WorldWideScience

Sample records for normal gustatory responses

  1. Quantitative radiation dose-response relationships for normal tissues in man - I. Gustatory tissues response during photon and neutron radiotherapy

    International Nuclear Information System (INIS)

    Mossman, K.L.

    1982-01-01

    Quantitative radiation dose-response curves for normal gustatory tissue in man were studied. Taste function, expressed as taste loss, was evaluated in 84 patients who were given either photon or neutron radiotherapy for tumors in the head and neck region. Patients were treated to average tumor doses of 6600 cGy (photon) or 2200 cGy intervals for photon patients and 320-cGy intervals for neutron patients during radiotherapy. The dose-response curves for photons and neutrons were analyzed by fitting a four-parameter logistic equation to the data. Photon and neutron curves differed principally in their relative position along the dose axis. Comparison of the dose-response curves were made by determination of RBE. At 320 cGy, the lowest neutron dose at which taste measurements were made, RBE = 5.7. If this RBE is correct, then the therapeutic gain factor may be equal to or less than 1, indicating no biological advantage in using neutrons over photons for this normal tissue. These studies suggest measurements of taste function and evaluation of dose-response relationships may also be useful in quantitatively evaluating the efficacy of chemical modifiers of radiation response such as hypoxic cell radiosensitizers and radioprotectors

  2. Gustatory tissue injury in man: radiation dose response relationships and mechanisms of taste loss

    International Nuclear Information System (INIS)

    Mossman, K.L.

    1986-01-01

    In this report dose response data for gustatory tissue damage in patients given total radiation doses ranging from 3000 to 6000 cGy are presented. In order to evaluate direct radiation injury to gustatory tissues as a mechanism of taste loss, measurements of damage to specific taste structures in bovine and murine systems following radiation exposure in the clinical range are correlated to taste impairment observed in radiotherapy patients. (author)

  3. Rewiring the gustatory system: specificity between nerve and taste bud field is critical for normal salt discrimination.

    Science.gov (United States)

    Spector, Alan C; Blonde, Ginger; Garcea, Mircea; Jiang, Enshe

    2010-01-15

    Forty years have passed since it was demonstrated that a cross-regenerated gustatory nerve in the rat tongue adopts the stimulus-response properties of the taste receptor field it cross-reinnervates. Nevertheless, the functional consequences of channeling peripheral taste signals through inappropriate central circuits remain relatively unexplored. Here we tested whether histologically confirmed cross-regeneration of the chorda tympani nerve (CT) into the posterior tongue in the absence of the glossopharyngeal nerve (GL) (CT-PostTongue) or cross-regeneration of the GL into the anterior tongue in the absence of the CT (GL-AntTongue) would maintain presurgically trained performance in an operant NaCl vs. KCl taste discrimination task in rats. Before surgery all groups were averaging over 90% accuracy. Oral amiloride treatment dropped performance to virtually chance levels. During the first week after surgery, sham-operated rats, GL-transected rats, and rats with regenerated CTs displayed highly competent discrimination performance. In contrast, CT-transected rats were severely impaired (59% accuracy). Both the CT-PostTongue and the GL-AntTongue groups were impaired to a similar degree as CT-transected rats. These initially impaired groups improved their performance over the weeks of postsurgical testing, suggesting that the rats were capable of relearning the task with discriminable signals in the remaining taste nerves. This relearned performance was dependent on input from amiloride-sensitive receptors likely in the palate. Overall, these results suggest that normal competence in a salt discrimination task is dependent on the taste receptor field origin of the input as well as the specific nerve transmitting the signals to its associated circuits in the brain. Copyright 2009 Elsevier B.V. All rights reserved.

  4. The Influence of Gustatory and Olfactory Experiences on Responsiveness to Reward in the Honeybee

    Science.gov (United States)

    Ramírez, Gabriela P.; Martínez, Andrés S.; Fernández, Vanesa M.; Corti Bielsa, Gonzalo; Farina, Walter M.

    2010-01-01

    Background Honeybees (Apis mellifera) exhibit an extraordinarily tuned division of labor that depends on age polyethism. This adjustment is generally associated with the fact that individuals of different ages display different response thresholds to given stimuli, which determine specific behaviors. For instance, the sucrose-response threshold (SRT) which largely depends on genetic factors may also be affected by the nectar sugar content. However, it remains unknown whether SRTs in workers of different ages and tasks can differ depending on gustatory and olfactory experiences. Methodology Groups of worker bees reared either in an artificial environment or else in a queen-right colony, were exposed to different reward conditions at different adult ages. Gustatory response scores (GRSs) and odor-memory retrieval were measured in bees that were previously exposed to changes in food characteristics. Principal Findings Results show that the gustatory responses of pre-foraging-aged bees are affected by changes in sucrose solution concentration and also to the presence of an odor provided it is presented as scented sucrose solution. In contrast no differences in worker responses were observed when presented with odor only in the rearing environment. Fast modulation of GRSs was observed in older bees (12–16 days of age) which are commonly involved in food processing tasks within the hive, while slower modulation times were observed in younger bees (commonly nurse bees, 6–9 days of age). This suggests that older food-processing bees have a higher plasticity when responding to fluctuations in resource information than younger hive bees. Adjustments in the number of trophallaxis events were also found when scented food circulated inside the nest, and this was positively correlated with the differences in timing observed in gustatory responsiveness and memory retention for hive bees of different age classes. Conclusions This work demonstrates the accessibility of

  5. Electrophysiological responses of gustatory receptor neurons on the labella of the common malaria mosquito Anopheles quadrimaculatus Say (Diptera: Culicidae)

    Science.gov (United States)

    We recorded electrical responses from sensory cells associated with gustatory sensilla on the labella of female Anopheles quadrimaculatus to salt, sucrose, quinine (a feeding deterrent) and the insect repellent, N,N-diethyl-3-methylbenzamide (DEET). A salt-sensitive cell responded to increasing con...

  6. Temporal characteristics of gustatory responses in rat parabrachial neurons vary by stimulus and chemosensitive neuron type.

    Science.gov (United States)

    Geran, Laura; Travers, Susan

    2013-01-01

    It has been demonstrated that temporal features of spike trains can increase the amount of information available for gustatory processing. However, the nature of these temporal characteristics and their relationship to different taste qualities and neuron types are not well-defined. The present study analyzed the time course of taste responses from parabrachial (PBN) neurons elicited by multiple applications of "sweet" (sucrose), "salty" (NaCl), "sour" (citric acid), and "bitter" (quinine and cycloheximide) stimuli in an acute preparation. Time course varied significantly by taste stimulus and best-stimulus classification. Across neurons, the ensemble code for the three electrolytes was similar initially but quinine diverged from NaCl and acid during the second 500 ms of stimulation and all four qualities became distinct just after 1s. This temporal evolution was reflected in significantly broader tuning during the initial response. Metric space analyses of quality discrimination by individual neurons showed that increases in information (H) afforded by temporal factors was usually explained by differences in rate envelope, which had a greater impact during the initial 2s (22.5% increase in H) compared to the later response (9.5%). Moreover, timing had a differential impact according to cell type, with between-quality discrimination in neurons activated maximally by NaCl or citric acid most affected. Timing was also found to dramatically improve within-quality discrimination (80% increase in H) in neurons that responded optimally to bitter stimuli (B-best). Spikes from B-best neurons were also more likely to occur in bursts. These findings suggest that among PBN taste neurons, time-dependent increases in mutual information can arise from stimulus- and neuron-specific differences in response envelope during the initial dynamic period. A stable rate code predominates in later epochs.

  7. T1r3 taste receptor involvement in gustatory neural responses to ethanol and oral ethanol preference.

    Science.gov (United States)

    Brasser, Susan M; Norman, Meghan B; Lemon, Christian H

    2010-05-01

    Elevated alcohol consumption is associated with enhanced preference for sweet substances across species and may be mediated by oral alcohol-induced activation of neurobiological substrates for sweet taste. Here, we directly examined the contribution of the T1r3 receptor protein, important for sweet taste detection in mammals, to ethanol intake and preference and the neural processing of ethanol taste by measuring behavioral and central neurophysiological responses to oral alcohol in T1r3 receptor-deficient mice and their C57BL/6J background strain. T1r3 knockout and wild-type mice were tested in behavioral preference assays for long-term voluntary intake of a broad concentration range of ethanol, sucrose, and quinine. For neurophysiological experiments, separate groups of mice of each genotype were anesthetized, and taste responses to ethanol and stimuli of different taste qualities were electrophysiologically recorded from gustatory neurons in the nucleus of the solitary tract. Mice lacking the T1r3 receptor were behaviorally indifferent to alcohol (i.e., ∼50% preference values) at concentrations typically preferred by wild-type mice (5-15%). Central neural taste responses to ethanol in T1r3-deficient mice were significantly lower compared with C57BL/6J controls, a strain for which oral ethanol stimulation produced a concentration-dependent activation of sweet-responsive NTS gustatory neurons. An attenuated difference in ethanol preference between knockouts and controls at concentrations >15% indicated that other sensory and/or postingestive effects of ethanol compete with sweet taste input at high concentrations. As expected, T1r3 knockouts exhibited strongly suppressed behavioral and neural taste responses to sweeteners but did not differ from wild-type mice in responses to prototypic salt, acid, or bitter stimuli. These data implicate the T1r3 receptor in the sensory detection and transduction of ethanol taste.

  8. Plutella xylostella (diamondback moth) and its parasitoid Diadegma semiclausum show different gustatory and longevity responses to a range of nectar and honeydew sugars

    NARCIS (Netherlands)

    Winkler, K.; Wäckers, F.L.; Stingli, A.; Van Lenteren, J.C.

    2005-01-01

    Parasitoids as well as many of their herbivorous hosts, depend on carbohydrate-rich food during the adult stage. Different types of nectar and honeydew vary with regard to their sugar composition. In order to successfully exploit a food source, the insect must show a positive gustatory response to

  9. Neurons in the posterior insular cortex are responsive to gustatory stimulation of the pharyngolarynx, baroreceptor and chemoreceptor stimulation, and tail pinch in rats.

    Science.gov (United States)

    Hanamori, T; Kunitake, T; Kato, K; Kannan, H

    1998-02-23

    Extracellular unit responses to gustatory stimulation of the pharyngolaryngeal region, baroreceptor and chemoreceptor stimulation, and tail pinch were recorded from the insular cortex of anesthetized and paralyzed rats. Of the 32 neurons identified, 28 responded to at least one of the nine stimuli used in the present study. Of the 32 neurons, 11 showed an excitatory response to tail pinch, 13 showed an inhibitory response, and the remaining eight had no response. Of the 32 neurons, eight responded to baroreceptor stimulation by an intravenous (i.v.) injection of methoxamine hydrochloride (Mex), four were excitatory and four were inhibitory. Thirteen neurons were excited and six neurons were inhibited by an arterial chemoreceptor stimulation by an i.v. injection of sodium cyanide (NaCN). Twenty-two neurons were responsive to at least one of the gustatory stimuli (deionized water, 1.0 M NaCl, 30 mM HCl, 30 mM quinine HCl, and 1.0 M sucrose); five to 11 excitatory neurons and three to seven inhibitory neurons for each stimulus. A large number of the neurons (25/32) received converging inputs from more than one stimulus among the nine stimuli used in the present study. Most neurons (23/32) received converging inputs from different modalities (gustatory, visceral, and tail pinch). The neurons responded were located in the insular cortex between 2.0 mm anterior and 0.2 mm posterior to the anterior edge of the joining of the anterior commissure (AC); the mean location was 1.2 mm (n=28) anterior to the AC. This indicates that most of the neurons identified in the present study seem to be located in the region posterior to the taste area and anterior to the visceral area in the insular cortex. These results indicate that the insular cortex neurons distributing between the taste area and the visceral area receive convergent inputs from gustatory, baroreceptor, chemoreceptor, and nociceptive organs. Copyright 1998 Elsevier Science B.V.

  10. Developmental, gustatory, and behavioral responses of leafroller larvae, Choristoneura rosaceana, to tannic acid and glucose.

    Science.gov (United States)

    Panzuto, M; Mauffette, Y; Alber, P J

    2002-01-01

    Soluble sugars are essential nutrients generally perceived as phagostimulants to most insects studied. However, tannins are known as digestibility reducers, hence deleterious to caterpillar development, and as deterrents as well. Previous work demonstrated that larvae of the polyphagous oblique-banded leafroller, Choristoneura rosaceana, performed better when reared on a control + 0.5% tannic acid diet than on the standard control diet and that larvae reared on a control + 5% glucose diet had slower development and reduced survival. This study was designed to elucidate the behavioral and neurophysiological components of the larval responses to tannic acid and glucose. C. rosaceana larvae were reared individually from the first to the sixth instar on one of four different artificial diets: (1) control; (2) control + 5% glucose; (3) control + 0.5% tannic acid; (4) control + 5% glucose + 0.5% tannic acid. After 14 days, larvae reared on the control + 5% glucose diet had not developed past the fourth instar, whereas a considerable proportion of larvae reared on the control + 0.5% tannic acid diet had already attained the pupal stage. Insects reared on the control or the control + 5% glucose + 0.5% tannic acid diet had intermediate development. with most larvae in the fifth instar. In addition, once the mid-sixth instar was reached, the feeding preferences to 25 and 300 mM glucose, 25 mM tannic acid, and 25 mM glucose + 25 mM tannic acid over water were assessed in two-choice tests. Feeding affected preference. Control-reared insects preferred feeding on treatments containing glucose and were not deterred by tannic acid. However, larvae that had been exposed to tannic acid during their development were deterred by tannic acid and their glucose discrimination was impaired. The sensitivity to glucose was also examined from neurophysiological recordings by stimulating the sugar-sensitive cell (cell 1) on the lateral styloconic sensillum of the maxillary galea with

  11. 5-HT3A -driven green fluorescent protein delineates gustatory fibers innervating sour-responsive taste cells: A labeled line for sour taste?

    Science.gov (United States)

    Stratford, J M; Larson, E D; Yang, R; Salcedo, E; Finger, T E

    2017-07-01

    Taste buds contain multiple cell types with each type expressing receptors and transduction components for a subset of taste qualities. The sour sensing cells, Type III cells, release serotonin (5-HT) in response to the presence of sour (acidic) tastants and this released 5-HT activates 5-HT 3 receptors on the gustatory nerves. We show here, using 5-HT 3A GFP mice, that 5-HT 3 -expressing nerve fibers preferentially contact and receive synaptic contact from Type III taste cells. Further, these 5-HT 3 -expressing nerve fibers terminate in a restricted central-lateral portion of the nucleus of the solitary tract (nTS)-the same area that shows increased c-Fos expression upon presentation of a sour tastant (30 mM citric acid). This acid stimulation also evokes c-Fos in the laterally adjacent mediodorsal spinal trigeminal nucleus (DMSp5), but this trigeminal activation is not associated with the presence of 5-HT 3 -expressing nerve fibers as it is in the nTS. Rather, the neuronal activation in the trigeminal complex likely is attributable to direct depolarization of acid-sensitive trigeminal nerve fibers, for example, polymodal nociceptors, rather than through taste buds. Taken together, these findings suggest that transmission of sour taste information involves communication between Type III taste cells and 5-HT 3 -expressing afferent nerve fibers that project to a restricted portion of the nTS consistent with a crude mapping of taste quality information in the primary gustatory nucleus. © 2017 Wiley Periodicals, Inc.

  12. Gustatory and metabolic perception of nutrient stress in Drosophila.

    Science.gov (United States)

    Linford, Nancy J; Ro, Jennifer; Chung, Brian Y; Pletcher, Scott D

    2015-02-24

    Sleep loss is an adaptive response to nutrient deprivation that alters behavior to maximize the chances of feeding before imminent death. Organisms must maintain systems for detecting the quality of the food source to resume healthy levels of sleep when the stress is alleviated. We determined that gustatory perception of sweetness is both necessary and sufficient to suppress starvation-induced sleep loss when animals encounter nutrient-poor food sources. We further find that blocking specific dopaminergic neurons phenocopies the absence of gustatory stimulation, suggesting a specific role for these neurons in transducing taste information to sleep centers in the brain. Finally, we show that gustatory perception is required for survival, specifically in a low nutrient environment. Overall, these results demonstrate an important role for gustatory perception when environmental food availability approaches zero and illustrate the interplay between sensory and metabolic perception of nutrient availability in regulating behavioral state.

  13. Prandial states modify the reactivity of the gustatory cortex using gustatory evoked potentials in humans

    Directory of Open Access Journals (Sweden)

    Agnès eJACQUIN-PIQUES

    2016-01-01

    Full Text Available Previous functional Magnetic Resonance Imaging studies evaluated the role of satiety on cortical taste area activity and highlighted decreased activation in the orbito-frontal cortex when food was eaten until satiation. The modulation of orbito-frontal neurons (secondary taste area by ad libitum food intake has been associated with the pleasantness of the food’s flavor. The insula and frontal operculum (primary taste area are also involved in reward processing. The aim was to compare human gustatory evoked potentials (GEP recorded in the primary and secondary gustatory cortices in a fasted state with those after food intake. Fifteen healthy volunteers were enrolled in this observational study. In each of two sessions, two GEP recordings were performed (at 11:00 am and 1:30 pm in response to sucrose gustatory stimulation, and a sucrose-gustatory threshold was determined. During one session, a standard lunch was provided between the two GEP recordings. During the other session, subjects had nothing to eat. Hunger sensation, wanting, liking and the perception of the solution’s intensity were evaluated with visual analogue scales. GEP latencies measured in the Pz (p<0.001, Cz (p<0.01, Fz (p<0.001 recordings (primary taste area were longer after lunch than in the pre-prandial condition. Fp1 and Fp2 latencies (secondary taste area tended to be longer after lunch, but the difference was not significant. No difference was observed for the sucrose-gustatory threshold regardless of the session and time. Modifications in the primary taste area activity during the post-prandial period occurred regardless of the nature of the food eaten and could represent the activity of the frontal operculum and insula, which was recently shown to be modulated by gut signals (GLP-1, CCK, ghrelin, or insulin through vagal afferent neurons or metabolic changes of the internal milieu after nutrient absorption. This trial was registered at clinicalstrials.gov as NCT

  14. Processing of Intraoral Olfactory and Gustatory Signals in the Gustatory Cortex of Awake Rats.

    Science.gov (United States)

    Samuelsen, Chad L; Fontanini, Alfredo

    2017-01-11

    The integration of gustatory and olfactory information is essential to the perception of flavor. Human neuroimaging experiments have pointed to the gustatory cortex (GC) as one of the areas involved in mediating flavor perception. Although GC's involvement in encoding the chemical identity and hedonic value of taste stimuli is well studied, it is unknown how single GC neurons process olfactory stimuli emanating from the mouth. In this study, we relied on multielectrode recordings to investigate how single GC neurons respond to intraorally delivered tastants and tasteless odorants dissolved in water and whether/how these two modalities converge in the same neurons. We found that GC neurons could either be unimodal, responding exclusively to taste (taste-only) or odor (odor-only), or bimodal, responding to both gustatory and olfactory stimuli. Odor responses were confirmed to result from retronasal olfaction: monitoring respiration revealed that exhalation preceded odor-evoked activity and reversible inactivation of olfactory receptors in the nasal epithelium significantly reduced responses to intraoral odorants but not to tastants. Analysis of bimodal neurons revealed that they encode palatability significantly better than the unimodal taste-only group. Bimodal neurons exhibited similar responses to palatable tastants and odorants dissolved in water. This result suggested that odorized water could be palatable. This interpretation was further supported with a brief access task, where rats avoided consuming aversive taste stimuli and consumed the palatable tastants and dissolved odorants. These results demonstrate the convergence of the chemosensory components of flavor onto single GC neurons and provide evidence for the integration of flavor with palatability coding. Food perception and choice depend upon the concurrent processing of olfactory and gustatory signals from the mouth. The primary gustatory cortex has been proposed to integrate chemosensory stimuli

  15. Postsynaptic P2X3-containing receptors in gustatory nerve fibres mediate responses to all taste qualities in mice.

    Science.gov (United States)

    Vandenbeuch, Aurelie; Larson, Eric D; Anderson, Catherine B; Smith, Steven A; Ford, Anthony P; Finger, Thomas E; Kinnamon, Sue C

    2015-03-01

    Taste buds release ATP to activate ionotropic purinoceptors composed of P2X2 and P2X3 subunits, present on the taste nerves. Mice with genetic deletion of P2X2 and P2X3 receptors (double knockout mice) lack responses to all taste stimuli presumably due to the absence of ATP-gated receptors on the afferent nerves. Recent experiments on the double knockout mice showed, however, that their taste buds fail to release ATP, suggesting the possibility of pleiotropic deficits in these global knockouts. To test further the role of postsynaptic P2X receptors in afferent signalling, we used AF-353, a selective antagonist of P2X3-containing receptors to inhibit the receptors acutely during taste nerve recording and behaviour. The specificity of AF-353 for P2X3-containing receptors was tested by recording Ca(2+) transients to exogenously applied ATP in fura-2 loaded isolated geniculate ganglion neurons from wild-type and P2X3 knockout mice. ATP responses were completely inhibited by 10 μm or 100 μm AF-353, but neither concentration blocked responses in P2X3 single knockout mice wherein the ganglion cells express only P2X2-containing receptors. Furthermore, AF-353 had no effect on taste-evoked ATP release from taste buds. In wild-type mice, i.p. injection of AF-353 or simple application of the drug directly to the tongue, inhibited taste nerve responses to all taste qualities in a dose-dependent fashion. A brief access behavioural assay confirmed the electrophysiological results and showed that preference for a synthetic sweetener, SC-45647, was abolished following i.p. injection of AF-353. These data indicate that activation of P2X3-containing receptors is required for transmission of all taste qualities. © 2015 The Authors. The Journal of Physiology © 2015 The Physiological Society.

  16. Gustatory Processing in Drosophila melanogaster.

    Science.gov (United States)

    Scott, Kristin

    2018-01-07

    The ability to identify nutrient-rich food and avoid toxic substances is essential for an animal's survival. Although olfaction and vision contribute to food detection, the gustatory system acts as a final checkpoint control for food acceptance or rejection. The vinegar fly Drosophila melanogaster tastes many of the same stimuli as mammals and provides an excellent model system for comparative studies of taste detection. The relative simplicity of the fly brain and behaviors, along with the molecular genetic and functional approaches available in this system, allow the examination of gustatory neural circuits from sensory input to motor output. This review discusses the molecules and cells that detect taste compounds in the periphery and the circuits that process taste information in the brain. These studies are providing insight into how the detection of taste compounds regulates feeding decisions.

  17. A pair of pharyngeal gustatory receptor neurons regulates caffeine-dependent ingestion in Drosophila larvae

    Directory of Open Access Journals (Sweden)

    Jaekyun Choi

    2016-07-01

    Full Text Available The sense of taste is an essential chemosensory modality that enables animals to identify appropriate food sources and control feeding behavior. In particular, the recognition of bitter taste prevents animals from feeding on harmful substances. Feeding is a complex behavior comprised of multiple steps, and food quality is continuously assessed. We here examined the role of pharyngeal gustatory organs in ingestion behavior. As a first step, we constructed a gustatory receptor-to-neuron map of the larval pharyngeal sense organs, and examined corresponding gustatory receptor neuron projections in the larval brain. Out of 22 candidate bitter compounds, we found 14 bitter compounds that elicit inhibition of ingestion in a dose-dependent manner. We provide evidence that certain pharyngeal gustatory receptor neurons are necessary and sufficient for the ingestion response of larvae to caffeine. Additionally, we show that a specific pair of pharyngeal gustatory receptor neurons, DP1, responds to caffeine by calcium imaging. In this study we show that a specific pair of gustatory receptor neurons in the pharyngeal sense organs coordinates caffeine sensing with regulation of behavioral responses such as ingestion. Our results indicate that in Drosophila larvae, the pharyngeal gustatory receptor neurons have a major role in sensing food palatability to regulate ingestion behavior. The pharyngeal sense organs are prime candidates to influence ingestion due to their position in the pharynx, and they may act as first level sensors of ingested food.

  18. Does ambient noise or hypobaric atmosphere influence olfactory and gustatory function?

    Science.gov (United States)

    Rahne, Torsten; Köppke, Robert; Nehring, Michael; Plontke, Stefan K; Fischer, Hans-Georg

    2018-01-01

    Multidimensional food perception is based mainly on gustatory and olfactory function. Recent research has demonstrated that hypobaric pressure impairs gustatory function and that background noise or distracting auditory stimulation impairs olfactory function. Using a hypobaric chamber, the odor identification, discrimination, and thresholds as well as taste identification and threshold scores were measured in 16 healthy male volunteers under normal and hypobaric (6380 ft) conditions using clinically validated tests. In both conditions, background noise was either canceled out or replaced by white noise presentation (70 dB sound pressure level). Olfactory sensitivity for n-butanol and gustatory sensitivity were impaired in a hypobaric atmosphere. White noise did not influence the odor test results. White noise stimulation impaired sensitivity for sour and sweet but not for bitter or salty tastants. We conclude that hypobaric or noisy environments could impair gustatory and olfactory sensitivity selectively for particular tastants and odorants.

  19. Factors that regulate embryonic gustatory development

    Directory of Open Access Journals (Sweden)

    Krimm Robin F

    2007-09-01

    Full Text Available Abstract Numerous molecular factors orchestrate the development of the peripheral taste system. The unique anatomy/function of the taste system makes this system ideal for understanding the mechanisms by which these factors function; yet the taste system is underutilized for this role. This review focuses on some of the many factors that are known to regulate gustatory development, and discusses a few topics where more work is needed. Some attention is given to factors that regulate epibranchial placode formation, since gustatory neurons are thought to be primarily derived from this region. Epibranchial placodes appear to arise from a pan-placodal region and a number of regulatory factors control the differentiation of individual placodes. Gustatory neuron differentiation is regulated by a series of transcription factors and perhaps bone morphongenic proteins (BMP. As neurons differentiate, they also proliferate such that their numbers exceed those in the adult, and this is followed by developmental death. Some of these cell-cycling events are regulated by neurotrophins. After gustatory neurons become post-mitotic, axon outgrowth occurs. Axons are guided by multiple chemoattractive and chemorepulsive factors, including semaphorins, to the tongue epithelium. Brain derived neurotrophic factor (BDNF, functions as a targeting factor in the final stages of axon guidance and is required for gustatory axons to find and innervate taste epithelium. Numerous factors are involved in the development of gustatory papillae including Sox-2, Sonic hedge hog and Wnt-β-catenin signaling. It is likely that just as many factors regulate taste bud differentiation; however, these factors have not yet been identified. Studies examining the molecular factors that regulate terminal field formation in the nucleus of the solitary tract are also lacking. However, it is possible that some of the factors that regulate geniculate ganglion development, outgrowth, guidance and

  20. Restoration of quinine-stimulated Fos-immunoreactive neurons in the central nucleus of the amygdala and gustatory cortex following reinnervation or cross-reinnervation of the lingual taste nerves in rats.

    Science.gov (United States)

    King, Camille Tessitore; Garcea, Mircea; Spector, Alan C

    2014-08-01

    Remarkably, when lingual gustatory nerves are surgically rerouted to inappropriate taste fields in the tongue, some taste functions recover. We previously demonstrated that quinine-stimulated oromotor rejection reflexes and neural activity (assessed by Fos immunoreactivity) in subregions of hindbrain gustatory nuclei were restored if the posterior tongue, which contains receptor cells that respond strongly to bitter compounds, was cross-reinnervated by the chorda tympani nerve. Such functional recovery was not seen if instead, the anterior tongue, where receptor cells are less responsive to bitter compounds, was cross-reinnervated by the glossopharyngeal nerve, even though this nerve typically responds robustly to bitter substances. Thus, recovery depended more on the taste field being reinnervated than on the nerve itself. Here, the distribution of quinine-stimulated Fos-immunoreactive neurons in two taste-associated forebrain areas was examined in these same rats. In the central nucleus of the amygdala (CeA), a rostrocaudal gradient characterized the normal quinine-stimulated Fos response, with the greatest number of labeled cells situated rostrally. Quinine-stimulated neurons were found throughout the gustatory cortex, but a "hot spot" was observed in its anterior-posterior center in subregions approximating the dysgranular/agranular layers. Fos neurons here and in the rostral CeA were highly correlated with quinine-elicited gapes. Denervation of the posterior tongue eliminated, and its reinnervation by either nerve restored, numbers of quinine-stimulated labeled cells in the rostralmost CeA and in the subregion approximating the dysgranular gustatory cortex. These results underscore the remarkable plasticity of the gustatory system and also help clarify the functional anatomy of neural circuits activated by bitter taste stimulation. © 2014 Wiley Periodicals, Inc.

  1. Re-patterning sleep architecture in Drosophila through gustatory perception and nutritional quality.

    Directory of Open Access Journals (Sweden)

    Nancy J Linford

    Full Text Available Organisms perceive changes in their dietary environment and enact a suite of behavioral and metabolic adaptations that can impact motivational behavior, disease resistance, and longevity. However, the precise nature and mechanism of these dietary responses is not known. We have uncovered a novel link between dietary factors and sleep behavior in Drosophila melanogaster. Dietary sugar rapidly altered sleep behavior by modulating the number of sleep episodes during both the light and dark phase of the circadian period, independent of an intact circadian rhythm and without affecting total sleep, latency to sleep, or waking activity. The effect of sugar on sleep episode number was consistent with a change in arousal threshold for waking. Dietary protein had no significant effect on sleep or wakefulness. Gustatory perception of sugar was necessary and sufficient to increase the number of sleep episodes, and this effect was blocked by activation of bitter-sensing neurons. Further addition of sugar to the diet blocked the effects of sweet gustatory perception through a gustatory-independent mechanism. However, gustatory perception was not required for diet-induced fat accumulation, indicating that sleep and energy storage are mechanistically separable. We propose a two-component model where gustatory and metabolic cues interact to regulate sleep architecture in response to the quantity of sugar available from dietary sources. Reduced arousal threshold in response to low dietary availability may have evolved to provide increased responsiveness to cues associated with alternative nutrient-dense feeding sites. These results provide evidence that gustatory perception can alter arousal thresholds for sleep behavior in response to dietary cues and provide a mechanism by which organisms tune their behavior and physiology to environmental cues.

  2. Re-patterning sleep architecture in Drosophila through gustatory perception and nutritional quality.

    Science.gov (United States)

    Linford, Nancy J; Chan, Tammy P; Pletcher, Scott D

    2012-01-01

    Organisms perceive changes in their dietary environment and enact a suite of behavioral and metabolic adaptations that can impact motivational behavior, disease resistance, and longevity. However, the precise nature and mechanism of these dietary responses is not known. We have uncovered a novel link between dietary factors and sleep behavior in Drosophila melanogaster. Dietary sugar rapidly altered sleep behavior by modulating the number of sleep episodes during both the light and dark phase of the circadian period, independent of an intact circadian rhythm and without affecting total sleep, latency to sleep, or waking activity. The effect of sugar on sleep episode number was consistent with a change in arousal threshold for waking. Dietary protein had no significant effect on sleep or wakefulness. Gustatory perception of sugar was necessary and sufficient to increase the number of sleep episodes, and this effect was blocked by activation of bitter-sensing neurons. Further addition of sugar to the diet blocked the effects of sweet gustatory perception through a gustatory-independent mechanism. However, gustatory perception was not required for diet-induced fat accumulation, indicating that sleep and energy storage are mechanistically separable. We propose a two-component model where gustatory and metabolic cues interact to regulate sleep architecture in response to the quantity of sugar available from dietary sources. Reduced arousal threshold in response to low dietary availability may have evolved to provide increased responsiveness to cues associated with alternative nutrient-dense feeding sites. These results provide evidence that gustatory perception can alter arousal thresholds for sleep behavior in response to dietary cues and provide a mechanism by which organisms tune their behavior and physiology to environmental cues.

  3. A taste for words and sounds: a case of lexical-gustatory and sound-gustatory synesthesia

    NARCIS (Netherlands)

    Colizoli, O.; Murre, J.M.J.; Rouw, R.

    2013-01-01

    Gustatory forms of synesthesia involve the automatic and consistent experience of tastes that are triggered by non-taste related inducers. We present a case of lexical-gustatory and sound-gustatory synesthesia within one individual, SC. Most words and a subset of non-linguistic sounds induce the

  4. Gustatory Behaviour in Caenorhabditis elegans

    NARCIS (Netherlands)

    R.K. Hukema (Renate)

    2006-01-01

    textabstractThe nematode C. elegans is an ideal model-organism to study the genetics of behaviour (Brenner, 1974). It is capable of sensing salts and we discriminate three different responses: it is attracted to low salt concentrations (Ward, 1973; Dusenbery et al., 1974), it avoids high salt

  5. A Box-Cox normal model for response times

    NARCIS (Netherlands)

    Klein Entink, R.H.; Fox, J.P.; Linden, W.J. van der

    2009-01-01

    The log-transform has been a convenient choice in response time modelling on test items. However, motivated by a dataset of the Medical College Admission Test where the lognormal model violated the normality assumption, the possibilities of the broader class of Box–Cox transformations for response

  6. A Box-Cox normal model for response times.

    Science.gov (United States)

    Klein Entink, R H; van der Linden, W J; Fox, J-P

    2009-11-01

    The log-transform has been a convenient choice in response time modelling on test items. However, motivated by a dataset of the Medical College Admission Test where the lognormal model violated the normality assumption, the possibilities of the broader class of Box-Cox transformations for response time modelling are investigated. After an introduction and an outline of a broader framework for analysing responses and response times simultaneously, the performance of a Box-Cox normal model for describing response times is investigated using simulation studies and a real data example. A transformation-invariant implementation of the deviance information criterium (DIC) is developed that allows for comparing model fit between models with different transformation parameters. Showing an enhanced description of the shape of the response time distributions, its application in an educational measurement context is discussed at length.

  7. Associative learning changes cross-modal representations in the gustatory cortex.

    Science.gov (United States)

    Vincis, Roberto; Fontanini, Alfredo

    2016-08-30

    A growing body of literature has demonstrated that primary sensory cortices are not exclusively unimodal, but can respond to stimuli of different sensory modalities. However, several questions concerning the neural representation of cross-modal stimuli remain open. Indeed, it is poorly understood if cross-modal stimuli evoke unique or overlapping representations in a primary sensory cortex and whether learning can modulate these representations. Here we recorded single unit responses to auditory, visual, somatosensory, and olfactory stimuli in the gustatory cortex (GC) of alert rats before and after associative learning. We found that, in untrained rats, the majority of GC neurons were modulated by a single modality. Upon learning, both prevalence of cross-modal responsive neurons and their breadth of tuning increased, leading to a greater overlap of representations. Altogether, our results show that the gustatory cortex represents cross-modal stimuli according to their sensory identity, and that learning changes the overlap of cross-modal representations.

  8. Microwave processing of gustatory tissues for immunohistochemistry

    Science.gov (United States)

    Bond, Amanda; Kinnamon, John C.

    2013-01-01

    We use immunohistochemistry to study taste cell structure and function as a means to elucidate how taste receptor cells communicate with nerve fibers and adjacent taste cells. This conventional method, however, is time consuming. In the present study we used taste buds from rat circumvallate papillae to compare conventional immunohistochemical tissue processing with microwave processing for the colocalization of several biochemical pathway markers (PLCβ2, syntaxin-1, IP3R3, α-gustducin) and the nuclear stain, Sytox. The results of our study indicate that in microwave versus conventional immunocytochemistry: (1) fixation quality is improved; (2) the amount of time necessary for processing tissue is decreased; (3) antigen retrieval is no longer needed; (4) image quality is superior. In sum, microwave tissue processing of gustatory tissues is faster and superior to conventional immunohistochemical tissue processing for many applications. PMID:23473796

  9. Age-related functional changes in gustatory and reward processing regions: An fMRI study.

    Science.gov (United States)

    Jacobson, Aaron; Green, Erin; Murphy, Claire

    2010-11-01

    Changes in appetite in older adults may result in unhealthy weight change and negatively affect overall nutrition. Research examining gustatory processing in young adults has linked changes in patterns of the hemodynamic response of gustatory and motivation related brain regions to the physiological states of hunger and satiety. Whether the same brain regions are involved in taste processing in older adults is unknown. The current study used functional magnetic resonance imaging (fMRI) to examine age-related changes in gustatory processing during hedonic assessment. Caffeine, citric acid, sucrose, and NaCl were administered orally during two event-related fMRI sessions, one during hunger and one after a pre-load. Participants assessed the pleasantness of the solutions in each session. Increased activity of the insula was seen in both age groups during hunger. Activity of secondary and higher order taste processing and reward regions such as the orbitofrontal cortex, amygdala, hippocampus, thalamus, and caudate nucleus was also observed. Hunger and satiety differentially affected the hemodynamic response, resulting in positive global activation during hunger and negative during satiety in both age groups. While in a state of hunger, the frequency and consistency of positive activation in gustatory and reward processing regions was greater in older adults. Additional regions not commonly associated with taste processing were also activated in older adults. Investigating the neurological response of older adults to taste stimuli under conditions of hunger and satiety may aid in understanding appetite, health, and functional changes in this population. Copyright 2010 Elsevier Inc. All rights reserved.

  10. A test for measuring gustatory function.

    Science.gov (United States)

    Smutzer, Gregory; Lam, Si; Hastings, Lloyd; Desai, Hetvi; Abarintos, Ray A; Sobel, Marc; Sayed, Nabil

    2008-08-01

    The purpose of this study was to determine the usefulness of edible taste strips for measuring human gustatory function. The physical properties of edible taste strips were examined to determine their potential for delivering threshold and suprathreshold amounts of taste stimuli to the oral cavity. Taste strips were then assayed by fluorescence to analyze the uniformity and distribution of bitter tastant in the strips. Finally, taste recognition thresholds for sweet taste were examined to determine whether or not taste strips could detect recognition thresholds that were equal to or better than those obtained from aqueous tests. Edible strips were prepared from pullulan-hydroxypropyl methylcellulose solutions that were dried to a thin film. The maximal amount of a tastant that could be incorporated in a 2.54 cm2 taste strip was identified by including representative taste stimuli for each class of tastant (sweet, sour, salty, bitter, and umami) during strip formation. Distribution of the bitter tastant quinine hydrochloride in taste strips was assayed by fluorescence emission spectroscopy. The efficacy of taste strips for evaluating human gustatory function was examined by using a single series ascending method of limits protocol. Sucrose taste recognition threshold data from edible strips was then compared with results that were obtained from a standard "sip and spit" recognition threshold test. Edible films that formed from a pullulan-hydroxypropyl methylcellulose polymer mixture can be used to prepare clear, thin strips that have essentially no background taste and leave no physical presence after release of tastant. Edible taste strips could uniformly incorporate up to 5% of their composition as tastant. Taste recognition thresholds for sweet taste were over one order of magnitude lower with edible taste strips when compared with an aqueous taste test. Edible taste strips are a highly sensitive method for examining taste recognition thresholds in humans. This

  11. Evaluation of normal tissue responses to high-LET radiations

    International Nuclear Information System (INIS)

    Halnan, K.E.

    1979-01-01

    Clinical results presented have been analysed to evaluate normal tissue responses to high-LET radiations. Damage to brain, spinal cord, gut, skin, connective tissue and bone has occurred. A high RBE is probable for brain and possible for spinal cord and gut but other reasons for damage are also discussed. A net gain seems likely. Random controlled trials are advocated. (author)

  12. Normalization of cell responses in cat striate cortex

    Science.gov (United States)

    Heeger, D. J.

    1992-01-01

    Simple cells in the striate cortex have been depicted as half-wave-rectified linear operators. Complex cells have been depicted as energy mechanisms, constructed from the squared sum of the outputs of quadrature pairs of linear operators. However, the linear/energy model falls short of a complete explanation of striate cell responses. In this paper, a modified version of the linear/energy model is presented in which striate cells mutually inhibit one another, effectively normalizing their responses with respect to stimulus contrast. This paper reviews experimental measurements of striate cell responses, and shows that the new model explains a significantly larger body of physiological data.

  13. Measurement of human normal tissue and tumour responses

    International Nuclear Information System (INIS)

    Ross, G.; Yarnold, J.R.

    1988-01-01

    The scarcity of quantitative measures of normal tissue damage and tumour response in patients undergoing radiotherapy is an obstacle to the clinical evaluation of new treatment strategies. Retrospective studies of complications in critical normal tissues taught important lessons in the past concerning the potential dangers of hypofractionation. However, it is unethical to use serious complications as planned end-points in prospective studies. This paper reviews the desirable characteristics of clinical end-points required to compare alternative treatments employing radiotherapy, with emphasis on simple scales applied by clinicians or even the patients themselves

  14. Vagal gustatory reflex circuits for intraoral food sorting behavior in the goldfish: cellular organization and neurotransmitters.

    Science.gov (United States)

    Ikenaga, Takanori; Ogura, Tatsuya; Finger, Thomas E

    2009-09-20

    The sense of taste is crucial in an animal's determination as to what is edible and what is not. This gustatory function is especially important in goldfish, who utilize a sophisticated oropharyngeal sorting mechanism to separate food from substrate material. The computational aspects of this detection are carried out by the medullary vagal lobe, which is a large, laminated structure combining elements of both the gustatory nucleus of the solitary tract and the nucleus ambiguus. The sensory layers of the vagal lobe are coupled to the motor layers via a simple reflex arc. Details of this reflex circuit were investigated with histology and calcium imaging. Biocytin injections into the motor layer labeled vagal reflex interneurons that have radially directed dendrites ramifying within the layers of primary afferent terminals. Axons of reflex interneurons extend radially inward to terminate onto both vagal motoneurons and small, GABAergic interneurons in the motor layer. Functional imaging shows increases in intracellular Ca++ of vagal motoneurons following electrical stimulation in the sensory layer. These responses were suppressed under Ca(++)-free conditions and by interruption of the axons bridging between the sensory and motor layers. Pharmacological experiments showed that glutamate acting via (+/-)-alpha-amino-3-hydroxy- 5-ethylisoxazole-4-propioinc acid (AMPA)/kainate and N-methyl-D-aspartic acid (NMDA) receptors mediate neurotransmission between reflex interneurons and vagal motoneurons. Thus, the vagal gustatory portion of the viscerosensory complex is linked to branchiomotor neurons of the pharynx via a glutamatergic interneuronal system.

  15. Vagal gustatory reflex circuits for intraoral food sorting behavior in the goldfish Cellular organization and neurotransmitters

    Science.gov (United States)

    Ikenaga, Takanori; Ogura, Tatsuya; Finger, Thomas E.

    2009-01-01

    The sense of taste is crucial in an animal’s determination as to what is edible and what is not. This gustatory function is especially important in goldfish who utilize a sophisticated oropharyngeal sorting mechanism to separate food from substrate material. The computational aspects of this detection are carried out by the medullary vagal lobe which is a large, laminated structure combining elements of both the gustatory nucleus of the solitary tract and the nucleus ambiguus. The sensory layers of the vagal lobe are coupled to the motor layers via a simple reflex arc. Details of this reflex circuit were investigated with histology and calcium imaging. Biocytin injections into the motor layer labeled vagal reflex interneurons which have radially-directed dendrites ramifying within the layers of primary afferent terminals. Axons of reflex interneurons extend radially inward to terminate onto both vagal motoneurons and small, GABAergic interneurons in the motor layer. Functional imaging shows increases in intracellular Ca++ of vagal motoneurons following electrical stimulation in the sensory layer. These responses were suppressed under Ca++-free conditions and by interruption of the axons bridging between the sensory and motor layers. Pharmacological experiments showed that glutamate acting via (±)-α-amino-3-hydroxy-5-ethylisoxazole-4-propioinc acid (AMPA)/kainate and N-methyl-D-aspartic acid (NMDA) receptors mediates neurotransmission between reflex interneurons and vagal motoneurons. Thus the vagal gustatory portion of the viscerosensory complex is linked to branchiomotor neurons of the pharynx via a glutamatergic interneuronal system. PMID:19598285

  16. Decaleside: a new class of natural insecticide targeting tarsal gustatory sites

    Science.gov (United States)

    Rajashekar, Yallappa; Rao, Lingamallu J. M.; Shivanandappa, Thimmappa

    2012-10-01

    Natural sources for novel insecticide molecules hold promise in view of their eco-friendly nature, selectivity, and mammalian safety. Recent progress in understanding the biology of insect olfaction and taste offers new strategies for developing selective pest control agents. We have isolated two natural insecticidal molecules from edible roots of Decalepis hamiltonii named Decalesides I and II, which are novel trisaccharides, highly toxic to household insect pests and stored-product insects. We have experimentally shown that insecticidal activity requires contact with tarsi on the legs but is not toxic orally. The insecticidal activity of molecules is lost by hydrolysis, and various sugars modify toxic response, showing that the insecticidal activity is via gustatory sites on the tarsi. Selective toxicity to insects by virtue of their gustatory site of action and the mammalian safety of the new insecticides is inherent in their chemical structure with 1-4 or 1-1 α linkage that is easily hydrolyzed by digestive enzymes of mammals. Decalesides represent a new chemical class of natural insecticides with a unique mode of action targeting tarsal chemosensory/gustatory system of insects.

  17. Isometric exercise: cardiovascular responses in normal and cardiac populations.

    Science.gov (United States)

    Hanson, P; Nagle, F

    1987-05-01

    Isometric exercise produces a characteristic pressor increase in blood pressure which may be important in maintaining perfusion of muscle during sustained contraction. This response is mediated by combined central and peripheral afferent input to medullary cardiovascular centers. In normal individuals the increase in blood pressure is mediated by a rise in cardiac output with little or no change in systemic vascular resistance. However, the pressor response is also maintained during pharmacologic blockade or surgical denervation by increasing systemic vascular resistance. Left ventricular function is normally maintained or improves in normal subjects and cardiac patients with mild impairment of left ventricular contractility. Patients with poor left ventricular function may show deterioration during isometric exercise, although this pattern of response is difficult to predict from resting studies. Recent studies have shown that patients with uncomplicated myocardial infarction can perform submaximum isometric exercise such as carrying weights in the range of 30 to 50 lb without difficulty or adverse responses. In addition, many patients who show ischemic ST depression or angina during dynamic exercise may have a reduced ischemic response during isometric or combined isometric and dynamic exercise. Isometric exercises are frequently encountered in activities of daily living and many occupational tasks. Cardiac patients should be gradually exposed to submaximum isometric training in supervised cardiac rehabilitation programs. Specific job tasks that require isometric or combined isometric and dynamic activities may be evaluated by work simulation studies. This approach to cardiac rehabilitation may facilitate patients who wish to return to a job requiring frequent isometric muscle contraction. Finally, there is a need for additional research on the long-term effects of isometric exercise training on left ventricular hypertrophy and performance. The vigorous training

  18. Quantitative radiation dose-response relationships for normal tissues in man. II. Response of the salivary glands during radiotherapy

    International Nuclear Information System (INIS)

    Mossman, K.L.

    1983-01-01

    A quantitative dose-response curve for salivary gland function in patients during radiotherapy is presented. Salivary-function data used in this study were obtained from four previously published reports. All patients were treated with 60 Co teletherapy to the head and neck using conventional treatment techniques. Salivary dysfunction was determined at specific dose levels by comparing salivary flow rates before therapy with flow rates at specific dose intervals during radiotherapy up to a total dose of 6000 cGy. Fifty percent salivary dysfunction occurred after 1000 cGy and eighty percent dysfunction was observed by the end of the therapy course (6000 cGy). The salivary-function curve was also compared to the previously published dose-response curve for taste function. Comparisons of the two curves indicate that salivary dysfunction precedes taste loss and that the shapes of the dose-response curves are different. A new term, tissue tolerance ratio, defined as the ratio of responses of two tissues given the same radiation dose, was used to make the comparisons between gustatory and salivary gland tissue effects. Measurements of salivary gland function and analysis of dose-response curves may be useful in evaluating chemical modifiers of radiation response

  19. Gustatory thalamus lesions in the rat: III. Simultaneous contrast and autoshaping.

    Science.gov (United States)

    Reilly, S; Pritchard, T C

    1997-12-01

    The performance of rats with electrophysiologically guided electrolytic lesions of the gustatory thalamus (GT) was compared to that of control subjects in two experiments. In Experiment 1, the lesioned rats showed normal simultaneous contrast effects (both positive and negative) during brief, alternating access to 0.15% saccharin and 1.0 M sucrose. There was, however, a substantial lesion-induced impairment in the level of conditioned stimulus-directed maintenance responding on the autoshaping procedure of Experiment 2. These findings are discussed with respect to the anticipatory contrast deficit recently reported in GT-lesioned rats.

  20. Plasma catecholamine responses to physiologic stimuli in normal human pregnancy.

    Science.gov (United States)

    Barron, W M; Mujais, S K; Zinaman, M; Bravo, E L; Lindheimer, M D

    1986-01-01

    The dynamic response of the sympathoadrenal system was evaluated during and after pregnancy in 13 healthy women with a protocol that compared cardiovascular parameters and plasma catecholamine levels during the basal state, after postural maneuvers, and following isometric exercise. Plasma epinephrine and norepinephrine levels were similar during and after gestation when the women rested on their sides, but heart rate was greater in pregnancy. Ten minutes of supine recumbency produced minimal changes, but attenuation of the anticipated increases in heart rate and plasma norepinephrine levels during standing and isometric exercise were observed during pregnancy. In contrast, alterations in plasma epinephrine appeared unaffected by gestation. Plasma renin activity and aldosterone levels were, as expected, greater during pregnancy; however, increments in response to upright posture were similar in pregnant and postpartum women. To the extent that circulating catecholamines may be considered indices of sympathoadrenal function, these data suggest that normal pregnancy alters cardiovascular and sympathetic nervous system responses to physiologic stimuli.

  1. T lymphocytes and normal tissue responses to radiation

    International Nuclear Information System (INIS)

    Schaue, Dörthe; McBride, William H.

    2012-01-01

    There is compelling evidence that lymphocytes are a recurring feature in radiation damaged normal tissues, but assessing their functional significance has proven difficult. Contradictory roles have been postulated in both tissue pathogenesis and protection, although these are not necessarily mutually exclusive as the immune system can display what may seem to be opposing faces at any one time. While the exact role of T lymphocytes in irradiated normal tissue responses may still be obscure, their accumulation after tissue damage suggests they may be critical targets for radiotherapeutic intervention and worthy of further study. This is accentuated by recent findings that pathologically damaged “self,” such as occurs after exposure to ionizing radiation, can generate danger signals with the ability to activate pathways similar to those that activate adoptive immunity to pathogens. In addition, the demonstration of T cell subsets with their recognition radars tuned to “self” moieties has revolutionized our ideas on how all immune responses are controlled and regulated. New concepts of autoimmunity have resulted based on the dissociation of immune functions between different subsets of immune cells. It is becoming axiomatic that the immune system has the power to regulate radiation-induced tissue damage, from failure of regeneration to fibrosis, to acute and chronic late effects, and even to carcinogenesis. Our understanding of the interplay between T lymphocytes and radiation-damaged tissue may still be rudimentary but this is a good time to re-examine their potential roles, their radiobiological and microenvironmental influences, and the possibilities for therapeutic manipulation. This review will discuss the yin and yang of T cell responses within the context of radiation exposures, how they might drive or protect against normal tissue side effects and what we may be able do about it.

  2. Re-test reliability of gustatory testing and introduction of the sensitive Taste-Drop-Test

    DEFF Research Database (Denmark)

    Fjaeldstad, A; Niklassen, A; Fernandes, H

    2018-01-01

    . Testing gustatory function can be important for diagnostics and assessment of treatment effects. However, the gustatory tests applied are required to be both sensitive and reliable.In this study, we investigate the re-test validity of popular Taste Strips gustatory test for gustatory screening....... Furthermore, we introduce a new sensitive Taste-Drop-Test, which was found to be superior for detecting a more accurate measure of tastant sensitivity....

  3. Mathematical models of tumour and normal tissue response

    International Nuclear Information System (INIS)

    Jones, B.; Dale, R.G.; Charing Cross Group of Hospitals, London

    1999-01-01

    The historical application of mathematics in the natural sciences and in radiotherapy is compared. The various forms of mathematical models and their limitations are discussed. The Linear Quadratic (LQ) model can be modified to include (i) radiobiological parameter changes that occur during fractionated radiotherapy, (ii) situations such as focal forms of radiotherapy, (iii) normal tissue responses, and (iv) to allow for the process of optimization. The inclusion of a variable cell loss factor in the LQ model repopulation term produces a more flexible clonogenic doubling time, which can simulate the phenomenon of 'accelerated repopulation'. Differential calculus can be applied to the LQ model after elimination of the fraction number integers. The optimum dose per fraction (maximum cell kill relative to a given normal tissue fractionation sensitivity) is then estimated from the clonogen doubling times and the radiosensitivity parameters (or α/β ratios). Economic treatment optimization is described. Tumour volume studies during or following teletherapy are used to optimize brachytherapy. The radiation responses of both individual tumours and tumour populations (by random sampling 'Monte-Carlo' techniques from statistical ranges of radiobiological and physical parameters) can be estimated. Computerized preclinical trials can be used to guide choice of dose fractionation scheduling in clinical trials. The potential impact of gene and other biological therapies on the results of radical radiotherapy are testable. New and experimentally testable hypotheses are generated from limited clinical data by exploratory modelling exercises. (orig.)

  4. WHAT DOES THE GUSTATORY PREFERENCES DEVELOPMENT IN INFANTS DEPEND ON?

    Directory of Open Access Journals (Sweden)

    I. N. Zakharova

    2012-01-01

    Full Text Available Intensive development of the molecular biology, genetically engineered methods of examination and decoding of human genome rendered significant assistance to discoveries in the field of gustatory preferences and food behavior formation study in children. It was proved that gustatory preferences in children and, further, in adults are influenced by numerous factors. The main of such factors are genetic ones; peculiarities of pregnant woman and child nutrition; national food traditions. The afore-mentioned factors and possible ways of influence on them are considered in this article, which contributes to development of appropriate food behavior, playing a significant role in the formation of children’ and adults’ health. 

  5. Memory, verbal fluency, and response inhibition in normal aging

    Directory of Open Access Journals (Sweden)

    Gaurav Thapliyal

    2016-01-01

    Full Text Available Background: The concepts of aging-related cognitive changes have appeared to be a major challenge in the society. In this context, the present study was planned to find out the functioning of aging population on different neurocognitive measures. Aims: The aim of the study was to find out the neurocognitive functioning, namely memory, verbal fluency, and response inhibition of normal aging population. Materials and Methods: Following purposive sampling technique, a total of 50 healthy subjects (30 males and 20 females in the age range of 60-70 years were recruited from Jaipur city of Rajasthan. Mini-mental state Examination, PGI memory scale, animal names test, and Stroop test were administered. Results: The findings reveal dysfunction in almost all the domains of memory, namely mental balance, attention and concentration, delayed recall, verbal retention for dissimilar pairs, visual retention and recognition, immediate recall, verbal retention for similar pairs, and visual retention. In domain of verbal fluency, all subjects gave low responses on the animal names test. In domain of response inhibition, all the subjects took less time in color test as compared to color word test on the Stroop task. Conclusions: Findings suggest that there are dysfunction in the area of memory, verbal fluency, and response inhibition in persons aged 60-70 years. However, recent and remote memory were found to be intact.

  6. RNAi-mediated double gene knockdown and gustatory perception measurement in honey bees (Apis mellifera).

    Science.gov (United States)

    Wang, Ying; Baker, Nicholas; Amdam, Gro V

    2013-07-25

    This video demonstrates novel techniques of RNA interference (RNAi) which downregulate two genes simultaneously in honey bees using double-stranded RNA (dsRNA) injections. It also presents a protocol of proboscis extension response (PER) assay for measuring gustatory perception. RNAi-mediated gene knockdown is an effective technique downregulating target gene expression. This technique is usually used for single gene manipulation, but it has limitations to detect interactions and joint effects between genes. In the first part of this video, we present two strategies to simultaneously knock down two genes (called double gene knockdown). We show both strategies are able to effectively suppress two genes, vitellogenin (vg) and ultraspiracle (usp), which are in a regulatory feedback loop. This double gene knockdown approach can be used to dissect interrelationships between genes and can be readily applied in different insect species. The second part of this video is a demonstration of proboscis extension response (PER) assay in honey bees after the treatment of double gene knockdown. The PER assay is a standard test for measuring gustatory perception in honey bees, which is a key predictor for how fast a honey bee's behavioral maturation is. Greater gustatory perception of nest bees indicates increased behavioral development which is often associated with an earlier age at onset of foraging and foraging specialization in pollen. In addition, PER assay can be applied to identify metabolic states of satiation or hunger in honey bees. Finally, PER assay combined with pairing different odor stimuli for conditioning the bees is also widely used for learning and memory studies in honey bees.

  7. An automated system for the objective evaluation of human gustatory sensitivity using tongue biopotential recordings.

    Directory of Open Access Journals (Sweden)

    Danilo Pani

    Full Text Available The goal of this work is to develop an automatic system for the evaluation of the gustatory sensitivity of patients using an electrophysiological recording of the response of bud cells to taste stimuli. In particular, the study aims to evaluate the effectiveness and limitations of supervised classifiers in the discrimination between subjects belonging to the three 6-n-propylthiouracil (PROP taster categories (supertasters, medium tasters, and non-tasters, exploiting features extracted from electrophysiological recordings of the tongue. Thirty-nine subjects (equally divided into the three PROP status classes by standard non-objective scaling methods underwent a non-invasive, differential, biopotential recording of their tongues during stimulation with PROP by using a custom-made, flexible, silver electrode. Two different classifiers were trained to recognize up to seven different features extracted from the recorded depolarization signal. The classification results indicate that the identified set of features allows to distinguish between PROP tasters and non-tasters (average accuracy of 80% ± 18% and up to 94% ± 15% when only supertasters and non-tasters are considered, but medium tasters were difficult to identify. However, these apparent classification errors are related to uncertainty in the labeling procedures, which are based on non-objective tests, in which the subjects provided borderline evaluations. Thus, using the proposed method, it is possible, for the first time, to automatically achieve objective PROP taster status identification with high accuracy. The simplicity of the recording technique allows for easy reproduction of the experimental setting; thus the technique can be used in future studies to evaluate other gustatory stimuli. The proposed approach represents the first objective and automatic method to directly measure human gustatory responses and a milestone for physiological taste studies, with applications ranging from

  8. Radiation-induced changes in gustatory function comparison of effects of neutron and photon irradiation

    International Nuclear Information System (INIS)

    Mossman, K.L.; Chencharick, J.D.; Scheer, A.C.; Walker, W.P.; Ornitz, R.D.; Rogers, C.C.; Henkin, R.I.

    1979-01-01

    Changes in gustatory function were measured in 51 patients with various forms of cancer who received radiation to the head and neck region. Forty patients (group I) were treated with conventional photon radiation (e.g. 66 Gy/7 weeks), and 11 patients (group II) were treated with cyclotron produced fast neutrons (e.g. 22 Gy/7 weeks). Taste acuity was measured for four taste qualities (salt, sweet, sour, and bitter) by a forced choice-three stimulus drop technique which measured detection and recognition thresholds and by a forced scaling technique which measured taste intensity responsiveness. Subjective complaints of anorexia, dysgeusia, taste loss, and xerostomia were also recorded. Patients were studied before, during and up to two months after therapy. Prior to therapy, detection and recognition thresholds, intensity responsiveness, and the frequency of subjective complaints in patients from groups I and II were statistically equivalent. During and up to 2 months after therapy, taste impairment and frequency of subjective complaints increased significantly in neutron and photon treated patients, but were statistically equivalent. Results of this study indicate that gustatory tissue response as measured by taste detection and recognition and intensity responsiveness, and the frequency of subjective complaints related to taste are statistically equivalent in patients before, during, or up 2 months after they were given either neutron or photon radiation for tumors of the head and neck

  9. Canine tumor and normal tissue response to heat and radiation

    International Nuclear Information System (INIS)

    Gillette, E.L.; McChesney, S.L.

    1985-01-01

    Oral squamous cell carcinomas of dogs were treated with either irradiation alone or combined with hyperthermia. Tumor control was assessed as no evidence of disease one year following treatment. Dogs were randomized to variable radiation doses which were given in ten fractions three times a week for three weeks. Heat was given three hours after the first and third radiation dose each week for seven treatments. The attempt was made to achieve a minimum tumor temperature of 42 0 C for thirty minutes with a maximum normal tissue temperature of 40 0 C. It was usually possible to selectively heat tumors. The TCD 50 for irradiation alone was about 400 rads greater than for heat plus irradiation. The dose response curve for heat plus radiation was much steeper than for radiation alone indicating less heterogeneity of tumor response. That also implies a much greater effectiveness of radiation combined with heat at higher tumor control probabilities. Early necrosis caused by heating healed with conservative management. No increase in late radiation necrosis was observed

  10. Diffusion-weighted MR imaging of salivary glands with gustatory stimulation - Comparison before and after radiotherapy

    International Nuclear Information System (INIS)

    Zhang, Yunyan; Gu, Yajia; Peng, Weijun; Mao, Jian; Lei, Yue; Shen, Xigang; Ou, Dan; He, Xiayun

    2013-01-01

    Background: Xerostomia is the most prominent complication in patients with head and neck carcinoma after radiotherapy (RT). Diffusion-weighted magnetic resonance imaging (DWI) with gustatory stimulation may contribute to the evaluation of salivary gland function. Purpose: To investigate the value of DWI for quantifying physiological changes of the parotid gland during gustatory stimulation in patients before and after RT. Material and Methods: Magnetic resonance imaging (MRI) was performed in 28 consecutive patients with nasopharyngeal carcinoma before and after RT and clinical xerostomia was also assessed. A DWI sequence was performed once at rest and continually repeated seven times during stimulation with ascorbic acid. Apparent diffusion coefficient (ADC) maps for parotid glands at different time points and the range of increase with stimulation were calculated. Paired two-tailed Student t tests were used to compare the ADC values before and after stimulation, and before and after RT. Results: Before RT, the ADC showed an initial increase (P<0.001) and then fluctuated during stimulation. After RT, as the clinical xerostomia changed from Grade 0 to Grade 2, the mean ADC at rest increased compared with the pre-RT value (P<0.001). A similar response to stimulation was observed, but the range of increase between the maximum ADC during stimulation and the baseline value at rest was higher post-RT than pre-RT (P=0.022). The minimum ADC during stimulation was higher than the baseline value post-RT (P=0.028), but there was no difference pre-RT (P=0.603). Conclusion: DWI combined with gustatory stimulation seems to display the physiological changes of the parotid gland following RT and may be a potential tool for non-invasively assessing salivary gland function

  11. Diffusion-weighted MR imaging of salivary glands with gustatory stimulation - Comparison before and after radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yunyan; Gu, Yajia; Peng, Weijun; Mao, Jian; Lei, Yue; Shen, Xigang [Dept. of Radiology, Fudan Univ. Shanghai Cancer Center, Shanghai (China); Dept. of Oncology, Shanghai Medical College, Fudan Univ., Shanghai (China); Ou, Dan; He, Xiayun [Dept. of Radiation Oncology, Fudan Univ. Shanghai Cancer Center, Shanghai (China); Dept. of Oncology, Shanghai Medical College, Fudan Univ., Shanghai (China)

    2013-10-15

    Background: Xerostomia is the most prominent complication in patients with head and neck carcinoma after radiotherapy (RT). Diffusion-weighted magnetic resonance imaging (DWI) with gustatory stimulation may contribute to the evaluation of salivary gland function. Purpose: To investigate the value of DWI for quantifying physiological changes of the parotid gland during gustatory stimulation in patients before and after RT. Material and Methods: Magnetic resonance imaging (MRI) was performed in 28 consecutive patients with nasopharyngeal carcinoma before and after RT and clinical xerostomia was also assessed. A DWI sequence was performed once at rest and continually repeated seven times during stimulation with ascorbic acid. Apparent diffusion coefficient (ADC) maps for parotid glands at different time points and the range of increase with stimulation were calculated. Paired two-tailed Student t tests were used to compare the ADC values before and after stimulation, and before and after RT. Results: Before RT, the ADC showed an initial increase (P<0.001) and then fluctuated during stimulation. After RT, as the clinical xerostomia changed from Grade 0 to Grade 2, the mean ADC at rest increased compared with the pre-RT value (P<0.001). A similar response to stimulation was observed, but the range of increase between the maximum ADC during stimulation and the baseline value at rest was higher post-RT than pre-RT (P=0.022). The minimum ADC during stimulation was higher than the baseline value post-RT (P=0.028), but there was no difference pre-RT (P=0.603). Conclusion: DWI combined with gustatory stimulation seems to display the physiological changes of the parotid gland following RT and may be a potential tool for non-invasively assessing salivary gland function.

  12. Biochemical response of normal albino rats to the addition of ...

    African Journals Online (AJOL)

    Experiments were conducted to determine the biochemical effect of Hibiscus cannabinus and Murraya koenigii extracts on normal albino rats using standard methods. Analyses carried out indicated that the aqueous leaf extract of H. cannabinus and M. koenigii exhibited significant hypolipideamic activity in normal rats.

  13. Sexy DEG/ENaC channels involved in gustatory detection of fruit fly pheromones.

    Science.gov (United States)

    Pikielny, Claudio W

    2012-11-06

    Hydrocarbon pheromones on the cuticle of Drosophila melanogaster modulate the complex courtship behavior of males. Recently, three members of the degenerin/epithelial Na+ channel (DEG/ENaC) family of sodium channel subunits, Ppk25, Ppk23, and Ppk29 (also known as Nope), have been shown to function in gustatory perception of courtship-modulating contact pheromones. All three proteins are required for the activation of male courtship by female pheromones. Specific interactions between two of them have been demonstrated in cultured cells, suggesting that, in a subset of cells where they are coexpressed, these three subunits function within a common heterotrimeric DEG/ENaC channel. Such a DEG/ENaC channel may be gated by pheromones, either directly or indirectly, or alternatively may control the excitability of pheromone-sensing cells. In addition, these studies identify taste neurons that respond specifically to courtship-modulating pheromones and mediate their effects on male behavior. Two types of pheromone-sensing taste neurons, F and M cells, have been defined on the basis of their specific response to either female or male pheromones. These reports set the stage for the dissection of the molecular and cellular mechanisms that mediate gustatory detection of contact pheromones.

  14. Hunger state affects both olfactory abilities and gustatory sensitivity.

    Science.gov (United States)

    Hanci, Deniz; Altun, Huseyin

    2016-07-01

    Chemical senses such as odor, taste and appearance are directly related with appetite. Understanding the relation between appetite and flavor is getting more important due to increasing number of obese patients worldwide. The literature on the studies investigating the change in olfactory abilities and gustatory sensitivity mostly performed using food-related odors and tastes rather than standardized tests were developed to study olfaction and gustation. Therefore, results are inconsistent and the relationship between olfactory and gustatory sensitivity with respect to the actual state of human satiety is still not completely understood. Here, for the first time in literature, we investigated the change in both olfactory abilities and gustatory sensitivity in hunger and in satiety using 123 subjects (37 men, 86 women; mean age 31.4 years, age range 21-41 years). The standardized Sniffin' Sticks Extended Test and Taste Strips were used for olfactory testing and gustatory sensitivity, respectively. TDI score (range 1-48) was calculated as the collective scores of odor threshold (T), odor discrimination (D) and odor identification (I). The evaluation was performed in two successive days where the hunger state of test subjects was confirmed by blood glucose test strips (mean blood glucose level 90.0 ± 5.6 mg/dl in hunger and 131.4 ± 8.1 mg/dl in satiety). The results indicated statistically significant decrease in olfaction in satiety compared to hunger (mean TDI 39.3 ± 1.1 in hunger, 37.4 ± 1.1 in satiety, p hunger (p hunger state.

  15. Taste bud-derived BDNF maintains innervation of a subset of TrkB-expressing gustatory nerve fibers.

    Science.gov (United States)

    Tang, Tao; Rios-Pilier, Jennifer; Krimm, Robin

    2017-07-01

    Taste receptor cells transduce different types of taste stimuli and transmit this information to gustatory neurons that carry it to the brain. Taste receptor cells turn over continuously in adulthood, requiring constant new innervation from nerve fibers. Therefore, the maintenance of innervation to taste buds is an active process mediated by many factors, including brain-derived neurotrophic factor (BDNF). Specifically, 40% of taste bud innervation is lost when Bdnf is removed during adulthood. Here we speculated that not all gustatory nerve fibers express the BDNF receptor, TrkB, resulting in subsets of neurons that vary in their response to BDNF. However, it is also possible that the partial loss of innervation occurred because the Bdnf gene was not effectively removed. To test these possibilities, we first determined that not all gustatory nerve fibers express the TrkB receptor in adult mice. We then verified the efficiency of Bdnf removal specifically in taste buds of K14-CreER:Bdnf mice and found that Bdnf expression was reduced to 1%, indicating efficient Bdnf gene recombination. BDNF removal resulted in a 55% loss of TrkB-expressing nerve fibers, which was greater than the loss of P2X3-positive fibers (39%), likely because taste buds were innervated by P2X3+/TrkB- fibers that were unaffected by BDNF removal. We conclude that gustatory innervation consists of both TrkB-positive and TrkB-negative taste fibers and that BDNF is specifically important for maintaining TrkB-positive innervation to taste buds. In addition, although taste bud size was not affected by inducible Bdnf removal, the expression of the γ subunit of the ENaC channel was reduced. So, BDNF may regulate expression of some molecular components of taste transduction pathways. Copyright © 2017. Published by Elsevier Inc.

  16. A taste for words and sounds: a case of lexical-gustatory and sound-gustatory synesthesia

    Directory of Open Access Journals (Sweden)

    Olympia eColizoli

    2013-10-01

    Full Text Available Gustatory forms of synesthesia involve the automatic and consistent experience of tastes that are triggered by non-taste related inducers. We present a case of lexical-gustatory and sound-gustatory synesthesia within one individual, SC. Most words and a subset of nonlinguistic sounds induce the experience of taste, smell and physical sensations for SC. SC’s lexical-gustatory associations were significantly more consistent than those of a group of controls. We tested for effects of presentation modality (visual vs. auditory, taste-related congruency, and synesthetic inducer-concurrent direction using a priming task. SC’s performance did not differ significantly from a trained control group. We used functional magnetic resonance imaging to investigate the neural correlates of SC’s synesthetic experiences by comparing her brain activation to the literature on brain networks related to language, music and sound processing, in addition to synesthesia. Words that induced a strong taste were contrasted to words that induced weak-to-no tastes (tasty vs. tasteless words. Brain activation was also measured during passive listening to music and environmental sounds. Brain activation patterns showed evidence that two regions are implicated in SC’s synesthetic experience of taste and smell: the left anterior insula and left superior parietal lobe. Anterior insula activation may reflect the synesthetic taste experience. The superior parietal lobe is proposed to be involved in binding sensory information across sub-types of synesthetes. We conclude that SC’s synesthesia is genuine and reflected in her brain activation. The type of inducer (visual-lexical, auditory-lexical, and non-lexical auditory stimuli could be differentiated based on patterns of brain activity.

  17. Is the assumption of normality or log-normality for continuous response data critical for benchmark dose estimation?

    International Nuclear Information System (INIS)

    Shao, Kan; Gift, Jeffrey S.; Setzer, R. Woodrow

    2013-01-01

    Continuous responses (e.g. body weight) are widely used in risk assessment for determining the benchmark dose (BMD) which is used to derive a U.S. EPA reference dose. One critical question that is not often addressed in dose–response assessments is whether to model the continuous data as normally or log-normally distributed. Additionally, if lognormality is assumed, and only summarized response data (i.e., mean ± standard deviation) are available as is usual in the peer-reviewed literature, the BMD can only be approximated. In this study, using the “hybrid” method and relative deviation approach, we first evaluate six representative continuous dose–response datasets reporting individual animal responses to investigate the impact on BMD/BMDL estimates of (1) the distribution assumption and (2) the use of summarized versus individual animal data when a log-normal distribution is assumed. We also conduct simulation studies evaluating model fits to various known distributions to investigate whether the distribution assumption has influence on BMD/BMDL estimates. Our results indicate that BMDs estimated using the hybrid method are more sensitive to the distribution assumption than counterpart BMDs estimated using the relative deviation approach. The choice of distribution assumption has limited impact on the BMD/BMDL estimates when the within dose-group variance is small, while the lognormality assumption is a better choice for relative deviation method when data are more skewed because of its appropriateness in describing the relationship between mean and standard deviation. Additionally, the results suggest that the use of summarized data versus individual response data to characterize log-normal distributions has minimal impact on BMD estimates. - Highlights: • We investigate to what extent the distribution assumption can affect BMD estimates. • Both real data analysis and simulation study are conducted. • BMDs estimated using hybrid method are more

  18. Is the assumption of normality or log-normality for continuous response data critical for benchmark dose estimation?

    Energy Technology Data Exchange (ETDEWEB)

    Shao, Kan, E-mail: Shao.Kan@epa.gov [ORISE Postdoctoral Fellow, National Center for Environmental Assessment, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Gift, Jeffrey S. [National Center for Environmental Assessment, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Setzer, R. Woodrow [National Center for Computational Toxicology, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States)

    2013-11-01

    Continuous responses (e.g. body weight) are widely used in risk assessment for determining the benchmark dose (BMD) which is used to derive a U.S. EPA reference dose. One critical question that is not often addressed in dose–response assessments is whether to model the continuous data as normally or log-normally distributed. Additionally, if lognormality is assumed, and only summarized response data (i.e., mean ± standard deviation) are available as is usual in the peer-reviewed literature, the BMD can only be approximated. In this study, using the “hybrid” method and relative deviation approach, we first evaluate six representative continuous dose–response datasets reporting individual animal responses to investigate the impact on BMD/BMDL estimates of (1) the distribution assumption and (2) the use of summarized versus individual animal data when a log-normal distribution is assumed. We also conduct simulation studies evaluating model fits to various known distributions to investigate whether the distribution assumption has influence on BMD/BMDL estimates. Our results indicate that BMDs estimated using the hybrid method are more sensitive to the distribution assumption than counterpart BMDs estimated using the relative deviation approach. The choice of distribution assumption has limited impact on the BMD/BMDL estimates when the within dose-group variance is small, while the lognormality assumption is a better choice for relative deviation method when data are more skewed because of its appropriateness in describing the relationship between mean and standard deviation. Additionally, the results suggest that the use of summarized data versus individual response data to characterize log-normal distributions has minimal impact on BMD estimates. - Highlights: • We investigate to what extent the distribution assumption can affect BMD estimates. • Both real data analysis and simulation study are conducted. • BMDs estimated using hybrid method are more

  19. Empathy, normality and responsiveness among street-level bureaucrats

    DEFF Research Database (Denmark)

    Møller, Marie Østergaard; Nielsen, Vibeke Lehmann

    2014-01-01

    Within the public sector it is a permanent dilemma that we on one hand – on the grounds of effectiveness and flexibility – want employees to have discretion and autonomy, but at the same time want to make sure that citizens and clients of the public sector are treated equally and independent of w...... this paper discusses and analyzes how perceptions of local target group’s problem portfolio (normality perceptions) conditions the behavioral effects of personal attributes/personality traits (differences in empathy)....

