Restoration of quinine-stimulated Fos-immunoreactive neurons in the central nucleus of the amygdala and gustatory cortex following reinnervation or cross-reinnervation of the lingual taste nerves in rats.

Science.gov (United States)

King, Camille Tessitore; Garcea, Mircea; Spector, Alan C

2014-08-01

Remarkably, when lingual gustatory nerves are surgically rerouted to inappropriate taste fields in the tongue, some taste functions recover. We previously demonstrated that quinine-stimulated oromotor rejection reflexes and neural activity (assessed by Fos immunoreactivity) in subregions of hindbrain gustatory nuclei were restored if the posterior tongue, which contains receptor cells that respond strongly to bitter compounds, was cross-reinnervated by the chorda tympani nerve. Such functional recovery was not seen if instead, the anterior tongue, where receptor cells are less responsive to bitter compounds, was cross-reinnervated by the glossopharyngeal nerve, even though this nerve typically responds robustly to bitter substances. Thus, recovery depended more on the taste field being reinnervated than on the nerve itself. Here, the distribution of quinine-stimulated Fos-immunoreactive neurons in two taste-associated forebrain areas was examined in these same rats. In the central nucleus of the amygdala (CeA), a rostrocaudal gradient characterized the normal quinine-stimulated Fos response, with the greatest number of labeled cells situated rostrally. Quinine-stimulated neurons were found throughout the gustatory cortex, but a "hot spot" was observed in its anterior-posterior center in subregions approximating the dysgranular/agranular layers. Fos neurons here and in the rostral CeA were highly correlated with quinine-elicited gapes. Denervation of the posterior tongue eliminated, and its reinnervation by either nerve restored, numbers of quinine-stimulated labeled cells in the rostralmost CeA and in the subregion approximating the dysgranular gustatory cortex. These results underscore the remarkable plasticity of the gustatory system and also help clarify the functional anatomy of neural circuits activated by bitter taste stimulation. © 2014 Wiley Periodicals, Inc.

Rewiring the gustatory system: specificity between nerve and taste bud field is critical for normal salt discrimination.

Science.gov (United States)

Spector, Alan C; Blonde, Ginger; Garcea, Mircea; Jiang, Enshe

2010-01-15

Forty years have passed since it was demonstrated that a cross-regenerated gustatory nerve in the rat tongue adopts the stimulus-response properties of the taste receptor field it cross-reinnervates. Nevertheless, the functional consequences of channeling peripheral taste signals through inappropriate central circuits remain relatively unexplored. Here we tested whether histologically confirmed cross-regeneration of the chorda tympani nerve (CT) into the posterior tongue in the absence of the glossopharyngeal nerve (GL) (CT-PostTongue) or cross-regeneration of the GL into the anterior tongue in the absence of the CT (GL-AntTongue) would maintain presurgically trained performance in an operant NaCl vs. KCl taste discrimination task in rats. Before surgery all groups were averaging over 90% accuracy. Oral amiloride treatment dropped performance to virtually chance levels. During the first week after surgery, sham-operated rats, GL-transected rats, and rats with regenerated CTs displayed highly competent discrimination performance. In contrast, CT-transected rats were severely impaired (59% accuracy). Both the CT-PostTongue and the GL-AntTongue groups were impaired to a similar degree as CT-transected rats. These initially impaired groups improved their performance over the weeks of postsurgical testing, suggesting that the rats were capable of relearning the task with discriminable signals in the remaining taste nerves. This relearned performance was dependent on input from amiloride-sensitive receptors likely in the palate. Overall, these results suggest that normal competence in a salt discrimination task is dependent on the taste receptor field origin of the input as well as the specific nerve transmitting the signals to its associated circuits in the brain. Copyright 2009 Elsevier B.V. All rights reserved.

Re-test reliability of gustatory testing and introduction of the sensitive Taste-Drop-Test

DEFF Research Database (Denmark)

Fjaeldstad, A; Niklassen, A; Fernandes, H

2018-01-01

. Testing gustatory function can be important for diagnostics and assessment of treatment effects. However, the gustatory tests applied are required to be both sensitive and reliable.In this study, we investigate the re-test validity of popular Taste Strips gustatory test for gustatory screening....... Furthermore, we introduce a new sensitive Taste-Drop-Test, which was found to be superior for detecting a more accurate measure of tastant sensitivity....

Gustatory Processing in Drosophila melanogaster.

Science.gov (United States)

Scott, Kristin

2018-01-07

The ability to identify nutrient-rich food and avoid toxic substances is essential for an animal's survival. Although olfaction and vision contribute to food detection, the gustatory system acts as a final checkpoint control for food acceptance or rejection. The vinegar fly Drosophila melanogaster tastes many of the same stimuli as mammals and provides an excellent model system for comparative studies of taste detection. The relative simplicity of the fly brain and behaviors, along with the molecular genetic and functional approaches available in this system, allow the examination of gustatory neural circuits from sensory input to motor output. This review discusses the molecules and cells that detect taste compounds in the periphery and the circuits that process taste information in the brain. These studies are providing insight into how the detection of taste compounds regulates feeding decisions.

Gustatory thalamus lesions in the rat: III. Simultaneous contrast and autoshaping.

Science.gov (United States)

Reilly, S; Pritchard, T C

1997-12-01

The performance of rats with electrophysiologically guided electrolytic lesions of the gustatory thalamus (GT) was compared to that of control subjects in two experiments. In Experiment 1, the lesioned rats showed normal simultaneous contrast effects (both positive and negative) during brief, alternating access to 0.15% saccharin and 1.0 M sucrose. There was, however, a substantial lesion-induced impairment in the level of conditioned stimulus-directed maintenance responding on the autoshaping procedure of Experiment 2. These findings are discussed with respect to the anticipatory contrast deficit recently reported in GT-lesioned rats.

Gustatory imagery reveals functional connectivity from the prefrontal to insular cortices traced with magnetoencephalography.

Directory of Open Access Journals (Sweden)

Masayuki Kobayashi

Full Text Available Our experience and prejudice concerning food play an important role in modulating gustatory information processing; gustatory memory stored in the central nervous system influences gustatory information arising from the peripheral nervous system. We have elucidated the mechanism of the "top-down" modulation of taste perception in humans using functional magnetic resonance imaging (fMRI and demonstrated that gustatory imagery is mediated by the prefrontal (PFC and insular cortices (IC. However, the temporal order of activation of these brain regions during gustatory imagery is still an open issue. To explore the source of "top-down" signals during gustatory imagery tasks, we analyzed the temporal activation patterns of activated regions in the cerebral cortex using another non-invasive brain imaging technique, magnetoencephalography (MEG. Gustatory imagery tasks were presented by words (Letter G-V or pictures (Picture G-V of foods/beverages, and participants were requested to recall their taste. In the Letter G-V session, 7/9 (77.8% participants showed activation in the IC with a latency of 401.7±34.7 ms (n = 7 from the onset of word exhibition. In 5/7 (71.4% participants who exhibited IC activation, the PFC was activated prior to the IC at a latency of 315.2±56.5 ms (n = 5, which was significantly shorter than the latency to the IC activation. In the Picture G-V session, the IC was activated in 6/9 (66.7% participants, and only 1/9 (11.1% participants showed activation in the PFC. There was no significant dominance between the right and left IC or PFC during gustatory imagery. These results support those from our previous fMRI study in that the Letter G-V session rather than the Picture G-V session effectively activates the PFC and IC and strengthen the hypothesis that the PFC mediates "top-down" control of retrieving gustatory information from the storage of long-term memories and in turn activates the IC.

Gustatory imagery reveals functional connectivity from the prefrontal to insular cortices traced with magnetoencephalography.

Science.gov (United States)

Kobayashi, Masayuki; Sasabe, Tetsuya; Shigihara, Yoshihito; Tanaka, Masaaki; Watanabe, Yasuyoshi

2011-01-01

Our experience and prejudice concerning food play an important role in modulating gustatory information processing; gustatory memory stored in the central nervous system influences gustatory information arising from the peripheral nervous system. We have elucidated the mechanism of the "top-down" modulation of taste perception in humans using functional magnetic resonance imaging (fMRI) and demonstrated that gustatory imagery is mediated by the prefrontal (PFC) and insular cortices (IC). However, the temporal order of activation of these brain regions during gustatory imagery is still an open issue. To explore the source of "top-down" signals during gustatory imagery tasks, we analyzed the temporal activation patterns of activated regions in the cerebral cortex using another non-invasive brain imaging technique, magnetoencephalography (MEG). Gustatory imagery tasks were presented by words (Letter G-V) or pictures (Picture G-V) of foods/beverages, and participants were requested to recall their taste. In the Letter G-V session, 7/9 (77.8%) participants showed activation in the IC with a latency of 401.7±34.7 ms (n = 7) from the onset of word exhibition. In 5/7 (71.4%) participants who exhibited IC activation, the PFC was activated prior to the IC at a latency of 315.2±56.5 ms (n = 5), which was significantly shorter than the latency to the IC activation. In the Picture G-V session, the IC was activated in 6/9 (66.7%) participants, and only 1/9 (11.1%) participants showed activation in the PFC. There was no significant dominance between the right and left IC or PFC during gustatory imagery. These results support those from our previous fMRI study in that the Letter G-V session rather than the Picture G-V session effectively activates the PFC and IC and strengthen the hypothesis that the PFC mediates "top-down" control of retrieving gustatory information from the storage of long-term memories and in turn activates the IC.

RNAi-mediated double gene knockdown and gustatory perception measurement in honey bees (Apis mellifera).

Science.gov (United States)

Wang, Ying; Baker, Nicholas; Amdam, Gro V

2013-07-25

This video demonstrates novel techniques of RNA interference (RNAi) which downregulate two genes simultaneously in honey bees using double-stranded RNA (dsRNA) injections. It also presents a protocol of proboscis extension response (PER) assay for measuring gustatory perception. RNAi-mediated gene knockdown is an effective technique downregulating target gene expression. This technique is usually used for single gene manipulation, but it has limitations to detect interactions and joint effects between genes. In the first part of this video, we present two strategies to simultaneously knock down two genes (called double gene knockdown). We show both strategies are able to effectively suppress two genes, vitellogenin (vg) and ultraspiracle (usp), which are in a regulatory feedback loop. This double gene knockdown approach can be used to dissect interrelationships between genes and can be readily applied in different insect species. The second part of this video is a demonstration of proboscis extension response (PER) assay in honey bees after the treatment of double gene knockdown. The PER assay is a standard test for measuring gustatory perception in honey bees, which is a key predictor for how fast a honey bee's behavioral maturation is. Greater gustatory perception of nest bees indicates increased behavioral development which is often associated with an earlier age at onset of foraging and foraging specialization in pollen. In addition, PER assay can be applied to identify metabolic states of satiation or hunger in honey bees. Finally, PER assay combined with pairing different odor stimuli for conditioning the bees is also widely used for learning and memory studies in honey bees.

Hunger state affects both olfactory abilities and gustatory sensitivity.

Science.gov (United States)

Hanci, Deniz; Altun, Huseyin

2016-07-01

Chemical senses such as odor, taste and appearance are directly related with appetite. Understanding the relation between appetite and flavor is getting more important due to increasing number of obese patients worldwide. The literature on the studies investigating the change in olfactory abilities and gustatory sensitivity mostly performed using food-related odors and tastes rather than standardized tests were developed to study olfaction and gustation. Therefore, results are inconsistent and the relationship between olfactory and gustatory sensitivity with respect to the actual state of human satiety is still not completely understood. Here, for the first time in literature, we investigated the change in both olfactory abilities and gustatory sensitivity in hunger and in satiety using 123 subjects (37 men, 86 women; mean age 31.4 years, age range 21-41 years). The standardized Sniffin' Sticks Extended Test and Taste Strips were used for olfactory testing and gustatory sensitivity, respectively. TDI score (range 1-48) was calculated as the collective scores of odor threshold (T), odor discrimination (D) and odor identification (I). The evaluation was performed in two successive days where the hunger state of test subjects was confirmed by blood glucose test strips (mean blood glucose level 90.0 ± 5.6 mg/dl in hunger and 131.4 ± 8.1 mg/dl in satiety). The results indicated statistically significant decrease in olfaction in satiety compared to hunger (mean TDI 39.3 ± 1.1 in hunger, 37.4 ± 1.1 in satiety, p hunger (p hunger state.

Gustatory and olfactory sensitivity in patients with anorexia and bulimia in the course of treatment.

Science.gov (United States)

Aschenbrenner, Katja; Scholze, Ninette; Joraschky, Peter; Hummel, Thomas

2008-12-01

The majority of studies on taste and smell in eating disorders have revealed several alterations of olfactory or gustatory functions. Aim of this prospective study was to employ detailed olfactory and gustatory testing in female subjects of three homogenous groups - anorexia nervosa, bulimia nervosa and healthy controls - and to look at the effects of treatment on these measures. Sixteen hospitalized female patients with anorexia (restricting type, mean age [M]=24.5 years), 24 female patients with bulimia (purging type, M=24.3 years) as well as 23 healthy controls (M=24.5 years) received olfactory ("Sniffin' Sticks") and gustatory testing ("Taste Strips"). Group differences in olfactory and gustatory sensitivity, body mass index (BMI), the Beck depression inventory, the eating attitudes test (EAT), and the influence of therapy on gustatory and olfactory function were investigated. (1) Group differences were present for odor discrimination and overall olfactory function with anorexic patients having the lowest scores. (2) Regarding taste function, controls scored higher than patients with anorexia. (3) At admission small but significant correlations were found between overall olfactory function and body weight (r(63)=0.35), BMI (r(63) = 0.37), and EAT score (r(63) = -0.27). Similarly, (4) the taste test score correlated significantly with body weight (r(63)= 0.48), and BMI (r(63) = 0.45). Finally, (5) at discharge overall olfactory and gustatory function were significantly higher compared to admission in anorexic patients. As compared to healthy controls and bulimic patients our results show lowered olfactory and gustatory sensitivities in anorexic patients that improved with increasing BMI and decreasing eating pathology in the course of treatment.

Radiation-induced changes in gustatory function comparison of effects of neutron and photon irradiation

International Nuclear Information System (INIS)

Mossman, K.L.; Chencharick, J.D.; Scheer, A.C.; Walker, W.P.; Ornitz, R.D.; Rogers, C.C.; Henkin, R.I.

1979-01-01

Changes in gustatory function were measured in 51 patients with various forms of cancer who received radiation to the head and neck region. Forty patients (group I) were treated with conventional photon radiation (e.g. 66 Gy/7 weeks), and 11 patients (group II) were treated with cyclotron produced fast neutrons (e.g. 22 Gy/7 weeks). Taste acuity was measured for four taste qualities (salt, sweet, sour, and bitter) by a forced choice-three stimulus drop technique which measured detection and recognition thresholds and by a forced scaling technique which measured taste intensity responsiveness. Subjective complaints of anorexia, dysgeusia, taste loss, and xerostomia were also recorded. Patients were studied before, during and up to two months after therapy. Prior to therapy, detection and recognition thresholds, intensity responsiveness, and the frequency of subjective complaints in patients from groups I and II were statistically equivalent. During and up to 2 months after therapy, taste impairment and frequency of subjective complaints increased significantly in neutron and photon treated patients, but were statistically equivalent. Results of this study indicate that gustatory tissue response as measured by taste detection and recognition and intensity responsiveness, and the frequency of subjective complaints related to taste are statistically equivalent in patients before, during, or up 2 months after they were given either neutron or photon radiation for tumors of the head and neck

Identification of a sugar gustatory receptor and its effect on fecundity of the brown planthopper Nilaparvata lugens.

Science.gov (United States)

Chen, Wei-Wen; Kang, Kui; Yang, Pan; Zhang, Wen-Qing

2017-11-27

In insects, the gustatory system plays a crucial role in multiple physiological behaviors, including feeding, toxin avoidance, courtship, mating and oviposition. Gustatory stimuli from the environment are recognized by gustatory receptors. To date, little is known about the function of gustatory receptors in agricultural pest insects. In this study, we cloned a sugar gustatory receptor gene, NlGr11, from the brown planthopper (BPH), Nilaparvata lugens (Stål), a serious pest of rice in Asia; we then identified its ligands, namely, fructose, galactose and arabinose, by calcium imaging assay. After injection of NlGr11 double-stranded RNA, we found that the number of eggs laid by BPH decreased. Moreover, we found that NlGr11 inhibited the phosphorylation of adenosine monophosphate-activated protein kinase (AMPK) and promoted the phosphorylation of protein kinase B (AKT). These findings demonstrated that NlGr11 could accelerate the fecundity of BPH through AMPK- and AKT-mediated signaling pathways. This is the first report to indicate that a gustatory receptor modulates the fecundity of insects and that the receptor could be a potential target for pest control. © 2017 Institute of Zoology, Chinese Academy of Sciences.

WHAT DOES THE GUSTATORY PREFERENCES DEVELOPMENT IN INFANTS DEPEND ON?

Directory of Open Access Journals (Sweden)

I. N. Zakharova

2012-01-01

Full Text Available Intensive development of the molecular biology, genetically engineered methods of examination and decoding of human genome rendered significant assistance to discoveries in the field of gustatory preferences and food behavior formation study in children. It was proved that gustatory preferences in children and, further, in adults are influenced by numerous factors. The main of such factors are genetic ones; peculiarities of pregnant woman and child nutrition; national food traditions. The afore-mentioned factors and possible ways of influence on them are considered in this article, which contributes to development of appropriate food behavior, playing a significant role in the formation of children’ and adults’ health. 

Taste bud-derived BDNF maintains innervation of a subset of TrkB-expressing gustatory nerve fibers.

