novel therapeutic approaches thus aim to interfere with the activity or expression of these factors, either in single-agent or combinatorial treatment or as supplements of the existing therapeutic concepts. Among them, NF-κB, STAT-3, and HIF-1 play a crucial role in radiation-induced inflammatory responses embedded in a complex inflammatory network. A great variety of classical or novel drugs including nutraceuticals such as plant phytochemicals have the capacity to interfere with the inflammatory network in cancer and are considered as putative radiosensitizers. Thus, targeting the inflammatory signaling pathways induced by IR offers the opportunity to improve the clinical outcome of radiation therapy by enhancing radiosensitivity and decreasing putative metabolic effects. Since inflammation and sex steroids also impact tumorigenesis, a therapeutic approach targeting glucocorticoid receptors and radiation-induced production of tumorigenic factors might be effective in sensitizing certain tumors to IR.

  4. The intestinal flora is required to support antibody responses to systemic immunization in infant and germ free mice. (United States)

    Lamousé-Smith, Esi S; Tzeng, Alice; Starnbach, Michael N


    The presence of a complex and diverse intestinal flora is functionally important for regulating intestinal mucosal immune responses. However, the extent to which a balanced intestinal flora regulates systemic immune responses is still being defined. In order to specifically examine whether the acquisition of a less complex flora influences responses to immunization in the pre-weaning stages of life, we utilize a model in which infant mice acquire an intestinal flora from their mothers that has been altered by broad-spectrum antibiotics. In this model, pregnant dams are treated with a cocktail of antibiotics that alters both the density and microbial diversity of the intestinal flora. After challenge with a subcutaneous immunization, the antibiotic altered flora infant mice have lower antigen specific antibody titers compared to control age-matched mice. In a second model, we examined germ free (GF) mice to analyze how the complete lack of flora influences the ability to mount normal antibody responses following subcutaneous immunization. GF mice do not respond well to immunization and introduction of a normal flora into GF mice restores the capacity of these mice to respond. These results indicate that a gastrointestinal flora reduced in density and complexity at critical time points during development adversely impacts immune responses to systemic antigens.

  5. Cocoa Diet and Antibody Immune Response in Preclinical Studies

    Directory of Open Access Journals (Sweden)

    Mariona Camps-Bossacoma


    Full Text Available The ability of cocoa to interact with the immune system in vitro and in vivo has been described. In the latter context, a cocoa-enriched diet in healthy rats was able to modify the immune system’s functionality. This fact could be observed in the composition and functionality of lymphoid tissues, such as the thymus, spleen, and lymph nodes. Consequently, immune effector mechanisms, such as antibody synthesis, were modified. A cocoa-enriched diet in young rats was able to attenuate the serum levels of immunoglobulin (Ig G, IgM, and IgA and also the intestinal IgM and IgA secretion. Moreover, in immunized rats, the intake of cocoa decreased specific IgG1, IgG2a, IgG2c, and IgM concentrations in serum. This immune-regulator potential was then tested in disease models in which antibodies play a pathogenic role. A cocoa-enriched diet was able to partially prevent the synthesis of autoantibodies in a model of autoimmune arthritis in rats and was also able to protect against IgE and T helper 2-related antibody synthesis in two rat models of allergy. Likewise, a cocoa-enriched diet prevented an oral sensitization process in young rats. In this review, we will focus on the influence of cocoa on the acquired branch of the immune function. Therefore, we will focus on how a cocoa diet influences lymphocyte function both in the systemic and intestinal immune system. Likewise, its potential role in preventing some antibody-induced immune diseases is also included. Although further studies must characterize the particular cocoa components responsible for such effects and nutritional studies in humans need to be carried out, cocoa has potential as a nutraceutical agent in some hypersensitivity status.

  6. HTLV-1, Immune Response and Autoimmunity

    Directory of Open Access Journals (Sweden)

    Juarez A S Quaresma


    Full Text Available Human T-lymphotropic virus type-1 (HTLV-1 infection is associated with adult T-cell leukemia/lymphoma (ATL. Tropical spastic paraparesis/HTLV-1-associated myelopathy (PET/HAM is involved in the development of autoimmune diseases including Rheumatoid Arthritis (RA, Systemic Lupus Erythematosus (SLE, and Sjögren’s Syndrome (SS. The development of HTLV-1-driven autoimmunity is hypothesized to rely on molecular mimicry, because virus-like particles can trigger an inflammatory response. However, HTLV-1 modifies the behavior of CD4+ T cells on infection and alters their cytokine production. A previous study showed that in patients infected with HTLV-1, the activity of regulatory CD4+ T cells and their consequent expression of inflammatory and anti-inflammatory cytokines are altered. In this review, we discuss the mechanisms underlying changes in cytokine release leading to the loss of tolerance and development of autoimmunity.

  7. [Immune response of Hansen's disease. Review]. (United States)

    Rada, Elsa; Aranzazu, Nacarid; Convit, Jacinto


    Hansen's disease presents a wide spectrum of clinical and histopathological manifestations that reflect the nature of the immunological response of the host towards diverse Mycobacterium leprae components. The immunological system, composed by both innate and adaptive immunology, offers protection towards infections of various etiologies, among them bacterial. Bacteria, of course, have developed multiple strategies for evading host defenses, based on either very complex or simple mechanisms, but with a single purpose: to "resist" host attacks and to be able to survive. We have tried to summarize some recent studies in Hansen's disease, with more emphasis in the inmunology area. We think that in the future, all illnesses should also be very strongly related to other important aspects such as the social, environmental and economic, and whose development is not solved in a laboratory.

  8. Immune and clinical response to honeybee venom in beekeepers

    Directory of Open Access Journals (Sweden)

    Jan Matysiak


    The differences in the immune response to a bee sting between the beekeepers and individuals not exposed to bees were probably due to the high exposure of the beekeepers to honeybee venom allergens. This may suggest a different approach to the bee venom allergy diagnostic tests in this occupational group.

  9. Induction of protective immune responses in mice by double DNA ...

    African Journals Online (AJOL)

    Purpose: To investigate the efficacy of a double DNA vaccine encoding of Brucella melitensis omp31 gene and of Escherichia coli eae gene in inducing protective immune response in a mouse model. Methods: After performing PCR assays and cloning both the eae and omp31 genes, the generated DNA vaccines were ...

  10. Impact on allergic immune response after treatment with vitamin A

    DEFF Research Database (Denmark)

    Matheu, Victor; Berggård, Karin; Barrios, Yvelise


    ABSTRACT: BACKGROUND: Vitamin A may have some influence on the immune system, but the role in allergy modulation is still unclear. OBJECTIVE: To clarify whether high levels of retinoic acid (RA) affects allergic response in vivo, we used a murine experimental model of airway allergic disease...

  11. Genetic variations in non-specific immune response to ...

    African Journals Online (AJOL)

    Non-specific immune response in three strains of Heterobranchus bidorsalis challenged with the bacterium Aeromonas hydrophilia was evaluated. The study was undertaken in three strains of H. bidorsalis from different ecological zones in Nigeria and the percentage cumulative mortality was lowest and significantly ...

  12. Humoral and cellular immune responses to modified hepatitis B ...

    African Journals Online (AJOL)

    These findings indicate that the vaccine induced both a humoral and cellular ... Keywords: Hepatitis B virus, Plasmid DNA, Vaccine, Spleen cytokines, Humoral and cellular immune responses ... produced in mice. ... were performed and HBsAg specific IgM and IgG ..... and protection elicited against Plasmodium berghei.

  13. Cellular immune response in prognosis of Bell's palsy and its ...

    African Journals Online (AJOL)

    Objective: To determine the cellular immune response in Bell's palsy (BP) and its prognostic value in relation to clinical and electrophysiological findings. Methods: Twenty patients with BP were subjected to: Facial nerve paralysis assessment according to House–Brackmann (H&B) grading system, bilateral facial nerve ...

  14. Radiation-induced augmentation of the immune response

    International Nuclear Information System (INIS)

    Anderson, R.E.; Lefkovits, I.; Troup, G.M.


    Radiation-induced augmentation of the immune response has been shown to occur both in vivo and in vitro. Evidence is presented to implicate injury to an extremely radiosensitive T cell in the expression of this phenomenon. Experiments are outlined which could be employed to support or reflect this hypothesis

  15. A multiherbal formulation influencing immune response in vitro. (United States)

    Menghini, L; Leporini, L; Scanu, N; Pintore, G; Ferrante, C; Recinella, L; Orlando, G; Vacca, M; Brunetti, L


    Aim of this study was to evaluate the effects of phytocomplexes of Uncaria, Shiitake and Ribes in terms of viability and inflammatory response on immune cell-derived cultures. Standardized extracts of Uncaria, Shitake and Ribes and their commercial formulation were tested on cell lines PBMC, U937 and macrophage. The activity was evaluated in terms of cell viability (MTT test), variations of oxidative marker release (ROS and PGE2) and modulatory effects on immune response (gene expression of IL-6, IL-8 and TNFα, RT-PCR). Cell viability was not affected by extracts, except subtle variations observed only at higher doses (>250 µg/mL). The extract mixture was well tolerated, with no effects on cell viability up to doses of 500 µg/mL. Pre-treatment of macrophages with subtoxic doses of the extracts reduced the basal release of oxidative markers and enhanced the cell response to exogenous oxidant stimulation, as revealed by ROS and PGE2 release reduction. The same treatment on macrophage resulted in a selective modulation of the immune response, as shown by an increase of IL-6 mRNA and, partially, IL-8 mRNA, while a reduction was observed for TNFα mRNA. Data confirm that extracts and their formulations can act as regulator of the immune system with mechanisms involving the oxidative stress and the release of selected proinflammatory cytokines.

  16. Signalling through C-type lectin receptors: shaping immune responses

    NARCIS (Netherlands)

    Geijtenbeek, Teunis B. H.; Gringhuis, Sonja I.


    C-type lectin receptors (CLRs) expressed by dendritic cells are crucial for tailoring immune responses to pathogens. Following pathogen binding, CLRs trigger distinct signalling pathways that induce the expression of specific cytokines which determine T cell polarization fates. Some CLRs can induce

  17. Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention. (United States)

    Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna


    Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.

  18. The immune system strikes back: cellular immune responses against indoleamine 2,3-dioxygenase

    DEFF Research Database (Denmark)

    Sørensen, Rikke Baek; Berge-Hansen, Linda; Junker, Niels


    BACKGROUND: The enzyme indoleamine 2,3-dioxygenase (IDO) exerts an well established immunosuppressive function in cancer. IDO is expressed within the tumor itself as well as in antigen-presenting cells in tumor-draining lymph nodes, where it promotes the establishment of peripheral immune tolerance...... to tumor antigens. In the present study, we tested the notion whether IDO itself may be subject to immune responses. METHODS AND FINDINGS: The presence of naturally occurring IDO-specific CD8 T cells in cancer patients was determined by MHC/peptide stainings as well as ELISPOT. Antigen specific cytotoxic T...... of the major immune suppressive cell populations. CONCLUSION: IDO may serve as an important and widely applicable target for anti-cancer immunotherapeutic strategies. Furthermore, as emerging evidence suggests that IDO constitutes a significant counter-regulatory mechanism induced by pro-inflammatory signals...

  19. Tumor PDT-associated immune response: relevance of sphingolipids (United States)

    Korbelik, Mladen; Merchant, Soroush; Separovic, Duska M.


    Sphingolipids have become recognized as essential effector molecules in signal transduction with involvement in various aspects of cell function and death, immune response and cancer treatment response. Major representatives of sphingolipids family, ceramide, sphingosine and sphingosine-1-phosphate (S1P), have attracted interest in their relevance to tumor response to photodynamic therapy (PDT) because of their roles as enhancers of apoptosis, mediators of cell growth and vasculogenesis, and regulators of immune response. Our recent in vivo studies with mouse tumor models have confirmed that PDT treatment has a pronounced impact on sphingolipid profile in the targeted tumor and that significant advances in therapeutic gain with PDT can be attained by combining this modality with adjuvant treatment with ceramide analog LCL29.

  20. Memory B-Cell and Antibody Responses Induced by Plasmodium falciparum Sporozoite Immunization

    NARCIS (Netherlands)

    Nahrendorf, W.; Scholzen, A.; Bijker, E.M.; Teirlinck, A.C.; Bastiaens, G.J.H.; Schats, R.; Hermsen, C.C.; Visser, L.G.; Langhorne, J.; Sauerwein, R.W.


    BACKGROUND: Immunization of healthy volunteers during receipt of chemoprophylaxis with Plasmodium falciparum sporozoites (CPS-immunization) induces sterile protection from malaria. Antibody responses have long been known to contribute to naturally acquired immunity against malaria, but their

  1. Immune Response to Electromagnetic Fields through Cybernetic Modeling

    International Nuclear Information System (INIS)

    Godina-Nava, J. J.; Segura, M. A. Rodriguez; Cadena, S. Reyes; Sierra, L. C. Gaitan


    We study the optimality of the humoral immune response through a mathematical model, which involves the effect of electromagnetic fields over the large lymphocytes proliferation. Are used the so called cybernetic variables in the context of the matching law of microeconomics or mathematical psychology, to measure the large lymphocytes population and to maximize the instantaneous antibody production rate in time during the immunologic response in order to most efficiently inactivate the antigen

  2. Immune Response to Electromagnetic Fields through Cybernetic Modeling (United States)

    Godina-Nava, J. J.; Segura, M. A. Rodríguez; Cadena, S. Reyes; Sierra, L. C. Gaitán


    We study the optimality of the humoral immune response through a mathematical model, which involves the effect of electromagnetic fields over the large lymphocytes proliferation. Are used the so called cybernetic variables in the context of the matching law of microeconomics or mathematical psychology, to measure the large lymphocytes population and to maximize the instantaneous antibody production rate in time during the immunologic response in order to most efficiently inactivate the antigen.

  3. Glycan-mediated modification of the immune response

    DEFF Research Database (Denmark)

    Madsen, Caroline B; Pedersen, Anders E; Wandall, Hans H


    Aberrantly glycosylated tumor antigens represent promising targets for the development of anti-cancer vaccines, yet how glycans influence immune responses is poorly understood. Recent studies have demonstrated that GalNAc-glycosylation enhances antigen uptake by dendritic cells as well as CD4(+) T......-cell and humoral responses, but prevents CD8(+) T-cell activation. Here, we briefly discuss the relevance of glycans as candidate targets for anti-cancer vaccines....

  4. Stochastic responses of tumor–immune system with periodic treatment

    International Nuclear Information System (INIS)

    Li Dong-Xi; Li Ying


    We investigate the stochastic responses of a tumor–immune system competition model with environmental noise and periodic treatment. Firstly, a mathematical model describing the interaction between tumor cells and immune system under external fluctuations and periodic treatment is established based on the stochastic differential equation. Then, sufficient conditions for extinction and persistence of the tumor cells are derived by constructing Lyapunov functions and Ito’s formula. Finally, numerical simulations are introduced to illustrate and verify the results. The results of this work provide the theoretical basis for designing more effective and precise therapeutic strategies to eliminate cancer cells, especially for combining the immunotherapy and the traditional tools. (paper)

  5. Immunization with Brucella VirB proteins reduces organ colonization in mice through a Th1-type immune response and elicits a similar immune response in dogs. (United States)

    Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C


    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. Primary immune system responders to nucleus pulposus cells: evidence for immune response in disc herniation

    Directory of Open Access Journals (Sweden)

    K Murai


    Full Text Available Although intervertebral disc herniation and associated sciatica is a common disease, its molecular pathogenesis is not well understood. Immune responses are thought to be involved. This study provides direct evidence that even non-degenerated nucleus pulposus (NP cells elicit immune responses. An in vitro colony forming inhibition assay demonstrated the suppressive effects of autologous spleen cells on NP cells and an in vitro cytotoxicity assay showed the positive cytotoxic effects of natural killer (NK cells and macrophages on NP cells. Non-degenerated rat NP tissues transplanted into wild type rats and immune-deficient mice demonstrated a significantly higher NP cell survival rate in immune-deficient mice. Immunohistochemical staining showed the presence of macrophages and NK cells in the transplanted NP tissues. These results suggest that even non-degenerated autologous NP cells are recognized by macrophages and NK cells, which may have an immunological function in the early phase of disc herniation. These findings contribute to understanding resorption and the inflammatory reaction to disc herniation.

  7. Immunization with avian metapneumovirus harboring chicken Fc induces higher immune responses. (United States)

    Paudel, Sarita; Easwaran, Maheswaran; Jang, Hyun; Jung, Ho-Kyoung; Kim, Joo-Hun; Shin, Hyun-Jin


    In this study, we evaluated the immune responses of avian metapneumovirus harboring chicken Fc molecule. Stable Vero cells expressing chicken Fc chimera on its surface (Vero-cFc) were established, and we confirmed that aMPV grown in Vero-cFc incorporated host derived chimera Fc into the aMPV virions. Immunization of chicken with aMPV-cFc induced higher level of antibodies and inflammatory cytokines; (Interferon (IFN)-γ and Interleukin (IL)-1β) compared to those of aMPV. The increased levels of antibodies and inflammatory cytokines in chicken immunized with aMPV-cFc were statistically significantly (p<0.05) to that of aMPV and control. The aMPV-cFc group also generated the highest neutralizing antibody response. After challenges, chickens immunized with aMPV-cFc showed much less pathological signs in nasal turbinates and trachea so that we could confirm aMPV-cFc induced higher protection than that of aMPV. The greater ability of aMPV harboring chicken Fc to that of aMPV presented it as a possible vaccine candidate. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Inflammation and Immune Response in COPD: Where Do We Stand?

    Directory of Open Access Journals (Sweden)

    Nikoletta Rovina


    Full Text Available Increasing evidence indicates that chronic inflammatory and immune responses play key roles in the development and progression of COPD. Recent data provide evidence for a role in the NLRP3 inflammasome in the airway inflammation observed in COPD. Cigarette smoke activates innate immune cells by triggering pattern recognition receptors (PRRs to release “danger signal”. These signals act as ligands to Toll-like receptors (TLRs, triggering the production of cytokines and inducing innate inflammation. In smokers who develop COPD there appears to be a specific pattern of inflammation in the airways and parenchyma as a result of both innate and adaptive immune responses, with the predominance of CD8+ and CD4+ cells, and in the more severe disease, with the presence of lymphoid follicles containing B lymphocytes and T cells. Furthermore, viral and bacterial infections interfere with the chronic inflammation seen in stable COPD and exacerbations via pathogen-associated molecular patterns (PAMPs. Finally, autoimmunity is another novel aspect that may play a critical role in the pathogenesis of COPD. This review is un update of the currently discussed roles of inflammatory and immune responses in the pathogenesis of COPD.

  9. Laser Therapy Inhibits Tumor Growth in Mice by Promoting Immune Surveillance and Vessel Normalization

    Directory of Open Access Journals (Sweden)

    Giulia Ottaviani


    Full Text Available Laser therapy, recently renamed as photobiomodulation, stands as a promising supportive treatment for oral mucositis induced by oncological therapies. However, its mechanisms of action and, more importantly, its safety in cancer patients, are still unclear. Here we explored the anti-cancer effect of 3 laser protocols, set at the most commonly used wavelengths, in B16F10 melanoma and oral carcinogenesis mouse models. While laser light increased cell metabolism in cultured cells, the in vivo outcome was reduced tumor progression. This striking, unexpected result, was paralleled by the recruitment of immune cells, in particular T lymphocytes and dendritic cells, which secreted type I interferons. Laser light also reduced the number of highly angiogenic macrophages within the tumor mass and promoted vessel normalization, an emerging strategy to control tumor progression. Collectively, these results set photobiomodulation as a safety procedure in oncological patients and open the way to its innovative use for cancer therapy.

  10. Humoral and cellular immune responses to Yersinia pestis Pla antigen in humans immunized with live plague vaccine. (United States)

    Feodorova, Valentina A; Lyapina, Anna M; Khizhnyakova, Maria A; Zaitsev, Sergey S; Sayapina, Lidiya V; Arseneva, Tatiana E; Trukhachev, Alexey L; Lebedeva, Svetlana A; Telepnev, Maxim V; Ulianova, Onega V; Lyapina, Elena P; Ulyanov, Sergey S; Motin, Vladimir L


    To establish correlates of human immunity to the live plague vaccine (LPV), we analyzed parameters of cellular and antibody response to the plasminogen activator Pla of Y. pestis. This outer membrane protease is an essential virulence factor that is steadily expressed by Y. pestis. PBMCs and sera were obtained from a cohort of naïve (n = 17) and LPV-vaccinated (n = 34) donors. Anti-Pla antibodies of different classes and IgG subclasses were determined by ELISA and immunoblotting. The analysis of antibody response was complicated with a strong reactivity of Pla with normal human sera. The linear Pla B-cell epitopes were mapped using a library of 15-mer overlapping peptides. Twelve peptides that reacted specifically with sera of vaccinated donors were found together with a major cross-reacting peptide IPNISPDSFTVAAST located at the N-terminus. PBMCs were stimulated with recombinant Pla followed by proliferative analysis and cytokine profiling. The T-cell recall response was pronounced in vaccinees less than a year post-immunization, and became Th17-polarized over time after many rounds of vaccination. The Pla protein can serve as a biomarker of successful vaccination with LPV. The diagnostic use of Pla will require elimination of cross-reactive parts of the antigen.

  11. Cell mediated immune response in human antirabies revaccination

    Directory of Open Access Journals (Sweden)

    Débora Regina Veiga


    Full Text Available The occurrence of secondary cell mediated immune response (CMI in human antirabies immunization was studied. The Puenzalida & Palácios vaccine was used because it is routinely used in Brazil. CMI was evaluated by lymphoblastic transformation indices obtained in whole blood culture in the presence of rabies and control (nervous tissue antigens. Eleven volunteers submitted to revaccination constituted the group under study, while three other volunteers submitted primo vaccination were utilized as control group. A clear secondary CMI to rabies antigen was detected in all the revaccinated volunteers who showed earlier and more intense response than the control group. Response to the control antigen, however, present in all the components of the first group was not detectable in two out of the three primovaccinated and very low in the third one.

  12. Evaluation of normal tissue responses to high-LET radiations

    International Nuclear Information System (INIS)

    Halnan, K.E.


    Clinical results presented have been analysed to evaluate normal tissue responses to high-LET radiations. Damage to brain, spinal cord, gut, skin, connective tissue and bone has occurred. A high RBE is probable for brain and possible for spinal cord and gut but other reasons for damage are also discussed. A net gain seems likely. Random controlled trials are advocated. (author)

  13. Effect of Scoparia dulcis on noise stress induced adaptive immunity and cytokine response in immunized Wistar rats

    Directory of Open Access Journals (Sweden)

    Loganathan Sundareswaran


    Conclusion: S. dulcis (SD has normalized and prevented the noise induced changes in cell-mediated and humoral immunity and it could be the presence of anti-stressor and immuno stimulant activity of the plant.

  14. Persistence of the immune response induced by BCG vaccination

    Directory of Open Access Journals (Sweden)

    Blitz Rose


    Full Text Available Abstract Background Although BCG vaccination is recommended in most countries of the world, little is known of the persistence of BCG-induced immune responses. As novel TB vaccines may be given to boost the immunity induced by neonatal BCG vaccination, evidence concerning the persistence of the BCG vaccine-induced response would help inform decisions about when such boosting would be most effective. Methods A randomised control study of UK adolescents was carried out to investigate persistence of BCG immune responses. Adolescents were tested for interferon-gamma (IFN-γ response to Mycobacterium tuberculosis purified protein derivative (M.tb PPD in a whole blood assay before, 3 months, 12 months (n = 148 and 3 years (n = 19 after receiving teenage BCG vaccination or 14 years after receiving infant BCG vaccination (n = 16. Results A gradual reduction in magnitude of response was evident from 3 months to 1 year and from 1 year to 3 years following teenage vaccination, but responses 3 years after vaccination were still on average 6 times higher than before vaccination among vaccinees. Some individuals (11/86; 13% failed to make a detectable antigen-specific response three months after vaccination, or lost the response after 1 (11/86; 13% or 3 (3/19; 16% years. IFN-γ response to Ag85 was measured in a subgroup of adolescents and appeared to be better maintained with no decline from 3 to 12 months. A smaller group of adolescents were tested 14 years after receiving infant BCG vaccination and 13/16 (81% made a detectable IFN-γ response to M.tb PPD 14 years after infant vaccination as compared to 6/16 (38% matched unvaccinated controls (p = 0.012; teenagers vaccinated in infancy were 19 times more likely to make an IFN-γ response of > 500 pg/ml than unvaccinated teenagers. Conclusion BCG vaccination in infancy and adolescence induces immunological memory to mycobacterial antigens that is still present and measurable for at least 14 years in the

  15. Augmenting Plant Immune Responses and Biological Control by Microbial Determinants

    Directory of Open Access Journals (Sweden)

    Sang Moo Lee


    Full Text Available Plant have developed sophisticated defence mechanisms against microbial pathogens. The recent accumulated information allow us to understand the nature of plant immune responses followed by recognition of microbial factors/determinants through cutting-edge genomics and multi-omics techniques. However, the practical approaches to sustain plant health using enhancement of plant immunity is yet to be fully appreciated. Here, we overviewed the general concept and representative examples on the plant immunity. The fungal, bacterial, and viral determinants that was previously reported as the triggers of plant immune responses are introduced and described as the potential protocol of biological control. Specifically, the role of chitin, glucan, lipopolysaccharides/extracellular polysaccharides, microbe/pathogen-associated molecular pattern, antibiotics, mimic-phytohormones, N-acyl homoserine lactone, harpin, vitamins, and volatile organic compounds are considered. We hope that this review stimulates scientific community and farmers to broaden their knowledge on the microbial determinant-based biological control and to apply the technology on the integrated pest management program.

  16. Chicken Immune Response after In Ovo Immunization with Chimeric TLR5 Activating Flagellin of Campylobacter jejuni.

    Directory of Open Access Journals (Sweden)

    Katarzyna A Radomska

    Full Text Available Campylobacter jejuni is the main cause of bacterial food-borne diseases in developed countries. Chickens are the most important source of human infection. Vaccination of poultry is an attractive strategy to reduce the number of C. jejuni in the intestinal tract of chickens. We investigated the immunogenicity and protective efficacy of a recombinant C. jejuni flagellin-based subunit vaccine with intrinsic adjuvant activity. Toll-like receptor activation assays demonstrated the purity and TLR5 stimulating (adjuvant activity of the vaccine. The antigen (20-40 μg was administered in ovo to 18 day-old chicken embryos. Serum samples and intestinal content were assessed for antigen-specific systemic and mucosal humoral immune responses. In ovo vaccination resulted in the successful generation of IgY and IgM serum antibodies against the flagellin-based subunit vaccine as determined by ELISA and Western blotting. Vaccination did not induce significant amounts of flagellin-specific secretory IgA in the chicken intestine. Challenge of chickens with C. jejuni yielded similar intestinal colonization levels for vaccinated and control animals. Our results indicate that in ovo delivery of recombinant C. jejuni flagellin subunit vaccine is a feasible approach to yield a systemic humoral immune response in chickens but that a mucosal immune response may be needed to reduce C. jejuni colonization.

  17. Immunity to rhabdoviruses in rainbow trout: the antibody response

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lapatra, S.E.


    to their occasional detrimental effect on rainbow trout farming. Research efforts have been focused on understanding the mechanisms involved in protective immunity. Several specific and nonspecific cellular and humoral parameters are believed to be involved, but only the antibody response has been characterised......, have demonstrated that rainbow trout can produce specific and highly functional antibodies that are able to neutralise virus pathogenicity in vitro as well as in vivo. The apparently more restricted antibody response to IHNV and VHSV antigens in fish compared to mammals could possibly be explained...... aspects of antibody response and antibody reactivity with IHNV and VHSV antigens....

  18. Immune responses of Helicoverpa armigera to different kinds of pathogens

    Directory of Open Access Journals (Sweden)

    Zhao Xiao-Fan


    Full Text Available Abstract Background Insects react against pathogens through innate immunity. The cotton bollworm Helicoverpa armigera (H. armigera is an important defoliator and an extremely destructive pest insect of many crops. The elucidation of the mechanism of the immune response of H. armigera to various pathogens can provide a theoretical basis for new approaches to biologically control this pest. Results Four kinds of pathogens Bacillus thuringiensis, Klebsiella pneumoniae, Candida albicans, and Autographa californica multiple nucleocapsid nucleopolyhedrovirus harbored green fluorescence protein and polyhedron (AcMNPV-GFP were used to challenge the insect. The cellular and humoral immune responses to the pathogens were analyzed in the challenged H. armigera. The results show that in the five kinds of haemocytes, only granulocytes phagocytized the Gram-negative and Gram-positive bacteria and fungi. All haemocytes can be infected by AcMNPV. Fourteen immune-related genes including pattern recognition receptors (PRRs such as peptidoglycan recognition proteins (HaPGRP and HaPGRP C and Gram-Negative Bacteria-Binding Protein (HaGNBP, and antimicrobial peptides (AMPs such as cecropin-1, 2 and 3 (HaCec-1, 2 and 3, lysozyme (HaLys, attacin (HaAtt, gallerimycin-like (HaGall, gloverin-like (HaGlo, moricin-like (HaMor, cobatoxin-like (HaCob, galiomicin-like (HaGali, and immune inducible protein (HaIip appeared in different expression profiles to different pathogen infections. The transcripts of 13 immune related genes (except HaPGRPC are obviously up-regulated by Gram-positive bacteria. HaCec-1 and 3, HaMor, HaAtt, HaLys, HaIip, HaPGRP and HaGNBP are greatly up-regulated after fungal infection. HaGNBP, HaCec-2, HaGall, HaGlo, HaMor, HaCob, HaGali obviously increased in Gram-negative bacterial infection. Only five genes, HaGNBP, HaCec-1, HaGali, HaGlo, and HaLys, are weakly up-regulated after viral infection. The AMP transcripts had higher expression levels than the

  19. Normalization of cell responses in cat striate cortex (United States)

    Heeger, D. J.


    Simple cells in the striate cortex have been depicted as half-wave-rectified linear operators. Complex cells have been depicted as energy mechanisms, constructed from the squared sum of the outputs of quadrature pairs of linear operators. However, the linear/energy model falls short of a complete explanation of striate cell responses. In this paper, a modified version of the linear/energy model is presented in which striate cells mutually inhibit one another, effectively normalizing their responses with respect to stimulus contrast. This paper reviews experimental measurements of striate cell responses, and shows that the new model explains a significantly larger body of physiological data.

  20. Early-life inflammation, immune response and ageing. (United States)

    Khan, Imroze; Agashe, Deepa; Rolff, Jens


    Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. © 2017 The Author(s).

  1. CD28 Aptamers as Powerful Immune Response Modulators

    Directory of Open Access Journals (Sweden)

    Fernando Pastor


    Full Text Available CD28 is one of the main costimulatory receptors responsible for the proper activation of T lymphocytes. We have isolated two aptamers that bind to the CD28 receptor. As a monomer, one of them interfered with the binding of CD28 to its ligand (B7, precluding the costimulatory signal, whereas the other one was inactive. However, dimerization of any of the anti-CD28 aptamers was sufficient to provide an artificial costimulatory signal. No antibody has featured a dual function (i.e., the ability to work as agonist and antagonist to date. Two different agonistic structures were engineered for each anti-CD28 aptamer. One showed remarkably improved costimulatory properties, surpassing the agonistic effect of an anti-CD28 antibody. Moreover, we showed in vivo that the CD28 agonistic aptamer is capable of enhancing the cellular immune response against a lymphoma idiotype and of prolonging survival of mice which receive the aptamer together with an idiotype vaccine. The CD28 aptamers described in this work could be used to modulate the immune response either blocking the interaction with B7 or enhancing vaccine-induced immune responses in cancer immunotherapy.

  2. Tailoring the Immune Response via Customization of Pathogen Gene Expression. (United States)

    Runco, Lisa M; Stauft, Charles B; Coleman, J Robert


    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

  3. Inhibition of the immune response to experimental fresh osteoarticular allografts

    International Nuclear Information System (INIS)

    Rodrigo, J.J.; Schnaser, A.M.; Reynolds, H.M. Jr.; Biggart, J.M. III; Leathers, M.W.; Chism, S.E.; Thorson, E.; Grotz, T.; Yang, Q.M.


    The immune response to osteoarticular allografts is capable of destroying the cartilage--a tissue that has antigens on its cells identical to those on the bone and marrow cells. Osteoarticular allografts of the distal femur were performed in rats using various methods to attempt to temporarily inhibit the antibody response. The temporary systemic immunosuppressant regimens investigated were cyclophosphamide, azathioprine and prednisolone, cyclosporine A, and total lymphoid irradiation. The most successful appeared to be cyclosporine A, but significant side effects were observed. To specifically inhibit the immune response in the allograft antigens without systemically inhibiting the entire immune system, passive enhancement and preadministration of donor blood were tried. Neither was as effective as coating the donor bone with biodegradable cements, a method previously found to be successful. Cyclosporine A was investigated in dogs in a preliminary study of medial compartmental knee allografts and was found to be successful in inhibiting the antibody response and in producing a more successful graft; however, some significant side effects were similarly observed

  4. Measurement of human normal tissue and tumour responses

    International Nuclear Information System (INIS)

    Ross, G.; Yarnold, J.R.


    The scarcity of quantitative measures of normal tissue damage and tumour response in patients undergoing radiotherapy is an obstacle to the clinical evaluation of new treatment strategies. Retrospective studies of complications in critical normal tissues taught important lessons in the past concerning the potential dangers of hypofractionation. However, it is unethical to use serious complications as planned end-points in prospective studies. This paper reviews the desirable characteristics of clinical end-points required to compare alternative treatments employing radiotherapy, with emphasis on simple scales applied by clinicians or even the patients themselves

  5. Curcumin prevents human dendritic cell response to immune stimulants

    International Nuclear Information System (INIS)

    Shirley, Shawna A.; Montpetit, Alison J.; Lockey, R.F.; Mohapatra, Shyam S.


    Curcumin, a compound found in the Indian spice turmeric, has anti-inflammatory and immunomodulatory properties, though the mechanism remains unclear. Dendritic cells (DCs) are important to generating an immune response and the effect of curcumin on human DCs has not been explored. The role curcumin in the DC response to bacterial and viral infection was investigated in vitro using LPS and Poly I:C as models of infection. CD14 + monocytes, isolated from human peripheral blood, were cultured in GM-CSF- and IL-4-supplemented medium to generate immature DCs. Cultures were incubated with curcumin, stimulated with LPS or Poly I:C and functional assays were performed. Curcumin prevents DCs from responding to immunostimulants and inducing CD4 + T cell proliferation by blocking maturation marker, cytokine and chemokine expression and reducing both migration and endocytosis. These data suggest a therapeutic role for curcumin as an immune suppressant

  6. An overview of HCV molecular biology, replication and immune responses

    Directory of Open Access Journals (Sweden)

    Nawaz Zafar


    Full Text Available Abstract Hepatitis C virus (HCV causes acute and chronic hepatitis which can eventually lead to permanent liver damage, hepatocellular carcinoma and death. Currently, there is no vaccine available for prevention of HCV infection due to high degree of strain variation. The current treatment of care, Pegylated interferon α in combination with ribavirin is costly, has significant side effects and fails to cure about half of all infections. In this review, we summarize molecular virology, replication and immune responses against HCV and discussed how HCV escape from adaptive and humoral immune responses. This advance knowledge will be helpful for development of vaccine against HCV and discovery of new medicines both from synthetic chemistry and natural sources.

  7. Immune responses of poultry to Newcastle disease virus. (United States)

    Kapczynski, Darrell R; Afonso, Claudio L; Miller, Patti J


    Newcastle disease (ND) remains a constant threat to poultry producers worldwide, in spite of the availability and global employment of ND vaccinations since the 1950s. Strains of Newcastle disease virus (NDV) belong to the order Mononegavirales, family Paramyxoviridae, and genus Avulavirus, are contained in one serotype and are also known as avian paramyxovirus serotype-1 (APMV-1). They are pleomorphic in shape and are single-stranded, non-segmented, negative sense RNA viruses. The virus has been reported to infect most orders of birds and thus has a wide host range. Isolates are characterized by virulence in chickens and the presence of basic amino acids at the fusion protein cleavage site. Low virulent NDV typically produce subclinical disease with some morbidity, whereas virulent isolates can result in rapid, high mortality of birds. Virulent NDV are listed pathogens that require immediate notification to the Office of International Epizootics and outbreaks typically result in trade embargos. Protection against NDV is through the use of vaccines generated with low virulent NDV strains. Immunity is derived from neutralizing antibodies formed against the viral hemagglutinin and fusion glycoproteins, which are responsible for attachment and spread of the virus. However, new techniques and technologies have also allowed for more in depth analysis of the innate and cell-mediated immunity of poultry to NDV. Gene profiling experiments have led to the discovery of novel host genes modulated immediately after infection. Differences in virus virulence alter host gene response patterns have been demonstrated. Furthermore, the timing and contributions of cell-mediated immune responses appear to decrease disease and transmission potential. In view of recent reports of vaccine failure from many countries on the ability of classical NDV vaccines to stop spread of disease, renewed interest in a more complete understanding of the global immune response of poultry to NDV will be

  8. Enhancement of Immune Memory Responses to Respiratory Infection (United States)


    Unlimited Distribution 13. SUPPLEMENTARY NOTES 14. ABSTRACT Maintenance of long - term immunological memory against pathogens is crucial for the rapid...highly expressed in memory B cells in mice, and Atg7 is required for maintenance of long - term memory B cells needed to protect against influenza...AWARD NUMBER: W81XWH-16-1-0361 TITLE: Enhancement of Immune Memory Responses to Respiratory Infection PRINCIPAL INVESTIGATORs: Dr Farrah

  9. Immune response to Sarcocystis neurona infection in naturally infected horses with equine protozoal myeloencephalitis. (United States)

    Yang, Jibing; Ellison, Siobhan; Gogal, Robert; Norton, Heather; Lindsay, David S; Andrews, Frank; Ward, Daniel; Witonsky, Sharon


    Equine protozoal myeloencephalitis (EPM) is one of the most common neurologic diseases of horses in the United States. The primary etiologic agent is Sarcocystis neurona. Currently, there is limited knowledge regarding the protective or pathophysiologic immune response to S. neurona infection or the subsequent development of EPM. The objectives of this study were to determine whether S. neurona infected horses with clinical signs of EPM had altered or suppressed immune responses compared to neurologically normal horses and if blood sample storage would influence these findings. Twenty clinically normal horses and 22 horses with EPM, diagnosed by the presence of S. neurona specific antibodies in the serum and/or cerebrospinal (CSF) and clinical signs, were evaluated for differences in the immune cell subsets and function. Our results demonstrated that naturally infected horses had significantly (Pneurona in horses, as well as to determine the mechanism associated with suppressed in vitro proliferation responses. Finally, overnight storage of blood samples appears to alter T lymphocyte phenotypes and viability among leukocytes.

  10. Effect of host nutrition on immunity and local immune response of rabbits to Obeliscoides cuniculi

    International Nuclear Information System (INIS)

    Sinski, E.; Bezubik, B.; Wedrychowicz, H.; Szklarczyk, J.; Doligalska, M.


    In a series of experiments carried out on young and adult rabbits the effect of isocaloric low protein diets containing 4% or 8% protein compared with a diet containing 21% protein on Obeliscoides cuniculi infection was studied. The pathogenesis, resistance and local immunity were assessed after single infections with 10,000 larvae or reinfection with 5000 larvae. Live weight gain was reduced in young and adult rabbits fed the low protein diets, but the establishment of parasites was not substantially influenced by protein deprivation. However, development of worms in the histotrophic phase and parasite fecundity were impaired in association with the low protein diet. Moreover, mild anaemia as well as changes in the mucosal immune response as a result of infection were related to the level of dietary protein. (author). 30 refs, 6 figs, 5 tabs

  11. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus. (United States)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete


    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.

  12. Role of levamisole immunotherapy as an adjuvant to radiotherapy in oral cancer - Immune responses

    International Nuclear Information System (INIS)

    Balaram, P.; Remani, P.; Padmanabhan, T.K.


    Investigations were carried out to assess the effect of levamisole immunotherapy as an adjuvant to radiotherapy, on the immune response of patients with squamous cell carcinoma of the oral cavity. Parameters assessed were leukocyte migration inhibition, response to PPD and oral cancer extract (OCA), lymphocyte transformation to PHA, circulating antibodies to OCA and circulating immune complexes (CIC). Comparisons were made between groups receiving levamisole, those receiving placebo and normal controls. The results of a thirty-month follow-up are presented. Radiotherapy resulted in a depression of cell-mediated functions, reduction in antibody titre also showed a gradual increase with time of follow-up. Levamisole, however, appeared to reduce the levels of CIC. (author). 2 figs., 1 tab., 38 refs

  13. Cancer Immunotherapy and the Immune Response in Hodgkin Lymphoma

    Directory of Open Access Journals (Sweden)

    Christoph Renner


    Full Text Available Patients with classical Hodgkin lymphoma (cHL have an impaired cellular immune response as indicated by an anergic reaction against standard recall antigens and a diminished rejection reaction of allogeneic skin transplant. This clinical observation can be linked to the histopathological feature of cHL since the typical pattern of a cHL manifestation is characterized by sparse large CD30+ tumor-infiltrating Hodgkin–Reed–Sternberg (HRS cells that are surrounded by a dense inflammatory immune microenvironment with mixed cellularity. Despite this extensive polymorphous inflammatory infiltrate, there is only a poor antitumor immune response seen to the neoplastic HRS cells. This is primarily mediated by a high expression of PD-L1 and PD-L2 ligands on the HRS cell surface which in turn antagonizes the activity of programmed death-1 (PD-1 antigen-positive T cells. PD-L1/L2 overexpression is caused by gene amplification at the 9p24.1 locus and/or latent Epstein–Barr virus infection present in around 40% of cHL cases. The blockade of the PD-L1/L2–PD-1 pathway by monoclonal antibodies can restore local T cell activity and leads to impressive tumor responses, some of which are long lasting and eventually curative. Another feature of HRS cells is the high CD30 antigen expression. Monoclonal antibody technology allowed for the successful development of CD30-specific immunotoxins, bispecific antibodies, and reprogrammed autologous T cells with the first one already approved for the treatment of high risk or relapsed cHL. Altogether, the discovery of the described pathomechanism of immune suppression and the identification of preferential target antigens has rendered cHL to be a prime subject for the successful development of new immunotherapeutic approaches.

  14. Alterations in immune responses in prenatally irradiated dogs

    International Nuclear Information System (INIS)

    Nold, J.B.; Benjamin, S.A.; Miller, G.K.


    Immunologic responses were studied in beagle dogs following prenatal (35 days gestation) irradiation to evaluate the effects of ionizing radiation on the developing immune system. Each dog received 1.5 Gy 60 Co gamma irradiation or sham irradiation. Prenatally irradiated dogs exhibited a significant reduction in primary humoral antibody responses to inoculated sheep red blood cells, a T-dependent antigen, and a concurrent decrease in T-helper lymphocyte subpopulations in the peripheral blood at 3 to 4 months of age. Similarly, irradiated fetuses have been shown to have defects in epitheliostromal development of the thymus. It is suggested that the postnatal immunologic deficits may relate to the prenatal thymic injury

  15. Mannose Receptor Mediates the Immune Response to Ganoderma atrum Polysaccharides in Macrophages. (United States)

    Li, Wen-Juan; Tang, Xiao-Fang; Shuai, Xiao-Xue; Jiang, Cheng-Jia; Liu, Xiang; Wang, Le-Feng; Yao, Yu-Fei; Nie, Shao-Ping; Xie, Ming-Yong


    The ability of mannose receptor (MR) to recognize the carbohydrate structures is well-established. Here, we reported that MR was crucial for the immune response to a Ganoderma atrum polysaccharide (PSG-1), as evidenced by elevation of MR in association with increase of phagocytosis and concentrations of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α) in normal macrophages. Elevation of MR triggered by PSG-1 also led to control lipopolysaccharide (LPS)-triggered inflammatory response via the increase of interleukin-10 (IL-10) and inhibition of phagocytosis and IL-1β. Anti-MR antibody partly attenuated PSG-1-mediated anti-inflammatory responses, while it could not affect TNF-α secretion, suggesting that another receptor was involved in PSG-1-triggered immunomodulatory effects. MR and toll-like receptor (TLR)4 coordinated the influences on the TLR4-mediated signaling cascade by the nuclear factor-κB (NF-κB) pathway in LPS-stimulated macrophages subjected to PSG-1. Collectively, immune response to PSG-1 required recognition by MR in macrophages. The NF-κB pathway served as a central role for the coordination of MR and TLR4 to elicit immune response to PSG-1.