  20. Mouse genetic approaches applied to the normal tissue radiation response

    International Nuclear Information System (INIS)

    Haston, Christina K.

    2012-01-01

    The varying responses of inbred mouse models to radiation exposure present a unique opportunity to dissect the genetic basis of radiation sensitivity and tissue injury. Such studies are complementary to human association studies as they permit both the analysis of clinical features of disease, and of specific variants associated with its presentation, in a controlled environment. Herein I review how animal models are studied to identify specific genetic variants influencing predisposition to radiation-induced traits. Among these radiation-induced responses are documented strain differences in repair of DNA damage and in extent of tissue injury (in the lung, skin, and intestine) which form the base for genetic investigations. For example, radiation-induced DNA damage is consistently greater in tissues from BALB/cJ mice, than the levels in C57BL/6J mice, suggesting there may be an inherent DNA damage level per strain. Regarding tissue injury, strain specific inflammatory and fibrotic phenotypes have been documented for principally, C57BL/6 C3H and A/J mice but a correlation among responses such that knowledge of the radiation injury in one tissue informs of the response in another is not evident. Strategies to identify genetic differences contributing to a trait based on inbred strain differences, which include linkage analysis and the evaluation of recombinant congenic (RC) strains, are presented, with a focus on the lung response to irradiation which is the only radiation-induced tissue injury mapped to date. Such approaches are needed to reveal genetic differences in susceptibility to radiation injury, and also to provide a context for the effects of specific genetic variation uncovered in anticipated clinical association studies. In summary, mouse models can be studied to uncover heritable variation predisposing to specific radiation responses, and such variations may point to pathways of importance to phenotype development in the clinic.

  1. Radiogenic responses of normal cells induced by fractionated irradiation -a simulation study. Pt. 2. Late responses

    International Nuclear Information System (INIS)

    Duechting, W.; Ulmer, W.; Ginsberg, T.; Kikhounga-N'Got, O.; Saile, C.

    1995-01-01

    Based on controlled theory, a computed simulation model has been constructed which describes the time course of slowly responding normal cells after irradiation exposure. Subsequently, different clinical irradiation schemes are compared in regard to their delayed radiogenic responses referred to as late effects in radiological terminology. A cybernetic model of a paraenchymal tissue consisting of dominantly resting functional cells has been developed and transferred into a computer model. The radiation effects are considered by characteristic cell parameters as well as by the linear-quadratic model. Three kinds of tissue (brain and lung parenchym of the mouse, liver parenchym of rat) have been irradiated in the model according to standard-, super-, hyperfractionation and a single high dose per week. The simulation studies indicate that the late reaction of brain parenchym to hyperfractionation (3 x 1.5 Gy per day) and of lung parenchym tissue with regard to all fractionation schemes applied is particularly severe. The behavior of liver parenchym is not unique. A comparison of the simulation results basing to the survival of cell numbers with clinical experience and practice shows that the clinical reality can qualitatively be represented by the model. This opens the door for connecting side effects to normal tissue with the corresponding tumor efficacy (discussed in previous papers). The model is open to further refinement and to discussions referring to the phenomenon of late effects. (orig.) [de

  2. Odorant and gustatory receptors in the tsetse fly Glossina morsitans morsitans.

    Directory of Open Access Journals (Sweden)

    George F O Obiero

    2014-04-01

    Full Text Available Tsetse flies use olfactory and gustatory responses, through odorant and gustatory receptors (ORs and GRs, to interact with their environment. Glossina morsitans morsitans genome ORs and GRs were annotated using homologs of these genes in Drosophila melanogaster and an ab initio approach based on OR and GR specific motifs in G. m. morsitans gene models coupled to gene ontology (GO. Phylogenetic relationships among the ORs or GRs and the homologs were determined using Maximum Likelihood estimates. Relative expression levels among the G. m. morsitans ORs or GRs were established using RNA-seq data derived from adult female fly. Overall, 46 and 14 putative G. m. morsitans ORs and GRs respectively were recovered. These were reduced by 12 and 59 ORs and GRs respectively compared to D. melanogaster. Six of the ORs were homologous to a single D. melanogaster OR (DmOr67d associated with mating deterrence in females. Sweet taste GRs, present in all the other Diptera, were not recovered in G. m. morsitans. The GRs associated with detection of CO2 were conserved in G. m. morsitans relative to D. melanogaster. RNA-sequence data analysis revealed expression of GmmOR15 locus represented over 90% of expression profiles for the ORs. The G. m. morsitans ORs or GRs were phylogenetically closer to those in D. melanogaster than to other insects assessed. We found the chemoreceptor repertoire in G. m. morsitans smaller than other Diptera, and we postulate that this may be related to the restricted diet of blood-meal for both sexes of tsetse flies. However, the clade of some specific receptors has been expanded, indicative of their potential importance in chemoreception in the tsetse.

  3. A heteroscedastic generalized linear model with a non-normal speed factor for responses and response times.

    Science.gov (United States)

    Molenaar, Dylan; Bolsinova, Maria

    2017-05-01

    In generalized linear modelling of responses and response times, the observed response time variables are commonly transformed to make their distribution approximately normal. A normal distribution for the transformed response times is desirable as it justifies the linearity and homoscedasticity assumptions in the underlying linear model. Past research has, however, shown that the transformed response times are not always normal. Models have been developed to accommodate this violation. In the present study, we propose a modelling approach for responses and response times to test and model non-normality in the transformed response times. Most importantly, we distinguish between non-normality due to heteroscedastic residual variances, and non-normality due to a skewed speed factor. In a simulation study, we establish parameter recovery and the power to separate both effects. In addition, we apply the model to a real data set. © 2017 The Authors. British Journal of Mathematical and Statistical Psychology published by John Wiley & Sons Ltd on behalf of British Psychological Society.

  4. Gustatory sensitivity and food acceptance in two phylogenetically closely related papilionid species: Papilio hospiton and Papilio machaon.

    Science.gov (United States)

    Sollai, Giorgia; Tomassini Barbarossa, Iole; Masala, Carla; Solari, Paolo; Crnjar, Roberto

    2014-01-01

    In herbivorous insects, food selection depends on sensitivity to specific chemical stimuli from host-plants as well as to secondary metabolites (bitter) and to sugars (phagostimulatory). Bitter compounds are noxious, unpalatable or both and evoke an aversive feeding response. Instead, sugars and sugar alcohols play a critical role in determining and enhancing the palatability of foods. We assumed that peripheral taste sensitivity may be related to the width of the host selection. Our model consists of two closely phylogenetically related Papilionid species exhibiting a difference in host plant choice: Papilio hospiton and Papilio machaon. The spike activity of the lateral and medial maxillary styloconic taste sensilla was recorded following stimulation with several carbohydrates, nicotine and NaCl, with the aim of characterizing their gustatory receptor neurons and of comparing their response patterns in the light of their different acceptability in feeding behaviour. The results show that: a) each sensillum houses phagostimulant and phagodeterrent cells; b) the spike activity of the gustatory neurons in response to different taste stimuli is higher in P. hospiton than in P. machaon; c) sugar solutions inhibit the spike activity of the deterrent and salt cells, and the suppression is higher in P. machaon than in P. hospiton. In conclusion, we propose that the different balance between the phagostimulant and phagodeterrent inputs from GRNs of maxillary sensilla may contribute in determining the difference in food choice and host range.

  5. Gustatory sensitivity and food acceptance in two phylogenetically closely related papilionid species: Papilio hospiton and Papilio machaon.

    Directory of Open Access Journals (Sweden)

    Giorgia Sollai

    Full Text Available In herbivorous insects, food selection depends on sensitivity to specific chemical stimuli from host-plants as well as to secondary metabolites (bitter and to sugars (phagostimulatory. Bitter compounds are noxious, unpalatable or both and evoke an aversive feeding response. Instead, sugars and sugar alcohols play a critical role in determining and enhancing the palatability of foods. We assumed that peripheral taste sensitivity may be related to the width of the host selection. Our model consists of two closely phylogenetically related Papilionid species exhibiting a difference in host plant choice: Papilio hospiton and Papilio machaon. The spike activity of the lateral and medial maxillary styloconic taste sensilla was recorded following stimulation with several carbohydrates, nicotine and NaCl, with the aim of characterizing their gustatory receptor neurons and of comparing their response patterns in the light of their different acceptability in feeding behaviour. The results show that: a each sensillum houses phagostimulant and phagodeterrent cells; b the spike activity of the gustatory neurons in response to different taste stimuli is higher in P. hospiton than in P. machaon; c sugar solutions inhibit the spike activity of the deterrent and salt cells, and the suppression is higher in P. machaon than in P. hospiton. In conclusion, we propose that the different balance between the phagostimulant and phagodeterrent inputs from GRNs of maxillary sensilla may contribute in determining the difference in food choice and host range.

  6. Gustatory perception and fat body energy metabolism are jointly affected by vitellogenin and juvenile hormone in honey bees.

    Directory of Open Access Journals (Sweden)

    Ying Wang

    2012-06-01

    Full Text Available Honey bees (Apis mellifera provide a system for studying social and food-related behavior. A caste of workers performs age-related tasks: young bees (nurses usually feed the brood and other adult bees inside the nest, while older bees (foragers forage outside for pollen, a protein/lipid source, or nectar, a carbohydrate source. The workers' transition from nursing to foraging and their foraging preferences correlate with differences in gustatory perception, metabolic gene expression, and endocrine physiology including the endocrine factors vitellogenin (Vg and juvenile hormone (JH. However, the understanding of connections among social behavior, energy metabolism, and endocrine factors is incomplete. We used RNA interference (RNAi to perturb the gene network of Vg and JH to learn more about these connections through effects on gustation, gene transcripts, and physiology. The RNAi perturbation was achieved by single and double knockdown of the genes ultraspiracle (usp and vg, which encode a putative JH receptor and Vg, respectively. The double knockdown enhanced gustatory perception and elevated hemolymph glucose, trehalose, and JH. We also observed transcriptional responses in insulin like peptide 1 (ilp1, the adipokinetic hormone receptor (AKHR, and cGMP-dependent protein kinase (PKG, or "foraging gene" Amfor. Our study demonstrates that the Vg-JH regulatory module controls changes in carbohydrate metabolism, but not lipid metabolism, when worker bees shift from nursing to foraging. The module is also placed upstream of ilp1, AKHR, and PKG for the first time. As insulin, adipokinetic hormone (AKH, and PKG pathways influence metabolism and gustation in many animals, we propose that honey bees have conserved pathways in carbohydrate metabolism and conserved connections between energy metabolism and gustatory perception. Thus, perhaps the bee can make general contributions to the understanding of food-related behavior and metabolic disorders.

  7. Gustatory perception and fat body energy metabolism are jointly affected by vitellogenin and juvenile hormone in honey bees.

    Science.gov (United States)

    Wang, Ying; Brent, Colin S; Fennern, Erin; Amdam, Gro V

    2012-06-01

    Honey bees (Apis mellifera) provide a system for studying social and food-related behavior. A caste of workers performs age-related tasks: young bees (nurses) usually feed the brood and other adult bees inside the nest, while older bees (foragers) forage outside for pollen, a protein/lipid source, or nectar, a carbohydrate source. The workers' transition from nursing to foraging and their foraging preferences correlate with differences in gustatory perception, metabolic gene expression, and endocrine physiology including the endocrine factors vitellogenin (Vg) and juvenile hormone (JH). However, the understanding of connections among social behavior, energy metabolism, and endocrine factors is incomplete. We used RNA interference (RNAi) to perturb the gene network of Vg and JH to learn more about these connections through effects on gustation, gene transcripts, and physiology. The RNAi perturbation was achieved by single and double knockdown of the genes ultraspiracle (usp) and vg, which encode a putative JH receptor and Vg, respectively. The double knockdown enhanced gustatory perception and elevated hemolymph glucose, trehalose, and JH. We also observed transcriptional responses in insulin like peptide 1 (ilp1), the adipokinetic hormone receptor (AKHR), and cGMP-dependent protein kinase (PKG, or "foraging gene" Amfor). Our study demonstrates that the Vg-JH regulatory module controls changes in carbohydrate metabolism, but not lipid metabolism, when worker bees shift from nursing to foraging. The module is also placed upstream of ilp1, AKHR, and PKG for the first time. As insulin, adipokinetic hormone (AKH), and PKG pathways influence metabolism and gustation in many animals, we propose that honey bees have conserved pathways in carbohydrate metabolism and conserved connections between energy metabolism and gustatory perception. Thus, perhaps the bee can make general contributions to the understanding of food-related behavior and metabolic disorders.

  8. Biphasic activation of the mTOR pathway in the gustatory cortex is correlated with and necessary for taste learning.

    Science.gov (United States)

    Belelovsky, Katya; Kaphzan, Hanoch; Elkobi, Alina; Rosenblum, Kobi

    2009-06-10

    Different forms of memories and synaptic plasticity require synthesis of new proteins at the time of acquisition or immediately after. We are interested in the role of translation regulation in the cortex, the brain structure assumed to store long-term memories. The mammalian target of rapamycin, mTOR (also known as FRAP and RAFT-1), is part of a key signal transduction mechanism known to regulate translation of specific subset of mRNAs and to affect learning and synaptic plasticity. We report here that novel taste learning induces two waves of mTOR activation in the gustatory cortex. Interestingly, the first wave can be identified both in synaptoneurosomal and cellular fractions, whereas the second wave is detected in the cellular fraction but not in the synaptic one. Inhibition of mTOR, specifically in the gustatory cortex, has two effects. First, biochemically, it modulates several known downstream proteins that control translation and reduces the expression of postsynaptic density-95 in vivo. Second, behaviorally, it attenuates long-term taste memory. The results suggest that the mTOR pathway in the cortex modulates both translation factor activity and protein expression, to enable normal taste memory consolidation.

  9. Analysis of a Dynamic Viscoelastic Contact Problem with Normal Compliance, Normal Damped Response, and Nonmonotone Slip Rate Dependent Friction

    Directory of Open Access Journals (Sweden)

    Mikaël Barboteu

    2016-01-01

    Full Text Available We consider a mathematical model which describes the dynamic evolution of a viscoelastic body in frictional contact with an obstacle. The contact is modelled with a combination of a normal compliance and a normal damped response law associated with a slip rate-dependent version of Coulomb’s law of dry friction. We derive a variational formulation and an existence and uniqueness result of the weak solution of the problem is presented. Next, we introduce a fully discrete approximation of the variational problem based on a finite element method and on an implicit time integration scheme. We study this fully discrete approximation schemes and bound the errors of the approximate solutions. Under regularity assumptions imposed on the exact solution, optimal order error estimates are derived for the fully discrete solution. Finally, after recalling the solution of the frictional contact problem, some numerical simulations are provided in order to illustrate both the behavior of the solution related to the frictional contact conditions and the theoretical error estimate result.

  10. Frictional response of simulated faults to normal stresses perturbations probed with ultrasonic waves

    Science.gov (United States)

    Shreedharan, S.; Riviere, J.; Marone, C.

    2017-12-01

    We report on a suite of laboratory friction experiments conducted on saw-cut Westerly Granite surfaces to probe frictional response to step changes in normal stress and loading rate. The experiments are conducted to illuminate the fundamental processes that yield friction rate and state dependence. We quantify the microphysical frictional response of the simulated fault surfaces to normal stress steps, in the range of 1% - 600% step increases and decreases from a nominal baseline normal stress. We measure directly the fault slip rate and account for changes in slip rate with changes in normal stress and complement mechanical data acquisition by continuously probing the faults with ultrasonic pulses. We conduct the experiments at room temperature and humidity conditions in a servo controlled biaxial testing apparatus in the double direct shear configuration. The samples are sheared over a range of velocities, from 0.02 - 100 μm/s. We report observations of a transient shear stress and friction evolution with step increases and decreases in normal stress. Specifically, we show that, at low shear velocities and small increases in normal stress ( 5% increases), the shear stress evolves immediately with normal stress. We show that the excursions in slip rate resulting from the changes in normal stress must be accounted for in order to predict fault strength evolution. Ultrasonic wave amplitudes which first increase immediately in response to normal stress steps, then decrease approximately linearly to a new steady state value, in part due to changes in fault slip rate. Previous descriptions of frictional state evolution during normal stress perturbations have not adequately accounted for the effect of large slip velocity excursions. Here, we attempt to do so by using the measured ultrasonic amplitudes as a proxy for frictional state during transient shear stress evolution. Our work aims to improve understanding of induced and triggered seismicity with focus on

  11. Tumor and normal tissue responses to fractioned non-uniform dose delivery

    Energy Technology Data Exchange (ETDEWEB)

    Kaellman, P; Aegren, A; Brahme, A [Karolinska Inst., Stockholm (Sweden). Dept. of Radiation Physics

    1996-08-01

    The volume dependence of the radiation response of a tumor is straight forward to quantify because it depends primarily on the eradication of all its clonogenic cells. A tumor therefore has a parallel organization as any surviving clonogen in principle can repopulate the tumor. The difficulty with the response of the tumor is instead to know the density and sensitivity distribution of the most resistant clonogenic cells. The increase in the 50% tumor control dose and the decrease in the maximum normalized slope of the dose response relation, {gamma}, in presence of small compartments of resistant tumor cells have therefore been quantified to describe their influence on the dose response relation. Injury to normal tissue is a much more complex and gradual process. It depends on earlier effects induced long before depletion of the differentiated and clonogenic cells that in addition may have a complex structural and functional organization. The volume dependence of the dose response relation of normal tissues is therefore described here by the relative seriality, s, of the infrastructure of the organ. The model can also be generalized to describe the response of heterogeneous tissues to non uniform dose distributions. The new model is compared with clinical and experimental data on normal tissue response, and shows good agreement both with regard to the shape of dose response relation and the volume dependence of the isoeffect dose. The response of tumors and normal tissues are quantified for arbitrary dose fractionations using the linear quadratic cell survival parameters {alpha} and {beta}. The parameters of the dose response relation are derived both for a constant dose per fraction and a constant number of dose fractions, thus in the latter case accounting also for non uniform dose delivery. (author). 26 refs, 4 figs.

  12. Extensive Gustatory Cortex Lesions Significantly Impair Taste Sensitivity to KCl and Quinine but Not to Sucrose in Rats.

    Directory of Open Access Journals (Sweden)

    Michelle B Bales

    Full Text Available Recently, we reported that large bilateral gustatory cortex (GC lesions significantly impair taste sensitivity to salts in rats. Here we extended the tastants examined to include sucrose and quinine in rats with ibotenic acid-induced lesions in GC (GCX and in sham-operated controls (SHAM. Presurgically, immediately after drinking NaCl, rats received a LiCl or saline injection (i.p., but postsurgical tests indicated a weak conditioned taste aversion (CTA even in controls. The rats were then trained and tested in gustometers to discriminate a tastant from water in a two-response operant taste detection task. Psychometric functions were derived for sucrose, KCl, and quinine. Our mapping system was used to determine placement, size, and symmetry of the lesions (~91% GC damage on average. For KCl, there was a significant rightward shift (ΔEC50 = 0.57 log10 units; p<0.001 in the GCX psychometric function relative to SHAM, replicating our prior work. There was also a significant lesion-induced impairment (ΔEC50 = 0.41 log10 units; p = 0.006 in quinine sensitivity. Surprisingly, taste sensitivity to sucrose was unaffected by the extensive lesions and was comparable between GCX and SHAM rats. The fact that such large bilateral GC lesions did not shift sucrose psychometric functions relative to SHAM, but did significantly compromise quinine and KCl sensitivity suggests that the neural circuits responsible for the detection of specific taste stimuli are partially dissociable. Lesion-induced impairments were observed in expression of a postsurgical CTA to a maltodextrin solution as assessed in a taste-oriented brief-access test, but were not reflected in a longer term 46-h two-bottle test. Thus, deficits observed in rats after extensive damage to the GC are also dependent on the test used to assess taste function. In conclusion, the degree to which the GC is necessary for the maintenance of normal taste detectability apparently depends on the chemical and

  13. Responses of vibrissa-sensitive cortical neurons in normal and prenatally x-irradiated rat

    International Nuclear Information System (INIS)

    Ito, M.; Kawabata, M.; Shoji, R.

    1979-01-01

    Rats were irradiated by 200 R of x ray on day 17 of gestation through the body wall of the mother. When they underwent the following electrophysiological tests at the age of 3 to 4 month, the somatosensory cortex showed a lack of layers II, III, IV, and Va. Spike responses to quick whisker deflections were recorded from single cells in the somatosenory cortex of normal and prenatally x-irradiated rats. For the irradiated rats the response latency was prolonged when compared to the normal controls. Cortical laminar analysis of field potentials revealed that there was no difference in the latency of these potentials between the two groups, suggesting that vibrissal sensory signals reach the cortical level normally even in the irradiated rats. The prolonged latency of the irradiated cortical neuronal response could thus be ascribed to an abnormal intracortical delay, which was most likely associated with the failure of development of layer IV stellate cells in these preparations

  14. Fluid consumption and taste novelty determines transcription temporal dynamics in the gustatory cortex.

    Science.gov (United States)

    Inberg, Sharon; Jacob, Eyal; Elkobi, Alina; Edry, Efrat; Rappaport, Akiva; Simpson, T Ian; Armstrong, J Douglas; Shomron, Noam; Pasmanik-Chor, Metsada; Rosenblum, Kobi

    2016-02-09

    Novel taste memories, critical for animal survival, are consolidated to form long term memories which are dependent on translation regulation in the gustatory cortex (GC) hours following acquisition. However, the role of transcription regulation in the process is unknown. Here, we report that transcription in the GC is necessary for taste learning in rats, and that drinking and its consequences, as well as the novel taste experience, affect transcription in the GC during taste memory consolidation. We show differential effects of learning on temporal dynamics in set of genes in the GC, including Arc/Arg3.1, known to regulate the homeostasis of excitatory synapses. We demonstrate that in taste learning, transcription programs were activated following the physiological responses (i.e., fluid consumption following a water restriction regime, reward, arousal of the animal, etc.) and the specific information about a given taste (i.e., taste novelty). Moreover, the cortical differential prolonged kinetics of mRNA following novel versus familiar taste learning may represent additional novelty related molecular response, where not only the total amount, but also the temporal dynamics of transcription is modulated by sensory experience of novel information.

  15. Gustatory and olfactory sensitivity in patients with anorexia and bulimia in the course of treatment.

    Science.gov (United States)

    Aschenbrenner, Katja; Scholze, Ninette; Joraschky, Peter; Hummel, Thomas

    2008-12-01

    The majority of studies on taste and smell in eating disorders have revealed several alterations of olfactory or gustatory functions. Aim of this prospective study was to employ detailed olfactory and gustatory testing in female subjects of three homogenous groups - anorexia nervosa, bulimia nervosa and healthy controls - and to look at the effects of treatment on these measures. Sixteen hospitalized female patients with anorexia (restricting type, mean age [M]=24.5 years), 24 female patients with bulimia (purging type, M=24.3 years) as well as 23 healthy controls (M=24.5 years) received olfactory ("Sniffin' Sticks") and gustatory testing ("Taste Strips"). Group differences in olfactory and gustatory sensitivity, body mass index (BMI), the Beck depression inventory, the eating attitudes test (EAT), and the influence of therapy on gustatory and olfactory function were investigated. (1) Group differences were present for odor discrimination and overall olfactory function with anorexic patients having the lowest scores. (2) Regarding taste function, controls scored higher than patients with anorexia. (3) At admission small but significant correlations were found between overall olfactory function and body weight (r(63)=0.35), BMI (r(63) = 0.37), and EAT score (r(63) = -0.27). Similarly, (4) the taste test score correlated significantly with body weight (r(63)= 0.48), and BMI (r(63) = 0.45). Finally, (5) at discharge overall olfactory and gustatory function were significantly higher compared to admission in anorexic patients. As compared to healthy controls and bulimic patients our results show lowered olfactory and gustatory sensitivities in anorexic patients that improved with increasing BMI and decreasing eating pathology in the course of treatment.

  16. Rapid Estimation of Gustatory Sensitivity Thresholds with SIAM and QUEST

    Directory of Open Access Journals (Sweden)

    Richard Höchenberger

    2017-06-01

    Full Text Available Adaptive methods provide quick and reliable estimates of sensory sensitivity. Yet, these procedures are typically developed for and applied to the non-chemical senses only, i.e., to vision, audition, and somatosensation. The relatively long inter-stimulus-intervals in gustatory studies, which are required to minimize adaptation and habituation, call for time-efficient threshold estimations. We therefore tested the suitability of two adaptive yes-no methods based on SIAM and QUEST for rapid estimation of taste sensitivity by comparing test-retest reliability for sucrose, citric acid, sodium chloride, and quinine hydrochloride thresholds. We show that taste thresholds can be obtained in a time efficient manner with both methods (within only 6.5 min on average using QUEST and ~9.5 min using SIAM. QUEST yielded higher test-retest correlations than SIAM in three of the four tastants. Either method allows for taste threshold estimation with low strain on participants, rendering them particularly advantageous for use in subjects with limited attentional or mnemonic capacities, and for time-constrained applications during cohort studies or in the testing of patients and children.

  17. Evaluation of Olfactory and Gustatory Function of HIV Infected Women

    Directory of Open Access Journals (Sweden)

    Ayotunde James Fasunla

    2016-01-01

    Full Text Available Background. Compliance with medication requires good sense of smell and taste. Objective. To evaluate the olfactory and gustatory function of HIV infected women in Ibadan, Nigeria. Methods. A case control study of women comprising 83 HIV infected women and 79 HIV uninfected women. Subjective self-rating of taste and smell function was by visual analogue scale. Olfactory function was measured via olfactory threshold (OT, olfactory discrimination (OD, olfactory identification (OI, and TDI using “Sniffin’ sticks” kits and taste function (Total Taste Strips (TTS score measurement was by taste strips. Results. The mean age of the HIV infected women was 43.67 years ± 10.72 and control was 41.48 years ± 10.99. There was no significant difference in the self-reported assessment of smell (p=0.67 and taste (p=0.84 of HIV infected and uninfected women. Although the mean OT, OD, OI, TDI, and TTS scores of HIV infected and uninfected women were within the normosmic and normogeusic values, the values were significantly higher in the controls (p<0.05. Hyposmia was in 39.7% of subjects and 12.6% of controls while hypogeusia was in 15.7% of subjects and 1.3% of controls. Conclusions. Hyposmia and hypogeusia are commoner among the HIV infected women than the HIV uninfected women and the risk increases with an increased duration of highly active antiretroviral therapy.

  18. Dosimetric precision requirements and quantities for characterizing the response of tumors and normal tissues

    Energy Technology Data Exchange (ETDEWEB)

    Brahme, A [Karolinska Inst., Stockholm (Sweden). Dept. of Radiation Physics

    1996-08-01

    Based on simple radiobiological models the effect of the distribution of absorbed dose in therapy beams on the radiation response of tumor and normal tissue volumes are investigated. Under the assumption that the dose variation in the treated volume is small it is shown that the response of the tissue to radiation is determined mainly by the mean dose to the tumor or normal tissue volume in question. Quantitative expressions are also given for the increased probability of normal tissue complications and the decreased probability of tumor control as a function of increasing dose variations around the mean dose level to these tissues. When the dose variations are large the minimum tumor dose (to cm{sup 3} size volumes) will generally be better related to tumor control and the highest dose to significant portions of normal tissue correlates best to complications. In order not to lose more than one out of 20 curable patients (95% of highest possible treatment outcome) the required accuracy in the dose distribution delivered to the target volume should be 2.5% (1{sigma}) for a mean dose response gradient {gamma} in the range 2 - 3. For more steeply responding tumors and normal tissues even stricter requirements may be desirable. (author). 15 refs, 6 figs.

  19. The influence of dose fractionation and dose rate on normal tissue responses

    International Nuclear Information System (INIS)

    Barendsen, G.W.

    1982-01-01

    An analysis of responses of a variety of normal tissues in animals to fractionated irradiations has been made with the aim of developing a formalism for the prediction of tolerance doses as a function of the dose per fraction and the overall treatment time. An important feature of the formalism is that it is directly based on radiological insights and therefore provides a logical concept to account for the diversity of tissue responses. (Auth.)

  20. Gustatory imagery reveals functional connectivity from the prefrontal to insular cortices traced with magnetoencephalography.

    Science.gov (United States)

    Kobayashi, Masayuki; Sasabe, Tetsuya; Shigihara, Yoshihito; Tanaka, Masaaki; Watanabe, Yasuyoshi

    2011-01-01

    Our experience and prejudice concerning food play an important role in modulating gustatory information processing; gustatory memory stored in the central nervous system influences gustatory information arising from the peripheral nervous system. We have elucidated the mechanism of the "top-down" modulation of taste perception in humans using functional magnetic resonance imaging (fMRI) and demonstrated that gustatory imagery is mediated by the prefrontal (PFC) and insular cortices (IC). However, the temporal order of activation of these brain regions during gustatory imagery is still an open issue. To explore the source of "top-down" signals during gustatory imagery tasks, we analyzed the temporal activation patterns of activated regions in the cerebral cortex using another non-invasive brain imaging technique, magnetoencephalography (MEG). Gustatory imagery tasks were presented by words (Letter G-V) or pictures (Picture G-V) of foods/beverages, and participants were requested to recall their taste. In the Letter G-V session, 7/9 (77.8%) participants showed activation in the IC with a latency of 401.7±34.7 ms (n = 7) from the onset of word exhibition. In 5/7 (71.4%) participants who exhibited IC activation, the PFC was activated prior to the IC at a latency of 315.2±56.5 ms (n = 5), which was significantly shorter than the latency to the IC activation. In the Picture G-V session, the IC was activated in 6/9 (66.7%) participants, and only 1/9 (11.1%) participants showed activation in the PFC. There was no significant dominance between the right and left IC or PFC during gustatory imagery. These results support those from our previous fMRI study in that the Letter G-V session rather than the Picture G-V session effectively activates the PFC and IC and strengthen the hypothesis that the PFC mediates "top-down" control of retrieving gustatory information from the storage of long-term memories and in turn activates the IC.

  1. Gustatory imagery reveals functional connectivity from the prefrontal to insular cortices traced with magnetoencephalography.

    Directory of Open Access Journals (Sweden)

    Masayuki Kobayashi

    Full Text Available Our experience and prejudice concerning food play an important role in modulating gustatory information processing; gustatory memory stored in the central nervous system influences gustatory information arising from the peripheral nervous system. We have elucidated the mechanism of the "top-down" modulation of taste perception in humans using functional magnetic resonance imaging (fMRI and demonstrated that gustatory imagery is mediated by the prefrontal (PFC and insular cortices (IC. However, the temporal order of activation of these brain regions during gustatory imagery is still an open issue. To explore the source of "top-down" signals during gustatory imagery tasks, we analyzed the temporal activation patterns of activated regions in the cerebral cortex using another non-invasive brain imaging technique, magnetoencephalography (MEG. Gustatory imagery tasks were presented by words (Letter G-V or pictures (Picture G-V of foods/beverages, and participants were requested to recall their taste. In the Letter G-V session, 7/9 (77.8% participants showed activation in the IC with a latency of 401.7±34.7 ms (n = 7 from the onset of word exhibition. In 5/7 (71.4% participants who exhibited IC activation, the PFC was activated prior to the IC at a latency of 315.2±56.5 ms (n = 5, which was significantly shorter than the latency to the IC activation. In the Picture G-V session, the IC was activated in 6/9 (66.7% participants, and only 1/9 (11.1% participants showed activation in the PFC. There was no significant dominance between the right and left IC or PFC during gustatory imagery. These results support those from our previous fMRI study in that the Letter G-V session rather than the Picture G-V session effectively activates the PFC and IC and strengthen the hypothesis that the PFC mediates "top-down" control of retrieving gustatory information from the storage of long-term memories and in turn activates the IC.

  2. Does taste matter? How anticipation of cola brands influences gustatory processing in the brain.

    Directory of Open Access Journals (Sweden)

    Simone Kühn

    Full Text Available Brands surround us everywhere in daily life. Here we investigate the influences of brand cues on gustatory processing of the same beverage. Participants were led to believe that the brand that announced the administration of a Cola mixture provided correct information about the drink to come. We found stronger fMRI signal in right mOFC during weak compared to strong brand cues in a contrast of parametric modulation with subjective liking. When directly comparing the two strong brands cues, more activation in the right amygdala was found for Coca Cola cues compared with Pepsi Cola cues. During the taste phase the same beverage elicited stronger activation in left ventral striatum when it was previously announced by a strong compared with a weak brand. This effect was stronger in participants who drink Cola infrequently and might therefore point to a stronger reliance on brand cues in less experienced consumers. The present results reveal strong effects of brand labels on neural responses signalling reward.

  3. Gustatory sensation of (L)- and (D)-amino acids in humans.

    Science.gov (United States)

    Kawai, Misako; Sekine-Hayakawa, Yuki; Okiyama, Atsushi; Ninomiya, Yuzo

    2012-12-01

    Amino acids are known to elicit complex taste, but most human psychophysical studies on the taste of amino acids have focused on a single basic taste, such as umami (savory) taste, sweetness, or bitterness. In this study, we addressed the potential relationship between the structure and the taste properties of amino acids by measuring the human gustatory intensity and quality in response to aqueous solutions of proteogenic amino acids in comparison to D-enantiomers. Trained subjects tasted aqueous solution of each amino acid and evaluated the intensities of total taste and each basic taste using a category-ratio scale. Each basic taste of amino acids showed the dependency on its hydrophobicity, size, charge, functional groups on the side chain, and chirality of the alpha carbon. In addition, the overall taste of amino acid was found to be the combination of basic tastes according to the partial structure. For example, hydrophilic non-charged middle-sized amino acids elicited sweetness, and L-enantiomeric hydrophilic middle-sized structure was necessary for umami taste. For example, L-serine had mainly sweet and minor umami taste, and D-serine was sweet. We further applied Stevens' psychophysical function to relate the total-taste intensity and the concentration, and found that the slope values depended on the major quality of taste (e.g., bitter large, sour small).

  4. Does taste matter? How anticipation of cola brands influences gustatory processing in the brain.

    Science.gov (United States)

    Kühn, Simone; Gallinat, Jürgen

    2013-01-01

    Brands surround us everywhere in daily life. Here we investigate the influences of brand cues on gustatory processing of the same beverage. Participants were led to believe that the brand that announced the administration of a Cola mixture provided correct information about the drink to come. We found stronger fMRI signal in right mOFC during weak compared to strong brand cues in a contrast of parametric modulation with subjective liking. When directly comparing the two strong brands cues, more activation in the right amygdala was found for Coca Cola cues compared with Pepsi Cola cues. During the taste phase the same beverage elicited stronger activation in left ventral striatum when it was previously announced by a strong compared with a weak brand. This effect was stronger in participants who drink Cola infrequently and might therefore point to a stronger reliance on brand cues in less experienced consumers. The present results reveal strong effects of brand labels on neural responses signalling reward.

  5. Comparative Evaluation of the Effect of Menstruation, Pregnancy and Menopause on Salivary Flow Rate, pH and Gustatory Function

    Science.gov (United States)

    Shetty, Vishwaprakash; Dave, Aparna; Arora, Manpreet; Hans, Vibha; Madan, Ajay

    2014-01-01

    Objective: There are five situations in a women’s life during which hormone fluctuations make them more susceptible to oral health problems – during puberty, at certain points in the monthly menstrual cycle, when using birth control pills, during pregnancy, and at menopause. The present study aimed at evaluating the effect of menstruation, pregnancy and menopause on salivary flow rate, pH and gustatory function. Materials and Methods: The study was carried out on 120 patients including 30 controls (with normal menstrual cycle of 28 to 30 d) and 90 cases (30 patients within three days of menstruation, 30 pregnant and 30 postmenopausal). Paraffin-stimulated saliva samples were obtained by expectoration to calculate salivary flow rate, pH was measured electrometically and patients were prospectively evaluated for gustatory function. Then, whole mouth taste test was performed in which the quality identification and intensity ratings of taste solutions were measured. Results: No statistically significant difference was found between the groups with respect to salivary flow rate but pH values were significantly lower in post menopausal women (pwomen than intensity of taste perception for other tastes (pwomen reported change in their dietary habits as all of them expressed liking for sweeter food. Conclusion: Reduced salivary flow rate and pH in postmen­opausal women may make them more prone to the occurrence of oral health problems. Also, pregnant and postmenopausal women appeared to have a reduced perception of sucrose, which can alter eating habits, such as intake of more sweet foods whereas no significant difference is observed in taste perception of NaCl, citric acid and quinine hydrochloride between the subjects. PMID:25478455

  6. Comparative Evaluation of the Effect of Menstruation, Pregnancy and Menopause on Salivary Flow Rate, pH and Gustatory Function.

    Science.gov (United States)

    Saluja, Pulin; Shetty, Vishwaprakash; Dave, Aparna; Arora, Manpreet; Hans, Vibha; Madan, Ajay

    2014-10-01

    There are five situations in a women's life during which hormone fluctuations make them more susceptible to oral health problems - during puberty, at certain points in the monthly menstrual cycle, when using birth control pills, during pregnancy, and at menopause. The present study aimed at evaluating the effect of menstruation, pregnancy and menopause on salivary flow rate, pH and gustatory function. The study was carried out on 120 patients including 30 controls (with normal menstrual cycle of 28 to 30 d) and 90 cases (30 patients within three days of menstruation, 30 pregnant and 30 postmenopausal). Paraffin-stimulated saliva samples were obtained by expectoration to calculate salivary flow rate, pH was measured electrometically and patients were prospectively evaluated for gustatory function. Then, whole mouth taste test was performed in which the quality identification and intensity ratings of taste solutions were measured. No statistically significant difference was found between the groups with respect to salivary flow rate but pH values were significantly lower in post menopausal women (pwomen than intensity of taste perception for other tastes (pwomen reported change in their dietary habits as all of them expressed liking for sweeter food. Reduced salivary flow rate and pH in postmen-opausal women may make them more prone to the occurrence of oral health problems. Also, pregnant and postmenopausal women appeared to have a reduced perception of sucrose, which can alter eating habits, such as intake of more sweet foods whereas no significant difference is observed in taste perception of NaCl, citric acid and quinine hydrochloride between the subjects.

  7. Accident and Off-Normal Response and Recovery from Multi-Canister Overpack (MCO) Processing Events

    International Nuclear Information System (INIS)

    ALDERMAN, C.A.

    2000-01-01

    In the process of removing spent nuclear fuel (SNF) from the K Basins through its subsequent packaging, drymg, transportation and storage steps, the SNF Project must be able to respond to all anticipated or foreseeable off-normal and accident events that may occur. Response procedures and recovery plans need to be in place, personnel training established and implemented to ensure the project will be capable of appropriate actions. To establish suitable project planning, these events must first be identified and analyzed for their expected impact to the project. This document assesses all off-normal and accident events for their potential cross-facility or Multi-Canister Overpack (MCO) process reversal impact. Table 1 provides the methodology for establishing the event planning level and these events are provided in Table 2 along with the general response and recovery planning. Accidents and off-normal events of the SNF Project have been evaluated and are identified in the appropriate facility Safety Analysis Report (SAR) or in the transportation Safety Analysis Report for Packaging (SARP). Hazards and accidents are summarized from these safety analyses and listed in separate tables for each facility and the transportation system in Appendix A, along with identified off-normal events. The tables identify the general response time required to ensure a stable state after the event, governing response documents, and the events with potential cross-facility or SNF process reversal impacts. The event closure is predicated on stable state response time, impact to operations and the mitigated annual occurrence frequency of the event as developed in the hazard analysis process

  8. Ejection fraction response to exercise in patients with chest pain and normal coronary arteriograms

    International Nuclear Information System (INIS)

    Gibbons, R.L.; Lee, K.L.; Cobb, F.; Jones, R.H.

    1981-01-01

    In this study we describe the ejection fraction response to upright exercise using first-pass radionuclide angiocardiography in a group of 60 patients with chest pain, normal coronary ateriograms and normal resting ventricular function. A wide range of resting function (heart rate and ejection fraction) and exercise function (heart rate, ejection fraction, peak work load and estimated peak oxygen uptake) were measured. The ejection fraction response to exercise demonstrated wide variation, ranging from a decrease of 23% to an increase of 24%. Six of 22 clinical and radionuclide angiocardiographic variables (resting ejection fraction, peak work load, age, sex, body surface area and the change in end-diastolic volume index with exercise) were significant univariate predictors of the ejection fraction response to exercise. Multivariable analysis identified resting ejection fraction, the change in end-diastolic volume index with exercise and either sex or peak work load as variables that provided significant independent predictive information. These observations indicate that the ejection fraction response to exercise is a complex response that is influenced by multiple physiologic variables. The wide variation in this population suggests that the ejection fraction response to exercise is not a reliable test for the diagnosis of coronary artery disease because of its low specificity

  9. Selective Deletion of Sodium Salt Taste during Development Leads to Expanded Terminal Fields of Gustatory Nerves in the Adult Mouse Nucleus of the Solitary Tract.

    Science.gov (United States)

    Sun, Chengsan; Hummler, Edith; Hill, David L

    2017-01-18

    Neuronal activity plays a key role in the development of sensory circuits in the mammalian brain. In the gustatory system, experimental manipulations now exist, through genetic manipulations of specific taste transduction processes, to examine how specific taste qualities (i.e., basic tastes) impact the functional and structural development of gustatory circuits. Here, we used a mouse knock-out model in which the transduction component used to discriminate sodium salts from other taste stimuli was deleted in taste bud cells throughout development. We used this model to test the hypothesis that the lack of activity elicited by sodium salt taste impacts the terminal field organization of nerves that carry taste information from taste buds to the nucleus of the solitary tract (NST) in the medulla. The glossopharyngeal, chorda tympani, and greater superficial petrosal nerves were labeled to examine their terminal fields in adult control mice and in adult mice in which the α-subunit of the epithelial sodium channel was conditionally deleted in taste buds (αENaC knockout). The terminal fields of all three nerves in the NST were up to 2.7 times greater in αENaC knock-out mice compared with the respective field volumes in control mice. The shapes of the fields were similar between the two groups; however, the density and spread of labels were greater in αENaC knock-out mice. Overall, our results show that disruption of the afferent taste signal to sodium salts disrupts the normal age-dependent "pruning" of all terminal fields, which could lead to alterations in sensory coding and taste-related behaviors. Neural activity plays a major role in the development of sensory circuits in the mammalian brain. To date, there has been no direct test of whether taste-elicited neural activity has a role in shaping central gustatory circuits. However, recently developed genetic tools now allow an assessment of how specific taste stimuli, in this case sodium salt taste, play a role

  10. Plasma Catecholamines, Sweat Electrolytes and Physiological Responses of Exercised Normal, Partial Anhidrotic and Anhidrotic Horses

    OpenAIRE

    A. Bashir; A. Rasedee

    2009-01-01

    Problem statement: Malaysia imports horses from temperate countries to develop equine sports in the country. Several of these horses developed partial and complete anhidrosis. Approach: Normal, partial anhidrotic and anhidrotic horses were exercised to determine their sweating and physiological responses to exercise. The heart and respiratory rates, rectal temperature and blood samples were obtained before the horses were lunged at 10 km h-­1 for 1 h and at again at 15, 30, 45, 60 min and 24 ...

  11. Responses of some normal tissues to low doses of γ-radiation

    International Nuclear Information System (INIS)

    Withers, H.R.

    1975-01-01

    The response of four normal tissues to low doses of γ-radiation was measured in mice using three indirect methods. The survival curves for cells of the tissues studied (colon, jejunum, testis and haemoleucopoietic system) may be exponential over an uncertain dose range (from zero to between 100 to 230 rad), the slope being about one third of that in the high-dose region. Some of the uncertainties in the data probably reflect variations in age-density distribution. (author)

  12. A radioactive waste transportation package monitoring system for normal transport and accident emergency response conditions

    International Nuclear Information System (INIS)

    Brown, G.S.; Cashwell, J.W.; Apple, M.L.

    1993-01-01

    This paper addresses spent fuel and high level waste transportation history and prospects, discusses accident histories of radioactive material transport, discusses emergency responder needs and provides a general description of the Transportation Intelligent Monitoring System (TRANSIMS) design. The key objectives of the monitoring system are twofold: (1) to facilitate effective emergency response to accidents involving a radioactive waste transportation package, while minimizing risk to the public and emergency first-response personnel, and (2) to allow remote monitoring of transportation vehicle and payload conditions to enable research into radioactive material transportation for normal and accident conditions. (J.P.N.)

  13. Nystagmus responses in a group of normal humans during earth-horizontal axis rotation

    Science.gov (United States)

    Wall, Conrad, III; Furman, Joseph M. R.

    1989-01-01

    Horizontal eye movement responses to earth-horizontal yaw axis rotation were evaluated in 50 normal human subjects who were uniformly distributed in age (20-69 years) and each age group was then divided by gender. Subjects were rotated with eyes open in the dark, using clockwise and counter-clockwise 60 deg velocity trapezoids. The nystagmus slow component velocity is analyzed. It is shown that, despite large intersubject variability, parameters which describe earth-horizontal yaw axis responses are loosely interrelated, and some of them vary significantly with gender and age.

  14. Behavioral analysis of Drosophila transformants expressing human taste receptor genes in the gustatory receptor neurons.

    Science.gov (United States)

    Adachi, Ryota; Sasaki, Yuko; Morita, Hiromi; Komai, Michio; Shirakawa, Hitoshi; Goto, Tomoko; Furuyama, Akira; Isono, Kunio

    2012-06-01

    Transgenic Drosophila expressing human T2R4 and T2R38 bitter-taste receptors or PKD2L1 sour-taste receptor in the fly gustatory receptor neurons and other tissues were prepared using conventional Gal4/UAS binary system. Molecular analysis showed that the transgene mRNAs are expressed according to the tissue specificity of the Gal4 drivers. Transformants expressing the transgene taste receptors in the fly taste neurons were then studied by a behavioral assay to analyze whether transgene chemoreceptors are functional and coupled to the cell response. Since wild-type flies show strong aversion against the T2R ligands as in mammals, the authors analyzed the transformants where the transgenes are expressed in the fly sugar receptor neurons so that they promote feeding ligand-dependently if they are functional and activate the neurons. Although the feeding preference varied considerably among different strains and individuals, statistical analysis using large numbers of transformants indicated that transformants expressing T2R4 showed a small but significant increase in the preference for denatonium and quinine, the T2R4 ligands, as compared to the control flies, whereas transformants expressing T2R38 did not. Similarly, transformants expressing T2R38 and PKD2L1 also showed a similar preference increase for T2R38-specific ligand phenylthiocarbamide (PTC) and a sour-taste ligand, citric acid, respectively. Taken together, the transformants expressing mammalian taste receptors showed a small but significant increase in the feeding preference that is taste receptor and also ligand dependent. Although future improvements are required to attain performance comparable to the endogenous robust response, Drosophila taste neurons may serve as a potential in vivo heterologous expression system for analyzing chemoreceptor function.

  15. Genomic instability: potential contributions to tumour and normal tissue response, and second tumours, after radiotherapy

    International Nuclear Information System (INIS)

    Hendry, Jolyon H.

    2001-01-01

    Purpose: Induced genomic instability generally refers to a type of damage which is transmissible down cell generations, and which results in a persistently enhanced frequency of de novo mutations, chromosomal abnormalities or lethality in a significant fraction of the descendant cell population. The potential contribution of induced genomic instability to tumour and normal tissue response, and second tumours, after radiotherapy, is explored. Results: The phenomenon of spontaneous genomic instability is well known in some rare genetic diseases (e.g. Gorlin's syndrome), and there is evidence in such cases that it can lead to a greater propensity for carcinogenesis (with shortened latency) which is enhanced after irradiation. It is unclear what role induced genomic instability plays in the response of normal individuals, but persistent chromosomal instability has been detected in vivo in lymphocytes and keratinocytes from irradiated normal individuals. Such induced genomic instability might play some role in tumour response in a subset of tumours with specific defects in damage response genes, but again its contribution to radiocurability in the majority of cancer patients is unclear. In normal tissues, genomic instability induced in wild-type cells leading to delayed cell death might contribute to more severe or prolonged early reactions as a consequence of increased cell loss, a longer time required for recovery, and greater residual injury. In tumours, induced genomic instability reflected in delayed reductions in clonogenic capacity might contribute to the radiosensitivity of primary tumours, and also to a lower incidence, longer latency and slower growth rate of recurrences and metastases. Conclusions: The evidence which is reviewed shows that there is little information at present to support these propositions, but what exists is consistent with their expectations. Also, it is not yet clear to what extent mutations associated with genomic instability

  16. Responsiveness of cardiodynamics to exercise loading in normal subjects and in patients with idiopathic cardiomyopathy

    International Nuclear Information System (INIS)

    Fukuoka, Yukie; Matsuda, Takeshi

    1996-01-01

    In the present study, we examined the responses of the left ventricular systolic function and diastolic function to exertion by cardiac blood pool scintigraphy using 99mTc in reference to changes with aging and changes in the cases of idiopathic cardiomyopathy. In order to study the functional response with aging to exertion, 38 normal subjects were divided by age. Subsequently, 28 hypertrophic cardiomyopathy cases (Group H), 13 dilated cardiomyopathy cases (Group D) and 14 normal cases (Group N) were studied. Ejection Fraction (EF) and Peak Ejection Rate (PER) were used as the indicators for the systolic function. Peak Filling Rate (PER), 1/3 Filling Rate (1/3FR) and Time to Peak Filling (TPF) were used as the indicators for the diastolic function. When comparison was made among the normal subjects by age, the systolic function and diastolic function at rest, varied as they were, showed no significant change with aging. The %delta EF and %delta PER tended to decrease linearly with aging (Y=-4E-X+28, p<0.0001; Y=-X+57, p<0.0001). As to the %delta PFR, %delta 1/3FR and %delta TPF, however, correlation with aging was not found. In comparing hypertrophic cardiomyopathy and dilated cardiomyopathy, Group D showed significantly lower values before exertion and after maximum exertion than the other two groups. A difference in the response of the systolic function and diastolic function to exertion was noted in both the comparative study on aging of the normal subjects and the study of cases of cardiomyopathy. The presence of the compensatory mechanism due to elevation of the left atrial pressure and an increase in the left atrial contractile power may be mentioned as a reservoir of blood and also as a booster pump. Particularly, the effect of the latter compensates for the decline in the left ventricular compliance, which may lead to the maintenance of the diastolic function. (K.H.)

  17. Radiobiological predictors of tumor and acute normal tissue response in radiotherapy for head and neck cancers

    International Nuclear Information System (INIS)

    Maciejewski, B.; Skladowski, K.; Zajusz, A.

    1991-01-01

    The importance of measurements of the potential doubling time (T pot. ) and of the survival fraction at 2.0 Gy (SF 2 ), and a method modifying acute radiation response of normal oral mucosa are discussed. Tumor clonogen repopulation accelerates around day 28 of the treatment, and the rate of repopulation is not constant but continuously increases from about 0.3 Gy/day to 1.0-1.3 Gy/day between day 28 and 65 of the treatment. This may suggest that T pot. values decrease correspondingly. The relevance of prior-to-treatment T pot. measurements to clinical situations is discussed. The SF 2 value reflects the intrinsic radiosensitivity of human tumors. The SF 2 values are expected to be valuable as predictors for tumor response to irradiation. Variations in the SF 2 values depending on tumor characteristics and assay methods are discussed in relation to the dose response and tumor cure probability. The effect of modifying the repopulation rate in the oral mucosa by stimulation with a 2% silver nitrate solution is discussed. Although these prognosticators are different in their nature, they might provide a rational basis for selecting patients into optimal irradiation treatment and might allow to modify the radiation response of dose-limiting normal tissues. (author). 5 figs., 1 tab., 28 refs

  18. Proprietary tomato extract improves metabolic response to high-fat meal in healthy normal weight subjects

    Directory of Open Access Journals (Sweden)

    Xavier Deplanque

    2016-10-01

    Full Text Available Background: Low-density lipoprotein (LDL oxidation is a risk factor for atherosclerosis. Lycopene and tomato-based products have been described as potent inhibitors of LDL oxidation. Objectives: To evaluate the effect of a 2-week supplementation with a carotenoid-rich tomato extract (CRTE standardized for a 1:1 ratio of lycopene and phytosterols, on post-prandial LDL oxidation after a high-fat meal. Design: In a randomized, double-blind, parallel-groups, placebo-controlled study, 146 healthy normal weight individuals were randomly assigned to a daily dose of CRTE standardized for tomato phytonutrients or placebo during 2 weeks. Oxidized LDL (OxLDL, glucose, insulin, and triglyceride (TG responses were measured for 8 h after ingestion of a high-fat meal before and at the end of intervention. Results: Plasma lycopene, phytofluene, and phytoene were increased throughout the study period in the CRTE group compared to placebo. CRTE ingestion significantly improved changes in OxLDL response to high-fat meal compared to placebo after 2 weeks (p<0.0001. Changes observed in glucose, insulin, and TG responses were not statistically significant after 2 weeks of supplementation, although together they may suggest a trend of favorable effect on metabolic outcomes after a high-fat meal. Conclusions: Two-week supplementation with CRTE increased carotenoids levels in plasma and improved oxidized LDL response to a high-fat meal in healthy normal weight individuals.

  19. Influence of ventilation and hypocapnia on sympathetic nerve responses to hypoxia in normal humans.

    Science.gov (United States)

    Somers, V K; Mark, A L; Zavala, D C; Abboud, F M

    1989-11-01

    The sympathetic response to hypoxia depends on the interaction between chemoreceptor stimulation (CRS) and the associated hyperventilation. We studied this interaction by measuring sympathetic nerve activity (SNA) to muscle in 13 normal subjects, while breathing room air, 14% O2, 10% O2, and 10% O2 with added CO2 to maintain isocapnia. Minute ventilation (VE) and blood pressure (BP) increased significantly more during isocapnic hypoxia (IHO) than hypocapnic hypoxia (HHO). In contrast, SNA increased more during HHO [40 +/- 10% (SE)] than during IHO (25 +/- 19%, P less than 0.05). To determine the reason for the lesser increase in SNA with IHO, 11 subjects underwent voluntary apnea during HHO and IHO. Apnea potentiated the SNA responses to IHO more than to HHO. SNA responses to IHO were 17 +/- 7% during breathing and 173 +/- 47% during apnea whereas SNA responses to HHO were 35 +/- 8% during breathing and 126 +/- 28% during apnea. During ventilation, the sympathoexcitation of IHO (compared with HHO) is suppressed, possibly for two reasons: 1) because of the inhibitory influence of activation of pulmonary afferents as a result of a greater increase in VE, and 2) because of the inhibitory influence of baroreceptor activation due to a greater rise in BP. Thus in humans, the ventilatory response to chemoreceptor stimulation predominates and restrains the sympathetic response. The SNA response to chemoreceptor stimulation represents the net effect of the excitatory influence of the chemoreflex and the inhibitory influence of pulmonary afferents and baroreceptor afferents.

  20. Estimating Non-Normal Latent Trait Distributions within Item Response Theory Using True and Estimated Item Parameters

    Science.gov (United States)

    Sass, D. A.; Schmitt, T. A.; Walker, C. M.

    2008-01-01

    Item response theory (IRT) procedures have been used extensively to study normal latent trait distributions and have been shown to perform well; however, less is known concerning the performance of IRT with non-normal latent trait distributions. This study investigated the degree of latent trait estimation error under normal and non-normal…

  1. Awareness of dysgeusia and gustatory tests in patients undergoing chemotherapy for breast cancer.

    Science.gov (United States)

    Kuba, Sayaka; Fujiyama, Rie; Yamanouchi, Kosho; Morita, Michi; Sakimura, Chika; Hatachi, Toshiko; Matsumoto, Megumi; Yano, Hiroshi; Takatsuki, Mitsuhisa; Hayashida, Naomi; Nagayasu, Takeshi; Eguchi, Susumu

    2018-05-12

    We analyzed the prevalence of gustatory test abnormalities in breast cancer (BC) patients undergoing chemotherapy. We enrolled 43 BC patients undergoing chemotherapy and 38 BC patients who had never undergone chemotherapy (control group). Two gustatory tests were conducted: an instillation method examining the threshold for four basic taste stimuli and an electrogustometry method measuring the threshold for perception with electric stimulation at the front two-thirds of the tongue (cranial nerve VII) and at the back third of the tongue (cranial nerve IX). The results of the two gustatory tests and clinicopathological factors were compared between the chemotherapy and control groups and between patients with and without awareness of dysgeusia in the chemotherapy group. In the chemotherapy group, 19 (44%) patients were aware of dysgeusia and 8 (19%) had hypogeusia using the instillation method. Although more patients had parageusia in the chemotherapy than control group, no significant differences in the results of the two gustatory tests were observed. Patients with dysgeusia awareness had a higher threshold at cranial nerve IX using the electrogustometry method than those without dysgeusia awareness; no significant differences in hypogeusia were observed using the instillation method. In fact, 74% (14/19) of patients with dysgeusia awareness could identify the four tastes accurately using the instillation method. Similar results were observed for the instillation and electrogustometry methods at cranial nerve VII. While approximately half of the chemotherapy patients were aware of dysgeusia, 81% (35/43) of them could accurately identify the four basic tastes using the instillation method.

  2. Effect of short-term fasting on lipolytic responsiveness in normal and obese human subjects

    International Nuclear Information System (INIS)

    Wolfe, R.R.; Peters, E.J.; Klein, S.; Holland, O.B.; Rosenblatt, J.; Gary, H. Jr.

    1987-01-01

    In this study the rate of lipolysis (fatty acid and glycerol release into blood) has been quantified in both normal weight and obese volunteers after both 15 and 87 h of fasting. In each study, the basal rate and subsequent response to epinephrine infusion were determined. The rate of appearance (R/sub a/) of free fatty acids (FFA) and glycerol were quantified by infusion of [1- 13 C]palmitate and D-5-glycerol, respectively. Substrate flux rates per unit of body fat mass and lean body mass were calculated from total body water measurements using H 2 18 O dilution. In normal volunteers, the basal R/sub a/ FFA and R/sub a/ glycerol rose markedly with 87 h of fasting, whereas the increases were more modest in the obese subjects. However, the rate of mobilization of fat, in relation to the lean body mass, was higher in the obese subjects than in the normal subjects after 15 h of fasting, and the values were similar in both groups after 87 h of fasting. There was an increased lipolytic response to epinephrine after fasting in both groups. This increased sensitivity may have resulted from the enhancement of fatty acid-triglyceride substrate cycling that occurred after fasting

  3. On- and off-response ERGs elicited by sawtooth stimuli in normal subjects and glaucoma patients.

    Science.gov (United States)

    Pangeni, Gobinda; Lämmer, Robert; Tornow, Ralf P; Horn, Folkert K; Kremers, Jan

    2012-06-01

    The aim of this study is to measure the on- and off-responses and their response asymmetries elicited by sawtooth stimuli in normal subjects and glaucoma patients. Furthermore, the correlation between the ERGs and other functional and structural parameters are investigated. Full-field stimuli were produced using a Ganzfeld bowl with Light Emitting Diodes (LEDs) as light sources. On- and off-response ERGs were recorded from 17 healthy subjects, 12 pre-perimetric and 15 perimetric glaucoma patients using 4-Hz luminance rapid-on and rapid-off sawtooth stimuli (white light; mean luminance 55 cd/m(2)) at 100% contrast. The on- and off-responses were added to study response asymmetries. In addition, flash ERGs were elicited by red stimuli (200 cd/m(2)) on a blue background (10 cd/m(2)). The mean deviations (MD) of the visual field defects were obtained by standard automated perimetry. The retinal nerve fibre layer thickness (RNFLT) was measured with Spectral Domain Optical Coherence Tomography (SOCT). We studied the correlation between ERG response amplitudes, visual field mean deviation (MDs) and RNFLT values. The on-responses showed an initial negative (N-on) followed by a positive (P-on), a late positive (LP-on) and a late negative responses (LN-on). The off-responses showed an initial positive (P-off) a late positive (LP-off) and a late negative response (LN-off). The addition of on- and off-responses revealed an initial positive (P-add) and a late negative response (LN-add). The on-response components (N-on, P-on and LN-on) in the glaucoma patients were relatively similar to those of the control subjects. However, the LP-on was significantly elevated (p = 0.03) in perimetric patients. The LP-off was significantly elevated (p < 0.001), and the amplitude of LN-off was significantly reduced in perimetric patients (p = 0.02). The LN-add amplitude was significantly reduced (p < 0.001) and delayed (p = 0.03) in perimetric patients. The amplitudes of the LN-off and LN

  4. Why a disaster is not just normal business ramped up: Disaster response among ED nurses.

    Science.gov (United States)

    Hammad, Karen S; Arbon, Paul; Gebbie, Kristine; Hutton, Alison

    2017-11-15

    The emergency department (ED) is a familiar place for the emergency nurse who spends their working days inside it. A disaster threatens that familiarity and creates changes that make working in the ED during a disaster response different from the everyday experience of working in the ED. This research reports on an aspect of the findings from a larger study about the experience of working as a nurse in the ED during a disaster response. Thirteen nurses from 8 different countries were interviewed about their experience. The findings from this research demonstrate that a disaster event leads to a chain reaction of changes in process, space and practice. Nurses' respond to the news of a disaster event with shock and disbelief. The ED may change as a result of the event requiring nurses to work in an altered environment or a completely different setting. These changes provoke nurses to alter their behaviour and practice and reflect on the experience after the response. Emergency nurses have a high likelihood of participating in disaster response and as such should be adequately prepared. This highlights how disaster response is different and leads to recommendations to enhance training for emergency nurses which will better prepare them Disasterresponse is not normal business ramped up. There are a number of challenges and changes that should be considered when preparing emergency nurses for the realities of disaster response. Copyright © 2017 College of Emergency Nursing Australasia. All rights reserved.

  5. Over-the-road tests of nuclear materials package response to normal environments

    International Nuclear Information System (INIS)

    Gwinn, K.W.; Glass, R.E.; Edwards, K.R.

    1991-12-01

    In support of the development of American National Standards Institute standards for the transport of radioactive materials, Sandia has a program to characterize the normal transport environment. This program includes both analytical modeling of package and trailer responses, and over-the-road tests to measure those responses. This paper presents the results of a series of over-the-road tests performed using Chem-Nuclear equipment in the Barnwell, SC, area. The test events included a variety of road types such as rough concrete, shock events such as railroad grade crossings, and driver responses such as sharp turns. The response of the package and trailer to these events was measured with accelerometers at various locations to determine the inertial loads. Either load cells or strain gages were used to measure tiedown response. These accelerations and loads were measured on systems with flexible and ''rigid'' tiedowns. The results indicated that while significant accelerations occur on the trailer bed, these do not translate into equivalent loads in either the package or the tiedown system. This indicates that trailer-bed response should not be used in determining the load factor for fatigue calculations of the package components or in determining design loads for tiedowns

  6. Sex-related differences in the normal cardiac response to upright exercise

    International Nuclear Information System (INIS)

    Higginbotham, M.B.; Morris, K.G.; Coleman, R.E.; Cobb, F.R.

    1984-01-01

    In previous studies from this laboratory, it was found that approximately 30% of women with chest pain and normal coronary arteries demonstrated either a decrease in or a failure to increase radionuclide ejection fraction during exercise. To examine the hypothesis that this apparent abnormality in left ventricular function represents a physiologic difference between men and women, a prospective study was made of central and peripheral cardiovascular responses to exercise in 31 age-matched healthy volunteers (16 women and 15 men). A combination of quantitative radionuclide (technetium) angiography and expired-gas analysis was used to measure ejection fraction and relative changes in end-diastolic counts, stroke counts, count output, and arteriovenous oxygen difference during symptom-limited upright bicycle exercise. Normal male and female volunteers demonstrated comparable baseline left ventricular function and similar aerobic capacity, as determined by weight-adjusted peak oxygen consumption. However, their cardiac responses to exercise were significantly different. The ejection fraction increased by 5 points or more in 14 of 15 men, but in only seven of the 16 women. End-diastolic counts increased by 30% in women, but was unchanged in men. Because decreases in ejection fraction were matched by increases in end-diastolic counts, relative increases in stroke counts and count output were the same for men and women. These data demonstrate a basic difference between men and women with respect to the mechanism by which they achieve a normal response of stroke volume to exercise; these differences must be taken into account when measurements of cardiac function during exercise stress are used for diagnostic purposes

  7. Normalize the response of EPID in pursuit of linear accelerator dosimetry standardization.

    Science.gov (United States)

    Cai, Bin; Goddu, S Murty; Yaddanapudi, Sridhar; Caruthers, Douglas; Wen, Jie; Noel, Camille; Mutic, Sasa; Sun, Baozhou

    2018-01-01

    Normalize the response of electronic portal imaging device (EPID) is the first step toward an EPID-based standardization of Linear Accelerator (linac) dosimetry quality assurance. In this study, we described an approach to generate two-dimensional (2D) pixel sensitivity maps (PSM) for EPIDs response normalization utilizing an alternative beam and dark-field (ABDF) image acquisition technique and large overlapping field irradiations. The automated image acquisition was performed by XML-controlled machine operation and the PSM was generated based on a recursive calculation algorithm for Varian linacs equipped with aS1000 and aS1200 imager panels. Cross-comparisons of normalized beam profiles and 1.5%/1.5 mm 1D Gamma analysis was adopted to quantify the improvement of beam profile matching before and after PSM corrections. PSMs were derived for both photon (6, 10, 15 MV) and electron (6, 20 MeV) beams via proposed method. The PSM-corrected images reproduced a horn-shaped profile for photon beams and a relative uniform profiles for electrons. For dosimetrically matched linacs equipped with aS1000 panels, PSM-corrected images showed increased 1D-Gamma passing rates for all energies, with an average 10.5% improvement for crossline and 37% for inline beam profiles. Similar improvements in the phantom study were observed with a maximum improvement of 32% for 15 MV and 22% for 20 MeV. The PSM value showed no significant change for all energies over a 3-month period. In conclusion, the proposed approach correct EPID response for both aS1000 and aS1200 panels. This strategy enables the possibility to standardize linac dosimetry QA and to benchmark linac performance utilizing EPID as the common detector. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

  8. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, W.A.; Wike, J.; Tucker, S.L.

    1995-01-01

    To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs

  9. A dynamic elastic-visco-plastic unilateral contact problem with normal damped response and Coulomb friction

    Czech Academy of Sciences Publication Activity Database

    Eck, Ch.; Jarušek, Jiří; Sofonea, M.

    2010-01-01

    Roč. 21, č. 3 (2010), s. 229-251 ISSN 0956-7925 R&D Projects: GA AV ČR IAA100750802 Institutional research plan: CEZ:AV0Z10190503 Keywords : elastic-vosco plastic material * dynamic contact problem * normal damped response * unilateral constraint * Coulomb friction * weak solution * penalitazion * smoothing Subject RIV: BA - General Mathematics Impact factor: 1.480, year: 2010 http://journals.cambridge.org/action/displayAbstract?fromPage=online&aid=7675484&fileId=S0956792510000045

  10. Central leptin action on euglycemia restoration in type 1 diabetes: Restraining responses normally induced by fasting?

    Science.gov (United States)

    Xu, Yuanzhong; Tong, Qingchun

    2017-07-01

    Leptin monotherapy is sufficient to restore euglycemia in insulinopenic type 1 diabetes (T1D), yet the underlying mechanism remains poorly understood. Accumulating evidence demonstrates that the brain mediates the leptin action on euglycemia restoration. Here, we first review evidence supporting that symptoms in T1D resemble an uncontrolled response to fasting. Then, we discuss recent research progress on brain neurons and their neurotransmitters that potentially mediate the leptin action. Finally, peripheral effective pathways, which are normally involved in fasting responses and associated with leptin action on euglycemia restoration in T1D, will also be discussed. This summary complements several previous excellent reviews on this topic (Meek and Morton, 2016; Perry et al., 2016; Fujikawa and Coppari, 2015). A deep understanding of neurocircuitry and the peripheral effective pathways that mediate the leptin action on euglycemia restoration will likely lead to novel targets for an insulin-independent therapeutics against T1D. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. The medical reshaping of disabled bodies as a response to stigma and a route to normality.

    Science.gov (United States)

    McLaughlin, Janice

    2017-12-01

    Disabled people are said to experience stigma because their embodied presence in the world does not fit with how others interact and use their bodies to be social participants. In response they can turn to medical procedures, such as surgery or physiotherapy, in order to reshape their bodies to more closely approximate norms of social interaction and embodiment. This paper explores how medicine plays a role in attempts to be recognised by others as normal and acceptable by minimising disability. It will do so via a focus on disabled young people, in order to explore how their emerging identities and aspirations for the future influence how they think about their bodies, what normality means and their participation in multiple activities that work on their bodies. The paper draws from an Economic and Social Research Council (ESRC) project that used a range of qualitative research methods with a group of disabled young people. The project explored ways in which participants actively worked on their bodies to be more normal and examined the disciplinary and agency dynamics involved in this work. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  12. Biological responses of progestogen metabolites in normal and cancerous human breast.

    Science.gov (United States)

    Pasqualini, Jorge R; Chetrite, Gérard S

    2010-12-01

    At present, more than 200 progestogen molecules are available, but their biological response is a function of various factors: affinity to progesterone or other receptors, their structure, the target tissues considered, biological response, experimental conditions, dose, method of administration and metabolic transformations. Metabolic transformation is of huge importance because in various biological processes the metabolic product(s) not only control the activity of the maternal hormone but also have an important activity of its own. In this regard, it was observed that the 20-dihydro derivative of the progestogen dydrogesterone (Duphaston®) is significantly more active than the parent compound in inhibiting sulfatase and 17β-hydroxysteroid dehydrogenase in human breast cancer cells. Estrone sulfatase activity is also inhibited by norelgestromin, a norgestimate metabolite. Interesting information was obtained with a similar progestogen, tibolone, which is rapidly metabolized into the active 3α/3β-hydroxy and 4-ene metabolites. All these metabolites can inhibit sulfatase and 17β-hydroxysteroid dehydrogenase and stimulate sulfotransferase in human breast cancer cells. Another attractive aspect is the metabolic transformation of progesterone itself in human breast tissues. In the normal breast progesterone is mainly converted to 4-ene derivatives, whereas in the tumor tissue it is converted mostly to 5α-pregnane derivatives. 20α-Dihydroprogesterone is found mainly in normal breast tissue and possesses antiproliferative properties as well as the ability to act as an anti-aromatase agent. Consequently, this progesterone metabolite could be involved in the control of estradiol production in the normal breast and therefore implicated in one of the multifactorial mechanisms of the breast carcinogenesis process. In conclusion, a better understanding of both natural and synthetic hormone metabolic transformations and their control could potentially provide

  13. Postprandial glucose response to selected tropical fruits in normal glucose-tolerant Nigerians.

    Science.gov (United States)

    Edo, A; Eregie, A; Adediran, O; Ohwovoriole, A; Ebengho, S

    2011-01-01

    The glycemic response to commonly eaten fruits in Nigeria has not been reported. Therefore, this study assessed the plasma glucose response to selected fruits in Nigeria. Ten normal glucose-tolerant subjects randomly consumed 50 g carbohydrate portions of three fruits: banana (Musa paradisiaca), pineapple (Ananus comosus), and pawpaw (Carica papaya), and a 50-g glucose load at 1-week intervals. Blood samples were collected in the fasting state and half-hourly over a 2-h period post-ingestion of the fruits or glucose. The samples were analyzed for plasma glucose concentrations. Plasma glucose responses were assessed by the peak plasma glucose concentration, maximum increase in plasma glucose, 2-h postprandial plasma glucose level, and incremental area under the glucose curve and glycemic index (GI). The results showed that the blood glucose response to these three fruits was similar in terms of their incremental areas under the glucose curve, maximum increase in plasma glucose, and glycemic indices (GIs). The 2-h postprandial plasma glucose level of banana was significantly higher than that of pineapple, P < 0.025. The mean ± SEM GI values were as follows: pawpaw; 86 ± 26.8%; banana, 75.1 ± 21.8%; pineapple, 64.5 ± 11.3%. The GI of glucose is taken as 100. The GI of pineapple was significantly lower than that of glucose (P < 0.05). Banana, pawpaw, and pineapple produced a similar postprandial glucose response. Measured portions of these fruits may be used as fruit exchanges with pineapple having the most favorable glycemic response.

  14. DESCRIPTION OF BRAINSTEM AUDITORY EVOKED RESPONSES (AIR AND BONE CONDUCTION IN CHILDREN WITH NORMAL HEARING

    Directory of Open Access Journals (Sweden)

    A. V. Pashkov

    2014-01-01

    Full Text Available Diagnosis of hearing level in small children with conductive hearing loss associated with congenital craniofacial abnormalities, particularly with agenesis of external ear and external auditory meatus is a pressing issue. Conventional methods of assessing hearing in the first years of life, i. e. registration of brainstem auditory evoked responses to acoustic stimuli in the event of air conduction, does not give an indication of the auditory analyzer’s condition due to potential conductive hearing loss in these patients. This study was aimed at assessing potential of diagnosing the auditory analyzer’s function with registering brainstem auditory evoked responses (BAERs to acoustic stimuli transmitted by means of a bone vibrator. The study involved 17 children aged 3–10 years with normal hearing. We compared parameters of registering brainstem auditory evoked responses (peak V depending on the type of stimulus transmission (air/bone in children with normal hearing. The data on thresholds of the BAERs registered to acoustic stimuli in the event of air and bone conduction obtained in this study are comparable; hearing thresholds in the event of acoustic stimulation by means of a bone vibrator correlates with the results of the BAERs registered to the stimuli transmitted by means of air conduction earphones (r = 0.9. High correlation of thresholds of BAERs to the stimuli transmitted by means of a bone vibrator with thresholds of BAERs registered when air conduction earphones were used helps to assess auditory analyzer’s condition in patients with any form of conductive hearing loss.  

  15. Functional changes of the gustatory organ caused by local radiation exposure during radiotherapy of the head-and-neck region

    International Nuclear Information System (INIS)

    Kamprad, F.; Hildebrandt, G.; Ranft, D.; Weber, A.