Science.gov (United States)

Tang, Tao; Rios-Pilier, Jennifer; Krimm, Robin

2017-07-01

Taste receptor cells transduce different types of taste stimuli and transmit this information to gustatory neurons that carry it to the brain. Taste receptor cells turn over continuously in adulthood, requiring constant new innervation from nerve fibers. Therefore, the maintenance of innervation to taste buds is an active process mediated by many factors, including brain-derived neurotrophic factor (BDNF). Specifically, 40% of taste bud innervation is lost when Bdnf is removed during adulthood. Here we speculated that not all gustatory nerve fibers express the BDNF receptor, TrkB, resulting in subsets of neurons that vary in their response to BDNF. However, it is also possible that the partial loss of innervation occurred because the Bdnf gene was not effectively removed. To test these possibilities, we first determined that not all gustatory nerve fibers express the TrkB receptor in adult mice. We then verified the efficiency of Bdnf removal specifically in taste buds of K14-CreER:Bdnf mice and found that Bdnf expression was reduced to 1%, indicating efficient Bdnf gene recombination. BDNF removal resulted in a 55% loss of TrkB-expressing nerve fibers, which was greater than the loss of P2X3-positive fibers (39%), likely because taste buds were innervated by P2X3+/TrkB- fibers that were unaffected by BDNF removal. We conclude that gustatory innervation consists of both TrkB-positive and TrkB-negative taste fibers and that BDNF is specifically important for maintaining TrkB-positive innervation to taste buds. In addition, although taste bud size was not affected by inducible Bdnf removal, the expression of the γ subunit of the ENaC channel was reduced. So, BDNF may regulate expression of some molecular components of taste transduction pathways. Copyright © 2017. Published by Elsevier Inc.

An automated system for the objective evaluation of human gustatory sensitivity using tongue biopotential recordings.

Directory of Open Access Journals (Sweden)

Danilo Pani

Full Text Available The goal of this work is to develop an automatic system for the evaluation of the gustatory sensitivity of patients using an electrophysiological recording of the response of bud cells to taste stimuli. In particular, the study aims to evaluate the effectiveness and limitations of supervised classifiers in the discrimination between subjects belonging to the three 6-n-propylthiouracil (PROP taster categories (supertasters, medium tasters, and non-tasters, exploiting features extracted from electrophysiological recordings of the tongue. Thirty-nine subjects (equally divided into the three PROP status classes by standard non-objective scaling methods underwent a non-invasive, differential, biopotential recording of their tongues during stimulation with PROP by using a custom-made, flexible, silver electrode. Two different classifiers were trained to recognize up to seven different features extracted from the recorded depolarization signal. The classification results indicate that the identified set of features allows to distinguish between PROP tasters and non-tasters (average accuracy of 80% ± 18% and up to 94% ± 15% when only supertasters and non-tasters are considered, but medium tasters were difficult to identify. However, these apparent classification errors are related to uncertainty in the labeling procedures, which are based on non-objective tests, in which the subjects provided borderline evaluations. Thus, using the proposed method, it is possible, for the first time, to automatically achieve objective PROP taster status identification with high accuracy. The simplicity of the recording technique allows for easy reproduction of the experimental setting; thus the technique can be used in future studies to evaluate other gustatory stimuli. The proposed approach represents the first objective and automatic method to directly measure human gustatory responses and a milestone for physiological taste studies, with applications ranging from

Functional changes of the gustatory organ caused by local radiation exposure during radiotherapy of the head-and-neck region

International Nuclear Information System (INIS)

Kamprad, F.; Hildebrandt, G.; Ranft, D.; Weber, A.

2008-01-01

Purpose: The aim of this prospective study was to investigate how often and at which dose levels gustatory disturbances appear during radiotherapy of the tongue and to which extent permanent gustatory deficiencies occur. Patients and Methods: The study included 44 patients treated by definitive irradiation for malignant head-and-neck tumors. In 22 patients the posterior two thirds of the tongue (group 1), and in the other 22 patients the entire tongue (group 2) were exposed to radiation. The control group comprised 30 patients with non-small cell lung cancer receiving definitive radiation therapy (group 3). The dose distribution in the tongue area was calculated using CT-based three-dimensional planning. Before, during and after irradiation the gustatory function was determined by means of gustometry and correlated with the corresponding results of enoral inspection and the patients' subjective statements on gustatory function. Results: The gustatory ability of the control group was not affected, whereas patients in the locally irradiated groups in parallel with enoral mucositis suffered from loss of gustatory function after a total dose of 20 Gy with a maximum between 40 and 60 Gy. Supportive measures had little influence on acute side effects. The gustatory disturbances regressed within 8 weeks after radiotherapy in patients with partial-tongue irradiation and almost completely after 6 months in patients with entire-tongue irradiation. Conclusion: The severity of gustatory disturbances and the longer recovery time in patients with entire-tongue irradiation suggest an influence of the volume exposed. Therefore, reduction of the highly exposed tongue volume by intensity-modulated radiotherapy opens up possibilities for a reduction of this undesirable side effect. (orig.)

Functional changes of the gustatory organ caused by local radiation exposure during radiotherapy of the head-and-neck region

Energy Technology Data Exchange (ETDEWEB)

Kamprad, F.; Hildebrandt, G. [University Hospital Leipzig AoeR (Germany). Dept. of Radiotherapy and Radiooncology; Ranft, D. [Universitaetsklinikum Greifswald GmbH (Germany). MVZ-Medizinisches Versorgungszentrum; Weber, A. [Sana Klinikum Remscheid (Germany). ENT Dept.

2008-03-15

Purpose: The aim of this prospective study was to investigate how often and at which dose levels gustatory disturbances appear during radiotherapy of the tongue and to which extent permanent gustatory deficiencies occur. Patients and Methods: The study included 44 patients treated by definitive irradiation for malignant head-and-neck tumors. In 22 patients the posterior two thirds of the tongue (group 1), and in the other 22 patients the entire tongue (group 2) were exposed to radiation. The control group comprised 30 patients with non-small cell lung cancer receiving definitive radiation therapy (group 3). The dose distribution in the tongue area was calculated using CT-based three-dimensional planning. Before, during and after irradiation the gustatory function was determined by means of gustometry and correlated with the corresponding results of enoral inspection and the patients' subjective statements on gustatory function. Results: The gustatory ability of the control group was not affected, whereas patients in the locally irradiated groups in parallel with enoral mucositis suffered from loss of gustatory function after a total dose of 20 Gy with a maximum between 40 and 60 Gy. Supportive measures had little influence on acute side effects. The gustatory disturbances regressed within 8 weeks after radiotherapy in patients with partial-tongue irradiation and almost completely after 6 months in patients with entire-tongue irradiation. Conclusion: The severity of gustatory disturbances and the longer recovery time in patients with entire-tongue irradiation suggest an influence of the volume exposed. Therefore, reduction of the highly exposed tongue volume by intensity-modulated radiotherapy opens up possibilities for a reduction of this undesirable side effect. (orig.)

Sexy DEG/ENaC channels involved in gustatory detection of fruit fly pheromones.

Science.gov (United States)

Pikielny, Claudio W

2012-11-06

Hydrocarbon pheromones on the cuticle of Drosophila melanogaster modulate the complex courtship behavior of males. Recently, three members of the degenerin/epithelial Na+ channel (DEG/ENaC) family of sodium channel subunits, Ppk25, Ppk23, and Ppk29 (also known as Nope), have been shown to function in gustatory perception of courtship-modulating contact pheromones. All three proteins are required for the activation of male courtship by female pheromones. Specific interactions between two of them have been demonstrated in cultured cells, suggesting that, in a subset of cells where they are coexpressed, these three subunits function within a common heterotrimeric DEG/ENaC channel. Such a DEG/ENaC channel may be gated by pheromones, either directly or indirectly, or alternatively may control the excitability of pheromone-sensing cells. In addition, these studies identify taste neurons that respond specifically to courtship-modulating pheromones and mediate their effects on male behavior. Two types of pheromone-sensing taste neurons, F and M cells, have been defined on the basis of their specific response to either female or male pheromones. These reports set the stage for the dissection of the molecular and cellular mechanisms that mediate gustatory detection of contact pheromones.

Vagal gustatory reflex circuits for intraoral food sorting behavior in the goldfish: cellular organization and neurotransmitters.

Science.gov (United States)

Ikenaga, Takanori; Ogura, Tatsuya; Finger, Thomas E

2009-09-20

The sense of taste is crucial in an animal's determination as to what is edible and what is not. This gustatory function is especially important in goldfish, who utilize a sophisticated oropharyngeal sorting mechanism to separate food from substrate material. The computational aspects of this detection are carried out by the medullary vagal lobe, which is a large, laminated structure combining elements of both the gustatory nucleus of the solitary tract and the nucleus ambiguus. The sensory layers of the vagal lobe are coupled to the motor layers via a simple reflex arc. Details of this reflex circuit were investigated with histology and calcium imaging. Biocytin injections into the motor layer labeled vagal reflex interneurons that have radially directed dendrites ramifying within the layers of primary afferent terminals. Axons of reflex interneurons extend radially inward to terminate onto both vagal motoneurons and small, GABAergic interneurons in the motor layer. Functional imaging shows increases in intracellular Ca++ of vagal motoneurons following electrical stimulation in the sensory layer. These responses were suppressed under Ca(++)-free conditions and by interruption of the axons bridging between the sensory and motor layers. Pharmacological experiments showed that glutamate acting via (+/-)-alpha-amino-3-hydroxy- 5-ethylisoxazole-4-propioinc acid (AMPA)/kainate and N-methyl-D-aspartic acid (NMDA) receptors mediate neurotransmission between reflex interneurons and vagal motoneurons. Thus, the vagal gustatory portion of the viscerosensory complex is linked to branchiomotor neurons of the pharynx via a glutamatergic interneuronal system.

Vagal gustatory reflex circuits for intraoral food sorting behavior in the goldfish Cellular organization and neurotransmitters

Science.gov (United States)

Ikenaga, Takanori; Ogura, Tatsuya; Finger, Thomas E.

2009-01-01

The sense of taste is crucial in an animal’s determination as to what is edible and what is not. This gustatory function is especially important in goldfish who utilize a sophisticated oropharyngeal sorting mechanism to separate food from substrate material. The computational aspects of this detection are carried out by the medullary vagal lobe which is a large, laminated structure combining elements of both the gustatory nucleus of the solitary tract and the nucleus ambiguus. The sensory layers of the vagal lobe are coupled to the motor layers via a simple reflex arc. Details of this reflex circuit were investigated with histology and calcium imaging. Biocytin injections into the motor layer labeled vagal reflex interneurons which have radially-directed dendrites ramifying within the layers of primary afferent terminals. Axons of reflex interneurons extend radially inward to terminate onto both vagal motoneurons and small, GABAergic interneurons in the motor layer. Functional imaging shows increases in intracellular Ca++ of vagal motoneurons following electrical stimulation in the sensory layer. These responses were suppressed under Ca++-free conditions and by interruption of the axons bridging between the sensory and motor layers. Pharmacological experiments showed that glutamate acting via (±)-α-amino-3-hydroxy-5-ethylisoxazole-4-propioinc acid (AMPA)/kainate and N-methyl-D-aspartic acid (NMDA) receptors mediates neurotransmission between reflex interneurons and vagal motoneurons. Thus the vagal gustatory portion of the viscerosensory complex is linked to branchiomotor neurons of the pharynx via a glutamatergic interneuronal system. PMID:19598285

5-HT3A -driven green fluorescent protein delineates gustatory fibers innervating sour-responsive taste cells: A labeled line for sour taste?

Science.gov (United States)

Stratford, J M; Larson, E D; Yang, R; Salcedo, E; Finger, T E

2017-07-01

Taste buds contain multiple cell types with each type expressing receptors and transduction components for a subset of taste qualities. The sour sensing cells, Type III cells, release serotonin (5-HT) in response to the presence of sour (acidic) tastants and this released 5-HT activates 5-HT 3 receptors on the gustatory nerves. We show here, using 5-HT 3A GFP mice, that 5-HT 3 -expressing nerve fibers preferentially contact and receive synaptic contact from Type III taste cells. Further, these 5-HT 3 -expressing nerve fibers terminate in a restricted central-lateral portion of the nucleus of the solitary tract (nTS)-the same area that shows increased c-Fos expression upon presentation of a sour tastant (30 mM citric acid). This acid stimulation also evokes c-Fos in the laterally adjacent mediodorsal spinal trigeminal nucleus (DMSp5), but this trigeminal activation is not associated with the presence of 5-HT 3 -expressing nerve fibers as it is in the nTS. Rather, the neuronal activation in the trigeminal complex likely is attributable to direct depolarization of acid-sensitive trigeminal nerve fibers, for example, polymodal nociceptors, rather than through taste buds. Taken together, these findings suggest that transmission of sour taste information involves communication between Type III taste cells and 5-HT 3 -expressing afferent nerve fibers that project to a restricted portion of the nTS consistent with a crude mapping of taste quality information in the primary gustatory nucleus. © 2017 Wiley Periodicals, Inc.

Awareness of dysgeusia and gustatory tests in patients undergoing chemotherapy for breast cancer.

Science.gov (United States)

Kuba, Sayaka; Fujiyama, Rie; Yamanouchi, Kosho; Morita, Michi; Sakimura, Chika; Hatachi, Toshiko; Matsumoto, Megumi; Yano, Hiroshi; Takatsuki, Mitsuhisa; Hayashida, Naomi; Nagayasu, Takeshi; Eguchi, Susumu

2018-05-12

We analyzed the prevalence of gustatory test abnormalities in breast cancer (BC) patients undergoing chemotherapy. We enrolled 43 BC patients undergoing chemotherapy and 38 BC patients who had never undergone chemotherapy (control group). Two gustatory tests were conducted: an instillation method examining the threshold for four basic taste stimuli and an electrogustometry method measuring the threshold for perception with electric stimulation at the front two-thirds of the tongue (cranial nerve VII) and at the back third of the tongue (cranial nerve IX). The results of the two gustatory tests and clinicopathological factors were compared between the chemotherapy and control groups and between patients with and without awareness of dysgeusia in the chemotherapy group. In the chemotherapy group, 19 (44%) patients were aware of dysgeusia and 8 (19%) had hypogeusia using the instillation method. Although more patients had parageusia in the chemotherapy than control group, no significant differences in the results of the two gustatory tests were observed. Patients with dysgeusia awareness had a higher threshold at cranial nerve IX using the electrogustometry method than those without dysgeusia awareness; no significant differences in hypogeusia were observed using the instillation method. In fact, 74% (14/19) of patients with dysgeusia awareness could identify the four tastes accurately using the instillation method. Similar results were observed for the instillation and electrogustometry methods at cranial nerve VII. While approximately half of the chemotherapy patients were aware of dysgeusia, 81% (35/43) of them could accurately identify the four basic tastes using the instillation method.

Temporal characteristics of gustatory responses in rat parabrachial neurons vary by stimulus and chemosensitive neuron type.

Science.gov (United States)

Geran, Laura; Travers, Susan

2013-01-01

It has been demonstrated that temporal features of spike trains can increase the amount of information available for gustatory processing. However, the nature of these temporal characteristics and their relationship to different taste qualities and neuron types are not well-defined. The present study analyzed the time course of taste responses from parabrachial (PBN) neurons elicited by multiple applications of "sweet" (sucrose), "salty" (NaCl), "sour" (citric acid), and "bitter" (quinine and cycloheximide) stimuli in an acute preparation. Time course varied significantly by taste stimulus and best-stimulus classification. Across neurons, the ensemble code for the three electrolytes was similar initially but quinine diverged from NaCl and acid during the second 500 ms of stimulation and all four qualities became distinct just after 1s. This temporal evolution was reflected in significantly broader tuning during the initial response. Metric space analyses of quality discrimination by individual neurons showed that increases in information (H) afforded by temporal factors was usually explained by differences in rate envelope, which had a greater impact during the initial 2s (22.5% increase in H) compared to the later response (9.5%). Moreover, timing had a differential impact according to cell type, with between-quality discrimination in neurons activated maximally by NaCl or citric acid most affected. Timing was also found to dramatically improve within-quality discrimination (80% increase in H) in neurons that responded optimally to bitter stimuli (B-best). Spikes from B-best neurons were also more likely to occur in bursts. These findings suggest that among PBN taste neurons, time-dependent increases in mutual information can arise from stimulus- and neuron-specific differences in response envelope during the initial dynamic period. A stable rate code predominates in later epochs.

Effects of caloric deprivation and satiety on sensitivity of the gustatory system

Directory of Open Access Journals (Sweden)

Zverev Yuriy P

2004-02-01

Full Text Available Abstract Background Sensitivity of the gustatory system could be modulated by a number of short-term and long-term factors such as body mass, gender, age, local and systemic diseases and pathological processes, excessive alcohol drinking, drug dependence, smoking, composition of oral fluid, state of oral hygiene, consumption of some foods among many others. A few studies have demonstrated the effects of hunger and caloric satiety on sensitivity of the gustatory system in obese humans and animals. The aim of the present study was to assess the effects of short-term caloric deprivation and satiety on recognition taste thresholds of healthy, non-smoking, non-drinking, non-obese young male subjects. The two-alternative forced-choice technique was used to measure taste threshold. Results Recognition thresholds for sucrose and salt were significantly lower during fasting state than after a meal (t = 2.23, P Conclusions Short-term caloric deprivation in our study model was associated with increased taste sensitivity to sweet and salty substances compared to satiated state while taste sensitivity to bitter substances was not affected by the conditions of measurements. Selective modulation of sensitivity of the gustatory system might reflect the different biological importance of salty, sweet and bitter qualities of taste.

Effects of gustatory stimulants of salivary secretion on salivary pH and flow: a randomized controlled trial.

Science.gov (United States)

da Mata, A D S P; da Silva Marques, D N; Silveira, J M L; Marques, J R O F; de Melo Campos Felino, E T; Guilherme, N F R P M

2009-04-01

To compare salivary pH changes and stimulation efficacy of two different gustatory stimulants of salivary secretion (GSSS). Portuguese Dental Faculty Clinic. Double blind randomized controlled trial. One hundred and twenty volunteers were randomized to two intervention groups. Sample sized was calculated using an alpha error of 0.05 and a beta of 0.20. Participants were randomly assigned to receive a new gustatory stimulant of secretory secretion containing a weaker malic acid, fluoride and xylitol or a traditionally citric acid-based one. Saliva collection was obtained by established methods at different times. The salivary pH of the samples was determined with a pH meter and a microelectrode. Salivary pH variations and counts of subjects with pH below 5.5 for over 1 min and stimulated salivary flow were the main outcome measures. Both GSSS significantly stimulated salivary output without significant differences between the two groups. The new gustatory stimulant of salivary secretion presented a risk reduction of 80 +/- 10.6% (95% CI) when compared with the traditional one. Gustatory stimulants of salivary secretion with fluoride, xylitol and lower acid content maintain similar salivary stimulation capacity while reducing significantly the dental erosion predictive potential.