  16. Effects of anti-schistosomal chemotherapy on immune responses, protection and immunity. II. Concomitant immunity and immunization with irradiated cercariae

    International Nuclear Information System (INIS)

    Tawfik, A.F.; Colley, D.G.


    Resistance of mice to challenge infections of Schistosoma mansoni was evaluated before and after elimination of their primary, established S. mansoni infections with the chemotherapeutic drug praziquantel. Mice treated after either 10 or 20 weeks of primary infection were challenged 6 or 10 weeks after treatment. Mice infected for for 10 weeks prior to treatment expressed progressively less resistance 6 and 10 weeks after treatment. By 10 weeks after treatment significant levels of protection were no longer observed. Resistance waned more slowly if mice were treated 20 weeks after infection, and there was still significant expression of resistance to challenge 10 weeks after treatment. A separate set of experiments evaluated the use of highly irradiated cercariae as a vaccine in mice that had been previously infected with S. mansoni and cured with praziquantel. It was observed that effective immunizations were possible in previously infected mice. These studies demonstrate that established resistance waned after treatment and the rate of loss of protection was dependent upon the duration of infection prior to treatment. Furthermore, the irradiated cercarial vaccine studies indicate that in the murine model induction of immunological resistance was feasible following chemotherapeutic treatment of infected populations

  17. Immunocyto-adherence test for the detection of cell mediated immune response in lambs vaccinated with irradiated amphistome metacercariae (Cercariae indicae XXVI)

    International Nuclear Information System (INIS)

    Hafeez, Md.; Rao, B.V.; Krishnaswamy, S.


    Adherence of lymphocytes and peritoneal macrophages on amphistome metacercariae (Cercaries indicae XXVI) and Paramphistomum epiclitum adult flukes was observed with cells obtained from lambs immunized with either normal or irradiated amphistome metacercariae (Cercariae indicae XXVI). The cell adherence reaction around metacercariae and adult flukes was comparatively more pronounced with cells obtained from lambs immunized with 2.5 or 3 krad irradiated metacercariae in comparison to cells obtained from lambs immunized with normal of 2 krad irradiated metacercariae. Possibly better CMI response was involved in the operation of immunity against the amphistome in the former two groups of lambs. (author)

  18. Multi-scale modeling of the CD8 immune response

    Energy Technology Data Exchange (ETDEWEB)

    Barbarroux, Loic, E-mail: [Inria, Université de Lyon, UMR 5208, Institut Camille Jordan (France); Ecole Centrale de Lyon, 36 avenue Guy de Collongue, 69134 Ecully (France); Michel, Philippe, E-mail: [Inria, Université de Lyon, UMR 5208, Institut Camille Jordan (France); Ecole Centrale de Lyon, 36 avenue Guy de Collongue, 69134 Ecully (France); Adimy, Mostafa, E-mail: [Inria, Université de Lyon, UMR 5208, Université Lyon 1, Institut Camille Jordan, 43 Bd. du 11 novembre 1918, F-69200 Villeurbanne Cedex (France); Crauste, Fabien, E-mail: [Inria, Université de Lyon, UMR 5208, Université Lyon 1, Institut Camille Jordan, 43 Bd. du 11 novembre 1918, F-69200 Villeurbanne Cedex (France)


    During the primary CD8 T-Cell immune response to an intracellular pathogen, CD8 T-Cells undergo exponential proliferation and continuous differentiation, acquiring cytotoxic capabilities to address the infection and memorize the corresponding antigen. After cleaning the organism, the only CD8 T-Cells left are antigen-specific memory cells whose role is to respond stronger and faster in case they are presented this very same antigen again. That is how vaccines work: a small quantity of a weakened pathogen is introduced in the organism to trigger the primary response, generating corresponding memory cells in the process, giving the organism a way to defend himself in case it encounters the same pathogen again. To investigate this process, we propose a non linear, multi-scale mathematical model of the CD8 T-Cells immune response due to vaccination using a maturity structured partial differential equation. At the intracellular scale, the level of expression of key proteins is modeled by a delay differential equation system, which gives the speeds of maturation for each cell. The population of cells is modeled by a maturity structured equation whose speeds are given by the intracellular model. We focus here on building the model, as well as its asymptotic study. Finally, we display numerical simulations showing the model can reproduce the biological dynamics of the cell population for both the primary response and the secondary responses.

  19. Hypocretin/orexin loss changes the hypothalamic immune response. (United States)

    Tanaka, Susumu; Takizawa, Nae; Honda, Yoshiko; Koike, Taro; Oe, Souichi; Toyoda, Hiromi; Kodama, Tohru; Yamada, Hisao


    Hypocretin, also known as orexin, maintains the vigilance state and regulates various physiological processes, such as arousal, sleep, food intake, energy expenditure, and reward. Previously, we found that when wild-type mice and hypocretin/ataxin-3 littermates (which are depleted of hypothalamic hypocretin-expressing neurons postnatally) were administered lipopolysaccharide (LPS), the two genotypes exhibited significant differences in their sleep/wake cycle, including differences in the degree of increase in sleep periods and in recovery from sickness behaviour. In the present study, we examined changes in the hypothalamic vigilance system and in the hypothalamic expression of inflammatory factors in response to LPS in hypocretin/ataxin-3 mice. Peripheral immune challenge with LPS affected the hypothalamic immune response and vigilance states. This response was altered by the loss of hypocretin. Hypocretin expression was inhibited after LPS injection in both hypocretin/ataxin-3 mice and their wild-type littermates, but expression was completely abolished only in hypocretin/ataxin-3 mice. Increases in the number of histidine decarboxylase (HDC)-positive cells and in Hdc mRNA expression were found in hypocretin/ataxin-3 mice, and this increase was suppressed by LPS. Hypocretin loss did not impact the change in expression of hypothalamic inflammatory factors in response to LPS, except for interferon gamma and colony stimulating factor 3. The number of c-Fos-positive/HDC-positive cells in hypocretin/ataxin-3 mice administered LPS injections was elevated, even during the rest period, in all areas, suggesting that there is an increase in the activity of histaminergic neurons in hypocretin/ataxin-3 mice following LPS injection. Taken together, our results suggest a novel role for hypocretin in the hypothalamic response to peripheral immune challenge. Our findings contribute to the understanding of the pathophysiology of narcolepsy. Copyright © 2016 Elsevier Inc. All

  20. DMPD: Innate immune responses: crosstalk of signaling and regulation of genetranscription. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16753195 Innate immune responses: crosstalk of signaling and regulation of genetran...l) (.csml) Show Innate immune responses: crosstalk of signaling and regulation of genetranscription. PubmedI...D 16753195 Title Innate immune responses: crosstalk of signaling and regulation o

  1. Redox rhythm reinforces the circadian clock to gate immune response. (United States)

    Zhou, Mian; Wang, Wei; Karapetyan, Sargis; Mwimba, Musoki; Marqués, Jorge; Buchler, Nicolas E; Dong, Xinnian


    Recent studies have shown that in addition to the transcriptional circadian clock, many organisms, including Arabidopsis, have a circadian redox rhythm driven by the organism's metabolic activities. It has been hypothesized that the redox rhythm is linked to the circadian clock, but the mechanism and the biological significance of this link have only begun to be investigated. Here we report that the master immune regulator NPR1 (non-expressor of pathogenesis-related gene 1) of Arabidopsis is a sensor of the plant's redox state and regulates transcription of core circadian clock genes even in the absence of pathogen challenge. Surprisingly, acute perturbation in the redox status triggered by the immune signal salicylic acid does not compromise the circadian clock but rather leads to its reinforcement. Mathematical modelling and subsequent experiments show that NPR1 reinforces the circadian clock without changing the period by regulating both the morning and the evening clock genes. This balanced network architecture helps plants gate their immune responses towards the morning and minimize costs on growth at night. Our study demonstrates how a sensitive redox rhythm interacts with a robust circadian clock to ensure proper responsiveness to environmental stimuli without compromising fitness of the organism.

  2. Isometric exercise: cardiovascular responses in normal and cardiac populations. (United States)

    Hanson, P; Nagle, F


    Isometric exercise produces a characteristic pressor increase in blood pressure which may be important in maintaining perfusion of muscle during sustained contraction. This response is mediated by combined central and peripheral afferent input to medullary cardiovascular centers. In normal individuals the increase in blood pressure is mediated by a rise in cardiac output with little or no change in systemic vascular resistance. However, the pressor response is also maintained during pharmacologic blockade or surgical denervation by increasing systemic vascular resistance. Left ventricular function is normally maintained or improves in normal subjects and cardiac patients with mild impairment of left ventricular contractility. Patients with poor left ventricular function may show deterioration during isometric exercise, although this pattern of response is difficult to predict from resting studies. Recent studies have shown that patients with uncomplicated myocardial infarction can perform submaximum isometric exercise such as carrying weights in the range of 30 to 50 lb without difficulty or adverse responses. In addition, many patients who show ischemic ST depression or angina during dynamic exercise may have a reduced ischemic response during isometric or combined isometric and dynamic exercise. Isometric exercises are frequently encountered in activities of daily living and many occupational tasks. Cardiac patients should be gradually exposed to submaximum isometric training in supervised cardiac rehabilitation programs. Specific job tasks that require isometric or combined isometric and dynamic activities may be evaluated by work simulation studies. This approach to cardiac rehabilitation may facilitate patients who wish to return to a job requiring frequent isometric muscle contraction. Finally, there is a need for additional research on the long-term effects of isometric exercise training on left ventricular hypertrophy and performance. The vigorous training

  3. The immune response of horses to tetanus toxoid. (United States)

    Jansen, B C; Knoetze, P C


    An intramuscular injection of 8-16 Lf tetanus toxoid in water-in-oil emulsion protected adult horses against tetanus for at least 128 weeks. A booster dose of 8 Lf toxoid in aqueous solution protected them for a further period of at least 3 1/2 years. Colostral immunity protected foals for at least 10 weeks. An intramuscular injection of 8 Lf toxoid in water-in-oil emulsion given to foals from immune dams when they were 10-18 weeks old did not elicit any antibody response. They did respond, however, to a booster injection of 8 Lf toxoid in aqueous solution given 12 weeks after the first dose. New-born foals were shown to be inherently unable to respond to an injection of tetanus toxoid.

  4. Impact of Bee Venom Enzymes on Diseases and Immune Responses. (United States)

    Hossen, Md Sakib; Shapla, Ummay Mahfuza; Gan, Siew Hua; Khalil, Md Ibrahim


    Bee venom (BV) is used to treat many diseases and exhibits anti-inflammatory, anti-bacterial, antimutagenic, radioprotective, anti-nociceptive immunity promoting, hepatocyte protective and anti-cancer activity. According to the literature, BV contains several enzymes, including phospholipase A2 (PLA2), phospholipase B, hyaluronidase, acid phosphatase and α-glucosidase. Recent studies have also reported the detection of different classes of enzymes in BV, including esterases, proteases and peptidases, protease inhibitors and other important enzymes involved in carbohydrate metabolism. Nevertheless, the physiochemical properties and functions of each enzyme class and their mechanisms remain unclear. Various pharmacotherapeutic effects of some of the BV enzymes have been reported in several studies. At present, ongoing research aims to characterize each enzyme and elucidate their specific biological roles. This review gathers all the current knowledge on BV enzymes and their specific mechanisms in regulating various immune responses and physiological changes to provide a basis for future therapies for various diseases.

  5. Impact of Bee Venom Enzymes on Diseases and Immune Responses

    Directory of Open Access Journals (Sweden)

    Md. Sakib Hossen


    Full Text Available Bee venom (BV is used to treat many diseases and exhibits anti-inflammatory, anti-bacterial, antimutagenic, radioprotective, anti-nociceptive immunity promoting, hepatocyte protective and anti-cancer activity. According to the literature, BV contains several enzymes, including phospholipase A2 (PLA2, phospholipase B, hyaluronidase, acid phosphatase and α-glucosidase. Recent studies have also reported the detection of different classes of enzymes in BV, including esterases, proteases and peptidases, protease inhibitors and other important enzymes involved in carbohydrate metabolism. Nevertheless, the physiochemical properties and functions of each enzyme class and their mechanisms remain unclear. Various pharmacotherapeutic effects of some of the BV enzymes have been reported in several studies. At present, ongoing research aims to characterize each enzyme and elucidate their specific biological roles. This review gathers all the current knowledge on BV enzymes and their specific mechanisms in regulating various immune responses and physiological changes to provide a basis for future therapies for various diseases.

  6. Danger Signals Activating the Immune Response after Trauma

    Directory of Open Access Journals (Sweden)

    Stefanie Hirsiger


    Full Text Available Sterile injury can cause a systemic inflammatory response syndrome (SIRS that resembles the host response during sepsis. The inflammatory response following trauma comprises various systems of the human body which are cross-linked with each other within a highly complex network of inflammation. Endogenous danger signals (danger-associated molecular patterns; DAMPs; alarmins as well as exogenous pathogen-associated molecular patterns (PAMPs play a crucial role in the initiation of the immune response. With popularization of the “danger theory,” numerous DAMPs and PAMPs and their corresponding pathogen-recognition receptors have been identified. In this paper, we highlight the role of the DAMPs high-mobility group box protein 1 (HMGB1, interleukin-1α (IL-1α, and interleukin-33 (IL-33 as unique dual-function mediators as well as mitochondrial danger signals released upon cellular trauma and necrosis.

  7. Glucosinolate metabolites required for an Arabidopsis innate immune response. (United States)

    Clay, Nicole K; Adio, Adewale M; Denoux, Carine; Jander, Georg; Ausubel, Frederick M


    The perception of pathogen or microbe-associated molecular pattern molecules by plants triggers a basal defense response analogous to animal innate immunity and is defined partly by the deposition of the glucan polymer callose at the cell wall at the site of pathogen contact. Transcriptional and metabolic profiling in Arabidopsis mutants, coupled with the monitoring of pathogen-triggered callose deposition, have identified major roles in pathogen response for the plant hormone ethylene and the secondary metabolite 4-methoxy-indol-3-ylmethylglucosinolate. Two genes, PEN2 and PEN3, are also necessary for resistance to pathogens and are required for both callose deposition and glucosinolate activation, suggesting that the pathogen-triggered callose response is required for resistance to microbial pathogens. Our study shows that well-studied plant metabolites, previously identified as important in avoiding damage by herbivores, are also required as a component of the plant defense response against microbial pathogens.

  8. Glucosinolate Metabolites Required for an Arabidopsis Innate Immune Response* (United States)

    Clay, Nicole K.; Adio, Adewale M.; Denoux, Carine; Jander, Georg; Ausubel, Frederick M.


    Summary The perception of pathogen or microbe-associated molecular pattern molecules by plants triggers a basal defense response analogous to animal innate immunity, and is defined in part by the deposition of the glucan polymer callose at the cell wall at the site of pathogen contact. Transcriptional and metabolic profiling in Arabidopsis mutants, coupled with the monitoring of pathogen triggered callose deposition, have identified major roles in pathogen response for the plant hormone ethylene and the secondary metabolite 4-methoxy-indol-3-ylmethylglucosinolate. Two genes, PEN2 and PEN3, are also necessary for resistance to pathogens and are required for both callose deposition and glucosinolate activation, suggesting that the pathogen triggered callose response is required for resistance to microbial pathogens. Our study shows that well-studied plant metabolites, previously identified as important in avoiding damage by herbivores, are also required as a component of the plant defense response against microbial pathogens. PMID:19095898

  9. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings (United States)

    Ruiz, Lorena; Espinosa-Martos, Irene; García-Carral, Cristina; Manzano, Susana; McGuire, Michelle K.; Meehan, Courtney L.; McGuire, Mark A.; Williams, Janet E.; Foster, James; Sellen, Daniel W.; Kamau-Mbuthia, Elizabeth W.; Kamundia, Egidioh W.; Mbugua, Samwel; Moore, Sophie E.; Kvist, Linda J.; Otoo, Gloria E.; Lackey, Kimberly A.; Flores, Katherine; Pareja, Rossina G.; Bode, Lars; Rodríguez, Juan M.


    Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα), acquired immunity factors (IL2, IL4, IL10, IL13, IL17), chemokines (IL8, Groα, MCP1, MIP1β), growth factors [IL5, IL7, epidermal growth factor (EGF), granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM), in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not) common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid. Clinical Trial Registration:, identifier NCT02670278. PMID:28713365

  10. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

    Directory of Open Access Journals (Sweden)

    Lorena Ruiz


    Full Text Available Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα, acquired immunity factors (IL2, IL4, IL10, IL13, IL17, chemokines (IL8, Groα, MCP1, MIP1β, growth factors [IL5, IL7, epidermal growth factor (EGF, granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM, in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid.Clinical Trial, identifier NCT02670278.

  11. Entirely Carbohydrate-Based Vaccines: An Emerging Field for Specific and Selective Immune Responses

    Directory of Open Access Journals (Sweden)

    Sharmeen Nishat


    Full Text Available Carbohydrates are regarded as promising targets for vaccine development against infectious disease because cell surface glycans on many infectious agents are attributed to playing an important role in pathogenesis. In addition, oncogenic transformation of normal cells, in many cases, is associated with aberrant glycosylation of the cell surface glycan generating tumor associated carbohydrate antigens (TACAs. Technological advances in glycobiology have added a new dimension to immunotherapy when considering carbohydrates as key targets in developing safe and effective vaccines to combat cancer, bacterial infections, viral infections, etc. Many consider effective vaccines induce T-cell dependent immunity with satisfactory levels of immunological memory that preclude recurrence. Unfortunately, carbohydrates alone are poorly immunogenic as they do not bind strongly to the MHCII complex and thus fail to elicit T-cell immunity. To increase immunogenicity, carbohydrates have been conjugated to carrier proteins, which sometimes can impede carbohydrate specific immunity as peptide-based immune responses can negate antibodies directed at the targeted carbohydrate antigens. To overcome many challenges in using carbohydrate-based vaccine design and development approaches targeting cancer and other diseases, zwitterionic polysaccharides (ZPSs, isolated from the capsule of commensal anaerobic bacteria, will be discussed as promising carriers of carbohydrate antigens to achieve desired immunological responses.

  12. Stimulation of dendritic cells enhances immune response after photodynamic therapy (United States)

    Mroz, Pawel; Castano, Ana P.; Hamblin, Michael R.


    Photodynamic therapy (PDT) involves the administration of photosensitizers followed by illumination of the primary tumor with red light producing reactive oxygen species that cause vascular shutdown and tumor cell necrosis and apoptosis. Anti-tumor immunity is stimulated after PDT due to the acute inflammatory response, priming of the immune system to recognize tumor-associated antigens (TAA). The induction of specific CD8+ Tlymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. This process is however, often sub-optimal, in part due to tumor-induced DC dysfunction. Instead of DC that can become mature and activated and have a potent antigen-presenting and immune stimulating phenotype, immature dendritic cells (iDC) are often found in tumors and are part of an immunosuppressive milieu including regulatory T-cells and immunosuppressive cytokines such as TGF-beta and IL10. We here report on the use of a potent DC activating agent, an oligonucleotide (ODN) that contains a non-methylated CpG motif and acts as an agonist of toll like receptor (TLR) 9. TLR activation is a danger signal to notify the immune system of the presence of invading pathogens. CpG-ODN (but not scrambled non-CpG ODN) increased bone-marrow DC activation after exposure to PDT-killed tumor cells, and significantly increased tumor response to PDT and mouse survival after peri-tumoral administration. CpG may be a valuable immunoadjuvant to PDT especially for tumors that produce DC dysfunction.

  13. Murine immune responses to oral BCG immunization in the presence or absence of prior BCG sensitization. (United States)

    Cross, Martin L; Lambeth, Matthew R; Aldwell, Frank E


    Oral delivery of live Mycobacterium bovis BCG in a lipid matrix invokes cell-mediated immune (CMI) responses in mice and consequent protection against pulmonary challenge with virulent mycobacteria. To investigate the influence of prior BCG sensitization on oral vaccine efficacy, we assessed CMI responses and BCG colonization of the alimentary tract lymphatics 5 months after oral vaccination, in both previously naive mice and in mice that had been sensitized to BCG by injection 6 months previously. CMI responses did not differ significantly between mice that received subcutaneous BCG followed by oral BCG and those that received either injected or oral BCG alone. In vivo BCG colonization was predominant in the mesenteric lymph nodes after oral vaccination; this colonizing ability was not influenced by prior BCG sensitization. From this murine model study, we conclude that although prior parenteral-route BCG sensitization does not detrimentally affect BCG colonization after oral vaccination, there is no significant immune-boosting effect of the oral vaccine either.

  14. Genetic immunization in the lung induces potent local and systemic immune responses

    NARCIS (Netherlands)

    Song, Kaimei; Bolton, Diane L.; Wilson, Robert L.; Camp, Jeremy V.; Bao, Saran; Mattapallil, Joseph J.; Herzenberg, Leonore A.; Herzenberg, Leonard A.; Andrews, Charla A.; Sadoff, Jerald C.; Goudsmit, Jaap; Pau, Maria Grazia; Seder, Robert A.; Kozlowski, Pamela A.; Nabel, Gary J.; Roederer, Mario; Rao, Srinivas S.


    Successful vaccination against respiratory infections requires elicitation of high levels of potent and durable humoral and cellular responses in the lower airways. To accomplish this goal, we used a fine aerosol that targets the entire lung surface through normal respiration to deliver

  15. Transcriptomic Study on Ovine Immune Responses to Fasciola hepatica Infection.

    Directory of Open Access Journals (Sweden)

    Yan Fu


    Full Text Available Fasciola hepatica is not only responsible for major economic losses in livestock farming, but is also a major food-borne zoonotic agent, with 180 million people being at risk of infection worldwide. This parasite is sophisticated in manipulating the hosts' immune system to benefit its own survival. A better understanding of the mechanisms underpinning this immunomodulation is crucial for the development of control strategies such as vaccines.This in vivo study investigated the global gene expression changes of ovine peripheral blood mononuclear cells (PBMC response to both acute & chronic infection of F. hepatica, and revealed 6490 and 2364 differential expressed genes (DEGS, respectively. Several transcriptional regulators were predicted to be significantly inhibited (e.g. IL12 and IL18 or activated (e.g. miR155-5p in PBMC during infection. Ingenuity Pathway Analysis highlighted a series of immune-associated pathways involved in the response to infection, including 'Transforming Growth Factor Beta (TGFβ signaling', 'Production of Nitric Oxide in Macrophages', 'Toll-like Receptor (TLRs Signaling', 'Death Receptor Signaling' and 'IL17 Signaling'. We hypothesize that activation of pathways relevant to fibrosis in ovine chronic infection, may differ from those seen in cattle. Potential mechanisms behind immunomodulation in F. hepatica infection are a discussed.In conclusion, the present study performed global transcriptomic analysis of ovine PBMC, the primary innate/adaptive immune cells, in response to infection with F. hepatica, using deep-sequencing (RNAseq. This dataset provides novel information pertinent to understanding of the pathological processes in fasciolosis, as well as a base from which to further refine development of vaccines.

  16. Immune Response to Sipuleucel-T in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    David I. Quinn


    Full Text Available Historically, chemotherapy has remained the most commonly utilized therapy in patients with metastatic cancers. In prostate cancer, chemotherapy has been reserved for patients whose metastatic disease becomes resistant to first line castration or androgen deprivation. While chemotherapy palliates, decreases serum prostate specific antigen and improves survival, it is associated with significant side effects and is only suitable for approximately 60% of patients with castrate-resistant prostate cancer. On that basis, exploration of other therapeutic options such as active secondary hormone therapy, bone targeted treatments and immunotherapy are important. Until recently, immunotherapy has had no role in the treatment of solid malignancies aside from renal cancer and melanoma. The FDA-approved autologous cellular immunotherapy sipuleucel-T has demonstrated efficacy in improving overall survival in patients with metastatic castrate-resistant prostate cancer in randomized clinical trials. The proposed mechanism of action is reliant on activating the patients’ own antigen presenting cells (APCs to prostatic acid phosphatase (PAP fused with granulocyte-macrophage colony stimulating factor (GM-CSF and subsequent triggered T-cell response to PAP on the surface of prostate cancer cells in the patients body. Despite significant prolongation of survival in Phase III trials, the challenge to health care providers remains the dissociation between objective changes in serum PSA or on imaging studies after sipleucel-T and survival benefit. On that basis there is an unmet need for markers of outcome and a quest to identify immunologic or clinical surrogates to fill this role. This review focuses on the impact of sipuleucel-T on the immune system, the T and B cells, and their responses to relevant antigens and prostate cancer. Other therapeutic modalities such as chemotherapy, corticosteroids and GM-CSF and host factors can also affect immune response. The

  17. Plasmodium berghei: immunosuppression of the cell-mediated immune response induced by nonviable antigenic preparations

    International Nuclear Information System (INIS)

    Gross, A.; Frankenburg, S.


    In this work, plasmodial antigens were examined for their ability to suppress the cellular immune response during lethal Plasmodium berghei infection. Splenic enlargement and the number and function of white spleen cells were assessed after injection of normal mice with irradiated parasitized erythrocytes (IPE) or with parasitized erythrocytes (PE) membranes. Both IPE and PE membranes caused splenomegaly and an increase in the number of splenic white cells with concurrent alteration of the relative proportions of T cells and macrophages. The percentage of T lymphocytes was fractionally diminished, but there was a marked increase in Lyt 2.2 positive (suppressor and cytotoxic) T subsets and in the number of splenic macrophage precursors. The pathological enlargement of the spleen was induced by various plasma membrane-derived antigens containing both proteins and carbohydrates. Splenocytes of mice injected with liposomes containing deoxycholate-treated PE or PE fractions showed both diminished interleukin 2 production and a decreased response to mitogen. It appears that some of the changes in the cellular immune response during P. berghei infection are a consequence of the massive provision of a wide spectrum of antigens, capable of suppressing the immune response. Thus, it may be appropriate to evaluate the possible negative effect of parasite epitopes that are candidates for vaccine

  18. Muscles provide protection during microbial infection by activating innate immune response pathways in Drosophila and zebrafish

    Directory of Open Access Journals (Sweden)

    Arunita Chatterjee


    Full Text Available Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual.

  19. Plasma catecholamine responses to physiologic stimuli in normal human pregnancy. (United States)

    Barron, W M; Mujais, S K; Zinaman, M; Bravo, E L; Lindheimer, M D


    The dynamic response of the sympathoadrenal system was evaluated during and after pregnancy in 13 healthy women with a protocol that compared cardiovascular parameters and plasma catecholamine levels during the basal state, after postural maneuvers, and following isometric exercise. Plasma epinephrine and norepinephrine levels were similar during and after gestation when the women rested on their sides, but heart rate was greater in pregnancy. Ten minutes of supine recumbency produced minimal changes, but attenuation of the anticipated increases in heart rate and plasma norepinephrine levels during standing and isometric exercise were observed during pregnancy. In contrast, alterations in plasma epinephrine appeared unaffected by gestation. Plasma renin activity and aldosterone levels were, as expected, greater during pregnancy; however, increments in response to upright posture were similar in pregnant and postpartum women. To the extent that circulating catecholamines may be considered indices of sympathoadrenal function, these data suggest that normal pregnancy alters cardiovascular and sympathetic nervous system responses to physiologic stimuli.

  20. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus

    DEFF Research Database (Denmark)

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter


    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper...

  1. Adoptive transfer of natural antibodies to non-immunized chickens affects subsequent antigen-specific humoral and cellular immune responses

    NARCIS (Netherlands)

    Lammers, A.; Klomp, M.E.V.; Nieuwland, M.G.B.; Savelkoul, H.F.J.; Parmentier, H.K.


    To determine a regulatory function of natural antibodies in the immune response of chickens, pooled plasma obtained from non-immunized (naive) 15 months old hens was subjected to keyhole limpet hemocyanin (KLH) antigen-affinity chromatography. Purified KLH-binding antibodies were adoptively

  2. Regulation of Mucosal Immune Responses – The Missing Link in IBD?

    Directory of Open Access Journals (Sweden)

    Charles O Elson


    Full Text Available Although the etiology of inflammatory bowel disease (IBD remains unknown, a major working hypothesis is that it represents a dysregulated immune response to common enteric bacterial antigens. Until recently there has been a relative dearth of experimental models to study this hypothesis. However, exciting developments in experimental models of colitis, including spontaneous, transgenic and knockout mice, now allow this and other hypotheses to be tested. The regulation of mucosal immune responses is not well understood in the normal animal, much less in those with chronic intestinal inflammation. Clearly the CD4 Th1 and Th2 pathways are important in the host response to microbial pathogens, and recent data indicate that the intestinal mucosa seems to be a site of preferential Th2 responses toward exogenous antigens. Deletion of certain cytokine genes involved in maintaining this Th1/Th2 balance (interleukin [IL]-2, IL-10 resulted in colitis, although deletion of others (IL-4, interferon-gamma that are also involved did not. Whether these cytokine gene deletions cause a dysregulation of the mucosal immune response has yet to be shown. However, the importance of regulation can be demonstrated in a model in which a normal CD4+ T cell subset (CD45Rbhigh is transferred into syngeneic severe combined immunodeficiency syndrome recipients. This results in a striking colitis over the ensuing weeks with chronic diarrhea and wasting of the animals. If the reciprocal CD4+ subset (CD45Rblow is co-transferred or if whole CD4+ T cells are transferred no colitis ensues. Therefore, T cells capable of causing colitis are present in normal animals but are prevented from doing so by immunoregulatory mechanisms. The antigens that drive the colitis in several of these models (IL-2 knockout mouse, human leukocyte antigen B27/β2M transgenic rat appear to be those of the normal enteric bacterial flora because germ-free animals do not get the disease. Spontaneously

  3. Feliform carnivores have a distinguished constitutive innate immune response

    Directory of Open Access Journals (Sweden)

    Sonja K. Heinrich


    Full Text Available Determining the immunological phenotype of endangered and threatened populations is important to identify those vulnerable to novel pathogens. Among mammals, members of the order Carnivora are particularly threatened by diseases. We therefore examined the constitutive innate immune system, the first line of protection against invading microbes, of six free-ranging carnivore species; the black-backed jackal (Canis mesomelas, the brown hyena (Hyena brunnea, the caracal (Caracal caracal, the cheetah (Acinonyx jubatus, the leopard (Panthera pardus and the lion (Panthera leo using a bacterial killing assay. The differences in immune responses amongst the six species were independent of their foraging behaviour, body mass or social organisation but reflected their phylogenetic relatedness. The bacterial killing capacity of black-backed jackals, a member of the suborder Caniformia, followed the pattern established for a wide variety of vertebrates. In contrast, the five representatives of the suborder Feliformia demonstrated a killing capacity at least an order of magnitude higher than any species reported previously, with a particularly high capacity in caracals and cheetahs. Our results suggest that the immunocompetence of threatened felids such as the cheetah has been underestimated and its assessment ought to consider both innate and adaptive components of the immune system.

  4. Outcome Prediction in Mathematical Models of Immune Response to Infection.

    Directory of Open Access Journals (Sweden)

    Manuel Mai

    Full Text Available Clinicians need to predict patient outcomes with high accuracy as early as possible after disease inception. In this manuscript, we show that patient-to-patient variability sets a fundamental limit on outcome prediction accuracy for a general class of mathematical models for the immune response to infection. However, accuracy can be increased at the expense of delayed prognosis. We investigate several systems of ordinary differential equations (ODEs that model the host immune response to a pathogen load. Advantages of systems of ODEs for investigating the immune response to infection include the ability to collect data on large numbers of 'virtual patients', each with a given set of model parameters, and obtain many time points during the course of the infection. We implement patient-to-patient variability v in the ODE models by randomly selecting the model parameters from distributions with coefficients of variation v that are centered on physiological values. We use logistic regression with one-versus-all classification to predict the discrete steady-state outcomes of the system. We find that the prediction algorithm achieves near 100% accuracy for v = 0, and the accuracy decreases with increasing v for all ODE models studied. The fact that multiple steady-state outcomes can be obtained for a given initial condition, i.e. the basins of attraction overlap in the space of initial conditions, limits the prediction accuracy for v > 0. Increasing the elapsed time of the variables used to train and test the classifier, increases the prediction accuracy, while adding explicit external noise to the ODE models decreases the prediction accuracy. Our results quantify the competition between early prognosis and high prediction accuracy that is frequently encountered by clinicians.

  5. Yersinia type III effectors perturb host innate immune responses (United States)

    Pha, Khavong; Navarro, Lorena


    The innate immune system is the first line of defense against invading pathogens. Innate immune cells recognize molecular patterns from the pathogen and mount a response to resolve the infection. The production of proinflammatory cytokines and reactive oxygen species, phagocytosis, and induced programmed cell death are processes initiated by innate immune cells in order to combat invading pathogens. However, pathogens have evolved various virulence mechanisms to subvert these responses. One strategy utilized by Gram-negative bacterial pathogens is the deployment of a complex machine termed the type III secretion system (T3SS). The T3SS is composed of a syringe-like needle structure and the effector proteins that are injected directly into a target host cell to disrupt a cellular response. The three human pathogenic Yersinia spp. (Y. pestis, Y. enterocolitica, and Y. pseudotuberculosis) are Gram-negative bacteria that share in common a 70 kb virulence plasmid which encodes the T3SS. Translocation of the Yersinia effector proteins (YopE, YopH, YopT, YopM, YpkA/YopO, and YopP/J) into the target host cell results in disruption of the actin cytoskeleton to inhibit phagocytosis, downregulation of proinflammatory cytokine/chemokine production, and induction of cellular apoptosis of the target cell. Over the past 25 years, studies on the Yersinia effector proteins have unveiled tremendous knowledge of how the effectors enhance Yersinia virulence. Recently, the long awaited crystal structure of YpkA has been solved providing further insights into the activation of the YpkA kinase domain. Multisite autophosphorylation by YpkA to activate its kinase domain was also shown and postulated to serve as a mechanism to bypass regulation by host phosphatases. In addition, novel Yersinia effector protein targets, such as caspase-1, and signaling pathways including activation of the inflammasome were identified. In this review, we summarize the recent discoveries made on Yersinia

  6. [Comparison of immune response after oral and intranasal immunization with recombinant Lactobacillus casei expressing ETEC F41]. (United States)

    Liu, Jiankui; Wei, Chunhua; Hou, Xilin; Wang, Guihua; Yu, Liyun


    In order to represent a promising strategy for mucosal vaccination, oral or intranasal immunization of Specific Pathogen Free (SPF) BALB/c mice were performed. The mucosal immunity, systemic immune and protective immune responses were compared after immunization with the recombinant Lactobacillus casei (L. casei) harboring enterotoxigenic Escherichia coli (ETEC) F41. The recombinant fusion proteins were detected by Western blot. Surface localization of the fusion protein was verified by immunofluorescence microscopy and flow cytometry. Six-week-old female SPF BALB/c mice (160 heads) were divided into 4 groups for immunization and control. Oral and intranasal immunization of mice was performed with the recombinant strain L. casei harboring pLA-F41 or pLA. For oral immunization, the mice were inoculated daily on days 0 to 4, 7 to 11, 21 to 25, and 49 to 53. A lighter schedule was used for nasal immunization (days 0 to 2, 7 to 9, 21 and 49). Specific anti-F41 IgG antibody in the serum and specific anti-F41 secret immunoglobulin A (sIgA) antibody in the lung, intestines, vagina fluid and feces of mice were detected by indirect ELISA. The mice orally or intranasally immunized with pLA-F41/L. casei and pLA/IL. casei were challenged with standard-type ETEC F41 (C83919) (2 x 10(3) LD50). Mice immunized with pLA-F41/L. casei could produce remarkable anti-F41 antibody level. More than 90% survived in oral immunization group whereas more than 85% survived in intranasal immunization group after challenged with C83919, all dead in the control group. Ninety percent of the pups survived in oral immunization group whereas 80% survived in intranasal immunization group after challenged with C83919, but only a 5% survival rate for pups that were either immunized with a control pLA vector or unimmunized. Oral or intranasal immunization with recombinant L. casei displaying ETEC F41 antigens on the surface induced effective and similar systemic and mucosal immune responses against the

  7. Serum and mucosal immune responses to an inactivated influenza virus vaccine induced by epidermal powder immunization. (United States)

    Chen, D; Periwal, S B; Larrivee, K; Zuleger, C; Erickson, C A; Endres, R L; Payne, L G


    Both circulating and mucosal antibodies are considered important for protection against infection by influenza virus in humans and animals. However, current inactivated vaccines administered by intramuscular injection using a syringe and needle elicit primarily circulating antibodies. In this study, we report that epidermal powder immunization (EPI) via a unique powder delivery system elicits both serum and mucosal antibodies to an inactivated influenza virus vaccine. Serum antibody responses to influenza vaccine following EPI were enhanced by codelivery of cholera toxin (CT), a synthetic oligodeoxynucleotide containing immunostimulatory CpG motifs (CpG DNA), or the combination of these two adjuvants. In addition, secretory immunoglobulin A (sIgA) antibodies were detected in the saliva and mucosal lavages of the small intestine, trachea, and vaginal tract, although the titers were much lower than the IgG titers. The local origin of the sIgA antibodies was further shown by measuring antibodies released from cultured tracheal and small intestinal fragments and by detecting antigen-specific IgA-secreting cells in the lamina propria using ELISPOT assays. EPI with a single dose of influenza vaccine containing CT or CT and CpG DNA conferred complete protection against lethal challenges with an influenza virus isolated 30 years ago, whereas a prime and boost immunizations were required for protection in the absence of an adjuvant. The ability to elicit augmented circulating antibody and mucosal antibody responses makes EPI a promising alternative to needle injection for administering vaccines against influenza and other diseases.

  8. Zoospore exudates from Phytophthora nicotianae affect immune responses in Arabidopsis. (United States)

    Kong, Ping; McDowell, John M; Hong, Chuanxue


    Zoospore exudates play important roles in promoting zoospore communication, homing and germination during plant infection by Phytophthora. However, it is not clear whether exudates affect plant immunity. Zoospore-free fluid (ZFF) and zoospores of P. nicotianae were investigated comparatively for effects on resistance of Arabidopsis thaliana Col-0 and mutants that affect signaling mediated by salicylic acid (SA) and jasmonic acid (JA): eds16 (enhanced disease susceptibility16), pad4 (phytoalexin deficient4), and npr1 (nonexpressor of pathogenesis-related genes1). Col-0 attracted more zoospores and had severe tissue damage when flooded with a zoospore suspension in ZFF. Mutants treated with ZFF alone developed disease symptoms similar to those inoculated with zoospores and requirements of EDS16 and PAD4 for plant responses to zoospores and the exudates was apparent. Zoospore and ZFFs also induced expression of the PR1 and PDF1.2 marker genes for defense regulated by SA and JA, respectively. However, ZFF affected more JA defense signaling, down regulating PR1 when SA signaling or synthesis is deficient, which may be responsible for Arabidopsis mutant plants more susceptible to infection by high concentration of P. nicotianae zoospores. These results suggest that zoospore exudates can function as virulence factors and inducers of plant immune responses during plant infection by Phytophthora.

  9. Zoospore exudates from Phytophthora nicotianae affect immune responses in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Ping Kong

    Full Text Available Zoospore exudates play important roles in promoting zoospore communication, homing and germination during plant infection by Phytophthora. However, it is not clear whether exudates affect plant immunity. Zoospore-free fluid (ZFF and zoospores of P. nicotianae were investigated comparatively for effects on resistance of Arabidopsis thaliana Col-0 and mutants that affect signaling mediated by salicylic acid (SA and jasmonic acid (JA: eds16 (enhanced disease susceptibility16, pad4 (phytoalexin deficient4, and npr1 (nonexpressor of pathogenesis-related genes1. Col-0 attracted more zoospores and had severe tissue damage when flooded with a zoospore suspension in ZFF. Mutants treated with ZFF alone developed disease symptoms similar to those inoculated with zoospores and requirements of EDS16 and PAD4 for plant responses to zoospores and the exudates was apparent. Zoospore and ZFFs also induced expression of the PR1 and PDF1.2 marker genes for defense regulated by SA and JA, respectively. However, ZFF affected more JA defense signaling, down regulating PR1 when SA signaling or synthesis is deficient, which may be responsible for Arabidopsis mutant plants more susceptible to infection by high concentration of P. nicotianae zoospores. These results suggest that zoospore exudates can function as virulence factors and inducers of plant immune responses during plant infection by Phytophthora.

  10. Innate lymphoid cells and their role in immune response regulation

    Directory of Open Access Journals (Sweden)

    Bibiana Patricia Ruiz-Sánchez


    Full Text Available Innate lymphoid cells (ILCs are lymphocytes lacking antigen recognition receptors and become activated in response to cytokines and through microbe-associated molecular pattern (MAMP receptors. ILCs are found mainly in mucosal tissues and participate in the immune response against infections and in chronic inflammatory conditions. ILCs are divided in ILC-1, ILC-2 and ILC-3, and these cells have analogue functions to those of immune adaptive response lymphocytes Th1, Th2 and Th17. ILC-1 express T-bet, produce IFNγ, protect against infections with intracellular microorganisms and are related to inflammatory bowel disease immunopathology. ILC-2 express GATA3, produce IL-4, IL-5, IL-13 and amphiregulin, protect against parasitic infections and related to allergy and obesity immunopathology. ILC-3 express ROR(γt, produce IL-17 and IL-22, protect against fungal infections and contribute to tolerance to intestinal microbiota and intestinal repair. They are related to inflammatory bowel disease and psoriasis immunopathology. In general terms, ILCs maintain homeostasis and coadjuvate in the protection against infections.