    2008-01-01

    Purpose: The aim of this prospective study was to investigate how often and at which dose levels gustatory disturbances appear during radiotherapy of the tongue and to which extent permanent gustatory deficiencies occur. Patients and Methods: The study included 44 patients treated by definitive irradiation for malignant head-and-neck tumors. In 22 patients the posterior two thirds of the tongue (group 1), and in the other 22 patients the entire tongue (group 2) were exposed to radiation. The control group comprised 30 patients with non-small cell lung cancer receiving definitive radiation therapy (group 3). The dose distribution in the tongue area was calculated using CT-based three-dimensional planning. Before, during and after irradiation the gustatory function was determined by means of gustometry and correlated with the corresponding results of enoral inspection and the patients' subjective statements on gustatory function. Results: The gustatory ability of the control group was not affected, whereas patients in the locally irradiated groups in parallel with enoral mucositis suffered from loss of gustatory function after a total dose of 20 Gy with a maximum between 40 and 60 Gy. Supportive measures had little influence on acute side effects. The gustatory disturbances regressed within 8 weeks after radiotherapy in patients with partial-tongue irradiation and almost completely after 6 months in patients with entire-tongue irradiation. Conclusion: The severity of gustatory disturbances and the longer recovery time in patients with entire-tongue irradiation suggest an influence of the volume exposed. Therefore, reduction of the highly exposed tongue volume by intensity-modulated radiotherapy opens up possibilities for a reduction of this undesirable side effect. (orig.)

  16. Functional changes of the gustatory organ caused by local radiation exposure during radiotherapy of the head-and-neck region

    Energy Technology Data Exchange (ETDEWEB)

    Kamprad, F.; Hildebrandt, G. [University Hospital Leipzig AoeR (Germany). Dept. of Radiotherapy and Radiooncology; Ranft, D. [Universitaetsklinikum Greifswald GmbH (Germany). MVZ-Medizinisches Versorgungszentrum; Weber, A. [Sana Klinikum Remscheid (Germany). ENT Dept.

    2008-03-15

    Purpose: The aim of this prospective study was to investigate how often and at which dose levels gustatory disturbances appear during radiotherapy of the tongue and to which extent permanent gustatory deficiencies occur. Patients and Methods: The study included 44 patients treated by definitive irradiation for malignant head-and-neck tumors. In 22 patients the posterior two thirds of the tongue (group 1), and in the other 22 patients the entire tongue (group 2) were exposed to radiation. The control group comprised 30 patients with non-small cell lung cancer receiving definitive radiation therapy (group 3). The dose distribution in the tongue area was calculated using CT-based three-dimensional planning. Before, during and after irradiation the gustatory function was determined by means of gustometry and correlated with the corresponding results of enoral inspection and the patients' subjective statements on gustatory function. Results: The gustatory ability of the control group was not affected, whereas patients in the locally irradiated groups in parallel with enoral mucositis suffered from loss of gustatory function after a total dose of 20 Gy with a maximum between 40 and 60 Gy. Supportive measures had little influence on acute side effects. The gustatory disturbances regressed within 8 weeks after radiotherapy in patients with partial-tongue irradiation and almost completely after 6 months in patients with entire-tongue irradiation. Conclusion: The severity of gustatory disturbances and the longer recovery time in patients with entire-tongue irradiation suggest an influence of the volume exposed. Therefore, reduction of the highly exposed tongue volume by intensity-modulated radiotherapy opens up possibilities for a reduction of this undesirable side effect. (orig.)

  17. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

    1995-01-01

    Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

  18. Identification of a sugar gustatory receptor and its effect on fecundity of the brown planthopper Nilaparvata lugens.

    Science.gov (United States)

    Chen, Wei-Wen; Kang, Kui; Yang, Pan; Zhang, Wen-Qing

    2017-11-27

    In insects, the gustatory system plays a crucial role in multiple physiological behaviors, including feeding, toxin avoidance, courtship, mating and oviposition. Gustatory stimuli from the environment are recognized by gustatory receptors. To date, little is known about the function of gustatory receptors in agricultural pest insects. In this study, we cloned a sugar gustatory receptor gene, NlGr11, from the brown planthopper (BPH), Nilaparvata lugens (Stål), a serious pest of rice in Asia; we then identified its ligands, namely, fructose, galactose and arabinose, by calcium imaging assay. After injection of NlGr11 double-stranded RNA, we found that the number of eggs laid by BPH decreased. Moreover, we found that NlGr11 inhibited the phosphorylation of adenosine monophosphate-activated protein kinase (AMPK) and promoted the phosphorylation of protein kinase B (AKT). These findings demonstrated that NlGr11 could accelerate the fecundity of BPH through AMPK- and AKT-mediated signaling pathways. This is the first report to indicate that a gustatory receptor modulates the fecundity of insects and that the receptor could be a potential target for pest control. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  19. Application of MR diffusion-weighted imaging in the evaluation of salivary glands with gustatory stimulation

    International Nuclear Information System (INIS)

    Zhang Yunyan; Ou Dan; Gu Yajia; He Xiayun; Mao Jian; Shen Xigang; Yue Lei; Peng Weijun

    2012-01-01

    Objective: To evaluate the function of the salivary glands with gustatory stimulation by using MR DWI. Methods: A prospective study was conducted in 30 patients with nasopharyngeal carcinoma who had normal salivary function. A DWI sequence was performed on the salivary glands at resting state, and continually repeated on the parotid immediately after oral ascorbic acid stimulation over a period of 21 minutes (once every 18 seconds). The multiple b-values (0, 400, 600, 800, 1000 s/mm 2 ) were used. ADC maps were evaluated with a manually placed region of interest including the entire salivary gland. The ADC of each gland was obtained by taking the mean of values on three contiguous sections containing the largest areas of the gland. The paired two-tailed Student t test was used to compare the ADC values of the parotid and the submandibular glands at rest, and of the parotid before and after stimulation. Results: The mean ADC value at rest was significantly lower in the parotid [(1.23 ±0.12) × 10 -3 mm 2 /s] than in the submandibular glands [(1.34 ± 0.07) × 10 -3 mm 2 /s, t=4.545, P<0.01]. After acid stimulation,the ADC value increased from the baseline to (1.41 ±0.19) × 10 -3 mm 2 /s firstly and then fluctuated at the following time, with a peak value of (1.49 ± 0.20) × 10 -3 mm 2 /s and the average value of (1.36 ±0.17) × 10 -3 mm 2 /s. The average value was significantly different from the baseline value (t=15.127, t=11.905, P<0.01). The minimum value [ ( 1.24 ± 0.14) × 10 -3 mm 2 /s] was not significantly different compared to the baseline value (t=1.329, P>0.05). Conclusion: MR DWI can noninvasively evaluate the physiologic changes of salivary glands before and after acid stimulation. (authors)

  20. Abnormal Auditory Brainstem Response (ABR Findings in a Near-Normal Hearing Child with Noonan Syndrome

    Directory of Open Access Journals (Sweden)

    Bahram Jalaei

    2017-01-01

    Full Text Available Introduction: Noonan syndrome (NS is a heterogeneous genetic disease that affects many parts of the body. It was named after Dr. Jacqueline Anne Noonan, a paediatric cardiologist.Case Report: We report audiological tests and auditory brainstem response (ABR findings in a 5-year old Malay boy with NS. Despite showing the marked signs of NS, the child could only produce a few meaningful words. Audiological tests found him to have bilateral mild conductive hearing loss at low frequencies. In ABR testing, despite having good waveform morphology, the results were atypical. Absolute latency of wave V was normal but interpeak latencies of wave’s I-V, I-II, II-III were prolonged. Interestingly, interpeak latency of waves III-V was abnormally shorter.Conclusion:Abnormal ABR results are possibly due to abnormal anatomical condition of brainstem and might contribute to speech delay.

  1. Inactivation of basolateral amygdala specifically eliminates palatability-related information in cortical sensory responses.

    Science.gov (United States)

    Piette, Caitlin E; Baez-Santiago, Madelyn A; Reid, Emily E; Katz, Donald B; Moran, Anan

    2012-07-18

    Evidence indirectly implicates the amygdala as the primary processor of emotional information used by cortex to drive appropriate behavioral responses to stimuli. Taste provides an ideal system with which to test this hypothesis directly, as neurons in both basolateral amygdala (BLA) and gustatory cortex (GC)-anatomically interconnected nodes of the gustatory system-code the emotional valence of taste stimuli (i.e., palatability), in firing rate responses that progress similarly through "epochs." The fact that palatability-related firing appears one epoch earlier in BLA than GC is broadly consistent with the hypothesis that such information may propagate from the former to the latter. Here, we provide evidence supporting this hypothesis, assaying taste responses in small GC single-neuron ensembles before, during, and after temporarily inactivating BLA in awake rats. BLA inactivation (BLAx) changed responses in 98% of taste-responsive GC neurons, altering the entirety of every taste response in many neurons. Most changes involved reductions in firing rate, but regardless of the direction of change, the effect of BLAx was epoch-specific: while firing rates were changed, the taste specificity of responses remained stable; information about taste palatability, however, which normally resides in the "Late" epoch, was reduced in magnitude across the entire GC sample and outright eliminated in most neurons. Only in the specific minority of neurons for which BLAx enhanced responses did palatability specificity survive undiminished. Our data therefore provide direct evidence that BLA is a necessary component of GC gustatory processing, and that cortical palatability processing in particular is, in part, a function of BLA activity.

  2. CT in normal pressure hydrocephalus. Correlation between CT and clinical response to shunting

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, K.; Nogaki, H.; Noda, M.; Kusunoki, T.; Tamaki, N. (Kobe Univ. (Japan). School of Medicine)

    1981-02-01

    CT scans were obtained on 33 patients (age 73y. to 31y.) with the diagnosis of normal pressure hydrocephalus. In each case, the diagnosis was made on the basis of the symptoms, CT and cisternographic findings. Underlying diseases of normal pressure hydrocephalus are ruptured aneurysms (21 cases), arteriovenous malformations (2 cases), head trauma (1 case), cerebrovascular accidents (1 case) and idiopathie (8 cases). Sixteen of 33 patients showed marked improvement, five, moderate or minimal improvement, and twelve, no change. The results were compared with CT findings and clinical response to shunting. CT findings were classified into five types, bases on the degree of periventricular hypodensity (P.V.H.), the extent of brain damage by underlying diseases, and the degree of cortical atrophy. In 17 cases of type (I), CT shows the presence of P.V.H. with or without minimal frontal lobe damage and no cortical atrophy. The good surgical improvements were achieved in all cases of type (I) by shunting. In 4 cases of type (II), CT shows the presence of P.V.H. and severe brain damage without cortical atrophy. The fair clinical improvements were achieved in 2 cases (50%) by shunting. In one case of type (III), CT shows the absence of P.V.H. without brain damage nor cortical atrophy. No clinical improvement was obtained by shunting in this type. In 9 cases of type (IV) with mild cortical atrophy, the fair clinical improvement was achieved in two cases (22%) and no improvement in 7 cases. In 2 cases of type (V) with moderate or marked cortical atrophy, no clinical improvement was obtained by shunting. In conclusion, it appeared from the present study that there was a good correlation between the result of shunting and the type of CT, and clinical response to shunting operation might be predicted by classification of CT findings.

  3. Electroretinogram responses of the normal thoroughbred horse sedated with detomidine hydrochloride.

    Science.gov (United States)

    Church, Melanie L; Norman, Joanna C

    2012-09-01

    The main objective was to record electroretinogram (ERG) parameters of normal thoroughbred mares using the HMsERG, a mini-Ganzfeld electroretinographic unit, and a contact lens electrode. The second objective was to determine whether IV detomidine hydrochloride at 0.015 mg/kg is consistently an effective choice for sedation of horses undergoing this ERG protocol. The study population consisted of 30 normal thoroughbred mares. ERG data were harvested using a protocol that included three different light intensities (10, 3000, and 10,000 mcd s/m(2)) and a 30-Hz flicker at 3000 mcd s/m(2). Mean, median, standard deviation, and estimated normal ranges using the 5-95% of the data for a- and b-wave implicit times (IT), amplitudes (AMP), and b/a ratios were reported. Scotopic results at low intensity (10 mcd s/m(2)) had estimated ranges for b-wave IT of 41.8-72.9 ms and AMP of 19.8-173.3 μV. Middle intensity (3000 mcd s/m(2)) a-wave IT was 13.2-14.7 ms with a-wave AMP of 68.4-144 μV; the b-wave IT was 28.7-41.5 ms with b-wave AMP of 105.7-271.5 μV; and the b/a ratio was 0.95-2.71. The high-intensity (10,000 mcd s/m(2)) average recordings showed an a-wave IT of 13-14.9 ms, a-wave AMP of 85.7-186.8 μV; b-wave IT of 26.6-45.4 ms, b-wave AMP of 104.7-250.6 μV; and a b/a wave ratio of 0.7-2.0. The 30-Hz cone flicker showed an IT of 22.8-28.9 ms and AMP of 44.1-117.1 μV. Results of normal thoroughbred ERG responses are reported. The protocol proved to be simple and safe and provided consistent results. © 2012 American College of Veterinary Ophthalmologists.

  4. Descriptive analysis of the masticatory and salivary functions and gustatory sensitivity in healthy children.

    Science.gov (United States)

    Marquezin, Maria Carolina Salomé; Pedroni-Pereira, Aline; Araujo, Darlle Santos; Rosar, João Vicente; Barbosa, Taís S; Castelo, Paula Midori

    2016-08-01

    The objective of this study is to better understand salivary and masticatory characteristics, this study evaluated the relationship among salivary parameters, bite force (BF), masticatory performance (MP) and gustatory sensitivity in healthy children. The secondary outcome was to evaluate possible gender differences. One hundred and sixteen eutrophic subjects aged 7-11 years old were evaluated, caries-free and with no definite need of orthodontic treatment. Salivary flow rate and pH, total protein (TP), alpha-amylase (AMY), calcium (CA) and phosphate (PHO) concentrations were determined in stimulated (SS) and unstimulated saliva (US). BF and MP were evaluated using digital gnathodynamometer and fractional sieving method, respectively. Gustatory sensitivity was determined by detecting the four primary tastes (sweet, salty, sour and bitter) in three different concentrations. Data were evaluated using descriptive statistics, Mann-Whitney/t-test, Spearman correlation and multiple regression analysis, considering α = 0.05. Significant positive correlation between taste and age was observed. CA and PHO concentrations correlated negatively with salivary flow and pH; sweet taste scores correlated with AMY concentrations and bitter taste sensitivity correlated with US flow rate (p salivary, masticatory characteristics and gustatory sensitivity was observed. The regression analysis showed a weak relationship between the distribution of chewed particles among the different sieves and BF. The concentration of some analytes was influenced by salivary flow and pH. Age, saliva flow and AMY concentrations influenced gustatory sensitivity. In addition, salivary, masticatory and taste characteristics did not differ between genders, and only a weak relation between MP and BF was observed.

  5. Fluid consumption and taste novelty determines transcription temporal dynamics in the gustatory cortex

    OpenAIRE

    Inberg, Sharon; Jacob, Eyal; Elkobi, Alina; Edry, Efrat; Rappaport, Akiva; Simpson, T. Ian; Armstrong, J. Douglas; Shomron, Noam; Pasmanik-Chor, Metsada; Rosenblum, Kobi

    2016-01-01

    Background Novel taste memories, critical for animal survival, are consolidated to form long term memories which are dependent on translation regulation in the gustatory cortex (GC) hours following acquisition. However, the role of transcription regulation in the process is unknown. Results Here, we report that transcription in the GC is necessary for taste learning in rats, and that drinking and its consequences, as well as the novel taste experience, affect transcription in the GC during ta...

  6. Effects of caloric deprivation and satiety on sensitivity of the gustatory system

    Directory of Open Access Journals (Sweden)

    Zverev Yuriy P

    2004-02-01

    Full Text Available Abstract Background Sensitivity of the gustatory system could be modulated by a number of short-term and long-term factors such as body mass, gender, age, local and systemic diseases and pathological processes, excessive alcohol drinking, drug dependence, smoking, composition of oral fluid, state of oral hygiene, consumption of some foods among many others. A few studies have demonstrated the effects of hunger and caloric satiety on sensitivity of the gustatory system in obese humans and animals. The aim of the present study was to assess the effects of short-term caloric deprivation and satiety on recognition taste thresholds of healthy, non-smoking, non-drinking, non-obese young male subjects. The two-alternative forced-choice technique was used to measure taste threshold. Results Recognition thresholds for sucrose and salt were significantly lower during fasting state than after a meal (t = 2.23, P Conclusions Short-term caloric deprivation in our study model was associated with increased taste sensitivity to sweet and salty substances compared to satiated state while taste sensitivity to bitter substances was not affected by the conditions of measurements. Selective modulation of sensitivity of the gustatory system might reflect the different biological importance of salty, sweet and bitter qualities of taste.

  7. Ultradian rhythmicity of plasma cortisol is necessary for normal emotional and cognitive responses in man.

    Science.gov (United States)

    Kalafatakis, K; Russell, G M; Harmer, C J; Munafo, M R; Marchant, N; Wilson, A; Brooks, J C; Durant, C; Thakrar, J; Murphy, P; Thai, N J; Lightman, S L

    2018-04-24

    Glucocorticoids (GCs) are secreted in an ultradian, pulsatile pattern that emerges from delays in the feedforward-feedback interaction between the anterior pituitary and adrenal glands. Dynamic oscillations of GCs are critical for normal cognitive and metabolic function in the rat and have been shown to modulate the pattern of GC-sensitive gene expression, modify synaptic activity, and maintain stress responsiveness. In man, current cortisol replacement therapy does not reproduce physiological hormone pulses and is associated with psychopathological symptoms, especially apathy and attenuated motivation in engaging with daily activities. In this work, we tested the hypothesis that the pattern of GC dynamics in the brain is of crucial importance for regulating cognitive and behavioral processes. We provide evidence that exactly the same dose of cortisol administered in different patterns alters the neural processing underlying the response to emotional stimulation, the accuracy in recognition and attentional bias toward/away from emotional faces, the quality of sleep, and the working memory performance of healthy male volunteers. These data indicate that the pattern of the GC rhythm differentially impacts human cognition and behavior under physiological, nonstressful conditions and has major implications for the improvement of cortisol replacement therapy.

  8. DNA damage and the bystander response in tumor and normal cells exposed to X-rays.

    Science.gov (United States)

    Subhashree, M; Venkateswarlu, R; Karthik, K; Shangamithra, V; Venkatachalam, P

    2017-09-01

    Monolayer and suspension cultures of tumor (BMG-1, CCRF-CEM), normal (AG1522, HADF, lymphocytes) and ATM-mutant (GM4405) human cells were exposed to X-rays at doses used in radiotherapy (high dose and high dose-rate) or radiological imaging (low dose and low dose-rate). Radiation-induced DNA damage, its persistence, and possible bystander effects were evaluated, based on DNA damage markers (γ-H2AX, p53 ser15 ) and cell-cycle-specific cyclins (cyclin B1 and cyclin D1). Dose-dependent DNA damage and a dose-independent bystander response were seen after exposure to high dose and high dose-rate radiation. The level of induced damage (expression of p53 ser15 , γ-H2AX) depended on ATM status. However, low dose and dose-rate exposures neither increased expression of marker proteins nor induced a bystander response, except in the CCRF-CEM cells. Bystander effects after high-dose irradiation may contribute to stochastic and deterministic effects. Precautions to protect unexposed regions or to inhibit transmission of DNA damage signaling might reduce radiation risks. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Proteinase-activated receptors - mediators of early and delayed normal tissue radiation responses

    International Nuclear Information System (INIS)

    Hauer-Jensen, M.

    2003-01-01

    Proteinase-activated receptors (PARs) are G-protein coupled receptors that are activated by proteolytic exposure of a receptor-tethered ligand. The discovery of this receptor family represents one of the most intriguing recent developments in signal transduction. PARs are involved in the regulation of many normal and pathophysiological processes, notably inflammatory and fibroproliferative responses to injury. Preclinical studies performed in our laboratory suggest that proteinase-activated receptor-1 (PAR-1) plays a critical role in the mechanism of chronicity of radiation fibrosis, while proteinase-activated receptor-2 (PAR-2) may mediate important fibroproliferative responses in irradiated intestine. Specifically, activation of PAR-1 by thrombin, and PAR-2 by pancreatic trypsin and mast cell proteinases, appears to be involved in acute radiation-induced inflammation, as well as in subsequent extracellular matrix deposition, leading to the development of intestinal wall fibrosis and clinical complications. Pharmacological modulators of PAR-1 or PAR-2 expression or activation would be potentially useful as preventive or therapeutic agents in patients who receive radiation therapy, especially if blockade could be targeted to specific tissues or cellular compartments

  10. Rho-associated kinase in the gustatory cortex is involved in conditioned taste aversion memory formation but not in memory retrieval or relearning.

    Science.gov (United States)

    Sweetat, Sahar; Rosenblum, Kobi; Lamprecht, Raphael

    2012-01-01

    Rho-associated kinase (ROCK) is intimately involved in cortical neuronal morphogenesis. The present study explores the roles of ROCK in conditioned taste aversion (CTA) memory formation in gustatory cortex (GC) in adult rat. Microinjection of the ROCK inhibitor Y-27632 into the GC 30 min before CTA training or 10 min after the conditioned stimulus (CS) impaired long-term CTA memory (LTM) formation. ROCK inhibitor had no effect on taste aversion when injected before the first LTM test day and did not alter taste aversion on subsequent test days. Microinjection of ROCK inhibitor into GC 30 min before preexposure to the taste CS had no effect on latent inhibition of CTA learning suggesting that ROCK is involved in CS-US association rather than taste learning per se. Cumulatively, these results show that ROCK is needed for normal CTA memory formation but not retrieval, relearning or incidental taste learning. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Effects of stimulus duration on gustatory evoked potentials

    DEFF Research Database (Denmark)

    Rotvel, Camilla Arndal; Møller, Stine; Kivisaar, Kätlin

    The objective of the present study was to investigate the effect of tastant stimulus duration on the brain response. The brain response was measured by electroencephalography (EEG) which measures neural processes with high temporal resolution and may therefore complement sensory panel assessments...

  12. Responses of catecholestrogen metabolism to acute graded exercise in normal menstruating women before and after training.

    Science.gov (United States)

    De Crée, C; Ball, P; Seidlitz, B; Van Kranenburg, G; Geurten, P; Keizer, H A

    1997-10-01

    It has been hypothesized that exercise-related hypo-estrogenemia occurs as a consequence of increased competition of catecholestrogens (CE) for catechol-O-methyltransferase (COMT). This may result in higher norepinephrine (NE) concentrations, which could interfere with normal gonadotropin pulsatility. The present study investigates the effects of training on CE responses to acute exercise stress. Nine untrained eumenorrheic women (mean percentage of body fat +/-SD: 24.8 +/- 3.1%) volunteered for an intensive 5-day training program. Resting, submaximal, and maximal (tmax) exercise plasma CE, estrogen, and catecholamine responses were determined pre- and post training in both the follicular (FPh) and luteal phase (LPh). Acute exercise stress increased total primary estrogens (E) but had little effect on total 2-hydroxyestrogens (2-OHE) and 2-hydroxyestrogen-monomethylethers (2-MeOE) (= O-methylated CE after competition for catechol-O-methyltransferase). This pattern was not significantly changed by training. However, posttraining LPh mean (+/-SE) plasma E, 2-OHE, and 2-MeOE concentrations were significantly lower (P Training produced opposite effects on 2-OHE:E ratios (an estimation of CE formation) during acute exercise in the FPh (reduction) and LPh (increase). The 2-MeOE:2-OHE ratio (an estimation of CE activity) showed significantly higher values at tmax in both menstrual phases after training (FPh: +11%; LPh: +23%; P training, NE values were significantly higher (P training lowers absolute concentrations of plasma estrogens and CE; the acute exercise challenge altered plasma estrogens but had little effect on CE; estimation of the formation and activity of CE suggests that formation and O-methylation of CE proportionately increases. These findings may be of importance for NE-mediated effects on gonadotropin release.

  13. 25-Hydroxycholecalciferol response to single oral cholecalciferol loading in the normal weight, overweight, and obese.

    Science.gov (United States)

    Camozzi, V; Frigo, A C; Zaninotto, M; Sanguin, F; Plebani, M; Boscaro, M; Schiavon, L; Luisetto, G

    2016-08-01

    After a single cholecalciferol load, peak serum 25-hydroxycholecalciferol (25OHD) is lower in individuals with a higher body mass index (BMI), probably due to it being distributed in a greater volume. Its subsequent disappearance from the serum is slower the higher the individual's BMI, probably due to the combination of a larger body volume and a slower release into the circulation of vitamin D stored in adipose tissue. The aim of the study is to examine 25-hydroxycholecalciferol (25OHD) response to a single oral load of cholecalciferol in the normal weight, overweight, and obese. We considered 55 healthy women aged from 25 to 67 years (mean ± SD, 50.8 ± 9.5) with a BMI ranging from 18.7 to 42 kg/m(2) (mean ± SD, 27.1 ± 6.0). The sample was divided into three groups by BMI: 20 were normal weight (BMI ≤ 25 kg/m(2)), 21 overweight (25.1 ≤ BMI ≤ 29.9 kg/ m(2)), and 14 obese (BMI ≥ 30 kg/m(2)). Each subject was given 300,000 IU of cholecalciferol orally during lunch. A fasting blood test was obtained before cholecalciferol loading and then 7, 30, and 90 days afterwards to measure serum 25OHD, 1,25 dihydroxyvitamin D [1,25 (OH)2D], parathyroid hormone (PTH), calcium (Ca), and phosphorus (P). Participants' absolute fat mass was measured using dual energy X-ray absorptiometry (DEXA). The fat mass of the normal weight subjects was significantly lower than that of the overweight, which in turn was lower than that of the obese participants. Serum 25OHD levels increased significantly in all groups, peaking 1 week after the cholecalciferol load. Peak serum 25OHD levels were lower the higher the individuals' BMI. After peaking, the 25OHD levels gradually decreased, following a significantly different trend in the three groups. The slope was similar for the overweight and obese, declining significantly more slowly than in the normal weight group. In the sample as a whole, there was a weakly significant negative correlation

  14. Normal postural responses preceding shoulder flexion: co-activation or asymmetric activation of transverse abdominis?

    Science.gov (United States)

    Davarian, Sanaz; Maroufi, Nader; Ebrahimi, Esmaeil; Parnianpour, Mohammad; Farahmand, Farzam

    2014-01-01

    It is suggested that activation of the transverse abdominis muscle has a stabilizing effect on the lumbar spine by raising intra-abdominal pressure without added disc compression. However, its feedforward activity has remained a controversial issue. In addition, research regarding bilateral activation of trunk muscles during a unilateral arm movement is limited. The aim of this study was to evaluate bilateral anticipatory activity of trunk muscles during unilateral arm flexion. Eighteen healthy subjects (aged 25 ± 3.96 years) participated in this study and performed 10 trials of rapid arm flexion in response to a visual stimulus. The electromyographic activity of the right anterior deltoid (AD) and bilateral trunk muscles including the transverse abdominis/internal oblique (TA/IO), superficial lumbar multifidus (SLM) and lumbar erector spine (LES) was recorded. The onset latency and anticipatory activity of the recorded trunk muscles were calculated. The first muscle activated in anticipation of the right arm flexion was the left TA/IO. The right TA/IO activated significantly later than all other trunk muscles (P 0.05). Healthy subjects showed no bilateral anticipatory co-activation of TA/IO in unilateral arm elevation. Further investigations are required to delineate normal muscle activation pattern in healthy subjects prior to prescribing bilateral activation training of transverse abdominis for subjects with chronic low back pain.

  15. Microvascular resistance in response to iodinated contrast media in normal and functionally impaired kidneys.

    Science.gov (United States)

    Kurihara, Osamu; Takano, Masamichi; Uchiyama, Saori; Fukuizumi, Isamu; Shimura, Tetsuro; Matsushita, Masato; Komiyama, Hidenori; Inami, Toru; Murakami, Daisuke; Munakata, Ryo; Ohba, Takayoshi; Hata, Noritake; Seino, Yoshihiko; Shimizu, Wataru

    2015-12-01

    Contrast-induced nephropathy (CIN) is considered to result from intrarenal vasoconstriction, and occurs more frequently in impaired than in normal kidneys. It was hypothesized that iodinated contrast media would markedly change renal blood flow and vascular resistance in functionally impaired kidneys. Thirty-six patients were enrolled (32 men; mean age, 75.3 ± 7.6 years) undergoing diagnostic coronary angiography and were divided into two groups based on the presence of chronic kidney disease (CKD), defined as an estimated glomerular filtration rate (eGFR) of contrast media. The APV and the RI were positively and inversely correlated with the eGFR at baseline, respectively (APV, R = 0.545, P = 0.001; RI, R = -0.627, P contrast media administration in the non-CKD group, but not in the CKD group (APV, P = 0.258; RI, P = 0.707). Although renal arterial resistance was higher in patients with CKD, it was not affected by contrast media administration, suggesting that patients with CKD could have an attenuated response to contrast media. © 2015 The Authors. Clinical and Experimental Pharmacology and Physiology Published by Wiley Publishing Asia Pty Ltd.

  16. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  17. Physiological recordings and RNA sequencing of the gustatory appendages of the yellow-fever mosquito Aedes aegypti.

    Science.gov (United States)

    Sparks, Jackson T; Dickens, Joseph C

    2014-12-30

    Electrophysiological recording of action potentials from sensory neurons of mosquitoes provides investigators a glimpse into the chemical perception of these disease vectors. We have recently identified a bitter sensing neuron in the labellum of female Aedes aegypti that responds to DEET and other repellents, as well as bitter quinine, through direct electrophysiological investigation. These gustatory receptor neuron responses prompted our sequencing of total mRNA from both male and female labella and tarsi samples to elucidate the putative chemoreception genes expressed in these contact chemoreception tissues. Samples of tarsi were divided into pro-, meso- and metathoracic subtypes for both sexes. We then validated our dataset by conducting qRT-PCR on the same tissue samples and used statistical methods to compare results between the two methods. Studies addressing molecular function may now target specific genes to determine those involved in repellent perception by mosquitoes. These receptor pathways may be used to screen novel repellents towards disruption of host-seeking behavior to curb the spread of harmful viruses.

  18. Neural responses to silent lipreading in normal hearing male and female subjects

    NARCIS (Netherlands)

    Ruytjens, Liesbet; Albers, Frans; van Dijk, Pim; Wit, Hero; Willemsen, Antoon

    In the past, researchers investigated silent lipreading in normal hearing subjects with functional neuroimaging tools and showed how the brain processes visual stimuli that are normally accompanied by an auditory counterpart. Previously, we showed activation differences between males and females in

  19. Terminal investment in the gustatory appeal of nuptial food gifts in crickets.

    Science.gov (United States)

    Duffield, K R; Hunt, J; Rapkin, J; Sadd, B M; Sakaluk, S K

    2015-10-01

    Investment in current versus future reproduction represents a prominent trade-off in life-history theory and is likely dependent on an individual's life expectancy. The terminal investment hypothesis posits that a reduction in residual reproductive value (i.e. potential for future offspring) will result in increased investment in current reproduction. We tested the hypothesis that male decorated crickets (Gryllodes sigillatus), when cued to their impending mortality, should increase their reproductive effort by altering the composition of their nuptial food gifts (i.e. spermatophylaxes) to increase their gustatory appeal to females. Using a repeated-measures design, we analysed the amino acid composition of spermatophylaxes derived from males both before and after injection of either a saline control or a solution of heat-killed bacteria. The latter, although nonpathogenic, represents an immune challenge that may signal an impending survival threat. One principal component explaining amino acid variation in spermatophylaxes, characterized by a high loading to histidine, was significantly lower in immune-challenged versus control males. The relevance of this difference for the gustatory appeal of gifts to females was assessed by mapping spermatophylax composition onto a fitness surface derived in an earlier study identifying the amino acid composition of spermatophylaxes preferred by females. We found that immune-challenged males maintained the level of attractiveness of their gifts post-treatment, whereas control males produced significantly less attractive gifts post-injection. These results are consistent with the hypothesis that cues of a survival-threatening infection stimulate terminal investment in male decorated crickets with respect to the gustatory appeal of their nuptial food gifts. © 2015 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2015 European Society For Evolutionary Biology.

  20. Normal mitogen-induced suppression of the interleukin-6 (IL-6) response and its deficiency in systemic lupus erythematosus

    International Nuclear Information System (INIS)

    Warrington, R.J.; Rutherford, W.J.

    1990-01-01

    A low-frequency suppressor-cell population in normal peripheral blood inhibits the B-cell CESS response to IL-6, following pokeweed mitogen stimulation. The suppression of IL-6 responsiveness is radiation sensitive, directed against CESS targets and not mediated by inhibition of IL-6 production, and associated with nonspecific cytotoxic activity against CESS targets. The generation of these cytolytic cells is also radiation sensitive. A correlation was found between PWM-induced cytotoxicity against CESS and the suppression of IL-6-dependent IgG production. But cytotoxicity toward CESS targets is not responsible for this suppression because IL-2 induces equivalent or greater nonspecific cytotoxicity against CESS in the total absence of suppression of CESS-derived IgG production and suppression is also induced by mitogen-activated PBL separated from CESS targets by a cell-impermeable membrane. This suppression was not mediated by TNF alpha/beta or IFN-gamma. In systemic lupus erythematosus, suppression of IL-6-dependent IgG production is impaired in patients with active disease (29.2 +/- 13.7%) compared to patients with inactive disease (70 +/- 19.5%) or normal controls (82.8 +/- 9.2%). There is also a defect in mitogen-induced nonspecific cytotoxicity in active SLE (specific lysis 15.1 +/- 3.5%, compared to 34 +/- 4% in normals). Pokeweed mitogen-activated PBL can therefore normally induce suppression of B-cell IL-6 responses and this response is deficient in lupus

  1. Ventral frontal satiation-mediated responses to food aromas in obese and normal-weight women123

    Science.gov (United States)

    Eiler, William JA; Dzemidzic, Mario; Case, K Rose; Armstrong, Cheryl LH; Mattes, Richard D; Cyders, Melissa A; Considine, Robert V; Kareken, David A

    2014-01-01

    Background: Sensory properties of foods promote and guide consumption in hunger states, whereas satiation should dampen the sensory activation of ingestive behaviors. Such activation may be disordered in obese individuals. Objective: Using functional magnetic resonance imaging (fMRI), we studied regional brain responses to food odor stimulation in the sated state in obese and normal-weight individuals targeting ventral frontal regions known to be involved in coding for stimulus reward value. Design: Forty-eight women (25 normal weight; 23 obese) participated in a 2-day (fed compared with fasting) fMRI study while smelling odors of 2 foods and an inedible, nonfood object. Analyses were conducted to permit an examination of both general and sensory-specific satiation (satiation effects specific to a given food). Results: Normal-weight subjects showed significant blood oxygen level–dependent responses in the ventromedial prefrontal cortex (vmPFC) to food aromas compared with responses induced by the odor of an inedible object. Normal-weight subjects also showed general (but not sensory-specific) satiation effects in both the vmPFC and orbitofrontal cortex. Obese subjects showed no differential response to the aromas of food and the inedible object when fasting. Within- and between-group differences in satiation were driven largely by changes in the response to the odor of the inedible stimulus. Responses to food aromas in the obese correlated with trait negative urgency, the tendency toward negative affect-provoked impulsivity. Conclusions: Ventral frontal signaling of reward value may be disordered in obesity, with negative urgency heightening responses to food aromas. The observed nature of responses to food and nonfood stimuli suggests that future research should independently quantify each to fully understand brain reward signaling in obesity. This trial was registered at clinicaltrials.gov as NCT02041039. PMID:24695888

  2. A comparison of cytokine responses during prolonged cycling in normal and hot environmental conditions

    Directory of Open Access Journals (Sweden)

    Ludmila M Cosio-Lima

    2011-01-01

    Full Text Available Ludmila M Cosio-Lima, Bhargav V Desai, Petra B Schuler, Lesley Keck, Logan ScheelerDepartment of Health, Leisure, and Exercise Science, University of West Florida, Pensacola, FL, USAPurpose: Components of immune function are affected by physical activity in an adverse environment. The purpose of this study was to compare plasma differences in inflammatory cytokines including tumor necrosis factor α (TNF-α and interleukin 6 (IL-6, in addition to the stress hormone cortisol, during prolonged cycling under normal and hot environmental conditions in elite cyclists.Methods and design: Six trained elite male cyclists (27 ± 8 years; 75.5 ± 4 kg; maximum oxygen uptake [VO2max] = 66 ± 6 mL/kg/min, mean ± SD. The cyclists biked for 2.5 h at their prescribed 60% maximum exercise workload (Wmax or 75% VO2max either in an environmental chamber set at 15°C and 40% relative humidity (NEUTRAL or at 35°C and 40% relative humidity (HOT. The cyclists were given 4 mL of water/kg body weight every 15 min under both conditions.Results: Total cortisol concentrations were elevated (P < 0.05 immediately postexercise and 12 h postexercise in both the NEUTRAL and HOT conditions. TNF-α concentrations were only significantly (P = 0.045 elevated postexercise in HOT conditions. During the HOT conditions, a significant (P = 0.006 and 0.007, respectively difference in IL-6 was seen immediately after and 12 h postexercise. During the NEUTRAL condition, IL-6 was only significantly elevated postexercise (P < 0.05.Conclusions: Heat exposure during a long bout of exercise is sufficient to elicit stress response in elite cyclists. However, the degree of release of anti-inflammatory and proinflammatory cytokines might be related to several factors that include the athlete’s fitness level, hydration status, exercise intensity, and length of exposure to hot environments.Keywords: cytokines, inflammation, heat, exercise, performance 

  3. Gustatory receptor neuron responds to DEET and other insect repellents in the yellow-fever mosquito, Aedes aegypti

    Science.gov (United States)

    Sanford, Jillian L.; Shields, Vonnie D. C.; Dickens, Joseph C.

    2013-03-01

    Three gustatory receptor neurons were characterized for contact chemoreceptive sensilla on the labella of female yellow-fever mosquitoes, Aedes aegypti. The neuron with the smallest amplitude spike responded to the feeding deterrent, quinine, as well as N, N-diethyl-3-methylbenzamide and other insect repellents. Two other neurons with differing spikes responded to salt (NaCl) and sucrose. This is the first report of a gustatory receptor neuron specific for insect repellents in mosquitoes and may provide a tool for screening chemicals to discover novel or improved feeding deterrents and repellents for use in the management of arthropod disease vectors.

  4. Thresholds of Tone Burst Auditory Brainstem Responses for Infants and Young Children with Normal Hearing in Taiwan

    Directory of Open Access Journals (Sweden)

    Chung-Yi Lee

    2007-10-01

    Conclusion: Based on the published research and our study, we suggest setting the normal criterion levels for infants and young children in Taiwan of the tone burst auditory brainstem response to air-conducted tones as 30 dB nHL for 500 and 1000 Hz, and 25 dB nHL for 2000 and 4000 Hz.

  5. Peek-a-What? Infants' Response to the Still-Face Task after Normal and Interrupted Peek-a-Boo

    Science.gov (United States)

    Bigelow, Ann E.; Best, Caitlin

    2013-01-01

    Infants' sensitivity to the vitality or tension envelope within dyadic social exchanges was investigated by examining their responses following normal and interrupted games of peek-a-boo embedded in a Still-Face Task. Infants 5-6 months old engaged in two modified Still-Face Tasks with their mothers. In one task, the initial interaction ended with…

  6. Artichoke compound cynarin differentially affects the survival, growth and stress response of normal, immortalized and cancerous human cells

    DEFF Research Database (Denmark)

    Gezer, Ceren; Yücecan, Sevinç; Rattan, Suresh Inder Singh

    2015-01-01

    of CYN on the proliferative potential, survival, morphology, and stress response (SR) markers haemoxygenase-1 (HO-1) and heat shock protein-70 (HSP70) in normal human skin fibroblasts (FSF-1), telomerase-immortalized mesenchymal stem cells (hTERT-MSC) and cervical cancer cells, HeLa. Effects of CYN...

  7. Angiogenesis for tumor vascular normalization of Endostar on hepatoma 22 tumor-bearing mice is involved in the immune response.

    Science.gov (United States)

    Xu, Qingyu; Gu, Junfei; Lv, You; Yuan, Jiarui; Yang, Nan; Chen, Juan; Wang, Chunfei; Hou, Xuefeng; Jia, Xiaobin; Feng, Liang; Yin, Guowen

    2018-03-01

    Tumor vascular normalization involved in immune response is beneficial to the chemotherapy of tumors. Recombinant human endostatin (Endostar), an angiogenesis inhibitor, has been demonstrated to be effective in hepatocellular cancer (HCC). However, its vascular normalization in HCC and the role of the immune response in angiogenesis were unclear. In the present study, effects of Endostar on tumor vascular normalization were evaluated in hepatoma 22 (H22) tumor-bearing mice. Endostar was able to inhibit the proliferation and infiltration of tumor cells and improve α-fetoprotein, tumor necrosis factor-α and cyclic adenosine 5'-phosphate levels in the serum of H22-bearing mice, as well as the protein expression levels of the immune factors interferon-γ and cluster of differentiation (CD)86 in liver tissue. Endostar also exhibited more marked downregulation of the levels of vascular endothelial growth factor, CD31, matrix metalloproteinase (MMP)-2, MMP-9 and interleukin-17 during day 3-9 treatment, resulting in short-term normalization of tumor blood vessels. The period of vascular normalization was 3-9 days. The results of the present study demonstrated that Endostar was able to induce the period of vascular normalization, contributing to a more efficacious means of HCC treatment combined with other chemotherapy, and this effect was associated with the immune response. It may be concluded that Endostar inhibited immunity-associated angiogenesis behaviors of vascular endothelial cells in response to HCC. The results of the present study provided more reasonable possibility for the combination therapy of Endostar for the treatment of HCC.

  8. Response of cultured normal human mammary epithelial cells to X rays

    International Nuclear Information System (INIS)

    Yang, T.C.; Stampfer, M.R.; Smith, H.S.

    1983-01-01

    The effect of X rays on the reproductive death of cultured normal human mammary epithelial cells was examined. Techniques were developed for isolating and culturing normal human mammary epithelial cells which provide sufficient cells at second passage for radiation studies, and an efficient clonogenic assay suitable for measuring radiation survival curves. It was found that the survival curves for epithelial cells from normal breast tissue were exponential and had D 0 values of about 109-148 rad for 225 kVp X rays. No consistent change in cell radiosensitivity with the age of donor was observed, and no sublethal damage repair in these cells could be detected with the split-dose technique

  9. Molecular signals into the insular cortex and amygdala during aversive gustatory memory formation.

    Science.gov (United States)

    Bermúdez-Rattoni, Federico; Ramírez-Lugo, Leticia; Gutiérrez, Ranier; Miranda, María Isabel

    2004-02-01

    In this paper, we will provide evidence of the putative molecular signals and biochemical events that mediate the formation of long-lasting gustatory memory trace. When an animal drinks a novel taste (the conditioned stimulus; CS) and it is later associated with malaise (unconditioned stimulus; US), the animal will reject it in the next presentation, developing a long-lasting taste aversion, i.e., the taste cue becomes an aversive signal, and this is referred to as conditioning taste aversion. Different evidence indicates that the novel stimulus (taste) induces a rapid and strong cortical acetylcholine activity that decreases when the stimulus becomes familiar after several presentations. Cholinergic activation via muscarinic receptors initiates a series of intracellular events leading to plastic changes that could be related to short- and/or long-term memory gustatory trace. Such plastic changes facilitate the incoming US signals carried out by, in part, the glutamate release induced by the US. Altogether, these events could produce the cellular changes related to the switch from safe to aversive taste memory trace. A proposed working model to explain the biochemical sequence of signals during taste memory formation will be discussed.

  10. Absence of diurnal variation in visceromotor response to colorectal distention in normal Long Evans rats [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Sara Botschuijver

    2016-01-01

    Full Text Available Background: Enhanced colorectal sensitivity (i.e. visceral hypersensitivity is thought to be a pathophysiological mechanism in irritable bowel syndrome (IBS. In healthy men a circadian variation in rectal perception to colonic distention was described. Disturbed day and night rhythms, which occur in shift work and trans meridian flights, are associated with the prevalence of IBS. This raises the question whether disruptions of circadian control are responsible for the observed pathology in IBS. Prior to investigating altered rhythmicity in relation to visceral hypersensitivity in a rat model for IBS, it is relevant to establish whether normal rats display circadian variation similar to healthy men.  Methodology and findings: In rodents colorectal distension leads to reproducible contractions of abdominal musculature. We used quantification of this so called visceromotor response (VMR by electromyography (EMG to assess visceral sensitivity in rats. We assessed the VMR in normal male Long Evans rats at different time points of the light/dark cycle. Although a control experiment with male maternal separated rats confirmed that intentionally inflicted (i.e. stress induced changes in VMR can be detected, normal male Long Evans rats showed no variation in VMR along the light/dark cycle in response to colorectal distension. Conclusions: In the absence of a daily rhythm of colorectal sensitivity in normal control rats it is not possible to investigate possible aberrancies in our rat model for IBS.

  11. Using an APOS Framework to Understand Teachers' Responses to Questions on the Normal Distribution

    Science.gov (United States)

    Bansilal, Sarah

    2014-01-01

    This study is an exploration of teachers' engagement with concepts embedded in the normal distribution. The participants were a group of 290 in-service teachers enrolled in a teacher development program. The research instrument was an assessment task that can be described as an "unknown percentage" problem, which required the application…

  12. Differences in response to conventional vitamin D therapy among obese and normal weight children and adolescents in Qazvin, Iran

    Directory of Open Access Journals (Sweden)

    Fatemeh Saffari

    2017-09-01

    Full Text Available Background: Vitamin D (Vit D deficiency is one of the major nutritional deficiencies in children. Obesity has inverse association with vitamin D levels. The aim of this study was to determine the differences in response to conventional treatment for Vit D deficiency and insufficiency in obese and normal weight children and adolescents.Methods: This nested case control study was conducted in 69 obese children and 133 normal weight matched control suffering from Vit D insufficiency or deficiency. Vit D deficiency was defined as serum 25(OH D

  13. Effects of gustatory stimulants of salivary secretion on salivary pH and flow: a randomized controlled trial.

    Science.gov (United States)

    da Mata, A D S P; da Silva Marques, D N; Silveira, J M L; Marques, J R O F; de Melo Campos Felino, E T; Guilherme, N F R P M

    2009-04-01

    To compare salivary pH changes and stimulation efficacy of two different gustatory stimulants of salivary secretion (GSSS). Portuguese Dental Faculty Clinic. Double blind randomized controlled trial. One hundred and twenty volunteers were randomized to two intervention groups. Sample sized was calculated using an alpha error of 0.05 and a beta of 0.20. Participants were randomly assigned to receive a new gustatory stimulant of secretory secretion containing a weaker malic acid, fluoride and xylitol or a traditionally citric acid-based one. Saliva collection was obtained by established methods at different times. The salivary pH of the samples was determined with a pH meter and a microelectrode. Salivary pH variations and counts of subjects with pH below 5.5 for over 1 min and stimulated salivary flow were the main outcome measures. Both GSSS significantly stimulated salivary output without significant differences between the two groups. The new gustatory stimulant of salivary secretion presented a risk reduction of 80 +/- 10.6% (95% CI) when compared with the traditional one. Gustatory stimulants of salivary secretion with fluoride, xylitol and lower acid content maintain similar salivary stimulation capacity while reducing significantly the dental erosion predictive potential.

  14. Gustatory receptor neuron responds to DEET and other insect repellents in the yellow fever mosquito, aedes aegypti

    Science.gov (United States)

    Three gustatory receptor neurons were characterized for contact chemoreceptive sensilla on the labella of female yellow fever mosquitoes, Aedes aegypti. The neuron with the smallest amplitude spike responded to the feeding deterrent, quinine, as well as DEET and other insect repellents. Two other ...

  15. Comparisons of amino acids, body constituents and antioxidative response between long-time HD and normal HD.

    Science.gov (United States)

    Torigoe, Akira; Sato, Emiko; Mori, Takefumi; Ieiri, Norio; Takahashi, Chika; Ishida, Yoko; Hotta, Osamu; Ito, Sadayoshi

    2016-10-01

    Introduction Oxidative stress is one of the main mediators of progression of chronic kidney diseases (CKD). Nuclear factor E2-related factor 2 (Nrf2) is the transcription factor of antioxidant and detoxifying enzymes and related proteins which play an important role in cellular defense. Long-time hemodialysis (HD) therapy (8 hours) has been considered to be more beneficial compared to normal HD therapy (4 hours). We investigated oxidative response related to Nrf2 in peripheral blood mononuclear cells (PBMCs) of long-time HD and normal HD patients. Methods Eight adult long-time HD therapy patients (44.5 ± 3.0 years) and 10 normal HD therapy patients (68.1 ± 2.7 years) were enrolled. PBMCs were isolated and processed for expression of Nrf2 and its related genes by qRT-PCR. Plasma indoxyl sulfate, amino acids, and body constituents were measured. Findings Plasma indoxyl sulfate was significantly low after long-time HD therapy compare to that of normal HD therapy. Although, skeletal muscle mass, lean body mass, mineral and protein were significantly decreased 2 months in normal HD patients, those in long-time HD patients were significantly increased after 2 months. Almost of amino acids were significantly decreased after HD therapy in both HD therapies. Plasma amino acids were significantly low in long-time HD patients compared to normal HD patients. In PBMCs, the expression of Nrf2 was significantly decreased and hemooxygenase-1 expression was significantly increased in long-time HD compared to normal HD. Conclusion These observations indicate the beneficial effects of in long-time HD in improving oxidative stress in patients. © 2016 International Society for Hemodialysis.

  16. Long-term visuo-gustatory appetitive and aversive conditioning potentiate human visual evoked potentials

    DEFF Research Database (Denmark)

    Christoffersen, Gert R.J.; Laugesen, Jakob L.; Møller, Per

    2017-01-01

    Human recognition of foods and beverages are often based on visual cues associated with flavors. The dynamics of neurophysiological plasticity related to acquisition of such long-term associations has only recently become the target of investigation. In the present work, the effects of appetitive...... and aversive visuo-gustatory conditioning were studied with high density EEG-recordings focusing on late components in the visual evoked potentials (VEPs), specifically the N2-P3 waves. Unfamiliar images were paired with either a pleasant or an unpleasant juice and VEPs evoked by the images were compared...... before and 1 day after the pairings. In electrodes located over posterior visual cortex areas, the following changes were observed after conditioning: the amplitude from the N2-peak to the P3-peak increased and the N2 peak delay was reduced. The percentage increase of N2-to-P3 amplitudes...

  17. "Good" Students and "Involved" Mothers: Latin@ Responses to Normalization Pressures in Schools

    Science.gov (United States)

    Cuero, Kimberley Kennedy; Valdez, Veronica E.

    2012-01-01

    Drawing from two in-depth qualitative studies, we used a sociocultural lens for a cross-case analysis examining how Latin@s' participation in schools is affected by ideological messages that subordinately position them in terms of their ethnicity, class, and immigrant status. We identified a range of dynamic responses to the school's normalization…

  18. Effect of retinol on the hyperthermal response of normal tissue in vivo

    International Nuclear Information System (INIS)

    Rogers, M.A.; Marigold, J.C.L.; Hume, S.P.

    1983-01-01

    The effect of prior administration of retinol, a membrane labilizer, on the in vivo hyperthermal response of lysosomes was investigated in the mouse spleen using a quantitative histochemical assay for the lysosomal enzyme acid phosphatase. A dose of retinol which had no effect when given alone enhanced the thermal response of the lysosome, causing an increase in lysosomal membrane permeability. In contrast, the same dose of retinol had no effect on the gross hyperthermal response of mouse intestine; a tissue which is relatively susceptible to hyperthermia. Thermal damage to intestine was assayed directly by crypt loss 1 day after treatment or assessed as thermal enhancement of x-ray damage by counting crypt microcolonies 4 days after a combined heat and x-ray treatment. Thus, although the hyperthermal response of the lysosome could be enhanced by the administration of retinol, thermal damage at a gross tissue level appeared to be unaffected, suggesting that lysosomal membrane injury is unlikely to be a primary event in hyperthermal cell killing

  19. Photodynamic therapy in prostate cancer: optical dosimetry and response of normal tissue

    Science.gov (United States)

    Chen, Qun; Shetty, Sugandh D.; Heads, Larry; Bolin, Frank; Wilson, Brian C.; Patterson, Michael S.; Sirls, Larry T., II; Schultz, Daniel; Cerny, Joseph C.; Hetzel, Fred W.

    1993-06-01

    The present study explores the possibility of utilizing photodynamic therapy (PDT) in treating localized prostate carcinoma. Optical properties of ex vivo human prostatectomy specimens, and in vivo and ex vivo dog prostate glands were studied. The size of the PDT induced lesion in dog prostate was pathologically evaluated as a biological endpoint. The data indicate that the human normal and carcinoma prostate tissues have similar optical properties. The average effective attenuation depth is less in vivo than that of ex vivo. The PDT treatment generated a lesion size of up to 16 mm in diameter. The data suggest that PDT is a promising modality in prostate cancer treatment. Multiple fiber system may be required for clinical treatment.

  20. Long-Term Visuo-Gustatory Appetitive and Aversive Conditioning Potentiate Human Visual Evoked Potentials

    Directory of Open Access Journals (Sweden)

    Gert R. J. Christoffersen

    2017-09-01

    Full Text Available Human recognition of foods and beverages are often based on visual cues associated with flavors. The dynamics of neurophysiological plasticity related to acquisition of such long-term associations has only recently become the target of investigation. In the present work, the effects of appetitive and aversive visuo-gustatory conditioning were studied with high density EEG-recordings focusing on late components in the visual evoked potentials (VEPs, specifically the N2-P3 waves. Unfamiliar images were paired with either a pleasant or an unpleasant juice and VEPs evoked by the images were compared before and 1 day after the pairings. In electrodes located over posterior visual cortex areas, the following changes were observed after conditioning: the amplitude from the N2-peak to the P3-peak increased and the N2 peak delay was reduced. The percentage increase of N2-to-P3 amplitudes was asymmetrically distributed over the posterior hemispheres despite the fact that the images were bilaterally symmetrical across the two visual hemifields. The percentage increases of N2-to-P3 amplitudes in each experimental subject correlated with the subject’s evaluation of positive or negative hedonic valences of the two juices. The results from 118 scalp electrodes gave surface maps of theta power distributions showing increased power over posterior visual areas after the pairings. Source current distributions calculated from swLORETA revealed that visual evoked currents rose as a result of conditioning in five cortical regions—from primary visual areas and into the inferior temporal gyrus (ITG. These learning-induced changes were seen after both appetitive and aversive training while a sham trained control group showed no changes. It is concluded that long-term visuo-gustatory conditioning potentiated the N2-P3 complex, and it is suggested that the changes are regulated by the perceived hedonic valence of the US.

  1. Pros and cons of rotating ground motion records to fault-normal/parallel directions for response history analysis of buildings

    Science.gov (United States)

    Kalkan, Erol; Kwong, Neal S.

    2014-01-01

    According to the regulatory building codes in the United States (e.g., 2010 California Building Code), at least two horizontal ground motion components are required for three-dimensional (3D) response history analysis (RHA) of building structures. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHAs should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here, for the first time, using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak values of engineering demand parameters (EDPs) were computed for rotation angles ranging from 0 through 180° to quantify the difference between peak values of EDPs over all rotation angles and those due to FN/FP direction rotated motions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.

  2. Factors influencing the vaccinia-specific cytotoxic response of thymocytes from normal and chimeric mice

    International Nuclear Information System (INIS)

    Doherty, P.C.; Schwartz, D.H.; Bennink, J.R.; Korngold, R.

    1981-01-01

    Following adoptive transfer into irradiated recipients, thymocytes can be induced to respond strongly to vaccinia virus. High levels of cytotoxic T-lymphocyte (CTL) activity may be generated from thymus, but not from spleen, of 3-day-old mice. The capacity of thymocytes to differentiate into effector CTL tends to be lost with age. Some of this loss may reflect positive suppression: a single, low dose of cyclophosphamide allows the reemergence of responsiveness in at least one mouse strain. Thymocytes from [A leads to (A x B)F1] and [(A x B)F1 leads to A] chimeras show the response patterns that would by predicted from previous studies of lymph node and spleen cells. However, thymic function seems to be rapidly lost in the [A leads to (A x B)F1] Chimeras

  3. Cardiovascular autonomic responses to head-up tilt in gestational hypertension and normal pregnancy.

    Science.gov (United States)

    Heiskanen, Nonna; Saarelainen, Heli; Kärkkäinen, Henna; Valtonen, Pirjo; Lyyra-Laitinen, Tiina; Laitinen, Tomi; Vanninen, Esko; Heinonen, Seppo

    2011-04-01

    The aim of the present study was to evaluate the influence of gestational hypertension on hemodynamics and cardiovascular autonomic regulation at rest and their responses to head-up tilt (HUT). We prospectively studied 56 pregnant women (28 with gestational hypertension and 28 healthy pregnant women) during the third trimester of pregnancy and 3 months after pregnancy. In women with pregnancy-induced hypertension, compared with control women, there were significant differences in hemodynamics and in markers of cardiovascular regulation (p Postural change from the supine to the upright position was associated with significant changes in hemodynamic responses in both groups during pregnancy (from p pregnancies (p changes in autonomic nervous function in hypertensive women appeared to be a feature of gestational-induced hypertension.

  4. Normal spectrum of pulmonary parametric response map to differentiate lung collapsibility: distribution of densitometric classifications in healthy adult volunteers

    International Nuclear Information System (INIS)

    Silva, Mario; Nemec, Stefan F.; Dufresne, Valerie; Occhipinti, Mariaelena; Heidinger, Benedikt H.; Bankier, Alexander A.; Chamberlain, Ryan

    2016-01-01

    Pulmonary parametric response map (PRM) was proposed for quantitative densitometric phenotypization of chronic obstructive pulmonary disease. However, little is known about this technique in healthy subjects. The purpose of this study was to describe the normal spectrum of densitometric classification of pulmonary PRM in a group of healthy adults. 15 healthy volunteers underwent spirometrically monitored chest CT at total lung capacity (TLC) and functional residual capacity (FRC). The paired CT scans were analyzed by PRM for voxel-by-voxel characterization of lung parenchyma according to 4 densitometric classifications: normal lung (TLC ≥ -950 HU, FRC ≥ -856 HU); expiratory low attenuation area (LAA) (TLC ≥ -950 HU, FRC < -856 HU); dual LAA (TLC<-950 HU, FRC < -856 HU); uncharacterized (TLC < -950 HU, FRC ≥ -856 HU). PRM spectrum was 78 % ± 10 % normal lung, 20 % ± 8 % expiratory LAA, and 1 % ± 1 % dual LAA. PRM was similar between genders, there was moderate correlation between dual LAA and spirometrically assessed TLC (R = 0.531; p = 0.042), and between expiratory LAA and Vol Exp/Insp ratio (R = -0.572; p = 0.026). PRM reflects the predominance of normal lung parenchyma in a group of healthy volunteers. However, PRM also confirms the presence of physiological expiratory LAA seemingly related to air trapping and a minimal amount of dual LAA likely reflecting emphysema. (orig.)

  5. Estimation of low-dose radiation-responsive proteins in the absence of genomic instability in normal human fibroblast cells.

    Science.gov (United States)

    Yim, Ji-Hye; Yun, Jung Mi; Kim, Ji Young; Nam, Seon Young; Kim, Cha Soon

    2017-11-01

    Low-dose radiation has various biological effects such as adaptive responses, low-dose hypersensitivity, as well as beneficial effects. However, little is known about the particular proteins involved in these effects. Here, we sought to identify low-dose radiation-responsive phosphoproteins in normal fibroblast cells. We assessed genomic instability and proliferation of fibroblast cells after γ-irradiation by γ-H2AX foci and micronucleus formation analyses and BrdU incorporation assay, respectively. We screened fibroblast cells 8 h after low-dose (0.05 Gy) γ-irradiation using Phospho Explorer Antibody Microarray and validated two differentially expressed phosphoproteins using Western blotting. Cell proliferation proceeded normally in the absence of genomic instability after low-dose γ-irradiation. Phospho antibody microarray analysis and Western blotting revealed increased expression of two phosphoproteins, phospho-NFκB (Ser536) and phospho-P70S6K (Ser418), 8 h after low-dose radiation. Our findings suggest that low-dose radiation of normal fibroblast cells activates the expression of phospho-NFκB (Ser536) and phospho-P70S6K (Ser418) in the absence of genomic instability. Therefore, these proteins may be involved in DNA damage repair processes.

  6. Estrogen Responsiveness of the TFIID Subunit TAF4B in the Normal Mouse Ovary and in Ovarian Tumors1

    Science.gov (United States)

    Wardell, Jennifer R.; Hodgkinson, Kendra M.; Binder, April K.; Seymour, Kimberly A.; Korach, Kenneth S.; Vanderhyden, Barbara C.; Freiman, Richard N.

    2013-01-01

    ABSTRACT Estrogen signaling in the ovary is a fundamental component of normal ovarian function, and evidence also indicates that excessive estrogen is a risk factor for ovarian cancer. We have previously demonstrated that the gonadally enriched TFIID subunit TAF4B, a paralog of the general transcription factor TAF4A, is required for fertility in mice and for the proliferation of ovarian granulosa cells following hormonal stimulation. However, the relationship between TAF4B and estrogen signaling in the normal ovary or during ovarian tumor initiation and progression has yet to be defined. Herein, we show that Taf4b mRNA and TAF4B protein, but not Taf4a mRNA or TAF4A protein, are increased in whole ovaries and granulosa cells of the ovary after exposure to 17beta-estradiol or the synthetic estrogen diethylstilbestrol and that this response occurs within hours after stimulation. Furthermore, this increase occurs via nuclear estrogen receptors both in vivo and in a mouse granulosa cancer cell line, NT-1. We observe a significant increase in Taf4b mRNA in estrogen-supplemented mouse ovarian tumors, which correlates with diminished survival of these mice. These data highlight the novel response of the general transcription factor TAF4B to estrogen in the normal ovary and during ovarian tumor progression in the mouse, suggesting its potential role in regulating actions downstream of estrogen stimulation. PMID:24068106

  7. Estrogen responsiveness of the TFIID subunit TAF4B in the normal mouse ovary and in ovarian tumors.

    Science.gov (United States)

    Wardell, Jennifer R; Hodgkinson, Kendra M; Binder, April K; Seymour, Kimberly A; Korach, Kenneth S; Vanderhyden, Barbara C; Freiman, Richard N

    2013-11-01

    Estrogen signaling in the ovary is a fundamental component of normal ovarian function, and evidence also indicates that excessive estrogen is a risk factor for ovarian cancer. We have previously demonstrated that the gonadally enriched TFIID subunit TAF4B, a paralog of the general transcription factor TAF4A, is required for fertility in mice and for the proliferation of ovarian granulosa cells following hormonal stimulation. However, the relationship between TAF4B and estrogen signaling in the normal ovary or during ovarian tumor initiation and progression has yet to be defined. Herein, we show that Taf4b mRNA and TAF4B protein, but not Taf4a mRNA or TAF4A protein, are increased in whole ovaries and granulosa cells of the ovary after exposure to 17beta-estradiol or the synthetic estrogen diethylstilbestrol and that this response occurs within hours after stimulation. Furthermore, this increase occurs via nuclear estrogen receptors both in vivo and in a mouse granulosa cancer cell line, NT-1. We observe a significant increase in Taf4b mRNA in estrogen-supplemented mouse ovarian tumors, which correlates with diminished survival of these mice. These data highlight the novel response of the general transcription factor TAF4B to estrogen in the normal ovary and during ovarian tumor progression in the mouse, suggesting its potential role in regulating actions downstream of estrogen stimulation.

  8. Enhancing the radiation response of tumors but not early or late responding normal tissues using a vascular disrupting agent

    DEFF Research Database (Denmark)

    Horsman, Michael R

    2017-01-01

    INTRODUCTION: Vascular disrupting agents (VDAs) damage tumor vasculature and enhance tumor radiation response. In this pre-clinical study, we combined radiation with the leading VDA in clinical development, combretastatin A-4 phosphate (CA4P), and compared the effects seen in tumors and relevant...... normal tissues. MATERIAL AND METHODS: Radiation was applied locally to tissues in CDF1 mice to produce full radiation dose-response curves. CA4P (250 mg/kg) was intraperitoneally (i.p.) injected within 30 minutes after irradiating. Response of 200 mm3 foot implanted C3H mammary carcinomas was assessed......% increase in ventilation rate measured by plethysmography within 9 months). A Chi-squared test was used for statistical comparisons (significance level of p 4P. The radiation...

  9. Temporally distinct response of irradiated normal human fibroblasts and their bystander cells to energetic heavy ions

    International Nuclear Information System (INIS)

    Hamada, Nobuyuki; Ni, Meinan; Funayama, Tomoo; Sakashita, Tetsuya; Kobayashi, Yasuhiko

    2008-01-01

    Ionizing radiation-induced bystander effects have been documented for a multitude of endpoints such as mutations, chromosome aberrations and cell death, which arise in nonirradiated bystander cells having received signals from directly irradiated cells; however, energetic heavy ion-induced bystander response is incompletely characterized. To address this, we employed precise microbeams of carbon and neon ions for targeting only a very small fraction of cells in confluent fibroblast cultures. Conventional broadfield irradiation was conducted in parallel to see the effects in irradiated cells. Exposure of 0.00026% of cells led to nearly 10% reductions in the clonogenic survival and twofold rises in the apoptotic incidence regardless of ion species. Whilst apoptotic frequency increased with time up to 72 h postirradiation in irradiated cells, its frequency escalated up to 24 h postirradiation but declined at 48 h postirradiation in bystander cells, indicating that bystander cells exhibit transient commitment to apoptosis. Carbon- and neon-ion microbeam irradiation similarly caused almost twofold increments in the levels of serine 15-phosphorylated p53 proteins, irrespective of whether 0.00026, 0.0013 or 0.0066% of cells were targeted. Whereas the levels of phosphorylated p53 were elevated and remained unchanged at 2 h and 6 h postirradiation in irradiated cells, its levels rose at 6 h postirradiation but not at 2 h postirradiation in bystander cells, suggesting that bystander cells manifest delayed p53 phosphorylation. Collectively, our results indicate that heavy ions inactivate clonogenic potential of bystander cells, and that the time course of the response to heavy ions differs between irradiated and bystander cells. These induced bystander responses could be a defensive mechanism that minimizes further expansion of aberrant cells

  10. Pituitary response to a dopamine antagonist at different times of the day in normal women.

    Science.gov (United States)

    Pérez-López, F R; González-Moreno, C M; Abós, M D; Andonegui, J A; Corvo, R H

    1982-08-01

    In order to determine whether or not pituitary responsiveness to the dopaminergic antagonist clebopride changes during the nyctohemeral cycle, 10 healthy women with regular cycles were given 1 mg of clebopride orally at 09.00 h and 24.00 h with at least a 5 day interval between each test. In addition, 5 of the women were given a placebo instead of clebopride at midnight to evaluate the spontaneous hormonal changes. During the 24.00 h test the women had significantly higher (P less than 0.05) mean TSH basal levels. Serum prolactin (Prl) increased significantly (P less than 0.001) after clebopride administration while these changes did not occur when placebo was used instead of clebopride at midnight. The Prl response to clebopride was qualitatively similar at 09.00 h and at 24.00 h. Clebopride given at midnight induced a significant increase (P less than 0.05) in serum TSH while this change did not occur when the drug was given at 09.00 h or when placebo was given at midnight. The administration of clebopride resulted in no discernible alternations in serum LH, FSH or GH in either the 09.00 h or the 24.00 h tests. Thus, Prl responses to clebopride were similar in the morning and at midnight, TSH significantly increased after clebopride at midnight whereas this did not occur when the drug was given in the morning, and no significant changes were induced in LH, FSH or GH at the times studied.

  11. The chondrogenic response to exercise in the proximal femur of normal and mdx mice

    Directory of Open Access Journals (Sweden)

    Nye David J

    2010-09-01

    Full Text Available Abstract Background Submaximal exercise is used in the management of muscular dystrophy. The effects of mechanical stimulation on skeletal development are well understood, although its effects on cartilage growth have yet to be investigated in the dystrophic condition. The objective of this study was to investigate the chondrogenic response to voluntary exercise in dystrophin-deficient mice. Methods Control and dystrophin-deficient (mdx mice were divided into sedentary and exercise-treated groups and tested for chondral histomorphometric differences at the proximal femur. Results Control mice ran 7 km/week further than mdx mice on average, but this difference was not statistically significant (P > 0.05. However, exercised control mice exhibited significantly enlarged femur head diameter, articular cartilage thickness, articular cartilage tissue area, and area of calcified cartilage relative to sedentary controls and exercised mdx mice (P Conclusions Mdx mice exhibit a reduced chondrogenic response to increased mechanical stimulation relative to controls. However, no significant reduction in articular dimensions was found, indicating loss of chondral tissue may not be a clinical concern with dystrophinopathy.

  12. EEG responses to low-level chemicals in normals and cacosmics.

    Science.gov (United States)

    Schwartz, G E; Bell, I R; Dikman, Z V; Fernandez, M; Kline, J P; Peterson, J M; Wright, K P

    1994-01-01

    Recent studies from the University of Arizona indicate that normal subjects, both college students and the elderly, can register the presence of low-intensity odors in the electroencephalogram (EEG) in the absence of conscious awareness of the odors. The experimental paradigm involves subjects sniffing pairs of bottles, one containing an odorant (e.g. isoamyl acetate) dissolved in an odorless solvent (water or liquid silicone), the other containing just the solvent, while 19 channels of EEG are continuously recorded. For the low-intensity odor conditions, concentrations are adjusted downward (decreased) until subjects correctly identify the odor bottle at chance (50%). The order of odorants, concentrations, and hand holding the control bottle, are counterbalanced within and across subjects. Three previous experiments found that alpha activity (8-12 hz) decreased in midline and posterior regions when subjects sniffed the low-intensity odors. The most recent study suggests that decreased theta activity (4-8 hz) may reflect sensory registration and decreased alpha activity may reflect perceptual registration. In a just completed experiment involving college students who were selected based on combinations of high and low scores on a scale measuring cacosmia (chemical odor intolerance) and high and low scores on a scale measuring depression, cacosmic subjects (independent of depression) showed greater decreases in low-frequency alpha (8-10 hz) and greater increases in low-frequency beta (12-16 hz) to the solvent propylene glycol compared to an empty bottle. Topographic EEG mapping to low-intensity odorants may provide a useful tool for investigating possible increased sensitivity to specific chemicals in chemically sensitive individuals.

  13. Peripheral, central and behavioral responses to the cuticular pheromone bouquet in Drosophila melanogaster males.

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Inoshita

    Full Text Available Pheromonal communication is crucial with regard to mate choice in many animals including insects. Drosophila melanogaster flies produce a pheromonal bouquet with many cuticular hydrocarbons some of which diverge between the sexes and differently affect male courtship behavior. Cuticular pheromones have a relatively high weight and are thought to be -- mostly but not only -- detected by gustatory contact. However, the response of the peripheral and central gustatory systems to these substances remains poorly explored. We measured the effect induced by pheromonal cuticular mixtures on (i the electrophysiological response of peripheral gustatory receptor neurons, (ii the calcium variation in brain centers receiving these gustatory inputs and (iii the behavioral reaction induced in control males and in mutant desat1 males, which show abnormal pheromone production and perception. While male and female pheromones induced inhibitory-like effects on taste receptor neurons, the contact of male pheromones on male fore-tarsi elicits a long-lasting response of higher intensity in the dedicated gustatory brain center. We found that the behavior of control males was more strongly inhibited by male pheromones than by female pheromones, but this difference disappeared in anosmic males. Mutant desat1 males showed an increased sensitivity of their peripheral gustatory neurons to contact pheromones and a behavioral incapacity to discriminate sex pheromones. Together our data indicate that cuticular hydrocarbons induce long-lasting inhibitory effects on the relevant taste pathway which may interact with the olfactory pathway to modulate pheromonal perception.

  14. Quantifying response to intracranial pressure normalization in idiopathic intracranial hypertension via dynamic neuroimaging.

    Science.gov (United States)

    Lublinsky, Svetlana; Kesler, Anat; Friedman, Alon; Horev, Anat; Shelef, Ilan

    2018-04-01

    Idiopathic intracranial hypertension (IIH) is characterized by elevated intracranial pressure without a clear cause. To investigate dynamic imaging findings in IIH and their relation to mechanisms underlying intracranial pressure normalization. Prospective. Eighteen IIH patients and 30 healthy controls. T 1 -weighted, venography, fluid attenuation inversion recovery, and apparent diffusion coefficients were acquired on 1.5T scanner. The dural sinus was measured before and after lumbar puncture (LP). The degree of sinus occlusion was evaluated, based on 95% confidence intervals of controls. We studied a number of neuroimaging biomarkers associated with IIH (sinus occlusion; optic nerve; distribution of cerebrospinal fluid into the subarachnoid space, sulci and lateral ventricles (LVs); Meckel's caves; arachnoid granulation; pituitary and choroid plexus), before and after LP, using a set of specially developed quantification techniques. Relationships among various biomarkers were investigated (Pearson correlation coefficient) and linked to long-term disease outcomes (logistic regression). The t-test and the Wilcoxon rank test were used to compare between controls and before and after LP data. As a result of LP, the following were found to be in good accordance with the opening pressure: relative compression of cerebrospinal fluid (R = -0.857, P < 0.001) and brain volumes (R = -0.576, P = 0.012), LV expansion (R = 0.772, P < 0.001) and venous volume (R = 0.696, P = 0.001), enlargement of the pituitary (R = 0.640, P = 0.023), and shrinkage of subarachnoid space (R = -0.887, P < 0.001). The only parameter that had an impact on long-term prognosis was cross-sectional size of supplemental drainage veins after LP (sensitivity of 92%, specificity of 20%, and area under the curve of 0.845, P < 0.001). We present an approach for quantitative characterization of the intracranial venous system and its implementation as a diagnostic assistance

  15. Dynamics of oligodendrocyte responses to anterograde axonal (Wallerian) and terminal degeneration in normal and TNF-transgenic mice

    DEFF Research Database (Denmark)

    Drøjdahl, Nina; Fenger, Christina; Nielsen, Helle H

    2004-01-01

    degeneration and lesion-induced axonal sprouting in the hippocampal dentate gyrus in TNF-transgenic mice with the response in genetically normal mice. Transectioning of the entorhino-dentate perforant path axonal projection increased hippocampal TNF mRNA expression in both types of mice, but to significantly...... larger levels in the TNF-transgenics. At 5 days after axonal transection, numbers of oligodendrocytes and myelin basic protein (MBP) mRNA expression in the denervated dentate gyrus in TNF-transgenic mice had increased to the same extent as in nontransgenic littermates. At this time, transgenics showed...