Diffusion-weighted MR imaging of salivary glands with gustatory stimulation - Comparison before and after radiotherapy

International Nuclear Information System (INIS)

Zhang, Yunyan; Gu, Yajia; Peng, Weijun; Mao, Jian; Lei, Yue; Shen, Xigang; Ou, Dan; He, Xiayun

2013-01-01

Background: Xerostomia is the most prominent complication in patients with head and neck carcinoma after radiotherapy (RT). Diffusion-weighted magnetic resonance imaging (DWI) with gustatory stimulation may contribute to the evaluation of salivary gland function. Purpose: To investigate the value of DWI for quantifying physiological changes of the parotid gland during gustatory stimulation in patients before and after RT. Material and Methods: Magnetic resonance imaging (MRI) was performed in 28 consecutive patients with nasopharyngeal carcinoma before and after RT and clinical xerostomia was also assessed. A DWI sequence was performed once at rest and continually repeated seven times during stimulation with ascorbic acid. Apparent diffusion coefficient (ADC) maps for parotid glands at different time points and the range of increase with stimulation were calculated. Paired two-tailed Student t tests were used to compare the ADC values before and after stimulation, and before and after RT. Results: Before RT, the ADC showed an initial increase (P<0.001) and then fluctuated during stimulation. After RT, as the clinical xerostomia changed from Grade 0 to Grade 2, the mean ADC at rest increased compared with the pre-RT value (P<0.001). A similar response to stimulation was observed, but the range of increase between the maximum ADC during stimulation and the baseline value at rest was higher post-RT than pre-RT (P=0.022). The minimum ADC during stimulation was higher than the baseline value post-RT (P=0.028), but there was no difference pre-RT (P=0.603). Conclusion: DWI combined with gustatory stimulation seems to display the physiological changes of the parotid gland following RT and may be a potential tool for non-invasively assessing salivary gland function

Diffusion-weighted MR imaging of salivary glands with gustatory stimulation - Comparison before and after radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Zhang, Yunyan; Gu, Yajia; Peng, Weijun; Mao, Jian; Lei, Yue; Shen, Xigang [Dept. of Radiology, Fudan Univ. Shanghai Cancer Center, Shanghai (China); Dept. of Oncology, Shanghai Medical College, Fudan Univ., Shanghai (China); Ou, Dan; He, Xiayun [Dept. of Radiation Oncology, Fudan Univ. Shanghai Cancer Center, Shanghai (China); Dept. of Oncology, Shanghai Medical College, Fudan Univ., Shanghai (China)

2013-10-15

Background: Xerostomia is the most prominent complication in patients with head and neck carcinoma after radiotherapy (RT). Diffusion-weighted magnetic resonance imaging (DWI) with gustatory stimulation may contribute to the evaluation of salivary gland function. Purpose: To investigate the value of DWI for quantifying physiological changes of the parotid gland during gustatory stimulation in patients before and after RT. Material and Methods: Magnetic resonance imaging (MRI) was performed in 28 consecutive patients with nasopharyngeal carcinoma before and after RT and clinical xerostomia was also assessed. A DWI sequence was performed once at rest and continually repeated seven times during stimulation with ascorbic acid. Apparent diffusion coefficient (ADC) maps for parotid glands at different time points and the range of increase with stimulation were calculated. Paired two-tailed Student t tests were used to compare the ADC values before and after stimulation, and before and after RT. Results: Before RT, the ADC showed an initial increase (P<0.001) and then fluctuated during stimulation. After RT, as the clinical xerostomia changed from Grade 0 to Grade 2, the mean ADC at rest increased compared with the pre-RT value (P<0.001). A similar response to stimulation was observed, but the range of increase between the maximum ADC during stimulation and the baseline value at rest was higher post-RT than pre-RT (P=0.022). The minimum ADC during stimulation was higher than the baseline value post-RT (P=0.028), but there was no difference pre-RT (P=0.603). Conclusion: DWI combined with gustatory stimulation seems to display the physiological changes of the parotid gland following RT and may be a potential tool for non-invasively assessing salivary gland function.

Inactivation of basolateral amygdala specifically eliminates palatability-related information in cortical sensory responses.

Science.gov (United States)

Piette, Caitlin E; Baez-Santiago, Madelyn A; Reid, Emily E; Katz, Donald B; Moran, Anan

2012-07-18

Evidence indirectly implicates the amygdala as the primary processor of emotional information used by cortex to drive appropriate behavioral responses to stimuli. Taste provides an ideal system with which to test this hypothesis directly, as neurons in both basolateral amygdala (BLA) and gustatory cortex (GC)-anatomically interconnected nodes of the gustatory system-code the emotional valence of taste stimuli (i.e., palatability), in firing rate responses that progress similarly through "epochs." The fact that palatability-related firing appears one epoch earlier in BLA than GC is broadly consistent with the hypothesis that such information may propagate from the former to the latter. Here, we provide evidence supporting this hypothesis, assaying taste responses in small GC single-neuron ensembles before, during, and after temporarily inactivating BLA in awake rats. BLA inactivation (BLAx) changed responses in 98% of taste-responsive GC neurons, altering the entirety of every taste response in many neurons. Most changes involved reductions in firing rate, but regardless of the direction of change, the effect of BLAx was epoch-specific: while firing rates were changed, the taste specificity of responses remained stable; information about taste palatability, however, which normally resides in the "Late" epoch, was reduced in magnitude across the entire GC sample and outright eliminated in most neurons. Only in the specific minority of neurons for which BLAx enhanced responses did palatability specificity survive undiminished. Our data therefore provide direct evidence that BLA is a necessary component of GC gustatory processing, and that cortical palatability processing in particular is, in part, a function of BLA activity.

Descriptive analysis of the masticatory and salivary functions and gustatory sensitivity in healthy children.

Science.gov (United States)

Marquezin, Maria Carolina Salomé; Pedroni-Pereira, Aline; Araujo, Darlle Santos; Rosar, João Vicente; Barbosa, Taís S; Castelo, Paula Midori

2016-08-01

The objective of this study is to better understand salivary and masticatory characteristics, this study evaluated the relationship among salivary parameters, bite force (BF), masticatory performance (MP) and gustatory sensitivity in healthy children. The secondary outcome was to evaluate possible gender differences. One hundred and sixteen eutrophic subjects aged 7-11 years old were evaluated, caries-free and with no definite need of orthodontic treatment. Salivary flow rate and pH, total protein (TP), alpha-amylase (AMY), calcium (CA) and phosphate (PHO) concentrations were determined in stimulated (SS) and unstimulated saliva (US). BF and MP were evaluated using digital gnathodynamometer and fractional sieving method, respectively. Gustatory sensitivity was determined by detecting the four primary tastes (sweet, salty, sour and bitter) in three different concentrations. Data were evaluated using descriptive statistics, Mann-Whitney/t-test, Spearman correlation and multiple regression analysis, considering α = 0.05. Significant positive correlation between taste and age was observed. CA and PHO concentrations correlated negatively with salivary flow and pH; sweet taste scores correlated with AMY concentrations and bitter taste sensitivity correlated with US flow rate (p salivary, masticatory characteristics and gustatory sensitivity was observed. The regression analysis showed a weak relationship between the distribution of chewed particles among the different sieves and BF. The concentration of some analytes was influenced by salivary flow and pH. Age, saliva flow and AMY concentrations influenced gustatory sensitivity. In addition, salivary, masticatory and taste characteristics did not differ between genders, and only a weak relation between MP and BF was observed.

Biphasic activation of the mTOR pathway in the gustatory cortex is correlated with and necessary for taste learning.

Science.gov (United States)

Belelovsky, Katya; Kaphzan, Hanoch; Elkobi, Alina; Rosenblum, Kobi

2009-06-10

Different forms of memories and synaptic plasticity require synthesis of new proteins at the time of acquisition or immediately after. We are interested in the role of translation regulation in the cortex, the brain structure assumed to store long-term memories. The mammalian target of rapamycin, mTOR (also known as FRAP and RAFT-1), is part of a key signal transduction mechanism known to regulate translation of specific subset of mRNAs and to affect learning and synaptic plasticity. We report here that novel taste learning induces two waves of mTOR activation in the gustatory cortex. Interestingly, the first wave can be identified both in synaptoneurosomal and cellular fractions, whereas the second wave is detected in the cellular fraction but not in the synaptic one. Inhibition of mTOR, specifically in the gustatory cortex, has two effects. First, biochemically, it modulates several known downstream proteins that control translation and reduces the expression of postsynaptic density-95 in vivo. Second, behaviorally, it attenuates long-term taste memory. The results suggest that the mTOR pathway in the cortex modulates both translation factor activity and protein expression, to enable normal taste memory consolidation.

Gustatory sensitivity and food acceptance in two phylogenetically closely related papilionid species: Papilio hospiton and Papilio machaon.

Science.gov (United States)

Sollai, Giorgia; Tomassini Barbarossa, Iole; Masala, Carla; Solari, Paolo; Crnjar, Roberto

2014-01-01

In herbivorous insects, food selection depends on sensitivity to specific chemical stimuli from host-plants as well as to secondary metabolites (bitter) and to sugars (phagostimulatory). Bitter compounds are noxious, unpalatable or both and evoke an aversive feeding response. Instead, sugars and sugar alcohols play a critical role in determining and enhancing the palatability of foods. We assumed that peripheral taste sensitivity may be related to the width of the host selection. Our model consists of two closely phylogenetically related Papilionid species exhibiting a difference in host plant choice: Papilio hospiton and Papilio machaon. The spike activity of the lateral and medial maxillary styloconic taste sensilla was recorded following stimulation with several carbohydrates, nicotine and NaCl, with the aim of characterizing their gustatory receptor neurons and of comparing their response patterns in the light of their different acceptability in feeding behaviour. The results show that: a) each sensillum houses phagostimulant and phagodeterrent cells; b) the spike activity of the gustatory neurons in response to different taste stimuli is higher in P. hospiton than in P. machaon; c) sugar solutions inhibit the spike activity of the deterrent and salt cells, and the suppression is higher in P. machaon than in P. hospiton. In conclusion, we propose that the different balance between the phagostimulant and phagodeterrent inputs from GRNs of maxillary sensilla may contribute in determining the difference in food choice and host range.

Gustatory sensitivity and food acceptance in two phylogenetically closely related papilionid species: Papilio hospiton and Papilio machaon.

Directory of Open Access Journals (Sweden)

Giorgia Sollai

Full Text Available In herbivorous insects, food selection depends on sensitivity to specific chemical stimuli from host-plants as well as to secondary metabolites (bitter and to sugars (phagostimulatory. Bitter compounds are noxious, unpalatable or both and evoke an aversive feeding response. Instead, sugars and sugar alcohols play a critical role in determining and enhancing the palatability of foods. We assumed that peripheral taste sensitivity may be related to the width of the host selection. Our model consists of two closely phylogenetically related Papilionid species exhibiting a difference in host plant choice: Papilio hospiton and Papilio machaon. The spike activity of the lateral and medial maxillary styloconic taste sensilla was recorded following stimulation with several carbohydrates, nicotine and NaCl, with the aim of characterizing their gustatory receptor neurons and of comparing their response patterns in the light of their different acceptability in feeding behaviour. The results show that: a each sensillum houses phagostimulant and phagodeterrent cells; b the spike activity of the gustatory neurons in response to different taste stimuli is higher in P. hospiton than in P. machaon; c sugar solutions inhibit the spike activity of the deterrent and salt cells, and the suppression is higher in P. machaon than in P. hospiton. In conclusion, we propose that the different balance between the phagostimulant and phagodeterrent inputs from GRNs of maxillary sensilla may contribute in determining the difference in food choice and host range.

Quantitative radiation dose-response relationships for normal tissues in man. II. Response of the salivary glands during radiotherapy

International Nuclear Information System (INIS)

Mossman, K.L.

1983-01-01

A quantitative dose-response curve for salivary gland function in patients during radiotherapy is presented. Salivary-function data used in this study were obtained from four previously published reports. All patients were treated with 60 Co teletherapy to the head and neck using conventional treatment techniques. Salivary dysfunction was determined at specific dose levels by comparing salivary flow rates before therapy with flow rates at specific dose intervals during radiotherapy up to a total dose of 6000 cGy. Fifty percent salivary dysfunction occurred after 1000 cGy and eighty percent dysfunction was observed by the end of the therapy course (6000 cGy). The salivary-function curve was also compared to the previously published dose-response curve for taste function. Comparisons of the two curves indicate that salivary dysfunction precedes taste loss and that the shapes of the dose-response curves are different. A new term, tissue tolerance ratio, defined as the ratio of responses of two tissues given the same radiation dose, was used to make the comparisons between gustatory and salivary gland tissue effects. Measurements of salivary gland function and analysis of dose-response curves may be useful in evaluating chemical modifiers of radiation response

Selective Deletion of Sodium Salt Taste during Development Leads to Expanded Terminal Fields of Gustatory Nerves in the Adult Mouse Nucleus of the Solitary Tract.

Science.gov (United States)

Sun, Chengsan; Hummler, Edith; Hill, David L

2017-01-18

Neuronal activity plays a key role in the development of sensory circuits in the mammalian brain. In the gustatory system, experimental manipulations now exist, through genetic manipulations of specific taste transduction processes, to examine how specific taste qualities (i.e., basic tastes) impact the functional and structural development of gustatory circuits. Here, we used a mouse knock-out model in which the transduction component used to discriminate sodium salts from other taste stimuli was deleted in taste bud cells throughout development. We used this model to test the hypothesis that the lack of activity elicited by sodium salt taste impacts the terminal field organization of nerves that carry taste information from taste buds to the nucleus of the solitary tract (NST) in the medulla. The glossopharyngeal, chorda tympani, and greater superficial petrosal nerves were labeled to examine their terminal fields in adult control mice and in adult mice in which the α-subunit of the epithelial sodium channel was conditionally deleted in taste buds (αENaC knockout). The terminal fields of all three nerves in the NST were up to 2.7 times greater in αENaC knock-out mice compared with the respective field volumes in control mice. The shapes of the fields were similar between the two groups; however, the density and spread of labels were greater in αENaC knock-out mice. Overall, our results show that disruption of the afferent taste signal to sodium salts disrupts the normal age-dependent "pruning" of all terminal fields, which could lead to alterations in sensory coding and taste-related behaviors. Neural activity plays a major role in the development of sensory circuits in the mammalian brain. To date, there has been no direct test of whether taste-elicited neural activity has a role in shaping central gustatory circuits. However, recently developed genetic tools now allow an assessment of how specific taste stimuli, in this case sodium salt taste, play a role

Odorant and gustatory receptors in the tsetse fly Glossina morsitans morsitans.

Directory of Open Access Journals (Sweden)

George F O Obiero

2014-04-01

Full Text Available Tsetse flies use olfactory and gustatory responses, through odorant and gustatory receptors (ORs and GRs, to interact with their environment. Glossina morsitans morsitans genome ORs and GRs were annotated using homologs of these genes in Drosophila melanogaster and an ab initio approach based on OR and GR specific motifs in G. m. morsitans gene models coupled to gene ontology (GO. Phylogenetic relationships among the ORs or GRs and the homologs were determined using Maximum Likelihood estimates. Relative expression levels among the G. m. morsitans ORs or GRs were established using RNA-seq data derived from adult female fly. Overall, 46 and 14 putative G. m. morsitans ORs and GRs respectively were recovered. These were reduced by 12 and 59 ORs and GRs respectively compared to D. melanogaster. Six of the ORs were homologous to a single D. melanogaster OR (DmOr67d associated with mating deterrence in females. Sweet taste GRs, present in all the other Diptera, were not recovered in G. m. morsitans. The GRs associated with detection of CO2 were conserved in G. m. morsitans relative to D. melanogaster. RNA-sequence data analysis revealed expression of GmmOR15 locus represented over 90% of expression profiles for the ORs. The G. m. morsitans ORs or GRs were phylogenetically closer to those in D. melanogaster than to other insects assessed. We found the chemoreceptor repertoire in G. m. morsitans smaller than other Diptera, and we postulate that this may be related to the restricted diet of blood-meal for both sexes of tsetse flies. However, the clade of some specific receptors has been expanded, indicative of their potential importance in chemoreception in the tsetse.

Gustatory perception and fat body energy metabolism are jointly affected by vitellogenin and juvenile hormone in honey bees.

Science.gov (United States)

Wang, Ying; Brent, Colin S; Fennern, Erin; Amdam, Gro V

2012-06-01

Honey bees (Apis mellifera) provide a system for studying social and food-related behavior. A caste of workers performs age-related tasks: young bees (nurses) usually feed the brood and other adult bees inside the nest, while older bees (foragers) forage outside for pollen, a protein/lipid source, or nectar, a carbohydrate source. The workers' transition from nursing to foraging and their foraging preferences correlate with differences in gustatory perception, metabolic gene expression, and endocrine physiology including the endocrine factors vitellogenin (Vg) and juvenile hormone (JH). However, the understanding of connections among social behavior, energy metabolism, and endocrine factors is incomplete. We used RNA interference (RNAi) to perturb the gene network of Vg and JH to learn more about these connections through effects on gustation, gene transcripts, and physiology. The RNAi perturbation was achieved by single and double knockdown of the genes ultraspiracle (usp) and vg, which encode a putative JH receptor and Vg, respectively. The double knockdown enhanced gustatory perception and elevated hemolymph glucose, trehalose, and JH. We also observed transcriptional responses in insulin like peptide 1 (ilp1), the adipokinetic hormone receptor (AKHR), and cGMP-dependent protein kinase (PKG, or "foraging gene" Amfor). Our study demonstrates that the Vg-JH regulatory module controls changes in carbohydrate metabolism, but not lipid metabolism, when worker bees shift from nursing to foraging. The module is also placed upstream of ilp1, AKHR, and PKG for the first time. As insulin, adipokinetic hormone (AKH), and PKG pathways influence metabolism and gustation in many animals, we propose that honey bees have conserved pathways in carbohydrate metabolism and conserved connections between energy metabolism and gustatory perception. Thus, perhaps the bee can make general contributions to the understanding of food-related behavior and metabolic disorders.