  11. The immune cell composition in Barrett's metaplastic tissue resembles that in normal duodenal tissue.

    Directory of Open Access Journals (Sweden)

    Alexandra Lind

    Full Text Available BACKGROUND AND OBJECTIVE: Barrett's esophagus (BE is characterized by the transition of squamous epithelium into columnar epithelium with intestinal metaplasia. The increased number and types of immune cells in BE have been indicated to be due to a Th2-type inflammatory process. We tested the alternative hypothesis that the abundance of T-cells in BE is caused by a homing mechanism that is found in the duodenum. PATIENTS AND METHODS: Biopsies from BE and duodenal tissue from 30 BE patients and duodenal tissue from 18 controls were characterized by immmunohistochemistry for the presence of T-cells and eosinophils(eos. Ex vivo expanded T-cells were further phenotyped by multicolor analysis using flowcytometry. RESULTS: The high percentage of CD4(+-T cells (69±3% (mean±SEM/n = 17, by flowcytometry, measured by flowcytometry and immunohistochemistry, and the presence of non-activated eosinophils found in BE by immunohistochemical staining, were not different from that found in duodenal tissue. Expanded lymphocytes from these tissues had a similar phenotype, characterized by a comparable but low percentage of αE(CD103 positive CD4(+cells (44±5% in BE, 43±4% in duodenum of BE and 34±7% in duodenum of controls and a similar percentage of granzyme-B(+CD8(+ cells(44±5% in BE, 33±6% in duodenum of BE and 36±7% in duodenum of controls. In addition, a similar percentage of α4β7(+ T-lymphocytes (63±5% in BE, 58±5% in duodenum of BE and 62±8% in duodenum of controls was found. Finally, mRNA expression of the ligand for α4β7, MAdCAM-1, was also similar in BE and duodenal tissue. No evidence for a Th2-response was found as almost no IL-4(+-T-cells were seen. CONCLUSION: The immune cell composition (lymphocytes and eosinophils and expression of intestinal adhesion molecule MAdCAM-1 is similar in BE and duodenum. This supports the hypothesis that homing of lymphocytes to BE tissue is mainly caused by intestinal homing signals rather than to an

  12. Immune response to mycobacterial infection: lessons from flow cytometry. (United States)

    Rovina, Nikoletta; Panagiotou, Marios; Pontikis, Konstantinos; Kyriakopoulou, Magdalini; Koulouris, Nikolaos G; Koutsoukou, Antonia


    Detecting and treating active and latent tuberculosis are pivotal elements for effective infection control; yet, due to their significant inherent limitations, the diagnostic means for these two stages of tuberculosis (TB) to date remain suboptimal. This paper reviews the current diagnostic tools for mycobacterial infection and focuses on the application of flow cytometry as a promising method for rapid and reliable diagnosis of mycobacterial infection as well as discrimination between active and latent TB: it summarizes diagnostic biomarkers distinguishing the two states of infection and also features of the distinct immune response against Mycobacterium tuberculosis (Mtb) at certain stages of infection as revealed by flow cytometry to date.

  13. Immune Response to Mycobacterial Infection: Lessons from Flow Cytometry

    Directory of Open Access Journals (Sweden)

    Nikoletta Rovina


    Full Text Available Detecting and treating active and latent tuberculosis are pivotal elements for effective infection control; yet, due to their significant inherent limitations, the diagnostic means for these two stages of tuberculosis (TB to date remain suboptimal. This paper reviews the current diagnostic tools for mycobacterial infection and focuses on the application of flow cytometry as a promising method for rapid and reliable diagnosis of mycobacterial infection as well as discrimination between active and latent TB: it summarizes diagnostic biomarkers distinguishing the two states of infection and also features of the distinct immune response against Mycobacterium tuberculosis (Mtb at certain stages of infection as revealed by flow cytometry to date.

  14. Immune response and histology of humoral rejection in kidney transplantation. (United States)

    González-Molina, Miguel; Ruiz-Esteban, Pedro; Caballero, Abelardo; Burgos, Dolores; Cabello, Mercedes; Leon, Miriam; Fuentes, Laura; Hernandez, Domingo


    The adaptive immune response forms the basis of allograft rejection. Its weapons are direct cellular cytotoxicity, identified from the beginning of organ transplantation, and/or antibodies, limited to hyperacute rejection by preformed antibodies and not as an allogenic response. This resulted in allogenic response being thought for decades to have just a cellular origin. But the experimental studies by Gorer demonstrating tissue damage in allografts due to antibodies secreted by B lymphocytes activated against polymorphic molecules were disregarded. The special coexistence of binding and unbinding between antibodies and antigens of the endothelial cell membranes has been the cause of the delay in demonstrating the humoral allogenic response. The endothelium, the target tissue of antibodies, has a high turnover, and antigen-antibody binding is non-covalent. If endothelial cells are attacked by the humoral response, immunoglobulins are rapidly removed from their surface by shedding and/or internalization, as well as degrading the components of the complement system by the action of MCP, DAF and CD59. Thus, the presence of complement proteins in the membrane of endothelial cells is transient. In fact, the acute form of antibody-mediated rejection was not demonstrated until C4d complement fragment deposition was identified, which is the only component that binds covalently to endothelial cells. This review examines the relationship between humoral immune response and the types of acute and chronic histological lesion shown on biopsy of the transplanted organ. Copyright © 2016 Sociedad Española de Nefrología. Published by Elsevier España, S.L.U. All rights reserved.

  15. Variety of immune responses to chronic stress in rats male

    Directory of Open Access Journals (Sweden)

    Іlona S Polovynko


    Full Text Available Background. Previously we have been carry out integrated quantitative estimation of neuroendocrine and immune responses to chronic restraint stress in male rats. Revealed that the value of canonical discriminant roots rats subjected to chronic stress different not only on the values of intact animals (by definition, but also among themselves. So we set a goal retrospectively divided stressed rats into three homogeneous groups. Material and methods. The experiment is at 50 white male rats. Of these 10 animals not subjected to any influences and 40 within 7 days subjected to moderate stress by daily 30-minute immobilization. The day after the completion of stressing in portion of the blood immunological parameters were determined by tests I and II levels of WHO. The spleen and thymus did smears for counting spleno- and thymocytograms. Results. The method of cluster analysis (k-means clustering formed three groups-clusters. For further analysis selected 18 parameters that members of each cluster differing minimum and maximum are different from members of other clusters (η2=0,73÷0,15; F=49,0÷3,26; p=10-6÷0,05. We stated that in 16 rats from cluster III the deviation 16 parameters in either side of the average norm almost identical and are in an acceptable range of ±0,5σ. Thus, the immune status of 40% of the rats subjected to moderate chronic stress was resistant to its factors. For the immune status of the 15 (37,5% rats cluster II typical moderate inhibition microphage, killer and T-cellular links in combination with a strong activation macrophage link. Poststressory changes in immunity in 9 rats (22,5% from cluster I differ from those in cluster II both qualitatively and quantitatively. In particular, the rats in this cluster were found no deviations from the norm or reaction blast transformation T-cells nor NK-lymphocytes levels. However, other parameters of T-link and microhage link suppressed more and settings macrophage link appeared

  16. Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response

    Directory of Open Access Journals (Sweden)

    Manns Michael P


    Full Text Available Abstract Spontaneous clearance of hepatitis C virus (HCV has frequently been associated with the presence of HCV-specific cellular immunity. However, there had been also reports in chimpanzees demonstrating clearance of HCV-viremia in the absence of significant levels of detectable HCV-specific cellular immune responses. We here report seven asymptomatic acute hepatitis C cases with peak HCV-RNA levels between 300 and 100.000 copies/ml who all cleared HCV-RNA spontaneously. Patients were identified by a systematic screening of 1176 consecutive new incoming offenders in a German young offender institution. Four of the seven patients never developed anti-HCV antibodies and had normal ALT levels throughout follow-up. Transient weak HCV-specific CD4+ T cell responses were detectable in five individuals which did not differ in strength and breadth from age- and sex-matched patients with chronic hepatitis C and long-term recovered patients. In contrast, HCV-specific MHC-class-I-tetramer-positive cells were found in 3 of 4 HLA-A2-positive patients. Thus, these cases highlight that clearance of low levels of HCV viremia is possible in the absence of a strong adaptive immune response which might explain the low seroconversion rate after occupational exposure to HCV.

  17. Immunizations with hepatitis B viral antigens and a TLR7/8 agonist adjuvant induce antigen-specific immune responses in HBV-transgenic mice

    Directory of Open Access Journals (Sweden)

    Ying Wang


    Conclusions: Immunization with CL097-conjugated HBV-Ag reversed immune tolerance in HBV-Tg mice and induced antigen-specific immune responses. TLR7/8 agonists appear to be potent adjuvants for the induction of antigen-specific Th1 responses in an immune tolerant state.

  18. Imunidade na gestação normal e na paciente com lúpus eritematoso sistêmico (LES Immunity in the normal pregnancy and in the patient with systemic lupus erythematosus (SLE

    Directory of Open Access Journals (Sweden)

    Alessandra Cardoso Pereira


    Full Text Available A gravidez é uma condição fisiológica na qual ocorrem várias mudanças imunoendócrinas com a finalidade de facilitar a imunossupressão e a tolerância aos antígenos paternos e fetais. Na gravidez humana normal existe uma relativa supressão de citocinas tipo Th1 na resposta dos linfócitos, levando a uma prevalência na resposta do tipo Th2. No LES, onde prevalece a resposta imune do tipo Th2, a gravidez pode estar relacionada com a ativação da doença. Este artigo é uma revisão dessas alterações relacionadas com a resposta imune durante a gestação normal e na da paciente com LES.Pregnancy is a physiologic condition where several immuno-endocrine changes take place with the aim of facilitating immunosuppression and tolerance towards paternal and fetal antigens. In normal human pregnancy there is a relative suppression of Th1 type cytokines in response to lymphocytes, leading to a Th2 type response. In SLE, where a Th2 type response prevails, pregnancy may exacerbate the disease. This article reviews the alterations related to the immune response during normal pregnancy and in SLE patients.

  19. Mathematical models of tumour and normal tissue response

    International Nuclear Information System (INIS)

    Jones, B.; Dale, R.G.; Charing Cross Group of Hospitals, London


    The historical application of mathematics in the natural sciences and in radiotherapy is compared. The various forms of mathematical models and their limitations are discussed. The Linear Quadratic (LQ) model can be modified to include (i) radiobiological parameter changes that occur during fractionated radiotherapy, (ii) situations such as focal forms of radiotherapy, (iii) normal tissue responses, and (iv) to allow for the process of optimization. The inclusion of a variable cell loss factor in the LQ model repopulation term produces a more flexible clonogenic doubling time, which can simulate the phenomenon of 'accelerated repopulation'. Differential calculus can be applied to the LQ model after elimination of the fraction number integers. The optimum dose per fraction (maximum cell kill relative to a given normal tissue fractionation sensitivity) is then estimated from the clonogen doubling times and the radiosensitivity parameters (or α/β ratios). Economic treatment optimization is described. Tumour volume studies during or following teletherapy are used to optimize brachytherapy. The radiation responses of both individual tumours and tumour populations (by random sampling 'Monte-Carlo' techniques from statistical ranges of radiobiological and physical parameters) can be estimated. Computerized preclinical trials can be used to guide choice of dose fractionation scheduling in clinical trials. The potential impact of gene and other biological therapies on the results of radical radiotherapy are testable. New and experimentally testable hypotheses are generated from limited clinical data by exploratory modelling exercises. (orig.)

  20. Effects of fenbendazole on routine immune response parameters of BALB/c mice. (United States)

    Cray, Carolyn; Villar, David; Zaias, Julia; Altman, Norman H


    Fenbendazole (FBZ) is an anthelmintic drug widely used to treat and prevent pinworm outbreaks in laboratory rodents. Although data in nonrodent species indicate possible effects of fenbendazole on the bone marrow and lymphocyte proliferation and function, little has been reported regarding possible effects on the rodent immune system. The purpose of the current study was to determine the effects of a therapeutic regimen of FBZ on immune parameters in BALB/c mice. Both 9-wk on-off and 5-wk continuous medicated feed protocols were assessed. No significant differences between normal and FBZ diet treated mice were observed in the following parameters: complete blood count, blood chemistry, quantitation of major T and B cell markers in spleen, quantitation of T cell markers in the thymus, spleen cell proliferation to T and B cell mitogens, bone marrow colony-forming cell assays, skin graft rejection, and primary and secondary humoral immune responses. These data indicate that FBZ treatment does not affect many standard broad measures of immune function.

  1. Fibroblast activation protein is dispensable in the anti-influenza immune response in mice.

    Directory of Open Access Journals (Sweden)

    Sioh-Yang Tan

    Full Text Available Fibroblast activation protein alpha (FAP is a unique dual peptidase of the S9B serine protease family, being capable of both dipeptidyl peptidase and endopeptidase activities. FAP is expressed at low level in healthy adult organs including the pancreas, cervix, uterus, submaxillary gland and the skin, and highly upregulated in embryogenesis, chronic inflammation and tissue remodelling. It is also expressed by cancer-associated stromal fibroblasts in more than 90% of epithelial tumours. FAP has enzymatic and non-enzymatic functions in the growth, immunosuppression, invasion and cell signalling of tumour cells. FAP deficient mice are fertile and viable with no gross abnormality, but little data exist on the role of FAP in the immune system. FAP is upregulated in association with microbial stimulation and chronic inflammation, but its function in infection remains unknown. We showed that major populations of immune cells including CD4+ and CD8+ T cells, B cells, dendritic cells and neutrophils are generated and maintained normally in FAP knockout mice. Upon intranasal challenge with influenza virus, FAP mRNA was increased in the lungs and lung-draining lymph nodes. Nonetheless, FAP deficient mice showed similar pathologic kinetics to wildtype controls, and were capable of supporting normal anti-influenza T and B cell responses. There was no evidence of compensatory upregulation of other DPP4 family members in influenza-infected FAP-deficient mice. FAP appears to be dispensable in anti-influenza adaptive immunity.

  2. Differential immune microenvironments and response to immune checkpoint blockade amongst molecular subtypes of murine medulloblastoma (United States)

    Pham, Christina D.; Flores, Catherine; Yang, Changlin; Pinheiro, Elaine M.; Yearley, Jennifer H.; Sayour, Elias J.; Pei, Yanxin; Moore, Colin; McLendon, Roger E.; Huang, Jianping; Sampson, John H.; Wechsler-Reya, Robert; Mitchell, Duane A.


    PURPOSE Despite significant strides in the identification and characterization of potential therapeutic targets for medulloblastoma (MB), the role of the immune system and its interplay with the tumor microenvironment within these tumors are poorly understood. To address this, we adapted two syngeneic animal models of human Sonic Hedgehog (SHH)-driven and Group 3 MB for preclinical evaluation in immunocompetent C57BL/6 mice. METHODS AND RESULTS Multicolor flow cytometric analyses were used to phenotype and characterize immune infiltrating cells within established cerebellar tumors. We observed significantly higher percentages of dendritic cells, infiltrating lymphocytes, myeloid derived suppressor cells and tumor-associated macrophages in murine SHH model tumors compared with Group 3 tumors. However, murine Group 3 tumors had higher percentages of CD8+ PD-1+ T cells within the CD3 population. PD-1 blockade conferred superior antitumor efficacy in animals bearing intracranial Group 3 tumors compared to SHH group tumors, indicating that immunologic differences within the tumor microenvironment can be leveraged as potential targets to mediate antitumor efficacy. Further analysis of anti-PD-1 monoclonal antibody localization revealed binding to PD-1+ peripheral T cells, but not tumor infiltrating lymphocytes within the brain tumor microenvironment. Peripheral PD-1 blockade additionally resulted in a marked increase in CD3+ T cells within the tumor microenvironment. CONCLUSIONS This is the first immunologic characterization of preclinical models of molecular subtypes of MB and demonstration that response to immune checkpoint blockade differs across subtype classification. Our findings also suggest that effective anti-PD-1 blockade does not require that systemically administered antibodies penetrate the brain tumor microenvironment. PMID:26405194

  3. Differential Immune Microenvironments and Response to Immune Checkpoint Blockade among Molecular Subtypes of Murine Medulloblastoma. (United States)

    Pham, Christina D; Flores, Catherine; Yang, Changlin; Pinheiro, Elaine M; Yearley, Jennifer H; Sayour, Elias J; Pei, Yanxin; Moore, Colin; McLendon, Roger E; Huang, Jianping; Sampson, John H; Wechsler-Reya, Robert; Mitchell, Duane A


    Despite significant strides in the identification and characterization of potential therapeutic targets for medulloblastoma, the role of the immune system and its interplay with the tumor microenvironment within these tumors are poorly understood. To address this, we adapted two syngeneic animal models of human Sonic Hedgehog (SHH)-driven and group 3 medulloblastoma for preclinical evaluation in immunocompetent C57BL/6 mice. Multicolor flow cytometric analyses were used to phenotype and characterize immune infiltrating cells within established cerebellar tumors. We observed significantly higher percentages of dendritic cells, infiltrating lymphocytes, myeloid-derived suppressor cells, and tumor-associated macrophages in murine SHH model tumors compared with group 3 tumors. However, murine group 3 tumors had higher percentages of CD8(+) PD-1(+) T cells within the CD3 population. PD-1 blockade conferred superior antitumor efficacy in animals bearing intracranial group 3 tumors compared with SHH group tumors, indicating that immunologic differences within the tumor microenvironment can be leveraged as potential targets to mediate antitumor efficacy. Further analysis of anti-PD-1 monoclonal antibody localization revealed binding to PD-1(+) peripheral T cells, but not tumor infiltrating lymphocytes within the brain tumor microenvironment. Peripheral PD-1 blockade additionally resulted in a marked increase in CD3(+) T cells within the tumor microenvironment. This is the first immunologic characterization of preclinical models of molecular subtypes of medulloblastoma and demonstration that response to immune checkpoint blockade differs across subtype classification. Our findings also suggest that effective anti-PD-1 blockade does not require that systemically administered antibodies penetrate the brain tumor microenvironment. ©2015 American Association for Cancer Research.

  4. Histological chorioamnionitis shapes the neonatal transcriptomic immune response. (United States)

    Weitkamp, Jörn-Hendrik; Guthrie, Scott O; Wong, Hector R; Moldawer, Lyle L; Baker, Henry V; Wynn, James L


    Histologic chorioamnionitis (HCA) is commonly associated with preterm birth and deleterious post-natal outcomes including sepsis and necrotizing enterocolitis. Transcriptomic analysis has been used to uncover gene signatures that permit diagnosis and prognostication, show new therapeutic targets, and reveal mechanisms that underlie differential outcomes with other complex disease states in neonates such as sepsis. To define the transcriptomic and inflammatory protein response in peripheral blood among infants with exposure to histologic chorioamnionitis. Prospective, observational study. Uninfected preterm neonates retrospectively categorized based on placental pathology with no HCA exposure (n=18) or HCA exposure (n=15). We measured the transcriptomic and inflammatory mediator response in prospectively collected whole blood. We found 488 significant (p<0.001), differentially expressed genes in whole blood samples among uninfected neonates with HCA exposure that collectively represented activated innate and adaptive immune cellular pathways and revealed a potential regulatory role for the pleotropic microRNA molecule miR-155. Differentially secreted plasma cytokines in patients with HCA exposure compared to patients without HCA included MCP-1, MPO, and MMP-9 (p<0.05). Exposure to HCA distinctively activates the neonatal immune system in utero with potentially long-term health consequences. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. Memory, verbal fluency, and response inhibition in normal aging

    Directory of Open Access Journals (Sweden)

    Gaurav Thapliyal


    Full Text Available Background: The concepts of aging-related cognitive changes have appeared to be a major challenge in the society. In this context, the present study was planned to find out the functioning of aging population on different neurocognitive measures. Aims: The aim of the study was to find out the neurocognitive functioning, namely memory, verbal fluency, and response inhibition of normal aging population. Materials and Methods: Following purposive sampling technique, a total of 50 healthy subjects (30 males and 20 females in the age range of 60-70 years were recruited from Jaipur city of Rajasthan. Mini-mental state Examination, PGI memory scale, animal names test, and Stroop test were administered. Results: The findings reveal dysfunction in almost all the domains of memory, namely mental balance, attention and concentration, delayed recall, verbal retention for dissimilar pairs, visual retention and recognition, immediate recall, verbal retention for similar pairs, and visual retention. In domain of verbal fluency, all subjects gave low responses on the animal names test. In domain of response inhibition, all the subjects took less time in color test as compared to color word test on the Stroop task. Conclusions: Findings suggest that there are dysfunction in the area of memory, verbal fluency, and response inhibition in persons aged 60-70 years. However, recent and remote memory were found to be intact.

  6. CD8(+)NKT-like cells regulate the immune response by killing antigen-bearing DCs. (United States)

    Wang, Chao; Liu, Xi; Li, Zhengyuan; Chai, Yijie; Jiang, Yunfeng; Wang, Qian; Ji, Yewei; Zhu, Zhongli; Wan, Ying; Yuan, Zhenglong; Chang, Zhijie; Zhang, Minghui


    CD1d-dependent NKT cells have been extensively studied; however, the function of CD8(+)NKT-like cells, which are CD1d-independent T cells with NK markers, remains unknown. Here, we report that CD1d-independent CD8(+)NKT-like cells, which express both T cell markers (TCRβ and CD3) and NK cell receptors (NK1.1, CD49b and NKG2D), are activated and significantly expanded in mice immunized with GFP-expressing dendritic cells. Distinct from CD1d-dependent NKT cells, CD8(+)NKT-like cells possess a diverse repertoire of TCRs and secrete high levels of IFN-gamma but not IL-4. CD8(+)NKT-like cell development is normal in CD1d(-/-) mice, which suggests that CD8(+)NKT-like cells undergo a unique development pathway that differs from iNKT cells. Further functional analyses show that CD8(+)NKT-like cells suppress T-cell responses through elimination of dendritic cells in an antigen-specific manner. Adoptive transfer of antigen-specific CD8(+)NKT-like cells into RIP-OVA mice prevented subsequent development of diabetes in the animals induced by activated OT-I CD8 T cells. Our study suggests that CD8(+)NKT-like cells can function as antigen-specific suppressive cells to regulate the immune response through killing antigen-bearing DCs. Antigen-specific down regulation may provide an active and precise method for constraining an excessive immune response and avoiding bypass suppression of necessary immune responses to other antigens.

  7. CD8+NKT-like cells regulate the immune response by killing antigen-bearing DCs (United States)

    Wang, Chao; Liu, Xi; Li, Zhengyuan; Chai, Yijie; Jiang, Yunfeng; Wang, Qian; Ji, Yewei; Zhu, Zhongli; Wan, Ying; Yuan, Zhenglong; Chang, Zhijie; Zhang, Minghui


    CD1d-dependent NKT cells have been extensively studied; however, the function of CD8+NKT-like cells, which are CD1d-independent T cells with NK markers, remains unknown. Here, we report that CD1d-independent CD8+NKT-like cells, which express both T cell markers (TCRβ and CD3) and NK cell receptors (NK1.1, CD49b and NKG2D), are activated and significantly expanded in mice immunized with GFP-expressing dendritic cells. Distinct from CD1d-dependent NKT cells, CD8+NKT-like cells possess a diverse repertoire of TCRs and secrete high levels of IFN-gamma but not IL-4. CD8+NKT-like cell development is normal in CD1d−/− mice, which suggests that CD8+NKT-like cells undergo a unique development pathway that differs from iNKT cells. Further functional analyses show that CD8+NKT-like cells suppress T-cell responses through elimination of dendritic cells in an antigen-specific manner. Adoptive transfer of antigen-specific CD8+NKT-like cells into RIP-OVA mice prevented subsequent development of diabetes in the animals induced by activated OT-I CD8 T cells. Our study suggests that CD8+NKT-like cells can function as antigen-specific suppressive cells to regulate the immune response through killing antigen-bearing DCs. Antigen-specific down regulation may provide an active and precise method for constraining an excessive immune response and avoiding bypass suppression of necessary immune responses to other antigens. PMID:26369936

  8. Monitoring Immune Responses in Organ Recipients by Flow Cytometry

    Directory of Open Access Journals (Sweden)

    Al-Mukhalafi Zuha


    Full Text Available Allograft rejection remains a major barrier to successful organ transplan-tation. Cellular and humoral immune responses play a critical role in mediating graft rejection. During the last few years, monoclonal antibodies have been used as a new specific therapeutic approach in the prevention of allograft rejection. Recently, the technology of flow cytometry has become a useful tool for monitoring immunological responses in transplant recipients. The application of this valuable tool in clinical transplantation at the present time is aimed at, i determining the extent of immuno-suppressive therapy through T-cell receptor analysis of cellular components, ii monitoring levels of alloreactive antibodies to identify high-risk recipients (sensitized patients in the pre-operative period and iii to predict rejection by monitoring their development post-operatively. In future, further development of this technology may demonstrate greater benefit to the field of organ transplantation.

  9. Immunization (United States)

    ... a lot worse. Some are even life-threatening. Immunization shots, or vaccinations, are essential. They protect against ... B, polio, tetanus, diphtheria, and pertussis (whooping cough). Immunizations are important for adults as well as children. ...

  10. Humoral immune responses of pregnant Guinea pigs Immunized with live attenuated Rhodococcus equi

    Directory of Open Access Journals (Sweden)

    Mawlood Abass Ali Al- Graibawi


    Full Text Available The potential to increase passive transfer of specific Rhodococcus equi (R.equi humoral immunity to newborn by preparturient vaccination of their dams was investigated in Pregnant Guinea pigs as a pilot study. Attenuated autogenous vaccine was prepared from a Congo red negative (CR- R.equi local isolate mixed with adjuvant (potassium alum sulphate, tested for sterility, safety and potency prior to vaccination .Two groups of pregnant G. pigs were used, the first group was vaccinated twice subcutaneously (S.C with the prepared vaccine at five and three weeks prior parturition, the second group was inoculated with adjuvant plus phosphate buffer saline (PBS twice s.c and kept as control. Offspring from the vaccinated dams had revealed high titers of specific R. equi antibody as detected by tube agglutination (TA and passive haemagglutination (PH test and showed protection against challenge dose. The results revealed that vaccination of pregnant G. pigs with the prepared attenuated vaccine was safe and efficient method to protect their offspring against experimental challenge with virulent R.equi. Vaccination was associated with increased humoral immune response in vaccinated group.

  11. The nociception genes painless and Piezo are required for the cellular immune response of Drosophila larvae to wasp parasitization. (United States)

    Tokusumi, Yumiko; Tokusumi, Tsuyoshi; Schulz, Robert A


    In vertebrates, interaction between the nervous system and immune system is important to protect a challenged host from stress inputs from external sources. In this study, we demonstrate that sensory neurons are involved in the cellular immune response elicited by wasp infestation of Drosophila larvae. Multidendritic class IV neurons sense contacts from external stimuli and induce avoidance behaviors for host defense. Our findings show that inactivation of these sensory neurons impairs the cellular response against wasp parasitization. We also demonstrate that the nociception genes encoding the mechanosensory receptors Painless and Piezo, both expressed in class IV neurons, are essential for the normal cellular immune response to parasite challenge. Copyright © 2017. Published by Elsevier Inc.

  12. Immune response to uv-induced tumors: transplantation immunity and lymphocyte populations exhibiting anti-tumor activity

    International Nuclear Information System (INIS)

    Streeter, P.R.


    Ultraviolet light-induced murine skin tumors were analyzed for their ability to induce tumor-specific and cross-protective transplantation immunity in immunocompetent syngeneic mice. These studies revealed that progressor UV-tumors, like regressor UV-tumors, possess tumor-specific transplantation antigens. Cross-protective transplantation immunity to UV-tumors, however, was associated with sensitization to the serum used to culture the tumor lines rather than to cross-reactive or common determinants on UV-tumors. An analysis of the cytolytic activity of lymphocytes from the spleens of mice immunized with either regressor or progressor UV-tumors revealed a striking difference between the two immune splenocyte populations. From regressor tumor-immune animals, cytolytic T (Tc) lymphocytes with specificity for the immunizing tumor were found. However, the analysis of splenic lymphocytes from progressor tumor immune animals revealed no such effector cells. To more effectively examine those lymphocytes exhibiting cytolytic activity in vitro, T lymphocyte cloning technology was used as a means of isolating homogeneous lymphocyte populations with the effector activities described above. The mechanisms where NK cells and other nonspecific effector cells could be induced in tumor-immune animals are discussed in the context of class II restricted immune responses

  13. Immune response is required for the control of in vivo translocation and chronic toxicity of graphene oxide (United States)

    Wu, Qiuli; Zhao, Yunli; Fang, Jianpeng; Wang, Dayong


    Graphene oxide (GO) shows great promise as a nanomaterial for medical applications; however, the mechanism for its long-term adverse effects is still largely unclear. Here, we show that chronic GO exposure not only caused damage on the function of both primary and secondary targeted organs but also induced severe accumulation of pathogenic microbial food (OP50) in the intestine of Caenorhabditis elegans, a non-mammalian alternative toxicity assay system. GO accumulated in the intestine could be largely co-localized with OP50 and induced decreased immune response of animals. In contrast, feeding with UV-treated OP50 suppressed GO toxicity and accumulation in the intestine and maintained the relatively normal immune response of animals. The severe accumulation of OP50 in the intestine might be partially due to the damage by GO on the development and function of AVL and DVB neurons controlling defecation behavior. Reduction of chronic GO toxicity by PEG surface modification largely resulted from the inhibition of OP50 accumulation in the intestine and the maintenance of normal immune response. Our results highlight the key role of innate immunity in regulating in vivo chronic GO toxicity, which will be helpful for our understanding of the interactions between nanomaterials and biological systems during the long-term development of animals.Graphene oxide (GO) shows great promise as a nanomaterial for medical applications; however, the mechanism for its long-term adverse effects is still largely unclear. Here, we show that chronic GO exposure not only caused damage on the function of both primary and secondary targeted organs but also induced severe accumulation of pathogenic microbial food (OP50) in the intestine of Caenorhabditis elegans, a non-mammalian alternative toxicity assay system. GO accumulated in the intestine could be largely co-localized with OP50 and induced decreased immune response of animals. In contrast, feeding with UV-treated OP50 suppressed GO

  14. Transient expression of protein tyrosine phosphatases encoded in Cotesia plutellae bracovirus inhibits insect cellular immune responses (United States)

    Ibrahim, Ahmed M. A.; Kim, Yonggyun


    Several immunosuppressive factors are associated with parasitism of an endoparasitoid wasp, Cotesia plutellae, on the diamondback moth, Plutella xylostella. C. plutellae bracovirus (CpBV) encodes a large number of putative protein tyrosine phosphatases (PTPs), which may play a role in inhibiting host cellular immunity. To address this inhibitory hypothesis of CpBV-PTPs, we performed transient expression of individual CpBV-PTPs in hemocytes of the beet armyworm, Spodoptera exigua, and analyzed their cellular immune responses. Two different forms of CpBV-PTPs were chosen and cloned into a eukaryotic expression vector under the control of the p10 promoter of baculovirus: one with the normal cysteine active site (CpBV-PTP1) and the other with a mutated active site (CpBV-PTP5). The hemocytes transfected with CpBV-PTP1 significantly increased in PTP activity compared to control hemocytes, but those with CpBV-PTP5 exhibited a significant decrease in the PTP activity. All transfected hemocytes exhibited a significant reduction in both cell spreading and encapsulation activities compared to control hemocytes. Co-transfection of CpBV-PTP1 together with its double-stranded RNA reduced the messenger RNA (mRNA) level of CpBV-PTP1 and resulted in recovery of both hemocyte behaviors. This is the first report demonstrating that the polydnaviral PTPs can manipulate PTP activity of the hemocytes to interrupt cellular immune responses.

  15. Host translational inhibition by Pseudomonas aeruginosa Exotoxin A Triggers an immune response in Caenorhabditis elegans. (United States)

    McEwan, Deborah L; Kirienko, Natalia V; Ausubel, Frederick M


    Intestinal epithelial cells are exposed to both innocuous and pathogenic microbes, which need to be distinguished to mount an effective immune response. To understand the mechanisms underlying pathogen recognition, we investigated how Pseudomonas aeruginosa triggers intestinal innate immunity in Caenorhabditis elegans, a process independent of Toll-like pattern recognition receptors. We show that the P. aeruginosa translational inhibitor Exotoxin A (ToxA), which ribosylates elongation factor 2 (EF2), upregulates a significant subset of genes normally induced by P. aeruginosa. Moreover, immune pathways involving the ATF-7 and ZIP-2 transcription factors, which protect C. elegans from P. aeruginosa, are required for preventing ToxA-mediated lethality. ToxA-responsive genes are not induced by enzymatically inactive ToxA protein but can be upregulated independently of ToxA by disruption of host protein translation. Thus, C. elegans has a surveillance mechanism to recognize ToxA through its effect on protein translation rather than by direct recognition of either ToxA or ribosylated EF2. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Enhancement of anamnestic immunospecific antibody response in orally immunized chickens

    DEFF Research Database (Denmark)

    Mayo, Susan; Carlsson, Hans-Erik; Zagon, Andrea


    Production of immunospecific egg yolk antibodies (IgY antibodies) in egg laying hens through oral immunization is an attractive alternative to conventional antibody production in mammals for economic reasons as well as for animal welfare reasons. Oral immunization results in a systemic humoral...... of the immunization in week 18, demonstrating the presence of memory cells following the two initial oral immunizations. Considering that oral immunization results in approximately ten times lower concentrations of immunospecific antibodies in the egg yolk, compared to traditional subcutaneous immunization schemes...

  17. GSL-enriched membrane microdomains in innate immune responses. (United States)

    Nakayama, Hitoshi; Ogawa, Hideoki; Takamori, Kenji; Iwabuchi, Kazuhisa


    Many pathogens target glycosphingolipids (GSLs), which, together with cholesterol, GPI-anchored proteins, and various signaling molecules, cluster on host cell membranes to form GSL-enriched membrane microdomains (lipid rafts). These GSL-enriched membrane microdomains may therefore be involved in host-pathogen interactions. Innate immune responses are triggered by the association of pathogens with phagocytes, such as neutrophils, macrophages and dendritic cells. Phagocytes express a diverse array of pattern-recognition receptors (PRRs), which sense invading microorganisms and trigger pathogen-specific signaling. PRRs can recognize highly conserved pathogen-associated molecular patterns expressed on microorganisms. The GSL lactosylceramide (LacCer, CDw17), which binds to various microorganisms, including Candida albicans, is expressed predominantly on the plasma membranes of human mature neutrophils and forms membrane microdomains together with the Src family tyrosine kinase Lyn. These LacCer-enriched membrane microdomains can mediate superoxide generation, migration, and phagocytosis, indicating that LacCer functions as a PRR in innate immunity. Moreover, the interactions of GSL-enriched membrane microdomains with membrane proteins, such as growth factor receptors, are important in mediating the physiological properties of these proteins. Similarly, we recently found that interactions between LacCer-enriched membrane microdomains and CD11b/CD18 (Mac-1, CR3, or αMβ2-integrin) are significant for neutrophil phagocytosis of non-opsonized microorganisms. This review describes the functional role of LacCer-enriched membrane microdomains and their interactions with CD11b/CD18.

  18. Immune response in pemphigus and beyond: progresses and emerging concepts. (United States)

    Di Zenzo, Giovanni; Amber, Kyle T; Sayar, Beyza S; Müller, Eliane J; Borradori, Luca


    Pemphigus vulgaris (PV) and pemphigus foliaceus (PF) are two severe autoimmune bullous diseases of the mucosae and/or skin associated with autoantibodies directed against desmoglein (Dsg) 3 and/or Dsg1. These two desmosomal cadherins, typifying stratified epithelia, are components of cell adhesion complexes called desmosomes and represent extra-desmosomal adhesion receptors. We herein review the advances in our understanding of the immune response underlying pemphigus, including human leucocyte antigen (HLA) class II-associated genetic susceptibility, characteristics of pathogenic anti-Dsg antibodies, antigenic mapping studies as well as findings about Dsg-specific B and T cells. The pathogenicity of anti-Dsg autoantibodies has been convincingly demonstrated. Disease activity and clinical phenotype correlate with anti-Dsg antibody titers and profile while passive transfer of anti-Dsg IgG from pemphigus patients' results in pemphigus-like lesions in neonatal and adult mice. Finally, adoptive transfer of splenocytes from Dsg3-knockout mice immunized with murine Dsg3 into immunodeficient mice phenotypically recapitulates PV. Although the exact pathogenic mechanisms leading to blister formation have not been fully elucidated, intracellular signaling following antibody binding has been found to be necessary for inducing cell-cell dissociation, at least for PV. These new insights not only highlight the key role of Dsgs in maintenance of tissue homeostasis but are expected to progressively change pemphigus management, paving the way for novel targeted immunologic and pharmacologic therapies.

  19. Immune Response to Marburg Virus Angola Infection in Nonhuman Primates. (United States)

    Fernando, Lisa; Qiu, Xiangguo; Melito, P Leno; Williams, Kinola J N; Feldmann, Friederike; Feldmann, Heinz; Jones, Steven M; Alimonti, Judie B


    The 2005 outbreak of Marburg virus (MARV) infection in Angola was the most lethal MARV infection outbreak in history, with a case-fatality rate (90%) similar to that for Zaire ebolavirus (EBOV) infection. However, very little is known about the pathogenicity of MARV Angola, as few studies have been conducted to date. Therefore, the immune response was examined in MARV Angola-infected nonhuman primates. Cynomolgus macaques were infected with MARV Angola and monitored for survival. The effect of MARV Angola on the immune system was examined by immunophenotyping whole-blood and by analyzing cytokine and chemokine levels in plasma and spleen specimens, using flow cytometry. The prominent clinical findings were rapid onset of disease and death (mean time after infection, 6.7 days), fever, depression, anorexia, petechial rash, and lymphopenia. Specifically, T, B, and natural killer cells were severely depleted in the blood by day 6. The typical cytokine storm was present, with levels of interferon γ, tumor necrosis factor, interleukin 6, and CCL2 rising in the blood early during infection. MARV Angola displayed the same virulence and disease pathology as EBOV. MARV Angola appears to cause a more rapid onset and severe outcome of infection than other MARV strains. © Crown copyright 2015.

  20. SOCS2 and SOCS3 expression in ulcerative colitis and their correlation with inflammatory response and immune response

    Directory of Open Access Journals (Sweden)

    Le Huang1


    Full Text Available Objective: To study the correlation of SOCS2 and SOCS3 expression in ulcerative colitis tissue with inflammatory response and immune response. Methods: Ulcerative colitis lesions and normal mucosa from colonoscopic biopsy in Central Hospital of Zibo Mining Refco Group Ltd between May 2014 and July 2016 were selected and enrolled in UC group and control group respectively. RNA was extracted to determine mRNA expression of SOCS2 and SOCS3 as well as inflammatory response JAKs/STATs pathway molecules; protein was extracted to determine the contents of immune response cytokines. Results: SOCS2 mRNA expression in intestinal mucosa of UC group was not significantly different from that of control group, and SOCS3 mRNA expression was significantly lower than that of control group; JAK1, JAK2, JAK3, STAT1, STAT3 and STAT5 mRNA expression as well as IFN-γ and IL-17 protein contents in intestinal mucosa of UC group were significantly higher than those of control group while IL-4 and IL-10 protein contents were significantly lower than those of control group; JAK1, JAK2, JAK3, STAT1, STAT3 and STAT5 mRNA expression as well as IFN-γ and IL-17 protein contents in UC group of intestinal mucosa with low SOCS3 expression were significantly higher than those of intestinal mucosa with high SOCS3 expression while IL-4 and IL-10 protein contents were significantly lower than those of intestinal mucosa with high SOCS3 expression. Conclusion: Low expression of SOCS3 in ulcerative colitis can aggravate the inflammatory reaction and cause the imbalance of Th1/Th2 and Th17/Treg immune response.

  1. Immune response modulation by curcumin in a latex allergy model

    Directory of Open Access Journals (Sweden)

    Raju Raghavan


    Full Text Available Abstract Background There has been a worldwide increase in allergy and asthma over the last few decades, particularly in industrially developed nations. This resulted in a renewed interest to understand the pathogenesis of allergy in recent years. The progress made in the pathogenesis of allergic disease has led to the exploration of novel alternative therapies, which include herbal medicines as well. Curcumin, present in turmeric, a frequently used spice in Asia has been shown to have anti-allergic and inflammatory potential. Methods We used a murine model of latex allergy to investigate the role of curcumin as an immunomodulator. BALB/c mice were exposed to latex allergens and developed latex allergy with a Th2 type of immune response. These animals were treated with curcumin and the immunological and inflammatory responses were evaluated. Results Animals exposed to latex showed enhanced serum IgE, latex specific IgG1, IL-4, IL-5, IL-13, eosinophils and inflammation in the lungs. Intragastric treatment of latex-sensitized mice with curcumin demonstrated a diminished Th2 response with a concurrent reduction in lung inflammation. Eosinophilia in curcumin-treated mice was markedly reduced, co-stimulatory molecule expression (CD80, CD86, and OX40L on antigen-presenting cells was decreased, and expression of MMP-9, OAT, and TSLP genes was also attenuated. Conclusion These results suggest that curcumin has potential therapeutic value for controlling allergic responses resulting from exposure to allergens.

  2. Aberrant Pregnancy Adaptations in the Peripheral Immune Response in Type 1 Diabetes: A Rat Model.

    Directory of Open Access Journals (Sweden)

    Bart Groen

    Full Text Available Despite tight glycemic control, pregnancy complication rate in type 1 diabetes patients is higher than in normal pregnancy. Other etiological factors may be responsible for the development of adverse pregnancy outcome. Acceptance of the semi-allogeneic fetus is accompanied by adaptations in the maternal immune-response. Maladaptations of the immune-response has been shown to contribute to pregnancy complications. We hypothesized that type 1 diabetes, as an autoimmune disease, may be associated with maladaptations of the immune-response to pregnancy, possibly resulting in pregnancy complications.We studied pregnancy outcome and pregnancy-induced immunological adaptations in a normoglycemic rat-model of type 1 diabetes, i.e. biobreeding diabetes-prone rats (BBDP; 5 non-pregnant rats, 7 pregnant day 10 rats and 6 pregnant day 18 rats , versus non-diabetic control rats (i.e. congenic non-diabetic biobreeding diabetes-resistant (BBDR; 6 non-pregnant rats, 6 pregnant day 10 rats and 6 pregnant day 18 rats and Wistar-rats (6 non-pregnant, 6 pregnant day 10 rats and 5 pregnant day 18 rats.We observed reduced litter size, lower fetal weight of viable fetuses and increased numbers of resorptions versus control rats. These complications are accompanied by various differences in the immune-response between BBDP and control rats in both pregnant and non-pregnant animals. The immune-response in non-pregnant BBDP-rats was characterized by decreased percentages of lymphocytes, increased percentages of effector T-cells, regulatory T-cells and natural killer cells, an increased Th1/Th2-ratio and activated monocytes versus Wistar and BBDR-rats. Furthermore, pregnancy-induced adaptations in BBDP-rats coincided with an increased Th1/Th2-ratio, a decreased mean fluorescence intensity CD161a/NKR-P1b ratio and no further activation of monocytes versus non-diabetic control rats.This study suggests that even in the face of strict normoglycemia, pregnancy complications

  3. Viral evasion of DNA-stimulated innate immune responses (United States)

    Christensen, Maria H; Paludan, Søren R


    Cellular sensing of virus-derived nucleic acids is essential for early defenses against virus infections. In recent years, the discovery of DNA sensing proteins, including cyclic GMP–AMP synthase (cGAS) and gamma-interferon-inducible protein (IFI16), has led to understanding of how cells evoke strong innate immune responses against incoming pathogens carrying DNA genomes. The signaling stimulated by DNA sensors depends on the adaptor protein STING (stimulator of interferon genes), to enable expression of antiviral proteins, including type I interferon. To facilitate efficient infections, viruses have evolved a wide range of evasion strategies, targeting host DNA sensors, adaptor proteins and transcription factors. In this review, the current literature on virus-induced activation of the STING pathway is presented and we discuss recently identified viral evasion mechanisms targeting different steps in this antiviral pathway. PMID:26972769

  4. Viral infection model with periodic lytic immune response

    International Nuclear Information System (INIS)

    Wang Kaifa; Wang Wendi; Liu Xianning


    Dynamical behavior and bifurcation structure of a viral infection model are studied under the assumption that the lytic immune response is periodic in time. The infection-free equilibrium is globally asymptotically stable when the basic reproductive ratio of virus is less than or equal to one. There is a non-constant periodic solution if the basic reproductive ratio of the virus is greater than one. It is found that period doubling bifurcations occur as the amplitude of lytic component is increased. For intermediate birth rates, the period triplication occurs and then period doubling cascades proceed gradually toward chaotic cycles. For large birth rate, the period doubling cascade proceeds gradually toward chaotic cycles without the period triplication, and the inverse period doubling can be observed. These results can be used to explain the oscillation behaviors of virus population, which was observed in chronic HBV or HCV carriers

  5. Viral evasion of DNA-stimulated innate immune responses. (United States)

    Christensen, Maria H; Paludan, Søren R


    Cellular sensing of virus-derived nucleic acids is essential for early defenses against virus infections. In recent years, the discovery of DNA sensing proteins, including cyclic GMP-AMP synthase (cGAS) and gamma-interferon-inducible protein (IFI16), has led to understanding of how cells evoke strong innate immune responses against incoming pathogens carrying DNA genomes. The signaling stimulated by DNA sensors depends on the adaptor protein STING (stimulator of interferon genes), to enable expression of antiviral proteins, including type I interferon. To facilitate efficient infections, viruses have evolved a wide range of evasion strategies, targeting host DNA sensors, adaptor proteins and transcription factors. In this review, the current literature on virus-induced activation of the STING pathway is presented and we discuss recently identified viral evasion mechanisms targeting different steps in this antiviral pathway.