  16. Response of normal stem cells to ionizing radiation: A balance between homeostasis and genomic stability

    International Nuclear Information System (INIS)

    Harfouche, G.; Martin, M.T.

    2010-01-01

    Stem cells have been described in most adult tissues, where they play a key role in maintaining tissue homeostasis. As they self-renew throughout life, accumulating genetic anomalies can compromise their genomic integrity and potentially give rise to cancer. Stem cells (SCs) may thus be a major target of radiation carcinogenesis. In addition, unrepaired genotoxic damage may cause cell death and stem cell pool depletion, impairing lineage functionality and accelerating aging. Developments in SC biology enabled the characterization of the responses of stem cells to genotoxic stress and their role in tissue damage. We here examine how these cells react to ionizing radiation (IR), and more specifically their radiosensitivity, stress signaling and DNA repair. We first review embryonic SCs, as a paradigm of primitive pluri-potent cells, then three adult tissues, bone marrow, skin and intestine, capable of long-term regeneration and at high risk for acute radiation syndromes and long-term carcinogenesis. We discuss IR disruption of the fine balance between maintenance of tissue homeostasis and genomic stability. We show that stem cell radiosensitivity does not follow a unique model, but differs notably according to the turnover rates of the tissues. (authors)

  17. Dynamic response characteristics of high temperature superconducting maglev systems: Comparison between Halbach-type and normal permanent magnet guideways

    Science.gov (United States)

    Wang, B.; Zheng, J.; Che, T.; Zheng, B. T.; Si, S. S.; Deng, Z. G.

    2015-12-01

    The permanent magnet guideway (PMG) is very important for the performance of the high temperature superconducting (HTS) system in terms of electromagnetic force and operational stability. The dynamic response characteristics of a HTS maglev model levitating on two types of PMG, which are the normal PMG with iron flux concentration and Halbach-type PMG, were investigated by experiments. The dynamic signals for different field-cooling heights (FCHs) and loading/unloading processes were acquired and analyzed by a vibration analyzer and laser displacement sensors. The resonant frequency, stiffness and levitation height of the model were discussed. It was found that the maglev model on the Halbach-type PMG has higher resonant frequency and higher vertical stiffness compared with the normal PMG. However, the low lateral stiffness of the model on the Halbach-type PMG indicates poor lateral stability. Besides, the Halbach-type PMG has better loading capacity than the normal PMG. These results are helpful to design a suitable PMG for the HTS system in practical applications.

  18. Dynamic response characteristics of high temperature superconducting maglev systems: Comparison between Halbach-type and normal permanent magnet guideways

    International Nuclear Information System (INIS)

    Wang, B.; Zheng, J.; Che, T.; Zheng, B.T.; Si, S.S.; Deng, Z.G.

    2015-01-01

    Highlights: • The loading weight affects the RF tremendously. • Reducing the FCH can improve the stability of the maglev vehicle. • The Halbach-type PMG has better loading capacity than the conventional PMG. • Pre-load is an effective way to enhance the dynamic characteristic of the HTS maglev vehicle. - Abstract: The permanent magnet guideway (PMG) is very important for the performance of the high temperature superconducting (HTS) system in terms of electromagnetic force and operational stability. The dynamic response characteristics of a HTS maglev model levitating on two types of PMG, which are the normal PMG with iron flux concentration and Halbach-type PMG, were investigated by experiments. The dynamic signals for different field-cooling heights (FCHs) and loading/unloading processes were acquired and analyzed by a vibration analyzer and laser displacement sensors. The resonant frequency, stiffness and levitation height of the model were discussed. It was found that the maglev model on the Halbach-type PMG has higher resonant frequency and higher vertical stiffness compared with the normal PMG. However, the low lateral stiffness of the model on the Halbach-type PMG indicates poor lateral stability. Besides, the Halbach-type PMG has better loading capacity than the normal PMG. These results are helpful to design a suitable PMG for the HTS system in practical applications.

  19. Dynamic response characteristics of high temperature superconducting maglev systems: Comparison between Halbach-type and normal permanent magnet guideways

    Energy Technology Data Exchange (ETDEWEB)

    Wang, B. [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); Zheng, J., E-mail: jzheng@swjtu.cn [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); Che, T. [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); Zheng, B.T.; Si, S.S. [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); School of Electrical Engineering, Southwest Jiaotong University, Chengdu 610031, P R China (China); Deng, Z.G., E-mail: deng@swjtu.cn [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China)

    2015-12-15

    Highlights: • The loading weight affects the RF tremendously. • Reducing the FCH can improve the stability of the maglev vehicle. • The Halbach-type PMG has better loading capacity than the conventional PMG. • Pre-load is an effective way to enhance the dynamic characteristic of the HTS maglev vehicle. - Abstract: The permanent magnet guideway (PMG) is very important for the performance of the high temperature superconducting (HTS) system in terms of electromagnetic force and operational stability. The dynamic response characteristics of a HTS maglev model levitating on two types of PMG, which are the normal PMG with iron flux concentration and Halbach-type PMG, were investigated by experiments. The dynamic signals for different field-cooling heights (FCHs) and loading/unloading processes were acquired and analyzed by a vibration analyzer and laser displacement sensors. The resonant frequency, stiffness and levitation height of the model were discussed. It was found that the maglev model on the Halbach-type PMG has higher resonant frequency and higher vertical stiffness compared with the normal PMG. However, the low lateral stiffness of the model on the Halbach-type PMG indicates poor lateral stability. Besides, the Halbach-type PMG has better loading capacity than the normal PMG. These results are helpful to design a suitable PMG for the HTS system in practical applications.

  20. Brainstem auditory evoked response characteristics in normal-hearing subjects with chronic tinnitus and in non-tinnitus group

    Directory of Open Access Journals (Sweden)

    Shadman Nemati

    2014-06-01

    Full Text Available Background and Aim: While most of the people with tinnitus have some degrees of hearing impairment, a small percent of patients admitted to ear, nose and throat clinics or hearing evaluation centers are those who complain of tinnitus despite having normal hearing thresholds. This study was performed to better understanding of the reasons of probable causes of tinnitus and to investigate possible changes in the auditory brainstem function in normal-hearing patients with chronic tinnitus.Methods: In this comparative cross-sectional, descriptive and analytic study, 52 ears (26 with and 26 without tinnitus were examined. Components of the auditory brainstem response (ABR including wave latencies and wave amplitudes were determined in the two groups and analyzed using appropriate statistical methods.Results: The mean differences between the absolute latencies of waves I, III and V was less than 0.1 ms between the two groups that was not statistically significant. Also, the interpeak latency values of waves I-III, III-V and I-V in both groups had no significant difference. Only, the V/I amplitude ratio in the tinnitus group was significantly higher (p=0.04.Conclusion: The changes observed in amplitude of waves, especially in the latter ones, can be considered as an indication of plastic changes in neuronal activity and its possible role in generation of tinnitus in normal-hearing patients.

  1. Benazepril, an angiotensin converting enzyme inhibitor: drug interaction with salbutamol and bronchial response to histamine in normal subjects

    Science.gov (United States)

    Bauer, K. G.; Brunel, P.; Nell, G.; Quinn, G.; Kaik, G. A.

    1997-01-01

    Aims To investigate the effect of the angiotensin converting enzyme inhibitor, benazepril, on pulmonary function. Methods We investigated the influence of benazepril, on lung function and the interaction with inhaled salbutamol (0.1 to 6.6 mg) and histamine (0.03 to 30.69 g l−1 ) in normal subjects. Benazepril 20 mg, salbutamol 8 mg, propranolol 160 mg, and placebo were given orally once daily over 10 days. Results On day 8, there was no difference in the area under the salbutamol dose-response curves between benazepril, placebo and oral salbutamol (P >0.05), propranolol shifted the curves to the right (Pbenazepril 1.04 (0.99–1.08), salbutamol 1.19 (1.13–1.25), propranolol 0.57 (0.50–0.65). Conclusions Benazepril had no influence on baseline lung function, caused no interaction with inhaled salbutamol and the bronchial response to histamine was similar to placebo. However, our findings in normal subjects cannot be extrapolated automatically to asthmatics. PMID:9431834

  2. Gustatory response and longevity in Aphidius parasitoids and their hyperparasitoid Dendrocerus aphidum

    NARCIS (Netherlands)

    Goelen, Tim; Baets, Dieter; Kos, Martine; Paulussen, Caroline; Lenaerts, Marijke; Rediers, Hans; Wäckers, F.L.; Jacquemyn, Hans; Lievens, Bart

    2018-01-01

    Aphid parasitoids are commonly used in the biological control of aphids. However, their success in biological control largely depends on the availability of carbohydrate-rich food as an energy source for maintenance and reproduction. Therefore, as these resources have become rare in modern

  3. Causality Assessment of Olfactory and Gustatory Dysfunction Associated with Intranasal Fluticasone Propionate: Application of the Bradford Hill Criteria

    OpenAIRE

    Muganurmath, Chandrashekhar S.; Curry, Amy L.; Schindzielorz, Andrew H.

    2018-01-01

    Causality assessment is crucial to post-marketing pharmacovigilance and helps optimize safe and appropriate use of medicines by patients in the real world. Self-reported olfactory and gustatory dysfunction are common in the general population as well as in patients with allergic rhinitis and nasal polyposis. Intranasal corticosteroids, including intranasal fluticasone propionate (INFP), are amongst the most effective drugs indicated in the treatment of allergic rhinitis and nasal polyposis. W...

  4. Gustatory Detection of Tetrodotoxin and Saxitoxin, and Its Competitive Inhibition by Quinine and Strychnine in Freshwater Fishes

    Directory of Open Access Journals (Sweden)

    Toshiaki J. Hara

    2011-11-01

    Full Text Available Fish detect extremely low levels of marine toxins tetrodotoxin (TTX and saxitoxin (STX via the specialized gustatory receptor(s. Physiological and pharmacological studies show that receptor(s for TTX and STX are distinct from those which detect feeding stimulant amino acids and bile acids, and that TTX and STX do not share the same receptor populations, while interacting with quinine and strychnine in a competitive fashion suggestive of an antidotal relationship.

  5. Gustatory Perception and Fat Body Energy Metabolism Are Jointly Affected by Vitellogenin and Juvenile Hormone in Honey Bees

    OpenAIRE

    Wang, Ying; Brent, Colin S.; Fennern, Erin; Amdam, Gro V.

    2012-01-01

    Honey bees (Apis mellifera) provide a system for studying social and food-related behavior. A caste of workers performs age-related tasks: young bees (nurses) usually feed the brood and other adult bees inside the nest, while older bees (foragers) forage outside for pollen, a protein/lipid source, or nectar, a carbohydrate source. The workers' transition from nursing to foraging and their foraging preferences correlate with differences in gustatory perception, metabolic gene expression, and e...

  6. Autonomous parvoviruses neither stimulate nor are inhibited by the type I interferon response in human normal or cancer cells.

    Science.gov (United States)

    Paglino, Justin C; Andres, Wells; van den Pol, Anthony N

    2014-05-01

    Members of the genus Parvovirus are small, nonenveloped single-stranded DNA viruses that are nonpathogenic in humans but have potential utility as cancer therapeutics. Because the innate immune response to parvoviruses has received relatively little attention, we compared the response to parvoviruses to that of several other types of viruses in human cells. In normal human glia, fibroblasts, or melanocytes, vesicular stomatitis virus evoked robust beta interferon (IFN-β) responses. Cytomegalovirus, pseudorabies virus, and Sindbis virus all evoked a 2-log-unit or greater upregulation of IFN-β in glia; in contrast, LuIII and MVMp parvoviruses did not evoke a detectable IFN-β or interferon-stimulated gene (ISG; MX1, oligoadenylate synthetase [OAS], IFIT-1) response in the same cell types. The lack of response raised the question of whether parvoviral infection can be attenuated by IFN; interestingly, we found that IFN did not decrease parvovirus (MVMp, LuIII, and H-1) infectivity in normal human glia, fibroblasts, or melanocytes. The same was true in human cancers, including glioma, sarcoma, and melanoma. Similarly, IFN failed to attenuate transduction by the dependovirus vector adeno-associated virus type 2. Progeny production of parvoviruses was also unimpaired by IFN in both glioma and melanoma, whereas vesicular stomatitis virus replication was blocked. Sarcoma cells with upregulated IFN signaling that show high levels of resistance to other viruses showed strong infection by LuIII. Unlike many other oncolytic viruses, we found no evidence that impairment of innate immunity in cancer cells plays a role in the oncoselectivity of parvoviruses in human cells. Parvoviral resistance to the effects of IFN in cancer cells may constitute an advantage in the virotherapy of some tumors. Understanding the interactions between oncolytic viruses and the innate immune system will facilitate employing these viruses as therapeutic agents in cancer patients. The cancer

  7. Functional brain response to food images in successful adolescent weight losers compared with normal-weight and overweight controls.

    Science.gov (United States)

    Jensen, Chad D; Kirwan, C Brock

    2015-03-01

    Research conducted with adults suggests that successful weight losers demonstrate greater activation in brain regions associated with executive control in response to viewing high-energy foods. No previous studies have examined these associations in adolescents. Functional neuroimaging was used to assess brain response to food images among groups of overweight (OW), normal-weight (NW), and successful weight-losing (SWL) adolescents. Eleven SWL, 12 NW, and 11 OW participants underwent functional magnetic resonance imaging while viewing images of high- and low-energy foods. When viewing high-energy food images, SWLs demonstrated greater activation in the dorsolateral prefrontal cortex (DLPFC) compared with OW and NW controls. Compared with NW and SWL groups, OW individuals demonstrated greater activation in the ventral striatum and anterior cingulate in response to food images. Adolescent SWLs demonstrated greater neural activation in the DLPFC compared with OW/NW controls when viewing high-energy food stimuli, which may indicate enhanced executive control. OW individuals' brain responses to food stimuli may indicate greater reward incentive processes than either SWL or NW groups. © 2015 The Obesity Society.

  8. The Gustatory Signaling Pathway and Bitter Taste Receptors Affect the Development of Obesity and Adipocyte Metabolism in Mice.

    Directory of Open Access Journals (Sweden)

    Bert Avau

    Full Text Available Intestinal chemosensory signaling pathways involving the gustatory G-protein, gustducin, and bitter taste receptors (TAS2R have been implicated in gut hormone release. Alterations in gut hormone profiles may contribute to the success of bariatric surgery. This study investigated the involvement of the gustatory signaling pathway in the development of diet-induced obesity and the therapeutic potential of targeting TAS2Rs to induce body weight loss. α-gustducin-deficient (α-gust-/- mice became less obese than wild type (WT mice when fed a high-fat diet (HFD. White adipose tissue (WAT mass was lower in α-gust-/- mice due to increased heat production as a result of increases in brown adipose tissue (BAT thermogenic activity, involving increased protein expression of uncoupling protein 1. Intra-gastric treatment of obese WT and α-gust-/- mice with the bitter agonists denatonium benzoate (DB or quinine (Q during 4 weeks resulted in an α-gustducin-dependent decrease in body weight gain associated with a decrease in food intake (DB, but not involving major changes in gut peptide release. Both WAT and 3T3-F442A pre-adipocytes express TAS2Rs. Treatment of pre-adipocytes with DB or Q decreased differentiation into mature adipocytes. In conclusion, interfering with the gustatory signaling pathway protects against the development of HFD-induced obesity presumably through promoting BAT activity. Intra-gastric bitter treatment inhibits weight gain, possibly by directly affecting adipocyte metabolism.

  9. 99mTc-sestamibi muscle scintigraphy to assess the response to neuromuscular electrical stimulation of normal quadriceps femoris muscle

    International Nuclear Information System (INIS)

    Pekindil, Y.; Sarikaya, A.; Birtane, M.; Pekindil, G.; Salan, A.

    2001-01-01

    Neuromuscular electrical stimulation (NMES) is widely used for improving muscle strength by simultaneous contraction in the prevention of muscle atrophy. Although there exist many clinical methods for evaluating the therapeutic response of muscles, 99m Tc-sestamibi which is a skeletal muscle perfusion and metabolism agent has not previously been used for this purpose. The aim of our work was to ascertain whether 99m Tc-sestamibi muscle scintigraphy is useful in the monitoring of therapeutic response to NMES in healthy women. The study included 16 women aged between 21 and 45, with a mean age of 32.7±6.4. Both quadriceps femoris muscles (QFM) of each patient were studied. After randomization to remove the effect of the dominant side, one QFM of each patient was subjected to the NMES procedure for a period of 20 days. NMES was performed with an alternating biphasic rectangular current, from a computed electrical stimulator daily for 23 minutes. After measurement of skinfold thickness over the thigh, pre- and post-NMES girth measurements were assessed in centimeters. Sixty minutes after injections of 555 MBq 99m Tc-sestamibi, static images of the thigh were obtained for 5 minutes. The thigh-to-knee uptake ratio was calculated by semiquantitative analysis and normalized to body surface area (NUR=normalized uptake ratio). The difference between the pre and post NMES NUR values was significant (1.76±0.31 versus 2.25±0.38, p=0.0000). The percentage (%) increase in NUR values also well correlated with the % increase in thigh girth measurements (r=0.89, p=0.0000). These results indicated that 99m Tc-sestamibi muscle scintigraphy as a new tool may be useful in evaluating therapeutic response to NMES. (author)

  10. Three-dimensional analysis of tarsal bone response to axial loading in patients with hallux valgus and normal feet.

    Science.gov (United States)

    Watanabe, Kota; Ikeda, Yasutoshi; Suzuki, Daisuke; Teramoto, Atsushi; Kobayashi, Takuma; Suzuki, Tomoyuki; Yamashita, Toshihiko

    2017-02-01

    Patients with hallux valgus present a variety of symptoms that may be related to the type of deformity. Weightbearing affects the deformities, and the evaluation of the load response of tarsal bones has been mainly performed using two-dimensional plane radiography. The purpose of this study was to investigate and compare structural changes in the medial foot arch between patients with hallux valgus and normal controls using a computer image analysis technique and weightbearing computed tomography data. Eleven patients with hallux valgus and eleven normal controls were included. Computed tomograms were obtained with and without simulated weightbearing using a compression device. Computed tomography data were transferred into a personal computer, and a three-dimensional bone model was created using image analysis software. The load responses of each tarsal bone in the medial foot arch were measured three-dimensionally and statistically compared between the two groups. Displacement of each tarsal bone under two weightbearing conditions was visually observed by creating three-dimensional bone models. At the first metatarsophalangeal joint, the proximal phalanges of the hallux valgus group showed significantly different displacements in multiple directions. Moreover, opposite responses to axial loading were also observed in both translation and rotation between the two groups. Weightbearing caused deterioration of the hallux valgus deformity three-dimensionally at the first metatarsophalangeal joint. Information from the computer image analysis was useful for understanding details of the pathology of foot disorders related to the deformities or instability and may contribute to the development of effective conservative and surgical treatments. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. It's in the eye of the beholder: selective attention to drink properties during tasting influences brain activation in gustatory and reward regions.

    Science.gov (United States)

    van Rijn, Inge; de Graaf, Cees; Smeets, Paul A M

    2018-04-01

    Statements regarding pleasantness, taste intensity or caloric content on a food label may influence the attention consumers pay to such characteristics during consumption. There is little research on the effects of selective attention on taste perception and associated brain activation in regular drinks. The aim of this study was to investigate the effect of selective attention on hedonics, intensity and caloric content on brain responses during tasting drinks. Using functional MRI brain responses of 27 women were measured while they paid attention to the intensity, pleasantness or caloric content of fruit juice, tomato juice and water. Brain activation during tasting largely overlapped between the three selective attention conditions and was found in the rolandic operculum, insula and overlying frontal operculum, striatum, amygdala, thalamus, anterior cingulate cortex and middle orbitofrontal cortex (OFC). Brain activation was higher during selective attention to taste intensity compared to calories in the right middle OFC and during selective attention to pleasantness compared to intensity in the right putamen, right ACC and bilateral middle insula. Intensity ratings correlated with brain activation during selective attention to taste intensity in the anterior insula and lateral OFC. Our data suggest that not only the anterior insula but also the middle and lateral OFC are involved in evaluating taste intensity. Furthermore, selective attention to pleasantness engaged regions associated with food reward. Overall, our results indicate that selective attention to food properties can alter the activation of gustatory and reward regions. This may underlie effects of food labels on the consumption experience of consumers.

  12. Revisiting the slow force response: the role of the PKG signaling pathway in the normal and the ischemic heart.

    Science.gov (United States)

    Castro-Ferreira, Ricardo; Neves, João Sérgio; Ladeiras-Lopes, Ricardo; Leite-Moreira, André M; Neiva-Sousa, Manuel; Almeida-Coelho, João; Ferreira-Martins, João; F Leite-Moreira, Adelino

    2014-09-01

    The myocardial response to acute stretch consists of a two-phase increase in contractility: an acute increase by the Frank-Starling mechanism and a gradual and time-dependent increase in force generated known as the slow force response (SFR). The SFR is actively modulated by different signaling pathways, but the role of protein kinase G (PKG) signaling is unknown. In this study we aim to characterize the role of the PKG signaling pathway in the SFR under normal and ischemic conditions. Rabbit papillary muscles were stretched from 92 to 100% of maximum length (Lmax) under basal conditions, in the absence (1) or presence of: a PKG agonist (2) and a PKG inhibitor (3); under ischemic conditions in the absence (4) or presence of: a PKG agonist (5); a nitric oxide (NO) donor (6) and a phosphodiesterase 5 (PDE5) inhibitor (7). Under normoxia, the SFR was significantly attenuated by inhibition of PKG and remained unaltered with PKG activation. Ischemia induced a progressive decrease in myocardial contractility after stretch. Neither the PKG agonist nor the NO donor altered the myocardial response to stretch under ischemic conditions. However, the use of a PDE5 inhibitor in ischemia partially reversed the progressive deterioration in contractility. PKG activity is essential for the SFR. During ischemia, a progressive decline in the force is observed in response to acute myocardial stretch. This dysfunctional response can be partially reversed by the use of PDE5 inhibitors. Copyright © 2013 Sociedade Portuguesa de Cardiologia. Published by Elsevier España. All rights reserved.

  13. Expression of an engineered heterologous antimicrobial peptide in potato alters plant development and mitigates normal abiotic and biotic responses.

    Directory of Open Access Journals (Sweden)

    Ravinder K Goyal

    Full Text Available Antimicrobial cationic peptides (AMPs are ubiquitous small proteins used by living cells to defend against a wide spectrum of pathogens. Their amphipathic property helps their interaction with negatively charged cellular membrane of the pathogen causing cell lysis and death. AMPs also modulate signaling pathway(s and cellular processes in animal models; however, little is known of cellular processes other than the pathogen-lysis phenomenon modulated by AMPs in plants. An engineered heterologous AMP, msrA3, expressed in potato was previously shown to cause resistance of the transgenic plants against selected fungal and bacterial pathogens. These lines together with the wild type were studied for growth habits, and for inducible defense responses during challenge with biotic (necrotroph Fusarium solani and abiotic stressors (dark-induced senescence, wounding and temperature stress. msrA3-expression not only conferred protection against F. solani but also delayed development of floral buds and prolonged vegetative phase. Analysis of select gene transcript profiles showed that the transgenic potato plants were suppressed in the hypersensitive (HR and reactive oxygen species (ROS responses to both biotic and abiotic stressors. Also, the transgenic leaves accumulated lesser amounts of the defense hormone jasmonic acid upon wounding with only a slight change in salicylic acid as compared to the wild type. Thus, normal host defense responses to the pathogen and abiotic stressors were mitigated by msrA3 expression suggesting MSRA3 regulates a common step(s of these response pathways. The stemming of the pathogen growth and mitigating stress response pathways likely contributes to resource reallocation for higher tuber yield.

  14. A Dose-Response Strategy Reveals Differences between Normal-Weight and Obese Men in Their Metabolic and Inflammatory Responses to a High-Fat Meal123

    Science.gov (United States)

    Schwander, Flurina; Kopf-Bolanz, Katrin A.; Buri, Caroline; Portmann, Reto; Egger, Lotti; Chollet, Magali; McTernan, Philip G.; Piya, Milan K.; Gijs, Martin A. M.; Vionnet, Nathalie; Pralong, François; Laederach, Kurt; Vergères, Guy

    2014-01-01

    A dose-response strategy may not only allow investigation of the impact of foods and nutrients on human health but may also reveal differences in the response of individuals to food ingestion based on their metabolic health status. In a randomized crossover study, we challenged 19 normal-weight (BMI: 20–25 kg/m2) and 18 obese (BMI: >30 kg/m2) men with 500, 1000, and 1500 kcal of a high-fat (HF) meal (60.5% energy from fat). Blood was taken at baseline and up to 6 h postprandially and analyzed for a range of metabolic, inflammatory, and hormonal variables, including plasma glucose, lipids, and C-reactive protein and serum insulin, glucagon-like peptide-1, interleukin-6 (IL-6), and endotoxin. Insulin was the only variable that could differentiate the postprandial response of normal-weight and obese participants at each of the 3 caloric doses. A significant response of the inflammatory marker IL-6 was only observed in the obese group after ingestion of the HF meal containing 1500 kcal [net incremental AUC (iAUC) = 22.9 ± 6.8 pg/mL × 6 h, P = 0.002]. Furthermore, the net iAUC for triglycerides significantly increased from the 1000 to the 1500 kcal meal in the obese group (5.0 ± 0.5 mmol/L × 6 h vs. 6.0 ± 0.5 mmol/L × 6 h; P = 0.015) but not in the normal-weight group (4.3 ± 0.5 mmol/L × 6 h vs. 4.8 ± 0.5 mmol/L × 6 h; P = 0.31). We propose that caloric dose-response studies may contribute to a better understanding of the metabolic impact of food on the human organism. This study was registered at clinicaltrials.gov as NCT01446068. PMID:24812072

  15. A dose-response strategy reveals differences between normal-weight and obese men in their metabolic and inflammatory responses to a high-fat meal.

    Science.gov (United States)

    Schwander, Flurina; Kopf-Bolanz, Katrin A; Buri, Caroline; Portmann, Reto; Egger, Lotti; Chollet, Magali; McTernan, Philip G; Piya, Milan K; Gijs, Martin A M; Vionnet, Nathalie; Pralong, François; Laederach, Kurt; Vergères, Guy

    2014-10-01

    A dose-response strategy may not only allow investigation of the impact of foods and nutrients on human health but may also reveal differences in the response of individuals to food ingestion based on their metabolic health status. In a randomized crossover study, we challenged 19 normal-weight (BMI: 20-25 kg/m(2)) and 18 obese (BMI: >30 kg/m(2)) men with 500, 1000, and 1500 kcal of a high-fat (HF) meal (60.5% energy from fat). Blood was taken at baseline and up to 6 h postprandially and analyzed for a range of metabolic, inflammatory, and hormonal variables, including plasma glucose, lipids, and C-reactive protein and serum insulin, glucagon-like peptide-1, interleukin-6 (IL-6), and endotoxin. Insulin was the only variable that could differentiate the postprandial response of normal-weight and obese participants at each of the 3 caloric doses. A significant response of the inflammatory marker IL-6 was only observed in the obese group after ingestion of the HF meal containing 1500 kcal [net incremental AUC (iAUC) = 22.9 ± 6.8 pg/mL × 6 h, P = 0.002]. Furthermore, the net iAUC for triglycerides significantly increased from the 1000 to the 1500 kcal meal in the obese group (5.0 ± 0.5 mmol/L × 6 h vs. 6.0 ± 0.5 mmol/L × 6 h; P = 0.015) but not in the normal-weight group (4.3 ± 0.5 mmol/L × 6 h vs. 4.8 ± 0.5 mmol/L × 6 h; P = 0.31). We propose that caloric dose-response studies may contribute to a better understanding of the metabolic impact of food on the human organism. This study was registered at clinicaltrials.gov as NCT01446068. © 2014 American Society for Nutrition.

  16. Ensembles of gustatory cortical neurons anticipate and discriminate between tastants in a single lick

    Directory of Open Access Journals (Sweden)

    Jennifer R Stapleton

    2007-10-01

    Full Text Available The gustatory cortex (GC processes chemosensory and somatosensory information and is involved in learning and anticipation. Previously we found that a subpopulation of GC neurons responded to tastants in a single lick (Stapleton et al., 2006. Here we extend this investigation to determine if small ensembles of GC neurons, obtained while rats received blocks of tastants on a fixed ratio schedule (FR5, can discriminate between tastants and their concentrations after a single 50 µL delivery. In the FR5 schedule subjects received tastants every fifth (reinforced lick and the intervening licks were unreinforced. The ensemble firing patterns were analyzed with a Bayesian generalized linear model whose parameters included the firing rates and temporal patterns of the spike trains. We found that when both the temporal and rate parameters were included, 12 of 13 ensembles correctly identified single tastant deliveries. We also found that the activity during the unreinforced licks contained signals regarding the identity of the upcoming tastant, which suggests that GC neurons contain anticipatory information about the next tastant delivery. To support this finding we performed experiments in which tastant delivery was randomized within each block and found that the neural activity following the unreinforced licks did not predict the upcoming tastant. Collectively, these results suggest that after a single lick ensembles of GC neurons can discriminate between tastants, that they may utilize both temporal and rate information, and when the tastant delivery is repetitive ensembles contain information about the identity of the upcoming tastant delivery.

  17. Numerical Study on Dynamic Response of a Horizontal Layered-Structure Rock Slope under a Normally Incident Sv Wave

    Directory of Open Access Journals (Sweden)

    Zhifa Zhan

    2017-07-01

    Full Text Available Several post-earthquake investigations have indicated that the slope structure plays a leading role in the stability of rock slopes under dynamic loads. In this paper, the dynamic response of a horizontal layered-structure rock slope under harmonic Sv wave is studied by making use of the Fast Lagrangian Analysis of Continua method (FLAC. The suitability of FLAC for studying wave transmission across rock joints is validated through comparison with analytical solutions. After parametric studies on Sv wave transmission across the horizontal layered-structure rock slope, it is found that the acceleration amplification coefficient η, which is defined as the ratio of the acceleration at the monitoring point to the value at the toe, wavily increases with an increase of the height along the slope surface. Meanwhile, the fluctuation weakens with normalized joint stiffness K increasing and enhances with normalized joint spacing ξ increasing. The acceleration amplification coefficient of the slope crest ηcrest does not monotonously increase with the increase of ξ, but decreases with the increase of K. Additionally, ηcrest is more sensitive to ξ compared to K. From the contour figures, it can also be found that the contour figures of η take on rhythm, and the effects of ξ on the acceleration amplification coefficient are more obvious compared to the effects on K.

  18. Changes in phosphatidylcholine fatty acid composition are associated with altered skeletal muscle insulin responsiveness in normal man.

    Science.gov (United States)

    Clore, J N; Harris, P A; Li, J; Azzam, A; Gill, R; Zuelzer, W; Rizzo, W B; Blackard, W G

    2000-02-01

    The fatty acid composition of skeletal muscle cell membrane phospholipids (PLs) is known to influence insulin responsiveness in man. We have recently shown that the fatty acid composition of phosphatidylcholine (PC), and not phosphatidylethanolamine (PE), from skeletal muscle membranes is of particular importance in this relationship. Efforts to alter the PL fatty acid composition in animal models have demonstrated induction of insulin resistance. However, it has been more difficult to determine if changes in insulin sensitivity are associated with changes in the skeletal muscle membrane fatty acid composition of PL in man. Using nicotinic acid (NA), an agent known to induce insulin resistance in man, 9 normal subjects were studied before and after treatment for 1 month. Skeletal muscle membrane fatty acid composition of PC and PE from biopsies of vastus lateralis was correlated with insulin responsiveness using a 3-step hyperinsulinemic-euglycemic clamp. Treatment with NA was associated with a 25% increase in the half-maximal insulin concentration ([ED50] 52.0 +/- 7.5 to 64.6 +/- 9.0 microU/mL, P insulin sensitivity. Significant changes in the fatty acid composition of PC, but not PE, were also observed after NA administration. An increase in the percentage of 16:0 (21% +/- 0.3% to 21.7% +/- 0.4%, P insulin resistance with NA is associated with changes in the fatty acid composition of PC in man.

  19. Genetic tracing of the gustatory and trigeminal neural pathways originating from T1R3-expressing taste receptor cells and solitary chemoreceptor cells.

    Science.gov (United States)

    Ohmoto, Makoto; Matsumoto, Ichiro; Yasuoka, Akihito; Yoshihara, Yoshihiro; Abe, Keiko

    2008-08-01

    We established transgenic mouse lines expressing a transneuronal tracer, wheat germ agglutinin (WGA), under the control of mouse T1R3 gene promoter/enhancer. In the taste buds, WGA transgene was faithfully expressed in T1R3-positive sweet/umami taste receptor cells. WGA protein was transferred not laterally to the synapse-bearing, sour-responsive type III cells in the taste buds but directly to a subset of neurons in the geniculate and nodose/petrosal ganglia, and further conveyed to a rostro-central region of the nucleus of solitary tract. In addition, WGA was expressed in solitary chemoreceptor cells in the nasal epithelium and transferred along the trigeminal sensory pathway to the brainstem neurons. The solitary chemoreceptor cells endogenously expressed T1R3 together with bitter taste receptors T2Rs. This result shows an exceptional signature of receptor expression. Thus, the t1r3-WGA transgenic mice revealed the sweet/umami gustatory pathways from taste receptor cells and the trigeminal neural pathway from solitary chemoreceptor cells.

  20. A large increase of sour taste receptor cells in Skn-1-deficient mice does not alter the number of their sour taste signal-transmitting gustatory neurons.

    Science.gov (United States)

    Maeda, Naohiro; Narukawa, Masataka; Ishimaru, Yoshiro; Yamamoto, Kurumi; Misaka, Takumi; Abe, Keiko

    2017-05-01

    The connections between taste receptor cells (TRCs) and innervating gustatory neurons are formed in a mutually dependent manner during development. To investigate whether a change in the ratio of cell types that compose taste buds influences the number of innervating gustatory neurons, we analyzed the proportion of gustatory neurons that transmit sour taste signals in adult Skn-1a -/- mice in which the number of sour TRCs is greatly increased. We generated polycystic kidney disease 1 like 3-wheat germ agglutinin (pkd1l3-WGA)/Skn-1a +/+ and pkd1l3-WGA/Skn-1a -/- mice by crossing Skn-1a -/- mice and pkd1l3-WGA transgenic mice, in which neural pathways of sour taste signals can be visualized. The number of WGA-positive cells in the circumvallate papillae is 3-fold higher in taste buds of pkd1l3-WGA/Skn-1a -/- mice relative to pkd1l3-WGA/Skn-1a +/+ mice. Intriguingly, the ratio of WGA-positive neurons to P2X 2 -expressing gustatory neurons in nodose/petrosal ganglia was similar between pkd1l3-WGA/Skn-1a +/+ and pkd1l3-WGA/Skn-1a -/- mice. In conclusion, an alteration in the ratio of cell types that compose taste buds does not influence the number of gustatory neurons that transmit sour taste signals. Copyright © 2017. Published by Elsevier B.V.

  1. Prolactin-sensitive neurons express estrogen receptor-α and depend on sex hormones for normal responsiveness to prolactin.

    Science.gov (United States)

    Furigo, Isadora C; Kim, Ki Woo; Nagaishi, Vanessa S; Ramos-Lobo, Angela M; de Alencar, Amanda; Pedroso, João A B; Metzger, Martin; Donato, Jose

    2014-05-30

    Estrogens and prolactin share important target tissues, including the gonads, brain, liver, kidneys and some types of cancer cells. Herein, we sought anatomical and functional evidence of possible crosstalk between prolactin and estrogens in the mouse brain. First, we determined the distribution of prolactin-responsive neurons that express the estrogen receptor α (ERα). A large number of prolactin-induced pSTAT5-immunoreactive neurons expressing ERα mRNA were observed in several brain areas, including the anteroventral periventricular nucleus, medial preoptic nucleus, arcuate nucleus of the hypothalamus, ventrolateral subdivision of the ventromedial nucleus of the hypothalamus (VMH), medial nucleus of the amygdala and nucleus of the solitary tract. However, although the medial preoptic area, periventricular nucleus of the hypothalamus, paraventricular nucleus of the hypothalamus, retrochiasmatic area, dorsomedial subdivision of the VMH, lateral hypothalamic area, dorsomedial nucleus of the hypothalamus and ventral premammillary nucleus contained significant numbers of prolactin-responsive neurons, these areas showed very few pSTAT5-immunoreactive cells expressing ERα mRNA. Second, we evaluated prolactin sensitivity in ovariectomized mice and observed that sex hormones are required for a normal responsiveness to prolactin as ovariectomized mice showed a lower number of prolactin-induced pSTAT5 immunoreactive neurons in all analyzed brain nuclei compared to gonad-intact females. In addition, we performed hypothalamic gene expression analyses to determine possible post-ovariectomy changes in components of prolactin signaling. We observed no significant changes in the mRNA expression of prolactin receptor, STAT5a or STAT5b. In summary, sex hormones exert a permissive role in maintaining the brain's prolactin sensitivity, most likely through post-transcriptional mechanisms. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. The quest for predicting sustained shunt response in normal pressure hydrocephalus: an analysis of the callosal angle's utility.

    Science.gov (United States)

    Grahnke, Kurt; Jusue-Torres, Ignacio; Szujewski, Caroline; Joyce, Cara; Schneck, Michael; Prabhu, Vikram; Anderson, Douglas

    2018-04-30

    Diagnosing normal pressure hydrocephalus (NPH) and selecting patients who will experience a sustained benefit from fluid diversion surgery remains challenging. This study seeks to evaluate the association between the callosal angle (CA) and the long-term post-operative response to ventriculoperitoneal shunt (VPS) surgery in a different subgroup population than previously studied to assess its generalizability. We studied 73 patients with idiopathic NPH who underwent VPS surgery and had at least 18 months of follow-up between 2000-2016. We recorded their pre and postoperative symptoms according to the NPH Eide scale and their comorbidities with the Kiefer index. Their CA, as well as Evan's Index, ventricular height, and transependymal signal were measured. Multivariable statistical models were used to determine which factors were associated with postoperative improvement, while controlling for the presence of the NPH triad. Fifty-nine patients (82%) demonstrated a successful response to surgery at their first postoperative follow-up. However, this declined to 54 patients (75%) at one year and 45 (62.5%) patients at their last follow-up. When controlling for the presence of the triad of symptoms, the CA significantly predicted a good, sustained response to surgery; for every degree decrease in the CA, a patient is 4% more likely to experience benefit from surgery. The CA is a useful preoperative prognostic tool for predicting which patients will experience a sustained benefit from surgery. Further studies are required to clarify this disease in the context of old age, comorbidity, and possible concomitant neurodegenerative diseases. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Hypothalamic amenorrhea with normal body weight: ACTH, allopregnanolone and cortisol responses to corticotropin-releasing hormone test.

    Science.gov (United States)

    Meczekalski, B; Tonetti, A; Monteleone, P; Bernardi, F; Luisi, S; Stomati, M; Luisi, M; Petraglia, F; Genazzani, A R

    2000-03-01

    Hypothalamic amenorrhea (HA) is a functional disorder caused by disturbances in gonadotropin-releasing hormone (GnRH) pulsatility. The mechanism by which stress alters GnRH release is not well known. Recently, the role of corticotropin-releasing hormone (CRH) and neurosteroids in the pathophysiology of HA has been considered. The aim of the present study was to explore further the role of the hypothalamic-pituitary-adrenal axis in HA. We included 8 patients (aged 23.16+/-1.72 years) suffering from hypothalamic stress-related amenorrhea with normal body weight and 8 age-matched healthy controls in the follicular phase of the menstrual cycle. We measured basal serum levels of FSH, LH, and estradiol and evaluated ACTH, allopregnanolone and cortisol responses to CRH test in both HA patients and healthy women. Serum basal levels of FSH, LH, and estradiol as well as basal levels of allopregnanolone were significantly lower in HA patients than in controls (P<0.001) while basal ACTH and cortisol levels were significantly higher in amenorrheic patients with respect to controls (P<0.001). The response (area under the curve) of ACTH, allopregnanolone and cortisol to CRH was significantly lower in amenorrheic women compared with controls (P<0.001, P<0.05, P<0.05 respectively). In conclusion, women with HA, despite the high ACTH and cortisol levels and, therefore, hypothalamus-pituitary-adrenal axis hyperactivity, are characterized by low allopregnanolone basal levels, deriving from an impairment of both adrenal and ovarian synthesis. The blunted ACTH, allopregnanolone and cortisol responses to CRH indicate that, in hypothalamic amenorrhea, there is a reduced sensitivity and expression of CRH receptor. These results open new perspectives on the role of neurosteroids in the pathogenesis of hypothalamic amenorrhea.

  4. Implementing a finite-state off-normal and fault response system for disruption avoidance in tokamaks

    Science.gov (United States)

    Eidietis, N. W.; Choi, W.; Hahn, S. H.; Humphreys, D. A.; Sammuli, B. S.; Walker, M. L.

    2018-05-01

    A finite-state off-normal and fault response (ONFR) system is presented that provides the supervisory logic for comprehensive disruption avoidance and machine protection in tokamaks. Robust event handling is critical for ITER and future large tokamaks, where plasma parameters will necessarily approach stability limits and many systems will operate near their engineering limits. Events can be classified as off-normal plasmas events, e.g. neoclassical tearing modes or vertical displacements events, or faults, e.g. coil power supply failures. The ONFR system presented provides four critical features of a robust event handling system: sequential responses to cascading events, event recovery, simultaneous handling of multiple events and actuator prioritization. The finite-state logic is implemented in Matlab®/Stateflow® to allow rapid development and testing in an easily understood graphical format before automated export to the real-time plasma control system code. Experimental demonstrations of the ONFR algorithm on the DIII-D and KSTAR tokamaks are presented. In the most complex demonstration, the ONFR algorithm asynchronously applies ‘catch and subdue’ electron cyclotron current drive (ECCD) injection scheme to suppress a virulent 2/1 neoclassical tearing mode, subsequently shuts down ECCD for machine protection when the plasma becomes over-dense, and enables rotating 3D field entrainment of the ensuing locked mode to allow a safe rampdown, all in the same discharge without user intervention. When multiple ONFR states are active simultaneously and requesting the same actuator (e.g. neutral beam injection or gyrotrons), actuator prioritization is accomplished by sorting the pre-assigned priority values of each active ONFR state and giving complete control of the actuator to the state with highest priority. This early experience makes evident that additional research is required to develop an improved actuator sharing protocol, as well as a methodology to

  5. Localization of Ulex europaeus agglutinin-I (UEA-I) in the developing gustatory epithelium of the rat.

    Science.gov (United States)

    Taniguchi, Ryo; Shi, Lei; Honma, Shiho; Fujii, Masae; Ueda, Katsura; El-Sharaby, Ashraf; Wakisaka, Satoshi

    2004-09-01

    To understand the development of the gustatory structures necessitates a reliable marker for both immature and mature taste buds. It has been reported that the intragemmal cells within the taste buds of adult rats were bound to Ulex europaeus agglutinin-I (UEA-I), a specific lectin for alpha-linked fucose, but it has not been determined whether immature taste buds, i.e. taste buds without an apparent taste pore, are labeled with UEA-I. The present study was conducted to examine the UEA-I binding pattern during the development of the rat gustatory epithelium. In adult animals, UEA-I bound to the membrane of taste buds in all examined regions of the gustatory epithelium. Within the individual taste buds, UEA-I labeled almost all intragemmal cells. The binding of UEA-I was occasionally detected below the keratinized layer of the trench wall epithelium but could not be found in the lingual epithelium of the adult animal. During the development of circumvallate papilla, some cells within the immature taste buds were also labeled with UEA-I. The developmental changes in the UEA-I binding pattern in fungiform papillae were almost identical to those in the circumvallate papilla: both immature and mature taste buds were labeled with UEA-I. The present results indicate that UEA-I is a specific lectin for the intragemmal cells of both immature and mature taste buds and, thus, UEA-I can be used as a reliable marker for all taste buds in the rat.

  6. Value of apparent diffusion coefficient calculation before and after gustatory stimulation in the diagnosis of acute or chronic parotitis

    Energy Technology Data Exchange (ETDEWEB)

    Ries, T.; Arndt, C.; Regier, M.; Cramer, M.C.; Adam, G.; Habermann, C.R. [Diagnostic Center, Department of Diagnostic and Interventional Radiology, Hamburg (Germany); Graessner, J. [Medical Solutions Hamburg, Siemens AG, Hamburg (Germany); Reitmeier, F.; Jaehne, M. [University Medical Center Hamburg-Eppendorf, Center of Head Care and Dermatology, Department of Otorhinolaryngology, Hamburg (Germany)

    2008-10-15

    The purpose of the study was to investigate the value of diffusion-weighted (DW) echo-planar imaging (EPI) for quantifying physiological changes of the parotid gland before and after gustatory stimulation in patients suffering from acute or chronic recurrent inflammation in comparison with healthy volunteers. Using a DW-EPI sequence at 1.5 T, parotid glands of 19 consecutive patients with acute (n = 14) and chronic (n=) inflammation of parotid glands and 52 healthy volunteers were examined. Magnetic-resonance (MR) images were obtained before and after gustatory stimulation with 5 cc of lemon juice. In volunteers mean ADC values of 1.14 x 10{sup -3} mm{sup 2}/s before and 1.2 x 10{sup -3} mm{sup 2}/s after gustatory stimulation were observed. In acute inflammation ADC values were higher before [1.22 x 10{sup -3} mm{sup 2}/s (p = 0.006)] and after stimulation [1.32 x 10{sup -3} mm{sup 2}/s (p<0.001)]. Before stimulation ADC differences between chronic inflammation (1.05 x 10{sup -3} mm{sup 2}/s) and healthy volunteers (p = 0.04) as well as between acute and chronic inflammation (p=0.005) were statistically significant. No differences were detected after stimulation between chronic inflammation (1.2 x 10{sup -3} mm{sup 2}/s) and healthy volunteers (p=0.94) and between acute and chronic inflammation (p=0.15), respectively. DW-EPI seems to display the physiological changes of the parotid gland in patients suffering from acute or chronic inflammation and might be useful for discriminating healthy from affected glands. (orig.)

  7. Mice Lacking Pannexin 1 Release ATP and Respond Normally to All Taste Qualities.

    Science.gov (United States)

    Vandenbeuch, Aurelie; Anderson, Catherine B; Kinnamon, Sue C

    2015-09-01

    Adenosine triphosphate (ATP) is required for the transmission of all taste qualities from taste cells to afferent nerve fibers. ATP is released from Type II taste cells by a nonvesicular mechanism and activates purinergic receptors containing P2X2 and P2X3 on nerve fibers. Several ATP release channels are expressed in taste cells including CALHM1, Pannexin 1, Connexin 30, and Connexin 43, but whether all are involved in ATP release is not clear. We have used a global Pannexin 1 knock out (Panx1 KO) mouse in a series of in vitro and in vivo experiments. Our results confirm that Panx1 channels are absent in taste buds of the knockout mice and that other known ATP release channels are not upregulated. Using a luciferin/luciferase assay, we show that circumvallate taste buds from Panx1 KO mice normally release ATP upon taste stimulation compared with wild type (WT) mice. Gustatory nerve recordings in response to various tastants applied to the tongue and brief-access behavioral testing with SC45647 also show no difference between Panx1 KO and WT. These results confirm that Panx1 is not required for the taste evoked release of ATP or for neural and behavioral responses to taste stimuli. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Attenuation of the pressor response to exogenous angiotensin by angiotensin receptor blockers and benazepril hydrochloride in clinically normal cats.

    Science.gov (United States)

    Jenkins, Tiffany L; Coleman, Amanda E; Schmiedt, Chad W; Brown, Scott A

    2015-09-01

    To compare the attenuation of the angiotensin I-induced blood pressure response by once-daily oral administration of various doses of angiotensin receptor blockers (irbesartan, telmisartan, and losartan), benazepril hydrochloride, or lactose monohydrate (placebo) for 8 days in clinically normal cats. 6 healthy cats (approx 17 months old) with surgically implanted arterial telemetric blood pressure-measuring catheters. Cats were administered orally the placebo or each of the drug treatments (benazepril [2.5 mg/cat], irbesartan [6 and 10 mg/kg], telmisartan [0.5, 1, and 3 mg/kg], and losartan [2.5 mg/kg]) once daily for 8 days in a crossover study. Approximately 90 minutes after capsule administration on day 8, each cat was anesthetized and arterial blood pressure measurements were recorded before and after IV administration of each of 4 boluses of angiotensin I (20, 100, 500, and 1,000 ng/kg). This protocol was repeated 24 hours after benazepril treatment and telmisartan (3 mg/kg) treatment. Differences in the angiotensin I-induced change in systolic arterial blood pressure (ΔSBP) among treatments were determined. At 90 minutes after capsule administration, only losartan did not significantly reduce ΔSBP in response to the 3 higher angiotensin doses, compared with placebo. Among drug treatments, telmisartan (3 mg/kg dosage) attenuated ΔSBP to a significantly greater degree than benazepril and all other treatments. At 24 hours, telmisartan was more effective than benazepril (mean ± SEM ΔSBP, 15.7 ± 1.9 mm Hg vs 55.9 ± 12.42 mm Hg, respectively). Results indicated that telmisartan administration may have advantages over benazepril administration for cats with renal or cardiovascular disease.

  9. Ventromedial hypothalamic expression of Bdnf is required to establish normal patterns of afferent GABAergic connectivity and responses to hypoglycemia

    Directory of Open Access Journals (Sweden)

    Anna Kamitakahara

    2016-02-01

    Full Text Available Objective: The ventromedial nucleus of the hypothalamus (VMH controls energy and glucose homeostasis through direct connections to a distributed network of nuclei in the hypothalamus, midbrain, and hindbrain. Structural changes in VMH circuit morphology have the potential to alter VMH function throughout life, however, molecular signals responsible for specifying its neural connections are not fully defined. The VMH contains a high density of neurons that express brain-derived neurotrophic factor (BDNF, a potent neurodevelopmental effector known to regulate neuronal survival, growth, differentiation, and connectivity in a number of neural systems. In the current study, we examined whether BDNF impacts the afferent and efferent connections of the VMH, as well as energy homeostatic function. Methods: To determine if BDNF is required for VMH circuit formation, a transgenic mouse model was used to conditionally delete Bdnf from steroidogenic factor 1 (SF1 expressing neurons of the VMH prior to the onset of establishing neural connections with other regions. Projections of SF1 expressing neurons were visualized with a genetically targeted fluorescent label and immunofluorescence was used to measure the density of afferents to SF1 neurons in the absence of BDNF. Physiological changes in body weight and circulating blood glucose were also evaluated in the mutant mice. Results: Our findings suggest that BDNF is required to establish normal densities of GABAergic afferents onto SF1 neurons located in the ventrolateral part of the VMH. Furthermore, loss of BDNF from VMH SF1 neurons results in impaired physiological responses to insulin-induced hypoglycemia. Conclusion: The results of this study indicate that BDNF is required for formation and/or maintenance of inhibitory inputs to SF1 neurons, with enduring effects on glycemic control. Author Video: Author Video Watch what authors say about their articles Keywords: Ventromedial nucleus of the hypothalamus

  10. The effect of palm oil, lard, and puff-pastry margarine on postprandial lipid and hormone responses in normal-weight and obese young women.

    Science.gov (United States)

    Jensen, J; Bysted, A; Dawids, S; Hermansen, K; Hølmer, G

    1999-12-01

    Only a few studies have been published on the postprandial effects of different fatty acids in obese subjects. Therefore, the present study investigated the effects of three test meals containing palm oil (PO), lard (LD), or puff-pastry margarine (PPM), all normal dietary ingredients, on postprandial lipid and hormone responses in normal-weight and obese young women. The study was performed as a randomized, crossover design. The fats differed in the content of palmitic acid, stearic acid, and trans monounsaturated fatty acids allowing a dietary comparison of different 'solid' fatty acids. The obese women had significantly higher fasting concentrations and postprandial responses of plasma total triacylglycerol (TAG), chylomicron-TAG, and insulin compared with the normal-weight women but there was no significant difference in the postprandial responses between the three test meals. The obese women had fasting concentrations of leptin four times greater than the normal-weight women. There were no postprandial changes in the concentrations of leptin. The fasting concentrations of HDL-cholesterol were significantly lower in the obese women than in the normal-weight women, whereas there was no significant difference between the two groups in the concentrations of total cholesterol or LDL-cholesterol. These results provide evidence that obese women have exaggerated lipid and hormone responses compared with normal-weight women but the different contents of saturated and trans monounsaturated fatty acids provided by PO, LD, and PPM have no effect in either group.

  11. Pentobarbital anesthesia and the response of tumor and normal tissue in the C3Hf/SED mouse to radiation

    International Nuclear Information System (INIS)

    Suit, H.D.; Sedlacek, R.S.; Silver, G.; Dosoretz, D.

    1985-01-01

    Experiments have been performed to assess the effect of sodium pentobarbital (NaPb) on the response of MCaIV, FSaII, and SCCVII using TCD50 and acute reaction of normal skin as end points. The TCD50 was lower or unchanged in the anesthetized than in the conscious mouse. There was no effect of NaPb on the acute reaction of skin. The ERs for NaPb on the TCD50 (ν = 1) for air breathing condition was essentially 1.0 for all three tumors. For the FSaII and SCCVII pentobarbital enhancement ratios were 1.29 and 1.34 for O/sub 2/3ATA conditions. For two dose (ν=2) irradiations ERs for the O/sub 2/3ATA were 1.46, 1.72 and 2.21 for MCaIV, FSaII and SCCVII respectively. For ν = 15, temperature 35 0 C ERs for O/sub 2/3ATA were 1.08 and 1.09 for MCaIV and FSaII but 1.22 for SCCVII

  12. Practice guideline: Idiopathic normal pressure hydrocephalus: Response to shunting and predictors of response: Report of the Guideline Development, Dissemination, and Implementation Subcommittee of the American Academy of Neurology.

    Science.gov (United States)

    Halperin, John J; Kurlan, Roger; Schwalb, Jason M; Cusimano, Michael D; Gronseth, Gary; Gloss, David

    2015-12-08

    We evaluated evidence for utility of shunting in idiopathic normal pressure hydrocephalus (iNPH) and for predictors of shunting effectiveness. We identified and classified relevant published studies according to 2004 and 2011 American Academy of Neurology methodology. Of 21 articles, we identified 3 Class I articles. Shunting is possibly effective in iNPH (96% chance subjective improvement, 83% chance improvement on timed walk test at 6 months) (3 Class III). Serious adverse event risk was 11% (1 Class III). Predictors of success included elevated Ro (1 Class I, multiple Class II), impaired cerebral blood flow reactivity to acetazolamide (by SPECT) (1 Class I), and positive response to either external lumbar drainage (1 Class III) or repeated lumbar punctures. Age may not be a prognostic factor (1 Class II). Data are insufficient to judge efficacy of radionuclide cisternography or aqueductal flow measurement by MRI. Clinicians may choose to offer shunting for subjective iNPH symptoms and gait (Level C). Because of significant adverse event risk, risks and benefits should be carefully weighed (Level B). Clinicians should inform patients with iNPH with elevated Ro and their families that they have an increased chance of responding to shunting compared with those without such elevation (Level B). Clinicians may counsel patients with iNPH and their families that (1) positive response to external lumbar drainage or to repeated lumbar punctures increases the chance of response to shunting, and (2) increasing age does not decrease the chance of shunting being successful (both Level C). © 2015 American Academy of Neurology.

  13. [Responses of normalized difference vegetation index (NDVI) to precipitation changes on the grassland of Tibetan Plateau from 2000 to 2015.

    Science.gov (United States)

    Wang, Zhi Peng; Zhang, Xian Zhou; He, Yong Tao; Li, Meng; Shi, Pei Li; Zu, Jia Xing; Niu, Ben

    2018-01-01

    Precipitation change is an important factor in the inter-annual variation of grassland growth on the Tibetan Plateau. The total amount, distribution pattern and concentration time are three basic characteristics of precipitation change. The temporal and spatial characteristics of precipitation change were analyzed based on climate data of 145 meteorological stations on the Tibetan Plateau and nearby areas from 2000 to 2015. The total precipitation amount was characterized by annual precipitation, distribution pattern of precipitation during the year was characterized by improved precipitation concentration index (PCI), and precipitation centroid (PC) was defined to indicate the change in precipitation concentrated time. To better illustrate the response of grassland to precipitation change, vegetation growth status was characterized by the maximum value of normalized difference vegetation index (NDVI max ). Results indicated that the annual precipitation and PCI had an apparent gradient across the whole plateau and the latest PC occurred in the southern plateau. NDVI max of alpine shrub grassland was significantly correlated with the change of PCI,increased with even distribution of precipitation during growth period, and limited by the total annual precipitation. Alpine meadow did not show significantly correlations with these three indices. The inter-annual variability of NDVI max of steppe was controlled by both PCI and PC. NDVI max of alpine desert grassland was mainly controlled by annual precipitation. In addition to annual total amount of precipitation, the distribution characteristics of precipitation should be further considered when the influence of precipitation change on different types of vegetation on the Qinghai Tibet Plateau was studied.

  14. Gustatory papillae and taste bud development and maintenance in the absence of TrkB ligands BDNF and NT-4.

    Science.gov (United States)

    Ito, Akira; Nosrat, Christopher A

    2009-09-01

    Taste buds and the peripheral nerves innervating them are two important components of the peripheral gustatory system. They require appropriate connections for the taste system to function. Neurotrophic factors play crucial roles in the innervation of peripheral sensory organs and tissues. Both brain-derived neurotrophic factor (BDNF) null-mutated and neurotrophin-4 (NT-4) null-mutated mice exhibit peripheral gustatory deficits. BDNF and NT-4 bind to a common high affinity tyrosine kinase receptor, TrkB (NTRK-2), and a common p75 neurotrophin receptor (NGFR). We are currently using a transgenic mouse model to study peripheral taste system development and innervation in the absence of both TrkB ligands. We show that taste cell progenitors express taste cell markers during early stages of taste bud development in both BDNF(-/-)xNT-4(-/-) and wild-type mice. At early embryonic stages, taste bud progenitors express Troma-1, Shh, and Sox2 in all mice. At later stages, lack of innervation becomes a prominent feature in BDNF(-/-)xNT-4(-/-) mice leading to a decreasing number of fungiform papillae and morphologically degenerating taste cells. A total loss of vallate taste cells also occurs in postnatal transgenic mice. Our data indicate an initial independence but a later permissive and essential role for innervation in taste bud development and maintenance.

  15. Gustatory Dysfunction and Decreased Number of Fungiform Taste Buds in Patients With Chronic Otitis Media With Cholesteatoma.

    Science.gov (United States)

    Saito, Takehisa; Ito, Tetsufumi; Ito, Yumi; Yamada, Takechiyo; Okamoto, Masayuki; Manabe, Yasuhiro

    2016-09-01

    To compare the number of fungiform taste buds among patients with chronic otitis media (COM), those with pars flaccida retraction type cholesteatoma, and those with pars tensa retraction type cholesteatoma in combination with gustatory function. Thirty-seven patients with COM, 22 patients with pars flaccida retraction type cholesteatoma, and 17 patients with pars tensa retraction type cholesteatoma were included. An average of 10 fungiform papillae (FP) per patient in the midlateral region of the tongue were observed by confocal laser scanning microscopy in vivo, and the average number of taste buds were counted. Just before the observation of FP, electrogustometry (EGM) was performed to evaluate gustatory function. A significant decrease of the average number of fungiform taste buds and significant elevation of EGM thresholds were clarified in the pars tensa retraction type cholesteatoma group but not in the COM or pars flaccida type cholesteatoma group. It was suggested that some neurotoxic cytokines produced by cholesteatoma tissue might affect the CTN morphology, resulting in a decreased number of fungiform taste buds and elevation of EGM threshold in patients with pars tensa retraction type cholesteatoma. © The Author(s) 2016.

  16. Effects of short-term glucocorticoid deprivation on growth hormone (GH) response to GH-releasing peptide-6: Studies in normal men and in patients with adrenal insufficiency

    OpenAIRE

    Pinto, Ana Claudia de Assis Rocha [UNIFESP; Dias-da-Silva, Magnus Régios [UNIFESP; Martins, Manoel R. [UNIFESP; Brunner, Elisa [UNIFESP; Lengyel, Ana Maria Judith [UNIFESP

    2000-01-01

    There are no data in the literature about the effects of glucocorticoid deprivation on GH-releasing peptide-g (GHRP-6)-induced GH release. the aims of this study were to evaluate GH responsiveness to GHRP-6 1) after metyrapone administration in normal men, and 2) in patients with chronic hypocortisolism after glucocorticoid withdrawal for 72 h. in normal subjects, metyrapone ingestion did not alter significantly GH responsiveness to GHRP-6 [n = 8; peak, 39.3 +/- 7.1 mu g/L; area under the cur...

  17. Expression map of a complete set of gustatory receptor genes in chemosensory organs of Bombyx mori.

    Science.gov (United States)

    Guo, Huizhen; Cheng, Tingcai; Chen, Zhiwei; Jiang, Liang; Guo, Youbing; Liu, Jianqiu; Li, Shenglong; Taniai, Kiyoko; Asaoka, Kiyoshi; Kadono-Okuda, Keiko; Arunkumar, Kallare P; Wu, Jiaqi; Kishino, Hirohisa; Zhang, Huijie; Seth, Rakesh K; Gopinathan, Karumathil P; Montagné, Nicolas; Jacquin-Joly, Emmanuelle; Goldsmith, Marian R; Xia, Qingyou; Mita, Kazuei

    2017-03-01

    Most lepidopteran species are herbivores, and interaction with host plants affects their gene expression and behavior as well as their genome evolution. Gustatory receptors (Grs) are expected to mediate host plant selection, feeding, oviposition and courtship behavior. However, due to their high diversity, sequence divergence and extremely low level of expression it has been difficult to identify precisely a complete set of Grs in Lepidoptera. By manual annotation and BAC sequencing, we improved annotation of 43 gene sequences compared with previously reported Grs in the most studied lepidopteran model, the silkworm, Bombyx mori, and identified 7 new tandem copies of BmGr30 on chromosome 7, bringing the total number of BmGrs to 76. Among these, we mapped 68 genes to chromosomes in a newly constructed chromosome distribution map and 8 genes to scaffolds; we also found new evidence for large clusters of BmGrs, especially from the bitter receptor family. RNA-seq analysis of diverse BmGr expression patterns in chemosensory organs of larvae and adults enabled us to draw a precise organ specific map of BmGr expression. Interestingly, most of the clustered genes were expressed in the same tissues and more than half of the genes were expressed in larval maxillae, larval thoracic legs and adult legs. For example, BmGr63 showed high expression levels in all organs in both larval and adult stages. By contrast, some genes showed expression limited to specific developmental stages or organs and tissues. BmGr19 was highly expressed in larval chemosensory organs (especially antennae and thoracic legs), the single exon genes BmGr53 and BmGr67 were expressed exclusively in larval tissues, the BmGr27-BmGr31 gene cluster on chr7 displayed a high expression level limited to adult legs and the candidate CO 2 receptor BmGr2 was highly expressed in adult antennae, where few other Grs were expressed. Transcriptional analysis of the Grs in B. mori provides a valuable new reference for

  18. Comparison of incidences of normal tissue complications with tumor response in a phase III trial comparing heat plus radiation to radiation alone

    International Nuclear Information System (INIS)

    Dewhirst, M.W.; Sim, D.A.; Grochowski, K.J.

    1984-01-01

    The success of hyperthermia (/sup Δ/) as an adjuvant to radiation (XRT) will depend on whether the increase in tumor control is greater than that for normal tissue reactions. One hundred and thirty dogs and cats were stratified by histology and randomized to receive XRT (460 rads per fraction, two fractions per week, for eight fractions) or /sup Δ/ + XRT (30 min. at 44 +-2 0 C; one fraction per week, four fractions; immediately prior to XRT). Heat induced changes in tumor and normal tissue responses were made by comparing ratios of incidence for /sup Δ/ + XRT and XRT alone (TRR; Thermal Relative Risk). Change in tumor response duration was calculated from statistical analysis of response duration curves (RRR; Relative Relapse Rate). Heat increased early normal tissue reactions (moist desquamation and mucositis by a factor of 1.08. Tumor complete response, by comparison, was significantly improved (TRR = 2.12, p < .001). Late skin fibrosis was also increased (TRR = 1.51), but the prolongation in tumor response was greater (RRR 1.85). The degree of thermal enhancement for all tissues was dependent on the minimum temperature achieved on the first treatment, but the values for tumor were consistently greater than those achieved for normal tissues

  19. Serum LH and FSH Responses to Synthetic LH-RH in Normal Infants, Children and Patients With Turner's Syndrome

    Science.gov (United States)

    Suwa, Seizo; And Others

    1974-01-01

    Effects of luteinizing hormone-releasing hormone (LH-RH) on LH and follicle-stimulating hormone (FSH) release were studied in 26 normal children and six patients (from 1-to 14-years-old) with Turner's syndrome. (Author)

  20. Evaluation of palatability of 10 commercial amlodipine orally disintegrating tablets by gustatory sensation testing, OD-mate as a new disintegration apparatus and the artificial taste sensor.

    Science.gov (United States)

    Uchida, Takahiro; Yoshida, Miyako; Hazekawa, Mai; Haraguchi, Tamami; Furuno, Hiroyuki; Teraoka, Makoto; Ikezaki, Hidekazu

    2013-09-01

    The purpose of this study was to evaluate and compare the palatability of 10 formulations (the original manufacturer's formulation and nine generics) of amlodipine orally disintegrating tablets (ODTs) by means of human gustatory sensation testing, disintegration/dissolution testing and the evaluation of bitterness intensity using a taste sensor. Initially, the palatability, dissolution and bitterness intensity of the ODTs were evaluated in gustatory sensation tests. Second, the disintegration times of the ODTs were measured using the OD-mate, a newly developed apparatus for measuring the disintegration of ODTs, and lastly, the bitterness intensities were evaluated using an artificial taste sensor. Using factor analysis, the factors most affecting the palatability of amlodipine ODTs were found to be disintegration and taste. There was high correlation between the disintegration times of the 10 amlodipine ODTs estimated in human gustatory testing and those found using the OD-mate. The bitterness intensities of amlodipine ODTs 10, 20 and 30 s after starting the conventional brief dissolution test and the values determined by the taste sensor were highly correlated with the bitterness intensities determined in gustatory sensation testing. The OD-mate and the taste sensor may be useful for predicting the disintegration and bitterness intensity of amlodipine ODTs in the mouth. © 2013 Royal Pharmaceutical Society.

  1. Relationship between gustatory function and average number of taste buds per fungiform papilla measured by confocal laser scanning microscopy in humans.

    Science.gov (United States)

    Saito, Takehisa; Ito, Tetsufumi; Ito, Yumi; Manabe, Yasuhiro; Sano, Kazuo

    2017-02-01

    The aim of this study was to elucidate the relationship between the gustatory function and average number of taste buds per fungiform papilla (FP) in humans. Systemically healthy volunteers (n = 211), pre-operative patients with chronic otitis media (n = 79), and postoperative patients, with or without a chorda tympani nerve (CTN) severed during middle ear surgery (n = 63), were included. Confocal laser scanning microscopy was employed to observe fungiform taste buds because it allows many FP to be observed non-invasively in a short period of time. Taste buds in an average of 10 FP in the midlateral region of the tongue were counted. In total, 3,849 FP were observed in 353 subjects. The gustatory function was measured by electrogustometry (EGM). An inverse relationship was found between the gustatory function and average number of fungiform taste buds per papilla. The healthy volunteers showed a lower EGM threshold (better gustatory function) and had more taste buds than did the patients with otitis media, and the patients with otitis media showed a lower EGM threshold and had more taste buds than did postoperative patients, reflecting the severity of damage to the CTN. It was concluded that the confocal laser scanning microscope is a very useful tool for using to observe a large number of taste buds non-invasively. © 2017 Eur J Oral Sci.

  2. The response of normal and ataxia-telangiectasia human fibroblasts to the lethal effects of far, mid and near ultraviolet radiations

    International Nuclear Information System (INIS)

    Keyse, S.M.; McAleer, M.A.; Davies, D.J.G.; Moss, S.H.

    1985-01-01

    The responses of two ataxia-telangiectasia (A-T) cell strains to the lethal effects of monochromatic far, mid and near ultraviolet radiations have been determined and compared with the responses of three normal human cell strains. The authors results confirm a previous observation that the A-T cell strain AT4BI is abnormally sensitive to the lethal effects of mid u.v. (313 nm) radiation. After far u.v. (254 nm) radiation the strain AT4BI exhibits a small but statistically significant increase in sensitivity compared to the normal strains. Of most interest, in terms of a mechanistic interpretation of the sensitivity of A-T strains, the survival responses of neither A-T strain tested to near u.v. (365 nm) radiation differed significantly from the mean response of the normal strains, although it is of interest that one normal strain (48BR) was found to be significantly more resistant to near u.v. radiation than any of the other strains tested. The results are discussed in terms of the possible induction of radiogenic lesions in DNA by ultraviolet radiations and the possible mechanisms of radiation sensitivity in ataxia-telangiectasia. (author)

  3. SU-E-J-212: MR Diffusion Tensor Imaging for Assessment of Tumor and Normal Brain Tissue Responses of Juvenile Pilocytic Astrocytoma Treated by Proton Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Hou, P; Park, P; Li, H; Zhu, X; Mahajan, A; Grosshans, D [M.D. Anderson Cancer Center, Houston, TX (United States)

    2015-06-15

    Purpose: Diffusion tensor imaging (DTI) can measure molecular mobility at the cellular level, quantified by the apparent diffusion coefficient (ADC). DTI may also reveal axonal fiber directional information in the white matter, quantified by the fractional anisotropy (FA). Juvenile pilocytic astrocytoma (JPA) is a rare brain tumor that occurs in children and young adults. Proton therapy (PT) is increasingly used in the treatment of pediatric brain tumors including JPA. However, the response of both tumors and normal tissues to PT is currently under investigation. We report tumor and normal brain tissue responses for a pediatric case of JPA treated with PT assessed using DTI. Methods: A ten year old male with JPA of the left thalamus received passive scattered PT to a dose of 50.4 Gy (RBE) in 28 fractions. Post PT, the patient has been followed up in seven years. At each follow up, MRI imaging including DTI was performed to assess response. MR images were registered to the treatment planning CT and the GTV mapped onto each MRI. The GTV contour was then mirrored to the right side of brain through the patient’s middle line to represent normal brain tissue. ADC and FA were measured within the ROIs. Results: Proton therapy can completely spare contra lateral brain while the target volume received full prescribed dose. From a series of MRI ADC images before and after PT at different follow ups, the enhancement corresponding to GTV had nearly disappeared more than 2 years after PT. Both ADC and FA demonstrate that contralateral normal brain tissue were not affect by PT and the tumor volume reverted to normal ADC and FA values. Conclusion: DTI allowed quantitative evaluation of tumor and normal brain tissue responses to PT. Further study in a larger cohort is warranted.

  4. SU-E-J-212: MR Diffusion Tensor Imaging for Assessment of Tumor and Normal Brain Tissue Responses of Juvenile Pilocytic Astrocytoma Treated by Proton Therapy

    International Nuclear Information System (INIS)

    Hou, P; Park, P; Li, H; Zhu, X; Mahajan, A; Grosshans, D

    2015-01-01

    Purpose: Diffusion tensor imaging (DTI) can measure molecular mobility at the cellular level, quantified by the apparent diffusion coefficient (ADC). DTI may also reveal axonal fiber directional information in the white matter, quantified by the fractional anisotropy (FA). Juvenile pilocytic astrocytoma (JPA) is a rare brain tumor that occurs in children and young adults. Proton therapy (PT) is increasingly used in the treatment of pediatric brain tumors including JPA. However, the response of both tumors and normal tissues to PT is currently under investigation. We report tumor and normal brain tissue responses for a pediatric case of JPA treated with PT assessed using DTI. Methods: A ten year old male with JPA of the left thalamus received passive scattered PT to a dose of 50.4 Gy (RBE) in 28 fractions. Post PT, the patient has been followed up in seven years. At each follow up, MRI imaging including DTI was performed to assess response. MR images were registered to the treatment planning CT and the GTV mapped onto each MRI. The GTV contour was then mirrored to the right side of brain through the patient’s middle line to represent normal brain tissue. ADC and FA were measured within the ROIs. Results: Proton therapy can completely spare contra lateral brain while the target volume received full prescribed dose. From a series of MRI ADC images before and after PT at different follow ups, the enhancement corresponding to GTV had nearly disappeared more than 2 years after PT. Both ADC and FA demonstrate that contralateral normal brain tissue were not affect by PT and the tumor volume reverted to normal ADC and FA values. Conclusion: DTI allowed quantitative evaluation of tumor and normal brain tissue responses to PT. Further study in a larger cohort is warranted

  5. Effect of luminance contrast on BOLD-fMRI response in deaf and normal occipital visual cortex

    International Nuclear Information System (INIS)

    Xue Yanping; Zhai Renyou; Jiang Tao; Cui Yong; Zhou Tiangang; Rao Hengyi; Zhuo Yan

    2002-01-01

    Objective: To examine the effect of luminance contrast stimulus by using blood oxygenation level dependent functional magnetic resonance imaging (BOLD-fMRI) within deaf occipital visual cortex, and to compare the distribution, extent, and intensity of activated areas between deaf subjects and normal hearing subjects. Methods: Twelve deaf subjects (average age 16.5) and 15 normal hearing subjects (average age 23.7) were stimulated by 4 kinds of luminance contrast (0.7, 2.2, 50.0, 180.0 lm). The fMRI data were collected on GE 1.5 T Signa Horizon LX MRI system and analyzed by AFNI to generate the activation map. Results: Responding to all 4 kinds of stimulus luminance contrast, all deaf and normal subjects showed significant activations in occipital visual cortex. For both deaf and normal subjects, the number of activated pixels increased significantly with increasing luminance contrast (F normal = 4.27, P deaf = 6.41, P 0.05). The local mean activation level for all activated pixels remained constant with increasing luminance contrast. However, there was an increase in the mean activation level for those activated pixels common to all trials as the stimulus luminance contrast was increased, but no significant difference was found within them (F normal = 0.79, P > 0.05; F deaf = 1.6, P > 0.05). Conclusion: The effect of luminance contrast on occipital visual cortex of deaf is similar to but somewhat higher than that of normal hearing subjects. In addition, it also proved that fMRI is a feasible method in the study of the deaf visual cortex

  6. The use of biological isodoses ''IsobioGy 2'' for evaluation of tumour and normal tissues response for fractionated irradiation

    International Nuclear Information System (INIS)

    Maciejewski, B.; Skolyszewski, J.; Majewski, S.; Lobodziec, W.; Jedynak, T.; Slosarek, K.