Gustatory perception and fat body energy metabolism are jointly affected by vitellogenin and juvenile hormone in honey bees.

Directory of Open Access Journals (Sweden)

Ying Wang

2012-06-01

Full Text Available Honey bees (Apis mellifera provide a system for studying social and food-related behavior. A caste of workers performs age-related tasks: young bees (nurses usually feed the brood and other adult bees inside the nest, while older bees (foragers forage outside for pollen, a protein/lipid source, or nectar, a carbohydrate source. The workers' transition from nursing to foraging and their foraging preferences correlate with differences in gustatory perception, metabolic gene expression, and endocrine physiology including the endocrine factors vitellogenin (Vg and juvenile hormone (JH. However, the understanding of connections among social behavior, energy metabolism, and endocrine factors is incomplete. We used RNA interference (RNAi to perturb the gene network of Vg and JH to learn more about these connections through effects on gustation, gene transcripts, and physiology. The RNAi perturbation was achieved by single and double knockdown of the genes ultraspiracle (usp and vg, which encode a putative JH receptor and Vg, respectively. The double knockdown enhanced gustatory perception and elevated hemolymph glucose, trehalose, and JH. We also observed transcriptional responses in insulin like peptide 1 (ilp1, the adipokinetic hormone receptor (AKHR, and cGMP-dependent protein kinase (PKG, or "foraging gene" Amfor. Our study demonstrates that the Vg-JH regulatory module controls changes in carbohydrate metabolism, but not lipid metabolism, when worker bees shift from nursing to foraging. The module is also placed upstream of ilp1, AKHR, and PKG for the first time. As insulin, adipokinetic hormone (AKH, and PKG pathways influence metabolism and gustation in many animals, we propose that honey bees have conserved pathways in carbohydrate metabolism and conserved connections between energy metabolism and gustatory perception. Thus, perhaps the bee can make general contributions to the understanding of food-related behavior and metabolic disorders.

Terminal investment in the gustatory appeal of nuptial food gifts in crickets.

Science.gov (United States)

Duffield, K R; Hunt, J; Rapkin, J; Sadd, B M; Sakaluk, S K

2015-10-01

Investment in current versus future reproduction represents a prominent trade-off in life-history theory and is likely dependent on an individual's life expectancy. The terminal investment hypothesis posits that a reduction in residual reproductive value (i.e. potential for future offspring) will result in increased investment in current reproduction. We tested the hypothesis that male decorated crickets (Gryllodes sigillatus), when cued to their impending mortality, should increase their reproductive effort by altering the composition of their nuptial food gifts (i.e. spermatophylaxes) to increase their gustatory appeal to females. Using a repeated-measures design, we analysed the amino acid composition of spermatophylaxes derived from males both before and after injection of either a saline control or a solution of heat-killed bacteria. The latter, although nonpathogenic, represents an immune challenge that may signal an impending survival threat. One principal component explaining amino acid variation in spermatophylaxes, characterized by a high loading to histidine, was significantly lower in immune-challenged versus control males. The relevance of this difference for the gustatory appeal of gifts to females was assessed by mapping spermatophylax composition onto a fitness surface derived in an earlier study identifying the amino acid composition of spermatophylaxes preferred by females. We found that immune-challenged males maintained the level of attractiveness of their gifts post-treatment, whereas control males produced significantly less attractive gifts post-injection. These results are consistent with the hypothesis that cues of a survival-threatening infection stimulate terminal investment in male decorated crickets with respect to the gustatory appeal of their nuptial food gifts. © 2015 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2015 European Society For Evolutionary Biology.

A test for measuring gustatory function.

Science.gov (United States)

Smutzer, Gregory; Lam, Si; Hastings, Lloyd; Desai, Hetvi; Abarintos, Ray A; Sobel, Marc; Sayed, Nabil

2008-08-01

The purpose of this study was to determine the usefulness of edible taste strips for measuring human gustatory function. The physical properties of edible taste strips were examined to determine their potential for delivering threshold and suprathreshold amounts of taste stimuli to the oral cavity. Taste strips were then assayed by fluorescence to analyze the uniformity and distribution of bitter tastant in the strips. Finally, taste recognition thresholds for sweet taste were examined to determine whether or not taste strips could detect recognition thresholds that were equal to or better than those obtained from aqueous tests. Edible strips were prepared from pullulan-hydroxypropyl methylcellulose solutions that were dried to a thin film. The maximal amount of a tastant that could be incorporated in a 2.54 cm2 taste strip was identified by including representative taste stimuli for each class of tastant (sweet, sour, salty, bitter, and umami) during strip formation. Distribution of the bitter tastant quinine hydrochloride in taste strips was assayed by fluorescence emission spectroscopy. The efficacy of taste strips for evaluating human gustatory function was examined by using a single series ascending method of limits protocol. Sucrose taste recognition threshold data from edible strips was then compared with results that were obtained from a standard "sip and spit" recognition threshold test. Edible films that formed from a pullulan-hydroxypropyl methylcellulose polymer mixture can be used to prepare clear, thin strips that have essentially no background taste and leave no physical presence after release of tastant. Edible taste strips could uniformly incorporate up to 5% of their composition as tastant. Taste recognition thresholds for sweet taste were over one order of magnitude lower with edible taste strips when compared with an aqueous taste test. Edible taste strips are a highly sensitive method for examining taste recognition thresholds in humans. This

Gustatory receptor neuron responds to DEET and other insect repellents in the yellow-fever mosquito, Aedes aegypti

Science.gov (United States)

Sanford, Jillian L.; Shields, Vonnie D. C.; Dickens, Joseph C.

2013-03-01

Three gustatory receptor neurons were characterized for contact chemoreceptive sensilla on the labella of female yellow-fever mosquitoes, Aedes aegypti. The neuron with the smallest amplitude spike responded to the feeding deterrent, quinine, as well as N, N-diethyl-3-methylbenzamide and other insect repellents. Two other neurons with differing spikes responded to salt (NaCl) and sucrose. This is the first report of a gustatory receptor neuron specific for insect repellents in mosquitoes and may provide a tool for screening chemicals to discover novel or improved feeding deterrents and repellents for use in the management of arthropod disease vectors.

Peripheral, central and behavioral responses to the cuticular pheromone bouquet in Drosophila melanogaster males.

Directory of Open Access Journals (Sweden)

Tsuyoshi Inoshita

Full Text Available Pheromonal communication is crucial with regard to mate choice in many animals including insects. Drosophila melanogaster flies produce a pheromonal bouquet with many cuticular hydrocarbons some of which diverge between the sexes and differently affect male courtship behavior. Cuticular pheromones have a relatively high weight and are thought to be -- mostly but not only -- detected by gustatory contact. However, the response of the peripheral and central gustatory systems to these substances remains poorly explored. We measured the effect induced by pheromonal cuticular mixtures on (i the electrophysiological response of peripheral gustatory receptor neurons, (ii the calcium variation in brain centers receiving these gustatory inputs and (iii the behavioral reaction induced in control males and in mutant desat1 males, which show abnormal pheromone production and perception. While male and female pheromones induced inhibitory-like effects on taste receptor neurons, the contact of male pheromones on male fore-tarsi elicits a long-lasting response of higher intensity in the dedicated gustatory brain center. We found that the behavior of control males was more strongly inhibited by male pheromones than by female pheromones, but this difference disappeared in anosmic males. Mutant desat1 males showed an increased sensitivity of their peripheral gustatory neurons to contact pheromones and a behavioral incapacity to discriminate sex pheromones. Together our data indicate that cuticular hydrocarbons induce long-lasting inhibitory effects on the relevant taste pathway which may interact with the olfactory pathway to modulate pheromonal perception.

Relationship between gustatory function and average number of taste buds per fungiform papilla measured by confocal laser scanning microscopy in humans.

Science.gov (United States)

Saito, Takehisa; Ito, Tetsufumi; Ito, Yumi; Manabe, Yasuhiro; Sano, Kazuo

2017-02-01

The aim of this study was to elucidate the relationship between the gustatory function and average number of taste buds per fungiform papilla (FP) in humans. Systemically healthy volunteers (n = 211), pre-operative patients with chronic otitis media (n = 79), and postoperative patients, with or without a chorda tympani nerve (CTN) severed during middle ear surgery (n = 63), were included. Confocal laser scanning microscopy was employed to observe fungiform taste buds because it allows many FP to be observed non-invasively in a short period of time. Taste buds in an average of 10 FP in the midlateral region of the tongue were counted. In total, 3,849 FP were observed in 353 subjects. The gustatory function was measured by electrogustometry (EGM). An inverse relationship was found between the gustatory function and average number of fungiform taste buds per papilla. The healthy volunteers showed a lower EGM threshold (better gustatory function) and had more taste buds than did the patients with otitis media, and the patients with otitis media showed a lower EGM threshold and had more taste buds than did postoperative patients, reflecting the severity of damage to the CTN. It was concluded that the confocal laser scanning microscope is a very useful tool for using to observe a large number of taste buds non-invasively. © 2017 Eur J Oral Sci.

Localization of Ulex europaeus agglutinin-I (UEA-I) in the developing gustatory epithelium of the rat.

Science.gov (United States)

Taniguchi, Ryo; Shi, Lei; Honma, Shiho; Fujii, Masae; Ueda, Katsura; El-Sharaby, Ashraf; Wakisaka, Satoshi

2004-09-01

To understand the development of the gustatory structures necessitates a reliable marker for both immature and mature taste buds. It has been reported that the intragemmal cells within the taste buds of adult rats were bound to Ulex europaeus agglutinin-I (UEA-I), a specific lectin for alpha-linked fucose, but it has not been determined whether immature taste buds, i.e. taste buds without an apparent taste pore, are labeled with UEA-I. The present study was conducted to examine the UEA-I binding pattern during the development of the rat gustatory epithelium. In adult animals, UEA-I bound to the membrane of taste buds in all examined regions of the gustatory epithelium. Within the individual taste buds, UEA-I labeled almost all intragemmal cells. The binding of UEA-I was occasionally detected below the keratinized layer of the trench wall epithelium but could not be found in the lingual epithelium of the adult animal. During the development of circumvallate papilla, some cells within the immature taste buds were also labeled with UEA-I. The developmental changes in the UEA-I binding pattern in fungiform papillae were almost identical to those in the circumvallate papilla: both immature and mature taste buds were labeled with UEA-I. The present results indicate that UEA-I is a specific lectin for the intragemmal cells of both immature and mature taste buds and, thus, UEA-I can be used as a reliable marker for all taste buds in the rat.

Comparative Evaluation of the Effect of Menstruation, Pregnancy and Menopause on Salivary Flow Rate, pH and Gustatory Function.

Science.gov (United States)

Saluja, Pulin; Shetty, Vishwaprakash; Dave, Aparna; Arora, Manpreet; Hans, Vibha; Madan, Ajay

2014-10-01

There are five situations in a women's life during which hormone fluctuations make them more susceptible to oral health problems - during puberty, at certain points in the monthly menstrual cycle, when using birth control pills, during pregnancy, and at menopause. The present study aimed at evaluating the effect of menstruation, pregnancy and menopause on salivary flow rate, pH and gustatory function. The study was carried out on 120 patients including 30 controls (with normal menstrual cycle of 28 to 30 d) and 90 cases (30 patients within three days of menstruation, 30 pregnant and 30 postmenopausal). Paraffin-stimulated saliva samples were obtained by expectoration to calculate salivary flow rate, pH was measured electrometically and patients were prospectively evaluated for gustatory function. Then, whole mouth taste test was performed in which the quality identification and intensity ratings of taste solutions were measured. No statistically significant difference was found between the groups with respect to salivary flow rate but pH values were significantly lower in post menopausal women (pwomen than intensity of taste perception for other tastes (pwomen reported change in their dietary habits as all of them expressed liking for sweeter food. Reduced salivary flow rate and pH in postmen-opausal women may make them more prone to the occurrence of oral health problems. Also, pregnant and postmenopausal women appeared to have a reduced perception of sucrose, which can alter eating habits, such as intake of more sweet foods whereas no significant difference is observed in taste perception of NaCl, citric acid and quinine hydrochloride between the subjects.

Microwave processing of gustatory tissues for immunohistochemistry

Science.gov (United States)

Bond, Amanda; Kinnamon, John C.

2013-01-01

We use immunohistochemistry to study taste cell structure and function as a means to elucidate how taste receptor cells communicate with nerve fibers and adjacent taste cells. This conventional method, however, is time consuming. In the present study we used taste buds from rat circumvallate papillae to compare conventional immunohistochemical tissue processing with microwave processing for the colocalization of several biochemical pathway markers (PLCβ2, syntaxin-1, IP3R3, α-gustducin) and the nuclear stain, Sytox. The results of our study indicate that in microwave versus conventional immunocytochemistry: (1) fixation quality is improved; (2) the amount of time necessary for processing tissue is decreased; (3) antigen retrieval is no longer needed; (4) image quality is superior. In sum, microwave tissue processing of gustatory tissues is faster and superior to conventional immunohistochemical tissue processing for many applications. PMID:23473796

A large increase of sour taste receptor cells in Skn-1-deficient mice does not alter the number of their sour taste signal-transmitting gustatory neurons.

Science.gov (United States)

Maeda, Naohiro; Narukawa, Masataka; Ishimaru, Yoshiro; Yamamoto, Kurumi; Misaka, Takumi; Abe, Keiko

2017-05-01

The connections between taste receptor cells (TRCs) and innervating gustatory neurons are formed in a mutually dependent manner during development. To investigate whether a change in the ratio of cell types that compose taste buds influences the number of innervating gustatory neurons, we analyzed the proportion of gustatory neurons that transmit sour taste signals in adult Skn-1a -/- mice in which the number of sour TRCs is greatly increased. We generated polycystic kidney disease 1 like 3-wheat germ agglutinin (pkd1l3-WGA)/Skn-1a +/+ and pkd1l3-WGA/Skn-1a -/- mice by crossing Skn-1a -/- mice and pkd1l3-WGA transgenic mice, in which neural pathways of sour taste signals can be visualized. The number of WGA-positive cells in the circumvallate papillae is 3-fold higher in taste buds of pkd1l3-WGA/Skn-1a -/- mice relative to pkd1l3-WGA/Skn-1a +/+ mice. Intriguingly, the ratio of WGA-positive neurons to P2X 2 -expressing gustatory neurons in nodose/petrosal ganglia was similar between pkd1l3-WGA/Skn-1a +/+ and pkd1l3-WGA/Skn-1a -/- mice. In conclusion, an alteration in the ratio of cell types that compose taste buds does not influence the number of gustatory neurons that transmit sour taste signals. Copyright © 2017. Published by Elsevier B.V.

Molecular signals into the insular cortex and amygdala during aversive gustatory memory formation.

Science.gov (United States)

Bermúdez-Rattoni, Federico; Ramírez-Lugo, Leticia; Gutiérrez, Ranier; Miranda, María Isabel

2004-02-01

In this paper, we will provide evidence of the putative molecular signals and biochemical events that mediate the formation of long-lasting gustatory memory trace. When an animal drinks a novel taste (the conditioned stimulus; CS) and it is later associated with malaise (unconditioned stimulus; US), the animal will reject it in the next presentation, developing a long-lasting taste aversion, i.e., the taste cue becomes an aversive signal, and this is referred to as conditioning taste aversion. Different evidence indicates that the novel stimulus (taste) induces a rapid and strong cortical acetylcholine activity that decreases when the stimulus becomes familiar after several presentations. Cholinergic activation via muscarinic receptors initiates a series of intracellular events leading to plastic changes that could be related to short- and/or long-term memory gustatory trace. Such plastic changes facilitate the incoming US signals carried out by, in part, the glutamate release induced by the US. Altogether, these events could produce the cellular changes related to the switch from safe to aversive taste memory trace. A proposed working model to explain the biochemical sequence of signals during taste memory formation will be discussed.

Fluid consumption and taste novelty determines transcription temporal dynamics in the gustatory cortex.

Science.gov (United States)

Inberg, Sharon; Jacob, Eyal; Elkobi, Alina; Edry, Efrat; Rappaport, Akiva; Simpson, T Ian; Armstrong, J Douglas; Shomron, Noam; Pasmanik-Chor, Metsada; Rosenblum, Kobi

2016-02-09

Novel taste memories, critical for animal survival, are consolidated to form long term memories which are dependent on translation regulation in the gustatory cortex (GC) hours following acquisition. However, the role of transcription regulation in the process is unknown. Here, we report that transcription in the GC is necessary for taste learning in rats, and that drinking and its consequences, as well as the novel taste experience, affect transcription in the GC during taste memory consolidation. We show differential effects of learning on temporal dynamics in set of genes in the GC, including Arc/Arg3.1, known to regulate the homeostasis of excitatory synapses. We demonstrate that in taste learning, transcription programs were activated following the physiological responses (i.e., fluid consumption following a water restriction regime, reward, arousal of the animal, etc.) and the specific information about a given taste (i.e., taste novelty). Moreover, the cortical differential prolonged kinetics of mRNA following novel versus familiar taste learning may represent additional novelty related molecular response, where not only the total amount, but also the temporal dynamics of transcription is modulated by sensory experience of novel information.

Existe-t-il une détection gustative des lipides alimentaires ? [Is there a gustatory detection of dietary lipids?

Directory of Open Access Journals (Sweden)

Philippe BESNARD

2016-06-01

Full Text Available The presence of lipids helps to make food more smooth, creamy and melting, in brief more palatable. This finding is not trivial. It indicates that lipids are easily perceived in a food matrix, which may be complex. During a long time, the oro-sensory detection of dietary lipids was thought to take place only through textural and retronasal olfactory cues. Over the last decade, this restrictive vision has gradually been challenged by a set of animal and human data suggesting that the gustatory pathway may also be involved in this phenomenon. After few reminders about the gustatory pathway, this mini-review will propose a short overview on a controversial question: is there a taste for fat?