  6. System immune response to vaccination on FDG-PET/CT

    Energy Technology Data Exchange (ETDEWEB)

    Mingos, Mark; Howard, Stephanie; Giaclone, Micholas; Kozono, David; Jacene, Heather [Brigham and Women' s Hospital, Boston (United States)


    A patient with newly diagnosed right lung cancer had transient 18F-fluorodeoxyglucose (FDG)-avid left axillary lymph nodes and intense splenic FDG uptake on positron emission tomography (PET)/computed tomography (CT). History revealed that the patient received a left-sided influenza vaccine 2-3 days before the examination. Although inflammatory FDG uptake in ipsilateral axillary nodes is reported, to our knowledge, this is the first report of visualization of the systemic immune response in the spleen related to the influenza vaccination on FDG-PET/CT. The history, splenic uptake and time course on serial FDG-PET/CT helped to avoid a false-positive interpretation for progressing lung cancer and alteration of the radiation therapy plan.

  7. Tissue specific heterogeneity in effector immune cell response

    Directory of Open Access Journals (Sweden)

    Saba eTufail


    Full Text Available Post pathogen invasion, migration of effector T-cell subsets to specific tissue locations is of prime importance for generation of robust immune response. Effector T cells are imprinted with distinct ‘homing codes’ (adhesion molecules and chemokine receptors during activation which regulate their targeted trafficking to specific tissues. Internal cues in the lymph node microenvironment along with external stimuli from food (vitamin A and sunlight (vitamin D3 prime dendritic cells, imprinting them to play centrestage in the induction of tissue tropism in effector T cells. B cells as well, in a manner similar to effector T cells, exhibit tissue tropic migration. In this review, we have focused on the factors regulating the generation and migration of effector T cells to various tissues alongwith giving an overview of tissue tropism in B cells.

  8. System immune response to vaccination on FDG-PET/CT

    International Nuclear Information System (INIS)

    Mingos, Mark; Howard, Stephanie; Giaclone, Micholas; Kozono, David; Jacene, Heather


    A patient with newly diagnosed right lung cancer had transient 18F-fluorodeoxyglucose (FDG)-avid left axillary lymph nodes and intense splenic FDG uptake on positron emission tomography (PET)/computed tomography (CT). History revealed that the patient received a left-sided influenza vaccine 2-3 days before the examination. Although inflammatory FDG uptake in ipsilateral axillary nodes is reported, to our knowledge, this is the first report of visualization of the systemic immune response in the spleen related to the influenza vaccination on FDG-PET/CT. The history, splenic uptake and time course on serial FDG-PET/CT helped to avoid a false-positive interpretation for progressing lung cancer and alteration of the radiation therapy plan

  9. Anterior Chamber-Associated Immune Deviation (ACAID: An Acute Response to Ocular Insult Protects from Future Immune-Mediated Damage?

    Directory of Open Access Journals (Sweden)

    Robert E. Cone


    Full Text Available The “immune privilege” that inhibits immune defense mechanisms that could lead to damage to sensitive ocular tissue is based on the expression of immunosuppressive factors on ocular tissue and in ocular fluids. In addition to this environmental protection, the injection of antigen into the anterior chamber or infection in the anterior chamber induces a systemic suppression of potentially damaging cell-mediated and humoral responses to the antigen. Here we discuss evidence that suggests that Anterior Chamber-Associated Immune Deviation (ACAID a is initiated by an ocular response to moderate inflammation that leads to a systemic immunoregulatory response. Injection into the anterior chamber induces a rise in TNF-α and MCP-1 in aqueous humor and an infiltration of circulating F4/80 + monocytes that home to the iris. The induction of ACAID is dependent on this infiltration of circulating monocytes that eventually emigrate to the thymus and spleen where they induce regulatory T cells that inhibit the inductive or effector phases of a cell-mediated immune response. ACAID therefore protects the eye from the collateral damage of an immune response to infection by suppressing a future potentially damaging response to infection.

  10. The human immune response to streptococcal extracellular antigens: clinical, diagnostic, and potential pathogenetic implications. (United States)

    Johnson, Dwight R; Kurlan, Roger; Leckman, James; Kaplan, Edward L


    Determination of an immune response to group A Streptococcus (GAS) antigens, frequently anti-streptolysin O and anti-DNase B, is crucial for documentation of bona fide GAS infection. Although the importance of immunologic confirmation of infection is widely accepted, the immediate and long-term immunokinetics of the human antibody response are incompletely documented and poorly understood. Pediatric study participants (n = 160) were followed during a 2-year study with monthly throat cultures (n = 3491) and blood samples (n = 1679) obtained every 13 weeks. Recovered GAS were characterized; serum anti-streptolysin O and anti-DNase B antibody titers were determined. Antibody titers and GAS culture results were temporally correlated and analyzed. The analyses clearly document, in some instances for the first time, that an increase in antibody titer more accurately defines infection than does an absolute titer (eg, "upper limit of normal"), that antibody titers can remain elevated for many months even without GAS, and that some individuals may harbor GAS continuously for months or years without symptoms of infection and without an associated immune response. Measuring 2 different antibodies is more accurate in defining infection. Single time-point cultures and single antibody titers are often misleading. Sequential samples more accurately define infection, allowing correlation of titer increases with temporal confirmation of GAS acquisition. Understanding kinetics of the immune response(s) to GAS infection is necessary in formulating accurate clinical diagnostic conclusions, to appropriate design of clinical and epidemiological studies examining the association of GAS with subsequent sequelae, and to providing insight into pathogenetic mechanisms associated with this important human pathogen.

  11. Canine tumor and normal tissue response to heat and radiation

    International Nuclear Information System (INIS)

    Gillette, E.L.; McChesney, S.L.


    Oral squamous cell carcinomas of dogs were treated with either irradiation alone or combined with hyperthermia. Tumor control was assessed as no evidence of disease one year following treatment. Dogs were randomized to variable radiation doses which were given in ten fractions three times a week for three weeks. Heat was given three hours after the first and third radiation dose each week for seven treatments. The attempt was made to achieve a minimum tumor temperature of 42 0 C for thirty minutes with a maximum normal tissue temperature of 40 0 C. It was usually possible to selectively heat tumors. The TCD 50 for irradiation alone was about 400 rads greater than for heat plus irradiation. The dose response curve for heat plus radiation was much steeper than for radiation alone indicating less heterogeneity of tumor response. That also implies a much greater effectiveness of radiation combined with heat at higher tumor control probabilities. Early necrosis caused by heating healed with conservative management. No increase in late radiation necrosis was observed

  12. Evasion of adaptive and innate immune response mechanisms by γ-herpesviruses (United States)

    Feng, Pinghui; Moses, Ashlee; Früh, Klaus


    γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies. PMID:23735334

  13. Sex-specific consequences of an induced immune response on reproduction in a moth. (United States)

    Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T


    Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.

  14. Contributions of immune responses to developmental resistance in Lymantria dispar challenged with baculovirus (United States)

    James McNeil; Diana Cox-Foster; James Slavicek; Kelli. Hoover


    How the innate immune system functions to defend insects from viruses is an emerging field of study. We examined the impact of melanized encapsulation, a component of innate immunity that integrates both cellular and humoral immune responses, on the success of the baculovirus Lymantria dispar multiple nucleocapsid nucleopolyhedrovirus (LdMNPV) in its...

  15. CD8 apoptosis may be a predictor of T cell number normalization after immune reconstitution in HIV

    Directory of Open Access Journals (Sweden)

    Martinez Maria L


    Full Text Available Abstract Background As part of the Houston Vanguard study, a subset of 10 patients randomized to receive IL-2 therapy were compared to 4 patients randomized to not receive IL-2, for markers of T cell activation and death during the first three cycles of IL-2. All patients were treated with combination antiretroviral therapy (ART and were virally suppressed. The purpose of the study was to examine the role of CD8+ T cell death in responses to ART and IL-2 therapy. Methods Lymphocytes were examined at Day 0, 5 and 30 days during three cycles of IL-2 therapy. CD25, CD38, HLA-DR expression and annexin (cell death were examined on CD4 and CD8 subpopulations. Follow up studies examined CD4 levels and CD4:CD8 reconstitution after 6 years using both univariant and multivariate analyses. Results Human lymphocytes responded to IL-2 therapy by upregulation of CD25 on CD4+ T cells, leading to an increase in CD4 cell counts. CD8+ T cells did not increase CD25 expression, but upregulated activation antigens (CD38 and DR and had increased death. At baseline, 7 of the 14 patients had high CD8+ T cell apoptosis (mean 17.0% ± 6.0. We did an exploratory analysis of immune status after six years, and found that baseline CD8+ T cell apoptosis was correlated with CD4 cell count gain beginning two years post enrollment. Patients with low levels of CD8+ T cell apoptosis at baseline (mean 2.2% ± 2.1 had significantly higher CD4 cell counts and more normalized CD4:CD8 ratios than patients with high CD8+ T cell apoptosis (mean CD4 cell counts 1,209 ± 164 vs 754 ± 320 cells/mm3; CD4:CD8 ratios 1.55 vs. 0.70, respectively. Conclusion We postulate that CD8+ T cell apoptosis may reflect inherent activation status, which continues in some patients even though viral replication is suppressed which influences the ability of CD4+ T cells to rebound. Levels of CD8+ T cell apoptosis may therefore be an independent predictor of immune status, which should be shown in a

  16. CD8 apoptosis may be a predictor of T cell number normalization after immune reconstitution in HIV (United States)

    Lewis, Dorothy E; Gross, Kimber L; Diez, Martine M; Martinez, Maria L; Lukefahr, Helen N; Kozinetz, Claudia A; Arduino, Roberto C


    Background As part of the Houston Vanguard study, a subset of 10 patients randomized to receive IL-2 therapy were compared to 4 patients randomized to not receive IL-2, for markers of T cell activation and death during the first three cycles of IL-2. All patients were treated with combination antiretroviral therapy (ART) and were virally suppressed. The purpose of the study was to examine the role of CD8+ T cell death in responses to ART and IL-2 therapy. Methods Lymphocytes were examined at Day 0, 5 and 30 days during three cycles of IL-2 therapy. CD25, CD38, HLA-DR expression and annexin (cell death) were examined on CD4 and CD8 subpopulations. Follow up studies examined CD4 levels and CD4:CD8 reconstitution after 6 years using both univariant and multivariate analyses. Results Human lymphocytes responded to IL-2 therapy by upregulation of CD25 on CD4+ T cells, leading to an increase in CD4 cell counts. CD8+ T cells did not increase CD25 expression, but upregulated activation antigens (CD38 and DR) and had increased death. At baseline, 7 of the 14 patients had high CD8+ T cell apoptosis (mean 17.0% ± 6.0). We did an exploratory analysis of immune status after six years, and found that baseline CD8+ T cell apoptosis was correlated with CD4 cell count gain beginning two years post enrollment. Patients with low levels of CD8+ T cell apoptosis at baseline (mean 2.2% ± 2.1) had significantly higher CD4 cell counts and more normalized CD4:CD8 ratios than patients with high CD8+ T cell apoptosis (mean CD4 cell counts 1,209 ± 164 vs 754 ± 320 cells/mm3; CD4:CD8 ratios 1.55 vs. 0.70, respectively). Conclusion We postulate that CD8+ T cell apoptosis may reflect inherent activation status, which continues in some patients even though viral replication is suppressed which influences the ability of CD4+ T cells to rebound. Levels of CD8+ T cell apoptosis may therefore be an independent predictor of immune status, which should be shown in a prospective study. PMID:17263884

  17. Different protein of Echinococcus granulosus stimulates dendritic induced immune response. (United States)

    Wang, Yana; Wang, Qiang; Lv, Shiyu; Zhang, Shengxiang


    Cystic echinococcosis is a chronic infectious disease that results from a host/parasite interaction. Vaccination with ferritin derived from Echinococcus granulosus is a potential preventative treatment. To understand whether ferritin is capable of inducing a host immune response, we investigated the response of dendritic cells (DCs) to both recombinant ferritin protein and the hydatid fluid (HF) of E. granulosus. We evaluated the immunomodulatory potential of these antigens by performing, immunocytochemistry, electron microscopy and in vivo imaging of monocyte-derived murine DCs. During antigen stimulation of DCs, ferritin cause DCs maturation and induced higher levels of surface marker expression and activated T-cell proliferation and migration. On contrary, HF failed to induce surface marker expression and to stimulate T-cell proliferation. In response to HF, DCs produced interleukin-6 (IL-6), but no IL-12 and IL-10. DCs stimulated with ferritin produced high levels of cytokines. Overall, HF appears to induce host immunosuppression in order to ensure parasite survival via inhibits DC maturation and promotes Th2-dependent secretion of cytokines. Although ferritin also promoted DC maturation and cytokine release, it also activates CD4+T-cell proliferation, but regard of the mechanism of the Eg.ferritin induce host to eradicate E. granulosus were not clear.

  18. Sub-meninges implantation reduces immune response to neural implants. (United States)

    Markwardt, Neil T; Stokol, Jodi; Rennaker, Robert L


    Glial scar formation around neural interfaces inhibits their ability to acquire usable signals from the surrounding neurons. To improve neural recording performance, the inflammatory response and glial scarring must be minimized. Previous work has indicated that meningeally derived cells participate in the immune response, and it is possible that the meninges may grow down around the shank of a neural implant, contributing to the formation of the glial scar. This study examines whether the glial scar can be reduced by placing a neural probe completely below the meninges. Rats were implanted with sets of loose microwire implants placed either completely below the meninges or implanted conventionally with the upper end penetrating the meninges, but not attached to the skull. Histological analysis was performed 4 weeks following surgical implantation to evaluate the glial scar. Our results found that sub-meninges implants showed an average reduction in reactive astrocyte activity of 63% compared to trans-meninges implants. Microglial activity was also reduced for sub-meninges implants. These results suggest that techniques that isolate implants from the meninges offer the potential to reduce the encapsulation response which should improve chronic recording quality and stability. Published by Elsevier B.V.

  19. Visible light induced changes in the immune response through an eye-brain mechanism (photoneuroimmunology). (United States)

    Roberts, J E


    The immune system is susceptible to a variety of stresses. Recent work in neuroimmunology has begun to define how mood alteration, stress, the seasons, and daily rhythms can have a profound effect on immune response through hormonal modifications. Central to these factors may be light through an eye-brain hormonal modulation. In adult primates, only visible light (400-700 nm) is received by the retina. This photic energy is then transduced and delivered to the visual cortex and by an alternative pathway to the suprachiasmatic nucleus (SCN). The SCN is a part of the hypothalamic region in the brain believed to direct circadian rhythm. Visible light exposure also modulates the pituitary and pineal gland which leads to neuroendocrine changes. Melatonin, norepinephrine and acetylcholine decrease with light activation, while cortisol, serotonin, gaba and dopamine levels increase. The synthesis of vasoactive intestinal polypeptide (VIP), gastrin releasing peptide (GRP) and neuropeptide Y (NPY) in rat SCN has been shown to be modified by light. These induced neuroendocrine changes can lead to alterations in mood and circadian rhythm. All of these neuroendocrine changes can lead to immune modulation. An alternative pathway for immune modulation by light is through the skin. Visible light (400-700 nm) can penetrate epidermal and dermal layers of the skin and may directly interact with circulating lymphocytes to modulate immune function. However, even in the presence of phototoxic agents such as eosin and rose bengal, visible light did not produce suppression of contact hypersensitivity with suppresser cells. In contrast to visible light, in vivo exposure to UV-B (280-320 nm) and UV-A (320-400 nm) radiation can only alter normal human immune function by a skin mediated response. Each UV subgroup (B, A) induces an immunosuppressive response but by differing mechanisms involving the regulation of differing interleukins and growth factors. Some effects observed in humans are

  20. Humoral and cell-mediated immune responses to influenza vaccination in equine metabolic syndrome (EMS) horses. (United States)

    Elzinga, Sarah; Reedy, Stephanie; Barker, Virginia D; Chambers, Thomas M; Adams, Amanda A


    Obesity is an increasing problem in the equine population with recent reports indicating that the percentage of overweight horses may range anywhere from 20.6-51%. Obesity in horses has been linked to more serious health concerns such as equine metabolic syndrome (EMS). EMS is a serious problem in the equine industry given its defining characteristics of insulin dysregualtion and obesity, as well as the involvement of laminitis. Little research however has been conducted to determine the effects of EMS on routine healthcare of these horses, in particular how they respond to vaccination. It has been shown that obese humans and mice have decreased immune responses to vaccination. EMS may have similar effects on vaccine responses in horses. If this is the case, these animals may be more susceptible to disease, acting as unknown disease reservoirs. Therefore, we investigated the effects of EMS on immune responses to routine influenza vaccination. Twenty-five adult horses of mixed-sex and mixed-breed (8-21 years old) horses; 13 EMS and 12 non-EMS were selected. Within each group, 4 horses served as non-vaccinate saline controls and the remaining horses were vaccinated with a commercially available equine influenza vaccine. Vaccination (influenza or saline) was administered on weeks 0 and 3, and peripheral blood samples taken on week 0 prior to vaccination and on weeks 1, 2, 3, 4, and 5 post vaccination. Blood samples were used to measure hemagglutination inhibition (HI) titers and equine influenza specific IgGa, IgGb, and IgGT levels. Blood samples were also used to isolate peripheral blood mononuclear cells (PBMCs) for analysis of cell mediated immune (CMI) responses via real-time polymerase chain reaction (RT-PCR). All horses receiving influenza vaccination responded with significant increases (P equine influenza specific antibodies following vaccination compared to saline controls. EMS did not significantly affect (P > 0.05) humoral immune responses as measured

  1. Pretreatment antigen-specific immunity and regulation - association with subsequent immune response to anti-tumor DNA vaccination. (United States)

    Johnson, Laura E; Olson, Brian M; McNeel, Douglas G


    Immunotherapies have demonstrated clinical benefit for many types of cancers, however many patients do not respond, and treatment-related adverse effects can be severe. Hence many efforts are underway to identify treatment predictive biomarkers. We have reported the results of two phase I trials using a DNA vaccine encoding prostatic acid phosphatase (PAP) in patients with biochemically recurrent prostate cancer. In both trials, persistent PAP-specific Th1 immunity developed in some patients, and this was associated with favorable changes in serum PSA kinetics. In the current study, we sought to determine if measures of antigen-specific or antigen non-specific immunity were present prior to treatment, and associated with subsequent immune response, to identify possible predictive immune biomarkers. Patients who developed persistent PAP-specific, IFNγ-secreting immune responses were defined as immune "responders." The frequency of peripheral T cell and B cell lymphocytes, natural killer cells, monocytes, dendritic cells, myeloid derived suppressor cells, and regulatory T cells were assessed by flow cytometry and clinical laboratory values. PAP-specific immune responses were evaluated by cytokine secretion in vitro, and by antigen-specific suppression of delayed-type hypersensitivity to a recall antigen in an in vivo SCID mouse model. The frequency of peripheral blood cell types did not differ between the immune responder and non-responder groups. Non-responder patients tended to have higher PAP-specific IL-10 production pre-vaccination (p = 0.09). Responder patients had greater preexisting PAP-specific bystander regulatory responses that suppressed DTH to a recall antigen (p = 0.016). While our study population was small (n = 38), these results suggest that different measures of antigen-specific tolerance or regulation might help predict immunological outcome from DNA vaccination. These will be prospectively evaluated in an ongoing randomized, phase II trial.

  2. Humoral immune response to measles and varicella vaccination in former very low birth weight preterm infants


    Carolina Schlindwein Mariano Ferreira; Maria Cristina Abrão Aued Perin; Maria Isabel de Moraes-Pinto; Raquel Maria Simão-Gurge; Ana Lucia Goulart; Lily Yin Weckx; Amélia Miyashiro Nunes dos Santos


    Introduction: Immune response to vaccination in infants born prematurely may be lower than in infants born at full-term. Some clinical factors might be associated with humoral immune response. Objectives: The objectives of this study were to compare the immune response to measles and varicella vaccination in infants born prematurely with those born at full-term and to analyze factors associated with measles and varicella antibody levels. Methods: Prospective study including two groups o...

  3. CAF01 potentiates immune responses and efficacy of an inactivated influenza vaccine in ferrets

    DEFF Research Database (Denmark)

    Martel, Cyril Jean-Marie; Agger, Else Marie; Poulsen, Julie Juul


    response, whereas the induction of cell-mediated immune responses is negligible. Recently, a cationic liposomal adjuvant (dimethyldioctadecylammonium/trehalose 6,6'-dibehenate, CAF01) was developed. CAF01 has proven to enhance both humoral and cell-mediated immune responses to a number of different...

  4. Discovery of stimulation-responsive immune enhancers with CRISPR activation (United States)

    Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K.; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander


    The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa) to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs.

  5. Discovery of stimulation-responsive immune enhancers with CRISPR activation (United States)

    Simeonov, Dimitre R.; Gowen, Benjamin G.; Boontanrart, Mandy; Roth, Theodore L.; Gagnon, John D.; Mumbach, Maxwell R.; Satpathy, Ansuman T.; Lee, Youjin; Bray, Nicolas L.; Chan, Alice Y.; Lituiev, Dmytro S.; Nguyen, Michelle L.; Gate, Rachel E.; Subramaniam, Meena; Li, Zhongmei; Woo, Jonathan M.; Mitros, Therese; Ray, Graham J.; Curie, Gemma L.; Naddaf, Nicki; Chu, Julia S.; Ma, Hong; Boyer, Eric; Van Gool, Frederic; Huang, Hailiang; Liu, Ruize; Tobin, Victoria R.; Schumann, Kathrin; Daly, Mark J.; Farh, Kyle K; Ansel, K. Mark; Ye, Chun J.; Greenleaf, William J.; Anderson, Mark S.; Bluestone, Jeffrey A.; Chang, Howard Y.; Corn, Jacob E.; Marson, Alexander


    The majority of genetic variants associated with common human diseases map to enhancers, non-coding elements that shape cell-type-specific transcriptional programs and responses to extracellular cues1–3. Systematic mapping of functional enhancers and their biological contexts is required to understand the mechanisms by which variation in non-coding genetic sequences contributes to disease. Functional enhancers can be mapped by genomic sequence disruption4–6, but this approach is limited to the subset of enhancers that are necessary in the particular cellular context being studied. We hypothesized that recruitment of a strong transcriptional activator to an enhancer would be sufficient to drive target gene expression, even if that enhancer was not currently active in the assayed cells. Here we describe a discovery platform that can identify stimulus-responsive enhancers for a target gene independent of stimulus exposure. We used tiled CRISPR activation (CRISPRa)7 to synthetically recruit a transcriptional activator to sites across large genomic regions (more than 100 kilobases) surrounding two key autoimmunity risk loci, CD69 and IL2RA. We identified several CRISPRa-responsive elements with chromatin features of stimulus-responsive enhancers, including an IL2RA enhancer that harbours an autoimmunity risk variant. Using engineered mouse models, we found that sequence perturbation of the disease-associated Il2ra enhancer did not entirely block Il2ra expression, but rather delayed the timing of gene activation in response to specific extracellular signals. Enhancer deletion skewed polarization of naive T cells towards a pro-inflammatory T helper (TH17) cell state and away from a regulatory T cell state. This integrated approach identifies functional enhancers and reveals how non-coding variation associated with human immune dysfunction alters context-specific gene programs. PMID:28854172

  6. The Relationship Between Morphological Symmetry and Immune Response in Wild-Caught Adult Bush-Crickets

    Directory of Open Access Journals (Sweden)

    Åsa Berggren


    Full Text Available Despite interest in the relationship between fluctuating asymmetry (FA, immune response and ecological factors in insects, little data are available from wild populations. In this study we measured FA and immune response in 370 wild-caught male bush-crickets, Metrioptera roeseli, from 20 experimentally introduced populations in southern-central Sweden. Individuals with more-symmetric wings had a higher immune response as measured by the cellular encapsulation of a surgically-implanted nylon monofilament. However, we found no relationship between measures of FA in other organs (i.e. tibia and maxillary palp and immune response, suggesting that this pattern may reflect differing selection pressures.

  7. Immune responses in cattle vaccinated with gamma-irradiated Anaplasma marginale

    International Nuclear Information System (INIS)

    Sharma, S.P.; Bansal, G.C.


    The infectivity and immunogenecity of gamma-irradiated Anaplasma marginale organisms were studied in bovine calves. The severity of Anaplasma infection based on per cent infected red blood cells, haematological values and mortality was more in animals immunized with blood exposed to 60 kR in comparison to those inoculated with blood irradiated at 70, 80 and 90 kR. The immunizing controls demonstrated a significantly high parasitaemia, marked anaemia and more deaths. Marked and prolonged cell-mediated and humoral immune responses detectable in the first 3 weeks of post-immunization may be responsible for conferring of protective immunity. (author)

  8. Polar lipids of Burkholderia pseudomallei induce different host immune responses.

    Directory of Open Access Journals (Sweden)

    Mercedes Gonzalez-Juarrero

    Full Text Available Melioidosis is a disease in tropical and subtropical regions of the world that is caused by Burkholderia pseudomallei. In endemic regions the disease occurs primarily in humans and goats. In the present study, we used the goat as a model to dissect the polar lipids of B. pseudomallei to identify lipid molecules that could be used for adjuvants/vaccines or as diagnostic tools. We showed that the lipidome of B. pseudomallei and its fractions contain several polar lipids with the capacity to elicit different immune responses in goats, namely rhamnolipids and ornithine lipids which induced IFN-γ, whereas phospholipids and an undefined polar lipid induced strong IL-10 secretion in CD4(+ T cells. Autologous T cells co-cultured with caprine dendritic cells (cDCs and polar lipids of B. pseudomallei proliferated and up-regulated the expression of CD25 (IL-2 receptor molecules. Furthermore, we demonstrated that polar lipids were able to up-regulate CD1w2 antigen expression in cDCs derived from peripheral blood monocytes. Interestingly, the same polar lipids had only little effect on the expression of MHC class II DR antigens in the same caprine dendritic cells. Finally, antibody blocking of the CD1w2 molecules on cDCs resulted in decreased expression for IFN-γ by CD4(+ T cells. Altogether, these results showed that polar lipids of B. pseudomallei are recognized by the caprine immune system and that their recognition is primarily mediated by the CD1 antigen cluster.

  9. Polar Lipids of Burkholderia pseudomallei Induce Different Host Immune Responses (United States)

    Gonzalez-Juarrero, Mercedes; Mima, Naoko; Trunck, Lily A.; Schweizer, Herbert P.; Bowen, Richard A.; Dascher, Kyle; Mwangi, Waithaka; Eckstein, Torsten M.


    Melioidosis is a disease in tropical and subtropical regions of the world that is caused by Burkholderia pseudomallei. In endemic regions the disease occurs primarily in humans and goats. In the present study, we used the goat as a model to dissect the polar lipids of B. pseudomallei to identify lipid molecules that could be used for adjuvants/vaccines or as diagnostic tools. We showed that the lipidome of B. pseudomallei and its fractions contain several polar lipids with the capacity to elicit different immune responses in goats, namely rhamnolipids and ornithine lipids which induced IFN-γ, whereas phospholipids and an undefined polar lipid induced strong IL-10 secretion in CD4+ T cells. Autologous T cells co-cultured with caprine dendritic cells (cDCs) and polar lipids of B. pseudomallei proliferated and up-regulated the expression of CD25 (IL-2 receptor) molecules. Furthermore, we demonstrated that polar lipids were able to up-regulate CD1w2 antigen expression in cDCs derived from peripheral blood monocytes. Interestingly, the same polar lipids had only little effect on the expression of MHC class II DR antigens in the same caprine dendritic cells. Finally, antibody blocking of the CD1w2 molecules on cDCs resulted in decreased expression for IFN-γ by CD4+ T cells. Altogether, these results showed that polar lipids of B. pseudomallei are recognized by the caprine immune system and that their recognition is primarily mediated by the CD1 antigen cluster. PMID:24260378

  10. Humoral immune response of mice injected with tocopherol after exposure to X-radiation

    International Nuclear Information System (INIS)

    Roy, R.M.; Petrella, M.


    Serum haemagglutination (HA) titers have been determined for irradiated and non-irradiated mice responding to injection of two different concentrations of sheep red blood cells (SRBC) 24 to 48 hours after irradiation and immediate intraperitoneal injection of 2.5 mg DL alpha-tocopherol, the emulsifying vehicle, or saline. Mice maintained on tocopherol-deficient diets for 8 weeks post-weaning and those on regular diets exhibited increased IgG titers during peak response when injected with vitamin E. This partially alleviated the radiation-depression of the primary immune response induced by the smaller SRBC injection. This stimulatory effect was most significant in mice maintained on vitamin E-deficient diets. The HA titers of irradiated and non-irradiated mice maintained on normal rations were determined following a 10-fold increase in the SRBC inoculation. Antibody titer was greater following injection of the higher concentration of SRBC but post-irradiation injection of tocopherol immediately or 24 hours after irradiation did not enhance immune response. At the higher SRBC concentration maximum observed HA titers decreased with increasing dose of radiation; however, tocopherol had no significant dose-reducing effect. Tocopherol toxicity as manifested by depressed HA titers was observed occasionally in non-irradiated mice challenged with the higher concentration of SRBC

  11. Immune responses to implants - a review of the implications for the design of immunomodulatory biomaterials. (United States)

    Franz, Sandra; Rammelt, Stefan; Scharnweber, Dieter; Simon, Jan C


    A key for long-term survival and function of biomaterials is that they do not elicit a detrimental immune response. As biomaterials can have profound impacts on the host immune response the concept emerged to design biomaterials that are able to trigger desired immunological outcomes and thus support the healing process. However, engineering such biomaterials requires an in-depth understanding of the host inflammatory and wound healing response to implanted materials. One focus of this review is to outline the up-to-date knowledge on immune responses to biomaterials. Understanding the complex interactions of host response and material implants reveals the need for and also the potential of "immunomodulating" biomaterials. Based on this knowledge, we discuss strategies of triggering appropriate immune responses by functional biomaterials and highlight recent approaches of biomaterials that mimic the physiological extracellular matrix and modify cellular immune responses. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Immune and inflammatory responses in the CNS : Modulation by astrocytes

    DEFF Research Database (Denmark)

    Penkowa, Milena; aschner, michael; hidalgo, juan


    Beyond their long-recognized support functions, astrocytes are active partners of neurons in processing information, synaptic integration, and production of trophic factors, just to name a few. Both microglia and astrocytes produce and secrete a number of cytokines, modulating and integrating...... the communication between hematogenous cells and resident cells of the central nervous system (CNS). This review will address (1) the functions of astrocytes in the normal brain and (2) their role in surveying noxious stimuli within the brain, with particular emphasis on astrocytic responses to damage or disease...

  13. Vaxfectin enhances antigen specific antibody titers and maintains Th1 type immune responses to plasmid DNA immunization. (United States)

    Reyes, L; Hartikka, J; Bozoukova, V; Sukhu, L; Nishioka, W; Singh, G; Ferrari, M; Enas, J; Wheeler, C J; Manthorpe, M; Wloch, M K


    Antigen specific immune responses were characterized after intramuscular immunization of BALB/c mice with 5 antigen encoding plasmid DNAs (pDNAs) complexed with Vaxfectin, a cationic lipid formulation. Vaxfectin increased IgG titers for all of the antigens with no effect on the CTL responses to the 2 antigens for which CTL assays were performed. Both antigen specific IgG1 and IgG2a were increased, although IgG2a remained greater than IgG1. Furthermore, Vaxfectin had no effect on IFN-gamma or IL-4 production by splenocytes re-stimulated with antigen, suggesting that the Th1 type responses typical of intramuscular pDNA immunization were not altered. Studies with IL-6 -/- mice suggest that the antibody enhancement is IL-6 dependent and results in a correlative increase in antigen specific antibody secreting cells.

  14. Oral polio vaccine influences the immune response to BCG vaccination. A natural experiment. (United States)

    Sartono, Erliyani; Lisse, Ida M; Terveer, Elisabeth M; van de Sande, Paula J M; Whittle, Hilton; Fisker, Ane B; Roth, Adam; Aaby, Peter; Yazdanbakhsh, Maria; Benn, Christine S


    Oral polio vaccine (OPV) is recommended to be given at birth together with BCG vaccine. While we were conducting two trials including low-birth-weight (LBW) and normal-birth-weight (NBW) infants in Guinea-Bissau, OPV was not available during some periods and therefore some infants did not receive OPV at birth, but only BCG. We investigated the effect of OPV given simultaneously with BCG at birth on the immune response to BCG vaccine. We compared the in vitro and the in vivo response to PPD in the infants who received OPV and BCG with that of infants who received BCG only. At age 6 weeks, the in vitro cytokine response to purified protein derivate (PPD) of M. Tuberculosis was reduced in LBW and NBW infants who had received OPV with BCG. In a pooled analysis receiving OPV with BCG at birth was associated with significantly lower IL-13 (p = 0.041) and IFN-gamma (p = 0.004) and a tendency for lower IL-10 (p = 0.054) in response to PPD. Furthermore, OPV was associated with reduced in vivo response to PPD at age 2 months, the prevalence ratio (PR) of having a PPD reaction being 0.75 (0.58-0.98), p = 0.033, and with a tendency for reduced likelihood of having a BCG scar (0.95 (0.91-1.00), p = 0.057)). Among children with a scar, OPV was associated with reduced scar size, the regression coefficient being -0.24 (-0.43-0.05), p = 0.012. This study is the first to address the consequences for the immune response to BCG of simultaneous administration with OPV. Worryingly, the results indicate that the common practice in low-income countries of administering OPV together with BCG at birth may down-regulate the response to BCG vaccine.

  15. Oral polio vaccine influences the immune response to BCG vaccination. A natural experiment.

    Directory of Open Access Journals (Sweden)

    Erliyani Sartono

    Full Text Available BACKGROUND: Oral polio vaccine (OPV is recommended to be given at birth together with BCG vaccine. While we were conducting two trials including low-birth-weight (LBW and normal-birth-weight (NBW infants in Guinea-Bissau, OPV was not available during some periods and therefore some infants did not receive OPV at birth, but only BCG. We investigated the effect of OPV given simultaneously with BCG at birth on the immune response to BCG vaccine. METHODS AND FINDINGS: We compared the in vitro and the in vivo response to PPD in the infants who received OPV and BCG with that of infants who received BCG only. At age 6 weeks, the in vitro cytokine response to purified protein derivate (PPD of M. Tuberculosis was reduced in LBW and NBW infants who had received OPV with BCG. In a pooled analysis receiving OPV with BCG at birth was associated with significantly lower IL-13 (p = 0.041 and IFN-gamma (p = 0.004 and a tendency for lower IL-10 (p = 0.054 in response to PPD. Furthermore, OPV was associated with reduced in vivo response to PPD at age 2 months, the prevalence ratio (PR of having a PPD reaction being 0.75 (0.58-0.98, p = 0.033, and with a tendency for reduced likelihood of having a BCG scar (0.95 (0.91-1.00, p = 0.057. Among children with a scar, OPV was associated with reduced scar size, the regression coefficient being -0.24 (-0.43-0.05, p = 0.012. CONCLUSIONS: This study is the first to address the consequences for the immune response to BCG of simultaneous administration with OPV. Worryingly, the results indicate that the common practice in low-income countries of administering OPV together with BCG at birth may down-regulate the response to BCG vaccine.

  16. Genetic constraints in the induction of the immune response to Ehrlich ascites tumor in mice

    International Nuclear Information System (INIS)

    Marusic, M.; Perkins, E.H.


    A single injection of irradiated Ehrlich ascites tumor (EAT) cells induces immunity in normal mice but fails to do so in T-cell-deficient-thymectomized, lethally irradiated, bone marrow-reconstituted (TIR) mice. TIR mice injected with normal syngeneic T cells develop an immune response to EAT when injected with irradiated EAT cells and reject a subsequent tumor cell challenge. In the present studies allogeneic T cells were unable to protect against EAT in TIR recipients even if harvested from donors tolerant to the recipient's transplantation antigens and injected into the TIR mice tolerant to the transplantation antigens of the injected T cells. Tolerance was produced by establishing long-term radiation chimeras of the P → F 1 type. Semiallogeneic T cells also failed to afford protection against EAT in TIR recipients. Whereas tolerance to other parental-strain transplantation antigens did not reverse the inability of parental T cells (cells from P → F 1 chimeric donors) to protect against EAT in F 1 TIR mice, it did enable F 1 T cells to afford protection in P → F 1 TIR mice

  17. The body’s immune response in the induction and progression of cancer of the cervix uteri: possible mechanisms

    Directory of Open Access Journals (Sweden)

    O. V. Kurmyshkina


    Full Text Available Human papillomavirus (HPV that is a main cause of cancer of the cervix uteri (CCU has immunogenic properties, i.e. an abilityto activate antiviral immunity responses as adaptive HPV-specific and innate ones. For this reason, despite multiple mechanisms generated by HPV to avoid immunity responses, the human body can eliminate the infection in most cases. At the same time, CCU results from the combined influence of many factors of different nature, among which the factors that impair the normal course of an immune response are of vital importance.This review describes the major factors and mechanisms, which promote the establishment of persistent HPV infection and the progression of dysplasia to cancer, on the one hand, and allow the tumor cells in CCU to restrict the body’s immune reactions, on the other Immune disorders induced by the virus and/or tumor cells are considered at both local and systemic levels. Particular emphasis is placed on the molecular mechanisms that can change the population composition and functional activity of leukocytes and the cytokine profile of cells and can form the tumor suppressor microenvironment.

  18. Effect of oral administration of Lactobacillus paracasei L9 on mouse systemic immunity and the immune response in the intestine

    Directory of Open Access Journals (Sweden)

    Zhu Yuanbo


    Full Text Available A probiotic strain Lactobacillus paracasei L9,which was isolated from human intestine, was investigated for its immunomodulatory activity in vivo. Results showed that L9 improved systemic immunity by enhancing the phagocytic activity of peritoneal macrophages, the proliferation ratio of splenocytes, the IgG level in the serum and the level of IgA in the mucosa. Further, L9induced theTh1-polarized immune response by elevating the IFN-γ/IL-4 ratio in the mucosa. This effect was confirmed by the enhanced IL-12-inducing activity of macrophages after in vitro stimulation of L9. Also detected was increased expression of TLR-2mRNA in the mucosa. We predict that L9 could enhance innate immunity by activating TLR-2 in the mucosa, and enhance acquired immunity by promoting Th1 polarization through induced production of IL-12 by macrophages.

  19. Role of Activin A in Immune Response to Breast Cancer (United States)


    Innate and adaptive immune cells in the tumor microenvironment. Nat Immunol 14:1014-1022, 2013 10. Ji R-R, Chasalow SD, Wang L, et al: An immune... cells also generate reactive oxygen and nitrogen species that modify the chemokine and antigen receptors on CTLs both in the lymphoid organs and in the... cells . endogenous, evolutionarily conserved intracellular molecules that are released upon necrotic cell death. By linking the innate and adaptive immune

  20. Chemokine-mediated immune responses in the female genital tract mucosa. (United States)

    Deruaz, Maud; Luster, Andrew D


    The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.

  1. Immune Response of Multiparous Hyper-Immunized Sows against Peptides from Non-Structural and Structural Proteins of PRRSV

    Directory of Open Access Journals (Sweden)

    Edgar Rascón-Castelo


    Full Text Available The purpose of this study was to evaluate the humoral and cellular responses of commercial multiparous and hyper-immunized sows against peptides from non-structural (nsp and structural proteins of porcine reproductive and respiratory syndrome virus (PRRSV. We selected sows with different numbers of parities from a commercial farm. Management practices on this farm include the use of the MLV commercial vaccine four times per year, plus two vaccinations during the acclimation period. The humoral response was evaluated via the antibody recognition of peptides from nsp and structural proteins, and the cellular response was assessed by measuring the frequency of peptide and PRRSV-specific IFN-gamma-secreting cells (IFNγ-SC. Our results show that sows with six parities have more antibodies against peptides from structural proteins than against peptides from nsp. The analysis of the cellular response revealed that the number of immunizations did not affect the frequency of IFNγ-SC and that the response was stronger against peptides from structural proteins (M protein than against nsp (nsp2. In summary, these results demonstrate that multiparous, hyper-immunized sows have a stronger immune humoral response to PRRSV structural peptides than nsp, but no differences in IFNγ-SC against the same peptides were observed.

  2. Characterization of the innate immune response to chronic aspiration in a novel rodent model

    Directory of Open Access Journals (Sweden)

    Lin Shu S


    Full Text Available Abstract Background Although chronic aspiration has been associated with several pulmonary diseases, the inflammatory response has not been characterized. A novel rodent model of chronic aspiration was therefore developed in order to investigate the resulting innate immune response in the lung. Methods Gastric fluid or normal saline was instilled into the left lung of rats (n = 48 weekly for 4, 8, 12, or 16 weeks (n = 6 each group. Thereafter, bronchoalveolar lavage specimens were collected and cellular phenotypes and cytokine concentrations of IL-1alpha, IL-1beta, IL-2, IL-4, IL-6, IL-10, GM-CSF, IFN-gamma, TNF-alpha, and TGF-beta were determined. Results Following the administration of gastric fluid but not normal saline, histologic specimens exhibited prominent evidence of giant cells, fibrosis, lymphocytic bronchiolitis, and obliterative bronchiolitis. Bronchoalveolar lavage specimens from the left (treated lungs exhibited consistently higher macrophages and T cells with an increased CD4:CD8 T cell ratio after treatment with gastric fluid compared to normal saline. The concentrations of IL-1alpha, IL-1beta, IL-2, TNF-alpha and TGF-beta were increased in bronchoalveolar lavage specimens following gastric fluid aspiration compared to normal saline. Conclusion This represents the first description of the pulmonary inflammatory response that results from chronic aspiration. Repetitive aspiration events can initiate an inflammatory response consisting of macrophages and T cells that is associated with increased TGF-beta, TNF-alpha, IL-1alpha, IL-1beta, IL-2 and fibrosis in the lung. Combined with the observation of gastric fluid-induced lymphocyitic bronchiolitis and obliterative bronchiolitis, these findings further support an association between chronic aspiration and pulmonary diseases, such as obliterative bronchiolitis, pulmonary fibrosis, and asthma.

  3. The inflammatory an immune response to mousepox (infectious ectromelia) virus

    International Nuclear Information System (INIS)

    Niemialtowski, M.G.; Spohr de Faundez, I.; Gierynska, M; Toka, F.N.; Schollenberger, A.; Popis, A.; Malicka, E.