    1988-01-01

    Divergences between physical and biological dose distributions were analysed using linear quadratic model. It was found that small variations in physical dose distribution and differences in normal tissue sensitivity for change in dose per fraction, expressed by a α/β value, can cause a high difference between physical and biological doses. This difference significantly increases when one field instead of two fields is daily treated. If there is no enough separation between treated fields, the biological dose may dramatically increase. The use of biological ''isobioGy 2'' isodoses, instead of physical isodoses, can provide an important information on biological effect in tumour or normal tissue and may diminish the risk of giving too high dose to normal tissue and too low dose to the tumour. 6 figs., 13 refs. (author)

  7. In vitro radiation response studies on bone marrow fibroblasts (CFU-F) obtained from normal and chronically irradiated dogs

    International Nuclear Information System (INIS)

    Klein, A.K.; Stitzel, K.A.; Greenberg, B.; Woo, L.

    1984-01-01

    The radiation resistance of bone marrow fibroblasts as measured by their proliferative potential was evaluated in chronically irradiated dogs. Bone marrows were obtained from eight dogs that had been chronically irradiated beginning at 21 days of gestation or after birth and eight age-matched controls. Of these irradiated dogs, four were either preleukemic or exhibited frank acute nonlymphocytic leukemia. The other four were clinically normal but demonstrated abnormalities in their marrow that could be attributed to radiation effects and/or other pathologic changes. Fibroblasts from six of the irradiated dogs were significantly more radioresistant than those of their controls. Five of these six dogs subsequently succumbed to hematopathologic disease, while the two irradiated dogs with normal fibroblasts remained clinically normal, suggesting that this observed radioresistance may be linked to the disease process. (author)

  8. DNA strand breaking and rejoining in response to ultraviolet light in normal human and xeroderma pigmentosum cells

    International Nuclear Information System (INIS)

    Dingman, C.W.; Kakunaga, T.

    1976-01-01

    A description is given of a reproducible technique for measuring DNA strand breaking and rejoining in cells after treatment with U.V.-light. Results obtained with normal human cells, xeroderma pigmentosum cells (XP, complementation group A) and XP variant cells suggested that all three of these cell-types can carry out single-strand incision with equal rapidity. However, the breaks so induced appeared to be only slowly rejoined in the XP variant cells and rejoined not at all in XP complementation group A cells. Furthermore, parental strand rejoining was inhibited by caffeine in XP variant cells but not in normal cells. (author)

  9. Response of growth hormone (GH), FFA, blood sugar and insulin to exercise in obese patients and normal subjects

    NARCIS (Netherlands)

    Schwarz, F.; Haar, D.J. ter; Riet, H.G. van; Thijssen, J.H.H.

    1969-01-01

    Ergometer tests with a constant workload of 600 Kg./min. during 30 minutes were done on eight normal subjects, eight severely obese patients, and two women who had formerly been obese. Arterial blood was sampled three times before, four times during and three times after exercise. The incidence and

  10. SIMBIOS Normalized Water-Leaving Radiance Calibration and Validation: Sensor Response, Atmospheric Corrections, Stray Light and Sun Glint. Chapter 14

    Science.gov (United States)

    Mueller, James L.

    2001-01-01

    This Sensor Intercomparison and Merger for Biological and Interdisciplinary Oceanic Studies (SIMBIOS) contract supports acquisition of match up radiometric and bio-optical data for validation of Sea-Viewing Wide Field-of-view Sensor (SeaWiFS) and other ocean color satellites, and evaluation of uncertainty budgets and protocols for in situ measurements of normalized water leaving radiances.

  11. The effect of palm oil, lard, and puff-pastry margarine on postprandial lipid and hormone responses in normal-weight and obese young women

    DEFF Research Database (Denmark)

    Jensen, Janne J. Dyrsborg; Bysted, Anette; Dawids, Steen

    1999-01-01

    , on postprandial lipid and hormone responses in normal-weight and obese young women. The study was performed as a randomized, crossover design. The fats differed in the content of palmitic acid, stearic acid, and traits monounsaturated fatty acids allowing a dietary comparison of different 'solid' fatty acids......Only a few studies have been published on the postprandial effects of different fatty acids in obese subjects. Therefore, the present study investigated the effects of three test meals containing palm oil (PO), lard (LD), or puff-pastry margarine (PPM), all normal dietary ingredients...... acids provided by PO, LD, and PPM have no effect in either group....

  12. Expression of AmGR10 of the Gustatory Receptor Family in Honey Bee Is Correlated with Nursing Behavior.

    Science.gov (United States)

    Paerhati, Yisilahaiti; Ishiguro, Shinichi; Ueda-Matsuo, Risa; Yang, Ping; Yamashita, Tetsuro; Ito, Kikukatsu; Maekawa, Hideaki; Tani, Hiroko; Suzuki, Koichi

    2015-01-01

    We investigated the association between the expression of a gene encoding gustatory receptor (G10) and division of labor in the honey bee, Apis mellifera. Among 10 GR genes encoding proteins 15% ~ 99% amino acid identity in the honey bee, we found that AmGR10 with 99% identity is involved in nursing or brood care. Expression of AmGR10 was restricted to organs of the hypopharyngeal gland, brain, and ovary in the nurse bee phase. Members of an extended nursing caste under natural conditions continued to express this gene. RNAi knockdown of AmGR10 accelerated the transition to foraging. Our findings demonstrate that this one gene has profound effects on the division of labor associated with the development and physiology of honeybee society.

  13. Molecular evolution of the odorant and gustatory receptor genes in lepidopteran insects: implications for their adaptation and speciation.

    Science.gov (United States)

    Engsontia, Patamarerk; Sangket, Unitsa; Chotigeat, Wilaiwan; Satasook, Chutamas

    2014-08-01

    Lepidoptera (comprised of butterflies and moths) is one of the largest groups of insects, including more than 160,000 described species. Chemoreception plays important roles in the adaptation of these species to a wide range of niches, e.g., plant hosts, egg-laying sites, and mates. This study investigated the molecular evolution of the lepidopteran odorant (Or) and gustatory receptor (Gr) genes using recently identified genes from Bombyx mori, Danaus plexippus, Heliconius melpomene, Plutella xylostella, Heliothis virescens, Manduca sexta, Cydia pomonella, and Spodoptera littoralis. A limited number of cases of large lineage-specific gene expansion are observed (except in the P. xylostella lineage), possibly due to selection against tandem gene duplication. There has been strong purifying selection during the evolution of both lepidopteran odorant and gustatory genes, as shown by the low ω values estimated through CodeML analysis, ranging from 0.0093 to 0.3926. However, purifying selection has been relaxed on some amino acid sites in these receptors, leading to sequence divergence, which is a precursor of positive selection on these sequences. Signatures of positive selection were detected only in a few loci from the lineage-specific analysis. Estimation of gene gains and losses suggests that the common ancestor of the Lepidoptera had fewer Or genes compared to extant species and an even more reduced number of Gr genes, particularly within the bitter receptor clade. Multiple gene gains and a few gene losses occurred during the evolution of Lepidoptera. Gene family expansion may be associated with the adaptation of lepidopteran species to plant hosts, especially after angiosperm radiation. Phylogenetic analysis of the moth sex pheromone receptor genes suggested that chromosomal translocations have occurred several times. New sex pheromone receptors have arisen through tandem gene duplication. Positive selection was detected at some amino acid sites predicted to be

  14. Separation of metabolic supply and demand: aerobic glycolysis as a normal physiological response to fluctuating energetic demands in the membrane.

    Science.gov (United States)

    Epstein, Tamir; Xu, Liping; Gillies, Robert J; Gatenby, Robert A

    2014-01-01

    Cancer cells, and a variety of normal cells, exhibit aerobic glycolysis, high rates of glucose fermentation in the presence of normal oxygen concentrations, also known as the Warburg effect. This metabolism is considered abnormal because it violates the standard model of cellular energy production that assumes glucose metabolism is predominantly governed by oxygen concentrations and, therefore, fermentative glycolysis is an emergency back-up for periods of hypoxia. Though several hypotheses have been proposed for the origin of aerobic glycolysis, its biological basis in cancer and normal cells is still not well understood. We examined changes in glucose metabolism following perturbations in membrane activity in different normal and tumor cell lines and found that inhibition or activation of pumps on the cell membrane led to reduction or increase in glycolysis, respectively, while oxidative phosphorylation remained unchanged. Computational simulations demonstrated that these findings are consistent with a new model of normal physiological cellular metabolism in which efficient mitochondrial oxidative phosphorylation supplies chronic energy demand primarily for macromolecule synthesis and glycolysis is necessary to supply rapid energy demands primarily to support membrane pumps. A specific model prediction was that the spatial distribution of ATP-producing enzymes in the glycolytic pathway must be primarily localized adjacent to the cell membrane, while mitochondria should be predominantly peri-nuclear. The predictions were confirmed experimentally. Our results show that glycolytic metabolism serves a critical physiological function under normoxic conditions by responding to rapid energetic demand, mainly from membrane transport activities, even in the presence of oxygen. This supports a new model for glucose metabolism in which glycolysis and oxidative phosphorylation supply different types of energy demand. Cells use efficient but slow-responding aerobic metabolism

  15. Vesicles mimicking normal and cancer cell membranes exhibit differential responses to the cell-penetrating peptide Pep-1.

    Science.gov (United States)

    Almarwani, Bashiyar; Phambu, Esther Nzuzi; Alexander, Christopher; Nguyen, Ha Aimee T; Phambu, Nsoki; Sunda-Meya, Anderson

    2018-06-01

    The cell-penetrating peptide (CPP) Pep-1 presents a great potential in drug delivery due to its intrinsic property to cross plasma membrane. However, its mechanism of entry into the cell remains unresolved. In this study, we compare the selectivity of Pep-1 towards vesicles mimicking normal and cancer cell membranes. The interaction was performed in a wide range of peptide-to-lipid molar ratios using infrared (IR), fluorescence, scanning electron microscopy (SEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC) techniques. At low peptide concentration, fluorescence experiments show that lipid-phosphatidylserine (PS) seems to enable Pep-1 translocation into cancer cell membrane as evidenced by the blue shift of its maximal emission wavelength. DSC data show that Pep-1 induces segregation of lipids. At high peptide concentration, IR data indicate that the interaction of Pep-1 is relatively stronger with normal cell membrane than with cancer cell membrane through the phosphate groups, while the interaction is weaker with normal cell membrane than with cancer cell membrane through the carbonyl groups. TGA and DSC data reveal that vesicles of normal cell membrane are thermally more stable than vesicles of cancer cell membrane. This suggests that the additional lipid PS included in cancer cell membrane has a destabilizing effect on the membrane structure. SEM images reveal that Pep-1 form superstructures including spherical particles and fibrils in the presence of both model membranes. PS seems to enhance peptide transport across cellular membranes. The biophysical techniques in this study provide valuable insights into the properties of CPPs in drug delivery systems. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Effect of endotoxin preparations (LPS) with irradiation decreased toxicity on the immune response of normal and irradiated rats

    Energy Technology Data Exchange (ETDEWEB)

    Elekes, E; Bertok, L [Orszagos Frederic Joliot-Curie Sugarbiologiai es Sugaregeszsegugyi Kutato Intezet, Budapest (Hungary)

    1979-03-01

    A comparison of the immunostimulating effect of parent and radiodetoxified with 50, 100, 150 and 200 kGy (5, 10, 15 and 20 Mrad) /sup 60/Co ..gamma..-rays endotoxin preparations in normal and irradiated rats is given. By increasing the dose of irradiation the immunostimulating effect decreased. The preparations detoxified even with the highest (200 kGy) dose is characterized by a pronounced adjuvant effect in irradiated animals.

  17. Comparison of Nocturia Response to Desmopressin Treatment between Patients with Normal and High Nocturnal Bladder Capacity Index

    Directory of Open Access Journals (Sweden)

    Tine Hajdinjak

    2013-01-01

    Full Text Available Objective. To compare efficacy of desmopressin for treatment of nocturia between patients with normal and high nocturnal bladder capacity index (NBCi. Methods. Retrospective analysis of adult patients treated with desmopressin for nocturia. Patients were analyzed according to high or normal NBCi value before treatment. Results. 55 patients were identified, aged 49–84, 47 males, 8 females, who started desmopressin 0.2 mg nocte between 2009 and 2011. Two groups (N: normal and H: high NBCi were similar regarding number, gender, age, 24 h urine volume, and nocturnal urine volume. On treatment, nocturnal volume decreased by mean of 364 mL. Number of nightly voids decreased in N group from 3.11 to 1.50, in H from 3.96 to 1.44. Nocturnal polyuria and nocturia indices also decreased significantly. NBCi remained the same in N group (0.56 on therapy and in H group decreased to mean 0.63. All on-treatment values were statistically similar in N and H groups. Pretreatment differences were abolished with treatment. NBCi was significantly correlated to nocturia reduction—larger reduction was observed in patients with higher NBCi. In 8/55 patients, hyponatremia was detected, but without clinical consequences. Conclusions. The results indicate that the effectiveness of desmopressin on nocturia is not dependent upon the patient's pretreatment NBCi.

  18. "Normality of Residuals Is a Continuous Variable, and Does Seem to Influence the Trustworthiness of Confidence Intervals: A Response to, and Appreciation of, Williams, Grajales, and Kurkiewicz (2013"

    Directory of Open Access Journals (Sweden)

    Jason W. Osborne

    2013-09-01

    Full Text Available Osborne and Waters (2002 focused on checking some of the assumptions of multiple linear.regression. In a critique of that paper, Williams, Grajales, and Kurkiewicz correctly clarify that.regression models estimated using ordinary least squares require the assumption of normally.distributed errors, but not the assumption of normally distributed response or predictor variables..They go on to discuss estimate bias and provide a helpful summary of the assumptions of multiple.regression when using ordinary least squares. While we were not as precise as we could have been.when discussing assumptions of normality, the critical issue of the 2002 paper remains -' researchers.often do not check on or report on the assumptions of their statistical methods. This response.expands on the points made by Williams, advocates a thorough examination of data prior to.reporting results, and provides an example of how incremental improvements in meeting the.assumption of normality of residuals incrementally improves the accuracy of confidence intervals.

  19. Radiotherapy. Non-standard fractionated regimens improving cancer treatment. Part II. Response of normal tissues to fractionated irradiation

    International Nuclear Information System (INIS)

    Villar, A.; Hernandez, M.; Pera, J.; Cambray, M.; Villa, S.; Arnaiz, M.D.

    1988-01-01

    The phenomena participating in the response of tissues to fractionated irradiation are analyzed with special emphasis on the most relevant points influencing the design of non-standard fractionated regimens. (Author)

  20. Response Pattern Based on the Amplitude of Ear Canal Recorded Cochlear Microphonic Waveforms across Acoustic Frequencies in Normal Hearing Subjects

    OpenAIRE

    Zhang, Ming

    2012-01-01

    Low-frequency otoacoustic emissions (OAEs) are often concealed by acoustic background noise such as those from a patient’s breathing and from the environment during recording in clinics. When using electrocochleaography (ECochG or ECoG), such as cochlear microphonics (CMs), acoustic background noise do not contaminate the recordings. Our objective is to study the response pattern of CM waveforms (CMWs) to explore an alternative approach in assessing cochlear functions. In response to a 14-mse...

  1. The Spatial Musical Association of Response Codes does not depend on a normal visual experience: A study with early blind individuals.

    Science.gov (United States)

    Cattaneo, Zaira; Lega, Carlotta; Rinaldi, Luca; Fantino, Micaela; Ferrari, Chiara; Merabet, Lotfi B; Vecchi, Tomaso

    2018-02-26

    Converging evidence suggests that the perception of auditory pitch exhibits a characteristic spatial organization. This pitch-space association can be demonstrated experimentally by the Spatial Musical Association of Response Codes (SMARC) effect. This is characterized by faster response times when a low-positioned key is pressed in response to a low-pitched tone, and a high-positioned key is pressed in response to a high-pitched tone. To investigate whether the development of this pitch-space association is mediated by normal visual experience, we tested a group of early blind individuals on a task that required them to discriminate the timbre of different instrument sounds with varying pitch. Results revealed a comparable pattern in the SMARC effect in both blind participants and sighted controls, suggesting that the lack of prior visual experience does not prevent the development of an association between pitch height and vertical space.

  2. Near-infrared spectroscopy can detect differences in vascular responsiveness to a hyperglycaemic challenge in individuals with obesity compared to normal-weight individuals.

    Science.gov (United States)

    Soares, Rogério Nogueira; Reimer, Raylene A; Alenezi, Zaid; Doyle-Baker, Patricia K; Murias, Juan Manuel

    2018-01-01

    To examine whether the near-infrared spectroscopy combined with vascular occlusion test technique could detect differences in vascular responsiveness during hyperglycaemia between normal-weight individuals and individuals with obesity. A total of 16 normal-weight individuals (body mass index, 21.3 ± 1.7 kg/m 2 ) and 13 individuals with obesity (body mass index, 34.4 ± 2.0 kg/m 2 ) were submitted to five vascular occlusion tests (Pre, 30, 60, 90 and 120 min after glucose challenge). Vascular responsiveness was determined by the Slope 2 (Slope 2 StO 2 ) and the area under the curve (StO 2AUC ) of oxygen saturation derived from near-infrared spectroscopy-vascular occlusion test. The Slope 2 StO 2 increased from 1.07 ± 0.16%/s (Pre) to 1.53 ± 0.21%/s at 90 min ( p obese it increased from 0.71 ± 0.09%/s (Pre) to 0.92 ± 0.14%/s at 60 min ( p obesity. Near-infrared spectroscopy-vascular occlusion test technique was capable of detecting differences in vascular responsiveness during hyperglycaemia between normal-weight individuals and individuals with obesity.

  3. Qualitative dose response of the normal canine head to epithermal neutron irradiation with and without boron capture

    International Nuclear Information System (INIS)

    DeHaan, C.E.; Gavin, P.R.; Kraft, S.L.; Wheeler, F.J.; Atkinson, C.A.

    1992-01-01

    Boron Neutron Capture Therapy is being re-evaluated for the treatment of intracranial tumors. Prior to human clinical trials, determination of normal tissue tolerance is critical. Dogs were chosen as a large animal model for the following reasons. Dogs can be evaluated with advanced imaging, diagnostic and therapeutic modalities. Dogs are amenable to detailed neurologic examination and subtle behavioral changes are easily detected. Specifically, Labrador retrievers were chosen for their large body and head size. The dogs received varying doses of epithermal neutron irradiation and boron neutron capture irradiation using an epithermal neutron source. The dogs were closely monitored for up to one year post irradiation

  4. Auditory brainstem response latency in forward masking, a marker of sensory deficits in listeners with normal hearing thresholds

    DEFF Research Database (Denmark)

    Mehraei, Golbarg; Paredes Gallardo, Andreu; Shinn-Cunningham, Barbara G.

    2017-01-01

    -spontaneous rate fibers results in a faster recovery of wave-V latency as the slow contribution of these fibers is reduced. Results showed that in young audiometrically normal listeners, a larger change in wave-V latency with increasing masker-to-probe interval was related to a greater effect of a preceding masker......-V latency changes with increasing masker-to-probe intervals. In the same listeners, behavioral forward masking detection thresholds were measured. We hypothesized that 1) auditory nerve fiber deafferentation increases forward masking thresholds and increases wave-V latency and 2) a preferential loss of low...

  5. The omega-3 fatty acid eicosapentaenoic acid is required for normal alcohol response behaviors in C. elegans.

    Directory of Open Access Journals (Sweden)

    Richard C Raabe

    Full Text Available Alcohol addiction is a widespread societal problem, for which there are few treatments. There are significant genetic and environmental influences on abuse liability, and understanding these factors will be important for the identification of susceptible individuals and the development of effective pharmacotherapies. In humans, the level of response to alcohol is strongly predictive of subsequent alcohol abuse. Level of response is a combination of counteracting responses to alcohol, the level of sensitivity to the drug and the degree to which tolerance develops during the drug exposure, called acute functional tolerance. We use the simple and well-characterized nervous system of Caenorhabditis elegans to model the acute behavioral effects of ethanol to identify genetic and environmental factors that influence level of response to ethanol. Given the strong molecular conservation between the neurobiological machinery of worms and humans, cellular-level effects of ethanol are likely to be conserved. Increasingly, variation in long-chain polyunsaturated fatty acid levels has been implicated in complex neurobiological phenotypes in humans, and we recently found that fatty acid levels modify ethanol responses in worms. Here, we report that 1 eicosapentaenoic acid, an omega-3 polyunsaturated fatty acid, is required for the development of acute functional tolerance, 2 dietary supplementation of eicosapentaenoic acid is sufficient for acute tolerance, and 3 dietary eicosapentaenoic acid can alter the wild-type response to ethanol. These results suggest that genetic variation influencing long-chain polyunsaturated fatty acid levels may be important abuse liability loci, and that dietary polyunsaturated fatty acids may be an important environmental modulator of the behavioral response to ethanol.

  6. Evaluation of fault-normal/fault-parallel directions rotated ground motions for response history analysis of an instrumented six-story building

    Science.gov (United States)

    Kalkan, Erol; Kwong, Neal S.

    2012-01-01

    According to regulatory building codes in United States (for example, 2010 California Building Code), at least two horizontal ground-motion components are required for three-dimensional (3D) response history analysis (RHA) of buildings. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHA analyses should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak responses of engineering demand parameters (EDPs) were obtained for rotation angles ranging from 0° through 180° for evaluating the FN/FP directions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.

  7. Apoptosis in chronic myeloid leukaemia: normal responses by progenitor cells to growth factor deprivation, X-irradiation and glucocorticoids

    Energy Technology Data Exchange (ETDEWEB)

    Amos, T.A.S.; Lewis, J.L.; Grand, F.H.; Gooding, R.P.; Goldman, J.M.; Gordon, M.Y. [Royal Postgraduate Medical School, London (United Kingdom)

    1995-10-01

    Inhibition of apoptosis (genetically programmed active cell death) by p210 BCR-ABL expression is a mechanism that might contribute to clonal expansion in chronic myeloid leukaemia (CML). Since cell death following exposure to ionizing radiation and many chemotherapeutic agents can occur by the apoptotic pathway, inhibition of apoptosis would be expected to confer a relative resistance to these treatments. Similarly, cells deprived of growth factors in vitro die by apoptosis, and inhibition of apoptosis would therefore be expected to allow cells to survive better in growth factor-deprived conditions. We found that the survival of normal and CML myeloid progenitors was the same after in vitro incubation in deprived conditions and after treatment with X-irradiation or glucocorticoids. We also found that mature cells in colonies produced by CML progenitors (CFU-GM) did not survive better than those produced by normal progenitor cells. Flow cytometric analysis of propidium iodide-stained cells provided a direct indication that the degree of apoptosis may correspond to the degree of deprivation. These results suggest that inhibition of apoptosis may not be the primary mechanism whereby BCR-ABL influences the expansion of the malignant clone in CML. (Author).

  8. The radiobiology of laser-driven particle beams: focus on sub-lethal responses of normal human cells

    International Nuclear Information System (INIS)

    Manti, L.; Perozziello, F.M.; Romagnani, L.; Borghesi, M.; Doria, D.; Candiano, G.; Cirrone, G.A.P.; Leanza, R.; Romano, F.; Scuderi, V.; Tramontana, A.; Chaudhary, P.; Gwynne, D.; Prise, K. M.

    2017-01-01

    Accelerated proton beams have become increasingly common for treating cancer. The need for cost and size reduction of particle accelerating machines has led to the pioneering investigation of optical ion acceleration techniques based on laser-plasma interactions as a possible alternative. Laser-matter interaction can produce extremely pulsed particle bursts of ultra-high dose rates (≥ 10 9 Gy/s), largely exceeding those currently used in conventional proton therapy. Since biological effects of ionizing radiation are strongly affected by the spatio-temporal distribution of DNA-damaging events, the unprecedented physical features of such beams may modify cellular and tissue radiosensitivity to unexplored extents. Hence, clinical applications of laser-generated particles need thorough assessment of their radiobiological effectiveness. To date, the majority of studies have either used rodent cell lines or have focussed on cancer cell killing being local tumour control the main objective of radiotherapy. Conversely, very little data exist on sub-lethal cellular effects, of relevance to normal tissue integrity and secondary cancers, such as premature cellular senescence. Here, we discuss ultra-high dose rate radiobiology and present preliminary data obtained in normal human cells following irradiation by laser-accelerated protons at the LULI PICO2000 facility at Laser Lab Europe, France.

  9. Apoptosis in chronic myeloid leukaemia: normal responses by progenitor cells to growth factor deprivation, X-irradiation and glucocorticoids

    International Nuclear Information System (INIS)

    Amos, T.A.S.; Lewis, J.L.; Grand, F.H.; Gooding, R.P.; Goldman, J.M.; Gordon, M.Y.

    1995-01-01

    Inhibition of apoptosis (genetically programmed active cell death) by p210 BCR-ABL expression is a mechanism that might contribute to clonal expansion in chronic myeloid leukaemia (CML). Since cell death following exposure to ionizing radiation and many chemotherapeutic agents can occur by the apoptotic pathway, inhibition of apoptosis would be expected to confer a relative resistance to these treatments. Similarly, cells deprived of growth factors in vitro die by apoptosis, and inhibition of apoptosis would therefore be expected to allow cells to survive better in growth factor-deprived conditions. We found that the survival of normal and CML myeloid progenitors was the same after in vitro incubation in deprived conditions and after treatment with X-irradiation or glucocorticoids. We also found that mature cells in colonies produced by CML progenitors (CFU-GM) did not survive better than those produced by normal progenitor cells. Flow cytometric analysis of propidium iodide-stained cells provided a direct indication that the degree of apoptosis may correspond to the degree of deprivation. These results suggest that inhibition of apoptosis may not be the primary mechanism whereby BCR-ABL influences the expansion of the malignant clone in CML. (Author)

  10. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  11. Response of normal children to influenza A/New Jersey/76 virus vaccine administered by jet injector.

    Science.gov (United States)

    McIntosh, K; Orr, I; Andersen, M; Arthur, J H; Blakeman, G J

    1977-12-01

    Ninety-seven children six to 10 years old received monovalent influenza A/New Jersey/76 virus vaccine by jet injector. Comparison with groups receiving vaccine intramuscularly revealed that local reactions (tenderness and erythema) were more frequent and more severe in the group vaccinated by jet injector. Antibody response, however, was similar for all groups.

  12. Normal and sublethally irradiated stem and granulocyte progenitor cell regeneration in an in vivo culture system. The cellular response to humoral factors released through the action of cyclophosphamide

    International Nuclear Information System (INIS)

    MacVittie, T.

    1977-01-01

    The in vivo diffusion chamber (DC) method of marrow culture was used to determine if the injection of host mice with cyclophosphamide (CY) caused, through its cytoxic action, the release of a humoral factor(s) capable of initiating stem cell (CFU-s) and granulocyte-macrophage progenitor cell (CFU-c) proliferation. Host mice were injected with CY 1-4 days prior to 800 rad of 60 Co WBI and implantation of DCs containing normal or 400 rad sublethally irradiated (SLI) marrow cells. The greatest proliferative response within CFU-s and CFU-c populations occurred in those mice injected with CY 3 days prior to implant. The marked CFU-s and CFU-c regeneration was initiated during the initial 24 hr of culture in both normal and SLI marrow cells. Thereafter growth rates were approximately the same. SLI marrow, however, showed a greater response to the humoral effects of CY injection than did normal marrow. These data provided evidence that CY induced the release of a diffusible factor(s) capable of accelerating regeneration of normal and sublethally irradiated CFU-s and CFU-c, the magnitude of which was dependent upon the time elapsed between CY injected and implantation of DCs. The marked proliferative response of the SLI stem and progenitor cells to the humoral stimulation may be indicative of the heterogeneity of both CFU-s and CFU-c populations surviving sublethal radiation exposure. The target cells may have possessed a differential sensitivity to the factor(s) initiating cell proliferation

  13. Blood leukocyte responses to extracorporeal circulation. 3. Long term extracorporeal circulation without and with irradiation in normal and splenectomized dogs

    Energy Technology Data Exchange (ETDEWEB)

    Szemere, P.; Fliedner, T.M. (Ulm Univ. (Germany, F.R.). Abt. Klinische Physiologie)

    1983-01-01

    Long term (12-48 h) extracorporeal circulation without and with irradiation of the blood was performed in normal and splenectomized dogs in order to observe the effect of these procedures on blood leukocyte counts including CFU-C. A transient granulocytopenia and a decrease of lymphocyte count were observed. The blood CFU-C level diminished to a very low level and remained low for the whole time of the experiments. There was no significant difference between the results of procedures with or without irradiation. The similar effect of a shortened tubing system on the blood leukocyte count is also reported. Heparin infusion alone did not decrease the peripheral CFU-C concentration. The possible explanations for the observed phenomena are discussed.

  14. A comparison of spent fuel shipping cask response to 10 CFR 71 normal conditions and realistic hot day extremes

    International Nuclear Information System (INIS)

    Manson, S.J.; Gianoulakis, S.E.

    1994-04-01

    An examination of the effect of a realistic (though conservative) hot day environment on the thermal transient behavior of spent fuel shipping casks is made. These results are compared to those that develop under the prescribed normal thermal condition of 10 CFR 71. Of specific concern are the characteristics of propagating thermal waves, which are set up by diurnal variations of temperature and insolation in the outdoor environment. In order to arrive at a realistic approximation of these variations on a conservative hot day, actual temperature and insolation measurements have been obtained from the National Climatic Data Center (NCDC) for representatively hot and high heat flux days. Thus, the use of authentic meteorological data ensures the realistic approach sought. Further supporting the desired realism of the modeling effort is the use of realistic cask configurations in which multiple laminations of structural, shielding, and other materials are expected to attenuate the propagating thermal waves. The completed analysis revealed that the majority of wall temperatures, for a wide variety of spent fuel shipping cask configurations, fall well below those predicted by enforcement of the regulatory environmental conditions of 10 CFR 71. It was found that maximum temperatures at the cask surface occasionally lie above temperatures predicted under the prescribed regulatory conditions. However, the temperature differences are small enough that the normal conservative assumptions that are made in the course of typical cask evaluations should correct for any potential violations. The analysis demonstrates that diurnal temperature variations that penetrate the cask wall all have maxima substantially less than the corresponding regulatory solutions. Therefore it is certain that vital cask components and the spent fuel itself will not exceed the temperatures calculated by use of the conditions of 10 CFR 71

  15. Gut microbiota and glucometabolic alterations in response to recurrent partial sleep deprivation in normal-weight young individuals.

    Science.gov (United States)

    Benedict, Christian; Vogel, Heike; Jonas, Wenke; Woting, Anni; Blaut, Michael; Schürmann, Annette; Cedernaes, Jonathan

    2016-12-01

    Changes to the microbial community in the human gut have been proposed to promote metabolic disturbances that also occur after short periods of sleep loss (including insulin resistance). However, whether sleep loss affects the gut microbiota remains unknown. In a randomized within-subject crossover study utilizing a standardized in-lab protocol (with fixed meal times and exercise schedules), we studied nine normal-weight men at two occasions: after two nights of partial sleep deprivation (PSD; sleep opportunity 02:45-07:00 h), and after two nights of normal sleep (NS; sleep opportunity 22:30-07:00 h). Fecal samples were collected within 24 h before, and after two in-lab nights, of either NS or PSD. In addition, participants underwent an oral glucose tolerance test following each sleep intervention. Microbiota composition analysis (V4 16S rRNA gene sequencing) revealed that after two days of PSD vs. after two days of NS, individuals exhibited an increased Firmicutes:Bacteroidetes ratio, higher abundances of the families Coriobacteriaceae and Erysipelotrichaceae, and lower abundance of Tenericutes (all P < 0.05) - previously all associated with metabolic perturbations in animal or human models. However, no PSD vs. NS effect on beta diversity or on fecal short-chain fatty acid concentrations was found. Fasting and postprandial insulin sensitivity decreased after PSD vs. NS (all P < 0.05). Our findings demonstrate that short-term sleep loss induces subtle effects on human microbiota. To what extent the observed changes to the microbial community contribute to metabolic consequences of sleep loss warrants further investigations in larger and more prolonged sleep studies, to also assess how sleep loss impacts the microbiota in individuals who already are metabolically compromised.

  16. Responses of human normal osteoblast cells and osteoblast-like cell line, MG-63 cells, to pulse electromagnetic field (PEMF

    Directory of Open Access Journals (Sweden)

    Suttatip Kamolmatyakul

    2008-01-01

    Full Text Available The objective of this in vitro study is to investigate the effect of pulsed electromagnetic field (PEMF on cellular proliferation and osteocalcin production of osteoblast-like cell line, MG-63 cells, and human normal osteoblast cells (NHOC obtained from surgical bone specimens. The cells were placed in 24-well culture plates in the amount of 3x104 cell/wells with 2 ml αMEM media supplemented with 10% FBS. The experimental plates were placed between a pair of Helmoltz coils powered by a pulse generator (PEMF, 50 Hz, 1.5 mV/cm in the upper compartment of a dual incubator (Forma. The control plates were placed in the lower compartment of the incubator without Helmotz coils. After three days, the cell proliferation was measured by the method modified from Mossman (J. Immunol Methods 1983; 65: 55-63. Other sets of plates were used for osteocalcin production assessment. Media from these sets were collected after 6 days and assessed for osteocalcin production using ELISA kits. The data were analyzed using a one-way analysis of variance (ANOVA. The results showed that MG-63 cells from the experimental group proliferated significantly more than those from the control group (20% increase, p<0.05. No significant difference in osteocalcin production was detected between the two groups. On the other hand, NHOC from the experimental group produced larger amount of osteocalcin (25% increase, p<0.05 and proliferated significantly more than those from the control group (100% increase, p<0.05. In conclusion, PEMF effect on osteoblasts might depend on their cell type of origin. For osteoblast-like cell line, MG-63 cells, PEMF increased proliferation rate but not osteocalcin production of the cells. However, PEMF stimulation effect on human normal osteoblast cells was most likely associated with enhancement of both osteocalcin production and cell proliferation.

  17. Existe-t-il une détection gustative des lipides alimentaires ? [Is there a gustatory detection of dietary lipids?

    Directory of Open Access Journals (Sweden)

    Philippe BESNARD

    2016-06-01

    Full Text Available The presence of lipids helps to make food more smooth, creamy and melting, in brief more palatable. This finding is not trivial. It indicates that lipids are easily perceived in a food matrix, which may be complex. During a long time, the oro-sensory detection of dietary lipids was thought to take place only through textural and retronasal olfactory cues. Over the last decade, this restrictive vision has gradually been challenged by a set of animal and human data suggesting that the gustatory pathway may also be involved in this phenomenon. After few reminders about the gustatory pathway, this mini-review will propose a short overview on a controversial question: is there a taste for fat?

  18. Possession of ATM Sequence Variants as Predictor for Late Normal Tissue Responses in Breast Cancer Patients Treated With Radiotherapy

    International Nuclear Information System (INIS)

    Ho, Alice Y.; Fan, Grace; Atencio, David P.; Green, Sheryl; Formenti, Silvia C.; Haffty, Bruce G.; Iyengar, Preetha B.A.; Bernstein, Jonine L.; Stock, Richard G.; Cesaretti, Jamie A.; Rosenstein, Barry S.

    2007-01-01

    Purpose: The ATM gene product is a central component of cell cycle regulation and genomic surveillance. We hypothesized that DNA sequence alterations in ATM predict for adverse effects after external beam radiotherapy for early breast cancer. Methods and Materials: A total of 131 patients with a minimum of 2 years follow-up who had undergone breast-conserving surgery and adjuvant radiotherapy were screened for sequence alterations in ATM using DNA from blood lymphocytes. Genetic variants were identified using denaturing high performance liquid chromatography. The Radiation Therapy Oncology Group late morbidity scoring schemes for skin and subcutaneous tissues were applied to quantify the radiation-induced effects. Results: Of the 131 patients, 51 possessed ATM sequence alterations located within exons or in short intron regions flanking each exon that encompass putative splice site regions. Of these 51 patients, 21 (41%) exhibited a minimum of a Grade 2 late radiation response. In contrast, of the 80 patients without an ATM sequence variation, only 18 (23%) had radiation-induced adverse responses, for an odds ratio of 2.4 (95% confidence interval, 1.1-5.2). Fifteen patients were heterozygous for the G→A polymorphism at nucleotide 5557, which causes substitution of asparagine for aspartic acid at position 1853 of the ATM protein. Of these 15 patients, 8 (53%) exhibited a Grade 2-4 late response compared with 31 (27%) of the 116 patients without this alteration, for an odds ratio of 3.1 (95% confidence interval, 1.1-9.4). Conclusion: Sequence variants located in the ATM gene, in particular the 5557 G→A polymorphism, may predict for late adverse radiation responses in breast cancer patients

  19. Gut microbiota and glucometabolic alterations in response to recurrent partial sleep deprivation in normal-weight young individuals

    Directory of Open Access Journals (Sweden)

    Christian Benedict

    2016-12-01

    Full Text Available Objective: Changes to the microbial community in the human gut have been proposed to promote metabolic disturbances that also occur after short periods of sleep loss (including insulin resistance. However, whether sleep loss affects the gut microbiota remains unknown. Methods: In a randomized within-subject crossover study utilizing a standardized in-lab protocol (with fixed meal times and exercise schedules, we studied nine normal-weight men at two occasions: after two nights of partial sleep deprivation (PSD; sleep opportunity 02:45–07:00 h, and after two nights of normal sleep (NS; sleep opportunity 22:30–07:00 h. Fecal samples were collected within 24 h before, and after two in-lab nights, of either NS or PSD. In addition, participants underwent an oral glucose tolerance test following each sleep intervention. Results: Microbiota composition analysis (V4 16S rRNA gene sequencing revealed that after two days of PSD vs. after two days of NS, individuals exhibited an increased Firmicutes:Bacteroidetes ratio, higher abundances of the families Coriobacteriaceae and Erysipelotrichaceae, and lower abundance of Tenericutes (all P < 0.05 – previously all associated with metabolic perturbations in animal or human models. However, no PSD vs. NS effect on beta diversity or on fecal short-chain fatty acid concentrations was found. Fasting and postprandial insulin sensitivity decreased after PSD vs. NS (all P < 0.05. Discussion: Our findings demonstrate that short-term sleep loss induces subtle effects on human microbiota. To what extent the observed changes to the microbial community contribute to metabolic consequences of sleep loss warrants further investigations in larger and more prolonged sleep studies, to also assess how sleep loss impacts the microbiota in individuals who already are metabolically compromised. Author Video: Author Video Watch what authors say about their articles Keywords: Bacteroidetes, Firmicutes, Insulin resistance

  20. Associations between postprandial insulin and blood glucose responses, appetite sensations and energy intake in normal weight and overweight individuals: a meta-analysis of test meal studies

    DEFF Research Database (Denmark)

    Flint, Anne; Gregersen, Nikolaj T.; Gluud, Lise L.

    2007-01-01

    is unclear whether postprandial blood glucose or insulin exerts a regulatory function in short-term appetite regulation in humans. The aim of this study was to investigate, by use of meta-analysis, the role of blood glucose and insulin in short-term appetite sensation and energy intake (EI......) in normal weight and overweight participants. Data from seven test meal studies were used, including 136 healthy participants (ALL) (92 normal weight (NW) and 44 overweight or obese (OW)). All meals were served as breakfasts after an overnight fast, and appetite sensations and blood samples were obtained...... frequently in the postprandial period. Finally, an ad libitum lunch was served. Data were analysed by fixed effects study level (SL) meta-regression analysis and individual participant data (IPD) regression analysis, using STATA software. In SL analysis, postprandial insulin response was associated...

  1. Comparison of Dose Response Models for Predicting Normal Tissue Complications from Cancer Radiotherapy: Application in Rat Spinal Cord

    Energy Technology Data Exchange (ETDEWEB)

    Adamus-Górka, Magdalena; Mavroidis, Panayiotis, E-mail: panayiotis.mavroidis@ki.se; Lind, Bengt K.; Brahme, Anders [Department of Medical Radiation Physics, Karolinska Institutet and Stockholm University, Stockholm S-17176 (Sweden)

    2011-05-18

    Seven different radiobiological dose-response models have been compared with regard to their ability to describe experimental data. The first four models, namely the critical volume, the relative seriality, the inverse tumor and the critical element models are mainly based on cell survival biology. The other three models: the Lyman (Gaussian distribution), the parallel architecture and the Weibull distribution models are semi-empirical and rather based on statistical distributions. The maximum likelihood estimation was used to fit the models to experimental data and the χ{sup 2}-distribution, AIC criterion and F-test were applied to compare the goodness-of-fit of the models. The comparison was performed using experimental data for rat spinal cord injury. Both the shape of the dose-response curve and the ability of handling the volume dependence were separately compared for each model. All the models were found to be acceptable in describing the present experimental dataset (p > 0.05). For the white matter necrosis dataset, the Weibull and Lyman models were clearly superior to the other models, whereas for the vascular damage case, the Relative Seriality model seems to have the best performance although the Critical volume, Inverse tumor, Critical element and Parallel architecture models gave similar results. Although the differences between many of the investigated models are rather small, they still may be of importance in indicating the advantages and limitations of each particular model. It appears that most of the models have favorable properties for describing dose-response data, which indicates that they may be suitable to be used in biologically optimized intensity modulated radiation therapy planning, provided a proper estimation of their radiobiological parameters had been performed for every tissue and clinical endpoint.

  2. Comparison of Dose Response Models for Predicting Normal Tissue Complications from Cancer Radiotherapy: Application in Rat Spinal Cord

    International Nuclear Information System (INIS)

    Adamus-Górka, Magdalena; Mavroidis, Panayiotis; Lind, Bengt K.; Brahme, Anders

    2011-01-01

    Seven different radiobiological dose-response models have been compared with regard to their ability to describe experimental data. The first four models, namely the critical volume, the relative seriality, the inverse tumor and the critical element models are mainly based on cell survival biology. The other three models: the Lyman (Gaussian distribution), the parallel architecture and the Weibull distribution models are semi-empirical and rather based on statistical distributions. The maximum likelihood estimation was used to fit the models to experimental data and the χ 2 -distribution, AIC criterion and F-test were applied to compare the goodness-of-fit of the models. The comparison was performed using experimental data for rat spinal cord injury. Both the shape of the dose-response curve and the ability of handling the volume dependence were separately compared for each model. All the models were found to be acceptable in describing the present experimental dataset (p > 0.05). For the white matter necrosis dataset, the Weibull and Lyman models were clearly superior to the other models, whereas for the vascular damage case, the Relative Seriality model seems to have the best performance although the Critical volume, Inverse tumor, Critical element and Parallel architecture models gave similar results. Although the differences between many of the investigated models are rather small, they still may be of importance in indicating the advantages and limitations of each particular model. It appears that most of the models have favorable properties for describing dose-response data, which indicates that they may be suitable to be used in biologically optimized intensity modulated radiation therapy planning, provided a proper estimation of their radiobiological parameters had been performed for every tissue and clinical endpoint

  3. Nitric oxide is involved in light-specific responses of tomato during germination under normal and osmotic stress conditions.

    Science.gov (United States)

    Piterková, Jana; Luhová, Lenka; Hofman, Jakub; Turecková, Veronika; Novák, Ondrej; Petrivalsky, Marek; Fellner, Martin

    2012-09-01

    Nitric oxide (NO) is involved in the signalling and regulation of plant growth and development and responses to biotic and abiotic stresses. The photoperiod-sensitive mutant 7B-1 in tomato (Solanum lycopersicum) showing abscisic acid (ABA) overproduction and blue light (BL)-specific tolerance to osmotic stress represents a valuable model to study the interaction between light, hormones and stress signalling. The role of NO as a regulator of seed germination and ABA-dependent responses to osmotic stress was explored in wild-type and 7B-1 tomato under white light (WL) and BL. Germination data were obtained from the incubation of seeds on germinating media of different composition. Histochemical analysis of NO production in germinating seeds was performed by fluorescence microscopy using a cell-permeable NO probe, and endogenous ABA was analysed by mass spectrometry. The NO donor S-nitrosoglutathione stimulated seed germination, whereas the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (PTIO) had an inhibitory effect. Under WL in both genotypes, PTIO strongly suppressed germination stimulated by fluridone, an ABA inhibitor. The stimulatory effect of the NO donor was also observed under osmotic stress for 7B-1 seeds under WL and BL. Seed germination inhibited by osmotic stress was restored by fluridone under WL, but less so under BL, in both genotypes. This effect of fluridone was further modulated by the NO donor and NO scavenger, but only to a minor extent. Fluorescence microscopy using the cell-permeable NO probe DAF-FM DA (4-amino-5-methylamino-2',7'-difluorofluorescein diacetate) revealed a higher level of NO in stressed 7B-1 compared with wild-type seeds. As well as defective BL signalling, the differential NO-dependent responses of the 7B-1 mutant are probably associated with its high endogenous ABA concentration and related impact on hormonal cross-talk in germinating seeds. These data confirm that light-controlled seed germination and

  4. Radiation dose response of normal lung assessed by Cone Beam CT - A potential tool for biologically adaptive radiation therapy

    International Nuclear Information System (INIS)

    Bertelsen, Anders; Schytte, Tine; Bentzen, Soren M.; Hansen, Olfred; Nielsen, Morten; Brink, Carsten

    2011-01-01

    Background: Density changes of healthy lung tissue during radiotherapy as observed by Cone Beam CT (CBCT) might be an early indicator of patient specific lung toxicity. This study investigates the time course of CBCT density changes and tests for a possible correlation with locally delivered dose. Methods: A total of 665 CBCTs in 65 lung cancer patients treated with IMRT/VMAT to 60 or 66 Gy in 2 Gy fractions were analyzed. For each patient, CBCT lung density changes during the treatment course were related to the locally delivered dose. Results: A dose response is observed for the patient population at the end of the treatment course. However, the observed dose response is highly variable among patients. Density changes at 10th and 20th fraction are clearly correlated to those observed at the end of the treatment course. Conclusions: CBCT density changes in healthy lung tissue during radiotherapy correlate with the locally delivered dose and can be detected relatively early during the treatment. If these density changes are correlated to subsequent clinical toxicity this assay could form the basis for biological adaptive radiotherapy.

  5. Immunoregulatory activities of human immunodeficiency virus (HIV) proteins: Effect of HIV recombinant and synthetic peptides on immunoglobulin synthesis and proliferative responses by normal lymphocytes

    International Nuclear Information System (INIS)

    Nair, M.P.N.; Pottathil, R.; Heimer, E.P.; Schwartz, S.A.

    1988-01-01

    Recombinant and synthetic peptides corresponding to envelope proteins of the human immunodeficiency virus (HIV) were examined for their effects on the activities of lymphocytes from normal donors in vitro. Although lymphocytes cultured with env-gag peptides produced significant amounts of IgG, addition of env-gag peptides to a pokeweed mitogen-induced B-cell activation system resulted in suppression of immunoglobulin synthesis by normal lymphocytes. Recombinant antigens, env-gag and env-80 dihydrofolate reductase (DHFR), produced a substantial proliferative response by peripheral blood mononuclear cells (PBMC) as determined by [ 3 H]thymidine incorporation. PBMC precultured with HIV synthetic peptide env 578-608 also manifested significant proliferative responses as compared to control cultures. CD3 + lymphocytes precultured with recombinant HIV antigens, env-gag and env-80 DHFR, and synthetic HIV peptide, env 487-511, showed moderate but significant proliferative responses. Both recombinant antigens and synthetic peptides also produced a dose-dependent stimulatory effect on proliferation by CD3 - lymphocytes. These studies demonstrate that recombinant and synthetic peptides of the HIV genome express immunoregulatory T- and B-cell epitopes. Identification of unique HIV epitopes with immunogenic and immunoregulatory activities is necessary for the development of an effective vaccine against HIV infection

  6. Estimation of Extreme Response and Failure Probability of Wind Turbines under Normal Operation using Probability Density Evolution Method

    DEFF Research Database (Denmark)

    Sichani, Mahdi Teimouri; Nielsen, Søren R.K.; Liu, W. F.

    2013-01-01

    Estimation of extreme response and failure probability of structures subjected to ultimate design loads is essential for structural design of wind turbines according to the new standard IEC61400-1. This task is focused on in the present paper in virtue of probability density evolution method (PDEM......), which underlies the schemes of random vibration analysis and structural reliability assessment. The short-term rare failure probability of 5-mega-watt wind turbines, for illustrative purposes, in case of given mean wind speeds and turbulence levels is investigated through the scheme of extreme value...... distribution instead of any other approximate schemes of fitted distribution currently used in statistical extrapolation techniques. Besides, the comparative studies against the classical fitted distributions and the standard Monte Carlo techniques are carried out. Numerical results indicate that PDEM exhibits...

  7. Auditory brainstem response latency in forward masking, a marker of sensory deficits in listeners with normal hearing thresholds

    DEFF Research Database (Denmark)

    Mehraei, Golbarg; Paredes Gallardo, Andreu; Shinn-Cunningham, Barbara G.

    2017-01-01

    In rodent models, acoustic exposure too modest to elevate hearing thresholds can nonetheless cause auditory nerve fiber deafferentation, interfering with the coding of supra-threshold sound. Low-spontaneous rate nerve fibers, important for encoding acoustic information at supra-threshold levels...... and in noise, are more susceptible to degeneration than high-spontaneous rate fibers. The change in auditory brainstem response (ABR) wave-V latency with noise level has been shown to be associated with auditory nerve deafferentation. Here, we measured ABR in a forward masking paradigm and evaluated wave......-V latency changes with increasing masker-to-probe intervals. In the same listeners, behavioral forward masking detection thresholds were measured. We hypothesized that 1) auditory nerve fiber deafferentation increases forward masking thresholds and increases wave-V latency and 2) a preferential loss of low...

  8. Vascular response to ischemia in the feet of falanga torture victims and normal controls--color and spectral Doppler findings

    DEFF Research Database (Denmark)

    Torp-Pedersen, Søren; Amris, Kirstine; Holm, Christian Cato

    2009-01-01

    to controls. On color Doppler this would be seen as less color after ischemia and on spectral Doppler as elevated resistive index (RI). METHODS: Ten male torture victims from the Middle East and nine age, sex and ethnically matched controls underwent Doppler examination of the abductor hallucis and flexor...... digitorum brevis muscles before and after two minutes ischemia induced with a pressure cuff over the malleoli. The color Doppler findings were quantified with the color fraction (CF) before and after ischemia. On spectral Doppler the resistive index was measured once before and three consecutive times after....... However, the trend in RI still supports the hypothesis. The negative findings may be due to inadequate design where the CF and RI were measured in one setting, perhaps resulting in both methods being applied imperfectly. The response to ischemia seems short-lived and we suggest that the Doppler methods...

  9. Taste Bud-Derived BDNF Is Required to Maintain Normal Amounts of Innervation to Adult Taste Buds123

    Science.gov (United States)

    Meng, Lingbin; Ohman-Gault, Lisa; Ma, Liqun

    2015-01-01

    Abstract Gustatory neurons transmit chemical information from taste receptor cells, which reside in taste buds in the oral cavity, to the brain. As adult taste receptor cells are renewed at a constant rate, nerve fibers must reconnect with new taste receptor cells as they arise. Therefore, the maintenance of gustatory innervation to the taste bud is an active process. Understanding how this process is regulated is a fundamental concern of gustatory system biology. We speculated that because brain-derived neurotrophic factor (BDNF) is required for taste bud innervation during development, it might function to maintain innervation during adulthood. If so, taste buds should lose innervation when Bdnf is deleted in adult mice. To test this idea, we first removed Bdnf from all cells in adulthood using transgenic mice with inducible CreERT2 under the control of the Ubiquitin promoter. When Bdnf was removed, approximately one-half of the innervation to taste buds was lost, and taste buds became smaller because of the loss of taste bud cells. Individual taste buds varied in the amount of innervation each lost, and those that lost the most innervation also lost the most taste bud cells. We then tested the idea that that the taste bud was the source of this BDNF by reducing Bdnf levels specifically in the lingual epithelium and taste buds. Taste buds were confirmed as the source of BDNF regulating innervation. We conclude that BDNF expressed in taste receptor cells is required to maintain normal levels of innervation in adulthood. PMID:26730405

  10. Taste Bud-Derived BDNF Is Required to Maintain Normal Amounts of Innervation to Adult Taste Buds.

    Science.gov (United States)

    Meng, Lingbin; Ohman-Gault, Lisa; Ma, Liqun; Krimm, Robin F

    2015-01-01

    Gustatory neurons transmit chemical information from taste receptor cells, which reside in taste buds in the oral cavity, to the brain. As adult taste receptor cells are renewed at a constant rate, nerve fibers must reconnect with new taste receptor cells as they arise. Therefore, the maintenance of gustatory innervation to the taste bud is an active process. Understanding how this process is regulated is a fundamental concern of gustatory system biology. We speculated that because brain-derived neurotrophic factor (BDNF) is required for taste bud innervation during development, it might function to maintain innervation during adulthood. If so, taste buds should lose innervation when Bdnf is deleted in adult mice. To test this idea, we first removed Bdnf from all cells in adulthood using transgenic mice with inducible CreERT2 under the control of the Ubiquitin promoter. When Bdnf was removed, approximately one-half of the innervation to taste buds was lost, and taste buds became smaller because of the loss of taste bud cells. Individual taste buds varied in the amount of innervation each lost, and those that lost the most innervation also lost the most taste bud cells. We then tested the idea that that the taste bud was the source of this BDNF by reducing Bdnf levels specifically in the lingual epithelium and taste buds. Taste buds were confirmed as the source of BDNF regulating innervation. We conclude that BDNF expressed in taste receptor cells is required to maintain normal levels of innervation in adulthood.

  11. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for

  12. Cigarette smoke induces endoplasmic reticulum stress and the unfolded protein response in normal and malignant human lung cells

    Directory of Open Access Journals (Sweden)

    Yang Jin

    2008-08-01

    Full Text Available Abstract Background Although lung cancer is among the few malignancies for which we know the primary etiological agent (i.e., cigarette smoke, a precise understanding of the temporal sequence of events that drive tumor progression remains elusive. In addition to finding that cigarette smoke (CS impacts the functioning of key pathways with significant roles in redox homeostasis, xenobiotic detoxification, cell cycle control, and endoplasmic reticulum (ER functioning, our data highlighted a defensive role for the unfolded protein response (UPR program. The UPR promotes cell survival by reducing the accumulation of aberrantly folded proteins through translation arrest, production of chaperone proteins, and increased degradation. Importance of the UPR in maintaining tissue health is evidenced by the fact that a chronic increase in defective protein structures plays a pathogenic role in diabetes, cardiovascular disease, Alzheimer's and Parkinson's syndromes, and cancer. Methods Gene and protein expression changes in CS exposed human cell cultures were monitored by high-density microarrays and Western blot analysis. Tissue arrays containing samples from 110 lung cancers were probed with antibodies to proteins of interest using immunohistochemistry. Results We show that: 1 CS induces ER stress and activates components of the UPR; 2 reactive species in CS that promote oxidative stress are primarily responsible for UPR activation; 3 CS exposure results in increased expression of several genes with significant roles in attenuating oxidative stress; and 4 several major UPR regulators are increased either in expression (i.e., BiP and eIF2α or phosphorylation (i.e., phospho-eIF2α in a majority of human lung cancers. Conclusion These data indicate that chronic ER stress and recruitment of one or more UPR effector arms upon exposure to CS may play a pivotal role in the etiology or progression of lung cancers, and that phospho-eIF2α and BiP may have

  13. Spermine modulation of the glutamateNMDA receptors is differentially responsive to conantokins in normal and alzheimer disease human cortex

    International Nuclear Information System (INIS)

    Ragnarsson, L.; Dodd, P.R.; Lewis, R.; University of Queensland, QLD

    1998-01-01

    Full text: The pharmacological characteristics of human N-methyl-D-aspartate (NMDA) receptors were examined in 12 control and 6 pathologically confirmed Alzheimer disease (AD) cases in six different brain areas, by studying their responses to MK-801, glutamate, spermine, and the NMDA receptor antagonists Ala(7)-conantokinG and Lys(7)-conantokinG. [ 3 H]MK801 binding assays performed by standard protocols on well-washed synoptic plasma membranes showed little variation in k D in all six brain areas, including comparisons between control and matched AD cases. b MAX values showed regional differences within control and AD cases, but there was no significant difference between groups in any of the brain regions. Maximal glutamate-enhanced [ 3 H]MK801 binding did not vary much between the brain regions or between control and AD cases, whereas maximal spermine-enhanced [ 3 H]MK-801 binding differed significantly between certain brain regions and between control and AD cases. In absolute terms in the control cases, the activation values were much lower in the spared regions, occipital and motor cortex, than in other areas; further, areas which are susceptible to damage showed reduced spermine activation in AD cases. These regional differences in the efficacy of spermine activation might be the result of local variations in the subunit composition of the NMDA receptor. Ala(7)-conantokinG and Lys(7)-conantokinG showed slight differences in potency, with the Ala(7) compound as the more potent. Both peptides produced 100% inhibition of spermine-enhanced [ 3 H]MK-801 binding in all brain areas, ana both gave lower IC 50 values in AD cases than in control cases. The significant differences in the inhibition of spermine-enhanced [ 3 H]MK-801 binding by the peptides between control and AD cases suggest that AD cases have a particular receptor subunit composition that is responsive to polyamines and which might make them more susceptible to excitotoxic damage. The spermine site

  14. c-Fos expression is elevated in GABAergic interneurons of the gustatory cortex following novel taste learning.

    Science.gov (United States)

    Doron, Guy; Rosenblum, Kobi

    2010-07-01

    Long-term sensory memories are considered to be stored in the relevant cortical region subserving the given modality. We and others have recently identified a series of molecular alterations in the gustatory cortex (GC) of the rat at different time intervals following novel taste learning. Some of these correlative modifications were also necessary for taste memory acquisition and/or consolidation. However, very little is known about the localization of these molecular modifications within the GC or about the functional activation of the GC hours after novel taste learning. Here, we hypothesize that inhibitory interneurons are activated in the GC on a scale of hours following learning and used c-Fos expression and confocal microscopy with different markers to test this hypothesis. We found that GABAergic interneurons are activated in the GC in correlation with novel taste learning. The activation was evident in the deep but not superficial layers of the dysgranular insular cortex. These results suggest that the GABAergic machinery in the deep layers of the GC participates in the processing of taste information hours after learning, and provide evidence for the involvement of a local cortical circuit not only during acquisition of new information but also during off-line processing and consolidation of taste information.

  15. Single Cell Chemical Cytometry of Akt Activity in Rheumatoid Arthritis and Normal Fibroblast-like Synoviocytes in Response to Tumor Necrosis Factor α.

    Science.gov (United States)

    Mainz, Emilie R; Serafin, D Stephen; Nguyen, Tuong T; Tarrant, Teresa K; Sims, Christopher E; Allbritton, Nancy L

    2016-08-02

    The etiology of rheumatoid arthritis (RA) is poorly understood, and 30% of patients are unresponsive to established treatments targeting tumor necrosis factor α (TNFα). Akt kinase is implicated in TNFα signaling and may act as a barometer of patient responses to biologic therapies. Fluorescent peptide sensors and chemical cytometry were employed to directly measure Akt activity as well as proteolytic activity in individual fibroblast-like synoviocytes (FLS) from RA and normal subjects. The specificity of the peptide reporter was evaluated and shown to be a valid measure of Akt activity in single cells. The effect of TNFα treatment on Akt activity was highly heterogeneous between normal and RA subjects, which was not observable in bulk analyses. In 2 RA subjects, a bimodal distribution of Akt activity was observed, primarily due to a subpopulation (21.7%: RA Subject 5; 23.8%: RA Subject 6) of cells in which >60% of the reporter was phosphorylated. These subjects also possessed statistically elevated proteolytic cleavage of the reporter relative to normal subjects, suggesting heterogeneity in Akt and protease activity that may play a role in the RA-affected joint. We expect that chemical cytometry studies pairing peptide reporters with capillary electrophoresis will provide valuable data regarding aberrant kinase activity from small samples of clinical interest.

  16. Strontium-Doped Calcium Phosphate and Hydroxyapatite Granules Promote Different Inflammatory and Bone Remodelling Responses in Normal and Ovariectomised Rats

    Science.gov (United States)

    Xia, Wei; Emanuelsson, Lena; Norlindh, Birgitta; Omar, Omar; Thomsen, Peter

    2013-01-01

    The healing of bone defects may be hindered by systemic conditions such as osteoporosis. Calcium phosphates, with or without ion substitutions, may provide advantages for bone augmentation. However, the mechanism of bone formation with these materials is unclear. The aim of this study was to evaluate the healing process in bone defects implanted with hydroxyapatite (HA) or strontium-doped calcium phosphate (SCP) granules, in non-ovariectomised (non-OVX) and ovariectomised (OVX) rats. After 0 (baseline), six and 28d, bone samples were harvested for gene expression analysis, histology and histomorphometry. Tumour necrosis factor-α (TNF-α), at six days, was higher in the HA, in non-OVX and OVX, whereas interleukin-6 (IL-6), at six and 28d, was higher in SCP, but only in non-OVX. Both materials produced a similar expression of the receptor activator of nuclear factor kappa-B ligand (RANKL). Higher expression of osteoclastic markers, calcitonin receptor (CR) and cathepsin K (CatK), were detected in the HA group, irrespective of non-OVX or OVX. The overall bone formation was comparable between HA and SCP, but with topological differences. The bone area was higher in the defect centre of the HA group, mainly in the OVX, and in the defect periphery of the SCP group, in both non-OVX and OVX. It is concluded that HA and SCP granules result in comparable bone formation in trabecular bone defects. As judged by gene expression and histological analyses, the two materials induced different inflammatory and bone remodelling responses. The modulatory effects are associated with differences in the spatial distribution of the newly formed bone. PMID:24376855

  17. A lower dose threshold for the in vivo protective adaptive response to radiation. Tumorigenesis in chronically exposed normal and Trp53 heterozygous C57BL/6 mice

    International Nuclear Information System (INIS)

    Mitchel, R.E.J.; Burchart, P.; Wyatt, H.

    2008-01-01

    Low doses of ionizing radiation to cells and animals may induce adaptive responses that reduce the risk of cancer. However, there are upper dose thresholds above which these protective adaptive responses do not occur. We have now tested the hypothesis that there are similar lower dose thresholds that must be exceeded in order to induce protective effects in vivo. We examined the effects of low dose/low dose rate fractionated exposures on cancer formation in Trp53 normal or cancer-prone Trp53 heterozygous female C57BL/6 mice. Beginning at 6 weeks of age, mice were exposed 5 days/week to single daily doses (0.33 mGy, 0.7 mGy/h) totaling 48, 97 or 146 mGy over 30, 60 or 90 weeks. The exposures for shorter times (up to 60 weeks) appeared to be below the level necessary to induce overall protective adaptive responses in Trp53 normal mice, and detrimental effects (shortened lifespan, increased frequency) evident for only specific tumor types (B- and T-cell lymphomas), were produced. Only when the exposures were continued for 90 weeks did the dose become sufficient to induce protective adaptive responses, balancing the detrimental effects for these specific cancers, and reducing the risk level back to that of the unexposed animals. Detrimental effects were not seen for other tumor types, and a protective effect was seen for sarcomas after 60 weeks of exposure, which was then lost when the exposure continued for 90 weeks. As previously shown for the upper dose threshold for protection by low doses, the lower dose boundary between protection and harm was influenced by Trp53 functionality. Neither protection nor harm was observed in exposed Trp53 heterozygous mice, indicating that reduced Trp53 function raises the lower dose/dose rate threshold for both detrimental and protective tumorigenic effects. (author)

  18. Specificity of tumor necrosis factor toxicity for human mammary carcinomas relative to normal mammary epithelium and correlation with response to doxorubicin

    International Nuclear Information System (INIS)

    Dollbaum, C.; Creasey, A.A.; Dairkee, S.H.; Hiller, A.J.; Rudolph, A.R.; Lin, L.; Vitt, C.; Smith, H.S.

    1988-01-01

    By using a unique short-term culture system capable of growing both normal and malignant breast epithelial tissue, human recombinant tumor necrosis factor (TNF) showed preferential cytotoxicity to malignant cells as compared to the corresponding nonmalignant cells. Most of the malignant specimens were sensitive to TNF with 13 of 18 specimens showing 90% inhibition of clonal growth (ID 90 ). In contrast, all 13 nonmalignant specimens tested clustered at the resistant end of the TNF response spectrum. This differential sensitivity to TNF was seen in three cases in which malignant and nonmalignant breast epithelial tissues from the same patient were studied. To investigate the mechanism of resistance to TNF by normal cells, the presence of receptors for TNF was determined. Five of six cultures showed specific binding of 125 I-labeled TNF and there was no relationship between the degree of resistance and the degree of specific binding. Simultaneous comparison of tumor responsiveness to doxorubicin and TNF revealed a positive correlation in ID 90 values; these results may have important implications for the clinical use of TNF in cancer patients heavily pretreated with doxorubicin

  19. {sup 99m}Tc-sestamibi muscle scintigraphy to assess the response to neuromuscular electrical stimulation of normal quadriceps femoris muscle

    Energy Technology Data Exchange (ETDEWEB)

    Pekindil, Y.; Sarikaya, A.; Birtane, M.; Pekindil, G.; Salan, A. [Trakya Univ., Edirne (Turkey). Hospital

    2001-08-01

    Neuromuscular electrical stimulation (NMES) is widely used for improving muscle strength by simultaneous contraction in the prevention of muscle atrophy. Although there exist many clinical methods for evaluating the therapeutic response of muscles, {sup 99m}Tc-sestamibi which is a skeletal muscle perfusion and metabolism agent has not previously been used for this purpose. The aim of our work was to ascertain whether {sup 99m}Tc-sestamibi muscle scintigraphy is useful in the monitoring of therapeutic response to NMES in healthy women. The study included 16 women aged between 21 and 45, with a mean age of 32.7{+-}6.4. Both quadriceps femoris muscles (QFM) of each patient were studied. After randomization to remove the effect of the dominant side, one QFM of each patient was subjected to the NMES procedure for a period of 20 days. NMES was performed with an alternating biphasic rectangular current, from a computed electrical stimulator daily for 23 minutes. After measurement of skinfold thickness over the thigh, pre- and post-NMES girth measurements were assessed in centimeters. Sixty minutes after injections of 555 MBq {sup 99m}Tc-sestamibi, static images of the thigh were obtained for 5 minutes. The thigh-to-knee uptake ratio was calculated by semiquantitative analysis and normalized to body surface area (NUR=normalized uptake ratio). The difference between the pre and post NMES NUR values was significant (1.76{+-}0.31 versus 2.25{+-}0.38, p=0.0000). The percentage (%) increase in NUR values also well correlated with the % increase in thigh girth measurements (r=0.89, p=0.0000). These results indicated that {sup 99m}Tc-sestamibi muscle scintigraphy as a new tool may be useful in evaluating therapeutic response to NMES. (author)

  20. Response of right ventricular size, function, and pressure to supine exercise: a comparison of patients with chronic obstructive lung disease and normal subjects

    Energy Technology Data Exchange (ETDEWEB)

    Slutsky, R; Hooper, W; Ackerman, W; Moser, K

    1982-12-01

    The response of right ventricular ejection fraction (RVEF) and right ventricular end-diastolic volume (RVEDV) to exercise was studied in 11 patients with severe (FEV/sub 25/sub(%)sub(-)/sub 75/sub(%)=0.32+-0.13, mean+-SD) chronic obstructive pulmonary disease (COPD). Using gated radionuclide cardiac blood pool imaging techniques, the response of the patients with COPD was compared with that of 15 control subjects. Arterial blood gases, pulmonary arterial pressures, wedge pressure, and right ventricular pressures also were monitored in patients with COPD. The resting RVEF was lower and the resting RVEDV was higher in patients with COPD than in normals (both, P<0.01). Two of the 11 COPD patients had a RVEF during rest that was below lower limits, while 10 of 11 patients had RV dilation. Right ventricular end-diastolic pressure, measured during rest in patients with COPD, was normal (6.1+-2.1 mm Hg) and cardiac index was within normal limits (3.55+-0.82 l/min/m/sup 2/). With exercise this cardiac index rose to 5.52+-1.7/min/m/sup 2/(P<0.01) due to the increase in heart rate (83+-18 to 125+-25 beats/min; P<0.01) while stroke volume did not significantly change. During exercise, normal subjects showed an increase in RVEF while RVEDV did not change; in patients with COPD, the RVEF fell and the RVEDV increased. In the patients with COPD, mild resting arterial hypoxemia and hypercapnia were both exaggerated during exercise; and mild resting pulmonary arterial hypertension (PAm=24.3+-7.65 mm Hg) also worsened with exercise (PAm=41+-19 mm Hg, P<0.01). Correlation between change in RVEF and PAm was -0.58, and between change in RVEDV and PAm was 0.63. We conclude that patients with severe COPD often have right ventricular dilation at rest and commonly respond to supine exercise with a fall in FV ejection fraction and further dilation of the right ventricle.

  1. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  2. Gustatory Habituation in "Drosophila" Relies on "Rutabaga" (Adenylate Cyclase)-Dependent Plasticity of GABAergic Inhibitory Neurons

    Science.gov (United States)

    Paranjpe, Pushkar; Rodrigues, Veronica; VijayRaghavan, K.; Ramaswami, Mani

    2012-01-01

    In some situations, animals seem to ignore stimuli which in other contexts elicit a robust response. This attenuation in behavior, which enables animals to ignore a familiar, unreinforced stimulus, is called habituation. Despite the ubiquity of this phenomenon, it is generally poorly understood in terms of the underlying neural circuitry. Hungry…

  3. Descending projections from the nucleus accumbens shell excite activity of taste-responsive neurons in the nucleus of the solitary tract in the hamster.

    Science.gov (United States)

    Li, Cheng-Shu; Lu, Da-Peng; Cho, Young K

    2015-06-01

    The nucleus of the solitary tract (NST) and the parabrachial nuclei (PbN) are the first and second relays in the rodent central taste pathway. A series of electrophysiological experiments revealed that spontaneous and taste-evoked activities of brain stem gustatory neurons are altered by descending input from multiple forebrain nuclei in the central taste pathway. The nucleus accumbens shell (NAcSh) is a key neural substrate of reward circuitry, but it has not been verified as a classical gustatory nucleus. A recent in vivo electrophysiological study demonstrated that the NAcSh modulates the spontaneous and gustatory activities of hamster pontine taste neurons. In the present study, we investigated whether activation of the NAcSh modulates gustatory responses of the NST neurons. Extracellular single-unit activity was recorded from medullary neurons in urethane-anesthetized hamsters. After taste response was confirmed by delivery of sucrose, NaCl, citric acid, and quinine hydrochloride to the anterior tongue, the NAcSh was stimulated bilaterally with concentric bipolar stimulating electrodes. Stimulation of the ipsilateral and contralateral NAcSh induced firings from 54 and 37 of 90 medullary taste neurons, respectively. Thirty cells were affected bilaterally. No inhibitory responses or antidromic invasion was observed after NAcSh activation. In the subset of taste cells tested, high-frequency electrical stimulation of the NAcSh during taste delivery enhanced taste-evoked neuronal firing. These results demonstrate that two-thirds of the medullary gustatory neurons are under excitatory descending influence from the NAcSh, which is a strong indication of communication between the gustatory pathway and the mesolimbic reward pathway. Copyright © 2015 the American Physiological Society.

  4. Effects of age and nutritional state on the expression of gustatory receptors in the honeybee (Apis mellifera.

    Directory of Open Access Journals (Sweden)

    Nicola K Simcock

    Full Text Available Gustatory receptors (Grs expressed in insect taste neurons signal the presence of carbohydrates, sugar alcohols, CO2, bitter compounds and oviposition stimulants. The honeybee (Apis mellifera has one of the smallest Gr gene sets (12 Gr genes of any insect whose genome has been sequenced. Honeybees live in eusocial colonies with a division of labour and perform age-dependent behavioural tasks, primarily food collection. Here, we used RT-qPCR to quantify Gr mRNA in honeybees at two ages (newly-emerged and foraging-age adults to examine the relationship between age-related physiology and expression of Gr genes. We measured the Gr mRNAs in the taste organs and also the brain and gut. The mRNA of all Gr genes was detected in all tissues analysed but showed plasticity in relative expression across tissues and in relation to age. Overall, Gr gene expression was higher in the taste organs than in the internal tissues but did not show an overall age-dependent difference. In contrast Gr gene expression in brain was generally higher in foragers, which may indicate greater reliance on internal nutrient sensing. Expression of the candidate sugar receptors AmGr1, AmGr2 and AmGr3 in forager brain was affected by the types of sugars bees fed on. The levels of expression in the brain were greater for AmGr1 but lower for AmGr2 and AmGr3 when bees were fed with glucose and fructose compared with sucrose. Additionally, AmGr3 mRNA was increased in starved bees compared to bees provided ad libitum sucrose. Thus, expression of these Grs in forager brain reflects both the satiety state of the bee (AmGr3 and the type of sugar on which the bee has fed.

  5. Neural circuits of eye movements during performance of the visual exploration task, which is similar to the responsive search score task, in schizophrenia patients and normal subjects

    International Nuclear Information System (INIS)

    Nemoto, Yasundo; Matsuda, Tetsuya; Matsuura, Masato

    2004-01-01

    Abnormal exploratory eye movements have been studied as a biological marker for schizophrenia. Using functional MRI (fMRI), we investigated brain activations of 12 healthy and 8 schizophrenic subjects during performance of a visual exploration task that is similar to the responsive search score task to clarify the neural basis of the abnormal exploratory eye movement. Performance data, such as the number of eye movements, the reaction time, and the percentage of correct answers showed no significant differences between the two groups. Only the normal subjects showed activations at the bilateral thalamus and the left anterior medial frontal cortex during the visual exploration tasks. In contrast, only the schizophrenic subjects showed activations at the right anterior cingulate gyms during the same tasks. The activation at the different locations between the two groups, the left anterior medial frontal cortex in normal subjects and the right anterior cingulate gyrus in schizophrenia subjects, was explained by the feature of the visual tasks. Hypoactivation at the bilateral thalamus supports a dysfunctional filtering theory of schizophrenia. (author)

  6. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  7. Effects of gustatory stimulants of salivary secretion on salivary pH and flow in patients with Sjögren's syndrome: a randomized controlled trial.