Comparative Evaluation of the Effect of Menstruation, Pregnancy and Menopause on Salivary Flow Rate, pH and Gustatory Function

Science.gov (United States)

Shetty, Vishwaprakash; Dave, Aparna; Arora, Manpreet; Hans, Vibha; Madan, Ajay

2014-01-01

Objective: There are five situations in a women’s life during which hormone fluctuations make them more susceptible to oral health problems – during puberty, at certain points in the monthly menstrual cycle, when using birth control pills, during pregnancy, and at menopause. The present study aimed at evaluating the effect of menstruation, pregnancy and menopause on salivary flow rate, pH and gustatory function. Materials and Methods: The study was carried out on 120 patients including 30 controls (with normal menstrual cycle of 28 to 30 d) and 90 cases (30 patients within three days of menstruation, 30 pregnant and 30 postmenopausal). Paraffin-stimulated saliva samples were obtained by expectoration to calculate salivary flow rate, pH was measured electrometically and patients were prospectively evaluated for gustatory function. Then, whole mouth taste test was performed in which the quality identification and intensity ratings of taste solutions were measured. Results: No statistically significant difference was found between the groups with respect to salivary flow rate but pH values were significantly lower in post menopausal women (pwomen than intensity of taste perception for other tastes (pwomen reported change in their dietary habits as all of them expressed liking for sweeter food. Conclusion: Reduced salivary flow rate and pH in postmen­opausal women may make them more prone to the occurrence of oral health problems. Also, pregnant and postmenopausal women appeared to have a reduced perception of sucrose, which can alter eating habits, such as intake of more sweet foods whereas no significant difference is observed in taste perception of NaCl, citric acid and quinine hydrochloride between the subjects. PMID:25478455

Gustatory receptor neuron responds to DEET and other insect repellents in the yellow fever mosquito, aedes aegypti

Science.gov (United States)

Three gustatory receptor neurons were characterized for contact chemoreceptive sensilla on the labella of female yellow fever mosquitoes, Aedes aegypti. The neuron with the smallest amplitude spike responded to the feeding deterrent, quinine, as well as DEET and other insect repellents. Two other ...

Evaluation of palatability of 10 commercial amlodipine orally disintegrating tablets by gustatory sensation testing, OD-mate as a new disintegration apparatus and the artificial taste sensor.

Science.gov (United States)

Uchida, Takahiro; Yoshida, Miyako; Hazekawa, Mai; Haraguchi, Tamami; Furuno, Hiroyuki; Teraoka, Makoto; Ikezaki, Hidekazu

2013-09-01

The purpose of this study was to evaluate and compare the palatability of 10 formulations (the original manufacturer's formulation and nine generics) of amlodipine orally disintegrating tablets (ODTs) by means of human gustatory sensation testing, disintegration/dissolution testing and the evaluation of bitterness intensity using a taste sensor. Initially, the palatability, dissolution and bitterness intensity of the ODTs were evaluated in gustatory sensation tests. Second, the disintegration times of the ODTs were measured using the OD-mate, a newly developed apparatus for measuring the disintegration of ODTs, and lastly, the bitterness intensities were evaluated using an artificial taste sensor. Using factor analysis, the factors most affecting the palatability of amlodipine ODTs were found to be disintegration and taste. There was high correlation between the disintegration times of the 10 amlodipine ODTs estimated in human gustatory testing and those found using the OD-mate. The bitterness intensities of amlodipine ODTs 10, 20 and 30 s after starting the conventional brief dissolution test and the values determined by the taste sensor were highly correlated with the bitterness intensities determined in gustatory sensation testing. The OD-mate and the taste sensor may be useful for predicting the disintegration and bitterness intensity of amlodipine ODTs in the mouth. © 2013 Royal Pharmaceutical Society.

The Gustatory Signaling Pathway and Bitter Taste Receptors Affect the Development of Obesity and Adipocyte Metabolism in Mice.

Directory of Open Access Journals (Sweden)

Bert Avau

Full Text Available Intestinal chemosensory signaling pathways involving the gustatory G-protein, gustducin, and bitter taste receptors (TAS2R have been implicated in gut hormone release. Alterations in gut hormone profiles may contribute to the success of bariatric surgery. This study investigated the involvement of the gustatory signaling pathway in the development of diet-induced obesity and the therapeutic potential of targeting TAS2Rs to induce body weight loss. α-gustducin-deficient (α-gust-/- mice became less obese than wild type (WT mice when fed a high-fat diet (HFD. White adipose tissue (WAT mass was lower in α-gust-/- mice due to increased heat production as a result of increases in brown adipose tissue (BAT thermogenic activity, involving increased protein expression of uncoupling protein 1. Intra-gastric treatment of obese WT and α-gust-/- mice with the bitter agonists denatonium benzoate (DB or quinine (Q during 4 weeks resulted in an α-gustducin-dependent decrease in body weight gain associated with a decrease in food intake (DB, but not involving major changes in gut peptide release. Both WAT and 3T3-F442A pre-adipocytes express TAS2Rs. Treatment of pre-adipocytes with DB or Q decreased differentiation into mature adipocytes. In conclusion, interfering with the gustatory signaling pathway protects against the development of HFD-induced obesity presumably through promoting BAT activity. Intra-gastric bitter treatment inhibits weight gain, possibly by directly affecting adipocyte metabolism.

Does taste matter? How anticipation of cola brands influences gustatory processing in the brain.

Directory of Open Access Journals (Sweden)

Simone Kühn

Full Text Available Brands surround us everywhere in daily life. Here we investigate the influences of brand cues on gustatory processing of the same beverage. Participants were led to believe that the brand that announced the administration of a Cola mixture provided correct information about the drink to come. We found stronger fMRI signal in right mOFC during weak compared to strong brand cues in a contrast of parametric modulation with subjective liking. When directly comparing the two strong brands cues, more activation in the right amygdala was found for Coca Cola cues compared with Pepsi Cola cues. During the taste phase the same beverage elicited stronger activation in left ventral striatum when it was previously announced by a strong compared with a weak brand. This effect was stronger in participants who drink Cola infrequently and might therefore point to a stronger reliance on brand cues in less experienced consumers. The present results reveal strong effects of brand labels on neural responses signalling reward.

Does taste matter? How anticipation of cola brands influences gustatory processing in the brain.

Science.gov (United States)

Kühn, Simone; Gallinat, Jürgen

2013-01-01

Brands surround us everywhere in daily life. Here we investigate the influences of brand cues on gustatory processing of the same beverage. Participants were led to believe that the brand that announced the administration of a Cola mixture provided correct information about the drink to come. We found stronger fMRI signal in right mOFC during weak compared to strong brand cues in a contrast of parametric modulation with subjective liking. When directly comparing the two strong brands cues, more activation in the right amygdala was found for Coca Cola cues compared with Pepsi Cola cues. During the taste phase the same beverage elicited stronger activation in left ventral striatum when it was previously announced by a strong compared with a weak brand. This effect was stronger in participants who drink Cola infrequently and might therefore point to a stronger reliance on brand cues in less experienced consumers. The present results reveal strong effects of brand labels on neural responses signalling reward.

Fluid consumption and taste novelty determines transcription temporal dynamics in the gustatory cortex

OpenAIRE

Inberg, Sharon; Jacob, Eyal; Elkobi, Alina; Edry, Efrat; Rappaport, Akiva; Simpson, T. Ian; Armstrong, J. Douglas; Shomron, Noam; Pasmanik-Chor, Metsada; Rosenblum, Kobi

2016-01-01

Background Novel taste memories, critical for animal survival, are consolidated to form long term memories which are dependent on translation regulation in the gustatory cortex (GC) hours following acquisition. However, the role of transcription regulation in the process is unknown. Results Here, we report that transcription in the GC is necessary for taste learning in rats, and that drinking and its consequences, as well as the novel taste experience, affect transcription in the GC during ta...

Neural responsivity during soft drink intake, anticipation, and advertisement exposure in habitually consuming youth

Science.gov (United States)

Burger, Kyle S.; Stice, Eric

2014-01-01

OBJECTIVE Although soft drinks are heavily advertised, widely consumed, and have been associated with obesity, little is understood regarding neural responsivity to soft drink intake, anticipated intake, and advertisements. METHODS Functional MRI was used to assess examine neural response to carbonated soft drink intake, anticipated intake and advertisement exposure as well as milkshake intake in 27 adolescents that varied on soft drink consumer status. RESULTS Intake and anticipated intake of carbonated Coke® activated regions implicated in gustatory, oral somatosensory, and reward processing, yet high-fat/sugar milkshake intake elicited greater activation in these regions versus Coke intake. Advertisements highlighting the Coke product vs. non-food control advertisements, but not the Coke logo, activated gustatory and visual brain regions. Habitual Coke consumers vs. non-consumers showed greater posterior cingulate responsivity to Coke logo ads, suggesting that the logo is a conditioned cue. Coke consumers exhibited less ventrolateral prefrontal cortex responsivity during anticipated Coke intake relative to non-consumers. CONCLUSIONS Results indicate that soft drinks activate reward and gustatory regions, but are less potent in activating these regions than high-fat/sugar beverages, and imply that habitual soft drink intake promotes hyper-responsivity of regions encoding salience/attention toward brand specific cues and hypo-responsivity of inhibitory regions while anticipating intake. PMID:23836764

Neural responsivity during soft drink intake, anticipation, and advertisement exposure in habitually consuming youth.

Science.gov (United States)

Burger, Kyle S; Stice, Eric

2014-02-01

Although soft drinks are heavily advertised, widely consumed, and have been associated with obesity, little is understood regarding neural responsivity to soft drink intake, anticipated intake, and advertisements. Functional MRI was used to assess examine neural response to carbonated soft drink intake, anticipated intake and advertisement exposure as well as milkshake intake in 27 adolescents that varied on soft drink consumer status. Intake and anticipated intake of carbonated Coke® activated regions implicated in gustatory, oral somatosensory, and reward processing, yet high-fat/sugar milkshake intake elicited greater activation in these regions vs. Coke intake. Advertisements highlighting the Coke product vs. nonfood control advertisements, but not the Coke logo, activated gustatory and visual brain regions. Habitual Coke consumers vs. nonconsumers showed greater posterior cingulate responsivity to Coke logo ads, suggesting that the logo is a conditioned cue. Coke consumers exhibited less ventrolateral prefrontal cortex responsivity during anticipated Coke intake relative to nonconsumers. Results indicate that soft drinks activate reward and gustatory regions, but are less potent in activating these regions than high-fat/sugar beverages, and imply that habitual soft drink intake promotes hyper-responsivity of regions encoding salience/attention toward brand specific cues and hypo-responsivity of inhibitory regions while anticipating intake. Copyright © 2013 The Obesity Society.

Gustatory sensation of (L)- and (D)-amino acids in humans.

Science.gov (United States)

Kawai, Misako; Sekine-Hayakawa, Yuki; Okiyama, Atsushi; Ninomiya, Yuzo

2012-12-01

Amino acids are known to elicit complex taste, but most human psychophysical studies on the taste of amino acids have focused on a single basic taste, such as umami (savory) taste, sweetness, or bitterness. In this study, we addressed the potential relationship between the structure and the taste properties of amino acids by measuring the human gustatory intensity and quality in response to aqueous solutions of proteogenic amino acids in comparison to D-enantiomers. Trained subjects tasted aqueous solution of each amino acid and evaluated the intensities of total taste and each basic taste using a category-ratio scale. Each basic taste of amino acids showed the dependency on its hydrophobicity, size, charge, functional groups on the side chain, and chirality of the alpha carbon. In addition, the overall taste of amino acid was found to be the combination of basic tastes according to the partial structure. For example, hydrophilic non-charged middle-sized amino acids elicited sweetness, and L-enantiomeric hydrophilic middle-sized structure was necessary for umami taste. For example, L-serine had mainly sweet and minor umami taste, and D-serine was sweet. We further applied Stevens' psychophysical function to relate the total-taste intensity and the concentration, and found that the slope values depended on the major quality of taste (e.g., bitter large, sour small).

Descending projections from the nucleus accumbens shell excite activity of taste-responsive neurons in the nucleus of the solitary tract in the hamster.

Science.gov (United States)

Li, Cheng-Shu; Lu, Da-Peng; Cho, Young K

2015-06-01

The nucleus of the solitary tract (NST) and the parabrachial nuclei (PbN) are the first and second relays in the rodent central taste pathway. A series of electrophysiological experiments revealed that spontaneous and taste-evoked activities of brain stem gustatory neurons are altered by descending input from multiple forebrain nuclei in the central taste pathway. The nucleus accumbens shell (NAcSh) is a key neural substrate of reward circuitry, but it has not been verified as a classical gustatory nucleus. A recent in vivo electrophysiological study demonstrated that the NAcSh modulates the spontaneous and gustatory activities of hamster pontine taste neurons. In the present study, we investigated whether activation of the NAcSh modulates gustatory responses of the NST neurons. Extracellular single-unit activity was recorded from medullary neurons in urethane-anesthetized hamsters. After taste response was confirmed by delivery of sucrose, NaCl, citric acid, and quinine hydrochloride to the anterior tongue, the NAcSh was stimulated bilaterally with concentric bipolar stimulating electrodes. Stimulation of the ipsilateral and contralateral NAcSh induced firings from 54 and 37 of 90 medullary taste neurons, respectively. Thirty cells were affected bilaterally. No inhibitory responses or antidromic invasion was observed after NAcSh activation. In the subset of taste cells tested, high-frequency electrical stimulation of the NAcSh during taste delivery enhanced taste-evoked neuronal firing. These results demonstrate that two-thirds of the medullary gustatory neurons are under excitatory descending influence from the NAcSh, which is a strong indication of communication between the gustatory pathway and the mesolimbic reward pathway. Copyright © 2015 the American Physiological Society.

A heteroscedastic generalized linear model with a non-normal speed factor for responses and response times.

Science.gov (United States)

Molenaar, Dylan; Bolsinova, Maria

2017-05-01

In generalized linear modelling of responses and response times, the observed response time variables are commonly transformed to make their distribution approximately normal. A normal distribution for the transformed response times is desirable as it justifies the linearity and homoscedasticity assumptions in the underlying linear model. Past research has, however, shown that the transformed response times are not always normal. Models have been developed to accommodate this violation. In the present study, we propose a modelling approach for responses and response times to test and model non-normality in the transformed response times. Most importantly, we distinguish between non-normality due to heteroscedastic residual variances, and non-normality due to a skewed speed factor. In a simulation study, we establish parameter recovery and the power to separate both effects. In addition, we apply the model to a real data set. © 2017 The Authors. British Journal of Mathematical and Statistical Psychology published by John Wiley & Sons Ltd on behalf of British Psychological Society.

A Box-Cox normal model for response times.

Science.gov (United States)

Klein Entink, R H; van der Linden, W J; Fox, J-P

2009-11-01

The log-transform has been a convenient choice in response time modelling on test items. However, motivated by a dataset of the Medical College Admission Test where the lognormal model violated the normality assumption, the possibilities of the broader class of Box-Cox transformations for response time modelling are investigated. After an introduction and an outline of a broader framework for analysing responses and response times simultaneously, the performance of a Box-Cox normal model for describing response times is investigated using simulation studies and a real data example. A transformation-invariant implementation of the deviance information criterium (DIC) is developed that allows for comparing model fit between models with different transformation parameters. Showing an enhanced description of the shape of the response time distributions, its application in an educational measurement context is discussed at length.

Physiological recordings and RNA sequencing of the gustatory appendages of the yellow-fever mosquito Aedes aegypti.

Science.gov (United States)

Sparks, Jackson T; Dickens, Joseph C

2014-12-30

Electrophysiological recording of action potentials from sensory neurons of mosquitoes provides investigators a glimpse into the chemical perception of these disease vectors. We have recently identified a bitter sensing neuron in the labellum of female Aedes aegypti that responds to DEET and other repellents, as well as bitter quinine, through direct electrophysiological investigation. These gustatory receptor neuron responses prompted our sequencing of total mRNA from both male and female labella and tarsi samples to elucidate the putative chemoreception genes expressed in these contact chemoreception tissues. Samples of tarsi were divided into pro-, meso- and metathoracic subtypes for both sexes. We then validated our dataset by conducting qRT-PCR on the same tissue samples and used statistical methods to compare results between the two methods. Studies addressing molecular function may now target specific genes to determine those involved in repellent perception by mosquitoes. These receptor pathways may be used to screen novel repellents towards disruption of host-seeking behavior to curb the spread of harmful viruses.

Value of apparent diffusion coefficient calculation before and after gustatory stimulation in the diagnosis of acute or chronic parotitis

Energy Technology Data Exchange (ETDEWEB)

Ries, T.; Arndt, C.; Regier, M.; Cramer, M.C.; Adam, G.; Habermann, C.R. [Diagnostic Center, Department of Diagnostic and Interventional Radiology, Hamburg (Germany); Graessner, J. [Medical Solutions Hamburg, Siemens AG, Hamburg (Germany); Reitmeier, F.; Jaehne, M. [University Medical Center Hamburg-Eppendorf, Center of Head Care and Dermatology, Department of Otorhinolaryngology, Hamburg (Germany)

2008-10-15

The purpose of the study was to investigate the value of diffusion-weighted (DW) echo-planar imaging (EPI) for quantifying physiological changes of the parotid gland before and after gustatory stimulation in patients suffering from acute or chronic recurrent inflammation in comparison with healthy volunteers. Using a DW-EPI sequence at 1.5 T, parotid glands of 19 consecutive patients with acute (n = 14) and chronic (n=) inflammation of parotid glands and 52 healthy volunteers were examined. Magnetic-resonance (MR) images were obtained before and after gustatory stimulation with 5 cc of lemon juice. In volunteers mean ADC values of 1.14 x 10{sup -3} mm{sup 2}/s before and 1.2 x 10{sup -3} mm{sup 2}/s after gustatory stimulation were observed. In acute inflammation ADC values were higher before [1.22 x 10{sup -3} mm{sup 2}/s (p = 0.006)] and after stimulation [1.32 x 10{sup -3} mm{sup 2}/s (p<0.001)]. Before stimulation ADC differences between chronic inflammation (1.05 x 10{sup -3} mm{sup 2}/s) and healthy volunteers (p = 0.04) as well as between acute and chronic inflammation (p=0.005) were statistically significant. No differences were detected after stimulation between chronic inflammation (1.2 x 10{sup -3} mm{sup 2}/s) and healthy volunteers (p=0.94) and between acute and chronic inflammation (p=0.15), respectively. DW-EPI seems to display the physiological changes of the parotid gland in patients suffering from acute or chronic inflammation and might be useful for discriminating healthy from affected glands. (orig.)