    The ectromelia virus(EV) has been recognized as the etiological agent of a relatively common infection in laboratory mouse colonies around the world, i.e. Europe (including Poland), U.S.A. and Asia. Due to widespread use of mice in biomedical research, it is important to study the biology of strains characteristic for a given country. This is particularly significant for the diagnosis, prevention and control ectromelia. In severe epizootics, approximately 90% morbidity is observed within colonies and mortality rate exceeding 70% is observed within 4 to 20 days from the appearance of clinical symptoms. The resistance to lethal infection is mouse strain-dependent. Several inbred strains of mice, including C57BL/6 and AKR are resistant to the lethal effects of EV infection, while others, such as A and BALB/c are susceptible. Recent studies indicate that (1) T lymphocytes, natural killer cells and interferon (IFN)-dependent host defenses must operate for the expression of resistance, (2) virus-specific T-cell precursors appear earlier in regional lymph nodes of resistant than susceptible mice, and (3) resistance mechanism are expressed during early stages of infection. Over the past several years, (1) induction of anti-EV cytotoxic CD8 + T lymphocytes responses in vivo in the absence of CD 4 + (T helper) cells, (2) importance of some cytokines e.g., IFN-gamma in EV clearance at all stages of infection, and (3) induction of nitric oxide synthase, which is necessary for a substantial antiviral activity of IFN-gamma, have been demonstrated. The effector mechanism by which EV-specific immune cells (T lymphocytes) execute their and inflammatory functions are thought to involve the release of soluble mediators that attract, focus and active cells at the infected sites. It is possible that the skin is the most relevant organ for studying the biology of an EV infection in vivo, yet very little is known concerning EV replication there and the importance of the skin;s innate and

  4. Sex differences in immune responses: Hormonal effects, antagonistic selection, and evolutionary consequences. (United States)

    Roved, Jacob; Westerdahl, Helena; Hasselquist, Dennis


    Males and females differ in both parasite load and the strength of immune responses and these effects have been verified in humans and other vertebrates. Sex hormones act as important modulators of immune responses; the male sex hormone testosterone is generally immunosuppressive while the female sex hormone estrogen tends to be immunoenhancing. Different sets of T-helper cells (Th) have important roles in adaptive immunity, e.g. Th1 cells trigger type 1 responses which are primarily cell-mediated, and Th2 cells trigger type 2 responses which are primarily humoral responses. In our review of the literature, we find that estrogen and progesterone enhance type 2 and suppress type 1 responses in females, whereas testosterone suppresses type 2 responses and shows an inconsistent pattern for type 1 responses in males. When we combine these patterns of generally immunosuppressive and immunoenhancing effects of the sex hormones, our results imply that the sex differences in immune responses should be particularly strong in immune functions associated with type 2 responses, and less pronounced with type 1 responses. In general the hormone-mediated sex differences in immune responses may lead to genetic sexual conflicts on immunity. Thus, we propose the novel hypothesis that sexually antagonistic selection may act on immune genes shared by the sexes, and that the strength of this sexually antagonistic selection should be stronger for type 2- as compared with type 1-associated immune genes. Finally, we put the consequences of sex hormone-induced effects on immune responses into behavioral and ecological contexts, considering social mating system, sexual selection, geographical distribution of hosts, and parasite abundance. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. The effect of cyclosporin A on the primary immune response to allogeneic red cells in rabbits. (United States)

    Smith, G N


    Cyclosporin A (CSA) has been used in an attempt to suppress the primary immune response of HgA(A)-negative rabbits to A-positive red cells. The immune response was assessed by measuring the survival of a small intravenous (i.v.) dose of 51Cr-labelled A-positive cells and by testing the serum of the immunized rabbits for anti-A. In one experiment, eight A-negative rabbits were given a first i.v. injection of A-positive red cells, and CSA (25 mg/kg/day) in olive oil was given by mouth for 17-34 days. There was no evidence of impaired alloimmunization compared with the responses in control animals treated with olive oil alone. In a second experiment, eight A-negative rabbits were given a first injection of A-positive muscularly (i.m.), and CSA (25 mg/kg/day) in miglyol was given by im.m. injection for 10 days. Six of these rabbits were rendered unresponsive, and the remaining two, who showed impaired survival of the monitoring red cells, produced only low anit-A titres. Seven out of eight controls given i.m. miglyol without CSA responded with good anti-A production. Rabbits that were unresponsive to A-positive red cells responded normally to sheep red blood cells 15 weeks after CSA treatment. Higher serum levels of CSA were found following i.m. administration of the drug but treatment by this route as associated with severe toxicity in some rabbits. PMID:7056563

  6. Immune response of cattle against fasciolopsis induced by inoculation of irradiated metacercariae of fasciola gigantic

    International Nuclear Information System (INIS)



    An experiment was carried out to study the immune response of cattle against fasciolopsis induced by inoculation of irradiated metacercariae of F. gigantic. Four groups of experimental cattle were used e.g: the first group (Vp) were inoculated by the unirradiated metacercariae as a positive control, the second group (Vi) were once inoculated with irradiated metacercariae and then challenged with the infected metacercariae three weeks later, the third group (Vii) were twice inoculated with irradiated metacercariae and then challenged with the infected metacercariae three weeks later, while the forth group (Vn), the negative control without any inoculation of metacercariae. Irradiation dose of 45 Gy was used, and each experimental animal received 700 live’s metacercariae of F. gigantic. The immune response towards fasciolopsis in cattle has been observed in the development of body weight, the number of red blood cells (RBC), the number of white blood cells (WBC), level of haemoglobin (Hb), percentages of Packed cell volume (PCV), the number of eosinophil cells, serological test by ELISA, pathology anatomic inspection and evaluation of the development of worm.The average every measurement of body weight development are Vp = 6 kg, Vi = 9 kg, Vii = 9 kg and Vn = 10 kg. The group of Vi, Vii and Vn were normal of their heart, but the group of Vp was disorder. The group of Vi, Vii and Vn were negative of adult worm’s, while the group of Vp was positive of adult worm’s. These results showed that inoculation of irradiated metacercariae F. gigantic could stimulate good immune response which was able to protect against the infectivity of the challenge in cattle. (author)

  7. Isotope-based immunological techniques. Their use in assessment of immune competence and the study of immune responses to pathogens

    International Nuclear Information System (INIS)

    Duffus, W.P.H.


    The influence of isotope-based techniques on both assessment of immune competence and immune response to pathogens is discussed. Immunodeficiencies acquired as a result of factors like malnutrition and concomitant disease can severely affect not only attempts to intensify and improve production but also successful immune response against important vaccines such as rinderpest and foot-and-mouth disease. Isotope-based techniques, with their accuracy, speed and small sample volume, are ideally suited for assessing immunocompetence. One of the main drawbacks remains antigen purity, an area where research should now be concentrated. Lymphocyte transformation is widely used to assess cell-mediated immuno-competence but techniques to assess biological functions such as phagocytosis and cell-mediated cytotoxicity could more usefully reflect immune status. These latter techniques utilize isotopes such as 3 H, 14 C, 32 P and 125 I. Investigation of specific cell-mediated immune response often requires a labelled target. Suitable isotopes such as 51 Cr, 99 Tcsup(m), 75 Se and 3 H are compared for their capacity to label both mammalian and parasite targets. Suggestions are made on a number of areas of research that might usefully be encouraged and supported in order to improve applied veterinary immunology in tropical countries. (author)

  8. Effects of Stressor Controllability on Acute Stress Responses: Cardiovascular, Neuroendocrine, and Immune Responses


    磯和, 勅子; Isowa, Tokiko


    This thesis is concerned with the effects of controllability over acute stressors on psychological and physiological responses intermediated by immune, cardiovascular, neuroendocrine systems. The effects of stressor controllability have been examined in animal studies based on the learned helplessness theory. However, there were few studies in human. Especially, there were remarkably few studies that examined the effects of stressor controllability on immunological system. In addition, result...

  9. Biochemical response of normal albino rats to the addition of ...

    African Journals Online (AJOL)

    Experiments were conducted to determine the biochemical effect of Hibiscus cannabinus and Murraya koenigii extracts on normal albino rats using standard methods. Analyses carried out indicated that the aqueous leaf extract of H. cannabinus and M. koenigii exhibited significant hypolipideamic activity in normal rats.

  10. Long term evolution of the immune response in the rat irradiated at mean and high doses

    International Nuclear Information System (INIS)

    Malarbet, J.L.; Veyrat, M.; Le Go, R.; Prudhomme, J.; Genest, L.; Castelnau, L.


    In irradiated animals, the lymphocytes, immunity vectors, are quickly and quantitatively depressed. Their ability to respond to an antigenic stimulus was tested in rats during post-irradiation lymphopenia and after restoration of normal lymphocytosis. The antigenic stimulus, sheep erythrocytes, was applied first 2 and 3 weeks, then 1, 2 and 3 months after exposures to 60 Co gamma rays (doses 300 and 600 rads). This study covered the 3rd through the 10th day after immunisation. Blood lymphocytes were separated by the Ficoll-Contrix gradient method and spleen lymphocytes were obtained by crushing. A lymphocyte sub-population separation was obtained from centrifugation on 4 discontinuous Ficoll-Contrix gradients. Size distribution spectra show that the lighter sub-population is made up of large-sized cells and that the heavier the cells, the smaller they are. The determination of surface immunoglobulins with fluorescent antigens shows that cells bearing immunoglobulins are predominant in the low-density sub-population. The measurement of electrophoretic mobility shows a low-mobility, low-density population and a higher density, faster mobility population which could reflect a higher proportion of B-cells in the low density population and of T-cells in the higher density population. The immune response was tested on the sub-populations. The rosette-forming ability was depressed during 1 month after irradiation then became progressively normal. The cellular plaque-forming ability was markedly suppressed 15 days after irradiation, but was soon active again. These results show the qualitative aspect of the post-irradiation immune defect [fr

  11. Hemagglutinating virus of Japan envelope (HVJ-E) can enhance the immune responses of swine immunized with killed PRRSV vaccine

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Zhihong [State Key Laboratory of Agrobiotechnology, College of Veterinary Medicine, China Agricultural University, Beijing 100094 (China); China Institute of Veterinary Drug Control, Beijing 100081 (China); Zhang, Quan [College of Veterinary Medicine, Yangzhou University, Yangzhou 225009 (China); Wang, Zaishi [China Institute of Veterinary Drug Control, Beijing 100081 (China); Zhang, Zhongqiu [State Key Laboratory of Agrobiotechnology, College of Veterinary Medicine, China Agricultural University, Beijing 100094 (China); Veterinary Bureau, Ministry of Agriculture of the People' s Republic of China, Beijing 100125 (China); Guo, Pengju [Institute of Veterinary Medicine, Guangdong Academy of Agricultural Sciences, Guangdong 510640 (China); Zhao, Deming, E-mail: [State Key Laboratory of Agrobiotechnology, College of Veterinary Medicine, China Agricultural University, Beijing 100094 (China)


    Highlights: Black-Right-Pointing-Pointer We investigated the immunoadjuvant effects of HVJ-E on killed PRRSV vaccine. Black-Right-Pointing-Pointer HVJ-E enhanced the humoral and cellular responses of the piglets to PRRSV. Black-Right-Pointing-Pointer It is suggested that HVJ-E could be developed as a new-type adjuvant for mammals. -- Abstract: Porcine reproductive and respiratory syndrome virus (PRRSV) is an economically detrimental pig pathogen that causes significant losses for the pig industry. The immunostimulatory effects of hemagglutinating virus of Japan envelope (HVJ-E) in cancer therapy and the adjuvant efficacy of HVJ-E have been previously evaluated. The objective of this study was to investigate the adjuvant effects of HVJ-E on immunization with killed PRRSV vaccine, and to evaluate the protective effects of this immunization strategy against virulent PRRSV infection in piglets. Next, the PRRSV-specific antibody response, lymphocyte proliferation, PRRSV-specific IL-2, IL-10 and IFN-{gamma} production, and the overall protection efficacy were evaluated to assess the immune responses of the piglets. The results showed that the piglets inoculated simultaneously with killed PRRSV vaccine and HVJ-E had a significantly stronger immune response than those inoculated with killed PRRSV vaccine alone. Our results suggest that HVJ-E could be employed as an effective adjuvant to enhance the humoral and cellular responses of piglets to PRRSV.

  12. DMPD: Cytosolic DNA recognition for triggering innate immune responses. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 18280611 Cytosolic DNA recognition for triggering innate immune responses. Takaoka ...A, Taniguchi T. Adv Drug Deliv Rev. 2008 Apr 29;60(7):847-57. Epub 2007 Dec 31. (.png) (.svg) (.html) (.csml) Show Cytosol...ic DNA recognition for triggering innate immune responses. PubmedID 18280611 Title Cytosolic D

  13. Modelling the innate immune response against avian influenza virus in chicken

    NARCIS (Netherlands)

    Hagenaars, T.J.; Fischer, E.A.J.; Jansen, C.A.; Rebel, J.M.J.; Spekreijse, D.; Vervelde, L.; Backer, J.A.; Jong, de M.C.M.; Koets, A.P.


    At present there is limited understanding of the host immune response to (low pathogenic) avian influenza virus infections in poultry. Here we develop a mathematical model for the innate immune response to avian influenza virus in chicken lung, describing the dynamics of viral load,

  14. DMPD: Macrophage migration inhibitory factor and host innate immune responses tomicrobes. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 14620137 Macrophage migration inhibitory factor and host innate immune responses to...microbes. Calandra T. Scand J Infect Dis. 2003;35(9):573-6. (.png) (.svg) (.html) (.csml) Show Macrophage migration... inhibitory factor and host innate immune responses tomicrobes. PubmedID 14620137 Title Macrophage migration

  15. DMPD: Innate immune responses during infection. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available va Correia J. Vaccine. 2004 Dec 6;22 Suppl 1:S25-30. (.png) (.svg) (.html) (.csml) Show Innate immune responses during infection. Pub...medID 15576198 Title Innate immune responses during infection. Authors Ulevitch RJ,

  16. Modelling the Innate Immune Response against Avian Influenza Virus in Chicken

    NARCIS (Netherlands)

    Hagenaars, T J; Fischer, E A J; Jansen, C A; Rebel, J M J; Spekreijse, D; Vervelde, L; Backer, J A; de Jong, M.C.M.; Koets, A P


    At present there is limited understanding of the host immune response to (low pathogenic) avian influenza virus infections in poultry. Here we develop a mathematical model for the innate immune response to avian influenza virus in chicken lung, describing the dynamics of viral load, interferon-α, -β

  17. Immune Response Augmentation in Metastasized Breast Cancer by Localized Therapy Utilizing Biocompatible Magnetic Fluids (United States)


    SUBJECT TERMS Cancer therapy by localized immune response, Magneto -rehological Fluids 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT...Metastasized Breast Cancer by Localized Therapy utilizing Biocompatible Magnetic Fluids PRINCIPAL INVESTIGATOR: Cahit Evrensel...2008 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Immune Response Augmentation in Metastasized Breast Cancer by Localized Therapy utilizing

  18. Effects of alcohol consumption on the allergen-specific immune response in mice

    DEFF Research Database (Denmark)

    Linneberg, Allan; Roursgaard, Martin; Hersoug, Lars-Georg


    There is evidence that chronic alcohol consumption impairs the T-helper 1 (Th1) lymphocyte-regulated cell-mediated immune response possibly favoring a Th2 deviation of the immune response. Moreover, a few epidemiological studies have linked alcohol consumption to allergen-specific IgE sensitization....

  19. Selected physiotherapeutic techniques and immune response in low back pain

    Directory of Open Access Journals (Sweden)

    Piotr Gawda


    Full Text Available Physiotherapy, as an element of medical rehabilitation, comprises such methods of function improvement as: massage, kinesiotherapy, physical therapy or manual therapy. In this area, medicine offers a wide range of treatment methods, practically at every stage of a patient’s recovery. Physiotherapy is used to enhance quality of life of people with disabilities, chronic diseases or after injuries, but also as a form of prevention of dysfunctions. The aim of the study  is to present the influence of physiotherapy of low back pain on factors of immune response based on literature review. Effectiveness of a given treatment is most easily noticeable in clinical practice. It is usually the patient who evaluates the efficiency of treatment, through experiencing less pain, easier performance of certain actions or overall better functioning in everyday life. Apart from registering the subjective experience of patients, the focus is on finding objective methods of evaluating effectiveness of physiotherapy and on attempts at scientific explanation of noticeable and perceptible influence of rehabilitation treatment. This also applies to the treatment of lumbar-sacral pain. The involvement of many inflammatory mediators such as nitric oxide, interleukins, matrix metalloproteinases, prostaglandin , tumor necrosis factor alpha and a group of cytokines. and a variety of cytokines have already been  identified in the dysfunction of this region.

  20. Balneotherapy, Immune System, and Stress Response: A Hormetic Strategy?

    Directory of Open Access Journals (Sweden)

    Isabel Gálvez


    Full Text Available Balneotherapy is a clinically effective complementary approach in the treatment of low-grade inflammation- and stress-related pathologies. The biological mechanisms by which immersion in mineral-medicinal water and the application of mud alleviate symptoms of several pathologies are still not completely understood, but it is known that neuroendocrine and immunological responses—including both humoral and cell-mediated immunity—to balneotherapy are involved in these mechanisms of effectiveness; leading to anti-inflammatory, analgesic, antioxidant, chondroprotective, and anabolic effects together with neuroendocrine-immune regulation in different conditions. Hormesis can play a critical role in all these biological effects and mechanisms of effectiveness. The hormetic effects of balneotherapy can be related to non-specific factors such as heat—which induces the heat shock response, and therefore the synthesis and release of heat shock proteins—and also to specific biochemical components such as hydrogen sulfide (H2S in sulfurous water and radon in radioactive water. Results from several investigations suggest that the beneficial effects of balneotherapy and hydrotherapy are consistent with the concept of hormesis, and thus support a role for hormesis in hydrothermal treatments.

  1. Autophagy in the immune response to tuberculosis: clinical perspectives.

    LENUS (Irish Health Repository)

    Ní Cheallaigh, C


    A growing body of evidence points to autophagy as an essential component in the immune response to tuberculosis. Autophagy is a direct mechanism of killing intracellular Mycobacterium tuberculosis and also acts as a modulator of proinflammatory cytokine secretion. In addition, autophagy plays a key role in antigen processing and presentation. Autophagy is modulated by cytokines; it is stimulated by T helper type 1 (Th1) cytokines such as tumour necrosis factor (TNF)-α and interferon (IFN)-γ, and is inhibited by the Th2 cytokines interleukin (IL)-4 and IL-13 and the anti-inflammatory cytokine IL-10. Vitamin D, via cathelicidin, can also induce autophagy, as can Toll-like receptor (TLR)-mediated signals. Autophagy-promoting agents, administered either locally to the lungs or systemically, could have a clinical application as adjunctive treatment of drug-resistant and drug-sensitive tuberculosis. Moreover, vaccines which effectively induce autophagy could be more successful in preventing acquisition or reactivation of latent tuberculosis.

  2. Perturbation of gut bacteria induces a coordinated cellular immune response in the purple sea urchin larva (United States)

    CH Ho, Eric; Buckley, Katherine M; Schrankel, Catherine S; Schuh, Nicholas W; Hibino, Taku; Solek, Cynthia M; Bae, Koeun; Wang, Guizhi; Rast, Jonathan P


    The purple sea urchin (Strongylocentrotus purpuratus) genome sequence contains a complex repertoire of genes encoding innate immune recognition proteins and homologs of important vertebrate immune regulatory factors. To characterize how this immune system is deployed within an experimentally tractable, intact animal, we investigate the immune capability of the larval stage. Sea urchin embryos and larvae are morphologically simple and transparent, providing an organism-wide model to view immune response at cellular resolution. Here we present evidence for immune function in five mesenchymal cell types based on morphology, behavior and gene expression. Two cell types are phagocytic; the others interact at sites of microbial detection or injury. We characterize immune-associated gene markers for three cell types, including a perforin-like molecule, a scavenger receptor, a complement-like thioester-containing protein and the echinoderm-specific immune response factor 185/333. We elicit larval immune responses by (1) bacterial injection into the blastocoel and (2) seawater exposure to the marine bacterium Vibrio diazotrophicus to perturb immune state in the gut. Exposure at the epithelium induces a strong response in which pigment cells (one type of immune cell) migrate from the ectoderm to interact with the gut epithelium. Bacteria that accumulate in the gut later invade the blastocoel, where they are cleared by phagocytic and granular immune cells. The complexity of this coordinated, dynamic inflammatory program within the simple larval morphology provides a system in which to characterize processes that direct both aspects of the echinoderm-specific immune response as well as those that are shared with other deuterostomes, including vertebrates. PMID:27192936

  3. Pathogens Inactivated by Low-Energy-Electron Irradiation Maintain Antigenic Properties and Induce Protective Immune Responses (United States)

    Fertey, Jasmin; Bayer, Lea; Grunwald, Thomas; Pohl, Alexandra; Beckmann, Jana; Gotzmann, Gaby; Casado, Javier Portillo; Schönfelder, Jessy; Rögner, Frank-Holm; Wetzel, Christiane; Thoma, Martin; Bailer, Susanne M.; Hiller, Ekkehard; Rupp, Steffen; Ulbert, Sebastian


    Inactivated vaccines are commonly produced by incubating pathogens with chemicals such as formaldehyde or β-propiolactone. This is a time-consuming process, the inactivation efficiency displays high variability and extensive downstream procedures are often required. Moreover, application of chemicals alters the antigenic components of the viruses or bacteria, resulting in reduced antibody specificity and therefore stimulation of a less effective immune response. An alternative method for inactivation of pathogens is ionizing radiation. It acts very fast and predominantly damages nucleic acids, conserving most of the antigenic structures. However, currently used irradiation technologies (mostly gamma-rays and high energy electrons) require large and complex shielding constructions to protect the environment from radioactivity or X-rays generated during the process. This excludes them from direct integration into biological production facilities. Here, low-energy electron irradiation (LEEI) is presented as an alternative inactivation method for pathogens in liquid solutions. LEEI can be used in normal laboratories, including good manufacturing practice (GMP)- or high biosafety level (BSL)-environments, as only minor shielding is necessary. We show that LEEI efficiently inactivates different viruses (influenza A (H3N8), porcine reproductive and respiratory syndrome virus (PRRSV), equine herpesvirus 1 (EHV-1)) and bacteria (Escherichia coli) and maintains their antigenicity. Moreover, LEEI-inactivated influenza A viruses elicit protective immune responses in animals, as analyzed by virus neutralization assays and viral load determination upon challenge. These results have implications for novel ways of developing and manufacturing inactivated vaccines with improved efficacy. PMID:27886076

  4. The role of radiotherapy for the induction of antitumor immune responses

    International Nuclear Information System (INIS)

    Multhoff, G.; Helmholtz-Zentrum Muenchen; Gaipl, U.S.; Niedermann, G.


    Effective radiotherapy is aimed to control the growth of the primary carcinoma and to induce a long-term specific antitumor immune response against the primary tumor, recurrence and metastases. The contribution covers the following issues: T cells and tumor specific immune responses, dendritic cells (DCs) start adaptive immune responses, NK (natural killer) cells for HLA independent tumor control, abscopal effects of radiotherapy, combination of radiotherapy and immune therapy, radiotherapy contribution to the induction of immunogenic cell death, combinability of radiotherapy and DC activation, combinability of radiotherapy and NK cell therapy. It turns out that the combination of radio-chemotherapy and immune therapy can change the microenvironment initiating antitumor immune reactions that inhibit the recurrence risk and the development of metastases.

  5. Potential use of salivary markers for longitudinal monitoring of inflammatory immune responses to vaccination

    NARCIS (Netherlands)

    Lim, Pei Wen; Garssen, Johan; Sandalova, Elena


    Vaccination, designed to trigger a protective immune response against infection, is a trigger for mild inflammatory responses. Vaccination studies can address the question of inflammation initiation, levels, and resolution as well as its regulation for respective studied pathogens. Such studies

  6. CHRONOVAC VOYAGEUR: A study of the immune response to yellow fever vaccine among infants previously immunized against measles. (United States)

    Goujon, Catherine; Gougeon, Marie-Lise; Tondeur, Laura; Poirier, Béatrice; Seffer, Valérie; Desprès, Philippe; Consigny, Paul-Henri; Vray, Muriel


    For administration of multiple live attenuated vaccines, the Advisory Committee on Immunization Practices recommends either simultaneous immunization or period of at least 28days between vaccines, due to a possible reduction in the immune response to either vaccine. The main objective of this study was to compare the immune response to measles (alone or combined with mumps and rubella) and yellow fever vaccines among infants aged 6-24months living in a yellow fever non-endemic country who had receivedmeasles and yellow fever vaccines before travelling to a yellow fever endemic area. A retrospective, multicenter case-control study was carried out in 7 travel clinics in the Paris area from February 1st 2011 to march 31, 2015. Cases were defined as infants immunized with the yellow fever vaccine and with the measles vaccine, either alone or in combination with mumps and rubella vaccine, with a period of 1-27days between each immunization. For each case, two controls were matched based on sex and age: a first control group (control 1) was defined as infants having received the measles vaccine and the yellow fever vaccine simultaneously; a second control group (control 2) was defined as infants who had a period of more than 27days between receiving the measles vaccine and yellow fever vaccine. The primary endpoint of the study was the percentage of infants with protective immunity against yellow fever, measured by the titer of neutralizing antibodies in a venous blood sample. One hundred and thirty-one infants were included in the study (62 cases, 50 infants in control 1 and 19 infants in control 2). Of these, 127 (96%) were shown to have a protective titer of yellow fever antibodies. All 4 infants without a protective titer of yellow fever antibodies were part of control group 1. The measles vaccine, alone or combined with mumps and rubella vaccines, appears to have no influence on humoral immune response to the yellow fever vaccine when administered between 1 and 27

  7. Children with asthma by school age display aberrant immune responses to pathogenic airway bacteria as infants

    DEFF Research Database (Denmark)

    Larsen, Jeppe Madura; Pedersen, Susanne Brix; Thysen, Anna Hammerich


    childhood asthma. We hypothesized that children with asthma have an abnormal immune response to pathogenic bacteria in infancy. ObjectiveWe aimed to assess the bacterial immune response in asymptomatic infants and the association with later development of asthma by age 7 years. MethodsThe Copenhagen...... was assessed based on the pattern of cytokines produced and T-cell activation. ResultsThe immune response to pathogenic bacteria was different in infants with asthma by 7 years of age (P = .0007). In particular, prospective asthmatic subjects had aberrant production of IL-5 (P = .008), IL-13 (P = .057), IL-17...... (P = .001), and IL-10 (P = .028), whereas there were no differences in T-cell activation or peripheral T-cell composition. ConclusionsChildren with asthma by school age exhibited an aberrant immune response to pathogenic bacteria in infancy. We propose that an abnormal immune response to pathogenic...

  8. Immune evasion strategies of ranaviruses and innate immune responses to these emerging pathogens. (United States)

    Grayfer, Leon; Andino, Francisco De Jesús; Chen, Guangchun; Chinchar, Gregory V; Robert, Jacques


    Ranaviruses (RV, Iridoviridae) are large double-stranded DNA viruses that infect fish, amphibians and reptiles. For ecological and commercial reasons, considerable attention has been drawn to the increasing prevalence of ranaviral infections of wild populations and in aquacultural settings. Importantly, RVs appear to be capable of crossing species barriers of numerous poikilotherms, suggesting that these pathogens possess a broad host range and potent immune evasion mechanisms. Indeed, while some of the 95-100 predicted ranavirus genes encode putative evasion proteins (e.g., vIFα, vCARD), roughly two-thirds of them do not share significant sequence identity with known viral or eukaryotic genes. Accordingly, the investigation of ranaviral virulence and immune evasion strategies is promising for elucidating potential antiviral targets. In this regard, recombination-based technologies are being employed to knock out gene candidates in the best-characterized RV member, Frog Virus (FV3). Concurrently, by using animal infection models with extensively characterized immune systems, such as the African clawed frog, Xenopus laevis, it is becoming evident that components of innate immunity are at the forefront of virus-host interactions. For example, cells of the macrophage lineage represent important combatants of RV infections while themselves serving as targets for viral infection, maintenance and possibly dissemination. This review focuses on the recent advances in the understanding of the RV immune evasion strategies with emphasis on the roles of the innate immune system in ranaviral infections.

  9. F4+ ETEC infection and oral immunization with F4 fimbriae elicits an IL-17-dominated immune response. (United States)

    Luo, Yu; Van Nguyen, Ut; de la Fe Rodriguez, Pedro Y; Devriendt, Bert; Cox, Eric


    Enterotoxigenic Escherichia coli (ETEC) are an important cause of post-weaning diarrhea (PWD) in piglets. Porcine-specific ETEC strains possess different fimbrial subtypes of which F4 fimbriae are the most frequently associated with ETEC-induced diarrhea in piglets. These F4 fimbriae are potent oral immunogens that induce protective F4-specific IgA antibody secreting cells at intestinal tissues. Recently, T-helper 17 (Th17) cells have been implicated in the protection of the host against extracellular pathogens. However, it remains unknown if Th17 effector responses are needed to clear ETEC infections. In the present study, we aimed to elucidate if ETEC elicits a Th17 response in piglets and if F4 fimbriae trigger a similar response. F4(+) ETEC infection upregulated IL-17A, IL-17F, IL-21 and IL-23p19, but not IL-12 and IFN-γ mRNA expression in the systemic and mucosal immune system. Similarly, oral immunization with F4 fimbriae triggered a Th17 signature evidenced by an upregulated mRNA expression of IL-17F, RORγt, IL-23p19 and IL-21 in the peripheral blood mononuclear cells (PBMCs). Intriguingly, IL-17A mRNA levels were unaltered. To further evaluate this difference between systemic and mucosal immune responses, we assayed the cytokine mRNA profile of F4 fimbriae stimulated PBMCs. F4 fimbriae induced IL-17A, IL-17F, IL-22 and IL-23p19, but downregulated IL-17B mRNA expression. Altogether, these data indicate a Th17 dominated response upon oral immunization with F4 fimbriae and F4(+) ETEC infection. Our work also highlights that IL-17B and IL-17F participate in the immune response to protect the host against F4(+) ETEC infection and could aid in the design of future ETEC vaccines.

  10. Role of IL-12 and IFN-γ in immune response to toxoplasma gondii infection

    International Nuclear Information System (INIS)

    Moawad, M.A.F.; ElGawish, M.A.M.


    Interlenkin 12 (IL-12) is a potent immunoregulatory molecule that is critically involved in a wide range of diseases. In several murine models of intracellular infection, endogenous IL-12 has been shown to be crucial for the generation of a protective Th1 response in a primary infection for a intracellular pathogens. Interferon-gamma (IFN-γ) is also an important mediator of cellular immunity against microbial pathogens and tumor cells due to its potent capacity to activate macrophages for enhanced cytotoxicity. The aim of the present study is to evaluate the immune response to toxoplasma gondii after primary inflection (infected groups and secondary infection (re-infected groups for over 19 weeks (the time of the experiment). the evaluation was assessed by measurements of levels of IL-12 and IFN-γ using ELISA technique in the sera of these infected rats. The results demonstrated that the primary immune response induced a fluctuation in the levels of IL-12 in the sera of infected rats, which reached maximum value of 122.6 ±1.4 pg/ml after 15 weeks of primary infection. While, in the challenged groups (secondary immune response, re-infected groups) the levels of IL-12 were generally lower than that of the primary immune response. On the other hand, IFN-γ levels increased significantly in the secondary immune response (re-infected groups) as compared to primary immune response 9 infected groups) In conclusion, the results suggest that IL-12 might have a role in the defense mechanism against intracellular infection with T-gondii especially in primary immune response than in the secondary immune response. This is in contrast to IFN-γ that takes the up-hand in secondary immune response to T-gondii infection

  11. Coccidiosis Immunization: Effects of Mushroom and Herb Polysaccharides on Immune Responses of Chickens Infected with Eimeria Tenella

    NARCIS (Netherlands)

    Guo, F.C.; Kwakkel, R.P.; Williams, B.A.; Suo, X.; Li, W.K.; Verstegen, M.W.A.


    An experiment was conducted to investigate the effects of polysaccharide extracts (E) of two mushrooms, Lentinus edodes (LenE) and Tremella fuciformis (TreE), and an herb, Astragalus membranaceus (AstE), on the immune responses of chickens infected with Eimeria tenella. A total of 180 broiler

  12. [The humoral immune response in mice induced by recombinant Lactococcus lactis expressing HIV-1 gag]. (United States)

    Zhao, Xiaofei; Zhang, Cairong; Liu, Xiaojuan; Ma, Zhenghai


    To analyze the humoral immune response induced by recombinant Lactococcus lactis expressing HIV-1 gag in mice immunized orally, intranasally, subcutaneously or in the combined way of above three. Fifty BALB/c mice were randomly divided into 5 groups, 10 mice per group. The mice were immunized consecutively three times at two week intervals with 10(9) CFU of recombinant Lactococcus lactis expressing gag through oral, intranasal, subcutaneous administration or the mix of them. The mice that were immunized orally with Lactococcus lactis containing PMG36e served as a control group. The sera of mice were collected before primary immunization and 2 weeks after each immunization to detect the gag specific IgG by ELISA. Compared with the control group, the higher titer of serum gag specific IgG was detected in the four groups immunized with recombinant Lactococcus lactis expressing gag, and it was the highest in the mixed immunization group (PLactococcus lactis expressing gag can induce humoral immune response in mice by oral, intranasal, subcutaneous injection or the mix of them, and the mixed immunization can enhance the immune effects of Lactococcus lactis vector vaccine.

  13. Nasal Immunization Confers High Avidity Neutralizing Antibody Response and Immunity to Primary and Recurrent Genital Herpes in Guinea Pigs (United States)

    Persson, Josefine; Zhang, Yuan; Olafsdottir, Thorunn A.; Thörn, Karolina; Cairns, Tina M.; Wegmann, Frank; Sattentau, Quentin J.; Eisenberg, Roselyn J.; Cohen, Gary H.; Harandi, Ali M.


    Genital herpes is one of the most prevalent sexually transmitted infections in both the developing and developed world. Following infection, individuals experience life-long latency associated with sporadic ulcerative outbreaks. Despite many efforts, no vaccine has yet been licensed for human use. Herein, we demonstrated that nasal immunization with an adjuvanted HSV-2 gD envelope protein mounts significant protection to primary infection as well as the establishment of latency and recurrent genital herpes in guinea pigs. Nasal immunization was shown to elicit specific T cell proliferative and IFN-γ responses as well as systemic and vaginal gD-specific IgG antibody (Ab) responses. Furthermore, systemic IgG Abs displayed potent HSV-2 neutralizing properties and high avidity. By employing a competitive surface plasmon resonance (SPR) analysis combined with a battery of known gD-specific neutralizing monoclonal Abs (MAbs), we showed that nasal immunization generated IgG Abs directed to two major discontinuous neutralizing epitopes of gD. These results highlight the potential of nasal immunization with an adjuvanted HSV-2 envelope protein for induction of protective immunity to primary and recurrent genital herpes. PMID:28082979

  14. Nasal Immunization Confers High Avidity Neutralizing Antibody Response and Immunity to Primary and Recurrent Genital Herpes in Guinea Pigs. (United States)

    Persson, Josefine; Zhang, Yuan; Olafsdottir, Thorunn A; Thörn, Karolina; Cairns, Tina M; Wegmann, Frank; Sattentau, Quentin J; Eisenberg, Roselyn J; Cohen, Gary H; Harandi, Ali M


    Genital herpes is one of the most prevalent sexually transmitted infections in both the developing and developed world. Following infection, individuals experience life-long latency associated with sporadic ulcerative outbreaks. Despite many efforts, no vaccine has yet been licensed for human use. Herein, we demonstrated that nasal immunization with an adjuvanted HSV-2 gD envelope protein mounts significant protection to primary infection as well as the establishment of latency and recurrent genital herpes in guinea pigs. Nasal immunization was shown to elicit specific T cell proliferative and IFN-γ responses as well as systemic and vaginal gD-specific IgG antibody (Ab) responses. Furthermore, systemic IgG Abs displayed potent HSV-2 neutralizing properties and high avidity. By employing a competitive surface plasmon resonance (SPR) analysis combined with a battery of known gD-specific neutralizing monoclonal Abs (MAbs), we showed that nasal immunization generated IgG Abs directed to two major discontinuous neutralizing epitopes of gD. These results highlight the potential of nasal immunization with an adjuvanted HSV-2 envelope protein for induction of protective immunity to primary and recurrent genital herpes.

  15. Immunization of neonatal mice with LAMP/p55 HIV gag DNA elicits robust immune responses that last to adulthood

    International Nuclear Information System (INIS)

    Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia; Piubelli, Orlando; Alves de Brito, Cyro; Fusaro, Ana Elisa; Eurico de Alencar, Liciana Xavier; August, Thomas; Torres Azevedo Marques, Ernesto; Silva Duarte, Alberto Jose da; Sato, Maria Notomi


    Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses, as measured by the breadth of the Gag peptide-specific IFN-γ, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.

  16. Manipulating the in vivo immune response by targeted gene knockdown. (United States)

    Lieberman, Judy


    Aptamers, nucleic acids selected for high affinity binding to proteins, can be used to activate or antagonize immune mediators or receptors in a location and cell-type specific manner and to enhance antigen presentation. They can also be linked to other molecules (other aptamers, siRNAs or miRNAs, proteins, toxins) to produce multifunctional compounds for targeted immune modulation in vivo. Aptamer-siRNA chimeras (AsiCs) that induce efficient cell-specific knockdown in immune cells in vitro and in vivo can be used as an immunological research tool or potentially as an immunomodulating therapeutic. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Immunization with Paracoccidioides brasiliensis radioattenuated yeast cells induces Th1 immune response in Balb/C mice

    International Nuclear Information System (INIS)

    Martins, Estefania M.N.; Andrade, Antero S.R.; Resende, Maria Aparecida de; Reis, Bernardo S.; Goes, Alfredo M.


    Paracoccidioides brasiliensis is the agent of paracoccidioidomycosis, the most prevalent mycosis in Latin America. To date, there is no effective vaccine. In our laboratory yeast cells of P. brasiliensis were attenuated by gamma irradiation. We defined an absorbed dose in which the pathogen loses the reproductive ability, while retaining the morphology, the synthesis and secretion of proteins and the oxidative metabolism. The immunization with these cells was able to confer protection in BALB/c mice. The aim of the present work was evaluate the immune response pathway activated in mice immunized with P. brasiliensis radioattenuated yeast cells. The protector effect was evaluated in BALB/c mice groups immunized once or twice, respectively. Each group was divided in three sub groups that were challenge 30, 45 or 60 days after the immunization. These groups were called G1A, G1B and G1C in the group immunized once and G2A, G2B and G2C in the group immunized twice. Recovery of CFUs and cytokines determination (IFN - γ, IL - 10 and IL IV 4) were performed three months post challenge. Quantitative RT-PCR was the method of choice used to quantify the expression of cytokines. The sera were collected weekly to evaluate the IgG antibody titers and the IgG1 and IgG2a pattern in the course of infection. A significant reduction in CFUs recovery was verified 90 days post challenge in mice submitted to one immunization: 73.0%, 96.0% and 76.3% for sub-groups G1A, G1B and G1C, respectively. In the group submitted to two immunizations, a remarkable increase in the protection was obtained. No CFUs was recovered from sub-groups G2B and G2C and very few CFUs (reduction of 98.6%) were recovered from the lungs of sub group G2A. In mice submitted to one immunization, Th1 and Th2 cytokines were simultaneously produced. In the group submitted to two immunizations, levels of IL-10 and IL-4 were very low, while IFN-γ production was maintained indicating that a Th1 pattern was dominant. For

  18. Immunization with Paracoccidioides brasiliensis radioattenuated yeast cells induces Th1 immune response in Balb/C mice

    Energy Technology Data Exchange (ETDEWEB)

    Martins, Estefania M.N.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN-CNEN/MG), Belo Horizonte, MG (Brazil)], e-mail:, e-mail:; Resende, Maria Aparecida de [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Microbiologia], e-mail:; Reis, Bernardo S.; Goes, Alfredo M. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Bioquimica e Imunologia], e-mail:, e-mail:


    Paracoccidioides brasiliensis is the agent of paracoccidioidomycosis, the most prevalent mycosis in Latin America. To date, there is no effective vaccine. In our laboratory yeast cells of P. brasiliensis were attenuated by gamma irradiation. We defined an absorbed dose in which the pathogen loses the reproductive ability, while retaining the morphology, the synthesis and secretion of proteins and the oxidative metabolism. The immunization with these cells was able to confer protection in BALB/c mice. The aim of the present work was evaluate the immune response pathway activated in mice immunized with P. brasiliensis radioattenuated yeast cells. The protector effect was evaluated in BALB/c mice groups immunized once or twice, respectively. Each group was divided in three sub groups that were challenge 30, 45 or 60 days after the immunization. These groups were called G1A, G1B and G1C in the group immunized once and G2A, G2B and G2C in the group immunized twice. Recovery of CFUs and cytokines determination (IFN - {gamma}, IL - 10 and IL IV 4) were performed three months post challenge. Quantitative RT-PCR was the method of choice used to quantify the expression of cytokines. The sera were collected weekly to evaluate the IgG antibody titers and the IgG1 and IgG2a pattern in the course of infection. A significant reduction in CFUs recovery was verified 90 days post challenge in mice submitted to one immunization: 73.0%, 96.0% and 76.3% for sub-groups G1A, G1B and G1C, respectively. In the group submitted to two immunizations, a remarkable increase in the protection was obtained. No CFUs was recovered from sub-groups G2B and G2C and very few CFUs (reduction of 98.6%) were recovered from the lungs of sub group G2A. In mice submitted to one immunization, Th1 and Th2 cytokines were simultaneously produced. In the group submitted to two immunizations, levels of IL-10 and IL-4 were very low, while IFN-{gamma} production was maintained indicating that a Th1 pattern was

  19. RhIL-11 treatment normalized Th1/Th2 and T-bet/GATA-3 imbalance in in human immune thrombocytopenic purpura (ITP). (United States)

    Lin, Ying; Zhou, Xieming; Guo, Wenjian; Li, Qianqian; Pan, Xiahui; Bao, Yunhua; He, Muqing; Zhu, Baoling; Lin, Xiaoji; Jin, Limin; Yao, Rongxin


    Immune thrombocytopenia (ITP) is an autoimmune hemorrhagic disorder characterized by reduction in platelet counts. T helper 1 (Th1) cells polarization with an increased shift of Th1/Th2 ratio has been reported in ITP. This shift is associated with transcription factor T-box expressed in T cells (T-bet) upregulation and GATA-binding protein 3 (GATA-3) downregulation, leading to an increased T-bet/GATA-3 ratio. Our previous in vitro study showed that recombinant human interleukin-11 (rhIL-11) could normalize Th1/Th2 imbalance in the peripheral blood mononuclear cells (PBMCs) isolated from adult ITP patients, which co-occurred with T-bet/GATA-3 ratio restoration. In this report, we investigated whether rhIL-11 had therapeutic effect in clinical ITP patients and whether rhIL-11 treatment could normalize Th1/Th2 and T-bet/GATA-3 levels in vivo. We found rhIL-11 treatment had a response rate of 67.7% and significantly decreased Th1 and T-bet levels but increased Th2 and GATA-3 levels in ITP patients who showed good response, normalizing Th1/Th2 and T-bet/GATA-3 ratios similar to that in healthy controls. Thus our study suggested rhIL-11 was effective with tolerable adverse effects in ITP. The treatment strategy warrants further clinical investigation. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Immune response at birth, long-term immune memory and 2 years follow-up after in-utero anti-HBV DNA immunization. (United States)

    Fazio, V M; Ria, F; Franco, E; Rosati, P; Cannelli, G; Signori, E; Parrella, P; Zaratti, L; Iannace, E; Monego, G; Blogna, S; Fioretti, D; Iurescia, S; Filippetti, R; Rinaldi, M


    Infections occurring at the end of pregnancy, during birth or by breastfeeding are responsible for the high toll of death among first-week infants. In-utero DNA immunization has demonstrated the effectiveness in inducing specific immunity in newborns. A major contribution to infant immunization would be achieved if a vaccine proved able to be protective as early as at the birth, preventing the typical 'first-week infections'. To establish its potential for use in humans, in-utero DNA vaccination efficiency has to be evaluated for short- and long-term safety, protection at delivery, efficacy of boosts in adults and effective window/s for modulation of immune response during pregnancy, in an animal model suitable with human development. Here we show that a single intramuscular in-utero anti-HBV DNA immunization at two-thirds of pig gestation produces, at birth, antibody titers considered protective in humans. The boost of antibody titers in every animal following recall at 4 and 10 months demonstrates the establishment of immune memory. The safety of in-utero fetus manipulation is guaranteed by short-term (no fetus loss, lack of local alterations, at-term spontaneous delivery, breastfeeding) and long-term (2 years) monitoring. Treatment of fetuses closer to delivery results in immune ignorance without induction of tolerance. This result highlights the repercussion of selecting the appropriate time point when this approach is used to deliver therapeutic genes. All these findings illustrate the relevance of naked DNA-based vaccination technology in therapeutic efforts aimed to prevent the high toll of death among first-week infants.