    Science.gov (United States)

    da Silva Marques, Duarte Nuno; da Mata, António Duarte Sola Pereira; Patto, José Maria Vaz; Barcelos, Filipe Alexandre Duarte; de Almeida Rato Amaral, João Pedro; de Oliveira, Miguel Constantino Mendes; Ferreira, Cristina Gutierrez Castanheira

    2011-11-01

    To compare salivary pH changes and stimulation efficacy of two different gustatory stimulants of salivary secretion (GSSS) in patients with primary Sjögren syndrome. Portuguese Institute for Rheumatological Diseases. Double-blind randomized controlled trial. Eighty patients were randomized to two intervention groups. Sample size was calculated using an alpha error of 0.05 and a beta of 0.20. Participants were randomly assigned to receive a new GSSS containing a weaker malic acid, fluoride and xylitol or a traditionally citric acid-based one. Saliva collection was obtained by established methods at different times. The salivary pH of the samples was determined with a pH meter and a microelectrode. Salivary pH variations and counts of subjects with pH below 4.5 for over 1 min and stimulated salivary flow were the main outcome measures. Both GSSS significantly stimulated salivary output without significant differences between the two groups. The new gustatory stimulant of salivary secretion presented an absolute risk reduction of 52.78% [33.42-72.13 (95% CI)] when compared with the traditional one. In Xerostomic Primary Sjögren syndrome patients, gustatory stimulants of salivary secretion based on acid mail only with fluoride and xylitol present similar salivary stimulation capacity when compared to citric acid-based ones, besides significantly reducing the number of salivary pH drops below 4.5. This could be related to a diminished risk for dental erosion and should be confirmed with further studies. © 2011 John Wiley & Sons A/S.

  8. Malware Normalization

    OpenAIRE

    Christodorescu, Mihai; Kinder, Johannes; Jha, Somesh; Katzenbeisser, Stefan; Veith, Helmut

    2005-01-01

    Malware is code designed for a malicious purpose, such as obtaining root privilege on a host. A malware detector identifies malware and thus prevents it from adversely affecting a host. In order to evade detection by malware detectors, malware writers use various obfuscation techniques to transform their malware. There is strong evidence that commercial malware detectors are susceptible to these evasion tactics. In this paper, we describe the design and implementation of a malware normalizer ...

  9. Exercise training normalizes renal blood flow responses to acute hypoxia in experimental heart failure: role of the α1-adrenergic receptor.

    Science.gov (United States)

    Pügge, Carolin; Mediratta, Jai; Marcus, Noah J; Schultz, Harold D; Schiller, Alicia M; Zucker, Irving H

    2016-02-01

    Recent data suggest that exercise training (ExT) is beneficial in chronic heart failure (CHF) because it improves autonomic and peripheral vascular function. In this study, we hypothesized that ExT in the CHF state ameliorates the renal vasoconstrictor responses to hypoxia and that this beneficial effect is mediated by changes in α1-adrenergic receptor activation. CHF was induced in rabbits. Renal blood flow (RBF) and renal vascular conductance (RVC) responses to 6 min of 5% isocapnic hypoxia were assessed in the conscious state in sedentary (SED) and ExT rabbits with CHF with and without α1-adrenergic blockade. α1-adrenergic receptor expression in the kidney cortex was also evaluated. A significant decline in baseline RBF and RVC and an exaggerated renal vasoconstriction during acute hypoxia occurred in CHF-SED rabbits compared with the prepaced state (P renal denervation (DnX) blocked the hypoxia-induced renal vasoconstriction in CHF-SED rabbits. α1-adrenergic protein in the renal cortex of animals with CHF was increased in SED animals and normalized after ExT. These data provide evidence that the acute decline in RBF during hypoxia is caused entirely by the renal nerves but is only partially mediated by α1-adrenergic receptors. Nonetheless, α1-adrenergic receptors play an important role in the beneficial effects of ExT in the kidney. Copyright © 2016 the American Physiological Society.

  10. HPA axis response to social stress is attenuated in schizophrenia but normal in depression: evidence from a meta-analysis of existing studies.

    Science.gov (United States)

    Ciufolini, Simone; Dazzan, Paola; Kempton, Matthew J; Pariante, Carmine; Mondelli, Valeria

    2014-11-01

    We conducted a meta-analysis to investigate the HPA axis response to social stress in studies that used the Trier Social Stress Test (TSST), or comparable distressing paradigms, in individuals with either depression or schizophrenia. Sample size-adjusted effect sizes (Hedge's g statistic) were calculated to estimate the HPA axis stress response to social stress. We used a meta-regression model to take into account the moderating effect of the baseline cortisol level. Participants with depression show an activation pattern to social stress similar to that of healthy controls. Despite a normal cortisol production rate, individuals with schizophrenia have lower cortisol levels than controls both in anticipation and after exposure to social stress. Participants with depression and higher cortisol levels before the task have an increased cortisol production and reached higher cortisol levels during the task. This may be explained by the presence of an impaired negative feedback. The activation pattern present in schizophrenia may explain the reduced ability to appropriately contextualize past experiences shown by individuals with psychosis in social stressful situation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Use of Sine Shaped High-Frequency Rhythmic Visual Stimuli Patterns for SSVEP Response Analysis and Fatigue Rate Evaluation in Normal Subjects

    Directory of Open Access Journals (Sweden)

    Ahmadreza Keihani

    2018-05-01

    Full Text Available Background: Recent EEG-SSVEP signal based BCI studies have used high frequency square pulse visual stimuli to reduce subjective fatigue. However, the effect of total harmonic distortion (THD has not been considered. Compared to CRT and LCD monitors, LED screen displays high-frequency wave with better refresh rate. In this study, we present high frequency sine wave simple and rhythmic patterns with low THD rate by LED to analyze SSVEP responses and evaluate subjective fatigue in normal subjects.Materials and Methods: We used patterns of 3-sequence high-frequency sine waves (25, 30, and 35 Hz to design our visual stimuli. Nine stimuli patterns, 3 simple (repetition of each of above 3 frequencies e.g., P25-25-25 and 6 rhythmic (all of the frequencies in 6 different sequences e.g., P25-30-35 were chosen. A hardware setup with low THD rate (<0.1% was designed to present these patterns on LED. Twenty two normal subjects (aged 23–30 (25 ± 2.1 yrs were enrolled. Visual analog scale (VAS was used for subjective fatigue evaluation after presentation of each stimulus pattern. PSD, CCA, and LASSO methods were employed to analyze SSVEP responses. The data including SSVEP features and fatigue rate for different visual stimuli patterns were statistically evaluated.Results: All 9 visual stimuli patterns elicited SSVEP responses. Overall, obtained accuracy rates were 88.35% for PSD and > 90% for CCA and LASSO (for TWs > 1 s. High frequency rhythmic patterns group with low THD rate showed higher accuracy rate (99.24% than simple patterns group (98.48%. Repeated measure ANOVA showed significant difference between rhythmic pattern features (P < 0.0005. Overall, there was no significant difference between the VAS of rhythmic [3.85 ± 2.13] compared to the simple patterns group [3.96 ± 2.21], (P = 0.63. Rhythmic group had lower within group VAS variation (min = P25-30-35 [2.90 ± 2.45], max = P35-25-30 [4.81 ± 2.65] as well as least individual pattern VAS (P25

  12. Differences in Normal Tissue Response in the Esophagus Between Proton and Photon Radiation Therapy for Non-Small Cell Lung Cancer Using In Vivo Imaging Biomarkers.

    Science.gov (United States)

    Niedzielski, Joshua S; Yang, Jinzhong; Mohan, Radhe; Titt, Uwe; Mirkovic, Dragan; Stingo, Francesco; Liao, Zhongxing; Gomez, Daniel R; Martel, Mary K; Briere, Tina M; Court, Laurence E

    2017-11-15

    To determine whether there exists any significant difference in normal tissue toxicity between intensity modulated radiation therapy (IMRT) or proton therapy for the treatment of non-small cell lung cancer. A total of 134 study patients (n=49 treated with proton therapy, n=85 with IMRT) treated in a randomized trial had a previously validated esophageal toxicity imaging biomarker, esophageal expansion, quantified during radiation therapy, as well as esophagitis grade (Common Terminology Criteria for Adverse Events version 3.0), on a weekly basis during treatment. Differences between the 2 modalities were statically analyzed using the imaging biomarker metric value (Kruskal-Wallis analysis of variance), as well as the incidence and severity of esophagitis grade (χ 2 and Fisher exact tests, respectively). The dose-response of the imaging biomarker was also compared between modalities using esophageal equivalent uniform dose, as well as delivered dose to an isotropic esophageal subvolume. No statistically significant difference in the distribution of esophagitis grade, the incidence of grade ≥3 esophagitis (15 and 11 patients treated with IMRT and proton therapy, respectively), or the esophageal expansion imaging biomarker between cohorts (P>.05) was found. The distribution of imaging biomarker metric values had similar distributions between treatment arms, despite a slightly higher dose volume in the proton arm (P>.05). Imaging biomarker dose-response was similar between modalities for dose quantified as esophageal equivalent uniform dose and delivered esophageal subvolume dose. Regardless of treatment modality, there was high variability in imaging biomarker response, as well as esophagitis grade, for similar esophageal doses between patients. There was no significant difference in esophageal toxicity from either proton- or photon-based radiation therapy as quantified by esophagitis grade or the esophageal expansion imaging biomarker. Copyright © 2017 Elsevier

  13. Dynamical response of the Galileo Galilei on the ground rotor to test the equivalence principle: Theory, simulation, and experiment. I. The normal modes

    International Nuclear Information System (INIS)

    Comandi, G.L.; Chiofalo, M.L.; Toncelli, R.; Bramanti, D.; Polacco, E.; Nobili, A.M.

    2006-01-01

    Recent theoretical work suggests that violation of the equivalence principle might be revealed in a measurement of the fractional differential acceleration η between two test bodies-of different compositions, falling in the gravitational field of a source mass--if the measurement is made to the level of η≅10 -13 or better. This being within the reach of ground based experiments gives them a new impetus. However, while slowly rotating torsion balances in ground laboratories are close to reaching this level, only an experiment performed in a low orbit around the Earth is likely to provide a much better accuracy. We report on the progress made with the 'Galileo Galilei on the ground' (GGG) experiment, which aims to compete with torsion balances using an instrument design also capable of being converted into a much higher sensitivity space test. In the present and following articles (Part I and Part II), we demonstrate that the dynamical response of the GGG differential accelerometer set into supercritical rotation-in particular, its normal modes (Part I) and rejection of common mode effects (Part II)-can be predicted by means of a simple but effective model that embodies all the relevant physics. Analytical solutions are obtained under special limits, which provide the theoretical understanding. A simulation environment is set up, obtaining a quantitative agreement with the available experimental data on the frequencies of the normal modes and on the whirling behavior. This is a needed and reliable tool for controlling and separating perturbative effects from the expected signal, as well as for planning the optimization of the apparatus

  14. Ammonium-acetate is sensed by gustatory and olfactory neurons in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Christian Frøkjaer-Jensen

    2008-06-01

    Full Text Available Caenorhabditis elegans chemosensation has been successfully studied using behavioral assays that treat detection of volatile and water soluble chemicals as separate senses, analogous to smell and taste. However, considerable ambiguity has been associated with the attractive properties of the compound ammonium-acetate (NH(4Ac. NH(4Ac has been used in behavioral assays both as a chemosensory neutral compound and as an attractant.Here we show that over a range of concentrations NH(4Ac can be detected both as a water soluble attractant and as an odorant, and that ammonia and acetic acid individually act as olfactory attractants. We use genetic analysis to show that NaCl and NH(4Ac sensation are mediated by separate pathways and that ammonium sensation depends on the cyclic nucleotide gated ion channel TAX-2/TAX-4, but acetate sensation does not. Furthermore we show that sodium-acetate (NaAc and ammonium-chloride (NH(4Cl are not detected as Na(+ and Cl(- specific stimuli, respectively.These findings clarify the behavioral response of C. elegans to NH(4Ac. The results should have an impact on the design and interpretation of chemosensory experiments studying detection and adaptation to soluble compounds in the nematode Caenorhabditis elegans.

  15. Immune Modulation in Normal Human Peripheral Blood Mononuclear Cells (PBMCs) (Lymphocytes) in Response to Benzofuran-2-Carboxylic Acid Derivative KMEG during Spaceflight

    Science.gov (United States)

    Okoro, Elvis; Mann, Vivek; Ellis, Ivory; Mansoor, Elvedina; Olamigoke, Loretta; Marriott, Karla Sue; Denkins, Pamela; Williams, Willie; Sundaresan, Alamelu

    2017-08-01

    Microgravity and radiation exposure during space flight have been widely reported to induce the suppression of normal immune system function, and increase the risk of cancer development in humans. These findings pose a serious risk to manned space missions. Interestingly, recent studies have shown that benzofuran-2-carboxylic acid derivatives can inhibit the progression of some of these devastating effects on earth and in modeled microgravity. However, these studies had not assessed the impacts of benzofuran-2- carboxylic acid and its derivatives on global gene expression under spaceflight conditions. In this study, the ability of a specific benzofuran-2-carboxylic acid derivative (KMEG) to confer protection from radiation and restore normal immune function was investigated following exposure to space flight conditions on the ISS. Normal human peripheral blood mononuclear cells (lymphocytes) treated with 10 µ g/ml of KMEG together with untreated control samples were flown on Nanoracks hardware on Spacex-3 flight. The Samples were returned one month later and gene expression was analyzed. A 1g-ground control experiment was performed in parallel at the Kennedy spaceflight center. The first overall subtractive unrestricted analysis revealed 78 genes, which were differentially expressed in space flight KMEG, untreated lymphocytes as compared to the corresponding ground controls. However, in KMEG-treated space flight lymphocytes, there was an increased expression of a group of genes that mediate increased transcription, translation and innate immune system mediating functions of lymphocytes as compared to KMEG-untreated samples. Analysis of genes related to T cell proliferation in spaceflight KMEG-treated lymphocytes compared to 1g-ground KMEG- treated lymphocytes revealed six T cell proliferation and signaling genes to be significantly upregulated (p trafficking, promote early response, mediating C-myc related proliferation, promote antiapoptotic activity and protects

  16. Normal accidents

    International Nuclear Information System (INIS)

    Perrow, C.

    1989-01-01

    The author has chosen numerous concrete examples to illustrate the hazardousness inherent in high-risk technologies. Starting with the TMI reactor accident in 1979, he shows that it is not only the nuclear energy sector that bears the risk of 'normal accidents', but also quite a number of other technologies and industrial sectors, or research fields. The author refers to the petrochemical industry, shipping, air traffic, large dams, mining activities, and genetic engineering, showing that due to the complexity of the systems and their manifold, rapidly interacting processes, accidents happen that cannot be thoroughly calculated, and hence are unavoidable. (orig./HP) [de

  17. Gustatory stimuli representing different perceptual qualities elicit distinct patterns of neuropeptide secretion from taste buds.

    Science.gov (United States)

    Geraedts, Maartje C P; Munger, Steven D

    2013-04-24

    Taste stimuli that evoke different perceptual qualities (e.g., sweet, umami, bitter, sour, salty) are detected by dedicated subpopulations of taste bud cells that use distinct combinations of sensory receptors and transduction molecules. Here, we report that taste stimuli also elicit unique patterns of neuropeptide secretion from taste buds that are correlated with those perceptual qualities. We measured tastant-dependent secretion of glucagon-like peptide-1 (GLP-1), glucagon, and neuropeptide Y (NPY) from circumvallate papillae of Tas1r3(+/+), Tas1r3(+/-) and Tas1r3 (-/-) mice. Isolated tongue epithelia were mounted in modified Ussing chambers, permitting apical stimulation of taste buds; secreted peptides were collected from the basal side and measured by specific ELISAs. Appetitive stimuli (sweet: glucose, sucralose; umami: monosodium glutamate; polysaccharide: Polycose) elicited GLP-1 and NPY secretion and inhibited basal glucagon secretion. Sweet and umami stimuli were ineffective in Tas1r3(-/-) mice, indicating an obligatory role for the T1R3 subunit common to the sweet and umami taste receptors. Polycose responses were unaffected by T1R3 deletion, consistent with the presence of a distinct polysaccharide taste receptor. The effects of sweet stimuli on peptide secretion also required the closing of ATP-sensitive K(+) (KATP) channels, as the KATP channel activator diazoxide inhibited the effects of glucose and sucralose on both GLP-1 and glucagon release. Both sour citric acid and salty NaCl increased NPY secretion but had no effects on GLP-1 or glucagon. Bitter denatonium showed no effects on these peptides. Together, these results suggest that taste stimuli of different perceptual qualities elicit unique patterns of neuropeptide secretion from taste buds.

  18. A 3 T event-related functional magnetic resonance imaging (fMRI) study of primary and secondary gustatory cortex localization using natural tastants

    International Nuclear Information System (INIS)

    Smits, Marion; Peeters, Ronald R.; Hecke, Paul van; Sunaert, Stefan

    2007-01-01

    It is known that taste is centrally represented in the insula, frontal and parietal operculum, as well as in the orbitofrontal cortex (secondary gustatory cortex). In functional MRI (fMRI) experiments activation in the insula has been confirmed, but activation in the orbitofrontal cortex is only infrequently found, especially at higher field strengths (3 T). Due to large susceptibility artefacts, the orbitofrontal cortex is a difficult region to examine with fMRI. Our aim was to localize taste in the human cortex at 3 T, specifically in the orbitofrontal cortex as well as in the primary gustatory cortex. Event-related fMRI was performed at 3 T in seven healthy volunteers. Taste stimuli consisted of lemon juice and chocolate. To visualize activation in the orbitofrontal cortex a dedicated 3D SENSE EPI fMRI sequence was used, in addition to a 2D SENSE EPI fMRI sequence for imaging the entire brain. Data were analyzed using a perception-based model. The dedicated 3D SENSE EPI sequence successfully reduced susceptibility artefacts in the orbitofrontal area. Significant taste-related activation was found in the orbitofrontal and insular cortices. fMRI of the orbitofrontal cortex is feasible at 3 T, using a dedicated sequence. Our results corroborate findings from previous studies. (orig.)

  19. Comparison of fungiform taste-bud distribution among age groups using confocal laser scanning microscopy in vivo in combination with gustatory function.

    Science.gov (United States)

    Saito, Takehisa; Ito, Tetsufumi; Ito, Yumi; Manabe, Yasuhiro; Sano, Kazuo

    2016-04-01

    The aim of this study was to compare the distribution of taste buds in fungiform papillae (FP) and gustatory function between young and elderly age groups. Confocal laser scanning microscopy was used because it allows many FP to be observed non-invasively in a short period of time. The age of participants (n = 211) varied from 20 to 83 yr. The tip and midlateral region of the tongue were observed. Taste buds in an average of 10 FP in each area were counted. A total of 2,350 FP at the tongue tip and 2,592 FP in the midlateral region could be observed. The average number of taste buds was similar among all age groups both at the tongue tip and in the midlateral region. The taste function, measured by electrogustometry, among participants 20-29 yr of age was significantly lower than that in the other age groups; however, there was no difference among any other age groups in taste function. These results indicate that the peripheral gustatory system is well maintained anatomically and functionally in elderly people. © 2016 Eur J Oral Sci.

  20. A 3 T event-related functional magnetic resonance imaging (fMRI) study of primary and secondary gustatory cortex localization using natural tastants

    Energy Technology Data Exchange (ETDEWEB)

    Smits, Marion [Erasmus MC, University Medical Center Rotterdam, Department of Radiology, P.O. Box 2040, CA Rotterdam (Netherlands); K.U.Leuven, Department of Radiology, University Hospitals, Leuven (Belgium); Peeters, Ronald R.; Hecke, Paul van; Sunaert, Stefan [K.U.Leuven, Department of Radiology, University Hospitals, Leuven (Belgium)

    2007-01-15

    It is known that taste is centrally represented in the insula, frontal and parietal operculum, as well as in the orbitofrontal cortex (secondary gustatory cortex). In functional MRI (fMRI) experiments activation in the insula has been confirmed, but activation in the orbitofrontal cortex is only infrequently found, especially at higher field strengths (3 T). Due to large susceptibility artefacts, the orbitofrontal cortex is a difficult region to examine with fMRI. Our aim was to localize taste in the human cortex at 3 T, specifically in the orbitofrontal cortex as well as in the primary gustatory cortex. Event-related fMRI was performed at 3 T in seven healthy volunteers. Taste stimuli consisted of lemon juice and chocolate. To visualize activation in the orbitofrontal cortex a dedicated 3D SENSE EPI fMRI sequence was used, in addition to a 2D SENSE EPI fMRI sequence for imaging the entire brain. Data were analyzed using a perception-based model. The dedicated 3D SENSE EPI sequence successfully reduced susceptibility artefacts in the orbitofrontal area. Significant taste-related activation was found in the orbitofrontal and insular cortices. fMRI of the orbitofrontal cortex is feasible at 3 T, using a dedicated sequence. Our results corroborate findings from previous studies. (orig.)

  1. A taste of the deep-sea: The roles of gustatory and tactile searching behaviour in the grenadier fish Coryphaenoides armatus

    Science.gov (United States)

    Bailey, David M.; Wagner, Hans-Joachim; Jamieson, Alan J.; Ross, Murray F.; Priede, Imants G.

    2007-01-01

    The deep-sea grenadier fishes ( Coryphaenoides spp.) are among the dominant predators and scavengers in the ocean basins that cover much of Earth's surface. Baited camera experiments were used to study the behaviour of these fishes. Despite the apparent advantages of rapidly consuming food, grenadiers attracted to bait spend a large proportion of their time in prolonged periods of non-feeding activity. Video analysis revealed that fish often adopted a head-down swimming attitude (mean of 21.3° between the fish and seafloor), with swimming velocity negatively related to attitude. The fish also swam around and along vertical and horizontal structures of the lander with their head immediately adjacent to the structure. We initially hypothesised that this behaviour was associated with the use of the short chin barbel in foraging. Barbel histology showed numerous taste buds in the skin, and a barbel nerve with about 20,000 axons in adult fish. A tracing experiment in one undamaged animal revealed the termination fields of the barbel neurons in the trigeminal and rhombencephalic regions, indicating both a mechanoreceptory and a gustatory role for the barbel. Our conclusion was that olfactory foraging becomes ineffective at close ranges and is followed by a search phase using tactile and gustatory sensing by the barbel. The development of this sensory method probably co-evolved alongside behavioural changes in swimming mechanics to allow postural stability at low swimming speeds.

  2. Pancreatic beta-cell responses to GLP-1 after near-normalization of blood glucose in patients with type 2 diabetes.

    Science.gov (United States)

    Asmar, Meena; Højberg, Patricia V; Deacon, Carolyn F; Hare, Kristine; Holst, Jens J; Madsbad, Sten

    2010-02-25

    This study investigated the effects of strict glycaemic control on beta-cell function in nine obese subjects with type 2 diabetes (T2DM), using graded glucose infusions together with infusions of saline or GLP-1 before (HbA(1)c: 8.0+/-0.4%) and after four weeks of near-normalization of blood glucose (BG) using insulin (mean diurnal BG: 6.4+/-0.3 mmol/l; HbA(1)c: 6.6+/-0.3%). Nine matched healthy subjects acted as controls. In controls, area-under-curve (AUC) for amylin, C-peptide and proinsulin were higher with GLP-1 than saline (PAUC amylin/C-peptide ratio was similar on both days, while AUC proinsulin/C-peptide ratio was higher with GLP-1 (P=0.02). In the patients, amylin, C-peptide and proinsulin AUCs were unaltered by near-normoglycaemia per se. Proinsulin responses to GLP-1 were unchanged, but amylin and C-peptide AUCs increased (PAUC amylin/C-peptide ratios rose to control levels. Near-normoglycaemia tended to reduce AUC proinsulin/C-peptide ratio, which was significant (P=0.04) with GLP-1, but still higher than with saline (P=0.004). In conclusion, amylin, C-peptide and proinsulin responses to glucose were unaffected by four weeks of near-normoglycaemia, whereas GLP-1 increased amylin and C-peptide secretion and amylin/C-peptide ratio. Near-normoglycaemia reduced proinsulin/C-peptide ratio during stimulation with GLP-1, suggesting that strict glycaemic control might ameliorate some of the disturbances in beta-cell function characterizing T2DM. Copyright 2010 Elsevier B.V. All rights reserved.

  3. Reconstructing Normality

    DEFF Research Database (Denmark)

    Gildberg, Frederik Alkier; Bradley, Stephen K.; Fristed, Peter Billeskov

    2012-01-01

    Forensic psychiatry is an area of priority for the Danish Government. As the field expands, this calls for increased knowledge about mental health nursing practice, as this is part of the forensic psychiatry treatment offered. However, only sparse research exists in this area. The aim of this study...... was to investigate the characteristics of forensic mental health nursing staff interaction with forensic mental health inpatients and to explore how staff give meaning to these interactions. The project included 32 forensic mental health staff members, with over 307 hours of participant observations, 48 informal....... The intention is to establish a trusting relationship to form behaviour and perceptual-corrective care, which is characterized by staff's endeavours to change, halt, or support the patient's behaviour or perception in relation to staff's perception of normality. The intention is to support and teach the patient...

  4. Pursuing Normality

    DEFF Research Database (Denmark)

    Madsen, Louise Sofia; Handberg, Charlotte

    2018-01-01

    implying an influence on whether to participate in cancer survivorship care programs. Because of "pursuing normality," 8 of 9 participants opted out of cancer survivorship care programming due to prospects of "being cured" and perceptions of cancer survivorship care as "a continuation of the disease......BACKGROUND: The present study explored the reflections on cancer survivorship care of lymphoma survivors in active treatment. Lymphoma survivors have survivorship care needs, yet their participation in cancer survivorship care programs is still reported as low. OBJECTIVE: The aim of this study...... was to understand the reflections on cancer survivorship care of lymphoma survivors to aid the future planning of cancer survivorship care and overcome barriers to participation. METHODS: Data were generated in a hematological ward during 4 months of ethnographic fieldwork, including participant observation and 46...

  5. Pancreatic beta-cell responses to GLP-1 after near-normalization of blood glucose in patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Asmar, Meena; Højberg, Patricia V; Deacon, Carolyn F

    2010-01-01

    glucose (BG) using insulin (mean diurnal BG: 6.4+/-0.3 mmol/l; HbA(1)c: 6.6+/-0.3%). Nine matched healthy subjects acted as controls. In controls, area-under-curve (AUC) for amylin, C-peptide and proinsulin were higher with GLP-1 than saline (PAUC amylin/C-peptide ratio was similar on both......This study investigated the effects of strict glycaemic control on beta-cell function in nine obese subjects with type 2 diabetes (T2DM), using graded glucose infusions together with infusions of saline or GLP-1 before (HbA(1)c: 8.0+/-0.4%) and after four weeks of near-normalization of blood...... amylin/C-peptide ratios rose to control levels. Near-normoglycaemia tended to reduce AUC proinsulin/C-peptide ratio, which was significant (P=0.04) with GLP-1, but still higher than with saline (P=0.004). In conclusion, amylin, C-peptide and proinsulin responses to glucose were unaffected by four weeks...

  6. Pancreatic ß-cell responses to GLP-1 after near-normalization of blood glucose in patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Asmar, Meena; Højberg, Patricia; Deacon, Carolyn F.

    2010-01-01

    glucose (BG) using insulin (mean diurnal BG: 6.4+/-0.3 mmol/l; HbA(1)c: 6.6+/-0.3%). Nine matched healthy subjects acted as controls. In controls, area-under-curve (AUC) for amylin, C-peptide and proinsulin were higher with GLP-1 than saline (PAUC amylin/C-peptide ratio was similar on both......This study investigated the effects of strict glycaemic control on beta-cell function in nine obese subjects with type 2 diabetes (T2DM), using graded glucose infusions together with infusions of saline or GLP-1 before (HbA(1)c: 8.0+/-0.4%) and after four weeks of near-normalization of blood...... amylin/C-peptide ratios rose to control levels. Near-normoglycaemia tended to reduce AUC proinsulin/C-peptide ratio, which was significant (P=0.04) with GLP-1, but still higher than with saline (P=0.004). In conclusion, amylin, C-peptide and proinsulin responses to glucose were unaffected by four weeks...

  7. Plasma ceramide levels are altered in low and normal birth weight men in response to short-term high-fat overfeeding

    DEFF Research Database (Denmark)

    Ribel-Madsen, Amalie; Ribel-Madsen, Rasmus; Nielsen, Kristian Fog

    2018-01-01

    Low birth weight (LBW) individuals have an increased risk of developing insulin resistance and type 2 diabetes compared with normal birth weight (NBW) individuals. We hypothesised that LBW individuals exhibit an increased fatty acid flux into lipogenesis in non-adipose tissue with a resulting...... accumulation of lipotoxic lipids, including ceramides, in the blood. Therefore, we measured fasting plasma levels of 27 ceramides in 18 young, healthy, LBW men and 25 NBW controls after an isocaloric control diet and a 5-day high-fat, high-calorie diet by HPLC-HRMS. LBW men did not show elevated plasma......:0–18:1/d18:1–18:0 and d18:1–24:2/d18:2–24:1 levels and increased the d18:0–24:1a level in response to overfeeding. Plasma d18:0–24:1a and total ceramide levels were positively associated with the fasting blood glucose level and endogenous glucose production after the control diet, and the total ceramide...

  8. Role of Stroma-Derived Extracellular Matrix in Regulation of Growth and Hormonal Responsiveness of Normal and Cancerous Human Breast Epithelium

    National Research Council Canada - National Science Library

    Woodward, Terry

    1997-01-01

    Specific extracellular matrix (ECM) proteins and their cellular receptors (integrins) are required for normal mammary gland morphogenesis and differentiation, while their expression is dramatically altered during tumorigenesis...

  9. Targeted taste cell-specific overexpression of brain-derived neurotrophic factor in adult taste buds elevates phosphorylated TrkB protein levels in taste cells, increases taste bud size, and promotes gustatory innervation.

    Science.gov (United States)

    Nosrat, Irina V; Margolskee, Robert F; Nosrat, Christopher A

    2012-05-11

    Brain-derived neurotrophic factor (BDNF) is the most potent neurotrophic factor in the peripheral taste system during embryonic development. It is also expressed in adult taste buds. There is a lack of understanding of the role of BDNF in the adult taste system. To address this, we generated novel transgenic mice in which transgene expression was driven by an α-gustducin promoter coupling BDNF expression to the postnatal expression of gustducin in taste cells. Immunohistochemistry revealed significantly stronger BDNF labeling in taste cells of high BDNF-expressing mouse lines compared with controls. We show that taste buds in these mice are significantly larger and have a larger number of taste cells compared with controls. To examine whether innervation was affected in Gust-BDNF mice, we used antibodies to neural cell adhesion molecule (NCAM) and ATP receptor P2X3. The total density of general innervation and specifically the gustatory innervation was markedly increased in high BDNF-expressing mice compared with controls. TrkB and NCAM gene expression in laser capture microdissected taste epithelia were significantly up-regulated in these mice. Up-regulation of TrkB transcripts in taste buds and elevated taste cell-specific TrkB phosphorylation in response to increased BDNF levels indicate that BDNF controls the expression and activation of its high affinity receptor in taste cells. This demonstrates a direct taste cell function for BDNF. BDNF also orchestrates and maintains taste bud innervation. We propose that the Gust-BDNF transgenic mouse models can be employed to further dissect the specific roles of BDNF in the adult taste system.

  10. Non-invasive screening for Alzheimer's disease by sensing salivary sugar using Drosophila cells expressing gustatory receptor (Gr5a) immobilized on an extended gate ion-sensitive field-effect transistor (EG-ISFET) biosensor.

    Science.gov (United States)

    Lau, Hui-Chong; Lee, In-Kyu; Ko, Pan-Woo; Lee, Ho-Won; Huh, Jeung-Soo; Cho, Won-Ju; Lim, Jeong-Ok

    2015-01-01

    Body fluids are often used as specimens for medical diagnosis. With the advent of advanced analytical techniques in biotechnology, the diagnostic potential of saliva has been the focus of many studies. We recently reported the presence of excess salivary sugars, in patients with Alzheimer's disease (AD). In the present study, we developed a highly sensitive, cell-based biosensor to detect trehalose levels in patient saliva. The developed biosensor relies on the overexpression of sugar sensitive gustatory receptors (Gr5a) in Drosophila cells to detect the salivary trehalose. The cell-based biosensor was built on the foundation of an improved extended gate ion-sensitive field-effect transistor (EG-ISFET). Using an EG-ISFET, instead of a traditional ion-sensitive field-effect transistor (ISFET), resulted in an increase in the sensitivity and reliability of detection. The biosensor was designed with the gate terminals segregated from the conventional ISFET device. This design allows the construction of an independent reference and sensing region for simultaneous and accurate measurements of samples from controls and patients respectively. To investigate the efficacy of the cell-based biosensor for AD screening, we collected 20 saliva samples from each of the following groups: participants diagnosed with AD, participants diagnosed with Parkinson's disease (PD), and a control group composed of healthy individuals. We then studied the response generated from the interaction of the salivary trehalose of the saliva samples and the Gr5a in the immobilized cells on an EG-ISFET sensor. The cell-based biosensor significantly distinguished salivary sugar, trehalose of the AD group from the PD and control groups. Based on these findings, we propose that salivary trehalose, might be a potential biomarker for AD and could be detected using our cell-based EG-ISFET biosensor. The cell-based EG-ISFET biosensor provides a sensitive and direct approach for salivary sugar detection and

  11. Targeted Taste Cell-specific Overexpression of Brain-derived Neurotrophic Factor in Adult Taste Buds Elevates Phosphorylated TrkB Protein Levels in Taste Cells, Increases Taste Bud Size, and Promotes Gustatory Innervation*

    Science.gov (United States)

    Nosrat, Irina V.; Margolskee, Robert F.; Nosrat, Christopher A.

    2012-01-01

    Brain-derived neurotrophic factor (BDNF) is the most potent neurotrophic factor in the peripheral taste system during embryonic development. It is also expressed in adult taste buds. There is a lack of understanding of the role of BDNF in the adult taste system. To address this, we generated novel transgenic mice in which transgene expression was driven by an α-gustducin promoter coupling BDNF expression to the postnatal expression of gustducin in taste cells. Immunohistochemistry revealed significantly stronger BDNF labeling in taste cells of high BDNF-expressing mouse lines compared with controls. We show that taste buds in these mice are significantly larger and have a larger number of taste cells compared with controls. To examine whether innervation was affected in Gust-BDNF mice, we used antibodies to neural cell adhesion molecule (NCAM) and ATP receptor P2X3. The total density of general innervation and specifically the gustatory innervation was markedly increased in high BDNF-expressing mice compared with controls. TrkB and NCAM gene expression in laser capture microdissected taste epithelia were significantly up-regulated in these mice. Up-regulation of TrkB transcripts in taste buds and elevated taste cell-specific TrkB phosphorylation in response to increased BDNF levels indicate that BDNF controls the expression and activation of its high affinity receptor in taste cells. This demonstrates a direct taste cell function for BDNF. BDNF also orchestrates and maintains taste bud innervation. We propose that the Gust-BDNF transgenic mouse models can be employed to further dissect the specific roles of BDNF in the adult taste system. PMID:22442142

  12. Use of Sine Shaped High-Frequency Rhythmic Visual Stimuli Patterns for SSVEP Response Analysis and Fatigue Rate Evaluation in Normal Subjects.

    Science.gov (United States)

    Keihani, Ahmadreza; Shirzhiyan, Zahra; Farahi, Morteza; Shamsi, Elham; Mahnam, Amin; Makkiabadi, Bahador; Haidari, Mohsen R; Jafari, Amir H

    2018-01-01

    Background: Recent EEG-SSVEP signal based BCI studies have used high frequency square pulse visual stimuli to reduce subjective fatigue. However, the effect of total harmonic distortion (THD) has not been considered. Compared to CRT and LCD monitors, LED screen displays high-frequency wave with better refresh rate. In this study, we present high frequency sine wave simple and rhythmic patterns with low THD rate by LED to analyze SSVEP responses and evaluate subjective fatigue in normal subjects. Materials and Methods: We used patterns of 3-sequence high-frequency sine waves (25, 30, and 35 Hz) to design our visual stimuli. Nine stimuli patterns, 3 simple (repetition of each of above 3 frequencies e.g., P25-25-25) and 6 rhythmic (all of the frequencies in 6 different sequences e.g., P25-30-35) were chosen. A hardware setup with low THD rate ( 90% for CCA and LASSO (for TWs > 1 s). High frequency rhythmic patterns group with low THD rate showed higher accuracy rate (99.24%) than simple patterns group (98.48%). Repeated measure ANOVA showed significant difference between rhythmic pattern features ( P rhythmic [3.85 ± 2.13] compared to the simple patterns group [3.96 ± 2.21], ( P = 0.63). Rhythmic group had lower within group VAS variation (min = P25-30-35 [2.90 ± 2.45], max = P35-25-30 [4.81 ± 2.65]) as well as least individual pattern VAS (P25-30-35). Discussion and Conclusion: Overall, rhythmic and simple pattern groups had higher and similar accuracy rates. Rhythmic stimuli patterns showed insignificantly lower fatigue rate than simple patterns. We conclude that both rhythmic and simple visual high frequency sine wave stimuli require further research for human subject SSVEP-BCI studies.

  13. Neural responses to visual food stimuli after a normal vs. higher protein breakfast in breakfast-skipping teens: a pilot fMRI study.

    Science.gov (United States)

    Leidy, Heather J; Lepping, Rebecca J; Savage, Cary R; Harris, Corey T

    2011-10-01

    This functional magnetic resonance imaging (fMRI) pilot study identified whether breakfast consumption would alter the neural activity in brain regions associated with food motivation and reward in overweight "breakfast skipping" (BS) adolescent girls and examined whether increased protein at breakfast would lead to additional alterations. Ten girls (Age: 15 ± 1 years; BMI percentile 93 ± 1%; BS 5 ± 1×/week) completed 3 testing days. Following the BS day, the participants were provided with, in randomized order, normal protein (NP; 18 ± 1 g protein) or higher protein (HP; 50 ± 1 g protein) breakfast meals to consume at home for 6 days. On day 7 of each pattern, the participants came to the laboratory to consume their respective breakfast followed by appetite questionnaires and an fMRI brain scan to identify brain activation responses to viewing food vs. nonfood images prior to lunch. Breakfast consumption led to enduring (i.e., 3-h post breakfast) reductions in neural activation in the hippocampus, amygdala, cingulate, and parahippocampus vs. BS. HP led to enduring reductions in insula and middle prefrontal cortex activation vs. NP. Hippocampal, amygdala, cingulate, and insular activations were correlated with appetite and inversely correlated with satiety. In summary, the addition of breakfast led to alterations in brain activation in regions previously associated with food motivation and reward with additional alterations following the higher-protein breakfast. These data suggest that increased dietary protein at breakfast might be a beneficial strategy to reduce reward-driven eating behavior in overweight teen girls. Due to the small sample size, caution is warranted when interpreting these preliminary findings.

  14. Using the ovarian sensitivity index to define poor, normal, and high response after controlled ovarian hyperstimulation in the long gonadotropin-releasing hormone-agonist protocol: suggestions for a new principle to solve an old problem.

    Science.gov (United States)

    Huber, Malin; Hadziosmanovic, Nermin; Berglund, Lars; Holte, Jan

    2013-11-01

    To explore the utility of using the ratio between oocyte yield and total dose of FSH, i.e., the ovarian sensitivity index (OSI), to define ovarian response patterns. Retrospective cross-sectional study. University-affiliated private center. The entire unselected cohort of 7,520 IVF/intracytoplasmic sperm injection treatments (oocyte pick-ups [OPUs]) during an 8-year period (long GnRH agonist-recombinant FSH protocol). None. The distribution of the OSI (oocytes recovered × 1,000/total dose of FSH), the cutoff levels for poor and high response, set at ±1 SD, and the relationship between OSI and treatment outcome. OSI showed a log-normal distribution with cutoff levels for poor and high response at 1.697/IU and 10.07/IU, respectively. A nomogram is presented. Live-birth rates per OPU were 10.5 ± 0.1%, 26.9 ± 0.6%, and 36.0 ± 1.4% for poor, normal, and high response treatments, respectively. The predictive power (C-statistic) for OSI to predict live birth was superior to that of oocyte yield. The OSI improves the definition of ovarian response patterns because it takes into account the degree of stimulation. The nomogram presents evidence-based cutoff levels for poor, normal, and high response and could be used for unifying study designs involving ovarian response patterns. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  15. Using Animal Models to Determine the Role of Gustatory Neural Input in the Control of Ingestive Behavior and the Maintenance of Body Weight.

    Science.gov (United States)

    Ciullo, Dana L; Dotson, Cedrick D

    2015-08-01

    Decades of research have suggested that nutritional intake contributes to the development of human disease, mainly by influencing the development of obesity and obesity-related conditions. A relatively large body of research indicates that functional variation in human taste perception can influence nutritional intake as well as body mass accumulation. However, there are a considerable number of studies that suggest that no link between these variables actually exists. These discrepancies in the literature likely result from the confounding influence of a variety of other, uncontrolled, factors that can influence ingestive behavior. In this review, the use of controlled animal experimentation to alleviate at least some of these issues related to the lack of control of experimental variables is discussed. Specific examples of the use of some of these techniques are examined. The review will close with some specific suggestions aimed at strengthening the link between gustatory neural input and its putative influence on ingestive behaviors and the maintenance of body weight.

  16. River profile response to normal fault growth and linkage: an example from the Hellenic forearc of south-central Crete, Greece

    Science.gov (United States)

    Gallen, Sean F.; Wegmann, Karl W.

    2017-02-01

    Topography is a reflection of the tectonic and geodynamic processes that act to uplift the Earth's surface and the erosional processes that work to return it to base level. Numerous studies have shown that topography is a sensitive recorder of tectonic signals. A quasi-physical understanding of the relationship between river incision and rock uplift has made the analysis of fluvial topography a popular technique for deciphering relative, and some argue absolute, histories of rock uplift. Here we present results from a study of the fluvial topography from south-central Crete, demonstrating that river longitudinal profiles indeed record the relative history of uplift, but several other processes make it difficult to recover quantitative uplift histories. Prior research demonstrates that the south-central coastline of Crete is bound by a large ( ˜ 100 km long) E-W striking composite normal fault system. Marine terraces reveal that it is uplifting between 0.1 and 1.0 mm yr-1. These studies suggest that two normal fault systems, the offshore Ptolemy and onshore South-Central Crete faults, linked together in the recent geologic past (ca. 0.4-1 My BP). Fault mechanics predict that when adjacent faults link into a single fault the uplift rate in footwalls of the linkage zone will increase rapidly. We use this natural experiment to assess the response of river profiles to a temporal jump in uplift rate and to assess the applicability of the stream power incision model to this setting. Using river profile analysis we show that rivers in south-central Crete record the relative uplift history of fault growth and linkage as theory predicts that they should. Calibration of the commonly used stream power incision model shows that the slope exponent, n, is ˜ 0.5, contrary to most studies that find n ≥ 1. Analysis of fluvial knickpoints shows that migration distances are not proportional to upstream contributing drainage area, as predicted by the stream power incision model

  17. ERK1/2 activation in human taste bud cells regulates fatty acid signaling and gustatory perception of fat in mice and humans.

    Science.gov (United States)

    Subramaniam, Selvakumar; Ozdener, Mehmet Hakan; Abdoul-Azize, Souleymane; Saito, Katsuyoshi; Malik, Bilal; Maquart, Guillaume; Hashimoto, Toshihiro; Marambaud, Philippe; Aribi, Mourad; Tordoff, Michael G; Besnard, Philippe; Khan, Naim Akhtar

    2016-10-01

    Obesity is a major public health problem. An in-depth knowledge of the molecular mechanisms of oro-sensory detection of dietary lipids may help fight it. Humans and rodents can detect fatty acids via lipido-receptors, such as CD36 and GPR120. We studied the implication of the MAPK pathways, in particular, ERK1/2, in the gustatory detection of fatty acids. Linoleic acid, a dietary fatty acid, induced via CD36 the phosphorylation of MEK1/2-ERK1/2-ETS-like transcription factor-1 cascade, which requires Fyn-Src kinase and lipid rafts in human taste bud cells (TBCs). ERK1/2 cascade was activated by Ca 2+ signaling via opening of the calcium-homeostasis modulator-1 (CALHM1) channel. Furthermore, fatty acid-evoked Ca 2+ signaling and ERK1/2 phosphorylation were decreased in both human TBCs after small interfering RNA knockdown of CALHM1 channel and in TBCs from Calhm1 -/- mice. Targeted knockdown of ERK1/2 by small interfering RNA or PD0325901 (MEK1/2 inhibitor) in the tongue and genetic ablation of Erk1 or Calhm1 genes impaired preference for dietary fat in mice. Lingual inhibition of ERK1/2 in healthy volunteers also decreased orogustatory sensitivity for linoleic acid. Our data demonstrate that ERK1/2-MAPK cascade is regulated by the opening of CALHM1 Ca 2+ channel in TBCs to modulate orogustatory detection of dietary lipids in mice and humans.-Subramaniam, S., Ozdener, M. H., Abdoul-Azize, S., Saito, K., Malik, B., Maquart, G., Hashimoto, T., Marambaud, P., Aribi, M., Tordoff, M. G., Besnard, P., Khan, N. A. ERK1/2 activation in human taste bud cells regulates fatty acid signaling and gustatory perception of fat in mice and humans. © FASEB.

  18. Neural responsivity during soft drink intake, anticipation, and advertisement exposure in habitually consuming youth.

    Science.gov (United States)

    Burger, Kyle S; Stice, Eric

    2014-02-01

    Although soft drinks are heavily advertised, widely consumed, and have been associated with obesity, little is understood regarding neural responsivity to soft drink intake, anticipated intake, and advertisements. Functional MRI was used to assess examine neural response to carbonated soft drink intake, anticipated intake and advertisement exposure as well as milkshake intake in 27 adolescents that varied on soft drink consumer status. Intake and anticipated intake of carbonated Coke® activated regions implicated in gustatory, oral somatosensory, and reward processing, yet high-fat/sugar milkshake intake elicited greater activation in these regions vs. Coke intake. Advertisements highlighting the Coke product vs. nonfood control advertisements, but not the Coke logo, activated gustatory and visual brain regions. Habitual Coke consumers vs. nonconsumers showed greater posterior cingulate responsivity to Coke logo ads, suggesting that the logo is a conditioned cue. Coke consumers exhibited less ventrolateral prefrontal cortex responsivity during anticipated Coke intake relative to nonconsumers. Results indicate that soft drinks activate reward and gustatory regions, but are less potent in activating these regions than high-fat/sugar beverages, and imply that habitual soft drink intake promotes hyper-responsivity of regions encoding salience/attention toward brand specific cues and hypo-responsivity of inhibitory regions while anticipating intake. Copyright © 2013 The Obesity Society.

  19. Neural responsivity during soft drink intake, anticipation, and advertisement exposure in habitually consuming youth

    Science.gov (United States)

    Burger, Kyle S.; Stice, Eric

    2014-01-01

    OBJECTIVE Although soft drinks are heavily advertised, widely consumed, and have been associated with obesity, little is understood regarding neural responsivity to soft drink intake, anticipated intake, and advertisements. METHODS Functional MRI was used to assess examine neural response to carbonated soft drink intake, anticipated intake and advertisement exposure as well as milkshake intake in 27 adolescents that varied on soft drink consumer status. RESULTS Intake and anticipated intake of carbonated Coke® activated regions implicated in gustatory, oral somatosensory, and reward processing, yet high-fat/sugar milkshake intake elicited greater activation in these regions versus Coke intake. Advertisements highlighting the Coke product vs. non-food control advertisements, but not the Coke logo, activated gustatory and visual brain regions. Habitual Coke consumers vs. non-consumers showed greater posterior cingulate responsivity to Coke logo ads, suggesting that the logo is a conditioned cue. Coke consumers exhibited less ventrolateral prefrontal cortex responsivity during anticipated Coke intake relative to non-consumers. CONCLUSIONS Results indicate that soft drinks activate reward and gustatory regions, but are less potent in activating these regions than high-fat/sugar beverages, and imply that habitual soft drink intake promotes hyper-responsivity of regions encoding salience/attention toward brand specific cues and hypo-responsivity of inhibitory regions while anticipating intake. PMID:23836764

  20. Hair-Normalized Cortisol Waking Response as a Novel Biomarker of Hypothalamic-Pituitary-Adrenal Axis Activity following Acute Trauma: A Proof-of-Concept Study with Pilot Results

    Directory of Open Access Journals (Sweden)

    David M. Walton

    2013-01-01

    Full Text Available The mechanisms underlying the development of persistent posttraumatic pain and disability remain elusive. Recent evidence suggests that disordered stress-system pathway (hypothalamic-pituitary-adrenal axis activity may be responsible for the genesis and maintenance of long-term sensory and emotional problems. However, confidence in current evidence is limited by the necessarily retrospective collection of data. Hair cortisol can serve as a calendar of HPA axis activity going back several months prior to injury. The purposes of this pilot study were to determine the feasibility of using hair cortisol and hair-normalized salivary cortisol as biomarkers of distress following traumatic injuries of whiplash or distal radius fracture. Ten subjects provided complete data within 3 weeks of injury. Hair cortisol, cortisol waking response (CWR, and mean daily cortisol (MDC were captured at inception, as were self-report indicators of pain, disability, and pain catastrophizing. Pain and disability were also captured 3 months after injury. Results indicate that cortisol waking response may be a useful biomarker of current distress as measured using the pain catastrophizing scale, especially when normalized to 3-month hair cortisol (r=0.77 raw, 0.93 normalized. Hair-normalized CWR may also have predictive capacity, correlating with 3-month self-reported disability at r=0.70. While promising, the results must be viewed in light of the small sample.

  1. Muscle inflammatory signaling in response to 9 days of physical inactivity in young men with low compared to normal birth weight

    DEFF Research Database (Denmark)

    Friedrichsen, Martin; Ribel-Madsen, Rasmus; Mortensen, Brynjulf

    2012-01-01

    OBJECTIVE: The molecular mechanisms linking physical inactivity and muscle insulin resistance in humans has been suggested to include increased muscle inflammation, possibly associated with impaired oxidative metabolism. We employed a human bed rest study including 20 young males with normal birth...

  2. RNA-sequence data normalization through in silico prediction of reference genes: the bacterial response to DNA damage as case study.

    Science.gov (United States)

    Berghoff, Bork A; Karlsson, Torgny; Källman, Thomas; Wagner, E Gerhart H; Grabherr, Manfred G

    2017-01-01

    Measuring how gene expression changes in the course of an experiment assesses how an organism responds on a molecular level. Sequencing of RNA molecules, and their subsequent quantification, aims to assess global gene expression changes on the RNA level (transcriptome). While advances in high-throughput RNA-sequencing (RNA-seq) technologies allow for inexpensive data generation, accurate post-processing and normalization across samples is required to eliminate any systematic noise introduced by the biochemical and/or technical processes. Existing methods thus either normalize on selected known reference genes that are invariant in expression across the experiment, assume that the majority of genes are invariant, or that the effects of up- and down-regulated genes cancel each other out during the normalization. Here, we present a novel method, moose 2 , which predicts invariant genes in silico through a dynamic programming (DP) scheme and applies a quadratic normalization based on this subset. The method allows for specifying a set of known or experimentally validated invariant genes, which guides the DP. We experimentally verified the predictions of this method in the bacterium Escherichia coli , and show how moose 2 is able to (i) estimate the expression value distances between RNA-seq samples, (ii) reduce the variation of expression values across all samples, and (iii) to subsequently reveal new functional groups of genes during the late stages of DNA damage. We further applied the method to three eukaryotic data sets, on which its performance compares favourably to other methods. The software is implemented in C++ and is publicly available from http://grabherr.github.io/moose2/. The proposed RNA-seq normalization method, moose 2 , is a valuable alternative to existing methods, with two major advantages: (i) in silico prediction of invariant genes provides a list of potential reference genes for downstream analyses, and (ii) non-linear artefacts in RNA-seq data

  3. Genome Wide Evaluation of Normal Human Tissue in Response to Controlled, In vivo Low-Dose Low LET Ionizing Radiation Exposure: Pathways and Mechanisms Final Report, September 2013

    Energy Technology Data Exchange (ETDEWEB)

    Rocke, David M. [University of California Davis

    2013-09-09

    During course of this project, we have worked in several areas relevant to low-dose ionizing radiation. Using gene expression to measure biological response, we have examined the response of human skin exposed in-vivo to radation, human skin exposed ex-vivo to radiation, and a human-skin model exposed to radiation. We have learned a great deal about the biological response of human skin to low-dose ionizing radiation.

  4. Differential post-irradiation caffeine response in normal diploid versus SV40-transformed human fibroblasts: potential role of nuclear organization and protein-composition

    International Nuclear Information System (INIS)

    Taylor, Y.C.; Parsian, A.J.; Duncan, P.G.

    1993-01-01

    To test the hypothesis that the enhancement of cell killing by post-irradiation treatment with caffeine (CAF) is mediated by alterations in chromatin structure, several nuclear parameters were examined in both caffeine-responsive and non-responsive cell lines. (author)

  5. Differential post-irradiation caffeine response in normal diploid versus SV40-transformed human fibroblasts: potential role of nuclear organization and protein-composition

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Y.C.; Parsian, A.J.; Duncan, P.G. (Washington Univ., St. Louis, MO (United States). School of Medicine)

    1993-07-01

    To test the hypothesis that the enhancement of cell killing by post-irradiation treatment with caffeine (CAF) is mediated by alterations in chromatin structure, several nuclear parameters were examined in both caffeine-responsive and non-responsive cell lines. (author).

  6. Ontogeny of thymic independent antibody responses in vitro in normal mice and mice with an x-linked B cell defect

    Energy Technology Data Exchange (ETDEWEB)

    Mosier, D.E.; Mond, J.J.; Goldings, E.A.

    1977-12-01

    The primary in vitro antibody response of neonatal spleen cells to three thymic independent antigens has been examined. The time of onset of responsiveness to TNP-Brucella abortus and TNP-lipopolysaccharide was significantly earlier than the onset of responsiveness to TNP-Ficoll. This ontologic sequence was not affected by T cell depletion or antigen presentation on adult macrophages. In neonatal mice bearing the X-linked CBA/N defect, the response to TNP-Brucella abortus and TNP-lipopolysaccharide was much delayed and no response to TNP-Ficoll developed. We conclude that different thymic independent antigens address different subpopulations of B cells, one of which appears earlier in ontogeny than the other.

  7. Ontogeny of thymic independent antibody responses in vitro in normal mice and mice with an x-linked B cell defect

    International Nuclear Information System (INIS)

    Mosier, D.E.; Mond, J.J.; Goldings, E.A.

    1977-01-01

    The primary in vitro antibody response of neonatal spleen cells to three thymic independent antigens has been examined. The time of onset of responsiveness to TNP-Brucella abortus and TNP-lipopolysaccharide was significantly earlier than the onset of responsiveness to TNP-Ficoll. This ontologic sequence was not affected by T cell depletion or antigen presentation on adult macrophages. In neonatal mice bearing the X-linked CBA/N defect, the response to TNP-Brucella abortus and TNP-lipopolysaccharide was much delayed and no response to TNP-Ficoll developed. We conclude that different thymic independent antigens address different subpopulations of B cells, one of which appears earlier in ontogeny than the other

  8. Extracting the normal lung dose–response curve from clinical DVH data: a possible role for low dose hyper-radiosensitivity, increased radioresistance

    International Nuclear Information System (INIS)

    Gordon, J J; Snyder, K; Zhong, H; Barton, K; Sun, Z; Chetty, I J; Matuszak, M; Ten Haken, R K

    2015-01-01

    In conventionally fractionated radiation therapy for lung cancer, radiation pneumonitis’ (RP) dependence on the normal lung dose-volume histogram (DVH) is not well understood. Complication models alternatively make RP a function of a summary statistic, such as mean lung dose (MLD). This work searches over damage profiles, which quantify sub-volume damage as a function of dose. Profiles that achieve best RP predictive accuracy on a clinical dataset are hypothesized to approximate DVH dependence.Step function damage rate profiles R(D) are generated, having discrete steps at several dose points. A range of profiles is sampled by varying the step heights and dose point locations. Normal lung damage is the integral of R(D) with the cumulative DVH. Each profile is used in conjunction with a damage cutoff to predict grade 2 plus (G2+) RP for DVHs from a University of Michigan clinical trial dataset consisting of 89 CFRT patients, of which 17 were diagnosed with G2+ RP.Optimal profiles achieve a modest increase in predictive accuracy—erroneous RP predictions are reduced from 11 (using MLD) to 8. A novel result is that optimal profiles have a similar distinctive shape: enhanced damage contribution from low doses (<20 Gy), a flat contribution from doses in the range ∼20–40 Gy, then a further enhanced contribution from doses above 40 Gy. These features resemble the hyper-radiosensitivity / increased radioresistance (HRS/IRR) observed in some cell survival curves, which can be modeled using Joiner’s induced repair model.A novel search strategy is employed, which has the potential to estimate RP dependence on the normal lung DVH. When applied to a clinical dataset, identified profiles share a characteristic shape, which resembles HRS/IRR. This suggests that normal lung may have enhanced sensitivity to low doses, and that this sensitivity can affect RP risk. (paper)

  9. Normal Pressure Hydrocephalus (NPH)

    Science.gov (United States)

    ... local chapter Join our online community Normal Pressure Hydrocephalus (NPH) Normal pressure hydrocephalus is a brain disorder ... Symptoms Diagnosis Causes & risks Treatments About Normal Pressure Hydrocephalus Normal pressure hydrocephalus occurs when excess cerebrospinal fluid ...

  10. Test-retest repeatability of the pupil light response to blue and red light stimuli in normal human eyes using a novel pupillometer

    DEFF Research Database (Denmark)

    Herbst, Kristina; Sander, Birgit; Milea, Dan

    2011-01-01

    In this study, we evaluated the repeatability of pupil responses to colored light stimuli in healthy subjects using a prototype chromatic pupillometer. One eye of 10 healthy subjects was tested twice in the same day using monochromatic light exposure at two selected wavelengths (660 and 470 nm......, we have developed a novel prototype of color pupillometer which demonstrates good repeatability in evoking and recording the pupillary response to a bright blue and red light stimulus....

  11. Test-retest repeatability of the pupil light response to blue and red light stimuli in normal human eyes using a novel pupillometer

    DEFF Research Database (Denmark)

    Herbst, Kristina; Sander, Birgit; Milea, Dan

    2011-01-01

    In this study, we evaluated the repeatability of pupil responses to colored light stimuli in healthy subjects using a prototype chromatic pupillometer. One eye of 10 healthy subjects was tested twice in the same day using monochromatic light exposure at two selected wavelengths (660 and 470¿nm......, we have developed a novel prototype of color pupillometer which demonstrates good repeatability in evoking and recording the pupillary response to a bright blue and red light stimulus....

  12. AKAP13 Rho-GEF and PKD-binding domain deficient mice develop normally but have an abnormal response to β-adrenergic-induced cardiac hypertrophy.

    Directory of Open Access Journals (Sweden)

    Matthew J Spindler

    Full Text Available A-kinase anchoring proteins (AKAPs are scaffolding molecules that coordinate and integrate G-protein signaling events to regulate development, physiology, and disease. One family member, AKAP13, encodes for multiple protein isoforms that contain binding sites for protein kinase A (PKA and D (PKD and an active Rho-guanine nucleotide exchange factor (Rho-GEF domain. In mice, AKAP13 is required for development as null embryos die by embryonic day 10.5 with cardiovascular phenotypes. Additionally, the AKAP13 Rho-GEF and PKD-binding domains mediate cardiomyocyte hypertrophy in cell culture. However, the requirements for the Rho-GEF and PKD-binding domains during development and cardiac hypertrophy are unknown.To determine if these AKAP13 protein domains are required for development, we used gene-trap events to create mutant mice that lacked the Rho-GEF and/or the protein kinase D-binding domains. Surprisingly, heterozygous matings produced mutant mice at Mendelian ratios that had normal viability and fertility. The adult mutant mice also had normal cardiac structure and electrocardiograms. To determine the role of these domains during β-adrenergic-induced cardiac hypertrophy, we stressed the mice with isoproterenol. We found that heart size was increased similarly in mice lacking the Rho-GEF and PKD-binding domains and wild-type controls. However, the mutant hearts had abnormal cardiac contractility as measured by fractional shortening and ejection fraction.These results indicate that the Rho-GEF and PKD-binding domains of AKAP13 are not required for mouse development, normal cardiac architecture, or β-adrenergic-induced cardiac hypertrophic remodeling. However, these domains regulate aspects of β-adrenergic-induced cardiac hypertrophy.

  13. A loss-of-function mutation in the nucleoporin AtNUP160 indicates that normal auxin signalling is required for a proper ethylene response in Arabidopsis

    Science.gov (United States)

    Robles, Linda M.; Deslauriers, Stephen D.; Alvarez, Ashley A.; Larsen, Paul B.

    2012-01-01

    As part of a continuing effort to elucidate mechanisms that regulate the magnitude of ethylene signalling, an Arabidopsis mutant with an enhanced ethylene response was identified. Subsequent characterization of this loss-of-function mutant revealed severe hypocotyl shortening in the presence of saturating ethylene along with increased expression in leaves of a subset of ethylene-responsive genes. It was subsequently determined by map-based cloning that the mutant (sar1-7) represents a loss-of-function mutation in the previously described nucleoporin AtNUP160 (At1g33410, SAR1). In support of previously reported results, the sar1-7 mutant partially restored auxin responsiveness to roots of an rce1 loss-of-function mutant, indicating that AtNUP160/SAR1 is required for proper expression of factors responsible for the repression of auxin signalling. Analysis of arf7-1/sar1-7 and arf19-1/sar1-7 double mutants revealed that mutations affecting either ARF7 or ARF19 function almost fully blocked manifestation of the sar1-7-dependent ethylene hypersensitivity phenotype, suggesting that ARF7- and ARF19-mediated auxin signalling is responsible for regulating the magnitude of and/or competence for the ethylene response in Arabidopsis etiolated hypocotyls. Consistent with this, addition of auxin to ethylene-treated seedlings resulted in severe hypocotyl shortening, reminiscent of that seen for other eer (enhanced ethylene response) mutants, suggesting that auxin functions in part synergistically with ethylene to control hypocotyl elongation and other ethylene-dependent phenomena. PMID:22238449

  14. Test-retest repeatability of the pupil light response to blue and red light stimuli in normal human eyes using a novel pupillometer

    Directory of Open Access Journals (Sweden)

    Kristina eHerbst

    2011-02-01

    Full Text Available In this study, we evaluated the repeatability of pupil responses to colored light stimuli in healthy subjects using a prototype chromatic pupillometer. One eye of 10 healthy subjects was tested twice in the same day using monochromatic light exposure at 2 selected wavelengths (660 nm and 470 nm, intensity 300 cd/m2 presented continuously for 20 seconds. Pupil responses were recorded in real time before, during and after light exposure. Maximal contraction amplitude and sustained contraction amplitude were calculated. In addition, we quantified the summed pupil response during continuous light stimulation as the total area between a reference line representing baseline pupil size and the line representing actual pupil size over 20 seconds (area under the curve. There was no significant difference in the repeated measure compared to the first test for any of the pupil response parameters. In conclusion, we have developed a novel prototype of color pupillometer which demonstrates good repeatability in evoking and recording the pupillary response to a bright blue and red light stimulus.

  15. Non-invasive screening for Alzheimer's disease by sensing salivary sugar using Drosophila cells expressing gustatory receptor (Gr5a immobilized on an extended gate ion-sensitive field-effect transistor (EG-ISFET biosensor.

    Directory of Open Access Journals (Sweden)

    Hui-Chong Lau

    Full Text Available Body fluids are often used as specimens for medical diagnosis. With the advent of advanced analytical techniques in biotechnology, the diagnostic potential of saliva has been the focus of many studies. We recently reported the presence of excess salivary sugars, in patients with Alzheimer's disease (AD. In the present study, we developed a highly sensitive, cell-based biosensor to detect trehalose levels in patient saliva. The developed biosensor relies on the overexpression of sugar sensitive gustatory receptors (Gr5a in Drosophila cells to detect the salivary trehalose. The cell-based biosensor was built on the foundation of an improved extended gate ion-sensitive field-effect transistor (EG-ISFET. Using an EG-ISFET, instead of a traditional ion-sensitive field-effect transistor (ISFET, resulted in an increase in the sensitivity and reliability of detection. The biosensor was designed with the gate terminals segregated from the conventional ISFET device. This design allows the construction of an independent reference and sensing region for simultaneous and accurate measurements of samples from controls and patients respectively. To investigate the efficacy of the cell-based biosensor for AD screening, we collected 20 saliva samples from each of the following groups: participants diagnosed with AD, participants diagnosed with Parkinson's disease (PD, and a control group composed of healthy individuals. We then studied the response generated from the interaction of the salivary trehalose of the saliva samples and the Gr5a in the immobilized cells on an EG-ISFET sensor. The cell-based biosensor significantly distinguished salivary sugar, trehalose of the AD group from the PD and control groups. Based on these findings, we propose that salivary trehalose, might be a potential biomarker for AD and could be detected using our cell-based EG-ISFET biosensor. The cell-based EG-ISFET biosensor provides a sensitive and direct approach for salivary sugar

  16. Ethics and "normal birth".

    Science.gov (United States)

    Lyerly, Anne Drapkin

    2012-12-01

    The concept of "normal birth" has been promoted as ideal by several international organizations, although debate about its meaning is ongoing. In this article, I examine the concept of normalcy to explore its ethical implications and raise a trio of concerns. First, in its emphasis on nonuse of technology as a goal, the concept of normalcy may marginalize women for whom medical intervention is necessary or beneficial. Second, in its emphasis on birth as a socially meaningful event, the mantra of normalcy may unintentionally avert attention to meaning in medically complicated births. Third, the emphasis on birth as a normal and healthy event may be a contributor to the long-standing tolerance for the dearth of evidence guiding the treatment of illness during pregnancy and the failure to responsibly and productively engage pregnant women in health research. Given these concerns, it is worth debating not just what "normal birth" means, but whether the term as an ideal earns its keep. © 2012, Copyright the Authors Journal compilation © 2012, Wiley Periodicals, Inc.

  17. Visual-gustatory interaction: orbitofrontal and insular cortices mediate the effect of high-calorie visual food cues on taste pleasantness.

    Science.gov (United States)

    Ohla, Kathrin; Toepel, Ulrike; le Coutre, Johannes; Hudry, Julie

    2012-01-01

    Vision provides a primary sensory input for food perception. It raises expectations on taste and nutritional value and drives acceptance or rejection. So far, the impact of visual food cues varying in energy content on subsequent taste integration remains unexplored. Using electrical neuroimaging, we assessed whether high- and low-calorie food cues differentially influence the brain processing and perception of a subsequent neutral electric taste. When viewing high-calorie food images, participants reported the subsequent taste to be more pleasant than when low-calorie food images preceded the identical taste. Moreover, the taste-evoked neural activity was stronger in the bilateral insula and the adjacent frontal operculum (FOP) within 100 ms after taste onset when preceded by high- versus low-calorie cues. A similar pattern evolved in the anterior cingulate (ACC) and medial orbitofrontal cortex (OFC) around 180 ms, as well as, in the right insula, around 360 ms. The activation differences in the OFC correlated positively with changes in taste pleasantness, a finding that is an accord with the role of the OFC in the hedonic evaluation of taste. Later activation differences in the right insula likely indicate revaluation of interoceptive taste awareness. Our findings reveal previously unknown mechanisms of cross-modal, visual-gustatory, sensory interactions underlying food evaluation.

  18. Oro-gustatory perception of dietary lipids and calcium signaling in taste bud cells are altered in nutritionally obesity-prone Psammomys obesus.

    Science.gov (United States)

    Abdoul-Azize, Souleymane; Atek-Mebarki, Feriel; Bitam, Arezki; Sadou, Hassimi; Koceïr, Elhadj Ahmed; Khan, Naim Akhtar

    2013-01-01

    Since the increasing prevalence of obesity is one of the major health problems of the modern era, understanding the mechanisms of oro-gustatory detection of dietary fat is critical for the prevention and treatment of obesity. We have conducted the present study on Psammomys obesus, the rodent desert gerbil which is a unique polygenic natural animal model of obesity. Our results show that obese animals exhibit a strong preference for lipid solutions in a two-bottle test. Interestingly, the expression of CD36, a lipido-receptor, in taste buds cells (TBC), isolated from circumvallate papillae, was decreased at mRNA level, but remained unaltered at protein level, in obese animals. We further studied the effects of linoleic acid (LA), a long-chain fatty acid, on the increases in free intracellular calcium (Ca(2+)) concentrations, [Ca(2+)]i, in the TBC of P. obesus. LA induced increases in [Ca(2+)]i, largely via CD36, from intracellular pool, followed by the opening of store-operated Ca(2+) (SOC) channels in the TBC of these animals. The action of this fatty acid on the increases in [Ca(2+)]i was higher in obese animals than that in controls. However, the release of Ca(2+) from intracellular stores, studied also by employing thapsigargin, was lower in TBC of obese animals than control rodents. In this study, we show, for the first time, that increased lipid intake and altered Ca(2+) signaling in TBC are associated with obesity in Psammomys obesus.

  19. Oro-gustatory perception of dietary lipids and calcium signaling in taste bud cells are altered in nutritionally obesity-prone Psammomys obesus.

    Directory of Open Access Journals (Sweden)

    Souleymane Abdoul-Azize

    Full Text Available Since the increasing prevalence of obesity is one of the major health problems of the modern era, understanding the mechanisms of oro-gustatory detection of dietary fat is critical for the prevention and treatment of obesity. We have conducted the present study on Psammomys obesus, the rodent desert gerbil which is a unique polygenic natural animal model of obesity. Our results show that obese animals exhibit a strong preference for lipid solutions in a two-bottle test. Interestingly, the expression of CD36, a lipido-receptor, in taste buds cells (TBC, isolated from circumvallate papillae, was decreased at mRNA level, but remained unaltered at protein level, in obese animals. We further studied the effects of linoleic acid (LA, a long-chain fatty acid, on the increases in free intracellular calcium (Ca(2+ concentrations, [Ca(2+]i, in the TBC of P. obesus. LA induced increases in [Ca(2+]i, largely via CD36, from intracellular pool, followed by the opening of store-operated Ca(2+ (SOC channels in the TBC of these animals. The action of this fatty acid on the increases in [Ca(2+]i was higher in obese animals than that in controls. However, the release of Ca(2+ from intracellular stores, studied also by employing thapsigargin, was lower in TBC of obese animals than control rodents. In this study, we show, for the first time, that increased lipid intake and altered Ca(2+ signaling in TBC are associated with obesity in Psammomys obesus.

  20. Normalization: A Preprocessing Stage

    OpenAIRE

    Patro, S. Gopal Krishna; Sahu, Kishore Kumar

    2015-01-01

    As we know that the normalization is a pre-processing stage of any type problem statement. Especially normalization takes important role in the field of soft computing, cloud computing etc. for manipulation of data like scale down or scale up the range of data before it becomes used for further stage. There are so many normalization techniques are there namely Min-Max normalization, Z-score normalization and Decimal scaling normalization. So by referring these normalization techniques we are ...

  1. NAD+ supplementation normalizes key Alzheimer’s features and DNA damage responses in a new AD mouse model with introduced DNA repair deficiency

    DEFF Research Database (Denmark)

    Hou, Yujun; Lautrup, Sofie; Cordonnier, Stephanie

    2018-01-01

    including phosphorylated Tau (pTau) pathologies, synaptic dysfunction, neuronal death, and cognitive impairment. Here we report that 3xTgAD/Polβ+/− mice have a reduced cerebral NAD+/NADH ratio indicating impaired cerebral energy metabolism, which is normalized by nicotinamide riboside (NR) treatment. NR...... function in multiple behavioral tests and restored hippocampal synaptic plasticity in 3xTgAD mice and 3xTgAD/Polβ+/− mice. In general, the deficits between genotypes and the benefits of NR were greater in 3xTgAD/Polβ+/− mice than in 3xTgAD mice. Our findings suggest a pivotal role for cellular NAD......+ depletion upstream of neuroinflammation, pTau, DNA damage, synaptic dysfunction, and neuronal degeneration in AD. Interventions that bolster neuronal NAD+ levels therefore have therapeutic potential for AD....

  2. Blood leukocyte responses to extracorporeal circulation. 2. Medium term extracorporeal circulation without and with extracorporeal irradiation in normal and splenectomized dogs

    Energy Technology Data Exchange (ETDEWEB)

    Szemere, P.; Fliedner, T.M. (Ulm Univ. (Germany, F.R.). Abt. Klinische Physiologie)

    1983-01-01

    Medium term (6-8 h) extracorporeal irradiation without and with irradiation of blood was performed in normal and splenectomized dogs to reveal the changes of blood leukocytes including CFU-C. A regular but transitory decrease of granulocytes and a longer lasting diminution of lymphocytes in the blood were observed. The CFU-C level became and mostly remained very low during the procedure. Splenectomy did not influence significantly the changes of peripheral leukocyte counts. No marked difference of leukocytes was seen in the blood samples taken from the arterial or venous side of the shunt or even from the cubital vein. Also, the irradiation did not produce any difference in the alterations of blood cell counts compared to those without irradiation. The possible explanations of these results are discussed.

  3. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.

    1987-01-01

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  4. Group normalization for genomic data.

    Science.gov (United States)

    Ghandi, Mahmoud; Beer, Michael A

    2012-01-01

    Data normalization is a crucial preliminary step in analyzing genomic datasets. The goal of normalization is to remove global variation to make readings across different experiments comparable. In addition, most genomic loci have non-uniform sensitivity to any given assay because of variation in local sequence properties. In microarray experiments, this non-uniform sensitivity is due to different DNA hybridization and cross-hybridization efficiencies, known as the probe effect. In this paper we introduce a new scheme, called Group Normalization (GN), to remove both global and local biases in one integrated step, whereby we determine the normalized probe signal by finding a set of reference probes with similar responses. Compared to conventional normalization methods such as Quantile normalization and physically motivated probe effect models, our proposed method is general in the sense that it does not require the assumption that the underlying signal distribution be identical for the treatment and control, and is flexible enough to correct for nonlinear and higher order probe effects. The Group Normalization algorithm is computationally efficient and easy to implement. We also describe a variant of the Group Normalization algorithm, called Cross Normalization, which efficiently amplifies biologically relevant differences between any two genomic datasets.