Gustatory Dysfunction and Decreased Number of Fungiform Taste Buds in Patients With Chronic Otitis Media With Cholesteatoma.

Science.gov (United States)

Saito, Takehisa; Ito, Tetsufumi; Ito, Yumi; Yamada, Takechiyo; Okamoto, Masayuki; Manabe, Yasuhiro

2016-09-01

To compare the number of fungiform taste buds among patients with chronic otitis media (COM), those with pars flaccida retraction type cholesteatoma, and those with pars tensa retraction type cholesteatoma in combination with gustatory function. Thirty-seven patients with COM, 22 patients with pars flaccida retraction type cholesteatoma, and 17 patients with pars tensa retraction type cholesteatoma were included. An average of 10 fungiform papillae (FP) per patient in the midlateral region of the tongue were observed by confocal laser scanning microscopy in vivo, and the average number of taste buds were counted. Just before the observation of FP, electrogustometry (EGM) was performed to evaluate gustatory function. A significant decrease of the average number of fungiform taste buds and significant elevation of EGM thresholds were clarified in the pars tensa retraction type cholesteatoma group but not in the COM or pars flaccida type cholesteatoma group. It was suggested that some neurotoxic cytokines produced by cholesteatoma tissue might affect the CTN morphology, resulting in a decreased number of fungiform taste buds and elevation of EGM threshold in patients with pars tensa retraction type cholesteatoma. © The Author(s) 2016.

Taste Bud-Derived BDNF Is Required to Maintain Normal Amounts of Innervation to Adult Taste Buds.

Science.gov (United States)

Meng, Lingbin; Ohman-Gault, Lisa; Ma, Liqun; Krimm, Robin F

2015-01-01

Gustatory neurons transmit chemical information from taste receptor cells, which reside in taste buds in the oral cavity, to the brain. As adult taste receptor cells are renewed at a constant rate, nerve fibers must reconnect with new taste receptor cells as they arise. Therefore, the maintenance of gustatory innervation to the taste bud is an active process. Understanding how this process is regulated is a fundamental concern of gustatory system biology. We speculated that because brain-derived neurotrophic factor (BDNF) is required for taste bud innervation during development, it might function to maintain innervation during adulthood. If so, taste buds should lose innervation when Bdnf is deleted in adult mice. To test this idea, we first removed Bdnf from all cells in adulthood using transgenic mice with inducible CreERT2 under the control of the Ubiquitin promoter. When Bdnf was removed, approximately one-half of the innervation to taste buds was lost, and taste buds became smaller because of the loss of taste bud cells. Individual taste buds varied in the amount of innervation each lost, and those that lost the most innervation also lost the most taste bud cells. We then tested the idea that that the taste bud was the source of this BDNF by reducing Bdnf levels specifically in the lingual epithelium and taste buds. Taste buds were confirmed as the source of BDNF regulating innervation. We conclude that BDNF expressed in taste receptor cells is required to maintain normal levels of innervation in adulthood.

Rho-associated kinase in the gustatory cortex is involved in conditioned taste aversion memory formation but not in memory retrieval or relearning.

Science.gov (United States)

Sweetat, Sahar; Rosenblum, Kobi; Lamprecht, Raphael

2012-01-01

Rho-associated kinase (ROCK) is intimately involved in cortical neuronal morphogenesis. The present study explores the roles of ROCK in conditioned taste aversion (CTA) memory formation in gustatory cortex (GC) in adult rat. Microinjection of the ROCK inhibitor Y-27632 into the GC 30 min before CTA training or 10 min after the conditioned stimulus (CS) impaired long-term CTA memory (LTM) formation. ROCK inhibitor had no effect on taste aversion when injected before the first LTM test day and did not alter taste aversion on subsequent test days. Microinjection of ROCK inhibitor into GC 30 min before preexposure to the taste CS had no effect on latent inhibition of CTA learning suggesting that ROCK is involved in CS-US association rather than taste learning per se. Cumulatively, these results show that ROCK is needed for normal CTA memory formation but not retrieval, relearning or incidental taste learning. Copyright © 2011 Elsevier Inc. All rights reserved.

A Box-Cox normal model for response times

NARCIS (Netherlands)

Klein Entink, R.H.; Fox, J.P.; Linden, W.J. van der

2009-01-01

The log-transform has been a convenient choice in response time modelling on test items. However, motivated by a dataset of the Medical College Admission Test where the lognormal model violated the normality assumption, the possibilities of the broader class of Box–Cox transformations for response

Extensive Gustatory Cortex Lesions Significantly Impair Taste Sensitivity to KCl and Quinine but Not to Sucrose in Rats.

Directory of Open Access Journals (Sweden)

Michelle B Bales

Full Text Available Recently, we reported that large bilateral gustatory cortex (GC lesions significantly impair taste sensitivity to salts in rats. Here we extended the tastants examined to include sucrose and quinine in rats with ibotenic acid-induced lesions in GC (GCX and in sham-operated controls (SHAM. Presurgically, immediately after drinking NaCl, rats received a LiCl or saline injection (i.p., but postsurgical tests indicated a weak conditioned taste aversion (CTA even in controls. The rats were then trained and tested in gustometers to discriminate a tastant from water in a two-response operant taste detection task. Psychometric functions were derived for sucrose, KCl, and quinine. Our mapping system was used to determine placement, size, and symmetry of the lesions (~91% GC damage on average. For KCl, there was a significant rightward shift (ΔEC50 = 0.57 log10 units; p<0.001 in the GCX psychometric function relative to SHAM, replicating our prior work. There was also a significant lesion-induced impairment (ΔEC50 = 0.41 log10 units; p = 0.006 in quinine sensitivity. Surprisingly, taste sensitivity to sucrose was unaffected by the extensive lesions and was comparable between GCX and SHAM rats. The fact that such large bilateral GC lesions did not shift sucrose psychometric functions relative to SHAM, but did significantly compromise quinine and KCl sensitivity suggests that the neural circuits responsible for the detection of specific taste stimuli are partially dissociable. Lesion-induced impairments were observed in expression of a postsurgical CTA to a maltodextrin solution as assessed in a taste-oriented brief-access test, but were not reflected in a longer term 46-h two-bottle test. Thus, deficits observed in rats after extensive damage to the GC are also dependent on the test used to assess taste function. In conclusion, the degree to which the GC is necessary for the maintenance of normal taste detectability apparently depends on the chemical and

Gustatory Detection of Tetrodotoxin and Saxitoxin, and Its Competitive Inhibition by Quinine and Strychnine in Freshwater Fishes

Directory of Open Access Journals (Sweden)

Toshiaki J. Hara

2011-11-01

Full Text Available Fish detect extremely low levels of marine toxins tetrodotoxin (TTX and saxitoxin (STX via the specialized gustatory receptor(s. Physiological and pharmacological studies show that receptor(s for TTX and STX are distinct from those which detect feeding stimulant amino acids and bile acids, and that TTX and STX do not share the same receptor populations, while interacting with quinine and strychnine in a competitive fashion suggestive of an antidotal relationship.

Taste Bud-Derived BDNF Is Required to Maintain Normal Amounts of Innervation to Adult Taste Buds123

Science.gov (United States)

Meng, Lingbin; Ohman-Gault, Lisa; Ma, Liqun

2015-01-01

Abstract Gustatory neurons transmit chemical information from taste receptor cells, which reside in taste buds in the oral cavity, to the brain. As adult taste receptor cells are renewed at a constant rate, nerve fibers must reconnect with new taste receptor cells as they arise. Therefore, the maintenance of gustatory innervation to the taste bud is an active process. Understanding how this process is regulated is a fundamental concern of gustatory system biology. We speculated that because brain-derived neurotrophic factor (BDNF) is required for taste bud innervation during development, it might function to maintain innervation during adulthood. If so, taste buds should lose innervation when Bdnf is deleted in adult mice. To test this idea, we first removed Bdnf from all cells in adulthood using transgenic mice with inducible CreERT2 under the control of the Ubiquitin promoter. When Bdnf was removed, approximately one-half of the innervation to taste buds was lost, and taste buds became smaller because of the loss of taste bud cells. Individual taste buds varied in the amount of innervation each lost, and those that lost the most innervation also lost the most taste bud cells. We then tested the idea that that the taste bud was the source of this BDNF by reducing Bdnf levels specifically in the lingual epithelium and taste buds. Taste buds were confirmed as the source of BDNF regulating innervation. We conclude that BDNF expressed in taste receptor cells is required to maintain normal levels of innervation in adulthood. PMID:26730405

Long-Term Visuo-Gustatory Appetitive and Aversive Conditioning Potentiate Human Visual Evoked Potentials

Directory of Open Access Journals (Sweden)

Gert R. J. Christoffersen

2017-09-01

Full Text Available Human recognition of foods and beverages are often based on visual cues associated with flavors. The dynamics of neurophysiological plasticity related to acquisition of such long-term associations has only recently become the target of investigation. In the present work, the effects of appetitive and aversive visuo-gustatory conditioning were studied with high density EEG-recordings focusing on late components in the visual evoked potentials (VEPs, specifically the N2-P3 waves. Unfamiliar images were paired with either a pleasant or an unpleasant juice and VEPs evoked by the images were compared before and 1 day after the pairings. In electrodes located over posterior visual cortex areas, the following changes were observed after conditioning: the amplitude from the N2-peak to the P3-peak increased and the N2 peak delay was reduced. The percentage increase of N2-to-P3 amplitudes was asymmetrically distributed over the posterior hemispheres despite the fact that the images were bilaterally symmetrical across the two visual hemifields. The percentage increases of N2-to-P3 amplitudes in each experimental subject correlated with the subject’s evaluation of positive or negative hedonic valences of the two juices. The results from 118 scalp electrodes gave surface maps of theta power distributions showing increased power over posterior visual areas after the pairings. Source current distributions calculated from swLORETA revealed that visual evoked currents rose as a result of conditioning in five cortical regions—from primary visual areas and into the inferior temporal gyrus (ITG. These learning-induced changes were seen after both appetitive and aversive training while a sham trained control group showed no changes. It is concluded that long-term visuo-gustatory conditioning potentiated the N2-P3 complex, and it is suggested that the changes are regulated by the perceived hedonic valence of the US.

Causality Assessment of Olfactory and Gustatory Dysfunction Associated with Intranasal Fluticasone Propionate: Application of the Bradford Hill Criteria

OpenAIRE

Muganurmath, Chandrashekhar S.; Curry, Amy L.; Schindzielorz, Andrew H.

2018-01-01

Causality assessment is crucial to post-marketing pharmacovigilance and helps optimize safe and appropriate use of medicines by patients in the real world. Self-reported olfactory and gustatory dysfunction are common in the general population as well as in patients with allergic rhinitis and nasal polyposis. Intranasal corticosteroids, including intranasal fluticasone propionate (INFP), are amongst the most effective drugs indicated in the treatment of allergic rhinitis and nasal polyposis. W...

Tumor and normal tissue responses to fractioned non-uniform dose delivery

Energy Technology Data Exchange (ETDEWEB)

Kaellman, P; Aegren, A; Brahme, A [Karolinska Inst., Stockholm (Sweden). Dept. of Radiation Physics

1996-08-01

The volume dependence of the radiation response of a tumor is straight forward to quantify because it depends primarily on the eradication of all its clonogenic cells. A tumor therefore has a parallel organization as any surviving clonogen in principle can repopulate the tumor. The difficulty with the response of the tumor is instead to know the density and sensitivity distribution of the most resistant clonogenic cells. The increase in the 50% tumor control dose and the decrease in the maximum normalized slope of the dose response relation, {gamma}, in presence of small compartments of resistant tumor cells have therefore been quantified to describe their influence on the dose response relation. Injury to normal tissue is a much more complex and gradual process. It depends on earlier effects induced long before depletion of the differentiated and clonogenic cells that in addition may have a complex structural and functional organization. The volume dependence of the dose response relation of normal tissues is therefore described here by the relative seriality, s, of the infrastructure of the organ. The model can also be generalized to describe the response of heterogeneous tissues to non uniform dose distributions. The new model is compared with clinical and experimental data on normal tissue response, and shows good agreement both with regard to the shape of dose response relation and the volume dependence of the isoeffect dose. The response of tumors and normal tissues are quantified for arbitrary dose fractionations using the linear quadratic cell survival parameters {alpha} and {beta}. The parameters of the dose response relation are derived both for a constant dose per fraction and a constant number of dose fractions, thus in the latter case accounting also for non uniform dose delivery. (author). 26 refs, 4 figs.

Gustatory Perception and Fat Body Energy Metabolism Are Jointly Affected by Vitellogenin and Juvenile Hormone in Honey Bees

OpenAIRE

Wang, Ying; Brent, Colin S.; Fennern, Erin; Amdam, Gro V.

2012-01-01

Honey bees (Apis mellifera) provide a system for studying social and food-related behavior. A caste of workers performs age-related tasks: young bees (nurses) usually feed the brood and other adult bees inside the nest, while older bees (foragers) forage outside for pollen, a protein/lipid source, or nectar, a carbohydrate source. The workers' transition from nursing to foraging and their foraging preferences correlate with differences in gustatory perception, metabolic gene expression, and e...

Effects of gustatory stimulants of salivary secretion on salivary pH and flow in patients with Sjögren's syndrome: a randomized controlled trial.

Science.gov (United States)

da Silva Marques, Duarte Nuno; da Mata, António Duarte Sola Pereira; Patto, José Maria Vaz; Barcelos, Filipe Alexandre Duarte; de Almeida Rato Amaral, João Pedro; de Oliveira, Miguel Constantino Mendes; Ferreira, Cristina Gutierrez Castanheira

2011-11-01

To compare salivary pH changes and stimulation efficacy of two different gustatory stimulants of salivary secretion (GSSS) in patients with primary Sjögren syndrome. Portuguese Institute for Rheumatological Diseases. Double-blind randomized controlled trial. Eighty patients were randomized to two intervention groups. Sample size was calculated using an alpha error of 0.05 and a beta of 0.20. Participants were randomly assigned to receive a new GSSS containing a weaker malic acid, fluoride and xylitol or a traditionally citric acid-based one. Saliva collection was obtained by established methods at different times. The salivary pH of the samples was determined with a pH meter and a microelectrode. Salivary pH variations and counts of subjects with pH below 4.5 for over 1 min and stimulated salivary flow were the main outcome measures. Both GSSS significantly stimulated salivary output without significant differences between the two groups. The new gustatory stimulant of salivary secretion presented an absolute risk reduction of 52.78% [33.42-72.13 (95% CI)] when compared with the traditional one. In Xerostomic Primary Sjögren syndrome patients, gustatory stimulants of salivary secretion based on acid mail only with fluoride and xylitol present similar salivary stimulation capacity when compared to citric acid-based ones, besides significantly reducing the number of salivary pH drops below 4.5. This could be related to a diminished risk for dental erosion and should be confirmed with further studies. © 2011 John Wiley & Sons A/S.

Rapid Estimation of Gustatory Sensitivity Thresholds with SIAM and QUEST

Directory of Open Access Journals (Sweden)

Richard Höchenberger

2017-06-01

Full Text Available Adaptive methods provide quick and reliable estimates of sensory sensitivity. Yet, these procedures are typically developed for and applied to the non-chemical senses only, i.e., to vision, audition, and somatosensation. The relatively long inter-stimulus-intervals in gustatory studies, which are required to minimize adaptation and habituation, call for time-efficient threshold estimations. We therefore tested the suitability of two adaptive yes-no methods based on SIAM and QUEST for rapid estimation of taste sensitivity by comparing test-retest reliability for sucrose, citric acid, sodium chloride, and quinine hydrochloride thresholds. We show that taste thresholds can be obtained in a time efficient manner with both methods (within only 6.5 min on average using QUEST and ~9.5 min using SIAM. QUEST yielded higher test-retest correlations than SIAM in three of the four tastants. Either method allows for taste threshold estimation with low strain on participants, rendering them particularly advantageous for use in subjects with limited attentional or mnemonic capacities, and for time-constrained applications during cohort studies or in the testing of patients and children.

Measurement of human normal tissue and tumour responses

International Nuclear Information System (INIS)

Ross, G.; Yarnold, J.R.

1988-01-01

The scarcity of quantitative measures of normal tissue damage and tumour response in patients undergoing radiotherapy is an obstacle to the clinical evaluation of new treatment strategies. Retrospective studies of complications in critical normal tissues taught important lessons in the past concerning the potential dangers of hypofractionation. However, it is unethical to use serious complications as planned end-points in prospective studies. This paper reviews the desirable characteristics of clinical end-points required to compare alternative treatments employing radiotherapy, with emphasis on simple scales applied by clinicians or even the patients themselves

Comparison of fungiform taste-bud distribution among age groups using confocal laser scanning microscopy in vivo in combination with gustatory function.

Science.gov (United States)

Saito, Takehisa; Ito, Tetsufumi; Ito, Yumi; Manabe, Yasuhiro; Sano, Kazuo

2016-04-01

The aim of this study was to compare the distribution of taste buds in fungiform papillae (FP) and gustatory function between young and elderly age groups. Confocal laser scanning microscopy was used because it allows many FP to be observed non-invasively in a short period of time. The age of participants (n = 211) varied from 20 to 83 yr. The tip and midlateral region of the tongue were observed. Taste buds in an average of 10 FP in each area were counted. A total of 2,350 FP at the tongue tip and 2,592 FP in the midlateral region could be observed. The average number of taste buds was similar among all age groups both at the tongue tip and in the midlateral region. The taste function, measured by electrogustometry, among participants 20-29 yr of age was significantly lower than that in the other age groups; however, there was no difference among any other age groups in taste function. These results indicate that the peripheral gustatory system is well maintained anatomically and functionally in elderly people. © 2016 Eur J Oral Sci.

Is the assumption of normality or log-normality for continuous response data critical for benchmark dose estimation?