  1. Costs of mounting an immune response during pregnancy in a lizard. (United States)

    Meylan, Sandrine; Richard, Murielle; Bauer, Sophie; Haussy, Claudy; Miles, Donald


    Immune defenses are of great benefit to hosts, but reducing the impact of infection by mounting an immune response also entails costs. However, the physiological mechanisms that generate the costs of an immune response remain poorly understood. Moreover, the majority of studies investigating the consequences of an immune challenge in vertebrates have been conducted on mammals and birds. The aim of this study is to investigate the physiological costs of mounting an immune response during gestation in an ectothermic species. Indeed, because ectothermic species are unable to internally regulate their body temperature, the apportionment of resources to homeostatic activities in ectothermic species can differ from that in endothermic species. We conducted this study on the common lizard Zootoca vivipara. We investigated the costs of mounting an immune response by injecting females with sheep red blood cells and quantified the consequences to reproductive performance (litter mass and success) and physiological performance (standard metabolic rate, endurance, and phytohemagglutinin response). In addition, we measured basking behavior. Our analyses revealed that mounting an immune response affected litter mass, physiological performance, and basking behavior. Moreover, we demonstrated that the modulation of an immune challenge is impacted by intrinsic factors, such as body size and condition.

  2. Qualitative and quantitative evaluation of donkeys responses to immunization by rabbits' IgG

    International Nuclear Information System (INIS)

    Hassan, A. M. E.; Saeed, A. M.


    In this study two apparently healthy donkeys were immunized with highly pure rabbit's 1gG using a revised protocol. Qualitative test using the same immuno gen was done as a primary test to eva lute the immune system response. However, the same 1gG was iodinated with 1 25I using chloramine T method and the labeled 1gG was used to quantitatively study the immune response. The two donkeys showed good response with the younger one having the best response. The obtained donkey anti rabbit sera was used as separating agent for RIA assay for human PRL. (Author)

  3. The immune response of the human brain to abdominal surgery

    DEFF Research Database (Denmark)

    Forsberg, Anton; Cervenka, Simon; Jonsson Fagerlund, Malin


    OBJECTIVE: Surgery launches a systemic inflammatory reaction that reaches the brain and associates with immune activation and cognitive decline. Although preclinical studies have in part described this systemic-to-brain signaling pathway, we lack information on how these changes appear in humans....... This study examines the short- and long-term impact of abdominal surgery on the human brain immune system by positron emission tomography (PET) in relation to blood immune reactivity, plasma inflammatory biomarkers, and cognitive function. METHODS: Eight males undergoing prostatectomy under general...... anesthesia were included. Prior to surgery (baseline), at postoperative days 3 to 4, and after 3 months, patients were examined using [11C]PBR28 brain PET imaging to assess brain immune cell activation. Concurrently, systemic inflammatory biomarkers, ex vivo blood tests on immunoreactivity...

  4. Nutritional modulation of the immune response in poultry (United States)

    Economic efficiency demanded by the poultry industry has pushed selection towards high production with improved feed conversion ratios (FCR) and high yield; however, selection based heavily on growth characteristics and other phenotypic traits has adversely affected immune competence. Despite incre...

  5. Immune responses to influenza virus and its correlation to age and inherited factors

    Directory of Open Access Journals (Sweden)

    Azadeh Bahadoran


    Full Text Available Influenza viruses belong to the family Orthomyxoviridae of enveloped viruses and are an important cause of respiratory infections worldwide. The influenza virus is able to infect a wide variety species as diverse as poultry, marine, pigs, horses and humans. Upon infection with influenza virus the innate immunity plays a critical role in efficient and rapid control of viral infections as well as in adaptive immunity initiation. The humoral immune system produces antibodies against different influenza antigens, of which the HA-specific antibody is the most important for neutralization of the virus and thus prevention of illness. Cell mediated immunity including CD4+ helper T cells and CD8+ cytotoxic T cells are the other arms of adaptive immunity induced upon influenza virus infection. The complex inherited factors and age related changes are associated with the host immune responses. Here, we review the different components of immune responses against influenza virus. Additionally, the correlation of the immune response to age and inherited factors has been discussed. These determinations lead to a better understanding of the limitations of immune responses for developing improved vaccines to control influenza virus infection.

  6. Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response

    Directory of Open Access Journals (Sweden)

    Hong Zhong


    Full Text Available In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.

  7. Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response. (United States)

    Zhong, Hong; Ma, Minjuan; Liang, Tingming; Guo, Li


    In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.

  8. Preexisting Salmonella-specific immunity interferes with the subsequent development of immune responses against the Salmonella strains delivering H9N2 hemagglutinin. (United States)

    Hajam, Irshad Ahmed; Lee, John Hwa


    Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (pSalmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (pSalmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Effect of Scoparia dulcis on noise stress induced adaptive immunity and cytokine response in immunized Wistar rats. (United States)

    Sundareswaran, Loganathan; Srinivasan, Sakthivel; Wankhar, Wankupar; Sheeladevi, Rathinasamy

    Noise acts as a stressor and is reported to have impact on individual health depending on nature, type, intensity and perception. Modern medicine has no effective drugs or cure to prevent its consequences. Being an environmental stressor noise cannot be avoided; instead minimizing its exposure or consuming anti-stressor and adaptogens from plants can be considered. The present study was carried out to evaluate the anti-stressor, adaptogen and immunostimulatory activity of Scoparia dulcis against noise-induced stress in Wistar rat models. Noise stress in rats was created by broadband white noise generator, 100 dB A/4 h daily/15 days and S. dulcis (200 mg/kg b.w.) was administered orally. 8 groups of rats were used consisting of 6 animals each; 4 groups for unimmunized and 4 groups for immunized. For immunization, sheep red blood cells (5 × 10 9  cells/ml) were injected intraperitoneally. Sub-acute noise exposed rats showed a significant increase in corticosterone and IL-4 levels in both immunized and unimmunized rats whereas lymphocytes, antibody titration, soluble immune complex, IL-4 showed a marked increase with a significant decrease in IL-2, TNF-α, IFN-γ cytokines only in unimmunized rats. Immunized noise exposed rats presented increased leukocyte migration index and decreased foot pad thickness, IL-2, TNF-α, IFN-γ with no changes in the lymphocytes. S. dulcis (SD) has normalized and prevented the noise induced changes in cell-mediated and humoral immunity and it could be the presence of anti-stressor and immuno stimulant activity of the plant. Copyright © 2016 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Published by Elsevier B.V. All rights reserved.

  10. Vitamin E, immunity, and infection (United States)

    A normally functioning immune system is critical for the body to fight and eliminate invading pathogens from the environment. On the other hand, the immune system also protects the body from internal risks such as neoplasia growing within and autoimmune responses that attack self. The immune system ...

  11. Antigen modulation of the immune response. III. Evaluation of the hypothetical short-lived memory cell

    International Nuclear Information System (INIS)

    Feldbush, T.L.; Lande, I.; Bryan, B.; O'Neill, E.


    The putative short-lived memory cells, whose existence has been suggested by the results of secondary adoptive transfer experiments, were investigated. On the basis of the following evidences we have concluded that the short-lived memory cell is probably an artifact of the adoptive transfer technique: when immune thoracic duct lymphocytes, known to consist predominantly of long-lived memory cells, were transferred to irradiated recipients and challenged at various times after transfer, approximately 80 to 90 percent of the initial response was absent by Day 14 challenge; preirradiating adoptive recipients with increasing dose of x-irradiation tended to lengthen the observed half life of memory cells; single or multiple treatments of immune donors with 0.3 mg Vinblastin before transfer resulted in neither a depression of the initial secondary response nor an alteration in the rate of decline of the memory potential; reconstitution of irradiated hosts with normal spleen cells one day before transfer of memory cells and challenge resulted in inhibition of the adoptive secondary response; and the transfer of memory cells to antigen free intermediate hosts, in which they were allowed to reside for one day or fourteen days before transfer to irradiated recipients, resulted in only a slight decline in their capacity to respond. We propose that the rapid decline of memory potential in adoptive recipients challenged at various times after transfer is due to modulating effects by the hosts as it recovers from irradiation. These effects may be the result of cell crowding or the loss of irradiation-produced stimulatory factors. The relevance of these findings to adoptive transfer systems in general and the secondary response of intact animals is discussed

  12. The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity (United States)


    P.J. (1989) Effect of Streptococcus pneumoniae on human respiratory epithelium in vitro. Infect. Immun. 57: 2006-2013. Stoop, J.N., van der Molen ...antibiotics. Clin. Microbiol. Rev. 3: 171-196. Knapp, S., Wieland, C.W., van ’t Veer, C., Takeuchi, O., Akira, S., Florquin, S., and van der Poll...R.G., Baan, C.C., van der Laan, L.J., Kuipers, E.J., Kusters, J.G., and Janssen, H.L. (2005) Regulatory T cells contribute to the impaired immune

  13. Cell-mediated immune responses in rainbow trout after DNA immunization against the viral hemorrhagic septicemia virus

    DEFF Research Database (Denmark)

    Utke, Katrin; Kock, Holger; Schuetze, Heike


    injection site rather than to injection sites of heterologous vaccines, suggesting the antigen specificity of homing. By demonstrating CMC responses to distinct viral proteins and homing in rainbow trout, these results substantially contribute to the understanding of the teleost immune system.......To identify viral proteins that induce cell-mediated cytotoxicity (CMC) against viral hemorrhagic septicemia virus (VHSV)-infected cells, rainbow trout were immunized with DNA vectors encoding the glycoprotein G or the nucleocapsid protein N of VHSV. The G protein was a more potent trigger...... of cytotoxic cells than the N protein. Peripheral blood leukocytes (PBL) isolated from trout immunized against the G protein killed both VHSV-infected MHC class I matched (RTG-2) and VHSV-infected xenogeneic (EPC) target cells, suggesting the involvement of both cytotoxic T lymphocytes (CTL) and NK cells...

  14. Innate immune responses to gut microbiota differ between oceanic and freshwater threespine stickleback populations

    Directory of Open Access Journals (Sweden)

    Kathryn Milligan-Myhre


    Full Text Available Animal hosts must co-exist with beneficial microbes while simultaneously being able to mount rapid, non-specific, innate immune responses to pathogenic microbes. How this balance is achieved is not fully understood, and disruption of this relationship can lead to disease. Excessive inflammatory responses to resident microbes are characteristic of certain gastrointestinal pathologies such as inflammatory bowel disease (IBD. The immune dysregulation of IBD has complex genetic underpinnings that cannot be fully recapitulated with single-gene-knockout models. A deeper understanding of the genetic regulation of innate immune responses to resident microbes requires the ability to measure immune responses in the presence and absence of the microbiota using vertebrate models with complex genetic variation. Here, we describe a new gnotobiotic vertebrate model to explore the natural genetic variation that contributes to differences in innate immune responses to microbiota. Threespine stickleback, Gasterosteus aculeatus, has been used to study the developmental genetics of complex traits during the repeated evolution from ancestral oceanic to derived freshwater forms. We established methods to rear germ-free stickleback larvae and gnotobiotic animals monoassociated with single bacterial isolates. We characterized the innate immune response of these fish to resident gut microbes by quantifying the neutrophil cells in conventionally reared monoassociated or germ-free stickleback from both oceanic and freshwater populations grown in a common intermediate salinity environment. We found that oceanic and freshwater fish in the wild and in the laboratory share many intestinal microbial community members. However, oceanic fish mount a strong immune response to residential microbiota, whereas freshwater fish frequently do not. A strong innate immune response was uniformly observed across oceanic families, but this response varied among families of freshwater fish

  15. A specific primed immune response in Drosophila is dependent on phagocytes.

    Directory of Open Access Journals (Sweden)

    Linh N Pham


    Full Text Available Drosophila melanogaster, like other invertebrates, relies solely on its innate immune response to fight invading microbes; by definition, innate immunity lacks adaptive characteristics. However, we show here that priming Drosophila with a sublethal dose of Streptococcus pneumoniae protects against an otherwise-lethal second challenge of S. pneumoniae. This protective effect exhibits coarse specificity for S. pneumoniae and persists for the life of the fly. Although not all microbial challenges induced this specific primed response, we find that a similar specific protection can be elicited by Beauveria bassiana, a natural fly pathogen. To characterize this primed response, we focused on S. pneumoniae-induced protection. The mechanism underlying this protective effect requires phagocytes and the Toll pathway. However, activation of the Toll pathway is not sufficient for priming-induced protection. This work contradicts the paradigm that insect immune responses cannot adapt and will promote the search for similar responses overlooked in organisms with an adaptive immune response.

  16. Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis. (United States)

    Lemieux, Maxime W; Sonzogni-Desautels, Karine; Ndao, Momar


    In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between T H 1/T H 2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.

  17. Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis

    Directory of Open Access Journals (Sweden)

    Maxime W. Lemieux


    Full Text Available In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between TH1/TH2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.

  18. Interplay between immune responses to HLA and non-HLA self-antigens in allograft rejection. (United States)

    Angaswamy, Nataraju; Tiriveedhi, Venkataswarup; Sarma, Nayan J; Subramanian, Vijay; Klein, Christina; Wellen, Jason; Shenoy, Surendra; Chapman, William C; Mohanakumar, T


    Recent studies strongly suggest an increasing role for immune responses against self-antigens (Ags) which are not encoded by the major histocompatibility complex in the immunopathogenesis of allograft rejection. Although, improved surgical techniques coupled with improved methods to detect and avoid sensitization against donor human leukocyte antigen (HLA) have improved the immediate and short term function of transplanted organs. However, acute and chronic rejection still remains a vexing problem for the long term function of the transplanted organ. Immediately following organ transplantation, several factors both immune and non immune mechanisms lead to the development of local inflammatory milieu which sets the stage for allograft rejection. Traditionally, development of antibodies (Abs) against mismatched donor HLA have been implicated in the development of Ab mediated rejection. However, recent studies from our laboratory and others have demonstrated that development of humoral and cellular immune responses against non-HLA self-Ags may contribute in the pathogenesis of allograft rejection. There are reports demonstrating that immune responses to self-Ags especially Abs to the self-Ags as well as cellular immune responses especially through IL17 has significant pro-fibrotic properties leading to chronic allograft failure. This review summarizes recent studies demonstrating the role for immune responses to self-Ags in allograft immunity leading to rejection as well as present recent evidence suggesting there is interplay between allo- and autoimmunity leading to allograft dysfunction. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  19. Cloning changes the response to obesity of innate immune factors in blood, liver, and adipose tissues in domestic pigs. (United States)

    Rødgaard, Tina; Skovgaard, Kerstin; Stagsted, Jan; Heegaard, Peter M H


    The objective of this study was to evaluate the usefulness of cloned pigs as porcine obesity models reflecting obesity-associated changes in innate immune factor gene expression profiles. Liver and adipose tissue expression of 43 innate immune genes as well as serum concentrations of six immune factors were analyzed in lean and diet-induced obese cloned domestic pigs and compared to normal domestic pigs (obese and lean). The number of genes affected by obesity was lower in cloned animals than in control animals. All genes affected by obesity in adipose tissues of clones were downregulated; both upregulation and downregulation were observed in the controls. Cloning resulted in a less differentiated adipose tissue expression pattern. Finally, the serum concentrations of two acute-phase proteins (APPs), haptoglobin (HP) and orosomucoid (ORM), were increased in obese clones as compared to obese controls as well as lean clones and controls. Generally, the variation in phenotype between individual pigs was not reduced in cloned siblings as compared to normal siblings. Therefore, we conclude that cloning limits both the number of genes responding to obesity as well as the degree of tissue-differentiated gene expression, concomitantly with an increase in APP serum concentrations only seen in cloned, obese pigs. This may suggest that the APP response seen in obese, cloned pigs is a consequence of the characteristic skewed gene response to obesity in cloned pigs, as described in this work. This should be taken into consideration when using cloned animals as models for innate responses to obesity.

  20. Study of the integrated immune response induced by an inactivated EV71 vaccine.

    Directory of Open Access Journals (Sweden)

    Longding Liu

    Full Text Available Enterovirus 71 (EV71, a major causative agent of hand-foot-and-mouth disease (HFMD, causes outbreaks among children in the Asia-Pacific region. A vaccine is urgently needed. Based on successful pre-clinical work, phase I and II clinical trials of an inactivated EV71 vaccine, which included the participants of 288 and 660 respectively, have been conducted. In the present study, the immune response and the correlated modulation of gene expression in the peripheral blood mononuclear cells (PBMCs of 30 infants (6 to 11 months immunized with this vaccine or placebo and consented to join this study in the phase II clinical trial were analyzed. The results showed significantly greater neutralizing antibody and specific T cell responses in vaccine group after two inoculations on days 0 and 28. Additionally, more than 600 functional genes that were up- or down-regulated in PBMCs were identified by the microarray assay, and these genes included 68 genes associated with the immune response in vaccine group. These results emphasize the gene expression profile of the immune system in response to an inactivated EV71 vaccine in humans and confirmed that such an immune response was generated as the result of the positive mobilization of the immune system. Furthermore, the immune response was not accompanied by the development of a remarkable inflammatory response.NCT01391494 and NCT01512706.

  1. Localized Sympathectomy Reduces Mechanical Hypersensitivity by Restoring Normal Immune Homeostasis in Rat Models of Inflammatory Pain. (United States)

    Xie, Wenrui; Chen, Sisi; Strong, Judith A; Li, Ai-Ling; Lewkowich, Ian P; Zhang, Jun-Ming


    Some forms of chronic pain are maintained or enhanced by activity in the sympathetic nervous system (SNS), but attempts to model this have yielded conflicting findings. The SNS has both pro- and anti-inflammatory effects on immunity, confounding the interpretation of experiments using global sympathectomy methods. We performed a "microsympathectomy" by cutting the ipsilateral gray rami where they entered the spinal nerves near the L4 and L5 DRG. This led to profound sustained reductions in pain behaviors induced by local DRG inflammation (a rat model of low back pain) and by a peripheral paw inflammation model. Effects of microsympathectomy were evident within one day, making it unlikely that blocking sympathetic sprouting in the local DRGs or hindpaw was the sole mechanism. Prior microsympathectomy greatly reduced hyperexcitability of sensory neurons induced by local DRG inflammation observed 4 d later. Microsympathectomy reduced local inflammation and macrophage density in the affected tissues (as indicated by paw swelling and histochemical staining). Cytokine profiling in locally inflamed DRG showed increases in pro-inflammatory Type 1 cytokines and decreases in the Type 2 cytokines present at baseline, changes that were mitigated by microsympathectomy. Microsympathectomy was also effective in reducing established pain behaviors in the local DRG inflammation model. We conclude that the effect of sympathetic fibers in the L4/L5 gray rami in these models is pro-inflammatory. This raises the possibility that therapeutic interventions targeting gray rami might be useful in some chronic inflammatory pain conditions. Sympathetic blockade is used for many pain conditions, but preclinical studies show both pro- and anti-nociceptive effects. The sympathetic nervous system also has both pro- and anti-inflammatory effects on immune tissues and cells. We examined effects of a very localized sympathectomy. By cutting the gray rami to the spinal nerves near the lumbar sensory

  2. Systems Biology of Immune Response to Live and Inactivated Dengue Virus Vaccines (United States)


    AWARD NUMBER: W81XWH-16-2-0032 TITLE: Systems Biology of Immune Response to Live and Inactivated Dengue Virus Vaccines PRINCIPAL INVESTIGATOR...CONTRACT NUMBER Systems Biology of Immune Response to Live and Inactivated Dengue Virus Vaccines 5b. GRANT NUMBER W81XWH-16-2-0032 5c. PROGRAM ELEMENT...cell) responses will be measured using molecular and cellular approaches and the data analyzed using a systems biology approach. During the first

  3. Systems Biology of the Immune Response to Live and Inactivated Dengue Virus Vaccines (United States)


    AWARD NUMBER: W81XWH-16-2-0031 TITLE: Systems Biology of the Immune Response to Live and Inactivated Dengue Virus Vaccines PRINCIPAL...SUBTITLE 5a. CONTRACT NUMBER Systems Biology of the Immune Response to Live and Inactivated Dengue Virus Vaccines 5b. GRANT NUMBER W81XWH-16-2-0031 5c...adaptive (T and B cell) responses will be measured using molecular and cellular approaches and the data analyzed using a systems biology approach

  4. The rate of immune escape vanishes when multiple immune responses control an HIV infection

    NARCIS (Netherlands)

    van Deutekom, Hanneke W. M.; Wijnker, Gilles; de Boer, Rob J.


    During the first months of HIV infection, the virus typically evolves several immune escape mutations. These mutations are found in epitopes in viral proteins and reduce the impact of the CD8⁺ T cells specific for these epitopes. Recent data show that only a subset of the epitopes escapes, that most

  5. Two different mechanisms of immune-complex trapping in the mouse spleen during immune responses

    NARCIS (Netherlands)

    Yoshida, K.; van den Berg, T. K.; Dijkstra, C. D.


    The capacity of immune-complex (IC) trapping was examined using purified horse radish peroxidase (HRP)-anti-HRP (PAP) on frozen sections of mouse spleen in vitro. We investigated the trapping mechanisms by applying the IC with or without fresh mouse serum added on the spleen sections of naive as

  6. Enhancement of mucosal immune responses by chimeric influenza HA/SHIV virus-like particles

    International Nuclear Information System (INIS)

    Guo Lizheng; Lu Xiaoyan; Kang, S.-M.; Chen Changyi; Compans, Richard W.; Yao Qizhi


    To enhance mucosal immune responses using simian/human immunodeficiency virus-like particles (SHIV VLPs), we have produced novel phenotypically mixed chimeric influenza HA/SHIV VLPs and used them to immunize C57BL/6J mice intranasally. Antibody and cytotoxic T-cell (CTL) responses as well as cytokine production in both systemic and mucosal sites were compared after immunization with SHIV VLPs or chimeric HA/SHIV VLPs. By using enzyme-linked immunosorbent assay (ELISA), the levels of serum IgG and mucosal IgA to the HIV envelope protein (Env) were found to be highest in the group immunized with chimeric HA/SHIV VLPs. Furthermore, the highest titer of serum neutralizing antibody against HIV Env was found with the group immunized with chimeric HA/SHIV VLPs. Analysis of the IgG1/IgG2a ratio indicated that a T H 1-oriented immune response resulted from these VLP immunizations. HA/SHIV VLP-immunized mice also showed significantly higher CTL responses than those observed in SHIV VLP-immunized mice. Moreover, a MHC class I restricted T-cell activation ELISPOT assay showed a mixed type of T H 1/T H 2 cytokines in the HA/SHIV VLP-immunized mice, indicating that the chimeric VLPs can enhance both humoral and cellular immune responses to the HIV Env protein at multiple mucosal and systemic sites. The results indicate that incorporation of influenza HA into heterotypic VLPs may be highly effective for targeting vaccines to mucosal surfaces

  7. Effects of hypoxia on dopamine concentration and the immune response of White Shrimp ( Litopenaeus vannamei) (United States)

    Hu, Fawen; Pan, Luqing; Jing, Futao


    Effects of hypoxia on the dopamine concentration and the immune response of White Shrimp Litopenaeus vannamei were studied. The results showed that hypoxia had significant effects on the concentration of dopamine (DA) in the haemolymph, haemocyte count, phenoloxidase activity, phagocytic activity of haemocytes and bacteriolytic and antibacterial activity in the haemolymph ( P<0.05). The concentration of the dopamine in haemolymph reached its maximum in the 3.0 and 1.5 mg L-1 DO groups at 12 h and 6 h, and then returned to normal after 24 h and 12 h, respectively. All immune parameters decreased with the reduction of dissolved oxygen. Total haemocyte count (THC), the hyaline cells and semi-granular cells in the 3.0 mg L-1 DO group became stable after 12 h, while granular cells did so after 24 h. The THC and different haemocyte count (DHC) in the 1.5 mg L-1 DO group became stable after 24 h. Phenoloxidase activity and bacteriolytic activity in the 3.0 and 1.5 mg L-1 DO groups reached their stable levels after 24 h and 12 h respectively, while phagocytic activity and antibacterial activity became stable after 24 and 12, and 36 and 24 h, respectively. It was also indicated that the changes of dopamine concentrations in haemolymph, haemocyte count and phenoloxidase activity were obviously related to the exposure time under hypoxic conditions.

  8. Anopheles gambiae antiviral immune response to systemic O'nyong-nyong infection.

    Directory of Open Access Journals (Sweden)

    Joanna Waldock

    Full Text Available Mosquito-borne viral diseases cause significant burden in much of the developing world. Although host-virus interactions have been studied extensively in the vertebrate host, little is known about mosquito responses to viral infection. In contrast to mosquitoes of the Aedes and Culex genera, Anopheles gambiae, the principal vector of human malaria, naturally transmits very few arboviruses, the most important of which is O'nyong-nyong virus (ONNV. Here we have investigated the A. gambiae immune response to systemic ONNV infection using forward and reverse genetic approaches.We have used DNA microarrays to profile the transcriptional response of A. gambiae inoculated with ONNV and investigate the antiviral function of candidate genes through RNAi gene silencing assays. Our results demonstrate that A. gambiae responses to systemic viral infection involve genes covering all aspects of innate immunity including pathogen recognition, modulation of immune signalling, complement-mediated lysis/opsonisation and other immune effector mechanisms. Patterns of transcriptional regulation and co-infections of A. gambiae with ONNV and the rodent malaria parasite Plasmodium berghei suggest that hemolymph immune responses to viral infection are diverted away from melanisation. We show that four viral responsive genes encoding two putative recognition receptors, a galectin and an MD2-like receptor, and two effector lysozymes, function in limiting viral load.This study is the first step in elucidating the antiviral mechanisms of A. gambiae mosquitoes, and has revealed interesting differences between A. gambiae and other invertebrates. Our data suggest that mechanisms employed by A. gambiae are distinct from described invertebrate antiviral immunity to date, and involve the complement-like branch of the humoral immune response, supressing the melanisation response that is prominent in anti-parasitic immunity. The antiviral immune response in A. gambiae is thus

  9. Inflammatory cytokines in the brain: does the CNS shape immune responses? (United States)

    Owens, T; Renno, T; Taupin, V; Krakowski, M


    Immune responses in the central nervous system (CNS) have traditionally been regarded as representing the intrusion of an unruly, ill-behaved mob of leukocytes into the well-ordered and organized domain of thought and reason. However, results accumulated over the past few years suggest that, far from being an immunologically privileged organ, T lymphocytes may be regular and frequent visitors to the CNS, for purposes of immune surveillance. Here, Trevor Owens and colleagues propose that the brain itself can regulate or shape immune responses therein. Furthermore, given that the immune cells may be subverted to autoimmunity, they suggest that the study of inflammatory autoimmune disease in the brain may shed light on the ability of the local environment to regulate immune responses.

  10. Report 10. Cooperative immune responses of different generations of mice

    International Nuclear Information System (INIS)

    Savtsova, Z.D.; Kovbasyuk, S.A.; Yudina, O.Yu.; Zaritskaya, M.Yu.; Voejkova, I.M.; Orlovskij, A.A.; Indyk, V.M.; Serkiz, Ya.I.


    The immune status of mice has been assessed by the whole complex of data. The permanent action of low-level radiation has been shown to suppress considerably the rate of reactions of the delayed-type hypersensitivity and graft-versus host disease, as well as NK and specific cytolytic T-lymphocyte activity. The dynamics of accumulation and the levels of antibodies in the serum, lung and trachea extracts are virtually invariable. The resistance of experimental animals to influenza is lower than that of non-irradiated mice of the same line and age. The data obtained indicate that the immune disturbances revealed are connected not only with the alteration of lymphoid cell populations, but also with the alteration of the immune regulation mechanisms

  11. Prevalence of local immune response against oral infection in a Drosophila/Pseudomonas infection model.

    Directory of Open Access Journals (Sweden)

    Peter Liehl


    Full Text Available Pathogens have developed multiple strategies that allow them to exploit host resources and resist the immune response. To study how Drosophila flies deal with infectious diseases in a natural context, we investigated the interactions between Drosophila and a newly identified entomopathogen, Pseudomonas entomophila. Flies orally infected with P. entomophila rapidly succumb despite the induction of both local and systemic immune responses, indicating that this bacterium has developed specific strategies to escape the fly immune response. Using a combined genetic approach on both host and pathogen, we showed that P. entomophila virulence is multi-factorial with a clear differentiation between factors that trigger the immune response and those that promote pathogenicity. We demonstrate that AprA, an abundant secreted metalloprotease produced by P. entomophila, is an important virulence factor. Inactivation of aprA attenuated both the capacity to persist in the host and pathogenicity. Interestingly, aprA mutants were able to survive to wild-type levels in immune-deficient Relish flies, indicating that the protease plays an important role in protection against the Drosophila immune response. Our study also reveals that the major contribution to the fly defense against P. entomophila is provided by the local, rather than the systemic immune response. More precisely, our data points to an important role for the antimicrobial peptide Diptericin against orally infectious Gram-negative bacteria, emphasizing the critical role of local antimicrobial peptide expression against food-borne pathogens.

  12. Ebola Virus Altered Innate and Adaptive Immune Response Signalling Pathways: Implications for Novel Therapeutic Approaches. (United States)

    Kumar, Anoop


    Ebola virus (EBOV) arise attention for their impressive lethality by the poor immune response and high inflammatory reaction in the patients. It causes a severe hemorrhagic fever with case fatality rates of up to 90%. The mechanism underlying this lethal outcome is poorly understood. In 2014, a major outbreak of Ebola virus spread amongst several African countries, including Leone, Sierra, and Guinea. Although infections only occur frequently in Central Africa, but the virus has the potential to spread globally. Presently, there is no vaccine or treatment is available to counteract Ebola virus infections due to poor understanding of its interaction with the immune system. Accumulating evidence indicates that the virus actively alters both innate and adaptive immune responses and triggers harmful inflammatory responses. In the literature, some reports have shown that alteration of immune signaling pathways could be due to the ability of EBOV to interfere with dendritic cells (DCs), which link innate and adaptive immune responses. On the other hand, some reports have demonstrated that EBOV, VP35 proteins act as interferon antagonists. So, how the Ebola virus altered the innate and adaptive immune response signaling pathways is still an open question for the researcher to be explored. Thus, in this review, I try to summarize the mechanisms of the alteration of innate and adaptive immune response signaling pathways by Ebola virus which will be helpful for designing effective drugs or vaccines against this lethal infection. Further, potential targets, current treatment and novel therapeutic approaches have also been discussed.

  13. Chimeric plant virus particles administered nasally or orally induce systemic and mucosal immune responses in mice

    DEFF Research Database (Denmark)

    Brennan, F.R.; Bellaby, T.; Helliwell, S.M.


    The humoral immune responses to the D2 peptide of fibronectin-binding protein B (FnBP) of Staphylococcus aureus, expressed on the plant virus cowpea mosaic virus (CPMV), were evaluated after mucosal delivery to mice. Intranasal immunization of these chimeric virus particles (CVPs), either alone...

  14. The effect of environmental temperature on immune response and metabolism of the young chicken

    NARCIS (Netherlands)

    Henken, A.M.


    The effect of environmental temperature on immune response and metabolism was studied in young chickens. Immunization was performed by injecting intramuscularly 0.5 ml packed SRBC (sheep red blood cells) in both thighs of 32 days old pullets ( WarrenSSL ). The

  15. Energetic and developmental costs of mounting an immune response in greenfinches (Carduelis chloris)

    NARCIS (Netherlands)

    Amat, Juan A.; Aguilera, Eduardo; Visser, G. Henk

    It is assumed that there is a trade-off between the costs allocated to mounting an immune defence and those allocated to costly functions such as breeding and moulting. The physiological basis for this is that mounting an immune response to pathogen challenge has energetic and/or nutrient costs

  16. Indian Hedgehog Suppresses a Stromal Cell–Driven Intestinal Immune Response

    Directory of Open Access Journals (Sweden)

    B. Florien Westendorp


    Conclusions: We show that epithelium-derived Indian Hedgehog signals exclusively to fibroblasts in the intestine. Loss of Ihh leads to a rapid immune response with up-regulation of fibroblast-derived CXCL12, and migration of immune cells into the lamina propria.

  17. Sex-specific consequences of an induced immune response on reproduction in a moth

    NARCIS (Netherlands)

    Barthel, A.; Staudacher, H.; Schmalz, A.; Heckel, D.G.; Groot, A.T.


    Background Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life



    A.V. Surzhik


    This article presents review of data of influence of probiotic culture Lactobacillus rhamnosus GG on intestinal biocenosis. Main attention was given to influence of L. rhamnosus GG on functions of immune system.Key words: probiotics, Lactobacillus rhamnosus GG, immune response.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2009;8(2):54-58)

  19. Voluntary activation of the sympathetic nervous system and attenuation of the innate immune response in humans

    NARCIS (Netherlands)

    Kox, M.; Eijk, L.T.G.J. van; Zwaag, J.; Wildenberg, J. van den; Sweep, F.C.; Hoeven, J.G. van der; Pickkers, P.


    Excessive or persistent proinflammatory cytokine production plays a central role in autoimmune diseases. Acute activation of the sympathetic nervous system attenuates the innate immune response. However, both the autonomic nervous system and innate immune system are regarded as systems that cannot

  20. Bovine immune response to inoculation with Neospora caninum surface antigen SRS2 lipopeptides mimics immune response to infection with live parasites. (United States)

    Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor


    Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.

  1. Immune responses to hair dyes containing toluene-2,5-diamine

    DEFF Research Database (Denmark)

    Schmidt, J D; Johansen, J D; Nielsen, M M


    BACKGROUND: Toluene-2,5-diamine (PTD) is the most frequently used dye in oxidative hair dyes on the Scandinavian market. However, little is known about immune responses to PTD-containing oxidative hair dyes. OBJECTIVES: To study immune responses induced by PTD-containing hair dyes in mice. METHODS......: Immune responses against two different permanent hair dye products containing 1·60% (w/w) and 0·48% (w/w) PTD within the colour gel, and various concentrations of pure PTD were studied. The local inflammatory response was measured by ear swelling and cell infiltration, and T- and B-cell infiltration...... and proliferation was determined in the draining lymph nodes. RESULTS: Concentration-dependent immune responses were seen to PTD both in the skin and draining lymph nodes. The hair dye containing 1·60% PTD induced strong local inflammation and caused T- and B-cell infiltration and proliferation as well...

  2. Mycobacterium tuberculosis co-operonic PE32/PPE65 proteins alter host immune responses by hampering Th1 response

    Directory of Open Access Journals (Sweden)

    Mohd eKhubaib


    Full Text Available PE/PPE genes, present in cluster with ESAT-6 like genes, are suspected to have a role in antigenic variation and virulence of Mycobacterium tuberculosis. Their roles in immune evasion and immune modulation of host are also well documented. We present evidence that PE32/PPE65 present within the RD8 region are co-operonic, co-transcribed and co-translated, and play role in modulating host immune responses. Experiments with macrophage cell lines revealed that this protein complex suppresses pro-inflammatory cytokines such as TNF-α and IL-6 whereas also inducing high expression of anti-inflammatory IL-10. Immunization of mice with these recombinant proteins dampens an effective Th1 response as evident from reduced frequency of IFN-g and IL-2 producing CD4+ and CD8+ T cells. IgG sub-typing from serum of immunized mice revealed high levels of IgG1 when compared with IgG2a and IgG2b. Further IgG1/IgG2a ratio clearly demonstrated that the protein complex manipulates the host immune response favourable to the pathogen. Our results demonstrate that the co-transcribed and co-translated PE32 and PPE65 antigens are involved specifically in modulating anti-mycobacterial host immune response by hampering Th1 response.

  3. Is the assumption of normality or log-normality for continuous response data critical for benchmark dose estimation?

    International Nuclear Information System (INIS)

    Shao, Kan; Gift, Jeffrey S.; Setzer, R. Woodrow


    Continuous responses (e.g. body weight) are widely used in risk assessment for determining the benchmark dose (BMD) which is used to derive a U.S. EPA reference dose. One critical question that is not often addressed in dose–response assessments is whether to model the continuous data as normally or log-normally distributed. Additionally, if lognormality is assumed, and only summarized response data (i.e., mean ± standard deviation) are available as is usual in the peer-reviewed literature, the BMD can only be approximated. In this study, using the “hybrid” method and relative deviation approach, we first evaluate six representative continuous dose–response datasets reporting individual animal responses to investigate the impact on BMD/BMDL estimates of (1) the distribution assumption and (2) the use of summarized versus individual animal data when a log-normal distribution is assumed. We also conduct simulation studies evaluating model fits to various known distributions to investigate whether the distribution assumption has influence on BMD/BMDL estimates. Our results indicate that BMDs estimated using the hybrid method are more sensitive to the distribution assumption than counterpart BMDs estimated using the relative deviation approach. The choice of distribution assumption has limited impact on the BMD/BMDL estimates when the within dose-group variance is small, while the lognormality assumption is a better choice for relative deviation method when data are more skewed because of its appropriateness in describing the relationship between mean and standard deviation. Additionally, the results suggest that the use of summarized data versus individual response data to characterize log-normal distributions has minimal impact on BMD estimates. - Highlights: • We investigate to what extent the distribution assumption can affect BMD estimates. • Both real data analysis and simulation study are conducted. • BMDs estimated using hybrid method are more

  4. Is the assumption of normality or log-normality for continuous response data critical for benchmark dose estimation?

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Kan, E-mail: [ORISE Postdoctoral Fellow, National Center for Environmental Assessment, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Gift, Jeffrey S. [National Center for Environmental Assessment, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Setzer, R. Woodrow [National Center for Computational Toxicology, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States)


    Continuous responses (e.g. body weight) are widely used in risk assessment for determining the benchmark dose (BMD) which is used to derive a U.S. EPA reference dose. One critical question that is not often addressed in dose–response assessments is whether to model the continuous data as normally or log-normally distributed. Additionally, if lognormality is assumed, and only summarized response data (i.e., mean ± standard deviation) are available as is usual in the peer-reviewed literature, the BMD can only be approximated. In this study, using the “hybrid” method and relative deviation approach, we first evaluate six representative continuous dose–response datasets reporting individual animal responses to investigate the impact on BMD/BMDL estimates of (1) the distribution assumption and (2) the use of summarized versus individual animal data when a log-normal distribution is assumed. We also conduct simulation studies evaluating model fits to various known distributions to investigate whether the distribution assumption has influence on BMD/BMDL estimates. Our results indicate that BMDs estimated using the hybrid method are more sensitive to the distribution assumption than counterpart BMDs estimated using the relative deviation approach. The choice of distribution assumption has limited impact on the BMD/BMDL estimates when the within dose-group variance is small, while the lognormality assumption is a better choice for relative deviation method when data are more skewed because of its appropriateness in describing the relationship between mean and standard deviation. Additionally, the results suggest that the use of summarized data versus individual response data to characterize log-normal distributions has minimal impact on BMD estimates. - Highlights: • We investigate to what extent the distribution assumption can affect BMD estimates. • Both real data analysis and simulation study are conducted. • BMDs estimated using hybrid method are more

  5. The development of a fully-integrated immune response model (FIRM) simulator of the immune response through integration of multiple subset models. (United States)

    Palsson, Sirus; Hickling, Timothy P; Bradshaw-Pierce, Erica L; Zager, Michael; Jooss, Karin; O'Brien, Peter J; Spilker, Mary E; Palsson, Bernhard O; Vicini, Paolo


    The complexity and multiscale nature of the mammalian immune response provides an excellent test bed for the potential of mathematical modeling and simulation to facilitate mechanistic understanding. Historically, mathematical models of the immune response focused on subsets of the immune system and/or specific aspects of the response. Mathematical models have been developed for the humoral side of the immune response, or for the cellular side, or for cytokine kinetics, but rarely have they been proposed to encompass the overall system complexity. We propose here a framework for integration of subset models, based on a system biology approach. A dynamic simulator, the Fully-integrated Immune Response Model (FIRM), was built in a stepwise fashion by integrating published subset models and adding novel features. The approach used to build the model includes the formulation of the network of interacting species and the subsequent introduction of rate laws to describe each biological process. The resulting model represents a multi-organ structure, comprised of the target organ where the immune response takes place, circulating blood, lymphoid T, and lymphoid B tissue. The cell types accounted for include macrophages, a few T-cell lineages (cytotoxic, regulatory, helper 1, and helper 2), and B-cell activation to plasma cells. Four different cytokines were accounted for: IFN-γ, IL-4, IL-10 and IL-12. In addition, generic inflammatory signals are used to represent the kinetics of IL-1, IL-2, and TGF-β. Cell recruitment, differentiation, replication, apoptosis and migration are described as appropriate for the different cell types. The model is a hybrid structure containing information from several mammalian species. The structure of the network was built to be physiologically and biochemically consistent. Rate laws for all the cellular fate processes, growth factor production rates and half-lives, together with antibody production rates and half-lives, are provided. The

  6. Empathy, normality and responsiveness among street-level bureaucrats

    DEFF Research Database (Denmark)

    Møller, Marie Østergaard; Nielsen, Vibeke Lehmann


    Within the public sector it is a permanent dilemma that we on one hand – on the grounds of effectiveness and flexibility – want employees to have discretion and autonomy, but at the same time want to make sure that citizens and clients of the public sector are treated equally and independent of w...... this paper discusses and analyzes how perceptions of local target group’s problem portfolio (normality perceptions) conditions the behavioral effects of personal attributes/personality traits (differences in empathy)....

  7. An immune response in the bumblebee, Bombus terrestris leads to increased food consumption

    Directory of Open Access Journals (Sweden)

    Mallon Eamonn B


    Full Text Available Abstract Background The concept of a costly immune system that must be traded off against other important physiological systems is fundamental to the burgeoning field of ecological immunity. Bumblebees have become one of the central models in this field. Although previous work has demonstrated costs of immunity in numerous life history traits, estimates of the more direct costs of bumblebee immunity have yet to be made. Results Here we show a 7.5% increase in energy consumption in response to non-pathogenic immune stimulation. Conclusion This increase in energy consumption along with other results suggests that immunity is one of the most important physiological systems, with other systems being sacrificed for its continuing efficiency. This increased consumption and maintained activity contrasts with the sickness-induced anorexia and reduced activity found in vertebrates.