  5. Group normalization for genomic data.

    Directory of Open Access Journals (Sweden)

    Mahmoud Ghandi

    Full Text Available Data normalization is a crucial preliminary step in analyzing genomic datasets. The goal of normalization is to remove global variation to make readings across different experiments comparable. In addition, most genomic loci have non-uniform sensitivity to any given assay because of variation in local sequence properties. In microarray experiments, this non-uniform sensitivity is due to different DNA hybridization and cross-hybridization efficiencies, known as the probe effect. In this paper we introduce a new scheme, called Group Normalization (GN, to remove both global and local biases in one integrated step, whereby we determine the normalized probe signal by finding a set of reference probes with similar responses. Compared to conventional normalization methods such as Quantile normalization and physically motivated probe effect models, our proposed method is general in the sense that it does not require the assumption that the underlying signal distribution be identical for the treatment and control, and is flexible enough to correct for nonlinear and higher order probe effects. The Group Normalization algorithm is computationally efficient and easy to implement. We also describe a variant of the Group Normalization algorithm, called Cross Normalization, which efficiently amplifies biologically relevant differences between any two genomic datasets.

  6. Regular activity breaks combined with physical activity improve postprandial plasma triglyceride, nonesterified fatty acid, and insulin responses in healthy, normal weight adults: A randomized crossover trial.

    Science.gov (United States)

    Homer, Ashleigh R; Fenemor, Stephen P; Perry, Tracy L; Rehrer, Nancy J; Cameron, Claire M; Skeaff, C Murray; Peddie, Meredith C

    Compared with prolonged sitting, regular activity breaks immediately lower postprandial glucose and insulin, but not triglyceride responses. Postprandial triglycerides can be lowered by physical activity but the effect is often delayed by ∼12 to 24 hours. The objective of the study was to determine whether regular activity breaks affect postprandial triglyceride response in a delayed manner similar to physical activity. In a randomized crossover trial, 36 adults (body mass index 23.9 kg/m 2 [standard deviation 3.9]) completed four 2-day interventions: (1) prolonged sitting (SIT); (2) prolonged sitting with 30 minutes of continuous walking (60% VO 2max ), at the end of Day 1 (SIT + PA D1 ); (3) Sitting with 2 minutes of walking (60% VO 2max ) every 30 minutes (RAB); (4) A combination of the continuous walking and regular activity breaks in 2 and 3 above (RAB + PA D1 ). Postprandial plasma triglyceride, nonesterified fatty acids, glucose, and insulin responses were measured in venous blood over 5 hours on Day 2. Compared with SIT, both RAB (difference: -43.61 mg/dL·5 hours; 95% confidence interval [CI] -83.66 to -2.67; P = .035) and RAB + PA D1 (-65.86 mg/dL·5 hours; 95% CI -112.14 to -19.58; P = .005) attenuated triglyceride total area under the curve (tAUC). RAB + PA D1 produced the greatest reductions in insulin tAUC (-23%; 95% CI -12% to -31%; P glucose tAUC (P = .290). Postprandial triglyceride response is attenuated by regular activity breaks, when measured ∼24 hours after breaks begin. Combining regular activity breaks with 30 minutes of continuous walking further improves insulinemic and lipidemic responses. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  7. SU-F-T-681: Does the Biophysical Modeling for Immunological Aspects in Radiotherapy Precisely Predict Tumor and Normal Tissue Responses?

    Energy Technology Data Exchange (ETDEWEB)

    Oita, M [Graduate School of Health Sciences, Okayama University, Okayama, Okayama (Japan); Nakata, K [Tokyo University of Science, Noda, Chiba (Japan); Sasaki, M [Tokushima University Hospital, Tokushima, Tokushima (Japan); Tominaga, M [Tokushima University Graduate School, Tokushima, Tokushima (Japan); Aoyama, H [Okayama University Hospital, Okayama, Okayama (Japan); Honda, H [Ehime University Hospital, Tohon, Ehime (Japan); Uto, Y [Tokushima University, Tokushima, Tokushima (Japan)

    2016-06-15

    Purpose: Recent advances in immunotherapy make possible to combine with radiotherapy. The aim of this study was to assess the TCP/NTCP model with immunological aspects including stochastic distribution as intercellular uncertainties. Methods: In the clinical treatment planning system (Eclipse ver.11.0, Varian medical systems, US), biological parameters such as α/β, D50, γ, n, m, TD50 including repair parameters (bi-exponential repair) can be set as any given values to calculate the TCP/NTCP. Using a prostate cancer patient data with VMAT commissioned as a 6-MV photon beam of Novalis-Tx (BrainLab, US) in clinical use, the fraction schedule were hypothesized as 70–78Gy/35–39fr, 72–81Gy/40–45fr, 52.5–66Gy/16–22fr, 35–40Gy/5fr of 5–7 fractions in a week. By use of stochastic biological model applying for Gaussian distribution, the effects of the TCP/NTCP variation of repair parameters of the immune system as well as the intercellular uncertainty of tumor and normal tissues have been evaluated. Results: As respect to the difference of the α/β, the changes of the TCP/NTCP were increased in hypo-fraction regimens. The difference between the values of n and m affect the variation of the NTCP with the fraction schedules, independently. The elongation of repair half-time (long) increased the TCP/NTCP twice or much higher in the case of hypo-fraction scheme. For tumor, the repopulation parameters such as Tpot and Tstart, which is immunologically working to the tumor, improved TCP. Conclusion: Compared to default fixed value, which has affected by the probability of cell death and cure, hypo-fractionation schemes seemed to have advantages for the variations of the values of m. The possibility of an increase of the α/β or TD50 and repair parameters in tumor and normal tissue by immunological aspects were highly expected. For more precise prediction, treatment planning systems should be incorporated the complicated biological optimization in clinical

  8. Spatiotemporal changes of normalized difference vegetation index (NDVI) and response to climate extremes and ecological restoration in the Loess Plateau, China

    Science.gov (United States)

    Zhao, Anzhou; Zhang, Anbing; Liu, Xianfeng; Cao, Sen

    2018-04-01

    Extreme drought, precipitation, and other extreme climatic events often have impacts on vegetation. Based on meteorological data from 52 stations in the Loess Plateau (LP) and a satellite-derived normalized difference vegetation index (NDVI) from the third-generation Global Inventory Modeling and Mapping Studies (GIMMS3g) dataset, this study investigated the relationship between vegetation change and climatic extremes from 1982 to 2013. Our results showed that the vegetation coverage increased significantly, with a linear rate of 0.025/10a ( P NDVI revealed an increasing trend from the northwest to the southeast, with about 61.79% of the LP exhibiting a significant increasing trend ( P NDVI at the yearly time scale ( P NDVI during the spring and autumn ( P NDVI and RX1day, TMAXmean, TXn, and TXx was insignificant in summer. Vegetation exhibited a significant negative relationship with precipitation extremes in winter ( P NDVI in Yan'an and Yulin during 1998-2013, r = 0.859 and 0.85, n = 16, P < 0.001.

  9. Ginsenoside Rb1 Attenuates Agonist-Induced Contractile Response via Inhibition of Store-Operated Calcium Entry in Pulmonary Arteries of Normal and Pulmonary Hypertensive Rats

    Directory of Open Access Journals (Sweden)

    Rui-Xing Wang

    2015-03-01

    Full Text Available Background: Pulmonary hypertension (PH is characterized by sustained vasoconstriction, enhanced vasoreactivity and vascular remodeling, which leads to right heart failure and death. Despite several treatments are available, many forms of PH are still incurable. Ginsenoside Rb1, a principle active ingredient of Panax ginseng, exhibits multiple pharmacological effects on cardiovascular system, and suppresses monocrotaline (MCT-induced right heart hypertrophy. However, its effect on the pulmonary vascular functions related to PH is unknown. Methods: We examined the vasorelaxing effects of ginsenoside Rb1 on endothelin-1 (ET-1 induced contraction of pulmonary arteries (PAs and store-operated Ca2+ entry (SOCE in pulmonary arterial smooth muscle cells (PASMCs from chronic hypoxia (CH and MCT-induced PH. Results: Ginsenoside Rb1 elicited concentration-dependent relaxation of ET-1-induced PA contraction. The vasorelaxing effect was unaffected by nifedipine, but abolished by the SOCE blocker Gd3+. Ginsenoside Rb1 suppressed cyclopiazonic acid (CPA-induced PA contraction, and CPA-activated cation entry and Ca2+ transient in PASMCs. ET-1 and CPA-induced contraction, and CPA-activated cation entry and Ca2+ transients were enhanced in PA and PASMCs of CH and MCT-treated rats; the enhanced responses were abolished by ginsenoside Rb1. Conclusion: Ginsenoside Rb1 attenuates ET-1-induced contractile response via inhibition of SOCE, and it can effectively antagonize the enhanced pulmonary vasoreactivity in PH.

  10. An increased rectal maximum tolerable volume and long anal canal are associated with poor short-term response to biofeedback therapy for patients with anismus with decreased bowel frequency and normal colonic transit time.

    Science.gov (United States)

    Rhee, P L; Choi, M S; Kim, Y H; Son, H J; Kim, J J; Koh, K C; Paik, S W; Rhee, J C; Choi, K W

    2000-10-01

    Biofeedback is an effective therapy for a majority of patients with anismus. However, a significant proportion of patients still failed to respond to biofeedback, and little has been known about the factors that predict response to biofeedback. We evaluated the factors associated with poor response to biofeedback. Biofeedback therapy was offered to 45 patients with anismus with decreased bowel frequency (less than three times per week) and normal colonic transit time. Any differences in demographics, symptoms, and parameters of anorectal physiologic tests were sought between responders (in whom bowel frequency increased up to three times or more per week after biofeedback) and nonresponders (in whom bowel frequency remained less than three times per week). Thirty-one patients (68.9 percent) responded to biofeedback and 14 patients (31.1 percent) did not. Anal canal length was longer in nonresponders than in responders (4.53 +/- 0.5 vs. 4.08 +/- 0.56 cm; P = 0.02), and rectal maximum tolerable volume was larger in nonresponders than in responders. (361 +/- 87 vs. 302 +/- 69 ml; P = 0.02). Anal canal length and rectal maximum tolerable volume showed significant differences between responders and nonresponders on multivariate analysis (P = 0.027 and P = 0.034, respectively). This study showed that a long anal canal and increased rectal maximum tolerable volume are associated with poor short-term response to biofeedback for patients with anismus with decreased bowel frequency and normal colonic transit time.

  11. Different roles of ROS and Nrf2 in Cr(VI)-induced inflammatory responses in normal and Cr(VI)-transformed cells

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Ram Vinod; Pratheeshkumar, Poyil; Son, Yong-Ok; Wang, Lei [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Department of Toxicology and Cancer Biology, College of Medicine, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Hitron, John Andrew [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Divya, Sasidharan Padmaja; Zhang, Zhuo [Department of Toxicology and Cancer Biology, College of Medicine, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Shi, Xianglin, E-mail: xshi5@email.uky.edu [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States)

    2016-09-15

    Hexavalent chromium (Cr(VI)) is classified as a human carcinogen. Cr(VI) has been associated with adenocarcinomas and squamous cell carcinoma of the lung. The present study shows that acute Cr(VI) treatment in human bronchial epithelial cells (BEAS-2B) increased inflammatory responses (TNF-α, COX-2, and NF-кB/p65) and expression of Nrf2. Cr(VI)-induced generation of reactive oxygen species (ROS) are responsible for increased inflammation. Despite the fact that Nrf2 is a master regulator of response to oxidative stress, silencing of Nrf2 in the acute Cr(VI) treatment had no effect on Cr(VI)-induced inflammation. In contrast, in Cr(VI)-transformed (CrT) cells, Nrf2 is constitutively activated. Knock-down of this protein resulted in decreased inflammation, while silencing of SOD2 and CAT had no effect in the expression of these inflammatory proteins. Results obtained from the knock-down of Nrf2 in CrT cells are very different from the results obtained in the acute Cr(VI) treatment. In BEAS-2B cells, knock-down of Nrf2 had no effect in the inflammation levels, while in CrT cells a decrease in the expression of inflammation markers was observed. These results indicate that before transformation, ROS plays a critical role while Nrf2 not in Cr(VI)-induced inflammation, whereas after transformation (CrT cells), Nrf2 is constitutively activated and this protein maintains inflammation while ROS not. Constitutively high levels of Nrf2 in CrT binds to the promoter regions of COX-2 and TNF-α, leading to increased inflammation. Collectively, our results demonstrate that before cell transformation ROS are important in Cr(VI)-induced inflammation and after transformation a constitutively high level of Nrf2 is important. - Highlights: • Cr(VI)-induced ROS increased inflammation, while Nrf2 had no effect. • In the CrT cells knock-down of Nrf2 resulted in decreased inflammation. • Mechanistic differences in regulating Cr(VI)-induced inflammation.

  12. TH-E-BRF-04: Characterizing the Response of Texture-Based CT Image Features for Quantification of Radiation-Induced Normal Lung Damage

    International Nuclear Information System (INIS)

    Krafft, S; Court, L; Briere, T; Martel, M

    2014-01-01

    Purpose: Radiation induced lung damage (RILD) is an important dose-limiting toxicity for patients treated with radiation therapy. Scoring systems for RILD are subjective and limit our ability to find robust predictors of toxicity. We investigate the dose and time-related response for texture-based lung CT image features that serve as potential quantitative measures of RILD. Methods: Pre- and post-RT diagnostic imaging studies were collected for retrospective analysis of 21 patients treated with photon or proton radiotherapy for NSCLC. Total lung and selected isodose contours (0–5, 5–15, 15–25Gy, etc.) were deformably registered from the treatment planning scan to the pre-RT and available follow-up CT studies for each patient. A CT image analysis framework was utilized to extract 3698 unique texture-based features (including co-occurrence and run length matrices) for each region of interest defined by the isodose contours and the total lung volume. Linear mixed models were fit to determine the relationship between feature change (relative to pre-RT), planned dose and time post-RT. Results: Seventy-three follow-up CT scans from 21 patients (median: 3 scans/patient) were analyzed to describe CT image feature change. At the p=0.05 level, dose affected feature change in 2706 (73.1%) of the available features. Similarly, time affected feature change in 408 (11.0%) of the available features. Both dose and time were significant predictors of feature change in a total of 231 (6.2%) of the extracted image features. Conclusion: Characterizing the dose and time-related response of a large number of texture-based CT image features is the first step toward identifying objective measures of lung toxicity necessary for assessment and prediction of RILD. There is evidence that numerous features are sensitive to both the radiation dose and time after RT. Beyond characterizing feature response, further investigation is warranted to determine the utility of these features as

  13. Cadmium, cobalt and lead cause stress response, cell cycle deregulation and increased steroid as well as xenobiotic metabolism in primary normal human bronchial epithelial cells which is coordinated by at least nine transcription factors

    Energy Technology Data Exchange (ETDEWEB)

    Glahn, Felix; Wiese, Jan; Foth, Heidi [Martin-Luther-University, Halle-Wittenberg, Institute of Environmental Toxicology, Halle/Saale (Germany); Schmidt-Heck, Wolfgang; Guthke, Reinhard [Leibniz Institute for Natural Product Research and Infection Biology, Hans Knoell Institute, Jena (Germany); Zellmer, Sebastian; Gebhardt, Rolf [University of Leipzig, Institute of Biochemistry, Medical Faculty, Leipzig (Germany); Golka, Klaus; Degen, Gisela H.; Hermes, Matthias; Schormann, Wiebke; Brulport, Marc; Bauer, Alexander; Bedawy, Essam [IfADo, Leibniz Research Centre for Working Environment and Human Factors, Dortmund (Germany); Hergenroeder, Roland [ISAS, Institute for Analytical Sciences, Dortmund (Germany); Lehmann, Thomas [Translational Centre for Regenerative Medicine, Leipzig (Germany); Hengstler, Jan G. [IfADo, Leibniz Research Centre for Working Environment and Human Factors, Dortmund (Germany)

    2008-08-15

    Workers occupationally exposed to cadmium, cobalt and lead have been reported to have increased levels of DNA damage. To analyze whether in vivo relevant concentrations of heavy metals cause systematic alterations in RNA expression patterns, we performed a gene array study using primary normal human bronchial epithelial cells. Cells were incubated with 15{mu}g/l Cd(II), 25{mu}g/l Co(II) and 550{mu}g/l Pb(II) either with individual substances or in combination. Differentially expressed genes were filtered out and used to identify enriched GO categories as well as KEGG pathways and to identify transcription factors whose binding sites are enriched in a given set of promoters. Interestingly, combined exposure to Cd(II), Co(II) and Pb(II) caused a coordinated response of at least seven stress response-related transcription factors, namely Oct-1, HIC1, TGIF, CREB, ATF4, SRF and YY1. A stress response was further corroborated by up regulation of genes involved in glutathione metabolism. A second major response to heavy metal exposure was deregulation of the cell cycle as evidenced by down regulation of the transcription factors ELK-1 and the Ets transcription factor GABP, as well as deregulation of genes involved in purine and pyrimidine metabolism. A third and surprising response was up regulation of genes involved in steroid metabolism, whereby promoter analysis identified up regulation of SRY that is known to play a role in sex determination. A forth response was up regulation of xenobiotic metabolising enzymes, particularly of dihydrodiol dehydrogenases 1 and 2 (AKR1C1, AKR1C2). Incubations with individual heavy metals showed that the response of AKR1C1 and AKR1C2 was predominantly caused by lead. In conclusion, we have shown that in vivo relevant concentrations of Cd(II), Co(II) and Pb(II) cause a complex and coordinated response in normal human bronchial epithelial cells. This study gives an overview of the most responsive genes. (orig.)

  14. Short-term effects of a low glycemic index carob-containing snack on energy intake, satiety, and glycemic response in normal-weight, healthy adults: Results from two randomized trials.

    Science.gov (United States)

    Papakonstantinou, Emilia; Orfanakos, Nickolaos; Farajian, Paul; Kapetanakou, Anastasia E; Makariti, Ifigenia P; Grivokostopoulos, Nikolaos; Ha, Marie-Ann; Skandamis, Panagiotis N

    2017-10-01

    The potential positive health effects of carob-containing snacks are largely unknown. Therefore, the aims of these studies were to determine the glycemic index (GI) of a carob snack compared with chocolate cookie containing equal amounts of available carbohydrates and to compare the effects of a carob versus chocolate cookie preload consumed as snack before a meal on (a) short-term satiety response measured by subsequent ad libitum meal intake, (b) subjective satiety as assessed by visual analog scales and (c) postprandial glycemic response. Ten healthy, normal-weight volunteers participated in GI investigation. Then, 50 healthy, normal-weight individuals consumed, crossover, in random order, the preloads as snack, with 1-wk washout period. Ad libitum meal (lunch and dessert) was offered. Capillary blood glucose samples were collected at baseline, 2 h after breakfast, just before preload consumption, 2 h after preload, 3 h after preload, just before meal (lunch and dessert), 1 h after meal, and 2 h after meal consumption. The carob snack was a low GI food, whereas the chocolate cookie was a high GI food (40 versus 78, respectively, on glucose scale). Consumption of the carob preload decreased the glycemic response to a following meal and to the individual's feelings of hunger, desire to eat, preoccupation with food, and thirst between snack and meal, as assessed with the use of visual analog scales. Subsequently, participants consumed less amounts of food (g) and had lower total energy intake at mealtimes. The carob snack led to increased satiety, lower energy intake at meal, and decreased postmeal glycemic response possibly due to its low GI value. Identifying foods that promote satiety and decrease glycemic response without increasing the overall energy intake may offer advantages to body weight and glycemic control. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Normalization Strategies for Enhancing Spatio-Temporal Analysis of Social Media Responses during Extreme Events: A Case Study based on Analysis of Four Extreme Events using Socio-Environmental Data Explorer (SEDE)

    Science.gov (United States)

    Ajayakumar, J.; Shook, E.; Turner, V. K.

    2017-10-01

    With social media becoming increasingly location-based, there has been a greater push from researchers across various domains including social science, public health, and disaster management, to tap in the spatial, temporal, and textual data available from these sources to analyze public response during extreme events such as an epidemic outbreak or a natural disaster. Studies based on demographics and other socio-economic factors suggests that social media data could be highly skewed based on the variations of population density with respect to place. To capture the spatio-temporal variations in public response during extreme events we have developed the Socio-Environmental Data Explorer (SEDE). SEDE collects and integrates social media, news and environmental data to support exploration and assessment of public response to extreme events. For this study, using SEDE, we conduct spatio-temporal social media response analysis on four major extreme events in the United States including the "North American storm complex" in December 2015, the "snowstorm Jonas" in January 2016, the "West Virginia floods" in June 2016, and the "Hurricane Matthew" in October 2016. Analysis is conducted on geo-tagged social media data from Twitter and warnings from the storm events database provided by National Centers For Environmental Information (NCEI) for analysis. Results demonstrate that, to support complex social media analyses, spatial and population-based normalization and filtering is necessary. The implications of these results suggests that, while developing software solutions to support analysis of non-conventional data sources such as social media, it is quintessential to identify the inherent biases associated with the data sources, and adapt techniques and enhance capabilities to mitigate the bias. The normalization strategies that we have developed and incorporated to SEDE will be helpful in reducing the population bias associated with social media data and will be useful

  16. THE RELATIONSHIP BETWEEN THE ACADEMIC PERFORMANCE AND PRACTICE OF TOLERANCE, SOLIDARITY AND RESPONSIBILITY OF STUDENTS FROM NORMAL RURAL SCHOOL "RICARDO FLORES MAGON"

    Directory of Open Access Journals (Sweden)

    Cintya Arely Hernández-López

    2016-07-01

    Full Text Available The Rural School “Ricardo Flores Magon” is concerned about providing an education that contributes to the integral formation of its students, with the intention that they will graduate with the skills needed to enter the labor and social world, for it is required to acquire values that contribute of the significantly way to consolidate the graduate profile. The quantitative method was used in this research; It focuses on the type of non-experimental design; the sample was probabilistic, 90 students of the Bachelor's degree in Elementary Education. Among the results it highlighted that students who practice more often the values of responsibility, solidarity and tolerance obtain higher academic achievement than those of their classmates.

  17. Changes in the renin-angiotensin-aldosterone system in response to dietary salt intake in normal and hypertensive pregnancy. A randomized trial

    DEFF Research Database (Denmark)

    Nielsen, Lise Hald; Ovesen, Per; Hansen, Mie R

    2016-01-01

    It was hypothesized that primary renal sodium retention blunted the reactivity of the renin-angiotensin-aldosterone system to changes in salt intake in preeclampsia (PE). A randomized, cross-over, double-blinded, dietary intervention design was used to measure the effects of salt tablets or place...... of plasma renin and angiotensin II in response to changes in dietary salt intake compatible with a primary increase in renal sodium reabsorption in hypertensive pregnancies.......It was hypothesized that primary renal sodium retention blunted the reactivity of the renin-angiotensin-aldosterone system to changes in salt intake in preeclampsia (PE). A randomized, cross-over, double-blinded, dietary intervention design was used to measure the effects of salt tablets or placebo...

  18. Maximal lipid oxidation in patients with type 2 diabetes is normal and shows an adequate increase in response to aerobic training

    DEFF Research Database (Denmark)

    Mogensen, M; Vind, B F; Højlund, K

    2009-01-01

    AIM: Insulin resistance in subjects with type 2 diabetes (T2D) and obesity is associated with an imbalance between the availability and the oxidation of lipids. We hypothesized that maximal whole-body lipid oxidation during exercise (FATmax) is reduced and that training-induced metabolic adaptation...... in response to aerobic training in obese subjects with and without T2D. These metabolic adaptations to training seem to be unrelated to changes in insulin sensitivity and indicate that an impaired capacity for lipid oxidation is not a major cause of insulin resistance in T2D....... subjects after training (all p Insulin-stimulated glucose disappearance rate (Rd) was lower in T2D vs. control subjects both before and after training. Rd increased...

  19. Endothelial Ca+-activated K+ channels in normal and impaired EDHF-dilator responses--relevance to cardiovascular pathologies and drug discovery.

    Science.gov (United States)

    Grgic, Ivica; Kaistha, Brajesh P; Hoyer, Joachim; Köhler, Ralf

    2009-06-01

    The arterial endothelium critically contributes to blood pressure control by releasing vasodilating autacoids such as nitric oxide, prostacyclin and a third factor or pathway termed 'endothelium-derived hyperpolarizing factor' (EDHF). The nature of EDHF and EDHF-signalling pathways is not fully understood yet. However, endothelial hyperpolarization mediated by the Ca(2+)-activated K(+) channels (K(Ca)) has been suggested to play a critical role in initializing EDHF-dilator responses in conduit and resistance-sized arteries of many species including humans. Endothelial K(Ca) currents are mediated by the two K(Ca) subtypes, intermediate-conductance K(Ca) (KCa3.1) (also known as, a.k.a. IK(Ca)) and small-conductance K(Ca) type 3 (KCa2.3) (a.k.a. SK(Ca)). In this review, we summarize current knowledge about endothelial KCa3.1 and KCa2.3 channels, their molecular and pharmacological properties and their specific roles in endothelial function and, particularly, in the EDHF-dilator response. In addition we focus on recent experimental evidences derived from KCa3.1- and/or KCa2.3-deficient mice that exhibit severe defects in EDHF signalling and elevated blood pressures, thus highlighting the importance of the KCa3.1/KCa2.3-EDHF-dilator system for blood pressure control. Moreover, we outline differential and overlapping roles of KCa3.1 and KCa2.3 for EDHF signalling as well as for nitric oxide synthesis and discuss recent evidence for a heterogeneous (sub) cellular distribution of KCa3.1 (at endothelial projections towards the smooth muscle) and KCa2.3 (at inter-endothelial borders and caveolae), which may explain their distinct roles for endothelial function. Finally, we summarize the interrelations of altered KCa3.1/KCa2.3 and EDHF system impairments with cardiovascular disease states such as hypertension, diabetes, dyslipidemia and atherosclerosis and discuss the therapeutic potential of KCa3.1/KCa2.3 openers as novel types of blood pressure-lowering drugs.

  20. Chondroitin 4-O-Sulfotransferase Is Indispensable for Sulfation of Chondroitin and Plays an Important Role in Maintaining Normal Life Span and Oxidative Stress Responses in Nematodes*

    Science.gov (United States)

    Izumikawa, Tomomi; Dejima, Katsufumi; Watamoto, Yukiko; Nomura, Kazuko H.; Kanaki, Nanako; Rikitake, Marika; Tou, Mai; Murata, Daisuke; Yanagita, Eri; Kano, Ai; Mitani, Shohei; Nomura, Kazuya; Kitagawa, Hiroshi

    2016-01-01

    Chondroitin sulfate (CS)/chondroitin (Chn) chains are indispensable for embryonic cell division and cytokinesis in the early developmental stages in Caenorhabditis elegans and mice, whereas heparan sulfate (HS) is essential for axon guidance during nervous system development. These data indicate that the fundamental functions of CS and HS are conserved from worms to mammals and that the function of CS/Chn differs from that of HS. Although previous studies have shown that C. elegans produces HS and non-sulfated Chn, whether the organism produces CS remains unclear. Here, we demonstrate that C. elegans produces a small amount of 4-O-sulfated Chn and report the identification of C41C4.1, an orthologue of the human chondroitin 4-O-sulfotransferase gene. Loss of C41C4.1 in C. elegans resulted in a decline in 4-O-sulfation of CS and an increase in the number of sulfated units in HS. C41C4.1 deletion mutants exhibited reduced survival rates after synchronization with sodium hypochlorite. Collectively, these results show for the first time that CS glycans are present in C. elegans and that the Chn 4-O-sulfotransferase responsible for the sulfation plays an important role in protecting nematodes from oxidative stress. PMID:27645998

  1. Chondroitin 4-O-Sulfotransferase Is Indispensable for Sulfation of Chondroitin and Plays an Important Role in Maintaining Normal Life Span and Oxidative Stress Responses in Nematodes.

    Science.gov (United States)

    Izumikawa, Tomomi; Dejima, Katsufumi; Watamoto, Yukiko; Nomura, Kazuko H; Kanaki, Nanako; Rikitake, Marika; Tou, Mai; Murata, Daisuke; Yanagita, Eri; Kano, Ai; Mitani, Shohei; Nomura, Kazuya; Kitagawa, Hiroshi

    2016-10-28

    Chondroitin sulfate (CS)/chondroitin (Chn) chains are indispensable for embryonic cell division and cytokinesis in the early developmental stages in Caenorhabditis elegans and mice, whereas heparan sulfate (HS) is essential for axon guidance during nervous system development. These data indicate that the fundamental functions of CS and HS are conserved from worms to mammals and that the function of CS/Chn differs from that of HS. Although previous studies have shown that C. elegans produces HS and non-sulfated Chn, whether the organism produces CS remains unclear. Here, we demonstrate that C. elegans produces a small amount of 4-O-sulfated Chn and report the identification of C41C4.1, an orthologue of the human chondroitin 4-O-sulfotransferase gene. Loss of C41C4.1 in C. elegans resulted in a decline in 4-O-sulfation of CS and an increase in the number of sulfated units in HS. C41C4.1 deletion mutants exhibited reduced survival rates after synchronization with sodium hypochlorite. Collectively, these results show for the first time that CS glycans are present in C. elegans and that the Chn 4-O-sulfotransferase responsible for the sulfation plays an important role in protecting nematodes from oxidative stress. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Trigemino-gustatory interactions: a randomized controlled clinical trial assessing the effects of selective anesthesia of dental afferents on taste thresholds.

    Science.gov (United States)

    Lecor, Papa Abdou; Touré, Babacar; Boucher, Yves

    2018-03-01

    This study aimed at analyzing the effect of the temporary removal of trigeminal dental afferents on electrogustometric thresholds (EGMt). EGMt were measured in 300 healthy subjects randomized in three groups, in nine loci on the right and left side (RS, LS) of the tongue surface before and after anesthesia. Group IAN (n = 56 RS, n = 44 LS) received intraosseous local anesthesia of the inferior alveolar nerve (IAN). Group MdN received mandibular nerve (MdN) block targeting IAN before its entrance into the mandibular foramen (n = 60, RS, and n = 40, LS); group MxN receiving maxillary nerve (MxN) anesthesia (n = 56 RS and n = 44 LS) was the control group. Differences between mean EGMt were analyzed with the Wilcoxon test; correlation between type of anesthesia and EGMt was performed with Spearman's rho, all with a level of significance set at p ≤ 0.05. Significant EGMt (μA) differences before and after anesthesia were found in all loci with MdN and IAN on the ipsilateral side (p Anesthesia of the MdN was positively correlated with the increase in EGMt (p anesthesia of IAN was positively correlated only with the increase in EGMt measured at posterior and dorsal loci of the tongue surface (p anesthesia suggests a participation of dental afferents in taste perception. Extraction of teeth may impair food intake not only due to impaired masticatory ability but also to alteration of neurological trigemino-gustatory interactions. PACTR201602001452260.

  3. Human SNM1B is required for normal cellular response to both DNA interstrand crosslink-inducing agents and ionizing radiation.

    Science.gov (United States)

    Demuth, Ilja; Digweed, Martin; Concannon, Patrick

    2004-11-11

    DNA interstrand crosslinks (ICLs) are critical lesions for the mammalian cell since they affect both DNA strands and block transcription and replication. The repair of ICLs in the mammalian cell involves components of different repair pathways such as nucleotide-excision repair and the double-strand break/homologous recombination repair pathways. However, the mechanistic details of mammalian ICL repair have not been fully delineated. We describe here the complete coding sequence and the genomic organization of hSNM1B, one of at least three human homologs of the Saccharomyces cerevisiae PSO2 gene. Depletion of hSNM1B by RNA interference rendered cells hypersensitive to ICL-inducing agents. This requirement for hSNM1B in the cellular response to ICL has been hypothesized before but never experimentally verified. In addition, siRNA knockdown of hSNM1B rendered cells sensitive to ionizing radiation, suggesting the possibility of hSNM1B involvement in homologous recombination repair of double-strand breaks arising as intermediates of ICL repair. Monoubiquitination of FANCD2, a key step in the FANC/BRCA pathway, is not affected in hSNM1B-depleted HeLa cells, indicating that hSNM1B is probably not a part of the Fanconi anemia core complex. Nonetheless, similarities in the phenotype of hSNM1B-depleted cells and cultured cells from patients suffering from Fanconi anemia make hSNM1B a candidate for one of the as yet unidentified Fanconi anemia genes not involved in monoubiquitination of FANCD2.

  4. Normalizing Catastrophe: Sustainability and Scientism

    Science.gov (United States)

    Bonnett, Michael

    2013-01-01

    Making an adequate response to our deteriorating environmental situation is a matter of ever increasing urgency. It is argued that a central obstacle to achieving this is the way that scientism has become normalized in our thinking about environmental issues. This is taken to reflect on an underlying "metaphysics of mastery" that vitiates proper…

  5. Elevated Postoperative Endogenous GLP-1 Levels Mediate Effects of Roux-en-Y Gastric Bypass on Neural Responsivity to Food Cues

    DEFF Research Database (Denmark)

    Ten Kulve, Jennifer S; Veltman, Dick J; Gerdes, Victor E A

    2017-01-01

    of the GLP-1 receptor antagonist exendin 9-39 (Ex9-39) and placebo were assessed in 10 women before and after RYGB. We used functional MRI to investigate CNS activation in response to visual food cues (pictures) and gustatory food cues (consumption of chocolate milk), comparing results with Ex9-39 versus...... in response to visual and gustatory food cues may be mediated by central effects of GLP-1. Our findings provide further insights into the mechanisms underlying the weight-lowering effects of RYGB.......OBJECTIVE: It has been suggested that weight reduction and improvements in satiety after Roux-en-Y gastric bypass (RYGB) are partly mediated via postoperative neuroendocrine changes. Glucagon-like peptide-1 (GLP-1) is a gut hormone secreted after food ingestion and is associated with appetite...

  6. Controlled cross-over study in normal subjects of naloxone-preceding-lactate infusions; respiratory and subjective responses: relationship to endogenous opioid system, suffocation false alarm theory and childhood parental loss.

    Science.gov (United States)

    Preter, M; Lee, S H; Petkova, E; Vannucci, M; Kim, S; Klein, D F

    2011-02-01

    The expanded suffocation false alarm theory (SFA) hypothesizes that dysfunction in endogenous opioidergic regulation increases sensitivity to CO2, separation distress and panic attacks. In panic disorder (PD) patients, both spontaneous clinical panics and lactate-induced panics markedly increase tidal volume (TV), whereas normals have a lesser effect, possibly due to their intact endogenous opioid system. We hypothesized that impairing the opioidergic system by naloxone could make normal controls parallel PD patients' response when lactate challenged. Whether actual separations and losses during childhood (childhood parental loss, CPL) affected naloxone-induced respiratory contrasts was explored. Subjective panic-like symptoms were analyzed although pilot work indicated that the subjective aspect of anxious panic was not well modeled by this specific protocol. Randomized cross-over sequences of intravenous naloxone (2 mg/kg) followed by lactate (10 mg/kg), or saline followed by lactate, were given to 25 volunteers. Respiratory physiology was objectively recorded by the LifeShirt. Subjective symptomatology was also recorded. Impairment of the endogenous opioid system by naloxone accentuates TV and symptomatic response to lactate. This interaction is substantially lessened by CPL. Opioidergic dysregulation may underlie respiratory pathophysiology and suffocation sensitivity in PD. Comparing specific anti-panic medications with ineffective anti-panic agents (e.g. propranolol) can test the specificity of the naloxone+lactate model. A screen for putative anti-panic agents and a new pharmacotherapeutic approach are suggested. Heuristically, the experimental unveiling of the endogenous opioid system impairing effects of CPL and separation in normal adults opens a new experimental, investigatory area.

  7. Controlled cross-over study in normal subjects of naloxone-preceding-lactate infusions; respiratory and subjective responses: relationship to endogenous opioid system, suffocation false alarm theory and childhood parental loss

    Science.gov (United States)

    Preter, M.; Lee, S. H.; Petkova, E.; Vannucci, M.; Kim, S.; Klein, D. F.

    2015-01-01

    Background The expanded suffocation false alarm theory (SFA) hypothesizes that dysfunction in endogenous opioidergic regulation increases sensitivity to CO2, separation distress and panic attacks. In panic disorder (PD) patients, both spontaneous clinical panics and lactate-induced panics markedly increase tidal volume (TV), whereas normals have a lesser effect, possibly due to their intact endogenous opioid system. We hypothesized that impairing the opioidergic system by naloxone could make normal controls parallel PD patients' response when lactate challenged. Whether actual separations and losses during childhood (childhood parental loss, CPL) affected naloxone-induced respiratory contrasts was explored. Subjective panic-like symptoms were analyzed although pilot work indicated that the subjective aspect of anxious panic was not well modeled by this specific protocol. Method Randomized cross-over sequences of intravenous naloxone (2 mg/kg) followed by lactate (10 mg/kg), or saline followed by lactate, were given to 25 volunteers. Respiratory physiology was objectively recorded by the LifeShirt. Subjective symptomatology was also recorded. Results Impairment of the endogenous opioid system by naloxone accentuates TV and symptomatic response to lactate. This interaction is substantially lessened by CPL. Conclusions Opioidergic dysregulation may underlie respiratory pathophysiology and suffocation sensitivity in PD. Comparing specific anti-panic medications with ineffective anti-panic agents (e.g. propranolol) can test the specificity of the naloxone + lactate model. A screen for putative anti-panic agents and a new pharmacotherapeutic approach are suggested. Heuristically, the experimental unveiling of the endogenous opioid system impairing effects of CPL and separation in normal adults opens a new experimental, investigatory area. PMID:20444308

  8. Comparison of the responses of the chorda tympani and glossopharyngeal nerves to taste stimuli in C57BL/6J mice

    Directory of Open Access Journals (Sweden)

    Hellekant Göran

    2003-03-01

    Full Text Available Abstract Background Recent progress in discernment of molecular pathways of taste transduction underscores the need for comprehensive phenotypic information for the understanding of the influence of genetic factors in taste. To obtain information that can be used as a base line for assessment of effects of genetic manipulations in mice taste, we have recorded the whole-nerve integrated responses to a wide array of taste stimuli in the chorda tympani (CT and glossopharyngeal (NG nerves, the two major taste nerves from the tongue. Results In C57BL/6J mice the responses in the two nerves were not the same. In general sweeteners gave larger responses in the CT than in the NG, while responses to bitter taste in the NG were larger. Thus the CT responses to cyanosuosan, fructose, NC00174, D-phenylalanline and sucrose at all concentrations were significantly larger than in the NG, whereas for acesulfame-K, L-proline, saccharin and SC45647 the differences were not significant. Among bitter compounds amiloride, atropine, cycloheximide, denatonium benzoate, L-phenylalanine, 6-n-propyl-2-thiouracil (PROP and tetraethyl ammonium chloride (TEA gave larger responses in the NG, while the responses to brucine, chloroquine, quinacrine, quinine hydrochloride (QHCl, sparteine and strychnine, known to be very bitter to humans, were not significantly larger in the NG than in the CT. Conclusion These data provide a comprehensive survey and comparison of the taste sensitivity of the normal C57BL/6J mouse against which the effects of manipulations of its gustatory system can be better assessed.

  9. Normalized modes at selected points without normalization

    Science.gov (United States)

    Kausel, Eduardo

    2018-04-01

    As every textbook on linear algebra demonstrates, the eigenvectors for the general eigenvalue problem | K - λM | = 0 involving two real, symmetric, positive definite matrices K , M satisfy some well-defined orthogonality conditions. Equally well-known is the fact that those eigenvectors can be normalized so that their modal mass μ =ϕT Mϕ is unity: it suffices to divide each unscaled mode by the square root of the modal mass. Thus, the normalization is the result of an explicit calculation applied to the modes after they were obtained by some means. However, we show herein that the normalized modes are not merely convenient forms of scaling, but that they are actually intrinsic properties of the pair of matrices K , M, that is, the matrices already "know" about normalization even before the modes have been obtained. This means that we can obtain individual components of the normalized modes directly from the eigenvalue problem, and without needing to obtain either all of the modes or for that matter, any one complete mode. These results are achieved by means of the residue theorem of operational calculus, a finding that is rather remarkable inasmuch as the residues themselves do not make use of any orthogonality conditions or normalization in the first place. It appears that this obscure property connecting the general eigenvalue problem of modal analysis with the residue theorem of operational calculus may have been overlooked up until now, but which has in turn interesting theoretical implications.Á

  10. Is applying the same exercise-based inpatient program to normal and reduced left ventricular function patients the best strategy after coronary surgery? A focus on autonomic cardiac response.

    Science.gov (United States)

    Mendes, Renata Gonçalves; Simões, Rodrigo Polaquini; Costa, Fernando de Souza Melo; Pantoni, Camila Bianca Falasco; Di Thommazo-Luporini, Luciana; Luzzi, Sérgio; Amaral-Neto, Othon; Arena, Ross; Catai, Aparecida Maria; Borghi-Silva, Audrey

    2014-01-01

    To assess whether the same exercise-based inpatient program applied to patients with normal and reduced left ventricular function (LVF) evokes a similar cardiac autonomic response after coronary artery bypass graft (CABG). Forty-four patients post-CABG, subgrouped according to normal LVF [LVFN: n = 23; left ventricular ejection fraction (LVEF) ≥ 55%] and reduced LVF (LVFR: n = 21; LVEF 35-54%), were included. All initiated the exercise protocol on post-operative day 1 (PO1), following a whole progressive program until discharge. Cardiac autonomic response was assessed by the indices of heart rate variability (HRV) at rest and during exercise (extremity range of motion and ambulation). During ambulation, lower values of HRV indices were found in the LVFR group compared with the LVFN group [standard deviation of all RR (STDRR; 6.1 ± 2.7 versus 8.9 ± 4.7 ms), baseline width of the RR histogram (TINN; 30.6 ± 14.8 versus 45.8 ± 24.9 ms), SD2 (14.8 ± 8.0 versus 21.3 ± 9.0 ms), Shannon entropy (3.6 ± 0.5 versus 3.9 ± 0.4) and correlation dimension (0.08 ± 0.2 versus 0.2 ± 0.2)]. Also, when comparing the ambulation to rest change, lower values were observed in the LVFR group for linear (STDRR, TINN, RR TRI, rMSSD) and non-linear (SD2 and correlation dimension) HRV indices (p exercise (extremity range of motion), for mean intervals between heart beats and heart rate. For patients with LVFN, the same inpatient exercise protocol triggered a more attenuated autonomic response compared with patients with LVFR. These findings have implications as to how exercise should be prescribed according to LVF in the early stages following recovery from CABG. Implications for Rehabilitation Exercise-based inpatient program, performed by post-CABG patients who have normal left ventricular function, triggered a more attenuated cardiac autonomic response compared with patients with reduced left ventricular function. Volume of the inpatient exercises should be prescribed according

  11. Visual attention to food cues is differentially modulated by gustatory-hedonic and post-ingestive attributes.

    Science.gov (United States)

    Garcia-Burgos, David; Lao, Junpeng; Munsch, Simone; Caldara, Roberto

    2017-07-01

    Although attentional biases towards food cues may play a critical role in food choices and eating behaviours, it remains largely unexplored which specific food attribute governs visual attentional deployment. The allocation of visual attention might be modulated by anticipatory postingestive consequences, from taste sensations derived from eating itself, or both. Therefore, in order to obtain a comprehensive understanding of the attentional mechanisms involved in the processing of food-related cues, we recorded the eye movements to five categories of well-standardised pictures: neutral non-food, high-calorie, good taste, distaste and dangerous food. In particular, forty-four healthy adults of both sexes were assessed with an antisaccade paradigm (which requires the generation of a voluntary saccade and the suppression of a reflex one) and a free viewing paradigm (which implies the free visual exploration of two images). The results showed that observers directed their initial fixations more often and faster on items with high survival relevance such as nutrient and possible dangers; although an increase in antisaccade error rates was only detected for high-calorie items. We also found longer prosaccade fixation duration and initial fixation duration bias score related to maintained attention towards high-calorie, good taste and danger categories; while shorter reaction times to correct an incorrect prosaccade related to less difficulties in inhibiting distasteful images. Altogether, these findings suggest that visual attention is differentially modulated by both the accepted and rejected food attributes, but also that normal-weight, non-eating disordered individuals exhibit enhanced approach to food's postingestive effects and avoidance of distasteful items (such as bitter vegetables or pungent products). Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Response

    Science.gov (United States)

    Higgins, Chris

    2012-01-01

    This article presents the author's response to the reviews of his book, "The Good Life of Teaching: An Ethics of Professional Practice." He begins by highlighting some of the main concerns of his book. He then offers a brief response, doing his best to address the main criticisms of his argument and noting where the four reviewers (Charlene…

  13. Normal foot and ankle

    International Nuclear Information System (INIS)

    Weissman, S.D.

    1989-01-01

    The foot may be thought of as a bag of bones tied tightly together and functioning as a unit. The bones re expected to maintain their alignment without causing symptomatology to the patient. The author discusses a normal radiograph. The bones must have normal shape and normal alignment. The density of the soft tissues should be normal and there should be no fractures, tumors, or foreign bodies

  14. Normalization Strategies for Enhancing Spatio-Temporal Analysis of Social Media Responses during Extreme Events: A Case Study based on Analysis of Four Extreme Events using Socio-Environmental Data Explorer (SEDE

    Directory of Open Access Journals (Sweden)

    J. Ajayakumar

    2017-10-01

    Full Text Available With social media becoming increasingly location-based, there has been a greater push from researchers across various domains including social science, public health, and disaster management, to tap in the spatial, temporal, and textual data available from these sources to analyze public response during extreme events such as an epidemic outbreak or a natural disaster. Studies based on demographics and other socio-economic factors suggests that social media data could be highly skewed based on the variations of population density with respect to place. To capture the spatio-temporal variations in public response during extreme events we have developed the Socio-Environmental Data Explorer (SEDE. SEDE collects and integrates social media, news and environmental data to support exploration and assessment of public response to extreme events. For this study, using SEDE, we conduct spatio-temporal social media response analysis on four major extreme events in the United States including the “North American storm complex” in December 2015, the “snowstorm Jonas” in January 2016, the “West Virginia floods” in June 2016, and the “Hurricane Matthew” in October 2016. Analysis is conducted on geo-tagged social media data from Twitter and warnings from the storm events database provided by National Centers For Environmental Information (NCEI for analysis. Results demonstrate that, to support complex social media analyses, spatial and population-based normalization and filtering is necessary. The implications of these results suggests that, while developing software solutions to support analysis of non-conventional data sources such as social media, it is quintessential to identify the inherent biases associated with the data sources, and adapt techniques and enhance capabilities to mitigate the bias. The normalization strategies that we have developed and incorporated to SEDE will be helpful in reducing the population bias associated with

  15. Assessment of Adaptive Rate Response Provided by Accelerometer, Minute Ventilation and Dual Sensor Compared with Normal Sinus Rhythm During Exercise: A Self-controlled Study in Chronotropically Competent Subjects

    Directory of Open Access Journals (Sweden)

    Yuanyuan Cao

    2015-01-01

    Full Text Available Background: Dual sensor (DS for rate adaption was supposed to be more physiological. To evaluate its superiority, the DS (accelerometer [ACC] and minute ventilation [MV] and normal sinus rate response were compared in a self-controlled way during exercise treadmill testing. Methods: This self-controlled study was performed in atrioventricular block patients with normal sinus function who met the indications of pacemaker implant. Twenty-one patients came to the 1-month follow-up visit. Patients performed a treadmill test 1-month post implant while programmed in DDDR and sensor passive mode. For these patients, sensor response factors were left at default settings (ACC = 8, MV = 3 and sensor indicated rates (SIRs for DS, ACC and MV sensor were retrieved from the pacemaker memories, along with measured sinus node (SN rates from the beginning to 1-minute after the end of the treadmill test, and compared among study groups. Repeated measures analysis of variance and profile analysis, as well as variance analysis of randomized block designs, were used for statistical analysis. Results: Fifteen patients (15/21 were determined to be chronotropically competent. The mean differences between DS SIRs and intrinsic sinus rates during treadmill testing were smaller than those for ACC and MV sensor (mean difference between SIR and SN rate: ACC vs. SN, MV vs. SN, DS vs. SN, respectively, 34.84, 17.60, 16.15 beats/min, though no sensors could mimic sinus rates under the default settings for sensor response factor (ACC vs. SN P-adjusted < 0.001; MV vs. SN P-adjusted = 0.002; DS vs. SN P-adjusted = 0.005. However, both in the range of 1 st minute and first 3 minutes of exercise, only the DS SIR profile did not differ from sinus rates (P-adjusted = 0.09, 0.90, respectively. Conclusions: The DS under default settings provides more physiological rate response during physical activity than the corresponding single sensors (ACC or MV sensor. Further study is needed to

  16. Normal Movement Selectivity in Autism

    OpenAIRE

    Dinstein, Ilan; Thomas, Cibu; Humphreys, Kate; Minshew, Nancy; Behrmann, Marlene; Heeger, David J.

    2010-01-01

    It has been proposed that individuals with autism have difficulties understanding the goals and intentions of others because of a fundamental dysfunction in the mirror neuron system. Here, however, we show that individuals with autism exhibited not only normal fMRI responses in mirror system areas during observation and execution of hand movements, but also exhibited typical movement-selective adaptation (repetition suppression) when observing or executing the same movement repeatedly. Moveme...

  17. Baby Poop: What's Normal?

    Science.gov (United States)

    ... I'm breast-feeding my newborn and her bowel movements are yellow and mushy. Is this normal for baby poop? Answers from Jay L. Hoecker, M.D. Yellow, mushy bowel movements are perfectly normal for breast-fed babies. Still, ...

  18. Hepatitis B virus (HBV)-specific T-cell responses to recombinant HBV core protein in patients with normal liver function and co-infected with chronic HBV and human immunodeficiency virus 1 (HIV-1)

    Science.gov (United States)

    2013-01-01

    Background Little is known about HBV-specific T-cell responses in chronic Hepatitis B patients (HBV) that are co-infected with Human immunodeficiency virus type 1 (HIV-1), especially those with normal alanine aminotransferase (ALT) levels. Methods Twenty-five patients with chronic HBV (11 hepatitis B e antigen [HBeAg]-positive, 14 HBeAg-negative) were enrolled in a cross-sectional study. A longitudinal study as also conducted in which follow-up was done at 3, 12, and 24 months, after acute HIV-1 infection, in 11 individuals who also had chronic HBV. Peripheral blood mononuclear cells were stimulated with recombinant HBV surface protein (S protein), core protein (C protein) or gag peptide. IFN-γ-secreting T cells were identified by ELISPOT assay. Results In the cross-sectional study, co-infected chronic HBV patients had lower C protein-specific T-cell responses compared with mono-infected individuals, though the difference was not significant. In co-infected, chronic HBV patients, the magnitude of C protein-specific T-cell responses was significantly greater in HBeAg-positive subjects compared to HBeAg-negative subjects (p = 0.011). C protein-specific T-cell responses were positively correlated with HBV viral load (rs = 0.40, p = 0.046). However, gag-specific T-cell responses were negatively correlated with HIV viral load (rs = −0.44, p = 0.026) and positively correlated with CD4+ count (rs = 0.46, p = 0.021). The results were different in mono-infected individuals. PBMCs from co-infected HBeAg-positive patients secreted more specific-IFN-γ in cultured supernatants compared with PBMCs from co-infected HBeAg-negative patients (p = 0.019). In the longitudinal study, S protein- and C protein-specific T-cell responses were decreased as the length of follow-up increased (p = 0.034, for S protein; p = 0.105, for C protein). Additionally, the S protein- and C protein-specific T-cell responses were significantly higher in HBe

  19. Visual Memories Bypass Normalization.

    Science.gov (United States)

    Bloem, Ilona M; Watanabe, Yurika L; Kibbe, Melissa M; Ling, Sam

    2018-05-01

    How distinct are visual memory representations from visual perception? Although evidence suggests that briefly remembered stimuli are represented within early visual cortices, the degree to which these memory traces resemble true visual representations remains something of a mystery. Here, we tested whether both visual memory and perception succumb to a seemingly ubiquitous neural computation: normalization. Observers were asked to remember the contrast of visual stimuli, which were pitted against each other to promote normalization either in perception or in visual memory. Our results revealed robust normalization between visual representations in perception, yet no signature of normalization occurring between working memory stores-neither between representations in memory nor between memory representations and visual inputs. These results provide unique insight into the nature of visual memory representations, illustrating that visual memory representations follow a different set of computational rules, bypassing normalization, a canonical visual computation.

  20. Making nuclear 'normal'

    International Nuclear Information System (INIS)

    Haehlen, Peter; Elmiger, Bruno

    2000-01-01

    The mechanics of the Swiss NPPs' 'come and see' programme 1995-1999 were illustrated in our contributions to all PIME workshops since 1996. Now, after four annual 'waves', all the country has been covered by the NPPs' invitation to dialogue. This makes PIME 2000 the right time to shed some light on one particular objective of this initiative: making nuclear 'normal'. The principal aim of the 'come and see' programme, namely to give the Swiss NPPs 'a voice of their own' by the end of the nuclear moratorium 1990-2000, has clearly been attained and was commented on during earlier PIMEs. It is, however, equally important that Swiss nuclear energy not only made progress in terms of public 'presence', but also in terms of being perceived as a normal part of industry, as a normal branch of the economy. The message that Swiss nuclear energy is nothing but a normal business involving normal people, was stressed by several components of the multi-prong campaign: - The speakers in the TV ads were real - 'normal' - visitors' guides and not actors; - The testimonials in the print ads were all real NPP visitors - 'normal' people - and not models; - The mailings inviting a very large number of associations to 'come and see' activated a typical channel of 'normal' Swiss social life; - Spending money on ads (a new activity for Swiss NPPs) appears to have resulted in being perceived by the media as a normal branch of the economy. Today we feel that the 'normality' message has well been received by the media. In the controversy dealing with antinuclear arguments brought forward by environmental organisations journalists nowadays as a rule give nuclear energy a voice - a normal right to be heard. As in a 'normal' controversy, the media again actively ask themselves questions about specific antinuclear claims, much more than before 1990 when the moratorium started. The result is that in many cases such arguments are discarded by journalists, because they are, e.g., found to be

  1. Normal Pressure Hydrocephalus

    Science.gov (United States)

    ... improves the chance of a good recovery. Without treatment, symptoms may worsen and cause death. What research is being done? The NINDS conducts and supports research on neurological disorders, including normal pressure hydrocephalus. Research on disorders such ...

  2. Normality in Analytical Psychology

    Science.gov (United States)

    Myers, Steve

    2013-01-01

    Although C.G. Jung’s interest in normality wavered throughout his career, it was one of the areas he identified in later life as worthy of further research. He began his career using a definition of normality which would have been the target of Foucault’s criticism, had Foucault chosen to review Jung’s work. However, Jung then evolved his thinking to a standpoint that was more aligned to Foucault’s own. Thereafter, the post Jungian concept of normality has remained relatively undeveloped by comparison with psychoanalysis and mainstream psychology. Jung’s disjecta membra on the subject suggest that, in contemporary analytical psychology, too much focus is placed on the process of individuation to the neglect of applications that consider collective processes. Also, there is potential for useful research and development into the nature of conflict between individuals and societies, and how normal people typically develop in relation to the spectrum between individuation and collectivity. PMID:25379262

  3. Normal pressure hydrocephalus

    Science.gov (United States)

    Hydrocephalus - occult; Hydrocephalus - idiopathic; Hydrocephalus - adult; Hydrocephalus - communicating; Dementia - hydrocephalus; NPH ... Ferri FF. Normal pressure hydrocephalus. In: Ferri FF, ed. ... Elsevier; 2016:chap 648. Rosenberg GA. Brain edema and disorders ...

  4. Normal Functioning Family

    Science.gov (United States)

    ... Spread the Word Shop AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care ... Español Text Size Email Print Share Normal Functioning Family Page Content Article Body Is there any way ...

  5. Normal growth and development

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/002456.htm Normal growth and development To use the sharing features on this page, please enable JavaScript. A child's growth and development can be divided into four periods: ...

  6. Neurochemical characterization of sea lamprey taste buds and afferent gustatory fibers: presence of serotonin, calretinin, and CGRP immunoreactivity in taste bud bi-ciliated cells of the earliest vertebrates.

    Science.gov (United States)

    Barreiro-Iglesias, Antón; Villar-Cerviño, Verona; Villar-Cheda, Begoña; Anadón, Ramón; Rodicio, María Celina

    2008-12-01

    Neuroactive substances such as serotonin and other monoamines have been suggested to be involved in the transmission of gustatory signals from taste bud cells to afferent fibers. Lampreys are the earliest vertebrates that possess taste buds, although these differ in structure from taste buds in jawed vertebrates, and their neurochemistry remains unknown. We used immunofluorescence methods with antibodies raised against serotonin, tyrosine hydroxylase (TH), gamma-aminobutyric acid (GABA), glutamate, calcitonin gene-related peptide (CGRP), neuropeptide Y (NPY), calretinin, and acetylated alpha-tubulin to characterize the neurochemistry and innervation of taste buds in the sea lamprey, Petromyzon marinus L. For localization of proliferative cells in taste buds we used bromodeoxyuridine labeling and proliferating cell nuclear antigen immunohistochemistry. Results with both markers indicate that proliferating cells are restricted to a few basal cells and that almost all cells in taste buds are nonproliferating. A large number of serotonin-, calretinin-, and CGRP-immunoreactive bi-ciliated cells were revealed in lamprey taste buds. This suggests that serotonin participates in the transmission of gustatory signals and indicates that this substance appeared early on in vertebrate evolution. The basal surface of the bi-ciliated taste bud cells was contacted by tubulin-immunoreactive fibers. Some of the fibers surrounding the taste bud were calretinin immunoreactive. Lamprey taste bud cells or afferent fibers did not exhibit TH, GABA, glutamate, or NPY immunoreactivity, which suggests that expression of these substances evolved in taste buds of some gnathostomes lines after the separation of gnathostomes and lampreys. (c) 2008 Wiley-Liss, Inc.

  7. Members of Bitter Taste Receptor Cluster Tas2r143/Tas2r135/Tas2r126 Are Expressed in the Epithelium of Murine Airways and Other Non-gustatory Tissues

    Directory of Open Access Journals (Sweden)

    Shuya Liu

    2017-10-01

    Full Text Available The mouse bitter taste receptors Tas2r143, Tas2r135, and Tas2r126 are encoded by genes that cluster on chromosome 6 and have been suggested to be expressed under common regulatory elements. Previous studies indicated that the Tas2r143/Tas2r135/Tas2r126 cluster is expressed in the heart, but other organs had not been systematically analyzed. In order to investigate the expression of this bitter taste receptor gene cluster in non-gustatory tissues, we generated a BAC (bacterial artificial chromosome based transgenic mouse line, expressing CreERT2 under the control of the Tas2r143 promoter. After crossing this line with a mouse line expressing EGFP after Cre-mediated recombination, we were able to validate the Tas2r143-CreERT2 transgenic mouse line and monitor the expression of Tas2r143. EGFP-positive cells, indicating expression of members of the cluster, were found in about 47% of taste buds, and could also be found in several other organs. A population of EGFP-positive cells was identified in thymic epithelial cells, in the lamina propria of the intestine and in vascular smooth muscle cells of cardiac blood vessels. EGFP-positive cells were also identified in the epithelium of organs readily exposed to pathogens including lower airways, the gastrointestinal tract, urethra, vagina, and cervix. With respect to the function of cells expressing this bitter taste receptor cluster, RNA-seq analysis in EGFP-positive cells isolated from the epithelium of trachea and stomach showed expression of genes related to innate immunity. These data further support the concept that bitter taste receptors serve functions outside the gustatory system.

  8. Smooth quantile normalization.

    Science.gov (United States)

    Hicks, Stephanie C; Okrah, Kwame; Paulson, Joseph N; Quackenbush, John; Irizarry, Rafael A; Bravo, Héctor Corrada

    2018-04-01

    Between-sample normalization is a critical step in genomic data analysis to remove systematic bias and unwanted technical variation in high-throughput data. Global normalization methods are based on the assumption that observed variability in global properties is due to technical reasons and are unrelated to the biology of interest. For example, some methods correct for differences in sequencing read counts by scaling features to have similar median values across samples, but these fail to reduce other forms of unwanted technical variation. Methods such as quantile normalization transform the statistical distributions across samples to be the same and assume global differences in the distribution are induced by only technical variation. However, it remains unclear how to proceed with normalization if these assumptions are violated, for example, if there are global differences in the statistical distributions between biological conditions or groups, and external information, such as negative or control features, is not available. Here, we introduce a generalization of quantile normalization, referred to as smooth quantile normalization (qsmooth), which is based on the assumption that the statistical distribution of each sample should be the same (or have the same distributional shape) within biological groups or conditions, but allowing that they may differ between groups. We illustrate the advantages of our method on several high-throughput datasets with global differences in distributions corresponding to different biological conditions. We also perform a Monte Carlo simulation study to illustrate the bias-variance tradeoff and root mean squared error of qsmooth compared to other global normalization methods. A software implementation is available from https://github.com/stephaniehicks/qsmooth.

  9. Normal movement selectivity in autism.

    Science.gov (United States)

    Dinstein, Ilan; Thomas, Cibu; Humphreys, Kate; Minshew, Nancy; Behrmann, Marlene; Heeger, David J

    2010-05-13

    It has been proposed that individuals with autism have difficulties understanding the goals and intentions of others because of a fundamental dysfunction in the mirror neuron system. Here, however, we show that individuals with autism exhibited not only normal fMRI responses in mirror system areas during observation and execution of hand movements but also exhibited typical movement-selective adaptation (repetition suppression) when observing or executing the same movement repeatedly. Movement selectivity is a defining characteristic of neurons involved in movement perception, including mirror neurons, and, as such, these findings argue against a mirror system dysfunction in autism. Copyright 2010 Elsevier Inc. All rights reserved.

  10. Monitoring the normal body

    DEFF Research Database (Denmark)

    Nissen, Nina Konstantin; Holm, Lotte; Baarts, Charlotte

    2015-01-01

    of practices for monitoring their bodies based on different kinds of calculations of weight and body size, observations of body shape, and measurements of bodily firmness. Biometric measurements are familiar to them as are health authorities' recommendations. Despite not belonging to an extreme BMI category...... provides us with knowledge about how to prevent future overweight or obesity. This paper investigates body size ideals and monitoring practices among normal-weight and moderately overweight people. Methods : The study is based on in-depth interviews combined with observations. 24 participants were...... recruited by strategic sampling based on self-reported BMI 18.5-29.9 kg/m2 and socio-demographic factors. Inductive analysis was conducted. Results : Normal-weight and moderately overweight people have clear ideals for their body size. Despite being normal weight or close to this, they construct a variety...

  11. Do estudo dos potenciais de média latência eliciados por logon em sujeitos do sexo feminino com audição normal A study of logon-evoked middle latency responses in female subjects with normal hearing

    Directory of Open Access Journals (Sweden)

    Erika Maria Fukushima

    2007-06-01

    Full Text Available Os potenciais de média latência são potenciais auditivos que ocorrem entre 10ms a 80ms, formados por ondas polifásicas positivas e negativas denominadas de N0, P0, Na, Pa, Nb e Pb. O logon é um estímulo acústico que permite eliciar respostas de média latência ativando regiões específicas da cóclea. Sua vantagem sobre o clique é a possibilidade avaliar as áreas de baixa freqüência (abaixo de 1kHz. OBJETIVO: O objetivo deste trabalho foi verificar a resposta eletrofisiológica das MLR estimulados por logon nas freqüências de 500, 1000 e 2000 Hz. CASUÍSTICA E MÉTODO: Forma de estudo prospectivo e descritivo de uma amostra de 14 voluntárias do sexo feminino, normais dos pontos de vista otológico e audiológico convencional. O estímulo foi monoaural e ipsilateral à derivação de captação dos potenciais (Cz/A1-2. RESULTADOS: O complexo NaPa foi o mais facilmente identificado e esteve presente em 100% dos exames realizados a 2000 Hz e em 96,4% a 500 e 1000 Hz. CONCLUSÕES: As MLR podem se eliciadas pelo logon nas freqüências de 500, 1000 e 2000 Hz; o complexo NaPa foi o evento prevalente das MLR e o estímulo logon a 2000 Hz eliciou maior número de respostas do que as outras freqüências.The middle latency response (MLR to an acoustic stimulus occurs between 10 and 80 ms. The waveform is characterized by a series of peaks and troughs labeled N0, P0, Na, Pa, Nb and Pb. Certain acoustic stimuli may excite specific cochlear areas in contrast with clicks, that activate the cochlea between 1000 and 4000 Hz. The logon stimulus activates segmentar areas of the cochlea and has advantages over clicks when assessing low frequency areas of the cochlea (below 1 kHz. AIM: The aim of this paper was to study the MLR electrophysiologic response when activated by logon stimuli at 500, 1000 and 2000 Hz. Method- a prospective and descriptive study. 14 female volunteers had normal otology and conventional audiology results. The stimulus was

  12. Normal modified stable processes

    DEFF Research Database (Denmark)

    Barndorff-Nielsen, Ole Eiler; Shephard, N.

    2002-01-01

    Gaussian (NGIG) laws. The wider framework thus established provides, in particular, for added flexibility in the modelling of the dynamics of financial time series, of importance especially as regards OU based stochastic volatility models for equities. In the special case of the tempered stable OU process......This paper discusses two classes of distributions, and stochastic processes derived from them: modified stable (MS) laws and normal modified stable (NMS) laws. This extends corresponding results for the generalised inverse Gaussian (GIG) and generalised hyperbolic (GH) or normal generalised inverse...

  13. Normalization of satellite imagery

    Science.gov (United States)

    Kim, Hongsuk H.; Elman, Gregory C.

    1990-01-01

    Sets of Thematic Mapper (TM) imagery taken over the Washington, DC metropolitan area during the months of November, March and May were converted into a form of ground reflectance imagery. This conversion was accomplished by adjusting the incident sunlight and view angles and by applying a pixel-by-pixel correction for atmospheric effects. Seasonal color changes of the area can be better observed when such normalization is applied to space imagery taken in time series. In normalized imagery, the grey scale depicts variations in surface reflectance and tonal signature of multi-band color imagery can be directly interpreted for quantitative information of the target.

  14. The normal holonomy group

    International Nuclear Information System (INIS)

    Olmos, C.

    1990-05-01

    The restricted holonomy group of a Riemannian manifold is a compact Lie group and its representation on the tangent space is a product of irreducible representations and a trivial one. Each one of the non-trivial factors is either an orthogonal representation of a connected compact Lie group which acts transitively on the unit sphere or it is the isotropy representation of a single Riemannian symmetric space of rank ≥ 2. We prove that, all these properties are also true for the representation on the normal space of the restricted normal holonomy group of any submanifold of a space of constant curvature. 4 refs

  15. Expression patterns of regulatory RNAs, including lncRNAs and tRNAs, during postnatal growth of normal and dystrophic (mdx) mouse muscles, and their response to taurine treatment.

    Science.gov (United States)

    Butchart, Lauren C; Terrill, Jessica R; Rossetti, Giulia; White, Robert; Filipovska, Aleksandra; Grounds, Miranda D

    2018-06-01

    Post-natal skeletal muscle growth in mice is very rapid and involves complex changes in many cells types over the first 6 weeks of life. The acute onset of dystropathology also occurs around 3 weeks of age in the mdx mouse model of the human disease Duchenne Muscular Dystrophy (DMD). This study investigated (i) alterations in expression patterns of regulatory non-coding RNAs (ncRNAs) in vivo, including miRNAs, lncRNAs and tRNAs, during early growth of skeletal muscles in normal control C57Bl/10Scsn (C57) compared with dystrophic mdx mice from 2 to 6 weeks of postnatal age, and revealed inherent differences in vivo for levels of 3 ncRNAs between C57 and mdx muscles before the onset of dystropathology. Since the amino acid taurine has many benefits and reduces disease severity in mdx mice, this study also (ii) determined the impact of taurine treatment on these expression patterns in mdx muscles at the onset of dystropathology (3 weeks) and after several bouts of myonecrosis and regeneration (6 weeks). Taurine treatment of mdx mice only altered ncRNA levels when administered from 18 days to 6 weeks of age, but a deficiency in tRNA levels was rectified earlier in mdx skeletal muscles treated from 14 days to 3 weeks. Myogenesis in tissue culture was also used to (iii) compare ncRNA expression patterns for both strains, and (iv) the response to taurine treatment. These analyses revealed intrinsic differences in ncRNA expression patterns during myogenesis between strains, as well as increased sensitivity of mdx ncRNA levels to taurine treatment. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Episodic normal faulting and magmatism during the syn-spreading stage of the Baiyun sag in Pearl River Mouth Basin: response to the multi-phase seafloor spreading of the South China Sea

    Science.gov (United States)

    Deng, Peng; Mei, Lianfu; Liu, Jun; Zheng, Jinyun; Liu, Minghui; Cheng, Zijie; Guo, Fengtai

    2018-03-01

    Considerable post-breakup extensional deformation is recorded in the continental margins of the South China Sea (SCS). To recognize the nature and origin of the significant deformation during the syn-spreading stage (32-15.5 Ma) in the SCS, we comprehensively analyzed the geometry and kinematics of the faults and contemporaneous magmas in the Baiyun sag, northern margin of the SCS, using high-resolution regional three-dimensional seismic data. The kinematic analyses indicate that the faults in the Baiyun sag are recently formed following the onset of seafloor spreading in the SCS. The faults exhibit multiple episodes of growth history, with three active episodes, 32-29, 23.8-21 and 18.5-16.5 Ma, separated by periods of inactivity. Four volcanic groups comprising 98 volcanic mounds have been identified and described, located separately in the northwestern, the central, the southeastern and the northern slope areas. The occurrence of multiple palaeo-seafloors, complemented by the biostratigraphic and K-Ar dating data, reveals multiple extrusive events of the syn-spreading magmas in the Baiyun sag, with three active periods of 23.8-21, 18.5-17.5 and 17.5-16.5 Ma. This study confirms that the normal faulting has a shared genetic origin with the contemporaneous magmatism during the syn-spreading stage in the deep-offshore Baiyun sag, northern margin of the SCS. The episodic fault growth and magmatic extrusive events reveal that the Baiyun sag has undergone at least three episodic tectonic events during the syn-spreading stage, which evolved in response to the multi-stage seafloor spreading of the SCS.

  17. Normality in Analytical Psychology

    Directory of Open Access Journals (Sweden)

    Steve Myers

    2013-11-01

    Full Text Available Although C.G. Jung’s interest in normality wavered throughout his career, it was one of the areas he identified in later life as worthy of further research. He began his career using a definition of normality which would have been the target of Foucault’s criticism, had Foucault chosen to review Jung’s work. However, Jung then evolved his thinking to a standpoint that was more aligned to Foucault’s own. Thereafter, the post Jungian concept of normality has remained relatively undeveloped by comparison with psychoanalysis and mainstream psychology. Jung’s disjecta membra on the subject suggest that, in contemporary analytical psychology, too much focus is placed on the process of individuation to the neglect of applications that consider collective processes. Also, there is potential for useful research and development into the nature of conflict between individuals and societies, and how normal people typically develop in relation to the spectrum between individuation and collectivity.

  18. Medically-enhanced normality

    DEFF Research Database (Denmark)

    Møldrup, Claus; Traulsen, Janine Morgall; Almarsdóttir, Anna Birna

    2003-01-01

    Objective: To consider public perspectives on the use of medicines for non-medical purposes, a usage called medically-enhanced normality (MEN). Method: Examples from the literature were combined with empirical data derived from two Danish research projects: a Delphi internet study and a Telebus...

  19. The Normal Fetal Pancreas.

    Science.gov (United States)

    Kivilevitch, Zvi; Achiron, Reuven; Perlman, Sharon; Gilboa, Yinon

    2017-10-01

    The aim of the study was to assess the sonographic feasibility of measuring the fetal pancreas and its normal development throughout pregnancy. We conducted a cross-sectional prospective study between 19 and 36 weeks' gestation. The study included singleton pregnancies with normal pregnancy follow-up. The pancreas circumference was measured. The first 90 cases were tested to assess feasibility. Two hundred ninety-seven fetuses of nondiabetic mothers were recruited during a 3-year period. The overall satisfactory visualization rate was 61.6%. The intraobserver and interobserver variability had high interclass correlation coefficients of of 0.964 and 0.967, respectively. A cubic polynomial regression described best the correlation of pancreas circumference with gestational age (r = 0.744; P pancreas circumference percentiles for each week of gestation were calculated. During the study period, we detected 2 cases with overgrowth syndrome and 1 case with an annular pancreas. In this study, we assessed the feasibility of sonography for measuring the fetal pancreas and established a normal reference range for the fetal pancreas circumference throughout pregnancy. This database can be helpful when investigating fetomaternal disorders that can involve its normal development. © 2017 by the American Institute of Ultrasound in Medicine.

  20. Normal and Abnormal Behavior in Early Childhood

    OpenAIRE

    Spinner, Miriam R.

    1981-01-01

    Evaluation of normal and abnormal behavior in the period to three years of age involves many variables. Parental attitudes, determined by many factors such as previous childrearing experience, the bonding process, parental psychological status and parental temperament, often influence the labeling of behavior as normal or abnormal. This article describes the forms of crying, sleep and wakefulness, and affective responses from infancy to three years of age.

  1. Idiopathic Normal Pressure Hydrocephalus

    Directory of Open Access Journals (Sweden)

    Basant R. Nassar BS

    2016-04-01

    Full Text Available Idiopathic normal pressure hydrocephalus (iNPH is a potentially reversible neurodegenerative disease commonly characterized by a triad of dementia, gait, and urinary disturbance. Advancements in diagnosis and treatment have aided in properly identifying and improving symptoms in patients. However, a large proportion of iNPH patients remain either undiagnosed or misdiagnosed. Using PubMed search engine of keywords “normal pressure hydrocephalus,” “diagnosis,” “shunt treatment,” “biomarkers,” “gait disturbances,” “cognitive function,” “neuropsychology,” “imaging,” and “pathogenesis,” articles were obtained for this review. The majority of the articles were retrieved from the past 10 years. The purpose of this review article is to aid general practitioners in further understanding current findings on the pathogenesis, diagnosis, and treatment of iNPH.