International Nuclear Information System (INIS)

Shao, Kan; Gift, Jeffrey S.; Setzer, R. Woodrow

2013-01-01

Continuous responses (e.g. body weight) are widely used in risk assessment for determining the benchmark dose (BMD) which is used to derive a U.S. EPA reference dose. One critical question that is not often addressed in dose–response assessments is whether to model the continuous data as normally or log-normally distributed. Additionally, if lognormality is assumed, and only summarized response data (i.e., mean ± standard deviation) are available as is usual in the peer-reviewed literature, the BMD can only be approximated. In this study, using the “hybrid” method and relative deviation approach, we first evaluate six representative continuous dose–response datasets reporting individual animal responses to investigate the impact on BMD/BMDL estimates of (1) the distribution assumption and (2) the use of summarized versus individual animal data when a log-normal distribution is assumed. We also conduct simulation studies evaluating model fits to various known distributions to investigate whether the distribution assumption has influence on BMD/BMDL estimates. Our results indicate that BMDs estimated using the hybrid method are more sensitive to the distribution assumption than counterpart BMDs estimated using the relative deviation approach. The choice of distribution assumption has limited impact on the BMD/BMDL estimates when the within dose-group variance is small, while the lognormality assumption is a better choice for relative deviation method when data are more skewed because of its appropriateness in describing the relationship between mean and standard deviation. Additionally, the results suggest that the use of summarized data versus individual response data to characterize log-normal distributions has minimal impact on BMD estimates. - Highlights: • We investigate to what extent the distribution assumption can affect BMD estimates. • Both real data analysis and simulation study are conducted. • BMDs estimated using hybrid method are more

Is the assumption of normality or log-normality for continuous response data critical for benchmark dose estimation?

Energy Technology Data Exchange (ETDEWEB)

Shao, Kan, E-mail: Shao.Kan@epa.gov [ORISE Postdoctoral Fellow, National Center for Environmental Assessment, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Gift, Jeffrey S. [National Center for Environmental Assessment, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Setzer, R. Woodrow [National Center for Computational Toxicology, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States)

2013-11-01

Continuous responses (e.g. body weight) are widely used in risk assessment for determining the benchmark dose (BMD) which is used to derive a U.S. EPA reference dose. One critical question that is not often addressed in dose–response assessments is whether to model the continuous data as normally or log-normally distributed. Additionally, if lognormality is assumed, and only summarized response data (i.e., mean ± standard deviation) are available as is usual in the peer-reviewed literature, the BMD can only be approximated. In this study, using the “hybrid” method and relative deviation approach, we first evaluate six representative continuous dose–response datasets reporting individual animal responses to investigate the impact on BMD/BMDL estimates of (1) the distribution assumption and (2) the use of summarized versus individual animal data when a log-normal distribution is assumed. We also conduct simulation studies evaluating model fits to various known distributions to investigate whether the distribution assumption has influence on BMD/BMDL estimates. Our results indicate that BMDs estimated using the hybrid method are more sensitive to the distribution assumption than counterpart BMDs estimated using the relative deviation approach. The choice of distribution assumption has limited impact on the BMD/BMDL estimates when the within dose-group variance is small, while the lognormality assumption is a better choice for relative deviation method when data are more skewed because of its appropriateness in describing the relationship between mean and standard deviation. Additionally, the results suggest that the use of summarized data versus individual response data to characterize log-normal distributions has minimal impact on BMD estimates. - Highlights: • We investigate to what extent the distribution assumption can affect BMD estimates. • Both real data analysis and simulation study are conducted. • BMDs estimated using hybrid method are more

Glucagon-like peptide-1 is specifically involved in sweet taste transmission.

Science.gov (United States)

Takai, Shingo; Yasumatsu, Keiko; Inoue, Mayuko; Iwata, Shusuke; Yoshida, Ryusuke; Shigemura, Noriatsu; Yanagawa, Yuchio; Drucker, Daniel J; Margolskee, Robert F; Ninomiya, Yuzo

2015-06-01

Five fundamental taste qualities (sweet, bitter, salty, sour, umami) are sensed by dedicated taste cells (TCs) that relay quality information to gustatory nerve fibers. In peripheral taste signaling pathways, ATP has been identified as a functional neurotransmitter, but it remains to be determined how specificity of different taste qualities is maintained across synapses. Recent studies demonstrated that some gut peptides are released from taste buds by prolonged application of particular taste stimuli, suggesting their potential involvement in taste information coding. In this study, we focused on the function of glucagon-like peptide-1 (GLP-1) in initial responses to taste stimulation. GLP-1 receptor (GLP-1R) null mice had reduced neural and behavioral responses specifically to sweet compounds compared to wild-type (WT) mice. Some sweet responsive TCs expressed GLP-1 and its receptors were expressed in gustatory neurons. GLP-1 was released immediately from taste bud cells in response to sweet compounds but not to other taste stimuli. Intravenous administration of GLP-1 elicited transient responses in a subset of sweet-sensitive gustatory nerve fibers but did not affect other types of fibers, and this response was suppressed by pre-administration of the GLP-1R antagonist Exendin-4(3-39). Thus GLP-1 may be involved in normal sweet taste signal transmission in mice. © FASEB.

Gustatory papillae and taste bud development and maintenance in the absence of TrkB ligands BDNF and NT-4.

Science.gov (United States)

Ito, Akira; Nosrat, Christopher A

2009-09-01

Taste buds and the peripheral nerves innervating them are two important components of the peripheral gustatory system. They require appropriate connections for the taste system to function. Neurotrophic factors play crucial roles in the innervation of peripheral sensory organs and tissues. Both brain-derived neurotrophic factor (BDNF) null-mutated and neurotrophin-4 (NT-4) null-mutated mice exhibit peripheral gustatory deficits. BDNF and NT-4 bind to a common high affinity tyrosine kinase receptor, TrkB (NTRK-2), and a common p75 neurotrophin receptor (NGFR). We are currently using a transgenic mouse model to study peripheral taste system development and innervation in the absence of both TrkB ligands. We show that taste cell progenitors express taste cell markers during early stages of taste bud development in both BDNF(-/-)xNT-4(-/-) and wild-type mice. At early embryonic stages, taste bud progenitors express Troma-1, Shh, and Sox2 in all mice. At later stages, lack of innervation becomes a prominent feature in BDNF(-/-)xNT-4(-/-) mice leading to a decreasing number of fungiform papillae and morphologically degenerating taste cells. A total loss of vallate taste cells also occurs in postnatal transgenic mice. Our data indicate an initial independence but a later permissive and essential role for innervation in taste bud development and maintenance.

Mice Lacking Pannexin 1 Release ATP and Respond Normally to All Taste Qualities.

Science.gov (United States)

Vandenbeuch, Aurelie; Anderson, Catherine B; Kinnamon, Sue C

2015-09-01

Adenosine triphosphate (ATP) is required for the transmission of all taste qualities from taste cells to afferent nerve fibers. ATP is released from Type II taste cells by a nonvesicular mechanism and activates purinergic receptors containing P2X2 and P2X3 on nerve fibers. Several ATP release channels are expressed in taste cells including CALHM1, Pannexin 1, Connexin 30, and Connexin 43, but whether all are involved in ATP release is not clear. We have used a global Pannexin 1 knock out (Panx1 KO) mouse in a series of in vitro and in vivo experiments. Our results confirm that Panx1 channels are absent in taste buds of the knockout mice and that other known ATP release channels are not upregulated. Using a luciferin/luciferase assay, we show that circumvallate taste buds from Panx1 KO mice normally release ATP upon taste stimulation compared with wild type (WT) mice. Gustatory nerve recordings in response to various tastants applied to the tongue and brief-access behavioral testing with SC45647 also show no difference between Panx1 KO and WT. These results confirm that Panx1 is not required for the taste evoked release of ATP or for neural and behavioral responses to taste stimuli. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Isometric exercise: cardiovascular responses in normal and cardiac populations.

Science.gov (United States)

Hanson, P; Nagle, F

1987-05-01

Isometric exercise produces a characteristic pressor increase in blood pressure which may be important in maintaining perfusion of muscle during sustained contraction. This response is mediated by combined central and peripheral afferent input to medullary cardiovascular centers. In normal individuals the increase in blood pressure is mediated by a rise in cardiac output with little or no change in systemic vascular resistance. However, the pressor response is also maintained during pharmacologic blockade or surgical denervation by increasing systemic vascular resistance. Left ventricular function is normally maintained or improves in normal subjects and cardiac patients with mild impairment of left ventricular contractility. Patients with poor left ventricular function may show deterioration during isometric exercise, although this pattern of response is difficult to predict from resting studies. Recent studies have shown that patients with uncomplicated myocardial infarction can perform submaximum isometric exercise such as carrying weights in the range of 30 to 50 lb without difficulty or adverse responses. In addition, many patients who show ischemic ST depression or angina during dynamic exercise may have a reduced ischemic response during isometric or combined isometric and dynamic exercise. Isometric exercises are frequently encountered in activities of daily living and many occupational tasks. Cardiac patients should be gradually exposed to submaximum isometric training in supervised cardiac rehabilitation programs. Specific job tasks that require isometric or combined isometric and dynamic activities may be evaluated by work simulation studies. This approach to cardiac rehabilitation may facilitate patients who wish to return to a job requiring frequent isometric muscle contraction. Finally, there is a need for additional research on the long-term effects of isometric exercise training on left ventricular hypertrophy and performance. The vigorous training

Normalization of cell responses in cat striate cortex

Science.gov (United States)

Heeger, D. J.

1992-01-01

Simple cells in the striate cortex have been depicted as half-wave-rectified linear operators. Complex cells have been depicted as energy mechanisms, constructed from the squared sum of the outputs of quadrature pairs of linear operators. However, the linear/energy model falls short of a complete explanation of striate cell responses. In this paper, a modified version of the linear/energy model is presented in which striate cells mutually inhibit one another, effectively normalizing their responses with respect to stimulus contrast. This paper reviews experimental measurements of striate cell responses, and shows that the new model explains a significantly larger body of physiological data.

Elevated Postoperative Endogenous GLP-1 Levels Mediate Effects of Roux-en-Y Gastric Bypass on Neural Responsivity to Food Cues

DEFF Research Database (Denmark)

Ten Kulve, Jennifer S; Veltman, Dick J; Gerdes, Victor E A

2017-01-01

of the GLP-1 receptor antagonist exendin 9-39 (Ex9-39) and placebo were assessed in 10 women before and after RYGB. We used functional MRI to investigate CNS activation in response to visual food cues (pictures) and gustatory food cues (consumption of chocolate milk), comparing results with Ex9-39 versus...... in response to visual and gustatory food cues may be mediated by central effects of GLP-1. Our findings provide further insights into the mechanisms underlying the weight-lowering effects of RYGB.......OBJECTIVE: It has been suggested that weight reduction and improvements in satiety after Roux-en-Y gastric bypass (RYGB) are partly mediated via postoperative neuroendocrine changes. Glucagon-like peptide-1 (GLP-1) is a gut hormone secreted after food ingestion and is associated with appetite...

Knocking out P2X receptors reduces transmitter secretion in taste buds

Science.gov (United States)

Huang, Yijen A.; Stone, Leslie M.; Pereira, Elizabeth; Yang, Ruibiao; Kinnamon, John C.; Dvoryanchikov, Gennady; Chaudhari, Nirupa; Finger, Thomas E.; Kinnamon, Sue C.; Roper, Stephen D.

2011-01-01

In response to gustatory stimulation, taste bud cells release a transmitter, ATP, that activates P2X2 and P2X3 receptors on gustatory afferent fibers. Taste behavior and gustatory neural responses are largely abolished in mice lacking P2X2 and P2X3 receptors (P2X2 and P2X3 double knockout, or “DKO” mice). The assumption has been that eliminating P2X2 and P2X3 receptors only removes postsynaptic targets but that transmitter secretion in mice is normal. Using functional imaging, ATP biosensor cells, and a cell-free assay for ATP, we tested this assumption. Surprisingly, although gustatory stimulation mobilizes Ca2+ in taste Receptor (Type II) cells from DKO mice, as from wild type (WT) mice, taste cells from DKO mice fail to release ATP when stimulated with tastants. ATP release could be elicited by depolarizing DKO Receptor cells with KCl, suggesting that ATP-release machinery remains functional in DKO taste buds. To explore the difference in ATP release across genotypes, we employed reverse transcriptase (RT)-PCR, immunostaining, and histochemistry for key proteins underlying ATP secretion and degradation: Pannexin1, TRPM5, and NTPDase2 (ecto-ATPase) are indistinguishable between WT and DKO mice. The ultrastructure of contacts between taste cells and nerve fibers is also normal in the DKO mice. Finally, quantitative RT-PCR show that P2X4 and P2X7, potential modulators of ATP secretion, are similarly expressed in taste buds in WT and DKO taste buds. Importantly, we find that P2X2 is expressed in WT taste buds and appears to function as an autocrine, positive feedback signal to amplify taste-evoked ATP secretion. PMID:21940456

Knocking out P2X receptors reduces transmitter secretion in taste buds.

Science.gov (United States)

Huang, Yijen A; Stone, Leslie M; Pereira, Elizabeth; Yang, Ruibiao; Kinnamon, John C; Dvoryanchikov, Gennady; Chaudhari, Nirupa; Finger, Thomas E; Kinnamon, Sue C; Roper, Stephen D

2011-09-21

In response to gustatory stimulation, taste bud cells release a transmitter, ATP, that activates P2X2 and P2X3 receptors on gustatory afferent fibers. Taste behavior and gustatory neural responses are largely abolished in mice lacking P2X2 and P2X3 receptors [P2X2 and P2X3 double knock-out (DKO) mice]. The assumption has been that eliminating P2X2 and P2X3 receptors only removes postsynaptic targets but that transmitter secretion in mice is normal. Using functional imaging, ATP biosensor cells, and a cell-free assay for ATP, we tested this assumption. Surprisingly, although gustatory stimulation mobilizes Ca(2+) in taste Receptor (Type II) cells from DKO mice, as from wild-type (WT) mice, taste cells from DKO mice fail to release ATP when stimulated with tastants. ATP release could be elicited by depolarizing DKO Receptor cells with KCl, suggesting that ATP-release machinery remains functional in DKO taste buds. To explore the difference in ATP release across genotypes, we used reverse transcriptase (RT)-PCR, immunostaining, and histochemistry for key proteins underlying ATP secretion and degradation: Pannexin1, TRPM5, and NTPDase2 (ecto-ATPase) are indistinguishable between WT and DKO mice. The ultrastructure of contacts between taste cells and nerve fibers is also normal in the DKO mice. Finally, quantitative RT-PCR show that P2X4 and P2X7, potential modulators of ATP secretion, are similarly expressed in taste buds in WT and DKO taste buds. Importantly, we find that P2X2 is expressed in WT taste buds and appears to function as an autocrine, positive feedback signal to amplify taste-evoked ATP secretion.

T lymphocytes and normal tissue responses to radiation

International Nuclear Information System (INIS)

Schaue, Dörthe; McBride, William H.

2012-01-01

There is compelling evidence that lymphocytes are a recurring feature in radiation damaged normal tissues, but assessing their functional significance has proven difficult. Contradictory roles have been postulated in both tissue pathogenesis and protection, although these are not necessarily mutually exclusive as the immune system can display what may seem to be opposing faces at any one time. While the exact role of T lymphocytes in irradiated normal tissue responses may still be obscure, their accumulation after tissue damage suggests they may be critical targets for radiotherapeutic intervention and worthy of further study. This is accentuated by recent findings that pathologically damaged “self,” such as occurs after exposure to ionizing radiation, can generate danger signals with the ability to activate pathways similar to those that activate adoptive immunity to pathogens. In addition, the demonstration of T cell subsets with their recognition radars tuned to “self” moieties has revolutionized our ideas on how all immune responses are controlled and regulated. New concepts of autoimmunity have resulted based on the dissociation of immune functions between different subsets of immune cells. It is becoming axiomatic that the immune system has the power to regulate radiation-induced tissue damage, from failure of regeneration to fibrosis, to acute and chronic late effects, and even to carcinogenesis. Our understanding of the interplay between T lymphocytes and radiation-damaged tissue may still be rudimentary but this is a good time to re-examine their potential roles, their radiobiological and microenvironmental influences, and the possibilities for therapeutic manipulation. This review will discuss the yin and yang of T cell responses within the context of radiation exposures, how they might drive or protect against normal tissue side effects and what we may be able do about it.

Long-term visuo-gustatory appetitive and aversive conditioning potentiate human visual evoked potentials

DEFF Research Database (Denmark)

Christoffersen, Gert R.J.; Laugesen, Jakob L.; Møller, Per

2017-01-01

Human recognition of foods and beverages are often based on visual cues associated with flavors. The dynamics of neurophysiological plasticity related to acquisition of such long-term associations has only recently become the target of investigation. In the present work, the effects of appetitive...... and aversive visuo-gustatory conditioning were studied with high density EEG-recordings focusing on late components in the visual evoked potentials (VEPs), specifically the N2-P3 waves. Unfamiliar images were paired with either a pleasant or an unpleasant juice and VEPs evoked by the images were compared...... before and 1 day after the pairings. In electrodes located over posterior visual cortex areas, the following changes were observed after conditioning: the amplitude from the N2-peak to the P3-peak increased and the N2 peak delay was reduced. The percentage increase of N2-to-P3 amplitudes...

A 3 T event-related functional magnetic resonance imaging (fMRI) study of primary and secondary gustatory cortex localization using natural tastants

International Nuclear Information System (INIS)

Smits, Marion; Peeters, Ronald R.; Hecke, Paul van; Sunaert, Stefan

2007-01-01

It is known that taste is centrally represented in the insula, frontal and parietal operculum, as well as in the orbitofrontal cortex (secondary gustatory cortex). In functional MRI (fMRI) experiments activation in the insula has been confirmed, but activation in the orbitofrontal cortex is only infrequently found, especially at higher field strengths (3 T). Due to large susceptibility artefacts, the orbitofrontal cortex is a difficult region to examine with fMRI. Our aim was to localize taste in the human cortex at 3 T, specifically in the orbitofrontal cortex as well as in the primary gustatory cortex. Event-related fMRI was performed at 3 T in seven healthy volunteers. Taste stimuli consisted of lemon juice and chocolate. To visualize activation in the orbitofrontal cortex a dedicated 3D SENSE EPI fMRI sequence was used, in addition to a 2D SENSE EPI fMRI sequence for imaging the entire brain. Data were analyzed using a perception-based model. The dedicated 3D SENSE EPI sequence successfully reduced susceptibility artefacts in the orbitofrontal area. Significant taste-related activation was found in the orbitofrontal and insular cortices. fMRI of the orbitofrontal cortex is feasible at 3 T, using a dedicated sequence. Our results corroborate findings from previous studies. (orig.)