  8. Inter-donor variation in cell subset specific immune signaling responses in healthy individuals. (United States)

    Longo, Diane M; Louie, Brent; Wang, Ena; Pos, Zoltan; Marincola, Francesco M; Hawtin, Rachael E; Cesano, Alessandra


    Single cell network profiling (SCNP) is a multi-parameter flow cytometry based approach that allows for the simultaneous interrogation of intracellular signaling pathways in multiple cell subpopulations within heterogeneous tissues, without the need for individual cell subset isolation. Thus, the technology is extremely well-suited for characterizing the multitude of interconnected signaling pathways and immune cell subpopulations that regulate the function of the immune system. Recently, SCNP was applied to generate a functional map of the healthy human immune cell signaling network by profiling immune signaling pathways downstream of 12 immunomodulators in 7 distinct immune cell subsets within peripheral blood mononuclear cells (PBMCs) from 60 healthy donors. In the study reported here, the degree of inter-donor variation in the magnitude of the immune signaling responses was analyzed. The highest inter-donor differences in immune signaling pathway activity occurred following perturbation of the immune signaling network, rather than in basal signaling. When examining the full panel of immune signaling responses, as one may expect, the overall degree of inter-donor variation was positively correlated (r = 0.727) with the magnitude of node response (i.e. a larger median signaling response was associated with greater inter-donor variation). However, when examining the degree of heterogeneity across cell subpopulations for individual signaling nodes, cell subset specificity in the degree of inter-donor variation was observed for several nodes. For such nodes, relatively weak correlations between inter-donor variation and the magnitude of the response were observed. Further, within the phenotypically distinct subpopulations, a fraction of the immune signaling responses had bimodal response profiles in which (a) only a portion of the cells had elevated phospho-protein levels following modulation and (b) the proportion of responsive cells varied by donor. These data

  9. The role of complement in the acquired immune response

    DEFF Research Database (Denmark)

    Nielsen, C H; Fischer, E M; Leslie, R G


    to specific T cells; the activation of a CD21/CD19 complex-mediated signalling pathway in B cells, which provides a stimulus synergistic to that induced by antigen interaction with the B-cell receptor (BCR); and promotion of the interaction between B cells and FDC, where C3d-bearing immune complexes...

  10. Vitamin E analogues and immune response in cancer treatment

    Czech Academy of Sciences Publication Activity Database

    Tomasetti, M.; Neužil, Jiří


    Roč. 76, - (2007), s. 463-491 ISSN 0083-6729 Institutional research plan: CEZ:AV0Z50520514; CEZ:AV0Z50520701 Keywords : vitamin E analogues * inducers of apoptosis * immune surveillance Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.889, year: 2007

  11. Pertussis vaccinations in Dutch children: memory immune responses

    NARCIS (Netherlands)

    Hendrikx, L.H.


    Despite high pertussis vaccination coverage, pertussis is reemerging in the Netherlands since 1996. In attempt to improve protection against whooping cough, two major changes in the national immunization program have been made; the introduction of a preschool booster vaccination in children 4 years

  12. Hepatitis B Virus Vaccine immune response in Egyptian children 15 ...

    African Journals Online (AJOL)

    Methods: Serum anti-HB surface antibody was measured in 225 healthy adolescents. Their ages ranged from 16-18 year with a definite history of receiving the primary immunization for HBV at infancy. A booster dose of the HB vaccine was given to 56 of the candidates in whom serum level of anti-HB surface antibody was ...

  13. An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response

    Directory of Open Access Journals (Sweden)

    Katherine M. Buckley


    Full Text Available The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17, are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism.

  14. DNA methylation patterns of genes related to immune response in the different clinical forms of oral lichen planus. (United States)

    Cruz, Aline Fernanda; de Resende, Renata Gonçalves; de Lacerda, Júlio César Tanos; Pereira, Núbia Braga; Melo, Leonardo Augusto; Diniz, Marina Gonçalves; Gomes, Carolina Cavalieri; Gomez, Ricardo Santiago


    The oral lichen planus is a chronic inflammatory disease. Although its aetiology is not well understood, the role of T lymphocytes in its inflammatory events is recognised. Identifying the epigenetic mechanisms involved in the pathogenesis of this immune-mediated condition is fundamental for understanding the inflammatory reaction that occurs in the disease. The purpose of this work was to evaluate the methylation pattern of 21 immune response-related genes in the different clinical forms of oral lichen planus. A cross-sectional study was performed to analyse the DNA methylation patterns in three distinct groups of oral lichen planus: (i) reticular/plaque lesions; (ii) erosive lesions; (iii) normal oral mucosa (control group). After DNA extraction from biopsies, the samples were submitted to digestions by methylation-sensitive and methylation-dependent enzymes and double digestion. The relative percentage of methylated DNA for each gene was provided using real-time polymerase chain reaction arrays. Hypermethylation of the STAT5A gene was observed only in the control group (59.0%). A higher hypermethylation of the ELANE gene was found in reticular/plaque lesions (72.1%) compared to the erosive lesions (50.0%). Our results show variations in the methylation profile of immune response-related genes, according to the clinical type of oral lichen planus after comparing with the normal oral mucosa. Further studies are necessary to validate these findings using gene expression analysis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Mouse genetic approaches applied to the normal tissue radiation response

    International Nuclear Information System (INIS)

    Haston, Christina K.


    The varying responses of inbred mouse models to radiation exposure present a unique opportunity to dissect the genetic basis of radiation sensitivity and tissue injury. Such studies are complementary to human association studies as they permit both the analysis of clinical features of disease, and of specific variants associated with its presentation, in a controlled environment. Herein I review how animal models are studied to identify specific genetic variants influencing predisposition to radiation-induced traits. Among these radiation-induced responses are documented strain differences in repair of DNA damage and in extent of tissue injury (in the lung, skin, and intestine) which form the base for genetic investigations. For example, radiation-induced DNA damage is consistently greater in tissues from BALB/cJ mice, than the levels in C57BL/6J mice, suggesting there may be an inherent DNA damage level per strain. Regarding tissue injury, strain specific inflammatory and fibrotic phenotypes have been documented for principally, C57BL/6 C3H and A/J mice but a correlation among responses such that knowledge of the radiation injury in one tissue informs of the response in another is not evident. Strategies to identify genetic differences contributing to a trait based on inbred strain differences, which include linkage analysis and the evaluation of recombinant congenic (RC) strains, are presented, with a focus on the lung response to irradiation which is the only radiation-induced tissue injury mapped to date. Such approaches are needed to reveal genetic differences in susceptibility to radiation injury, and also to provide a context for the effects of specific genetic variation uncovered in anticipated clinical association studies. In summary, mouse models can be studied to uncover heritable variation predisposing to specific radiation responses, and such variations may point to pathways of importance to phenotype development in the clinic.

  16. Study of the immune response to thyroglobulin through a model of experimental autoimmune thyroiditis

    International Nuclear Information System (INIS)

    Santos Castro, M. dos.


    The cellular and humoral immune response to thyroglobulin of different species was studied in guinea pigs. The experiments described suggested that the immune system can be activated against self-determinants. Human and pork thyroglobulin were able to induce the experimental thyroiditis as well as some immune responses, such as in vitro proliferative response, delayed hypersensitivity and antibodies. Although guinea pig thyroglobulin was unable to induce specific T-lymphocyte proliferation in vitro, delayed hypersensitivity response and antibodies, it was very efficient in inducing the autoimmune thyroiditis. On the contrary, bovine thyroglobulin did not induce experimental autoimmune thyroiditis despite producing good responses as determined by similar in vitro proliferative response, delayed hypersensitivity and on the humoral level. These results suggest that the assays utilised were not able to evaluate the relevant immune response to genesis of the thyroiditis. The determinant selection mechanisms operating in these immune responses are probably selecting determinants not responsible for self-recognition in vivo. It was suggested that the macrophage could be the cell responsible for the presentation of these determinants to the lymphocyte in an immunogenic form. (Author) [pt

  17. Increased innate and adaptive immune responses in induced sputum of young smokers

    Directory of Open Access Journals (Sweden)

    Agnese Kislina


    Conclusions: This study demonstrates that young smokers have early inflammatory changes in their airways that not only initiate nonspecific mechanisms recruiting neutrophils, but also involve specific immune mechanisms with recruitment of T regulatory lymphocytes. The lymphocyte response is probably adaptive.

  18. Asymmetric mesoporous silica nanoparticles as potent and safe immunoadjuvants provoke high immune responses. (United States)

    Abbaraju, Prasanna Lakshmi; Jambhrunkar, Manasi; Yang, Yannan; Liu, Yang; Lu, Yao; Yu, Chengzhong


    Asymmetric mesoporous silica nanoparticles with a head-tail structure are potent immunoadjuvants for delivering a peptide antigen, generating a higher antibody immune response in mice compared to their symmetric counterparts.

  19. Lung Transcriptome Data from Chickens with Newcastle Disease Virus--Impact of Gender Immune Response (United States)

    US Agency for International Development — To determine the gender impact on the immune response of chickens, the mRNA was isolated and sequenced from the lungs of 48 chickens of 2 lines as three time-points...

  20. Behavioral Fever Drives Epigenetic Modulation of the Immune Response in Fish. (United States)

    Boltana, Sebastian; Aguilar, Andrea; Sanhueza, Nataly; Donoso, Andrea; Mercado, Luis; Imarai, Monica; Mackenzie, Simon


    Ectotherms choose the best thermal conditions to mount a successful immune response, a phenomenon known as behavioral fever. The cumulative evidence suggests that behavioral fever impacts positively upon lymphocyte proliferation, inflammatory cytokine expression, and other immune functions. In this study, we have explored how thermal choice during infection impacts upon underpinning molecular processes and how temperature increase is coupled to the immune response. Our results show that behavioral fever results in a widespread, plastic imprint on gene regulation, and lymphocyte proliferation. We further explored the possible contribution of histone modification and identified global associations between temperature and histone changes that suggest epigenetic remodeling as a result of behavioral fever. Together, these results highlight the critical importance of thermal choice in mobile ectotherms, particularly in response to an infection, and demonstrate the key role of epigenetic modification to orchestrate the thermocoupling of the immune response during behavioral fever.

  1. Recent activation of the plaque immune response in coronary lesions underlying acute coronary syndromes

    NARCIS (Netherlands)

    van der Wal, A. C.; Piek, J. J.; de Boer, O. J.; Koch, K. T.; Teeling, P.; van der Loos, C. M.; Becker, A. E.


    OBJECTIVE: To discriminate between chronic inflammation and acute activation of the plaque immune response in culprit lesions of patients with acute coronary syndromes. DESIGN: Retrospective study. SETTING: Tertiary referral centre. SUBJECTS: 71 patients having coronary atherectomy were classified

  2. Effects of BRAF mutations and BRAF inhibition on immune responses to melanoma (United States)

    Ilieva, Kristina M.; Correa, Isabel; Josephs, Debra H.; Karagiannis, Panagiotis; Egbuniwe, Isioma U.; Cafferkey, Michiala J.; Spicer, James F.; Harries, Mark; Nestle, Frank O.; Lacy, Katie E.; Karagiannis, Sophia N.


    Malignant melanoma is associated with poor clinical prognosis; however, novel molecular and immune therapies are now improving patient outcomes. Almost 50% of melanomas harbor targetable activating mutations of BRAF which promote RAS-RAF-MEK-ERK pathway activation and melanoma proliferation. Recent evidence also indicates that melanomas bearing mutant BRAF may also have altered immune responses, suggesting additional avenues for treatment of this patient group. The small molecule inhibitors selective for mutant BRAF induce significant but short-lived clinical responses in a proportion of patients, but also lead to immune stimulatory bystander events, which then subside with the emergence of resistance to inhibition. Simultaneous BRAF and MEK inhibition, and especially combination of BRAF inhibitors with new immunotherapies such as checkpoint blockade antibodies, may further enhance immune activation, or counteract immunosuppressive signals. Pre-clinical evaluation and ongoing clinical trials should provide novel insights into the role of immunity in the therapy of BRAF-mutant melanoma. PMID:25385327

  3. Early Involvement of Immune/Inflammatory Response Genes in Retinal Degeneration in DBA/2J Mice

    Directory of Open Access Journals (Sweden)

    W. Fan


    Full Text Available Purpose The DBA/2J (D2 mouse carries mutations in two of its genes, Tyrp1 and Gpnmb. These alterations result in the development of an immune response in the iris, leading to iris atrophy and pigment dispersion. The development of elevated intraocular pressure (IOP in this model of glaucoma is considered to be a significant factor leading to the death of retinal ganglion cells (RGCs. Changes in gene expression in the retina have already been correlated with the appearance of elevated IOP in the D2 mouse. The purpose of the present study was to determine if any changes in gene expression occur prior to the development of IOP. Methods The IOP was measured monthly using a rebound tonometer in D2 and age-matched C57/BL6 (B6 mice (normal controls. D2 animals with normal IOP at 2 and 4 M were used. In addition, mice at the age of 6–7 M were included to look for any trends in gene expression that might develop during the progression of the disease. Separate RNA samples were prepared from each of three individual retinas for each age, and gene expression profiles were determined with the aid of mouse oligonucleotide arrays (Agilent. A subset of genes was examined with the aid of real-time PCR. Immunocytochemistry was used to visualize changes in the retina for some of the gene-products. Results Four hundred and thirteen oligonucleotide probes were differentially expressed in the retinas of 4 M versus 2 M old D2 mice. The most significantly up-regulated genes (181 were associated with immune responses including interferon signaling, the complement system and the antigen presentation pathway, whereas the down-regulated genes (232 were linked to pathways related to cell death and known neurological diseases/disorders. These particular changes were not revealed in the age-matched B6 mice. By 6 M, when IOP started to increase in many of the D2 mice, more robust changes of these same genes were observed. Changes in the levels of selected genes

  4. Early Involvement of Immune/Inflammatory Response Genes in Retinal Degeneration in DBA/2J Mice

    Directory of Open Access Journals (Sweden)

    W. Fan


    Full Text Available Purpose: The DBA/2J (D2 mouse carries mutations in two of its genes, Tyrp1 and Gpnmb. These alterations result in the development of an immune response in the iris, leading to iris atrophy and pigment dispersion. The development of elevated intraocular pressure (IOP in this model of glaucoma is considered to be a significant factor leading to the death of retinal ganglion cells (RGCs. Changes in gene expression in the retina have already been correlated with the appearance of elevated IOP in the D2 mouse. The purpose of the present study was to determine if any changes in gene expression occur prior to the development of IOP. Methods: The IOP was measured monthly using a rebound tonometer in D2 and age-matched C57/BL6 (B6 mice (normal controls. D2 animals with normal IOP at 2 and 4 M were used. In addition, mice at the age of 6–7 M were included to look for any trends in gene expression that might develop during the progression of the disease. Separate RNA samples were prepared from each of three individual retinas for each age, and gene expression profiles were determined with the aid of mouse oligonucleotide arrays (Agilent. A subset of genes was examined with the aid of real-time PCR. Immunocytochemistry was used to visualize changes in the retina for some of the gene-products. Results: Four hundred and thirteen oligonucleotide probes were differentially expressed in the retinas of 4 M versus 2 M old D2 mice. The most significantly up-regulated genes (181 were associated with immune responses including interferon signaling, the complement system and the antigen presentation pathway, whereas the down-regulated genes (232 were linked to pathways related to cell death and known neurological diseases/disorders. These particular changes were not revealed in the age-matched B6 mice. By 6 M, when IOP started to increase in many of the D2 mice, more robust changes of these same genes were observed. Changes in the levels of selected genes

  5. Babassu aqueous extract (BAE as an adjuvant for T helper (Th1-dependent immune responses in mice of a Th2 immune response-prone strain

    Directory of Open Access Journals (Sweden)

    Nascimento Flavia RF


    Full Text Available Abstract Background The aqueous extract of a Brazilian palm-tree fruit - the babassu - (BAE exerts a clear immunostimulative activity in vivo. In the present work, the possibility that BAE can promote Th1 immune responses in mice of a Th2 immune response-prone strain - the BALB/c was investigated. BAE itself, and preparations consisting of Leishmania amazonensis promastigote extract (LE, adsorbed or not to Al(OH3, and in the presence or not of BAE, were used as immunogens. LE and Al(OH3 have been shown to preferentially elicit Th2 immune responses. Results The addition of BAE to LE-containing immunogenic preparations, adsorbed or not to Al(OH3, clearly promoted the in vitro production of interferon γ (IFN-γ, a major Th1-dependent cytokine, and not of interleukin (IL-4 (a Th2-dependent cytokine, by LE-stimulated splenocytes of immunized BALB/c mice. It also promoted the in vivo formation of IgG2a anti-LE antibodies. However, immunization with LE by itself led to an increased production of IL-4 by LE-stimulated splenocytes, and this production, albeit not enhanced, was not reduced by the addition of BAE to the immunogen. On the other hand, the IL-4 production by LE-stimulated splenocytes was significantly lower in mice immunized with a preparation containing Al(OH3-adsorbed LE and BAE than in mice immunized with the control preparation of Al(OH3-adsorbed LE without BAE. Moreover, an increased production of IFN-γ, and not of IL-4, was observed in the culture supernatants of splenocytes, from BAE-immunized mice, which were in vitro stimulated with BAE or which received no specific in vitro stimulus. No differences in IL-10 (an immunoregulatory cytokine levels in the supernatants of splenocytes from mice that were injected with BAE, in relation to splenocytes from control mice, were observed. The spontaneous ex vivo production of NO by splenocytes of mice that had been injected with BAE was significantly higher than the production of NO by

  6. Proteomic Mapping of the Immune Response to Gluten in Children with Autism (United States)


    AWARD NUMBER: W81XWH-14-1-0293 TITLE: Proteomic Mapping of the Immune Response to Gluten in Children with Autism PRINCIPAL INVESTIGATOR...Sep 2014 – 29 Sep 2015 4. TITLE AND SUBTITLE Proteomic Mapping of the Immune Response to Gluten in Children with Autism 5a. CONTRACT NUMBER 5b. GRANT...gastrointestinal (GI) symptoms and defects in GI function in the context of autism . Our newly published data indicate that children with autism exhibit

  7. Impact of Enterobius vermicularis infection and mebendazole treatment on intestinal microbiota and host immune response


    Yang, Chin-An; Liang, Chao; Lin, Chia-Li; Hsiao, Chiung-Tzu; Peng, Ching-Tien; Lin, Hung-Chih; Chang, Jan-Gowth


    Background Previous studies on the association of enterobiasis and chronic inflammatory diseases have revealed contradictory results. The interaction of Enterobius vermicularis infection in particular with gut microbiota and induced immune responses has never been thoroughly examined. Methodology/Findings In order to answer the question of whether exposure to pinworm and mebendazole can shift the intestinal microbial composition and immune responses, we recruited 109 (30 pinworm-negative, 79 ...

  8. Polysaccharides Isolated from Açaí Fruit Induce Innate Immune Responses


    Holderness, Jeff; Schepetkin, Igor A.; Freedman, Brett; Kirpotina, Liliya N.; Quinn, Mark T.; Hedges, Jodi F.; Jutila, Mark A.


    The Açaí (Acai) fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fr...

  9. Adenovirus Vector-Derived VA-RNA-Mediated Innate Immune Responses

    Directory of Open Access Journals (Sweden)

    Hiroyuki Mizuguchi


    Full Text Available The major limitation of the clinical use of replication-incompetent adenovirus (Ad vectors is the interference by innate immune responses, including induction of inflammatory cytokines and interferons (IFN, following in vivo application of Ad vectors. Ad vector-induced production of inflammatory cytokines and IFNs also results in severe organ damage and efficient induction of acquired immune responses against Ad proteins and transgene products. Ad vector-induced innate immune responses are triggered by the recognition of Ad components by pattern recognition receptors (PRRs. In order to reduce the side effects by Ad vector-induced innate immune responses and to develop safer Ad vectors, it is crucial to clarify which PRRs and which Ad components are involved in Ad vector-induced innate immune responses. Our group previously demonstrated that myeloid differentiating factor 88 (MyD88 and toll-like receptor 9 (TLR9 play crucial roles in the Ad vector-induced inflammatory cytokine production in mouse bone marrow-derived dendritic cells. Furthermore, our group recently found that virus associated-RNAs (VA-RNAs, which are about 160 nucleotide-long non-coding small RNAs encoded in the Ad genome, are involved in IFN production through the IFN-β promoter stimulator-1 (IPS-1-mediated signaling pathway following Ad vector transduction. The aim of this review is to highlight the Ad vector-induced innate immune responses following transduction, especially VA-RNA-mediated innate immune responses. Our findings on the mechanism of Ad vector-induced innate immune responses should make an important contribution to the development of safer Ad vectors, such as an Ad vector lacking expression of VA-RNAs.

  10. Influence of Immune Responses in Gene/Stem Cell Therapies for Muscular Dystrophies

    Directory of Open Access Journals (Sweden)

    Andrea Farini


    Full Text Available Muscular dystrophies (MDs are a heterogeneous group of diseases, caused by mutations in different components of sarcolemma, extracellular matrix, or enzymes. Inflammation and innate or adaptive immune response activation are prominent features of MDs. Various therapies under development are directed toward rescuing the dystrophic muscle damage using gene transfer or cell therapy. Here we discussed current knowledge about involvement of immune system responses to experimental therapies in MDs.

  11. Effect of L-arginine supplementation on immune responsiveness in patients with sickle cell disease. (United States)

    Scavella, Arnette; Leiva, Lily; Monjure, Hanh; Zea, Arnold H; Gardner, Renee V


    L-arginine (L-Arg) is deficient in sickle cell disease (SSD) during vasoocclusion. We investigated possible causal relationship between L-Arg deficiency and immune dysfunction in SSD in steady-state. Fifteen patients with SSD in steady-state and 13 controls were studied. Plasma L-Arg levels were measured using liquid chromatography. T cell subsets and CD3zeta (CD3zeta) chain expression were analyzed using flow cytometry. Lymphocyte proliferative response to phytohemagglutinin (PHA) and production of IL-6 and interferon-gamma (IFN-gamma) were evaluated with and without L-Arg. SSD patients had significantly lower L-Arg levels than controls. CD3 and CD19 cell populations were comparable for both groups, but SSD patients had above normal numbers of natural killer cells (P = 0.06). Patients and controls exhibited significantly increased lymphocyte blastogenesis to PHA after introduction of L-Arg to cultures; response of patients was significantly greater than values for control individuals. Proliferative response to candida in SSD patients was significantly lower than in controls; L-Arg supplementation did not increase this response. L-Arg had no effect on blastogenic response to PPD and candida albicans. No effect was likewise seen in production of IL-6 and IFN-gamma after addition of L-Arg. CD3zeta chain expression increased after addition of L-Arg in both groups; differences were insignificant. L-Arg levels in steady-state SSD are significantly lower than in controls. L-Arg supplementation enhanced lymphocyte blastogenesis to PHA for both controls and patients, but not in response to antigen. There were no significant differences in CD3zeta chain expression although upregulation of expression occurred after L-Arg supplementation for both groups. (c) 2010 Wiley-Liss, Inc.

  12. Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection. (United States)

    Zhang, Jie; Liu, Huan; Wei, Bin

    Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.

  13. Natural functional SNPs in miR-155 alter its expression level, blood cell counts and immune responses

    Directory of Open Access Journals (Sweden)

    Congcong Li


    Full Text Available miR-155 has been confirmed to be a key factor in immune responses in humans and other mammals. Therefore, investigation of variations in miR-155 could be useful for understanding the differences in immunity between individuals. In this study, four SNPs in miR-155 were identified in mice (Mus musculus and humans (Homo sapiens. In mice, the four SNPs were closely linked and formed two miR-155 haplotypes (A and B. Ten distinct types of blood parameters were associated with miR-155 expression under normal conditions. Additionally, 4 and 14 blood parameters were significantly different between these two genotypes under normal and lipopolysaccharide (LPS stimulation conditions, respectively. Moreover, the expression levels of miR-155, the inflammatory response to LPS stimulation and the lethal ratio following Salmonella typhimurium infection were significantly increased in mice harboring the AA genotype. Further, two SNPs, one in the loop region and the other near the 3' terminal of pre-miR-155, were confirmed to be responsible for the differential expression of miR-155 in mice. Interestingly, two additional SNPs, one in the loop region and the other in the middle of miR-155*, modulated the function of miR-155 in humans. Predictions of secondary RNA structure using RNAfold showed that these SNPs affected the structure of miR-155 in both mice and humans. Our results provide novel evidence of the natural functional SNPs of miR-155 in both mice and humans, which may affect the expression levels of mature miR-155 by modulating its secondary structure. The SNPs of human miR-155 may be considered as causal mutations for some immune-related diseases in the clinic. The two genotypes of mice could be used as natural models for studying the mechanisms of immune diseases caused by abnormal expression of miR-155 in humans.

  14. Oral antibiotics enhance antibody responses to keyhole limpet hemocyanin in orally but not muscularly immunized chickens. (United States)

    Murai, Atsushi; Kitahara, Kazuki; Okumura, Shouta; Kobayashi, Misato; Horio, Fumihiko


    Recent studies have emphasized the crucial role of gut microbiota in triggering and modulating immune response. We aimed to determine whether the modification of gut microbiota by oral co-administration of two antibiotics, ampicillin and neomycin, would lead to changes in the antibody response to antigens in chickens. Neonatal chickens were given or not given ampicillin and neomycin (0.25 and 0.5 g/L, respectively) in drinking water. At 2 weeks of age, the chicks were muscularly or orally immunized with antigenic keyhole limpet hemocyanin (KLH), and then serum anti-KLH antibody levels were examined by ELISA. In orally immunized chicks, oral antibiotics treatment enhanced antibody responses (IgM, IgA, IgY) by 2-3-fold compared with the antibiotics-free control, while the antibiotics did not enhance antibody responses in the muscularly immunized chicks. Concomitant with their enhancement of antibody responses, the oral antibiotics also lowered the Lactobacillus species in feces. Low doses of antibiotics (10-fold and 100-fold lower than the initial trial), which failed to change the fecal Lactobacillus population, did not modify any antibody responses when chicks were orally immunized with KLH. In conclusion, oral antibiotics treatment enhanced the antibody response to orally exposed antigens in chickens. This enhancement of antibody response was associated with a modification of the fecal Lactobacillus content, suggesting a possible link between gut microbiota and antibody response in chickens. © 2015 Japanese Society of Animal Science.

  15. Mechanisms Underlying the Immune Response Generated by an Oral Vibrio cholerae Vaccine

    Directory of Open Access Journals (Sweden)

    Danylo Sirskyj


    Full Text Available Mechanistic details underlying the resulting protective immune response generated by mucosal vaccines remain largely unknown. We investigated the involvement of Toll-like receptor signaling in the induction of humoral immune responses following oral immunization with Dukoral, comparing wild type mice with TLR-2-, TLR-4-, MyD88- and Trif-deficient mice. Although all groups generated similar levels of IgG antibodies, the proliferation of CD4+ T-cells in response to V. cholerae was shown to be mediated via MyD88/TLR signaling, and independently of Trif signaling. The results demonstrate differential requirements for generation of immune responses. These results also suggest that TLR pathways may be modulators of the quality of immune response elicited by the Dukoral vaccine. Determining the critical signaling pathways involved in the induction of immune response to this vaccine would be beneficial, and could contribute to more precisely-designed versions of other oral vaccines in the future.

  16. Induction of complex immune responses and strong protection against retrovirus challenge by adenovirus-based immunization depends on the order of vaccine delivery. (United States)

    Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke


    In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.

  17. Exosomes and Immune Response in Cancer: Friends or Foes? (United States)

    Barros, Francisco M; Carneiro, Fatima; Machado, Jose C; Melo, Sónia A


    Exosomes are a type of extracellular vesicle whose study has grown exponentially in recent years. This led to the understanding that these structures, far from being inert waste by-products of cellular functioning, are active players in intercellular communication mechanisms, including in the interactions between cancer cells and the immune system. The deep comprehension of the crosstalk between tumors and the immune systems of their hosts has gained more and more importance, as immunotherapeutic techniques have emerged as viable options for several types of cancer. In this review, we present a comprehensive, updated, and elucidative review of the current knowledge on the functions played by the exosomes in this crosstalk. The roles of these vesicles in tumor antigen presentation, immune activation, and immunosuppression are approached as the relevant interactions between exosomes and the complement system. The last section of this review is reserved for the exploration of the results from the first phase I to II clinical trials of exosomes-based cell-free cancer vaccines.

  18. Differential and site specific impact of B cells in the protective immune response to Mycobacterium tuberculosis in the mouse.

    Directory of Open Access Journals (Sweden)

    Egídio Torrado

    Full Text Available Cell-mediated immune responses are known to be critical for control of mycobacterial infections whereas the role of B cells and humoral immunity is unclear. B cells can modulate immune responses by secretion of immunoglobulin, production of cytokines and antigen-presentation. To define the impact of B cells in the absence of secreted immunoglobulin, we analyzed the progression of Mycobacterium tuberculosis (Mtb infection in mice that have B cells but which lack secretory immunoglobulin (AID(-/-µS(-/-mice. AID(-/-µS(-/- mice accumulated a population of activated B cells in the lungs when infected and were more susceptible to aerosol Mtb when compared to wild type (C57BL/6 mice or indeed mice that totally lack B cells. The enhanced susceptibility of AID(-/-µS(-/- mice was not associated with defective T cell activation or expression of a type 1 immune response. While delivery of normal serum to AID(-/-µS(-/- mice did not reverse susceptibility, susceptibility in the spleen was dependent upon the presence of B cells and susceptibility in the lungs of AID(-/-µS(-/-mice was associated with elevated expression of the cytokines IL-6, GM-CSF, IL-10 and molecules made by alternatively activated macrophages. Blocking of IL-10 signaling resulted in reversal of susceptibility in the spleens and lungs of AID(-/-µS(-/- mice. These data support the hypothesis that B cells can modulate immunity to Mtb in an organ specific manner via the modulation of cytokine production and macrophage activation.

  19. Host control of malaria infections: constraints on immune and erythropoeitic response kinetics.

    Directory of Open Access Journals (Sweden)

    Philip G McQueen


    Full Text Available The two main agents of human malaria, Plasmodium vivax and Plasmodium falciparum, can induce severe anemia and provoke strong, complex immune reactions. Which dynamical behaviors of host immune and erythropoietic responses would foster control of infection, and which would lead to runaway parasitemia and/or severe anemia? To answer these questions, we developed differential equation models of interacting parasite and red blood cell (RBC populations modulated by host immune and erythropoietic responses. The model immune responses incorporate both a rapidly responding innate component and a slower-responding, long-term antibody component, with several parasite developmental stages considered as targets for each type of immune response. We found that simulated infections with the highest parasitemia tended to be those with ineffective innate immunity even if antibodies were present. We also compared infections with dyserythropoiesis (reduced RBC production during infection to those with compensatory erythropoiesis (boosted RBC production or a fixed basal RBC production rate. Dyserythropoiesis tended to reduce parasitemia slightly but at a cost to the host of aggravating anemia. On the other hand, compensatory erythropoiesis tended to reduce the severity of anemia but with enhanced parasitemia if the innate response was ineffective. For both parasite species, sharp transitions between the schizont and the merozoite stages of development (i.e., with standard deviation in intra-RBC development time immune response, though P. vivax attacks a much smaller subset of RBCs. Since most P. vivax infections are nonlethal (if debilitating clinically, this suggests that P

  20. Plasma metabolomic profiles and immune responses of piglets after weaning and challenge with E. coli

    DEFF Research Database (Denmark)

    Sugiharto, Sugiharto; Hedemann, Mette Skou; Lauridsen, Charlotte


    Background The processes of weaning and exposure to pathogenic bacteria induce stress responses, which may alter the metabolism. In this study, we investigated the changes in plasma metabolites and immune responses in piglets in response to the stress induced by weaning and Escherichia coli chall...

  1. Immune responses to mumps vaccine in adults who were vaccinated in childhood. (United States)

    Hanna-Wakim, Rima; Yasukawa, Linda L; Sung, Phillip; Arvin, Ann M; Gans, Hayley A


    In a mumps outbreak in the United States, many infected individuals were adults who had received 2 doses of mumps vaccine. The persistence of cellular immunity to mumps vaccine has not been defined. This was an observational, nonrandomized cohort study evaluating cell-mediated and humoral immunity to mumps in 10 vaccinated and 10 naturally immune adults. Mumps-specific T cell activation and interferon (IFN)-gamma production were measured using lymphoproliferative and flow cytometry assays, and mumps immunoglobulin (Ig) G was measured using enzyme-linked immunosorbent assay. T cell immunity to mumps was high in both groups; 70% of vaccinated and 80% of naturally immune individuals had a positive (> or =3) stimulation index (SI) (P = 1.0). The mean percentages of mumps-specific CD4+ T cells that expressed CD69 and produced IFN-gamma were equivalent in the 2 groups: 0.06% and 0.12%, respectively (P = .11). The mean SIs in the groups were also equivalent, although IFN-gamma concentrations from cultures stimulated with mumps antigen were higher in naturally immune adults than in vaccinated adults (P < or = .01). All adults were positive for mumps IgG. T and B cell immunity to mumps was detected in adults at least 10 years after immunization. Except for IFN-gamma release, responses in vaccinated adults paralleled those observed in naturally immune individuals.

  2. Siblings Promote a Type 1/Type 17-oriented immune response in the airways of asymptomatic neonates. (United States)

    Wolsk, H M; Chawes, B L; Følsgaard, N V; Rasmussen, M A; Brix, S; Bisgaard, H


    Siblings have been shown to reduce the risk of childhood asthma and allergy, but the mechanism driving this association is unknown. The objective was to study whether siblings affect the airway immune response in healthy neonates, which could represent an underlying immune modulatory pathway. We measured 20 immune mediators related to the Type 1, Type 2, Type 17, or regulatory immune pathways in the airway mucosa of 571 one-month-old asymptomatic neonates from the Copenhagen Prospective Studies on Asthma in Childhood2010 birth cohort (COPSAC2010 ). The association between airway mediator levels and presence of siblings was investigated using conventional statistics and principle component analysis (PCA). Neonates with siblings had an upregulated level of airway immune mediators, with predominance of Type 1- and Type 17-related mediators. This was supported by the PCA showing a highly significant difference between children with vs without siblings: P Siblings mediate a Type 1/Type 17-related immune-stimulatory effect in the airways of asymptomatic neonates, also after adjustment for pathogenic bacteria and viruses, indicating that siblings exert a transferable early immune modulatory effect. These findings may represent an in utero immune priming effect of the fetal immune system caused by previous pregnancies as the effect was attenuated with time since last childbirth, or it could relate to the presence of unidentified microbes, but further studies are needed to confirm our findings. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Autonomous parvoviruses neither stimulate nor are inhibited by the type I interferon response in human normal or cancer cells. (United States)

    Paglino, Justin C; Andres, Wells; van den Pol, Anthony N


    Members of the genus Parvovirus are small, nonenveloped single-stranded DNA viruses that are nonpathogenic in humans but have potential utility as cancer therapeutics. Because the innate immune response to parvoviruses has received relatively little attention, we compared the response to parvoviruses to that of several other types of viruses in human cells. In normal human glia, fibroblasts, or melanocytes, vesicular stomatitis virus evoked robust beta interferon (IFN-β) responses. Cytomegalovirus, pseudorabies virus, and Sindbis virus all evoked a 2-log-unit or greater upregulation of IFN-β in glia; in contrast, LuIII and MVMp parvoviruses did not evoke a detectable IFN-β or interferon-stimulated gene (ISG; MX1, oligoadenylate synthetase [OAS], IFIT-1) response in the same cell types. The lack of response raised the question of whether parvoviral infection can be attenuated by IFN; interestingly, we found that IFN did not decrease parvovirus (MVMp, LuIII, and H-1) infectivity in normal human glia, fibroblasts, or melanocytes. The same was true in human cancers, including glioma, sarcoma, and melanoma. Similarly, IFN failed to attenuate transduction by the dependovirus vector adeno-associated virus type 2. Progeny production of parvoviruses was also unimpaired by IFN in both glioma and melanoma, whereas vesicular stomatitis virus replication was blocked. Sarcoma cells with upregulated IFN signaling that show high levels of resistance to other viruses showed strong infection by LuIII. Unlike many other oncolytic viruses, we found no evidence that impairment of innate immunity in cancer cells plays a role in the oncoselectivity of parvoviruses in human cells. Parvoviral resistance to the effects of IFN in cancer cells may constitute an advantage in the virotherapy of some tumors. Understanding the interactions between oncolytic viruses and the innate immune system will facilitate employing these viruses as therapeutic agents in cancer patients. The cancer

  4. 17D yellow fever vaccine elicits comparable long-term immune responses in healthy individuals and immune-compromised patients. (United States)

    Wieten, R W; Goorhuis, A; Jonker, E F F; de Bree, G J; de Visser, A W; van Genderen, P J J; Remmerswaal, E B M; Ten Berge, I J M; Visser, L G; Grobusch, M P; van Leeuwen, E M M


    The 17D live attenuated yellow fever (YF) vaccine is contra-indicated in immune-compromised individuals and may elicit a suboptimal immunologic response. The aim of this study is to assess whether long-term immune responses against the YF vaccine are impaired in immune-compromised patients. Fifteen patients using different immunosuppressive drugs and 30 healthy individuals vaccinated 0-22 years ago were included. The serological response was measured using the plaque reduction neutralization test (PRNT). CD8(+) and CD4(+) T-cell responses were measured following proliferation and re-stimulation with YFV peptide pools. Phenotypic characteristics and cytokine responses of CD8(+) T-cells were determined using class I tetramers. The geometric mean titre of neutralizing antibodies was not different between the groups (p = 0.77). The presence of YFV-specific CD4(+) and CD8(+) T-cell did not differ between patients and healthy individuals (15/15, 100.0% vs. 29/30, 96.7%, p = 0.475). Time since vaccination correlated negatively with the number of YFV-specific CD8(+) T-cells (r = -0.66, p = 0.0045). Percentages of early-differentiated memory cells increased (r = 0.67, p = 0.017) over time. These results imply that YF vaccination is effective despite certain immunosuppressive drug regimens. An early-differentiated memory-like phenotype persisted, which is associated with effective expansion upon re-encounter with antigen, suggesting a potent memory T-cell pool remains. Copyright © 2016 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  5. Leptin, immune responses and autoimmune disease. Perspectives on the use of leptin antagonists. (United States)

    Peelman, F; Iserentant, H; Eyckerman, S; Zabeau, L; Tavernier, J


    The pivotal role of leptin in regulating body weight and energy homeostasis is very well established. More recently, leptin also emerged as an important regulator of T-cell-dependent immunity. Reduced leptin levels, as observed during periods of starvation, correlate with an impaired cellular immune response, whereby especially the T(H)1 pro-inflammatory immune response appears to be affected. Physiologically, this could reflect the high energy demand of such processes, which are suppressed in animals or people with nutrient shortage. Several autoimmune diseases are T(H)1 T-cell dependent. In line with a pro-inflammatory role for leptin, animal models of leptin deficiency are markedly resistant to a variety of T-cell dependent autoimmune diseases. Here, we review the role of leptin in immune responses, with emphasis on autoimmune diseases. The design and potential use of leptin antagonists is also discussed.

  6. A Comparative Study of Peripheral Immune Responses to Taenia solium in Individuals with Parenchymal and Subarachnoid Neurocysticercosis.

    Directory of Open Access Journals (Sweden)

    Iskra Tuero


    Full Text Available The ability of Taenia solium to modulate the immune system likely contributes to their longevity in the human host. We tested the hypothesis that the nature of the immune response is related to the location of parasite and clinical manifestations of infection.Peripheral blood mononuclear cells (PBMC were obtained from untreated patients with neurocysticercosis (NCC, categorized as having parenchymal or subarachnoid infection by the presence of cysts exclusively within the parenchyma or in subarachnoid spaces of the brain, and from uninfected (control individuals matched by age and gender to each patient. Using multiplex detection technology, sera from NCC patients and controls and cytokine production by PBMC after T. solium antigen (TsAg stimulation were assayed for levels of inflammatory and regulatory cytokines. PBMC were phenotyped by flow cytometry ex vivo and following in vitro stimulation with TsAg.Sera from patients with parenchymal NCC demonstrated significantly higher Th1 (IFN-γ/IL-12 and Th2 (IL-4/IL-13 cytokine responses and trends towards higher levels of IL-1β/IL-8/IL-5 than those obtained from patients with subarachnoid NCC. Also higher in vitro antigen-driven TNF-β secretion was detected in PBMC supernatants from parenchymal than in subarachnoid NCC. In contrast, there was a significantly higher IL-10 response to TsAg stimulation in patients with subarachnoid NCC compared to parenchymal NCC. Although no differences in regulatory T cells (Tregs frequencies were found ex vivo, there was a trend towards greater expansion of Tregs upon TsAg stimulation in subarachnoid than in parenchymal NCC when data were normalized for the corresponding controls.T. solium infection of the subarachnoid space is associated with an enhanced regulatory immune response compared to infection in the parenchyma. The resulting anti-inflammatory milieu may represent a parasite strategy to maintain a permissive environment in the host or diminish

  7. The effect of ghrelin upon the early immune response in lean and obese mice during sepsis.

    Directory of Open Access Journals (Sweden)

    Daniel Siegl

    Full Text Available It is well established that obesity-related hormones can have modulatory effects associated with the immune response. Ghrelin, a hormone mainly derived from endocrine cells of the gastric mucosa, regulates appetite, energy expenditure and body weight counteracting leptin, a hormone mainly derived from adipocytes. Additionally, receptors of both have been detected on immune cells and demonstrated an immune regulatory function during sepsis.In the present study, the effect of peripheral ghrelin administration on early immune response and survival was investigated with lean mice and mice with diet-induced obesity using cecal ligation and puncture to induce sepsis.In the obese group, we found that ghrelin treatment improved survival, ameliorated hypothermia, and increased hyperleptinemia as compared to the lean controls. We also observed that ghrelin treatment divergently regulated serum IL-1ß and TNF-α concentrations in both lean and obese septic mice. Ghrelin treatment initially decreased but later resulted in increased bacteriaemia in lean mice while having no impact upon obese mice. Similarly, ghrelin treatment increased early neutrophil oxidative burst while causing a decrease 48 hours after sepsis inducement.In conclusion, as the immune response to sepsis temporally changes, ghrelin treatment differentially mediates this response. Specifically, we observed that ghrelin conferred protective effects during the early phase of sepsis, but during the later phase deteriorated immune response and outcome. These adverse effects were more pronounced upon lean mice as compared to obese mice.

  8. pH-Responsive Micelle-Based Cytoplasmic Delivery System for Induction of Cellular Immunity

    Directory of Open Access Journals (Sweden)

    Eiji Yuba


    Full Text Available (1 Background: Cytoplasmic delivery of antigens is crucial for the induction of cellular immunity, which is an important immune response for the treatment of cancer and infectious diseases. To date, fusogenic protein-incorporated liposomes and pH-responsive polymer-modified liposomes have been used to achieve cytoplasmic delivery of antigen via membrane rupture or fusion with endosomes. However, a more versatile cytoplasmic delivery system is desired for practical use. For this study, we developed pH-responsive micelles composed of dilauroyl phosphatidylcholine (DLPC and deoxycholic acid and investigated their cytoplasmic delivery performance and immunity-inducing capability. (2 Methods: Interaction of micelles with fluorescence dye-loaded liposomes, intracellular distribution of micelles, and antigenic proteins were observed. Finally, antigen-specific cellular immune response was evaluated in vivo using ELIspot assay. (3 Results: Micelles induced leakage of contents from liposomes via lipid mixing at low pH. Micelles were taken up by dendritic cells mainly via macropinocytosis and delivered ovalbumin (OVA into the cytosol. After intradermal injection of micelles and OVA, OVA-specific cellular immunity was induced in the spleen. (4 Conclusions: pH-responsive micelles composed of DLPC and deoxycholic acid are promising as enhancers of cytosol delivery of antigens and the induction capability of cellular immunity for the treatment of cancer immunotherapy and infectious diseases.

  9. The role of dehydroepiandrosterone on functional innate immune responses to acute stress. (United States)

    Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P


    The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.