  2. Normal Weight Dyslipidemia

    DEFF Research Database (Denmark)

    Ipsen, David Hojland; Tveden-Nyborg, Pernille; Lykkesfeldt, Jens

    2016-01-01

    Objective: The liver coordinates lipid metabolism and may play a vital role in the development of dyslipidemia, even in the absence of obesity. Normal weight dyslipidemia (NWD) and patients with nonalcoholic fatty liver disease (NAFLD) who do not have obesity constitute a unique subset...... of individuals characterized by dyslipidemia and metabolic deterioration. This review examined the available literature on the role of the liver in dyslipidemia and the metabolic characteristics of patients with NAFLD who do not have obesity. Methods: PubMed was searched using the following keywords: nonobese......, dyslipidemia, NAFLD, NWD, liver, and metabolically obese/unhealthy normal weight. Additionally, article bibliographies were screened, and relevant citations were retrieved. Studies were excluded if they had not measured relevant biomarkers of dyslipidemia. Results: NWD and NAFLD without obesity share a similar...

  3. Tarsal taste neuron activity and proboscis extension reflex in response to sugars and amino acids in Helicoverpa armigera (Hubner).

    Science.gov (United States)

    Zhang, Yun-Feng; van Loon, Joop J A; Wang, Chen-Zhu

    2010-08-15

    In adult female Helicoverpa armigera (Hübner), the fifth tarsomere of the prothoracic legs bears 14 gustatory trichoid chemosensilla. These chemosensilla were characterized through electrophysiological experiments by stimulating with sucrose, glucose, fructose, maltose, myo-inositol and 20 common amino acids. In electrophysiological recordings from nine sensilla, responses were obtained to certain compounds tested at 100 mmol l(-1), and the response spectra differed from broad to narrow. The four sugars excited the same receptor neuron in sensillum a and sensillum b; sucrose and myo-inositol, sucrose and lysine, myo-inositol and lysine excited two different receptor neurons respectively in sensillum a; fructose and lysine excited two different receptor neurons in sensillum n. Furthermore, the four sugars, myo-inositol and lysine all elicited concentration-dependent electrophysiological responses. These six compounds also induced the proboscis extension reflex (PER) followed by ingestion of the solution when they were applied on the tarsi. Lysine and sucrose caused the strongest electrophysiological responses. However, sucrose had the strongest stimulatory effect on the PER whereas lysine had the weakest. Mixtures of sucrose with the other sugars or with lysine had a similar stimulatory effect on the PER as sucrose alone. The electrophysiological and behavioural responses caused by a range of sucrose concentrations were positively correlated. We conclude that the tarsal gustatory sensilla play an essential role in perceiving sugars available in floral nectar and provide chemosensory information determining feeding behaviour. Tarsal taste-receptor-neuron responses to lysine are implicated in oviposition behaviour.

  4. Relating normalization to neuronal populations across cortical areas.

    Science.gov (United States)

    Ruff, Douglas A; Alberts, Joshua J; Cohen, Marlene R

    2016-09-01

    Normalization, which divisively scales neuronal responses to multiple stimuli, is thought to underlie many sensory, motor, and cognitive processes. In every study where it has been investigated, neurons measured in the same brain area under identical conditions exhibit a range of normalization, ranging from suppression by nonpreferred stimuli (strong normalization) to additive responses to combinations of stimuli (no normalization). Normalization has been hypothesized to arise from interactions between neuronal populations, either in the same or different brain areas, but current models of normalization are not mechanistic and focus on trial-averaged responses. To gain insight into the mechanisms underlying normalization, we examined interactions between neurons that exhibit different degrees of normalization. We recorded from multiple neurons in three cortical areas while rhesus monkeys viewed superimposed drifting gratings. We found that neurons showing strong normalization shared less trial-to-trial variability with other neurons in the same cortical area and more variability with neurons in other cortical areas than did units with weak normalization. Furthermore, the cortical organization of normalization was not random: neurons recorded on nearby electrodes tended to exhibit similar amounts of normalization. Together, our results suggest that normalization reflects a neuron's role in its local network and that modulatory factors like normalization share the topographic organization typical of sensory tuning properties. Copyright © 2016 the American Physiological Society.

  5. CT in normal pressure hydrocephalus

    International Nuclear Information System (INIS)

    Fujita, Katsuzo; Nogaki, Hidekazu; Noda, Masaya; Kusunoki, Tadaki; Tamaki, Norihiko

    1981-01-01

    CT scans were obtained on 33 patients (age 73y. to 31y.) with the diagnosis of normal pressure hydrocephalus. In each case, the diagnosis was made on the basis of the symptoms, CT and cisternographic findings. Underlying diseases of normal pressure hydrocephalus are ruptured aneurysms (21 cases), arteriovenous malformations (2 cases), head trauma (1 case), cerebrovascular accidents (1 case) and idiopathie (8 cases). Sixteen of 33 patients showed marked improvement, five, moderate or minimal improvement, and twelve, no change. The results were compared with CT findings and clinical response to shunting. CT findings were classified into five types, bases on the degree of periventricular hypodensity (P.V.H.), the extent of brain damage by underlying diseases, and the degree of cortical atrophy. In 17 cases of type (I), CT shows the presence of P.V.H. with or without minimal frontal lobe damage and no cortical atrophy. The good surgical improvements were achieved in all cases of type (I) by shunting. In 4 cases of type (II), CT shows the presence of P.V.H. and severe brain damage without cortical atrophy. The fair clinical improvements were achieved in 2 cases (50%) by shunting. In one case of type (III), CT shows the absence of P.V.H. without brain damage nor cortical atrophy. No clinical improvement was obtained by shunting in this type. In 9 cases of type (IV) with mild cortical atrophy, the fair clinical improvement was achieved in two cases (22%) and no improvement in 7 cases. In 2 cases of type (V) with moderate or marked cortical atrophy, no clinical improvement was obtained by shunting. In conclusion, it appeared from the present study that there was a good correlation between the result of shunting and the type of CT, and clinical response to shunting operation might be predicted by classification of CT findings. (author)

  6. Theory of normal metals

    International Nuclear Information System (INIS)

    Mahan, G.D.

    1992-01-01

    The organizers requested that I give eight lectures on the theory of normal metals, ''with an eye on superconductivity.'' My job was to cover the general properties of metals. The topics were selected according to what the students would need to known for the following lectures on superconductivity. My role was to prepare the ground work for the later lectures. The problem is that there is not yet a widely accepted theory for the mechanism which pairs the electrons. Many mechanisms have been proposed, with those of phonons and spin fluctuations having the most followers. So I tried to discuss both topics. I also introduced the tight-binding model for metals, which forms the basis for most of the work on the cuprate superconductors

  7. Estudo das latências e amplitudes dos potenciais evocados auditivos de média latência em indivíduos audiologicamente normais Middle latency response study of auditory evoked potentials’ amplitudes and lantencies audiologically normal individuals

    Directory of Open Access Journals (Sweden)

    Ivone Ferreira Neves

    2007-02-01

    Full Text Available Estudo de coorte contemporânea com corte transversal. O Potencial Evocado Auditivo de Média Latência (PEAML é gerado entre 10 e 80ms e possui múltiplos geradores, com maior contribuição da região tálamo-cortical. O estabelecimento de critérios de normalidade para os valores de latência e amplitude é necessário para uso clínico. OBJETIVOS: Analisar a latência e amplitude do PEAML em indivíduos sem alterações audiológicas, e verificar a confiabilidade da amplitude Pa-Nb. MATERIAL E MÉTODO: Foram coletados os PEAML de 25 indivíduos durante o ano de 2005 e analisados os componentes Na, Pa, Nb para cada orelha testada (A1 e A2, e posicionamento de eletrodo (C3 e C4. RESULTADOS: Observou-se diferença estatisticamente significante entre os valores médios de latência para C3A1 e C4A1 com relação aos componentes Na e Pa, não sendo encontrada esta diferença para o componente Nb e valores médios das amplitudes Na-Pa e Pa-Nb. CONCLUSÃO: Foram estabelecidos os valores das médias e desvios padrão para os parâmetros latência e amplitude dos componentes Na, Pa, Nb, e Na-Pa e Pa-Nb, nas condições C3A1, C4A1, C3A2, C4A2, proporcionando os parâmetros para a análise e interpretação deste potencial.Contemporary cohort cross-sectional study. Introduction: The auditory middle latency response (AMLR is generated between 10 and 80 ms and has multiple generators, with a greater contribution from the thalamus-cortical pathways. The establishment of normality criteria for latency and amplitude values is necessary for clinical use. AIM: to analyze the latency and amplitude of the AMLR in individuals without audiological disorders, and verify the reliability of Pa-Nb amplitude. MATERIALS AND METHODS: The AMLR of 25 individuals was collected during 2005 and the Na, Pa, Nb components were analyzed for each tested ear (A1 and A2, and electrode positioning (C3 and C4. RESULTS: A statistically significant difference was noticed among middle

  8. Helicon normal modes in Proto-MPEX

    Science.gov (United States)

    Piotrowicz, P. A.; Caneses, J. F.; Green, D. L.; Goulding, R. H.; Lau, C.; Caughman, J. B. O.; Rapp, J.; Ruzic, D. N.

    2018-05-01

    The Proto-MPEX helicon source has been operating in a high electron density ‘helicon-mode’. Establishing plasma densities and magnetic field strengths under the antenna that allow for the formation of normal modes of the fast-wave are believed to be responsible for the ‘helicon-mode’. A 2D finite-element full-wave model of the helicon antenna on Proto-MPEX is used to identify the fast-wave normal modes responsible for the steady-state electron density profile produced by the source. We also show through the simulation that in the regions of operation in which core power deposition is maximum the slow-wave does not deposit significant power besides directly under the antenna. In the case of a simulation where a normal mode is not excited significant edge power is deposited in the mirror region. ).

  9. Normalization as a canonical neural computation

    Science.gov (United States)

    Carandini, Matteo; Heeger, David J.

    2012-01-01

    There is increasing evidence that the brain relies on a set of canonical neural computations, repeating them across brain regions and modalities to apply similar operations to different problems. A promising candidate for such a computation is normalization, in which the responses of neurons are divided by a common factor that typically includes the summed activity of a pool of neurons. Normalization was developed to explain responses in the primary visual cortex and is now thought to operate throughout the visual system, and in many other sensory modalities and brain regions. Normalization may underlie operations such as the representation of odours, the modulatory effects of visual attention, the encoding of value and the integration of multisensory information. Its presence in such a diversity of neural systems in multiple species, from invertebrates to mammals, suggests that it serves as a canonical neural computation. PMID:22108672

  10. Strength of Gamma Rhythm Depends on Normalization

    Science.gov (United States)

    Ray, Supratim; Ni, Amy M.; Maunsell, John H. R.

    2013-01-01

    Neuronal assemblies often exhibit stimulus-induced rhythmic activity in the gamma range (30–80 Hz), whose magnitude depends on the attentional load. This has led to the suggestion that gamma rhythms form dynamic communication channels across cortical areas processing the features of behaviorally relevant stimuli. Recently, attention has been linked to a normalization mechanism, in which the response of a neuron is suppressed (normalized) by the overall activity of a large pool of neighboring neurons. In this model, attention increases the excitatory drive received by the neuron, which in turn also increases the strength of normalization, thereby changing the balance of excitation and inhibition. Recent studies have shown that gamma power also depends on such excitatory–inhibitory interactions. Could modulation in gamma power during an attention task be a reflection of the changes in the underlying excitation–inhibition interactions? By manipulating the normalization strength independent of attentional load in macaque monkeys, we show that gamma power increases with increasing normalization, even when the attentional load is fixed. Further, manipulations of attention that increase normalization increase gamma power, even when they decrease the firing rate. Thus, gamma rhythms could be a reflection of changes in the relative strengths of excitation and normalization rather than playing a functional role in communication or control. PMID:23393427

  11. Feeding response of the silkworm, Bombyx mori, to UV irradiation of mulberry leaves

    International Nuclear Information System (INIS)

    Yazawa, M.; Shimizu, T.; Hirao, T.

    1992-01-01

    Ultraviolet irradiation of mulberry leaves caused a reduced feeding response in Bombyx mori larvae (ca. 22% reduction in consumption as compared with control). Sucrose content of the foliage decreased after exposure to UV irradiation (0.5 mW/cm 2 ) for 1 hr. Electrophysiological responses of the sensilla styloconica-I to sucrose concentration (ca. 0-80 mg/g) showed a reduced response to UV-irradiated foliage when compared with the control. From feeding, gustatory, and electrophysiological responses, as well as the measurement of sucrose contents of the leaves, we concluded that the reduced feeding response to UV-irradiated leaves is due to the reduced sucrose content of the mulberry leaves, thus reducing pleogostimulatory levels

  12. Normal modes of weak colloidal gels

    Science.gov (United States)

    Varga, Zsigmond; Swan, James W.

    2018-01-01

    The normal modes and relaxation rates of weak colloidal gels are investigated in calculations using different models of the hydrodynamic interactions between suspended particles. The relaxation spectrum is computed for freely draining, Rotne-Prager-Yamakawa, and accelerated Stokesian dynamics approximations of the hydrodynamic mobility in a normal mode analysis of a harmonic network representing several colloidal gels. We find that the density of states and spatial structure of the normal modes are fundamentally altered by long-ranged hydrodynamic coupling among the particles. Short-ranged coupling due to hydrodynamic lubrication affects only the relaxation rates of short-wavelength modes. Hydrodynamic models accounting for long-ranged coupling exhibit a microscopic relaxation rate for each normal mode, λ that scales as l-2, where l is the spatial correlation length of the normal mode. For the freely draining approximation, which neglects long-ranged coupling, the microscopic relaxation rate scales as l-γ, where γ varies between three and two with increasing particle volume fraction. A simple phenomenological model of the internal elastic response to normal mode fluctuations is developed, which shows that long-ranged hydrodynamic interactions play a central role in the viscoelasticity of the gel network. Dynamic simulations of hard spheres that gel in response to short-ranged depletion attractions are used to test the applicability of the density of states predictions. For particle concentrations up to 30% by volume, the power law decay of the relaxation modulus in simulations accounting for long-ranged hydrodynamic interactions agrees with predictions generated by the density of states of the corresponding harmonic networks as well as experimental measurements. For higher volume fractions, excluded volume interactions dominate the stress response, and the prediction from the harmonic network density of states fails. Analogous to the Zimm model in polymer

  13. Short proofs of strong normalization

    OpenAIRE

    Wojdyga, Aleksander

    2008-01-01

    This paper presents simple, syntactic strong normalization proofs for the simply-typed lambda-calculus and the polymorphic lambda-calculus (system F) with the full set of logical connectives, and all the permutative reductions. The normalization proofs use translations of terms and types to systems, for which strong normalization property is known.

  14. Radiogenomics: predicting clinical normal tissue radiosensitivity

    DEFF Research Database (Denmark)

    Alsner, Jan

    2006-01-01

    Studies on the genetic basis of normal tissue radiosensitivity, or  'radiogenomics', aims at predicting clinical radiosensitivity and optimize treatment from individual genetic profiles. Several studies have now reported links between variations in certain genes related to the biological response...... to radiation injury and risk of normal tissue morbidity in cancer patients treated with radiotherapy. However, after these initial association studies including few genes, we are still far from being able to predict clinical radiosensitivity on an individual level. Recent data from our own studies on risk...

  15. H2O2 homeostasis in wild-type and ethylene-insensitive Never ripe tomato in response to salicylic acid treatment in normal photoperiod and in prolonged darkness.

    Science.gov (United States)

    Takács, Zoltán; Poór, Péter; Borbély, Péter; Czékus, Zalán; Szalai, Gabriella; Tari, Irma

    2018-05-01

    Ethylene proved to be an important modulator of salicylic acid (SA) signalling pathway. Since SA may regulate both the production and scavenging of hydrogen peroxide (H 2 O 2 ), which show light-dependency, the aim of this study was to compare H 2 O 2 metabolism in the leaves of SA-treated wild-type (WT) tomato (Solanum lycopersicum L. cv. Ailsa Craig) and in ethylene receptor Never-ripe (Nr) mutants grown in normal photoperiod or in prolonged darkness. H 2 O 2 accumulation was higher in the WT than in the mutants in normal photoperiod after 1 mM SA treatment, while Nr leaves contained more H 2 O 2 after light deprivation. The expression of certain superoxide dismutase (SOD) genes and activity of the enzyme followed the same tendency as H 2 O 2 , which was scavenged by different enzymes in the two genotypes. Catalase (CAT, EC 1.11.1.6) activity was inhibited by SA in WT, while the mutants maintained enhanced enzyme activity in the dark. Thus, in WT, CAT inhibition was the major component of the H 2 O 2 accumulation elicited by 1 mM SA in a normal photoperiod, since the expression and/or activity of ascorbate (APX, EC 1.11.1.11) and guaiacol peroxidases (POD, EC 1.11.1.7) were induced in the leaves. The absence of APX and POD activation in mutant plants suggests that the regulation of these enzymes by SA needs functional ethylene signalling. While the block of ethylene perception in Nr mutants was overwritten in the transcription and activity of certain SOD and CAT isoenzymes during prolonged darkness, the low APX and POD activities led to H 2 O 2 accumulation in these tissues. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  16. Minimal residual disease and normalization of the bone marrow after long-term treatment with alpha-interferon2b in polycythemia vera. A report on molecular response patterns in seven patients in sustained complete hematological remission

    DEFF Research Database (Denmark)

    Larsen, Thomas Stauffer; Møller, Michael Boe; de Stricker, Karin

    2009-01-01

    Polycythemia vera (PV) is characterized by the presence of the JAK2V617F mutation in virtually all patients. Several studies have shown that the JAK2V617F mutational load decreases during treatment with alpha-interferon 2. We report on molecular and histomorphological bone marrow responses in seven...

  17. Bicervical normal uterus with normal vagina | Okeke | Annals of ...

    African Journals Online (AJOL)

    To the best of our knowledge, only few cases of bicervical normal uterus with normal vagina exist in the literature; one of the cases had an anterior‑posterior disposition. This form of uterine abnormality is not explicable by the existing classical theory of mullerian anomalies and suggests that a complex interplay of events ...

  18. Deconstructing Interocular Suppression: Attention and Divisive Normalization.

    Directory of Open Access Journals (Sweden)

    Hsin-Hung Li

    2015-10-01

    Full Text Available In interocular suppression, a suprathreshold monocular target can be rendered invisible by a salient competitor stimulus presented in the other eye. Despite decades of research on interocular suppression and related phenomena (e.g., binocular rivalry, flash suppression, continuous flash suppression, the neural processing underlying interocular suppression is still unknown. We developed and tested a computational model of interocular suppression. The model included two processes that contributed to the strength of interocular suppression: divisive normalization and attentional modulation. According to the model, the salient competitor induced a stimulus-driven attentional modulation selective for the location and orientation of the competitor, thereby increasing the gain of neural responses to the competitor and reducing the gain of neural responses to the target. Additional suppression was induced by divisive normalization in the model, similar to other forms of visual masking. To test the model, we conducted psychophysics experiments in which both the size and the eye-of-origin of the competitor were manipulated. For small and medium competitors, behavioral performance was consonant with a change in the response gain of neurons that responded to the target. But large competitors induced a contrast-gain change, even when the competitor was split between the two eyes. The model correctly predicted these results and outperformed an alternative model in which the attentional modulation was eye specific. We conclude that both stimulus-driven attention (selective for location and feature and divisive normalization contribute to interocular suppression.

  19. Deconstructing Interocular Suppression: Attention and Divisive Normalization.

    Science.gov (United States)

    Li, Hsin-Hung; Carrasco, Marisa; Heeger, David J

    2015-10-01

    In interocular suppression, a suprathreshold monocular target can be rendered invisible by a salient competitor stimulus presented in the other eye. Despite decades of research on interocular suppression and related phenomena (e.g., binocular rivalry, flash suppression, continuous flash suppression), the neural processing underlying interocular suppression is still unknown. We developed and tested a computational model of interocular suppression. The model included two processes that contributed to the strength of interocular suppression: divisive normalization and attentional modulation. According to the model, the salient competitor induced a stimulus-driven attentional modulation selective for the location and orientation of the competitor, thereby increasing the gain of neural responses to the competitor and reducing the gain of neural responses to the target. Additional suppression was induced by divisive normalization in the model, similar to other forms of visual masking. To test the model, we conducted psychophysics experiments in which both the size and the eye-of-origin of the competitor were manipulated. For small and medium competitors, behavioral performance was consonant with a change in the response gain of neurons that responded to the target. But large competitors induced a contrast-gain change, even when the competitor was split between the two eyes. The model correctly predicted these results and outperformed an alternative model in which the attentional modulation was eye specific. We conclude that both stimulus-driven attention (selective for location and feature) and divisive normalization contribute to interocular suppression.

  20. Comparison of spectrum normalization techniques for univariate ...

    Indian Academy of Sciences (India)

    Laser-induced breakdown spectroscopy; univariate study; normalization models; stainless steel; standard error of prediction. Abstract. Analytical performance of six different spectrum normalization techniques, namelyinternal normalization, normalization with total light, normalization with background along with their ...

  1. Normal matter storage of antiprotons

    International Nuclear Information System (INIS)

    Campbell, L.J.

    1987-01-01

    Various simple issues connected with the possible storage of anti p in relative proximity to normal matter are discussed. Although equilibrium storage looks to be impossible, condensed matter systems are sufficiently rich and controllable that nonequilibrium storage is well worth pursuing. Experiments to elucidate the anti p interactions with normal matter are suggested. 32 refs

  2. The N'ormal Distribution

    Indian Academy of Sciences (India)

    An optimal way of choosing sample size in an opinion poll is indicated using the normal distribution. Introduction. In this article, the ubiquitous normal distribution is intro- duced as a convenient approximation for computing bino- mial probabilities for large values of n. Stirling's formula. • and DeMoivre-Laplace theorem ...

  3. Touch-flavor transference: Assessing the effect of packaging weight on gustatory evaluations, desire for food and beverages, and willingness to pay.

    Science.gov (United States)

    Kampfer, Kristina; Leischnig, Alexander; Ivens, Björn Sven; Spence, Charles

    2017-01-01

    Product packaging serves a number of distinct functions and influences the way in which consumers respond to various product offerings. The research reported here examines whether the haptic characteristics of a non-diagnostic product packaging cue, namely its weight, affects the response of consumers. This article reviews existing research on haptic transference and proposes a conceptual framework to explore how the weight of product packaging affects the flavor of the food or beverages, and, in turn, consumers' desire for consumption and willingness to pay. Two studies demonstrate that an increase in packaging weight affects both desire and willingness to pay for the product. These effects are serially mediated by perceived flavor intensity and overall flavor evaluation. Based on these insights, implications for the design of food and beverages packaging are discussed.

  4. Touch-flavor transference: Assessing the effect of packaging weight on gustatory evaluations, desire for food and beverages, and willingness to pay

    Science.gov (United States)

    Kampfer, Kristina; Leischnig, Alexander; Spence, Charles

    2017-01-01

    Product packaging serves a number of distinct functions and influences the way in which consumers respond to various product offerings. The research reported here examines whether the haptic characteristics of a non-diagnostic product packaging cue, namely its weight, affects the response of consumers. This article reviews existing research on haptic transference and proposes a conceptual framework to explore how the weight of product packaging affects the flavor of the food or beverages, and, in turn, consumers’ desire for consumption and willingness to pay. Two studies demonstrate that an increase in packaging weight affects both desire and willingness to pay for the product. These effects are serially mediated by perceived flavor intensity and overall flavor evaluation. Based on these insights, implications for the design of food and beverages packaging are discussed. PMID:29020078

  5. Touch-flavor transference: Assessing the effect of packaging weight on gustatory evaluations, desire for food and beverages, and willingness to pay.

    Directory of Open Access Journals (Sweden)

    Kristina Kampfer

    Full Text Available Product packaging serves a number of distinct functions and influences the way in which consumers respond to various product offerings. The research reported here examines whether the haptic characteristics of a non-diagnostic product packaging cue, namely its weight, affects the response of consumers. This article reviews existing research on haptic transference and proposes a conceptual framework to explore how the weight of product packaging affects the flavor of the food or beverages, and, in turn, consumers' desire for consumption and willingness to pay. Two studies demonstrate that an increase in packaging weight affects both desire and willingness to pay for the product. These effects are serially mediated by perceived flavor intensity and overall flavor evaluation. Based on these insights, implications for the design of food and beverages packaging are discussed.

  6. Radionuclide ventriculography during rest and exercise: normal values

    International Nuclear Information System (INIS)

    Ludwig, E.B.; Marroni, B.J.; Achutti, A.C.; Anselmi, O.E.; Rabin, M.

    1983-01-01

    Twenty young volunteers of both sexes were examined by radioisotopic techniques to establish the normal range of ventricular function at rest and the response to a stress test (systolic arterious pressure X cardiac frequency > 25000). (M.A.C.) [pt

  7. Normal people working in normal organizations with normal equipment: system safety and cognition in a mid-air collision.

    Science.gov (United States)

    de Carvalho, Paulo Victor Rodrigues; Gomes, José Orlando; Huber, Gilbert Jacob; Vidal, Mario Cesar

    2009-05-01

    A fundamental challenge in improving the safety of complex systems is to understand how accidents emerge in normal working situations, with equipment functioning normally in normally structured organizations. We present a field study of the en route mid-air collision between a commercial carrier and an executive jet, in the clear afternoon Amazon sky in which 154 people lost their lives, that illustrates one response to this challenge. Our focus was on how and why the several safety barriers of a well structured air traffic system melted down enabling the occurrence of this tragedy, without any catastrophic component failure, and in a situation where everything was functioning normally. We identify strong consistencies and feedbacks regarding factors of system day-to-day functioning that made monitoring and awareness difficult, and the cognitive strategies that operators have developed to deal with overall system behavior. These findings emphasize the active problem-solving behavior needed in air traffic control work, and highlight how the day-to-day functioning of the system can jeopardize such behavior. An immediate consequence is that safety managers and engineers should review their traditional safety approach and accident models based on equipment failure probability, linear combinations of failures, rules and procedures, and human errors, to deal with complex patterns of coincidence possibilities, unexpected links, resonance among system functions and activities, and system cognition.

  8. Quantitation of regional cerebral blood flow corrected for partial volume effect using O-15 water and PET: II. Normal values and gray matter blood flow response to visual activation

    DEFF Research Database (Denmark)

    Law, I; Iida, H; Holm, S

    2000-01-01

    One of the most limiting factors for the accurate quantification of physiologic parameters with positron emission tomography (PET) is the partial volume effect (PVE). To assess the magnitude of this contribution to the measurement of regional cerebral blood flow (rCBF), the authors have formulated...... or 3D). Furthermore, the authors wanted to measure the activation response in the occipital gray matter compartment, and in doing so test the stability of the PTF, during perturbations of rCBF induced by visual stimulation. Eight dynamic PET scans were acquired per subject (n = 8), each for a duration...... of 6 minutes after IV bolus injection of H2(15)O. Four of these scans were performed using 2D and four using 3D acquisition. Visual stimulation was presented in four scans, and four scans were during rest. Model C was found optimal based on Akaike's Information Criteria (AIC) and had the smallest...

  9. The glycan-specific sulfotransferase (R77W)GalNAc-4-ST1 putatively responsible for peeling skin syndrome has normal properties consistent with a simple sequence polymorphisim.

    Science.gov (United States)

    Fiete, Dorothy; Mi, Yiling; Beranek, Mary; Baenziger, Nancy L; Baenziger, Jacques U

    2017-05-01

    Expanded access to DNA sequencing now fosters ready detection of site-specific human genome alterations whose actual significance requires in-depth functional study to rule in or out disease-causing mutations. This is a particular concern for genomic sequence differences in glycosyltransferases, whose implications are often difficult to assess. A recent whole-exome sequencing study identifies (c.229 C > T) in the GalNAc-4-ST1 glycosyltransferase (CHST8) as a disease-causing missense R77W mutation yielding the genodermatosis peeling skin syndrome (PSS) when homozygous. Cabral et al. (Genomics. 2012;99:202-208) cite this sequence change as reducing keratinocyte GalNAc-4-ST1 activity, thus decreasing glycosaminoglycan sulfation, as the mechanism for this blistering disorder. Such an identification could point toward potential clinical and/or prenatal diagnosis of a harmful medical condition. However, GalNAc-4-ST1 has minimal activity toward glycosaminoglycans, instead modifying terminal β1,4-linked GalNAc on N- and O-linked oligosaccharides on specific glycoproteins. We find expression, processing and catalytic activity of GalNAc-4-ST1 completely equivalent between wild type and (R77W) sulfotransferases. Moreover, keratinocytes have little or no GalNAc-4-ST1 mRNA, indicating that they do not express GalNAc-4-ST1. In addition, loss-of-function of GalNAc-4-ST1 primarily presents as reproductive system aberrations rather than skin effects. These findings, an allele frequency of 0.004357, and a 10-fold difference in prevalence of CHST8 (c.299 C > T, R77W) across different ethnic groups, suggest that this sequence represents a "passenger" distributed polymorphism, a simple sequence variant form of the enzyme having normal activity, rather than a "driver" disease-causing mutation that accounts for PSS. This study presents an example for guiding biomedical research initiatives, as well as medical and personal/family perspectives, regarding newly-identified genomic sequence

  10. Upper respiratory tract nociceptor stimulation and stress response following acute and repeated Cyfluthrin inhalation in normal and pregnant rats: Physiological rat-specific adaptions can easily be misunderstood as adversities.

    Science.gov (United States)

    Pauluhn, Juergen

    2018-01-05

    This paper reviews the results from past regulatory and mechanistic inhalation studies in rats with the type II pyrethroid Cyfluthrin. Apart from many chemical irritants, Cyfluthrin was shown to be a neuroexcitatory agent without any inherent tissue-destructive or irritant property. Thus, any Cyfluthrin-induced neuroexcitatory afferent sensory stimulus from peripheral nociceptors in the upper respiratory tract is likely to be perceived as a transient stimulus triggering annoyance and/or avoidance by both rats and humans. However, while thermolabile rats respond to such stresses reflexively, homeothermic humans appear to respond psychologically. With this focus in mind, past inhalation studies in rats and human volunteers were reevaluated and assessed to identify common denominators to such neuroexcitatory stimuli upon inhalation exposure. This analysis supports the conclusion that the adaptive physiological response occurring in rats secondary to such chemosensory stimuli requires inhalation exposures above the chemosensory threshold. Rats, a species known to undergo adaptively a hibernation-like physiological state upon environmental stresses, experienced reflexively-induced bradypnea, bradycardia, hypothermia, and changes in acid-base status during inhalation exposure. After cessation of the sensory stimulus, rapid recovery occurred. Physiological data of male and female rats from a 4-week repeated inhalation study (exposure 6-h/day, 5-times/week) were used to select concentration for a 10-day developmental inhalation toxicity study in pregnant rats. Maternal hypothermia and hypoventilation were identified as likely cause of fetal and placental growth retardations because of a maternal adaptation-driven reduced feto-placental transfer of oxygen. In summary, maternal reflex-hypothermia, reduced cardiac output and placental perfusion, and disruption of the gestation-related hyperventilation are believed to be the maternally mediated causes for developmental

  11. Visual attention and flexible normalization pools

    Science.gov (United States)

    Schwartz, Odelia; Coen-Cagli, Ruben

    2013-01-01

    Attention to a spatial location or feature in a visual scene can modulate the responses of cortical neurons and affect perceptual biases in illusions. We add attention to a cortical model of spatial context based on a well-founded account of natural scene statistics. The cortical model amounts to a generalized form of divisive normalization, in which the surround is in the normalization pool of the center target only if they are considered statistically dependent. Here we propose that attention influences this computation by accentuating the neural unit activations at the attended location, and that the amount of attentional influence of the surround on the center thus depends on whether center and surround are deemed in the same normalization pool. The resulting form of model extends a recent divisive normalization model of attention (Reynolds & Heeger, 2009). We simulate cortical surround orientation experiments with attention and show that the flexible model is suitable for capturing additional data and makes nontrivial testable predictions. PMID:23345413

  12. Normal stresses in semiflexible polymer hydrogels

    Science.gov (United States)

    Vahabi, M.; Vos, Bart E.; de Cagny, Henri C. G.; Bonn, Daniel; Koenderink, Gijsje H.; MacKintosh, F. C.

    2018-03-01

    Biopolymer gels such as fibrin and collagen networks are known to develop tensile axial stress when subject to torsion. This negative normal stress is opposite to the classical Poynting effect observed for most elastic solids including synthetic polymer gels, where torsion provokes a positive normal stress. As shown recently, this anomalous behavior in fibrin gels depends on the open, porous network structure of biopolymer gels, which facilitates interstitial fluid flow during shear and can be described by a phenomenological two-fluid model with viscous coupling between network and solvent. Here we extend this model and develop a microscopic model for the individual diagonal components of the stress tensor that determine the axial response of semiflexible polymer hydrogels. This microscopic model predicts that the magnitude of these stress components depends inversely on the characteristic strain for the onset of nonlinear shear stress, which we confirm experimentally by shear rheometry on fibrin gels. Moreover, our model predicts a transient behavior of the normal stress, which is in excellent agreement with the full time-dependent normal stress we measure.

  13. Role of the normal gut microbiota.

    Science.gov (United States)

    Jandhyala, Sai Manasa; Talukdar, Rupjyoti; Subramanyam, Chivkula; Vuyyuru, Harish; Sasikala, Mitnala; Nageshwar Reddy, D

    2015-08-07

    Relation between the gut microbiota and human health is being increasingly recognised. It is now well established that a healthy gut flora is largely responsible for overall health of the host. The normal human gut microbiota comprises of two major phyla, namely Bacteroidetes and Firmicutes. Though the gut microbiota in an infant appears haphazard, it starts resembling the adult flora by the age of 3 years. Nevertheless, there exist temporal and spatial variations in the microbial distribution from esophagus to the rectum all along the individual's life span. Developments in genome sequencing technologies and bioinformatics have now enabled scientists to study these microorganisms and their function and microbe-host interactions in an elaborate manner both in health and disease. The normal gut microbiota imparts specific function in host nutrient metabolism, xenobiotic and drug metabolism, maintenance of structural integrity of the gut mucosal barrier, immunomodulation, and protection against pathogens. Several factors play a role in shaping the normal gut microbiota. They include (1) the mode of delivery (vaginal or caesarean); (2) diet during infancy (breast milk or formula feeds) and adulthood (vegan based or meat based); and (3) use of antibiotics or antibiotic like molecules that are derived from the environment or the gut commensal community. A major concern of antibiotic use is the long-term alteration of the normal healthy gut microbiota and horizontal transfer of resistance genes that could result in reservoir of organisms with a multidrug resistant gene pool.

  14. Translation of the Children Helping Out--Responsibilities, Expectations and Supports (CHORES) questionnaire into Brazilian-Portuguese: semantic, idiomatic, conceptual and experiential equivalences and application in normal children and adolescents and in children with cerebral palsy.

    Science.gov (United States)

    Amaral, Maíra; Paula, Rebeca L; Drummond, Adriana; Dunn, Louise; Mancini, Marisa C

    2012-01-01

    The participation of children with disabilities in daily chores in different environments has been a therapeutic goal shared by both parents and rehabilitation professionals, leading to increased demand for instrument development. The Children Helping Out: Responsibilities, Expectations and Supports (CHORES) questionnaire was created with the objective of measuring child and teenager participation in daily household tasks. To translate the CHORES questionnaire into Brazilian Portuguese, evaluate semantic, idiomatic, experiential, and conceptual equivalences, apply the questionnaire to children and teenagers with and without disabilities, and test its test-retest reliability. Methodological study developed through the following stages: (1) translation of the questionnaire by two different translators; (2) synthesis of translations; (3) back-translation into English; (4) analysis by an expert committee to develop the pre-final version; (5) test-retest reliability; (6) administration to a sample of 50 parents of children with and without disabilities. The CHORES translation was validated in all stages. The implemented adaptations aimed to improve the understanding of the instrument's content by families of different socioeconomic and educational levels. The questionnaire showed strong consistency within a 7 to 14-day interval (ICCs=0.93 a 0.97; p=0.0001). After application, there was no need to change any items in the questionnaire. The translation of the CHORES questionnaire into Brazilian Portuguese offers a unique instrument for health professionals in Brazil, enabling the documentation of child and teenager participation in daily household tasks and making it possible to develop scientific investigation on the topic.

  15. Complete Normal Ordering 1: Foundations

    CERN Document Server

    Ellis, John; Skliros, Dimitri P.

    2016-01-01

    We introduce a new prescription for quantising scalar field theories perturbatively around a true minimum of the full quantum effective action, which is to `complete normal order' the bare action of interest. When the true vacuum of the theory is located at zero field value, the key property of this prescription is the automatic cancellation, to any finite order in perturbation theory, of all tadpole and, more generally, all `cephalopod' Feynman diagrams. The latter are connected diagrams that can be disconnected into two pieces by cutting one internal vertex, with either one or both pieces free from external lines. In addition, this procedure of `complete normal ordering' (which is an extension of the standard field theory definition of normal ordering) reduces by a substantial factor the number of Feynman diagrams to be calculated at any given loop order. We illustrate explicitly the complete normal ordering procedure and the cancellation of cephalopod diagrams in scalar field theories with non-derivative i...

  16. The normal and pathological language

    OpenAIRE

    Espejo, Luis D.

    2014-01-01

    The extraordinary development of normal and pathological psychology has achieved in recent decades, thanks to the dual method of objective observation and oral survey enabled the researcher spirit of neuro-psychiatrist penetrate the intimate mechanism of the nervous system whose supreme manifestation is thought. It is normal psychology explaining the complicated game of perceptions: their methods of transmission, their centers of projection, its transformations and its synthesis to construct ...

  17. Corticocortical feedback increases the spatial extent of normalization.

    Science.gov (United States)

    Nassi, Jonathan J; Gómez-Laberge, Camille; Kreiman, Gabriel; Born, Richard T

    2014-01-01

    Normalization has been proposed as a canonical computation operating across different brain regions, sensory modalities, and species. It provides a good phenomenological description of non-linear response properties in primary visual cortex (V1), including the contrast response function and surround suppression. Despite its widespread application throughout the visual system, the underlying neural mechanisms remain largely unknown. We recently observed that corticocortical feedback contributes to surround suppression in V1, raising the possibility that feedback acts through normalization. To test this idea, we characterized area summation and contrast response properties in V1 with and without feedback from V2 and V3 in alert macaques and applied a standard normalization model to the data. Area summation properties were well explained by a form of divisive normalization, which computes the ratio between a neuron's driving input and the spatially integrated activity of a "normalization pool." Feedback inactivation reduced surround suppression by shrinking the spatial extent of the normalization pool. This effect was independent of the gain modulation thought to mediate the influence of contrast on area summation, which remained intact during feedback inactivation. Contrast sensitivity within the receptive field center was also unaffected by feedback inactivation, providing further evidence that feedback participates in normalization independent of the circuit mechanisms involved in modulating contrast gain and saturation. These results suggest that corticocortical feedback contributes to surround suppression by increasing the visuotopic extent of normalization and, via this mechanism, feedback can play a critical role in contextual information processing.

  18. Corticocortical feedback increases the spatial extent of normalization

    Science.gov (United States)

    Nassi, Jonathan J.; Gómez-Laberge, Camille; Kreiman, Gabriel; Born, Richard T.

    2014-01-01

    Normalization has been proposed as a canonical computation operating across different brain regions, sensory modalities, and species. It provides a good phenomenological description of non-linear response properties in primary visual cortex (V1), including the contrast response function and surround suppression. Despite its widespread application throughout the visual system, the underlying neural mechanisms remain largely unknown. We recently observed that corticocortical feedback contributes to surround suppression in V1, raising the possibility that feedback acts through normalization. To test this idea, we characterized area summation and contrast response properties in V1 with and without feedback from V2 and V3 in alert macaques and applied a standard normalization model to the data. Area summation properties were well explained by a form of divisive normalization, which computes the ratio between a neuron's driving input and the spatially integrated activity of a “normalization pool.” Feedback inactivation reduced surround suppression by shrinking the spatial extent of the normalization pool. This effect was independent of the gain modulation thought to mediate the influence of contrast on area summation, which remained intact during feedback inactivation. Contrast sensitivity within the receptive field center was also unaffected by feedback inactivation, providing further evidence that feedback participates in normalization independent of the circuit mechanisms involved in modulating contrast gain and saturation. These results suggest that corticocortical feedback contributes to surround suppression by increasing the visuotopic extent of normalization and, via this mechanism, feedback can play a critical role in contextual information processing. PMID:24910596

  19. Is normal science good science?

    Directory of Open Access Journals (Sweden)

    Adrianna Kępińska

    2015-09-01

    Full Text Available “Normal science” is a concept introduced by Thomas Kuhn in The Structure of Scientific Revolutions (1962. In Kuhn’s view, normal science means “puzzle solving”, solving problems within the paradigm—framework most successful in solving current major scientific problems—rather than producing major novelties. This paper examines Kuhnian and Popperian accounts of normal science and their criticisms to assess if normal science is good. The advantage of normal science according to Kuhn was “psychological”: subjective satisfaction from successful “puzzle solving”. Popper argues for an “intellectual” science, one that consistently refutes conjectures (hypotheses and offers new ideas rather than focus on personal advantages. His account is criticized as too impersonal and idealistic. Feyerabend’s perspective seems more balanced; he argues for a community that would introduce new ideas, defend old ones, and enable scientists to develop in line with their subjective preferences. The paper concludes that normal science has no one clear-cut set of criteria encompassing its meaning and enabling clear assessment.

  20. nth roots of normal contractions

    International Nuclear Information System (INIS)

    Duggal, B.P.

    1992-07-01

    Given a complex separable Hilbert space H and a contraction A on H such that A n , n≥2 some integer, is normal it is shown that if the defect operator D A = (1 - A * A) 1/2 is of the Hilbert-Schmidt class, then A is similar to a normal contraction, either A or A 2 is normal, and if A 2 is normal (but A is not) then there is a normal contraction N and a positive definite contraction P of trace class such that parallel to A - N parallel to 1 = 1/2 parallel to P + P parallel to 1 (where parallel to · parallel to 1 denotes the trace norm). If T is a compact contraction such that its characteristics function admits a scalar factor, if T = A n for some integer n≥2 and contraction A with simple eigen-values, and if both T and A satisfy a ''reductive property'', then A is a compact normal contraction. (author). 16 refs

  1. The effects of shear and normal stress paths on rock friction

    International Nuclear Information System (INIS)

    Olsson, W.A.

    1990-01-01

    The effect of variable normal stress on the coefficient of friction of smooth artificial surfaces in welded tuff was studied. The shear stress response to changes in normal stress during constant-velocity sliding suggests that friction depends on the history of the normal stress; or, more generally, the path in shear/normal stress space. 6 refs., 5 figs

  2. Autobiographical Memory in Normal Ageing and Dementia

    Directory of Open Access Journals (Sweden)

    Harvey J. Sagar

    1991-01-01

    Full Text Available Autobiographical memories in young and elderly normal subjects are drawn mostly from the recent past but elderly subjects relate a second peak of memories from early adulthood. Memory for remote past public events is relatively preserved in dementia, possibly reflecting integrity of semantic relative to episodic memory. We examined recall of specific, consistent autobiographical episodes in Alzheimer's disease (AD in response to cue words. Patients and control subjects drew most memories from the recent 20 years: episode age related to anterograde memory function but not subject age or dementia. Subjects also related a secondary peak of memories from early adulthood; episode age related to subject age and severity of dementia. The results suggest that preferential recall of memories from early adulthood is based on the salience of retrieval cues, altered by age and dementia, superimposed on a temporal gradient of semantic memory. Further, AD shows behavioural similarity to normal ageing.

  3. Precaval retropancreatic space: Normal anatomy

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Yeon Hee; Kim, Ki Whang; Kim, Myung Jin; Yoo, Hyung Sik; Lee, Jong Tae [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    1992-07-15

    The authors defined precaval retropancreatic space as the space between pancreatic head with portal vein and IVC and analyzed the CT findings of this space to know the normal structures and size in this space. We evaluated 100 cases of normal abdominal CT scan to find out normal anatomic structures of precaval retropancreatic space retrospectively. We also measured the distance between these structures and calculated the minimum, maximum and mean values. At the splenoportal confluence level, normal structures between portal vein and IVC were vessel (21%), lymph node (19%), and caudate lobe of liver (2%) in order of frequency. The maximum AP diameter of portocaval lymph node was 4 mm. Common bile duct (CBD) was seen in 44% and the diameter was mean 3 mm and maximum 11 mm. CBD was located in extrapancreatic (75%) and lateral (60.6%) to pancreatic head. At IVC-left renal vein level, the maximum distance between CBD and IVC was 5 mm and the structure between posterior pancreatic surface and IVC was only fat tissue. Knowledge of these normal structures and measurement will be helpful in differentiating pancreatic mass with retropancreatic mass such as lymphadenopathy.

  4. Normal probability plots with confidence.

    Science.gov (United States)

    Chantarangsi, Wanpen; Liu, Wei; Bretz, Frank; Kiatsupaibul, Seksan; Hayter, Anthony J; Wan, Fang

    2015-01-01

    Normal probability plots are widely used as a statistical tool for assessing whether an observed simple random sample is drawn from a normally distributed population. The users, however, have to judge subjectively, if no objective rule is provided, whether the plotted points fall close to a straight line. In this paper, we focus on how a normal probability plot can be augmented by intervals for all the points so that, if the population distribution is normal, then all the points should fall into the corresponding intervals simultaneously with probability 1-α. These simultaneous 1-α probability intervals provide therefore an objective mean to judge whether the plotted points fall close to the straight line: the plotted points fall close to the straight line if and only if all the points fall into the corresponding intervals. The powers of several normal probability plot based (graphical) tests and the most popular nongraphical Anderson-Darling and Shapiro-Wilk tests are compared by simulation. Based on this comparison, recommendations are given in Section 3 on which graphical tests should be used in what circumstances. An example is provided to illustrate the methods. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. 3j Symbols: To Normalize or Not to Normalize?

    Science.gov (United States)

    van Veenendaal, Michel

    2011-01-01

    The systematic use of alternative normalization constants for 3j symbols can lead to a more natural expression of quantities, such as vector products and spherical tensor operators. The redefined coupling constants directly equate tensor products to the inner and outer products without any additional square roots. The approach is extended to…

  6. An Experiential Learning Activity Demonstrating Normal and Phobic Anxiety

    Science.gov (United States)

    Canu, Will H.

    2008-01-01

    This article describes an activity for an undergraduate abnormal psychology course that used student-generated data to illustrate normal versus clinically significant anxiety responses related to specific phobias. Students (N = 37) viewed 14 images of low- or high-anxiety valence and rated their subjective response to each. Discussion in a…

  7. CT and MRI normal findings

    International Nuclear Information System (INIS)

    Moeller, T.B.; Reif, E.

    1998-01-01

    This book gives answers to questions frequently heard especially from trainees and doctors not specialising in the field of radiology: Is that a normal finding? How do I decide? What are the objective criteria? The information presented is three-fold. The normal findings of the usual CT and MRI examinations are shown with high-quality pictures serving as a reference, with inscribed important additional information on measures, angles and other criteria describing the normal conditions. These criteria are further explained and evaluated in accompanying texts which also teach the systematic approach for individual picture analysis, and include a check list of major aspects, as a didactic guide for learning. The book is primarily intended for students, radiographers, radiology trainees and doctors from other medical fields, but radiology specialists will also find useful details of help in special cases. (orig./CB) [de

  8. Marrow transfusions into normal recipients

    International Nuclear Information System (INIS)

    Brecher, G.

    1983-01-01

    During the past several years we have explored the transfusion of bone marrow into normal nonirradiated mice. While transfused marrow proliferates readily in irradiated animals, only minimal proliferation takes place in nonirradiated recipients. It has generally been assumed that this was due to the lack of available proliferative sites in recipients with normal marrow. Last year we were able to report that the transfusion of 200 million bone marrow cells (about 2/3 of the total complement of marrow cells of a normal mouse) resulted in 20% to 25% of the recipient's marrow being replaced by donor marrow. Thus we can now study the behavior of animals that have been transfused (donor) and endogenous (recipient) marrow cells, although none of the tissues of either donor or recipient have been irradiated. With these animals we hope to investigate the nature of the peculiar phenomenon of serial exhaustion of marrow, also referred to as the limited self-replicability of stem cells

  9. The construction of normal expectations

    DEFF Research Database (Denmark)

    Quitzau, Maj-Britt; Røpke, Inge

    2008-01-01

    The gradual upward changes of standards in normal everyday life have significant environmental implications, and it is therefore important to study how these changes come about. The intention of the article is to analyze the social construction of normal expectations through a case study. The case...... concerns the present boom in bathroom renovations in Denmark, which offers an excellent opportunity to study the interplay between a wide variety of consumption drivers and social changes pointing toward long-term changes of normal expectations regarding bathroom standards. The study is problemoriented...... and transdisciplinary and draws on a wide range of sociological, anthropological, and economic theories. The empirical basis comprises a combination of statistics, a review of magazine and media coverage, visits to exhibitions, and qualitative interviews. A variety of consumption drivers are identified. Among...

  10. Normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  11. Random Generators and Normal Numbers

    OpenAIRE

    Bailey, David H.; Crandall, Richard E.

    2002-01-01

    Pursuant to the authors' previous chaotic-dynamical model for random digits of fundamental constants, we investigate a complementary, statistical picture in which pseudorandom number generators (PRNGs) are central. Some rigorous results are achieved: We establish b-normality for constants of the form $\\sum_i 1/(b^{m_i} c^{n_i})$ for certain sequences $(m_i), (n_i)$ of integers. This work unifies and extends previously known classes of explicit normals. We prove that for coprime $b,c>1$ the...

  12. Electronic tongue: An analytical gustatory tool

    Directory of Open Access Journals (Sweden)

    Rewanthwar Swathi Latha

    2012-01-01

    Full Text Available Taste is an important organoleptic property governing acceptance of products for administration through mouth. But majority of drugs available are bitter in taste. For patient acceptability and compliance, bitter taste drugs are masked by adding several flavoring agents. Thus, taste assessment is one important quality control parameter for evaluating taste-masked formulations. The primary method for the taste measurement of drug substances and formulations is by human panelists. The use of sensory panelists is very difficult and problematic in industry and this is due to the potential toxicity of drugs and subjectivity of taste panelists, problems in recruiting taste panelists, motivation and panel maintenance are significantly difficult when working with unpleasant products. Furthermore, Food and Drug Administration (FDA-unapproved molecules cannot be tested. Therefore, analytical taste-sensing multichannel sensory system called as electronic tongue (e-tongue or artificial tongue which can assess taste have been replacing the sensory panelists. Thus, e-tongue includes benefits like reducing reliance on human panel. The present review focuses on the electrochemical concepts in instrumentation, performance qualification of E-tongue, and applications in various fields.

  13. Complete normal ordering 1: Foundations

    Directory of Open Access Journals (Sweden)

    John Ellis

    2016-08-01

    Full Text Available We introduce a new prescription for quantising scalar field theories (in generic spacetime dimension and background perturbatively around a true minimum of the full quantum effective action, which is to ‘complete normal order’ the bare action of interest. When the true vacuum of the theory is located at zero field value, the key property of this prescription is the automatic cancellation, to any finite order in perturbation theory, of all tadpole and, more generally, all ‘cephalopod’ Feynman diagrams. The latter are connected diagrams that can be disconnected into two pieces by cutting one internal vertex, with either one or both pieces free from external lines. In addition, this procedure of ‘complete normal ordering’ (which is an extension of the standard field theory definition of normal ordering reduces by a substantial factor the number of Feynman diagrams to be calculated at any given loop order. We illustrate explicitly the complete normal ordering procedure and the cancellation of cephalopod diagrams in scalar field theories with non-derivative interactions, and by using a point splitting ‘trick’ we extend this result to theories with derivative interactions, such as those appearing as non-linear σ-models in the world-sheet formulation of string theory. We focus here on theories with trivial vacua, generalising the discussion to non-trivial vacua in a follow-up paper.

  14. Normal forms in Poisson geometry

    NARCIS (Netherlands)

    Marcut, I.T.

    2013-01-01

    The structure of Poisson manifolds is highly nontrivial even locally. The first important result in this direction is Conn's linearization theorem around fixed points. One of the main results of this thesis (Theorem 2) is a normal form theorem in Poisson geometry, which is the Poisson-geometric

  15. Mixed normal inference on multicointegration

    NARCIS (Netherlands)

    Boswijk, H.P.

    2009-01-01

    Asymptotic likelihood analysis of cointegration in I(2) models, see Johansen (1997, 2006), Boswijk (2000) and Paruolo (2000), has shown that inference on most parameters is mixed normal, implying hypothesis test statistics with an asymptotic 2 null distribution. The asymptotic distribution of the

  16. Is My Child's Appetite Normal?

    Science.gov (United States)

    Is My Child’s Appetite Normal? Cayla, who is 4 years old, did not finish her lunch. But she is ready to play. Her ... snack for later. That is okay! Your child’s appetite changes. Children do not grow as fast in ...

  17. Transforming Normal Programs by Replacement

    NARCIS (Netherlands)

    Bossi, Annalisa; Pettorossi, A.; Cocco, Nicoletta; Etalle, Sandro

    1992-01-01

    The replacement transformation operation, already defined in [28], is studied wrt normal programs. We give applicability conditions able to ensure the correctness of the operation wrt Fitting's and Kunen's semantics. We show how replacement can mimic other transformation operations such as thinning,

  18. Semigroups of data normalization functions

    NARCIS (Netherlands)

    Warrens, Matthijs J.

    2016-01-01

    Variable centering and scaling are functions that are typically used in data normalization. Various properties of centering and scaling functions are presented. It is shown that if we use two centering functions (or scaling functions) successively, the result depends on the order in which the

  19. Neutron RBE for normal tissues

    International Nuclear Information System (INIS)

    Field, S.B.; Hornsey, S.

    1979-01-01

    RBE for various normal tissues is considered as a function of neutron dose per fraction. Results from a variety of centres are reviewed. It is shown that RBE is dependent on neutron energy and is tissue dependent, but is not specially high for the more critical tissues or for damage occurring late after irradiation. (author)

  20. Normal and abnormal growth plate

    International Nuclear Information System (INIS)

    Kumar, R.; Madewell, J.E.; Swischuk, L.E.

    1987-01-01

    Skeletal growth is a dynamic process. A knowledge of the structure and function of the normal growth plate is essential in order to understand the pathophysiology of abnormal skeletal growth in various diseases. In this well-illustrated article, the authors provide a radiographic classification of abnormal growth plates and discuss mechanisms that lead to growth plate abnormalities

  1. Biochemical Response Of Normal Albino Rats To The Addition

    African Journals Online (AJOL)

    Science World Journal Vol 9 (No 1) 2014 ... to arrest such disorder; thereby reducing the burden of cost of treatment ... occur in diabetes resulting in morbidity and death ... vegetable, blood tonic and remedy for liver diseases and ..... be good appetizer and flavor (Afonne et al., 2002; .... year 2000 and projections for 2030.

  2. Normal RNAi response in human fragile x fibroblasts

    DEFF Research Database (Denmark)

    Madsen, Charlotte; Grønskov, Karen; Brøndum-Nielsen, Karen

    2009-01-01

    BACKGROUND: Fragile x syndrome is caused by loss of expression of the FMRP protein involved in the control of a large number of mRNA targets. The Drosophila ortholog dFXR interacts with a protein complex that includes Argonaute2, an essential component of the RNA-induced silencing complex (RISC...

  3. Superconducting versus normal conducting cavities

    CERN Document Server

    Podlech, Holger

    2013-01-01

    One of the most important issues of high-power hadron linacs is the choice of technology with respect to superconducting or room-temperature operation. The favour for a specific technology depends on several parameters such as the beam energy, beam current, beam power and duty factor. This contribution gives an overview of the comparison between superconducting and normal conducting cavities. This includes basic radiofrequency (RF) parameters, design criteria, limitations, required RF and plug power as well as case studies.

  4. Lithium control during normal operation

    International Nuclear Information System (INIS)

    Suryanarayan, S.; Jain, D.

    2010-01-01

    Periodic increases in lithium (Li) concentrations in the primary heat transport (PHT) system during normal operation are a generic problem at CANDU® stations. Lithiated mixed bed ion exchange resins are used at stations for pH control in the PHT system. Typically tight chemistry controls including Li concentrations are maintained in the PHT water. The reason for the Li increases during normal operation at CANDU stations such as Pickering was not fully understood. In order to address this issue a two pronged approach was employed. Firstly, PNGS-A data and information from other available sources was reviewed in an effort to identify possible factors that may contribute to the observed Li variations. Secondly, experimental studies were carried out to assess the importance of these factors in order to establish reasons for Li increases during normal operation. Based on the results of these studies, plausible mechanisms/reasons for Li increases have been identified and recommendations made for proactive control of Li concentrations in the PHT system. (author)

  5. Normalization of Gravitational Acceleration Models

    Science.gov (United States)

    Eckman, Randy A.; Brown, Aaron J.; Adamo, Daniel R.

    2011-01-01

    Unlike the uniform density spherical shell approximations of Newton, the con- sequence of spaceflight in the real universe is that gravitational fields are sensitive to the nonsphericity of their generating central bodies. The gravitational potential of a nonspherical central body is typically resolved using spherical harmonic approximations. However, attempting to directly calculate the spherical harmonic approximations results in at least two singularities which must be removed in order to generalize the method and solve for any possible orbit, including polar orbits. Three unique algorithms have been developed to eliminate these singularities by Samuel Pines [1], Bill Lear [2], and Robert Gottlieb [3]. This paper documents the methodical normalization of two1 of the three known formulations for singularity-free gravitational acceleration (namely, the Lear [2] and Gottlieb [3] algorithms) and formulates a general method for defining normalization parameters used to generate normalized Legendre Polynomials and ALFs for any algorithm. A treatment of the conventional formulation of the gravitational potential and acceleration is also provided, in addition to a brief overview of the philosophical differences between the three known singularity-free algorithms.

  6. "Ser diferente é normal?"/"Being different: is it normal?"

    Directory of Open Access Journals (Sweden)

    Viviane Veras

    2007-01-01

    Full Text Available A pergunta título deste trabalho retoma o slogan “Ser diferente é normal”, que é parte da campanha criada para uma organização não-governamental que atende portadores de Síndrome de Down. O objetivo é a inclusão social da pessoa com deficiência e o primeiro passo foi propor a inclusão de um grupo de diferentes no grupo dito normal. No vídeo de lançamento da campanha, o diferente, identificado como normal, é mostrado por meio de exemplos – um negro com cabelo black-power, um skin-head, um corpo tatuado, um corpo feminino halterofílico, uma família hippie, uma garota com síndrome de Down. A visão da adolescente dançando reduz, de certo modo, o efeito imaginário que vai além da síndrome, uma vez que apenas o corpo com seus olhinhos puxados se destacam, e não se interrogam questões cognitivas. Minha proposta é refletir sobre o estatuto paradoxal do exemplo, tal como é trabalhado nesse vídeo: se, por definição, um exemplo mostra de fato seu pertencimento a uma classe, pode-se concluir que é exatamente por ser exemplar que ele se encontra fora dela, no exato momento em que a exibe e define. The question in the title of this paper refers to the slogan "ser diferente é normal" ("It´s normal to be different", which is part of a campaign created for a NGO that supports people with Down syndrome. The objective of the campaign is to promote the social inclusion of individuals with Down syndrome, and the first step was to propose the inclusion of a group of "differents" in the so-called normal group. The film launching the campaign shows the different identified as normal by means of examples: a black man exhibiting blackpower haircut, a skin-head, a tattooed body, an over-athletic female body, a hippie family and a girl with Down syndrome. The vision of the dancing teenager lessens the imaginary effect that surpasses the syndrome, since only her body and her little oriental eyes stand out and no cognitive issues are

  7. Cross Correlation versus Normalized Mutual Information on Image Registration

    Science.gov (United States)

    Tan, Bin; Tilton, James C.; Lin, Guoqing

    2016-01-01

    This is the first study to quantitatively assess and compare cross correlation and normalized mutual information methods used to register images in subpixel scale. The study shows that the normalized mutual information method is less sensitive to unaligned edges due to the spectral response differences than is cross correlation. This characteristic makes the normalized image resolution a better candidate for band to band registration. Improved band-to-band registration in the data from satellite-borne instruments will result in improved retrievals of key science measurements such as cloud properties, vegetation, snow and fire.

  8. Normalization reduces intersubject variability in cervical vestibular evoked myogenic potentials.

    Science.gov (United States)

    van Tilburg, Mark J; Herrmann, Barbara S; Guinan, John J; Rauch, Steven D

    2014-09-01

    Cervical vestibular evoked myogenic potentials are used to assess saccular and inferior vestibular nerve function. Normalization of the VEMP waveform has been proposed to reduce the variability in vestibular evoked myogenic potentials by correcting for muscle activation. In this study, we test the hypothesis that normalization of the raw cervical VEMP waveform causes a significant decrease in the intersubject variability. Prospective cohort study. Large specialty hospital, department of otolaryngology. Twenty healthy subjects were used in this study. All subjects underwent cervical vestibular evoked myogenic potential testing using short tone bursts at 250, 500, 750, and 1,000 Hz. Both intersubject and intrasubject variability was assessed. Variability between raw and normalized peak-to-peak amplitudes was compared using the coefficient of variation. Intrasubject variability was assessed using the intraclass correlation coefficient and interaural asymmetry ratio. cVEMPs were present in most ears. Highest peak-to-peak amplitudes were recorded at 750 Hz. Normalization did not alter cVEMP tuning characteristics. Normalization of the cVEMP response caused a significant reduction in intersubject variability of the peak-to-peak amplitude. No significant change was seen in the intrasubject variability. Normalization significantly reduces cVEMP intersubject variability in healthy subjects without altering cVEMP characteristics. By reducing cVEMP amplitude variation due to nonsaccular, muscle-related factors, cVEMP normalization is expected to improve the ability to distinguish between healthy and pathologic responses in the clinical application of cVEMP testing.

  9. Understanding a Normal Distribution of Data.

    Science.gov (United States)

    Maltenfort, Mitchell G

    2015-12-01

    Assuming data follow a normal distribution is essential for many common statistical tests. However, what are normal data and when can we assume that a data set follows this distribution? What can be done to analyze non-normal data?

  10. Quantiles for Finite Mixtures of Normal Distributions

    Science.gov (United States)

    Rahman, Mezbahur; Rahman, Rumanur; Pearson, Larry M.

    2006-01-01

    Quantiles for finite mixtures of normal distributions are computed. The difference between a linear combination of independent normal random variables and a linear combination of independent normal densities is emphasized. (Contains 3 tables and 1 figure.)

  11. Modulation of taste responsiveness by the satiation hormone peptide YY

    Science.gov (United States)

    La Sala, Michael S.; Hurtado, Maria D.; Brown, Alicia R.; Bohórquez, Diego V.; Liddle, Rodger A.; Herzog, Herbert; Zolotukhin, Sergei; Dotson, Cedrick D.

    2013-01-01

    It has been hypothesized that the peripheral taste system may be modulated in the context of an animal's metabolic state. One purported mechanism for this phenomenon is that circulating gastrointestinal peptides modulate the functioning of the peripheral gustatory system. Recent evidence suggests endocrine signaling in the oral cavity can influence food intake (FI) and satiety. We hypothesized that these hormones may be affecting FI by influencing taste perception. We used immunohistochemistry along with genetic knockout models and the specific reconstitution of peptide YY (PYY) in saliva using gene therapy protocols to identify a role for PYY signaling in taste. We show that PYY is expressed in subsets of taste cells in murine taste buds. We also show, using brief-access testing with PYY knockouts, that PYY signaling modulates responsiveness to bitter-tasting stimuli, as well as to lipid emulsions. We show that salivary PYY augmentation, via viral vector therapy, rescues behavioral responsiveness to a lipid emulsion but not to bitter stimuli and that this response is likely mediated via activation of Y2 receptors localized apically in taste cells. Our findings suggest distinct functions for PYY produced locally in taste cells vs. that circulating systemically.—La Sala, M. S., Hurtado, M. D., Brown, A. R., Bohórquez, D. V., Liddle, R. A., Herzog, H., Zolotukhin, S., Dotson, C. D. Modulation of taste responsiveness by the satiation hormone peptide YY. PMID:24043261

  12. A locally adaptive normal distribution

    DEFF Research Database (Denmark)

    Arvanitidis, Georgios; Hansen, Lars Kai; Hauberg, Søren

    2016-01-01

    entropy distribution under the given metric. The underlying metric is, however, non-parametric. We develop a maximum likelihood algorithm to infer the distribution parameters that relies on a combination of gradient descent and Monte Carlo integration. We further extend the LAND to mixture models......The multivariate normal density is a monotonic function of the distance to the mean, and its ellipsoidal shape is due to the underlying Euclidean metric. We suggest to replace this metric with a locally adaptive, smoothly changing (Riemannian) metric that favors regions of high local density...

  13. Normal pediatric postmortem CT appearances

    Energy Technology Data Exchange (ETDEWEB)

    Klein, Willemijn M.; Bosboom, Dennis G.H.; Koopmanschap, Desiree H.J.L.M. [Radboud University Medical Center, Department of Radiology and Nuclear Medicine, Nijmegen (Netherlands); Nievelstein, Rutger A.J. [University Medical Center Utrecht, Department of Radiology, Utrecht (Netherlands); Nikkels, Peter G.J. [University Medical Center Utrecht, Department of Pathology, Utrecht (Netherlands); Rijn, Rick R. van [Academic Medical Center, Department of Radiology, Amsterdam (Netherlands)

    2015-04-01

    Postmortem radiology is a rapidly developing specialty that is increasingly used as an adjunct to or substitute for conventional autopsy. The goal is to find patterns of disease and possibly the cause of death. Postmortem CT images bring to light processes of decomposition most radiologists are unfamiliar with. These postmortem changes, such as the formation of gas and edema, should not be mistaken for pathological processes that occur in living persons. In this review we discuss the normal postmortem thoraco-abdominal changes and how these appear on CT images, as well as how to differentiate these findings from those of pathological processes. (orig.)

  14. Multispectral histogram normalization contrast enhancement

    Science.gov (United States)

    Soha, J. M.; Schwartz, A. A.

    1979-01-01

    A multispectral histogram normalization or decorrelation enhancement which achieves effective color composites by removing interband correlation is described. The enhancement procedure employs either linear or nonlinear transformations to equalize principal component variances. An additional rotation to any set of orthogonal coordinates is thus possible, while full histogram utilization is maintained by avoiding the reintroduction of correlation. For the three-dimensional case, the enhancement procedure may be implemented with a lookup table. An application of the enhancement to Landsat multispectral scanning imagery is presented.

  15. Normal modes and continuous spectra

    International Nuclear Information System (INIS)

    Balmforth, N.J.; Morrison, P.J.

    1994-12-01

    The authors consider stability problems arising in fluids, plasmas and stellar systems that contain singularities resulting from wave-mean flow or wave-particle resonances. Such resonances lead to singularities in the differential equations determining the normal modes at the so-called critical points or layers. The locations of the singularities are determined by the eigenvalue of the problem, and as a result, the spectrum of eigenvalues forms a continuum. They outline a method to construct the singular eigenfunctions comprising the continuum for a variety of problems

  16. Update on normal tension glaucoma

    Directory of Open Access Journals (Sweden)

    Jyotiranjan Mallick

    2016-01-01

    Full Text Available Normal tension glaucoma (NTG is labelled when typical glaucomatous disc changes, visual field defects and open anterior chamber angles are associated with intraocular pressure (IOP constantly below 21 mmHg. Chronic low vascular perfusion, Raynaud's phenomenon, migraine, nocturnal systemic hypotension and over-treated systemic hypertension are the main causes of normal tension glaucoma. Goldmann applanation tonometry, gonioscopy, slit lamp biomicroscopy, optical coherence tomography and visual field analysis are the main tools of investigation for the diagnosis of NTG. Management follows the same principles of treatment for other chronic glaucomas: To reduce IOP by a substantial amount, sufficient to prevent disabling visual loss. Treatment is generally aimed to lower IOP by 30% from pre-existing levels to 12-14 mmHg. Betaxolol, brimonidine, prostaglandin analogues, trabeculectomy (in refractory cases, systemic calcium channel blockers (such as nifedipine and 24-hour monitoring of blood pressure are considered in the management of NTG. The present review summarises risk factors, causes, pathogenesis, diagnosis and management of NTG.

  17. Normal variation of hepatic artery

    International Nuclear Information System (INIS)

    Kim, Inn; Nam, Myung Hyun; Rhim, Hyun Chul; Koh, Byung Hee; Seo, Heung Suk; Kim, Soon Yong

    1987-01-01

    This study was an analyses of blood supply of the liver in 125 patients who received hepatic arteriography and abdominal aortography from Jan. 1984 to Dec. 1986 at the Department of Radiology of Hanyang University Hospital. A. Variations in extrahepatic arteries: 1. The normal extrahepatic artery pattern occurred in 106 of 125 cases (84.8%) ; Right hepatic and left hepatic arteries arising from the hepatic artery proper and hepatic artery proper arising from the common hepatic artery. 2. The most common type of variation of extrahepatic artery was replaced right hepatic artery from superior mesenteric artery: 6 of 125 cases (4.8%). B. Variations in intrahepatic arteries: 1. The normal intrahepatic artery pattern occurred in 83 of 125 cases (66.4%). Right hepatic and left hepatic arteries arising from the hepatic artery proper and middle hepatic artery arising from lower portion of the umbilical point of left hepatic artery. 2. The most common variation of intrahepatic arteries was middle hepatic artery. 3. Among the variation of middle hepatic artery; Right, middle and left hepatic arteries arising from the same location at the hepatic artery proper was the most common type; 17 of 125 cases (13.6%)

  18. Is My Penis Normal? (For Teens)

    Science.gov (United States)

    ... Videos for Educators Search English Español Is My Penis Normal? KidsHealth / For Teens / Is My Penis Normal? Print en español ¿Es normal mi pene? ... any guy who's ever worried about whether his penis is a normal size. There's a fairly wide ...

  19. Normal vibrations in gallium arsenide

    International Nuclear Information System (INIS)

    Dolling, G.; Waugh, J.L.T.

    1964-01-01

    The triple axis crystal spectrometer at Chalk River has been used to observe coherent slow neutron scattering from a single crystal of pure gallium arsenide at 296 o K. The frequencies of normal modes of vibration propagating in the [ζ00], (ζζζ], and (0ζζ] crystal directions have been determined with a precision of between 1 and 2·5 per cent. A limited number of normal modes have also been studied at 95 and 184 o K. Considerable difficulty was experienced in obtaining welt resolved neutron peaks corresponding to the two non-degenerate optic modes for very small wave-vector, particularly at 296 o K. However, from a comparison of results obtained under various experimental conditions at several different points in reciprocal space, frequencies (units 10 12 c/s) for these modes (at 296 o K) have been assigned: T 8·02±0·08 and L 8·55±02. Other specific normal modes, with their measured frequencies are (a) (1,0,0): TO 7·56 ± 008, TA 2·36 ± 0·015, LO 7·22 ± 0·15, LA 6·80 ± 0·06; (b) (0·5, 0·5, 0·5): TO 7·84 ± 0·12, TA 1·86 ± 0·02, LO 7·15 ± 0·07, LA 6·26 ± 0·10; (c) (0, 0·65, 0·65): optic 8·08 ±0·13, 7·54 ± 0·12 and 6·57 ± 0·11, acoustic 5·58 ± 0·08, 3·42 · 0·06 and 2·36 ± 004. These results are generally slightly lower than the corresponding frequencies for germanium. An analysis in terms of various modifications of the dipole approximation model has been carried out. A feature of this analysis is that the charge on the gallium atom appears to be very small, about +0·04 e. The frequency distribution function has been derived from one of the force models. (author)

  20. Normal vibrations in gallium arsenide

    Energy Technology Data Exchange (ETDEWEB)

    Dolling, G; Waugh, J L T

    1964-07-01

    The triple axis crystal spectrometer at Chalk River has been used to observe coherent slow neutron scattering from a single crystal of pure gallium arsenide at 296{sup o}K. The frequencies of normal modes of vibration propagating in the [{zeta}00], ({zeta}{zeta}{zeta}], and (0{zeta}{zeta}] crystal directions have been determined with a precision of between 1 and 2{center_dot}5 per cent. A limited number of normal modes have also been studied at 95 and 184{sup o}K. Considerable difficulty was experienced in obtaining welt resolved neutron peaks corresponding to the two non-degenerate optic modes for very small wave-vector, particularly at 296{sup o}K. However, from a comparison of results obtained under various experimental conditions at several different points in reciprocal space, frequencies (units 10{sup 12} c/s) for these modes (at 296{sup o}K) have been assigned: T 8{center_dot}02{+-}0{center_dot}08 and L 8{center_dot}55{+-}02. Other specific normal modes, with their measured frequencies are (a) (1,0,0): TO 7{center_dot}56 {+-} 008, TA 2{center_dot}36 {+-} 0{center_dot}015, LO 7{center_dot}22 {+-} 0{center_dot}15, LA 6{center_dot}80 {+-} 0{center_dot}06; (b) (0{center_dot}5, 0{center_dot}5, 0{center_dot}5): TO 7{center_dot}84 {+-} 0{center_dot}12, TA 1{center_dot}86 {+-} 0{center_dot}02, LO 7{center_dot}15 {+-} 0{center_dot}07, LA 6{center_dot}26 {+-} 0{center_dot}10; (c) (0, 0{center_dot}65, 0{center_dot}65): optic 8{center_dot}08 {+-}0{center_dot}13, 7{center_dot}54 {+-} 0{center_dot}12 and 6{center_dot}57 {+-} 0{center_dot}11, acoustic 5{center_dot}58 {+-} 0{center_dot}08, 3{center_dot}42 {center_dot} 0{center_dot}06 and 2{center_dot}36 {+-} 004. These results are generally slightly lower than the corresponding frequencies for germanium. An analysis in terms of various modifications of the dipole approximation model has been carried out. A feature of this analysis is that the charge on the gallium atom appears to be very small, about +0{center_dot}04 e. The

  1. Striving for the unknown normal

    DEFF Research Database (Denmark)

    Nielsen, Mikka

    During the last decade, more and more people have received prescriptions for ADHD drug treatment, and simultaneously the legitimacy of the ADHD diagnosis has been heavily debated among both professionals and laymen. Based on an anthropological fieldwork among adults with ADHD, I illustrate how...... the ADHD diagnosis both answers and produces existential questions on what counts as normal behaviour and emotions. The diagnosis helps the diagnosed to identify, accept and handle problems by offering concrete explanations and solutions to diffuse experienced problems. But the diagnostic process...... is not only a clarifying procedure with a straight plan for treatment and direct effects. It is also a messy affair. In a process of experimenting with drugs and attempting to determine how or whether the medication eliminates the correct symptoms the diagnosed is put in an introspective, self...