  10. Intranasal immunization with protective antigen of Bacillus anthracis induces a long-term immunological memory response. (United States)

    Woo, Sun-Je; Kang, Seok-Seong; Park, Sung-Moo; Yang, Jae Seung; Song, Man Ki; Yun, Cheol-Heui; Han, Seung Hyun


    Although intranasal vaccination has been shown to be effective for the protection against inhalational anthrax, establishment of long-term immunity has yet to be achieved. Here, we investigated whether intranasal immunization with recombinant protective antigen (rPA) of Bacillus anthracis induces immunological memory responses in the mucosal and systemic compartments. Intranasal immunization with rPA plus cholera toxin (CT) sustained PA-specific antibody responses for 6 months in lung, nasal washes, and vaginal washes as well as serum. A significant induction of PA-specific memory B cells was observed in spleen, cervical lymph nodes (CLNs) and lung after booster immunization. Furthermore, intranasal immunization with rPA plus CT remarkably generated effector memory CD4(+) T cells in the lung. PA-specific CD4(+) T cells preferentially increased the expression of Th1- and Th17-type cytokines in lung, but not in spleen or CLNs. Collectively, the intranasal immunization with rPA plus CT promoted immunologic memory responses in the mucosal and systemic compartments, providing long-term immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Wallerian degeneration: the innate-immune response to traumatic nerve injury

    Directory of Open Access Journals (Sweden)

    Rotshenker Shlomo


    Full Text Available Abstract Traumatic injury to peripheral nerves results in the loss of neural functions. Recovery by regeneration depends on the cellular and molecular events of Wallerian degeneration that injury induces distal to the lesion site, the domain through which severed axons regenerate back to their target tissues. Innate-immunity is central to Wallerian degeneration since innate-immune cells, functions and molecules that are produced by immune and non-immune cells are involved. The innate-immune response helps to turn the peripheral nerve tissue into an environment that supports regeneration by removing inhibitory myelin and by upregulating neurotrophic properties. The characteristics of an efficient innate-immune response are rapid onset and conclusion, and the orchestrated interplay between Schwann cells, fibroblasts, macrophages, endothelial cells, and molecules they produce. Wallerian degeneration serves as a prelude for successful repair when these requirements are met. In contrast, functional recovery is poor when injury fails to produce the efficient innate-immune response of Wallerian degeneration.

  12. Characterization of humoral and cellular immune responses in patients with human papilloma virus

    International Nuclear Information System (INIS)

    Clares Pochet, Maria del Carmen; Ferrer Cosme, Belkis Maria; Dominguez Cardosa, Magda


    A descriptive and cross-sectional study was carried out in 30 females infected with the human papilloma virus, attended in the office of Immunology of the Specialty Polyclinic belonging to 'Saturnino Lora' Provincial Clinical Surgical Teaching Hospital in Santiago de Cuba, from June 2009 to June 2010, in order to characterize them according to immune response. To evaluate the humoral and cellular immune response rosetting assay and quantification of immunoglobulins were used respectively. Women between 25-36 years of age (40 %) infected with this virus, especially those coming from urban areas, prevailed in the series, and a significant decrease of the cellular response as compared to the humoral response was evidenced

  13. Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani.

    Directory of Open Access Journals (Sweden)

    Jia-Ying Zhu

    Full Text Available BACKGROUND: Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. METHODOLOGY/PRINCIPAL FINDINGS: In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26% showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. CONCLUSIONS/SIGNIFICANCE: obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular

  14. Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani. (United States)

    Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin


    Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host-parasitoid interaction.

  15. Transcriptomic Immune Response of Tenebrio molitor Pupae to Parasitization by Scleroderma guani (United States)

    Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin


    Background Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. Methodology/Principal Findings In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. Conclusions/Significance obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host

  16. Immune-mediated steroid-responsive epileptic spasms and epileptic encephalopathy associated with VGKC-complex antibodies. (United States)

    Suleiman, Jehan; Brenner, Tanja; Gill, Deepak; Troedson, Christopher; Sinclair, Adriane J; Brilot, Fabienne; Vincent, Angela; Lang, Bethan; Dale, Russell C


    Autoantibodies that bind to voltage-gated potassium-channel complex proteins (VGKC-complex antibodies) occur frequently in adults with limbic encephalitis presenting with cognitive impairment and seizures. Recently, VGKC-complex antibodies have been described in a few children with limbic encephalitis, and children with unexplained encephalitis presenting with status epilepticus. We report a case of infantile-onset epileptic spasms and developmental delay compatible with epileptic encephalopathy. Our patient was a female infant, aged 4 months at presentation. She had evidence of immune activation in the central nervous system with elevated cerebrospinal fluid neopterin and mirrored oligoclonal bands, which prompted testing for autoantibodies. VGKC-complex antibodies were elevated (201 pmol/L, normalVGKC-complex antibodies might represent a marker of immune therapy responsiveness in a subgroup of patients with infantile epileptic encephalopathy. © The Authors. Developmental Medicine & Child Neurology © 2011 Mac Keith Press.

  17. Integrated approach reveals diet, APOE genotype and sex affect immune response in APP mice. (United States)

    Nam, Kyong Nyon; Wolfe, Cody M; Fitz, Nicholas F; Letronne, Florent; Castranio, Emilie L; Mounier, Anais; Schug, Jonathan; Lefterov, Iliya; Koldamova, Radosveta


    Alzheimer's disease (AD) is a multifactorial neurodegenerative disorder that is influenced by genetic and environmental risk factors, such as inheritance of ε4 allele of APOE (APOE4), sex and diet. Here, we examined the effect of high fat diet (HFD) on amyloid pathology and expression profile in brains of AD model mice expressing human APOE isoforms (APP/E3 and APP/E4 mice). APP/E3 and APP/E4 mice were fed HFD or Normal diet for 3months. We found that HFD significantly increased amyloid plaques in male and female APP/E4, but not in APP/E3 mice. To identify differentially expressed genes and gene-networks correlated to diet, APOE isoform and sex, we performed RNA sequencing and applied Weighted Gene Co-expression Network Analysis. We determined that the immune response network with major hubs Tyrobp/DAP12, Csf1r, Tlr2, C1qc and Laptm5 correlated significantly and positively to the phenotype of female APP/E4-HFD mice. Correspondingly, we found that in female APP/E4-HFD mice, microglia coverage around plaques, particularly of larger size, was significantly reduced. This suggests altered containment of the plaque growth and sex-dependent vulnerability in response to diet. The results of our study show concurrent impact of diet, APOE isoform and sex on the brain transcriptome and AD-like phenotype. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. In vivo Ebola virus infection leads to a strong innate response in circulating immune cells. (United States)

    Caballero, Ignacio S; Honko, Anna N; Gire, Stephen K; Winnicki, Sarah M; Melé, Marta; Gerhardinger, Chiara; Lin, Aaron E; Rinn, John L; Sabeti, Pardis C; Hensley, Lisa E; Connor, John H


    Ebola virus is the causative agent of a severe syndrome in humans with a fatality rate that can approach 90 %. During infection, the host immune response is thought to become dysregulated, but the mechanisms through which this happens are not entirely understood. In this study, we analyze RNA sequencing data to determine the host response to Ebola virus infection in circulating immune cells. Approximately half of the 100 genes with the strongest early increases in expression were interferon-stimulated genes, such as ISG15, OAS1, IFIT2, HERC5, MX1 and DHX58. Other highly upregulated genes included cytokines CXCL11, CCL7, IL2RA, IL2R1, IL15RA, and CSF2RB, which have not been previously reported to change during Ebola virus infection. Comparing this response in two different models of exposure (intramuscular and aerosol) revealed a similar signature of infection. The strong innate response in the aerosol model was seen not only in circulating cells, but also in primary and secondary target tissues. Conversely, the innate immune response of vaccinated macaques was almost non-existent. This suggests that the innate response is a major aspect of the cellular response to Ebola virus infection in multiple tissues. Ebola virus causes a severe infection in humans that is associated with high mortality. The host immune response to virus infection is thought to be an important aspect leading to severe pathology, but the components of this overactive response are not well characterized. Here, we analyzed how circulating immune cells respond to the virus and found that there is a strong innate response dependent on active virus replication. This finding is in stark contrast to in vitro evidence showing a suppression of innate immune signaling, and it suggests that the strong innate response we observe in infected animals may be an important contributor to pathogenesis.

  19. Innate Immune Response to Rift Valley Fever Virus in Goats (United States)

    Nfon, Charles K.; Marszal, Peter; Zhang, Shunzhen; Weingartl, Hana M.


    Rift Valley fever (RVF), a re-emerging mosquito-borne disease of ruminants and man, was endemic in Africa but spread to Saudi Arabia and Yemen, meaning it could spread even further. Little is known about innate and cell-mediated immunity to RVF virus (RVFV) in ruminants, which is knowledge required for adequate vaccine trials. We therefore studied these aspects in experimentally infected goats. We also compared RVFV grown in an insect cell-line and that grown in a mammalian cell-line for differences in the course of infection. Goats developed viremia one day post infection (DPI), which lasted three to four days and some goats had transient fever coinciding with peak viremia. Up to 4% of peripheral blood mononuclear cells (PBMCs) were positive for RVFV. Monocytes and dendritic cells in PBMCs declined possibly from being directly infected with virus as suggested by in vitro exposure. Infected goats produced serum IFN-γ, IL-12 and other proinflammatory cytokines but not IFN-α. Despite the lack of IFN-α, innate immunity via the IL-12 to IFN-γ circuit possibly contributed to early protection against RVFV since neutralising antibodies were detected after viremia had cleared. The course of infection with insect cell-derived RVFV (IN-RVFV) appeared to be different from mammalian cell-derived RVFV (MAM-RVFV), with the former attaining peak viremia faster, inducing fever and profoundly affecting specific immune cell subpopulations. This indicated possible differences in infections of ruminants acquired from mosquito bites relative to those due to contact with infectious material from other animals. These differences need to be considered when testing RVF vaccines in laboratory settings. PMID:22545170

  20. The specificity of targeted vaccines for APC surface molecules influences the immune response phenotype.

    Directory of Open Access Journals (Sweden)

    Gunnveig Grødeland

    Full Text Available Different diseases require different immune responses for efficient protection. Thus, prophylactic vaccines should prime the immune system for the particular type of response needed for protection against a given infectious agent. We have here tested fusion DNA vaccines which encode proteins that bivalently target influenza hemagglutinins (HA to different surface molecules on antigen presenting cells (APC. We demonstrate that targeting to MHC class II molecules predominantly induced an antibody/Th2 response, whereas targeting to CCR1/3/5 predominantly induced a CD8(+/Th1 T cell response. With respect to antibodies, the polarizing effect was even more pronounced upon intramuscular (i.m delivery as compared to intradermal (i.d. vaccination. Despite these differences in induced immune responses, both vaccines protected against a viral challenge with influenza H1N1. Substitution of HA with ovalbumin (OVA demonstrated that polarization of immune responses, as a consequence of APC targeting specificity, could be extended to other antigens. Taken together, the results demonstrate that vaccination can be tailor-made to induce a particular phenotype of adaptive immune responses by specifically targeting different surface molecules on APCs.

  1. Is there a role for antioxidant carotenoids in limiting self-harming immune response in invertebrates? (United States)

    Cornet, Stéphane; Biard, Clotilde; Moret, Yannick


    Innate immunity relies on effectors, which produce cytotoxic molecules that have not only the advantage of killing pathogens but also the disadvantage of harming host tissues and organs. Although the role of dietary antioxidants in invertebrate immunity is still unknown, it has been shown in vertebrates that carotenoids scavenge cytotoxic radicals generated during the immune response. Carotenoids may consequently decrease the self-harming cost of immunity. A positive relationship between the levels of innate immune defence and circulating carotenoid might therefore be expected. Consistent with this hypothesis, we show that the maintenance and use of the prophenoloxidase system strongly correlate with carotenoid concentration in haemolymph within and among natural populations of the crustacean Gammarus pulex.

  2. Radiogenic responses of normal cells induced by fractionated irradiation -a simulation study. Pt. 2. Late responses

    International Nuclear Information System (INIS)

    Duechting, W.; Ulmer, W.; Ginsberg, T.; Kikhounga-N'Got, O.; Saile, C.


    Based on controlled theory, a computed simulation model has been constructed which describes the time course of slowly responding normal cells after irradiation exposure. Subsequently, different clinical irradiation schemes are compared in regard to their delayed radiogenic responses referred to as late effects in radiological terminology. A cybernetic model of a paraenchymal tissue consisting of dominantly resting functional cells has been developed and transferred into a computer model. The radiation effects are considered by characteristic cell parameters as well as by the linear-quadratic model. Three kinds of tissue (brain and lung parenchym of the mouse, liver parenchym of rat) have been irradiated in the model according to standard-, super-, hyperfractionation and a single high dose per week. The simulation studies indicate that the late reaction of brain parenchym to hyperfractionation (3 x 1.5 Gy per day) and of lung parenchym tissue with regard to all fractionation schemes applied is particularly severe. The behavior of liver parenchym is not unique. A comparison of the simulation results basing to the survival of cell numbers with clinical experience and practice shows that the clinical reality can qualitatively be represented by the model. This opens the door for connecting side effects to normal tissue with the corresponding tumor efficacy (discussed in previous papers). The model is open to further refinement and to discussions referring to the phenomenon of late effects. (orig.) [de

  3. Flight performance of western sandpipers, Calidris mauri, remains uncompromised when mounting an acute phase immune response. (United States)

    Nebel, Silke; Buehler, Deborah M; MacMillan, Alexander; Guglielmo, Christopher G


    Migratory birds have been implicated in the spread of some zoonotic diseases, but how well infected individuals can fly remains poorly understood. We used western sandpipers, Calidris mauri, to experimentally test whether flight is affected when long-distance migrants are mounting an immune response and whether migrants maintain immune defences during a flight in a wind tunnel. We measured five indicators of innate immunity in 'flown-healthy' birds (flying in a wind tunnel without mounting an immune response), 'flown-sick' birds (flying while mounting an acute phase response, which is part of induced innate immunity), and a non-flying control group ('not-flown'). Voluntary flight duration did not differ between flown-healthy and flown-sick birds, indicating that mounting an acute phase response to simulated infection did not hamper an individual's ability to fly for up to 3 h. However, in comparison to not-flown birds, bacterial killing ability of plasma was significantly reduced after flight in flown-sick birds. In flown-healthy birds, voluntary flight duration was positively correlated with bacterial killing ability and baseline haptoglobin concentration of the blood plasma measured 1-3 weeks before experimental flights, suggesting that high quality birds had strong immune systems and greater flight capacity. Our findings indicate that flight performance is not diminished by prior immune challenge, but that flight while mounting an acute phase response negatively affects other aspects of immune function. These findings have important implications for our understanding of the transmission of avian diseases, as they suggest that birds can still migrate while fighting an infection.

  4. Enhanced responses to tumor immunization following total body irradiation are time-dependent.

    Directory of Open Access Journals (Sweden)

    Adi Diab

    Full Text Available The development of successful cancer vaccines is contingent on the ability to induce effective and persistent anti-tumor immunity against self-antigens that do not typically elicit immune responses. In this study, we examine the effects of a non-myeloablative dose of total body irradiation on the ability of tumor-naïve mice to respond to DNA vaccines against melanoma. We demonstrate that irradiation followed by lymphocyte infusion results in a dramatic increase in responsiveness to tumor vaccination, with augmentation of T cell responses to tumor antigens and tumor eradication. In irradiated mice, infused CD8(+ T cells expand in an environment that is relatively depleted in regulatory T cells, and this correlates with improved CD8(+ T cell functionality. We also observe an increase in the frequency of dendritic cells displaying an activated phenotype within lymphoid organs in the first 24 hours after irradiation. Intriguingly, both the relative decrease in regulatory T cells and increase in activated dendritic cells correspond with a brief window of augmented responsiveness to immunization. After this 24 hour window, the numbers of dendritic cells decline, as does the ability of mice to respond to immunizations. When immunizations are initiated within the period of augmented dendritic cell activation, mice develop anti-tumor responses that show increased durability as well as magnitude, and this approach leads to improved survival in experiments with mice bearing established tumors as well as in a spontaneous melanoma model. We conclude that irradiation can produce potent immune adjuvant effects independent of its ability to induce tumor ablation, and that the timing of immunization and lymphocyte infusion in the irradiated host are crucial for generating optimal anti-tumor immunity. Clinical strategies using these approaches must therefore optimize such parameters, as the correct timing of infusion and vaccination may mean the difference

  5. Serotonergic Chemosensory Neurons Modify the C. elegans Immune Response by Regulating G-Protein Signaling in Epithelial Cells (United States)

    Anderson, Alexandra; Laurenson-Schafer, Henry; Partridge, Frederick A.; Hodgkin, Jonathan; McMullan, Rachel


    The nervous and immune systems influence each other, allowing animals to rapidly protect themselves from changes in their internal and external environment. However, the complex nature of these systems in mammals makes it difficult to determine how neuronal signaling influences the immune response. Here we show that serotonin, synthesized in Caenorhabditis elegans chemosensory neurons, modulates the immune response. Serotonin released from these cells acts, directly or indirectly, to regulate G-protein signaling in epithelial cells. Signaling in these cells is required for the immune response to infection by the natural pathogen Microbacterium nematophilum. Here we show that serotonin signaling suppresses the innate immune response and limits the rate of pathogen clearance. We show that C. elegans uses classical neurotransmitters to alter the immune response. Serotonin released from sensory neurons may function to modify the immune system in response to changes in the animal's external environment such as the availability, or quality, of food. PMID:24348250

  6. Influences of large sets of environmental exposures on immune responses in healthy adult men. (United States)

    Yi, Buqing; Rykova, Marina; Jäger, Gundula; Feuerecker, Matthias; Hörl, Marion; Matzel, Sandra; Ponomarev, Sergey; Vassilieva, Galina; Nichiporuk, Igor; Choukèr, Alexander


    Environmental factors have long been known to influence immune responses. In particular, clinical studies about the association between migration and increased risk of atopy/asthma have provided important information on the role of migration associated large sets of environmental exposures in the development of allergic diseases. However, investigations about environmental effects on immune responses are mostly limited in candidate environmental exposures, such as air pollution. The influences of large sets of environmental exposures on immune responses are still largely unknown. A simulated 520-d Mars mission provided an opportunity to investigate this topic. Six healthy males lived in a closed habitat simulating a spacecraft for 520 days. When they exited their "spacecraft" after the mission, the scenario was similar to that of migration, involving exposure to a new set of environmental pollutants and allergens. We measured multiple immune parameters with blood samples at chosen time points after the mission. At the early adaptation stage, highly enhanced cytokine responses were observed upon ex vivo antigen stimulations. For cell population frequencies, we found the subjects displayed increased neutrophils. These results may presumably represent the immune changes occurred in healthy humans when migrating, indicating that large sets of environmental exposures may trigger aberrant immune activity.

  7. Differential immune responses to albumin adducts of reactive intermediates of trichloroethene in MRL+/+ mice

    International Nuclear Information System (INIS)

    Cai Ping; Koenig, Rolf; Khan, M. Firoze; Kaphalia, Bhupendra S.; Ansari, G.A.S.


    Trichloroethene (TCE) is an industrial degreasing solvent and widespread environmental contaminant. Exposure to TCE is associated with autoimmunity. The mode of action of TCE is via its oxidative metabolism, and most likely, immunotoxicity is mediated via haptenization of macromolecules and subsequent induction of immune responses. To better understand the role of protein haptenization through TCE metabolism, we immunized MRL+/+ mice with albumin adducts of various TCE reactive intermediates. Serum immunoglobulins and cytokine levels were measured to determine immune responses against haptenized albumin. We found antigen-specific IgG responses of the IgG subtypes IgG 1 , IgG 2a , and IgG 2b , with IgG 1 predominating. Serum levels of G-CSF were increased in immunized mice, suggesting macrophage activation. Liver histology revealed lymphocyte infiltration in the lobules and the portal area following immunization with formyl-albumin. Our findings suggest that proteins haptenized by metabolites of TCE may act as neo-antigens that can induce humoral immune responses and T cell-mediated hepatitis

  8. Humanized mouse model for assessing the human immune response to xenogeneic and allogeneic decellularized biomaterials. (United States)

    Wang, Raymond M; Johnson, Todd D; He, Jingjin; Rong, Zhili; Wong, Michelle; Nigam, Vishal; Behfar, Atta; Xu, Yang; Christman, Karen L


    Current assessment of biomaterial biocompatibility is typically implemented in wild type rodent models. Unfortunately, different characteristics of the immune systems in rodents versus humans limit the capability of these models to mimic the human immune response to naturally derived biomaterials. Here we investigated the utility of humanized mice as an improved model for testing naturally derived biomaterials. Two injectable hydrogels derived from decellularized porcine or human cadaveric myocardium were compared. Three days and one week after subcutaneous injection, the hydrogels were analyzed for early and mid-phase immune responses, respectively. Immune cells in the humanized mouse model, particularly T-helper cells, responded distinctly between the xenogeneic and allogeneic biomaterials. The allogeneic extracellular matrix derived hydrogels elicited significantly reduced total, human specific, and CD4 + T-helper cell infiltration in humanized mice compared to xenogeneic extracellular matrix hydrogels, which was not recapitulated in wild type mice. T-helper cells, in response to the allogeneic hydrogel material, were also less polarized towards a pro-remodeling Th2 phenotype compared to xenogeneic extracellular matrix hydrogels in humanized mice. In both models, both biomaterials induced the infiltration of macrophages polarized towards a M2 phenotype and T-helper cells polarized towards a Th2 phenotype. In conclusion, these studies showed the importance of testing naturally derived biomaterials in immune competent animals and the potential of utilizing this humanized mouse model for further studying human immune cell responses to biomaterials in an in vivo environment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Genetic polymorphism and immune response to tuberculosis in indigenous populations: a brief review

    Directory of Open Access Journals (Sweden)

    Renata Maronna Praça Longhi

    Full Text Available We systematically reviewed studies of the immune response to tuberculosis and the genetic polymorphisms associated with Th1-or Th2-mediated cytokine expression in indigenous populations. A bibliographic search was performed on the Medline and ISI databases and included studies published between January 1980 and October 2011. The search terms were tuberculosis, American Indians, Amerindian, indigenous, Indians, native people, aboriginal, immun*, host immune, immune response, cytokine*, polymorphism*, and gene. Regardless of their design, studies that evaluated immunoglobulin, cytokine levels and genetic polymorphisms that altered cytokine expression were included. Thirteen studies met the inclusion criteria. The majority of studies were performed in Latin America, and five investigated the Warao ethnic group of Venezuela. Most of the investigations indirectly evaluated the immune response. Higher anergy to the tuberculin skin test, higher IgG4 and IgM levels, higher IL-5 production and lower TNF-a, IL-12p40 and IFN-I production were found in the indigenous populations. The studies also reported a predominantly Th2-type response in these populations and a possibly higher susceptibility to tuberculosis. A better understanding of the relevant genetic polymorphisms and their role in immune regulation would help to clarify the immunogenetic mechanisms of TB infection in these populations. This information would be useful for identifying new treatments and preventing infection and progression to active disease.

  10. Immune activation alters cellular and humoral responses to yellow fever 17D vaccine. (United States)

    Muyanja, Enoch; Ssemaganda, Aloysius; Ngauv, Pearline; Cubas, Rafael; Perrin, Helene; Srinivasan, Divya; Canderan, Glenda; Lawson, Benton; Kopycinski, Jakub; Graham, Amanda S; Rowe, Dawne K; Smith, Michaela J; Isern, Sharon; Michael, Scott; Silvestri, Guido; Vanderford, Thomas H; Castro, Erika; Pantaleo, Giuseppe; Singer, Joel; Gillmour, Jill; Kiwanuka, Noah; Nanvubya, Annet; Schmidt, Claudia; Birungi, Josephine; Cox, Josephine; Haddad, Elias K; Kaleebu, Pontiano; Fast, Patricia; Sekaly, Rafick-Pierre; Trautmann, Lydie; Gaucher, Denis


    Defining the parameters that modulate vaccine responses in African populations will be imperative to design effective vaccines for protection against HIV, malaria, tuberculosis, and dengue virus infections. This study aimed to evaluate the contribution of the patient-specific immune microenvironment to the response to the licensed yellow fever vaccine 17D (YF-17D) in an African cohort. We compared responses to YF-17D in 50 volunteers in Entebbe, Uganda, and 50 volunteers in Lausanne, Switzerland. We measured the CD8+ T cell and B cell responses induced by YF-17D and correlated them with immune parameters analyzed by flow cytometry prior to vaccination. We showed that YF-17D-induced CD8+ T cell and B cell responses were substantially lower in immunized individuals from Entebbe compared with immunized individuals from Lausanne. The impaired vaccine response in the Entebbe cohort associated with reduced YF-17D replication. Prior to vaccination, we observed higher frequencies of exhausted and activated NK cells, differentiated T and B cell subsets and proinflammatory monocytes, suggesting an activated immune microenvironment in the Entebbe volunteers. Interestingly, activation of CD8+ T cells and B cells as well as proinflammatory monocytes at baseline negatively correlated with YF-17D-neutralizing antibody titers after vaccination. Additionally, memory T and B cell responses in preimmunized volunteers exhibited reduced persistence in the Entebbe cohort but were boosted by a second vaccination. Together, these results demonstrate that an activated immune microenvironment prior to vaccination impedes efficacy of the YF-17D vaccine in an African cohort and suggest that vaccine regimens may need to be boosted in African populations to achieve efficient immunity. Registration is not required for observational studies. This study was funded by Canada's Global Health Research Initiative, Defense Threat Reduction Agency, National Institute of Allergy and Infectious Diseases

  11. Children with asthma by school age display aberrant immune responses to pathogenic airway bacteria as infants. (United States)

    Larsen, Jeppe Madura; Brix, Susanne; Thysen, Anna Hammerich; Birch, Sune; Rasmussen, Morten Arendt; Bisgaard, Hans


    Asthma is a highly prevalent chronic lung disease that commonly originates in early childhood. Colonization of neonatal airways with the pathogenic bacterial strains Haemophilus influenzae, Moraxella catarrhalis, and Streptococcus pneumoniae is associated with increased risk of later childhood asthma. We hypothesized that children with asthma have an abnormal immune response to pathogenic bacteria in infancy. We aimed to assess the bacterial immune response in asymptomatic infants and the association with later development of asthma by age 7 years. The Copenhagen Prospective Studies on Asthma in Childhood birth cohort was followed prospectively, and asthma was diagnosed at age 7 years. The immune response to H influenzae, M catarrhalis, and S pneumoniae was analyzed in 292 infants using PBMCs isolated and stored since the age of 6 months. The immune response was assessed based on the pattern of cytokines produced and T-cell activation. The immune response to pathogenic bacteria was different in infants with asthma by 7 years of age (P = .0007). In particular, prospective asthmatic subjects had aberrant production of IL-5 (P = .008), IL-13 (P = .057), IL-17 (P = .001), and IL-10 (P = .028), whereas there were no differences in T-cell activation or peripheral T-cell composition. Children with asthma by school age exhibited an aberrant immune response to pathogenic bacteria in infancy. We propose that an abnormal immune response to pathogenic bacteria colonizing the airways in early life might lead to chronic airway inflammation and childhood asthma. Copyright © 2014 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  12. Obligate brood parasites show more functionally effective innate immune responses: an eco-immunological hypothesis (United States)

    Hahn, D. Caldwell; Summers, Scott G.; Genovese, Kenneth J.; He, Haiqi; Kogut, Michael H.


    Immune adaptations of obligate brood parasites attracted interest when three New World cowbird species (Passeriformes, Icteridae, genus Molothrus) proved unusually resistant to West Nile virus. We have used cowbirds as models to investigate the eco-immunological hypothesis that species in parasite-rich environments characteristically have enhanced immunity as a life history adaptation. As part of an ongoing program to understand the cowbird immune system, in this study we measured degranulation and oxidative burst, two fundamental responses of the innate immune system. Innate immunity provides non-specific, fast-acting defenses against a variety of invading pathogens, and we hypothesized that innate immunity experiences particularly strong selection in cowbirds, because their life history strategy exposes them to diverse novel and unpredictable parasites. We compared the relative effectiveness of degranulation and oxidative burst responses in two cowbird species and one related, non-parasitic species. Both innate immune defenses were significantly more functionally efficient in the two parasitic cowbird species than in the non-parasitic red-winged blackbird (Icteridae, Agelaius phoeniceus). Additionally, both immune defenses were more functionally efficient in the brown-headed cowbird (M. ater), an extreme host-generalist brood parasite, than in the bronzed cowbird (M. aeneus), a moderate host-specialist with lower exposure to other species and their parasites. Thus the relative effectiveness of these two innate immune responses corresponds to the diversity of parasites in the niche of each species and to their relative resistance to WNV. This study is the first use of these two specialized assays in a comparative immunology study of wild avian species.

  13. The risk for behavioural deficits is determined by the maternal immune response to prenatal immune challenge in a neurodevelopmental model. (United States)

    Missault, S; Van den Eynde, K; Vanden Berghe, W; Fransen, E; Weeren, A; Timmermans, J P; Kumar-Singh, S; Dedeurwaerdere, S


    Schizophrenia is a highly disabling psychiatric disorder with a proposed neurodevelopmental basis. One mechanism through which genetic and environmental risk factors might act is by triggering persistent brain inflammation, as evidenced by long-lasting neuro-immunological disturbances in patients. Our goal was to investigate whether microglia activation is a neurobiological correlate to the altered behaviour in the maternal immune activation (MIA) model, a well-validated animal model with relevance to schizophrenia. A recent observation in the MIA model is the differential maternal body weight response to the immune stimulus, correlated with a different behavioural outcome in the offspring. Although it is generally assumed that the differences in maternal weight response reflect differences in cytokine response, this has not been investigated so far. Our aim was to investigate whether (i) the maternal weight response to MIA reflects differences in the maternal cytokine response, (ii) the differential behavioural phenotype of the offspring extends to depressive symptoms such as anhedonia and (iii) there are changes in chronic microglia activation dependent on the behavioural phenotype. Based on a dose-response study, MIA was induced in pregnant rats by injecting 4mg/kg Poly I:C at gestational day 15. Serum samples were collected to assess the amount of TNF-α in the maternal blood following MIA. MIA offspring were divided into weight loss (WL; n=14) and weight gain (WG; n=10) groups, depending on the maternal body weight response to Poly I:C. Adult offspring were behaviourally phenotyped for prepulse inhibition, locomotor activity with and without amphetamine and MK-801 challenge, and sucrose preference. Finally, microglia activation was scored on CD11b- and Iba1-immunohistochemically stained sections. Pregnant dams that lost weight following MIA showed increased levels of TNF-α compared to controls, unlike dams that gained weight following MIA. Poly I:C WL

  14. Transcriptional profiling of midgut immunity response and degeneration in the wandering silkworm, Bombyx mori. (United States)

    Xu, Qiuyun; Lu, Anrui; Xiao, Guohua; Yang, Bing; Zhang, Jie; Li, Xuquan; Guan, Jingmin; Shao, Qimiao; Beerntsen, Brenda T; Zhang, Peng; Wang, Chengshu; Ling, Erjun


    Lepidoptera insects have a novel development process comprising several metamorphic stages during their life cycle compared with vertebrate animals. Unlike most Lepidoptera insects that live on nectar during the adult stage, the Bombyx mori silkworm adults do not eat anything and die after egg-laying. In addition, the midguts of Lepidoptera insects produce antimicrobial proteins during the wandering stage when the larval tissues undergo numerous changes. The exact mechanisms responsible for these phenomena remain unclear. We used the silkworm as a model and performed genome-wide transcriptional profiling of the midgut between the feeding stage and the wandering stage. Many genes concerned with metabolism, digestion, and ion and small molecule transportation were down-regulated during the wandering stage, indicating that the wandering stage midgut loses its normal functions. Microarray profiling, qRT-PCR and western blot proved the production of antimicrobial proteins (peptides) in the midgut during the wandering stage. Different genes of the immune deficiency (Imd) pathway were up-regulated during the wandering stage. However, some key genes belonging to the Toll pathway showed no change in their transcription levels. Unlike butterfly (Pachliopta aristolochiae), the midgut of silkworm moth has a layer of cells, indicating that the development of midgut since the wandering stage is not usual. Cell division in the midgut was observed only for a short time during the wandering stage. However, there was extensive cell apoptosis before pupation. The imbalance of cell division and apoptosis probably drives the continuous degeneration of the midgut in the silkworm since the wandering stage. This study provided an insight into the mechanism of the degeneration of the silkworm midgut and the production of innate immunity-related proteins during the wandering stage. The imbalance of cell division and apoptosis induces irreversible degeneration of the midgut. The Imd pathway

  15. Transcriptional profiling of midgut immunity response and degeneration in the wandering silkworm, Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Qiuyun Xu

    Full Text Available BACKGROUND: Lepidoptera insects have a novel development process comprising several metamorphic stages during their life cycle compared with vertebrate animals. Unlike most Lepidoptera insects that live on nectar during the adult stage, the Bombyx mori silkworm adults do not eat anything and die after egg-laying. In addition, the midguts of Lepidoptera insects produce antimicrobial proteins during the wandering stage when the larval tissues undergo numerous changes. The exact mechanisms responsible for these phenomena remain unclear. PRINCIPAL FINDINGS: We used the silkworm as a model and performed genome-wide transcriptional profiling of the midgut between the feeding stage and the wandering stage. Many genes concerned with metabolism, digestion, and ion and small molecule transportation were down-regulated during the wandering stage, indicating that the wandering stage midgut loses its normal functions. Microarray profiling, qRT-PCR and western blot proved the production of antimicrobial proteins (peptides in the midgut during the wandering stage. Different genes of the immune deficiency (Imd pathway were up-regulated during the wandering stage. However, some key genes belonging to the Toll pathway showed no change in their transcription levels. Unlike butterfly (Pachliopta aristolochiae, the midgut of silkworm moth has a layer of cells, indicating that the development of midgut since the wandering stage is not usual. Cell division in the midgut was observed only for a short time during the wandering stage. However, there was extensive cell apoptosis before pupation. The imbalance of cell division and apoptosis probably drives the continuous degeneration of the midgut in the silkworm since the wandering stage. CONCLUSIONS: This study provided an insight into the mechanism of the degeneration of the silkworm midgut and the production of innate immunity-related proteins during the wandering stage. The imbalance of cell division and apoptosis

  16. Immunobiotic Bifidobacteria Strains Modulate Rotavirus Immune Response in Porcine Intestinal Epitheliocytes via Pattern Recognition Receptor Signaling.

    Directory of Open Access Journals (Sweden)

    Takamasa Ishizuka

    Full Text Available In this work, we aimed to characterize the antiviral response of an originally established porcine intestinal epithelial cell line (PIE cells by evaluating the molecular innate immune response to rotavirus (RVs. In addition, we aimed to select immunomodulatory bacteria with antiviral capabilities. PIE cells were inoculated with RVs isolated from different host species and the infective titers and the molecular innate immune response were evaluated. In addition, the protection against RVs infection and the modulation of immune response by different lactic acid bacteria (LAB strains was studied. The RVs strains OSU (porcine and UK (bovine effectively infected PIE cells. Our results also showed that RVs infection in PIE cells triggered TLR3-, RIG-I- and MDA-5-mediated immune responses with activation of IRF3 and NF-κB, induction of IFN-β and up-regulation of the interferon stimulated genes MxA and RNase L. Among the LAB strains tested, Bifidobacterium infantis MCC12 and B. breve MCC1274 significantly reduced RVs titers in infected PIE cells. The beneficial effects of both bifidobacteria were associated with reduction of A20 expression, and improvements of IRF-3 activation, IFN-β production, and MxA and RNase L expressions. These results indicate the value of PIE cells for studying RVs molecular innate immune response in pigs and for the selection of beneficial bacteria with antiviral capabilities.

  17. A Mathematical Model of Skeletal Muscle Disease and Immune Response in the mdx Mouse

    Directory of Open Access Journals (Sweden)

    Abdul Salam Jarrah


    Full Text Available Duchenne muscular dystrophy (DMD is a genetic disease that results in the death of affected boys by early adulthood. The genetic defect responsible for DMD has been known for over 25 years, yet at present there is neither cure nor effective treatment for DMD. During early disease onset, the mdx mouse has been validated as an animal model for DMD and use of this model has led to valuable but incomplete insights into the disease process. For example, immune cells are thought to be responsible for a significant portion of muscle cell death in the mdx mouse; however, the role and time course of the immune response in the dystrophic process have not been well described. In this paper we constructed a simple mathematical model to investigate the role of the immune response in muscle degeneration and subsequent regeneration in the mdx mouse model of Duchenne muscular dystrophy. Our model suggests that the immune response contributes substantially to the muscle degeneration and regeneration processes. Furthermore, the analysis of the model predicts that the immune system response oscillates throughout the life of the mice, and the damaged fibers are never completely cleared.

  18. Defective B cell response to T-dependent immunization in lupus-prone mice (United States)

    Niu, Haitao; Sobel, Eric S.; Morel, Laurence


    Lupus anti-nuclear Abs show the characteristics of Ag-driven T cell-dependent (TD) humoral responses. If autoAgs elicit the same response as exogenous Ags, lupus should enhance humoral responses to immunization. Blunted responses to various immunizations have, however, been reported in a significant portion of lupus patients. In this study, we show that lupus-prone B6.Sle1.Sle2.Sle3 (B6.TC) mice produce significantly less Ab in response to TD immunization than congenic controls, while producing significantly more total Ig. This blunted Ab response to TD Ag could be reconstituted with B6.TC B and CD4+ T cells. Multiple defects were found in the B6.TC response to NP-KLH as compared to total Ig, including a smaller percentage of B cells participating to the NP-response, a reduced entry into germinal centers, and highly defective production of NP-specific long-lived plasma cells in the bone marrow. B6.TC plasma cells expressed reduced levels of FcγRIIb, which suggests that reduced apoptosis in resident plasma cells prevents the establishment of newly-formed NP-specific plasma cells in bone marrow niches. Overall, these results show that lupus-prone mice responded differently to auto- and exogenous antigens and suggest that low FcγRIIb, hypergammaglobulinemia and high autoantibody production would be predictive of a poor response to immunization in lupus patients. PMID:18924209

  19. The Immune Response against Acinetobacter baumannii, an Emerging Pathogen in Nosocomial Infections (United States)

    García-Patiño, María Guadalupe; García-Contreras, Rodolfo; Licona-Limón, Paula


    Acinetobacter baumannii is the etiologic agent of a wide range of nosocomial infections, including pneumonia, bacteremia, and skin infections. Over the last 45 years, an alarming increase in the antibiotic resistance of this opportunistic microorganism has been reported, a situation that hinders effective treatments. In order to develop effective therapies against A. baumannii it is crucial to understand the basis of host–bacterium interactions, especially those concerning the immune response of the host. Different innate immune cells such as monocytes, macrophages, dendritic cells, and natural killer cells have been identified as important effectors in the defense against A. baumannii; among them, neutrophils represent a key immune cell indispensable for the control of the infection. Several immune strategies to combat A. baumannii have been identified such as recognition of the bacteria by immune cells through pattern recognition receptors, specifically toll-like receptors, which trigger bactericidal mechanisms including oxidative burst and cytokine and chemokine production to amplify the immune response against the pathogen. However, a complete picture of the protective immune strategies activated by this bacteria and its potential therapeutic use remains to be determined and explored. PMID:28446911

  20. Effect of glucocorticoids on melatonin receptor expression under T-cell activated immune response

    International Nuclear Information System (INIS)

    Tauschanova, P.; Georgiev, G.; Manchev, S.; Konakchieva, R.


    The present study was aimed to explore the stress response in rats under conditions of T-cell antigen-activated immune function and to investigate the specific melatonin (MEL) receptor binding in primary and secondary immune tissue of rats employing 2-( 125 I)-iodo melatonin autoradiography and in vitro ligand binding assay. The study revealed that melatonin receptor binding was specifically expressed in discrete areas of the lymphoid sheath of the spleen and in a network of interdigitating cells of the experimental rats. Demonstration of the modulation of MEL receptor binding in the course of a primary immune response under hypercorticalemic conditions indicate that the pineal hormone might interfere in the processes of glucocorticoid-dependent immune competency. (authors)

  1. A deterministic and stochastic model for the system dynamics of tumor-immune responses to chemotherapy (United States)

    Liu, Xiangdong; Li, Qingze; Pan, Jianxin


    Modern medical studies show that chemotherapy can help most cancer patients, especially for those diagnosed early, to stabilize their disease conditions from months to years, which means the population of tumor cells remained nearly unchanged in quite a long time after fighting against immune system and drugs. In order to better understand the dynamics of tumor-immune responses under chemotherapy, deterministic and stochastic differential equation models are constructed to characterize the dynamical change of tumor cells and immune cells in this paper. The basic dynamical properties, such as boundedness, existence and stability of equilibrium points, are investigated in the deterministic model. Extended stochastic models include stochastic differential equations (SDEs) model and continuous-time Markov chain (CTMC) model, which accounts for the variability in cellular reproduction, growth and death, interspecific competitions, and immune response to chemotherapy. The CTMC model is harnessed to estimate the extinction probability of tumor cells. Numerical simulations are performed, which confirms the obtained theoretical results.

  2. Evidence Report: Risk of Crew Adverse Health Event Due to Altered Immune Response (United States)

    Crucian, Brian; Sams, Clarence F.


    The Risk of Crew Adverse Health Event Due to Altered Immune Response is identified by the National Aeronautics and Space Administration (NASA) Human Research Program (HRP) as a recognized risk to human health and performance in space. The HRP Program Requirements Document (PRD) defines these risks. This Evidence Report provides a summary of the evidence that has been used to identify and characterize this risk. It is known that human immune function is altered in- and post-flight, but it is unclear at present if such alterations lead to increased susceptibility to disease. Reactivation of latent viruses has been documented in crewmembers, although this reactivation has not been directly correlated with immune changes or with observed diseases. As described in this report, further research is required to better characterize the relationships between altered immune response and susceptibility to disease during and after spaceflight. This is particularly important for future deep-space exploration missions.

  3. Sensitivity Analysis of an ENteric Immunity SImulator (ENISI)-Based Model of Immune Responses to Helicobacter pylori Infection. (United States)

    Alam, Maksudul; Deng, Xinwei; Philipson, Casandra; Bassaganya-Riera, Josep; Bisset, Keith; Carbo, Adria; Eubank, Stephen; Hontecillas, Raquel; Hoops, Stefan; Mei, Yongguo; Abedi, Vida; Marathe, Madhav


    Agent-based models (ABM) are widely used to study immune systems, providing a procedural and interactive view of the underlying system. The interaction of components and the behavior of individual objects is described procedurally as a function of the internal states and the local interactions, which are often stochastic in nature. Such models typically have complex structures and consist of a large number of modeling parameters. Determining the key modeling parameters which govern the outcomes of the system is very challenging. Sensitivity analysis plays a vital role in quantifying the impact of modeling parameters in massively interacting systems, including large complex ABM. The high computational cost of executing simulations impedes running experiments with exhaustive parameter settings. Existing techniques of analyzing such a complex system typically focus on local sensitivity analysis, i.e. one parameter at a time, or a close "neighborhood" of particular parameter settings. However, such methods are not adequate to measure the uncertainty and sensitivity of parameters accurately because they overlook the global impacts of parameters on the system. In this article, we develop novel experimental design and analysis techniques to perform both global and local sensitivity analysis of large-scale ABMs. The proposed method can efficiently identify the most significant parameters and quantify their contributions to outcomes of the system. We demonstrate the proposed methodology for ENteric Immune SImulator (ENISI), a large-scale ABM environment, using a computational model of immune responses to Helicobacter pylori colonization of the gastric mucosa.

  4. Siblings Promote a Type 1/Type 17-oriented immune response in the airways of asymptomatic neonates

    DEFF Research Database (Denmark)

    Wolsk, Helene Mygind; Chawes, Bo L.; Følsgaard, Nilofar V.


    -related mediators. This was supported by the PCA showing a highly significant difference between children with vs. without siblings: p...BACKGROUND: Siblings have been shown to reduce the risk of later asthma and allergy, but the mechanism driving this association is unknown. The objective was to study whether siblings affect the airway immune response in healthy neonates. We hypothesized that siblings exert immune modulatory......-cohort (COPSAC2010). The association between airway mediator levels and presence of siblings was investigated using conventional statistics and principle compo