A 3 T event-related functional magnetic resonance imaging (fMRI) study of primary and secondary gustatory cortex localization using natural tastants

Energy Technology Data Exchange (ETDEWEB)

Smits, Marion [Erasmus MC, University Medical Center Rotterdam, Department of Radiology, P.O. Box 2040, CA Rotterdam (Netherlands); K.U.Leuven, Department of Radiology, University Hospitals, Leuven (Belgium); Peeters, Ronald R.; Hecke, Paul van; Sunaert, Stefan [K.U.Leuven, Department of Radiology, University Hospitals, Leuven (Belgium)

2007-01-15

It is known that taste is centrally represented in the insula, frontal and parietal operculum, as well as in the orbitofrontal cortex (secondary gustatory cortex). In functional MRI (fMRI) experiments activation in the insula has been confirmed, but activation in the orbitofrontal cortex is only infrequently found, especially at higher field strengths (3 T). Due to large susceptibility artefacts, the orbitofrontal cortex is a difficult region to examine with fMRI. Our aim was to localize taste in the human cortex at 3 T, specifically in the orbitofrontal cortex as well as in the primary gustatory cortex. Event-related fMRI was performed at 3 T in seven healthy volunteers. Taste stimuli consisted of lemon juice and chocolate. To visualize activation in the orbitofrontal cortex a dedicated 3D SENSE EPI fMRI sequence was used, in addition to a 2D SENSE EPI fMRI sequence for imaging the entire brain. Data were analyzed using a perception-based model. The dedicated 3D SENSE EPI sequence successfully reduced susceptibility artefacts in the orbitofrontal area. Significant taste-related activation was found in the orbitofrontal and insular cortices. fMRI of the orbitofrontal cortex is feasible at 3 T, using a dedicated sequence. Our results corroborate findings from previous studies. (orig.)

Behavioral analysis of Drosophila transformants expressing human taste receptor genes in the gustatory receptor neurons.

Science.gov (United States)

Adachi, Ryota; Sasaki, Yuko; Morita, Hiromi; Komai, Michio; Shirakawa, Hitoshi; Goto, Tomoko; Furuyama, Akira; Isono, Kunio

2012-06-01

Transgenic Drosophila expressing human T2R4 and T2R38 bitter-taste receptors or PKD2L1 sour-taste receptor in the fly gustatory receptor neurons and other tissues were prepared using conventional Gal4/UAS binary system. Molecular analysis showed that the transgene mRNAs are expressed according to the tissue specificity of the Gal4 drivers. Transformants expressing the transgene taste receptors in the fly taste neurons were then studied by a behavioral assay to analyze whether transgene chemoreceptors are functional and coupled to the cell response. Since wild-type flies show strong aversion against the T2R ligands as in mammals, the authors analyzed the transformants where the transgenes are expressed in the fly sugar receptor neurons so that they promote feeding ligand-dependently if they are functional and activate the neurons. Although the feeding preference varied considerably among different strains and individuals, statistical analysis using large numbers of transformants indicated that transformants expressing T2R4 showed a small but significant increase in the preference for denatonium and quinine, the T2R4 ligands, as compared to the control flies, whereas transformants expressing T2R38 did not. Similarly, transformants expressing T2R38 and PKD2L1 also showed a similar preference increase for T2R38-specific ligand phenylthiocarbamide (PTC) and a sour-taste ligand, citric acid, respectively. Taken together, the transformants expressing mammalian taste receptors showed a small but significant increase in the feeding preference that is taste receptor and also ligand dependent. Although future improvements are required to attain performance comparable to the endogenous robust response, Drosophila taste neurons may serve as a potential in vivo heterologous expression system for analyzing chemoreceptor function.

A taste of the deep-sea: The roles of gustatory and tactile searching behaviour in the grenadier fish Coryphaenoides armatus

Science.gov (United States)

Bailey, David M.; Wagner, Hans-Joachim; Jamieson, Alan J.; Ross, Murray F.; Priede, Imants G.

2007-01-01

The deep-sea grenadier fishes ( Coryphaenoides spp.) are among the dominant predators and scavengers in the ocean basins that cover much of Earth's surface. Baited camera experiments were used to study the behaviour of these fishes. Despite the apparent advantages of rapidly consuming food, grenadiers attracted to bait spend a large proportion of their time in prolonged periods of non-feeding activity. Video analysis revealed that fish often adopted a head-down swimming attitude (mean of 21.3° between the fish and seafloor), with swimming velocity negatively related to attitude. The fish also swam around and along vertical and horizontal structures of the lander with their head immediately adjacent to the structure. We initially hypothesised that this behaviour was associated with the use of the short chin barbel in foraging. Barbel histology showed numerous taste buds in the skin, and a barbel nerve with about 20,000 axons in adult fish. A tracing experiment in one undamaged animal revealed the termination fields of the barbel neurons in the trigeminal and rhombencephalic regions, indicating both a mechanoreceptory and a gustatory role for the barbel. Our conclusion was that olfactory foraging becomes ineffective at close ranges and is followed by a search phase using tactile and gustatory sensing by the barbel. The development of this sensory method probably co-evolved alongside behavioural changes in swimming mechanics to allow postural stability at low swimming speeds.

Frictional response of simulated faults to normal stresses perturbations probed with ultrasonic waves

Science.gov (United States)

Shreedharan, S.; Riviere, J.; Marone, C.

2017-12-01

We report on a suite of laboratory friction experiments conducted on saw-cut Westerly Granite surfaces to probe frictional response to step changes in normal stress and loading rate. The experiments are conducted to illuminate the fundamental processes that yield friction rate and state dependence. We quantify the microphysical frictional response of the simulated fault surfaces to normal stress steps, in the range of 1% - 600% step increases and decreases from a nominal baseline normal stress. We measure directly the fault slip rate and account for changes in slip rate with changes in normal stress and complement mechanical data acquisition by continuously probing the faults with ultrasonic pulses. We conduct the experiments at room temperature and humidity conditions in a servo controlled biaxial testing apparatus in the double direct shear configuration. The samples are sheared over a range of velocities, from 0.02 - 100 μm/s. We report observations of a transient shear stress and friction evolution with step increases and decreases in normal stress. Specifically, we show that, at low shear velocities and small increases in normal stress ( 5% increases), the shear stress evolves immediately with normal stress. We show that the excursions in slip rate resulting from the changes in normal stress must be accounted for in order to predict fault strength evolution. Ultrasonic wave amplitudes which first increase immediately in response to normal stress steps, then decrease approximately linearly to a new steady state value, in part due to changes in fault slip rate. Previous descriptions of frictional state evolution during normal stress perturbations have not adequately accounted for the effect of large slip velocity excursions. Here, we attempt to do so by using the measured ultrasonic amplitudes as a proxy for frictional state during transient shear stress evolution. Our work aims to improve understanding of induced and triggered seismicity with focus on

X-ray microanalysis of Zn in the taste organ of the teleost Ameiurus nebulosus

International Nuclear Information System (INIS)

Reutter, K.

1983-01-01

The trace metal Zn seems to be essential for the normal functioning of the gustatory sense. It was tried to localize Zn within the peripheral and central parts of the bullhead's gustatory system by the use of scanning electron microscopy and X-ray microanalysis. In freeze dried preparations of the bullhead's barbel taste buds (and the taste buds of rabbits) Zn is found in randomly distributed granules, which cannot be related to distinct taste bud regions. Furthermore, Zn occurs in subunits of the central gustatory nuclei, the vagal and facial lobe of the rhombencephalon. Therefore Zn appears to be essential for intact peripheral as well as central gustatory processes, at least in lower vertebrates. (author)

Evaluation of normal tissue responses to high-LET radiations

International Nuclear Information System (INIS)

Halnan, K.E.

1979-01-01

Clinical results presented have been analysed to evaluate normal tissue responses to high-LET radiations. Damage to brain, spinal cord, gut, skin, connective tissue and bone has occurred. A high RBE is probable for brain and possible for spinal cord and gut but other reasons for damage are also discussed. A net gain seems likely. Random controlled trials are advocated. (author)

Responses of vibrissa-sensitive cortical neurons in normal and prenatally x-irradiated rat

International Nuclear Information System (INIS)

Ito, M.; Kawabata, M.; Shoji, R.

1979-01-01

Rats were irradiated by 200 R of x ray on day 17 of gestation through the body wall of the mother. When they underwent the following electrophysiological tests at the age of 3 to 4 month, the somatosensory cortex showed a lack of layers II, III, IV, and Va. Spike responses to quick whisker deflections were recorded from single cells in the somatosenory cortex of normal and prenatally x-irradiated rats. For the irradiated rats the response latency was prolonged when compared to the normal controls. Cortical laminar analysis of field potentials revealed that there was no difference in the latency of these potentials between the two groups, suggesting that vibrissal sensory signals reach the cortical level normally even in the irradiated rats. The prolonged latency of the irradiated cortical neuronal response could thus be ascribed to an abnormal intracortical delay, which was most likely associated with the failure of development of layer IV stellate cells in these preparations

Genetic tracing of the gustatory and trigeminal neural pathways originating from T1R3-expressing taste receptor cells and solitary chemoreceptor cells.

Science.gov (United States)

Ohmoto, Makoto; Matsumoto, Ichiro; Yasuoka, Akihito; Yoshihara, Yoshihiro; Abe, Keiko

2008-08-01

We established transgenic mouse lines expressing a transneuronal tracer, wheat germ agglutinin (WGA), under the control of mouse T1R3 gene promoter/enhancer. In the taste buds, WGA transgene was faithfully expressed in T1R3-positive sweet/umami taste receptor cells. WGA protein was transferred not laterally to the synapse-bearing, sour-responsive type III cells in the taste buds but directly to a subset of neurons in the geniculate and nodose/petrosal ganglia, and further conveyed to a rostro-central region of the nucleus of solitary tract. In addition, WGA was expressed in solitary chemoreceptor cells in the nasal epithelium and transferred along the trigeminal sensory pathway to the brainstem neurons. The solitary chemoreceptor cells endogenously expressed T1R3 together with bitter taste receptors T2Rs. This result shows an exceptional signature of receptor expression. Thus, the t1r3-WGA transgenic mice revealed the sweet/umami gustatory pathways from taste receptor cells and the trigeminal neural pathway from solitary chemoreceptor cells.

Dosimetric precision requirements and quantities for characterizing the response of tumors and normal tissues

Energy Technology Data Exchange (ETDEWEB)

Brahme, A [Karolinska Inst., Stockholm (Sweden). Dept. of Radiation Physics

1996-08-01

Based on simple radiobiological models the effect of the distribution of absorbed dose in therapy beams on the radiation response of tumor and normal tissue volumes are investigated. Under the assumption that the dose variation in the treated volume is small it is shown that the response of the tissue to radiation is determined mainly by the mean dose to the tumor or normal tissue volume in question. Quantitative expressions are also given for the increased probability of normal tissue complications and the decreased probability of tumor control as a function of increasing dose variations around the mean dose level to these tissues. When the dose variations are large the minimum tumor dose (to cm{sup 3} size volumes) will generally be better related to tumor control and the highest dose to significant portions of normal tissue correlates best to complications. In order not to lose more than one out of 20 curable patients (95% of highest possible treatment outcome) the required accuracy in the dose distribution delivered to the target volume should be 2.5% (1{sigma}) for a mean dose response gradient {gamma} in the range 2 - 3. For more steeply responding tumors and normal tissues even stricter requirements may be desirable. (author). 15 refs, 6 figs.

Mathematical models of tumour and normal tissue response

International Nuclear Information System (INIS)

Jones, B.; Dale, R.G.; Charing Cross Group of Hospitals, London

1999-01-01

The historical application of mathematics in the natural sciences and in radiotherapy is compared. The various forms of mathematical models and their limitations are discussed. The Linear Quadratic (LQ) model can be modified to include (i) radiobiological parameter changes that occur during fractionated radiotherapy, (ii) situations such as focal forms of radiotherapy, (iii) normal tissue responses, and (iv) to allow for the process of optimization. The inclusion of a variable cell loss factor in the LQ model repopulation term produces a more flexible clonogenic doubling time, which can simulate the phenomenon of 'accelerated repopulation'. Differential calculus can be applied to the LQ model after elimination of the fraction number integers. The optimum dose per fraction (maximum cell kill relative to a given normal tissue fractionation sensitivity) is then estimated from the clonogen doubling times and the radiosensitivity parameters (or α/β ratios). Economic treatment optimization is described. Tumour volume studies during or following teletherapy are used to optimize brachytherapy. The radiation responses of both individual tumours and tumour populations (by random sampling 'Monte-Carlo' techniques from statistical ranges of radiobiological and physical parameters) can be estimated. Computerized preclinical trials can be used to guide choice of dose fractionation scheduling in clinical trials. The potential impact of gene and other biological therapies on the results of radical radiotherapy are testable. New and experimentally testable hypotheses are generated from limited clinical data by exploratory modelling exercises. (orig.)

Evaluation of Olfactory and Gustatory Function of HIV Infected Women

Directory of Open Access Journals (Sweden)

Ayotunde James Fasunla

2016-01-01

Full Text Available Background. Compliance with medication requires good sense of smell and taste. Objective. To evaluate the olfactory and gustatory function of HIV infected women in Ibadan, Nigeria. Methods. A case control study of women comprising 83 HIV infected women and 79 HIV uninfected women. Subjective self-rating of taste and smell function was by visual analogue scale. Olfactory function was measured via olfactory threshold (OT, olfactory discrimination (OD, olfactory identification (OI, and TDI using “Sniffin’ sticks” kits and taste function (Total Taste Strips (TTS score measurement was by taste strips. Results. The mean age of the HIV infected women was 43.67 years ± 10.72 and control was 41.48 years ± 10.99. There was no significant difference in the self-reported assessment of smell (p=0.67 and taste (p=0.84 of HIV infected and uninfected women. Although the mean OT, OD, OI, TDI, and TTS scores of HIV infected and uninfected women were within the normosmic and normogeusic values, the values were significantly higher in the controls (p<0.05. Hyposmia was in 39.7% of subjects and 12.6% of controls while hypogeusia was in 15.7% of subjects and 1.3% of controls. Conclusions. Hyposmia and hypogeusia are commoner among the HIV infected women than the HIV uninfected women and the risk increases with an increased duration of highly active antiretroviral therapy.

Expression of AmGR10 of the Gustatory Receptor Family in Honey Bee Is Correlated with Nursing Behavior.

Science.gov (United States)

Paerhati, Yisilahaiti; Ishiguro, Shinichi; Ueda-Matsuo, Risa; Yang, Ping; Yamashita, Tetsuro; Ito, Kikukatsu; Maekawa, Hideaki; Tani, Hiroko; Suzuki, Koichi

2015-01-01

We investigated the association between the expression of a gene encoding gustatory receptor (G10) and division of labor in the honey bee, Apis mellifera. Among 10 GR genes encoding proteins 15% ~ 99% amino acid identity in the honey bee, we found that AmGR10 with 99% identity is involved in nursing or brood care. Expression of AmGR10 was restricted to organs of the hypopharyngeal gland, brain, and ovary in the nurse bee phase. Members of an extended nursing caste under natural conditions continued to express this gene. RNAi knockdown of AmGR10 accelerated the transition to foraging. Our findings demonstrate that this one gene has profound effects on the division of labor associated with the development and physiology of honeybee society.

Accident and Off-Normal Response and Recovery from Multi-Canister Overpack (MCO) Processing Events

International Nuclear Information System (INIS)

ALDERMAN, C.A.

2000-01-01

In the process of removing spent nuclear fuel (SNF) from the K Basins through its subsequent packaging, drymg, transportation and storage steps, the SNF Project must be able to respond to all anticipated or foreseeable off-normal and accident events that may occur. Response procedures and recovery plans need to be in place, personnel training established and implemented to ensure the project will be capable of appropriate actions. To establish suitable project planning, these events must first be identified and analyzed for their expected impact to the project. This document assesses all off-normal and accident events for their potential cross-facility or Multi-Canister Overpack (MCO) process reversal impact. Table 1 provides the methodology for establishing the event planning level and these events are provided in Table 2 along with the general response and recovery planning. Accidents and off-normal events of the SNF Project have been evaluated and are identified in the appropriate facility Safety Analysis Report (SAR) or in the transportation Safety Analysis Report for Packaging (SARP). Hazards and accidents are summarized from these safety analyses and listed in separate tables for each facility and the transportation system in Appendix A, along with identified off-normal events. The tables identify the general response time required to ensure a stable state after the event, governing response documents, and the events with potential cross-facility or SNF process reversal impacts. The event closure is predicated on stable state response time, impact to operations and the mitigated annual occurrence frequency of the event as developed in the hazard analysis process

Sex-related differences in the normal cardiac response to upright exercise

International Nuclear Information System (INIS)

Higginbotham, M.B.; Morris, K.G.; Coleman, R.E.; Cobb, F.R.

1984-01-01

In previous studies from this laboratory, it was found that approximately 30% of women with chest pain and normal coronary arteries demonstrated either a decrease in or a failure to increase radionuclide ejection fraction during exercise. To examine the hypothesis that this apparent abnormality in left ventricular function represents a physiologic difference between men and women, a prospective study was made of central and peripheral cardiovascular responses to exercise in 31 age-matched healthy volunteers (16 women and 15 men). A combination of quantitative radionuclide (technetium) angiography and expired-gas analysis was used to measure ejection fraction and relative changes in end-diastolic counts, stroke counts, count output, and arteriovenous oxygen difference during symptom-limited upright bicycle exercise. Normal male and female volunteers demonstrated comparable baseline left ventricular function and similar aerobic capacity, as determined by weight-adjusted peak oxygen consumption. However, their cardiac responses to exercise were significantly different. The ejection fraction increased by 5 points or more in 14 of 15 men, but in only seven of the 16 women. End-diastolic counts increased by 30% in women, but was unchanged in men. Because decreases in ejection fraction were matched by increases in end-diastolic counts, relative increases in stroke counts and count output were the same for men and women. These data demonstrate a basic difference between men and women with respect to the mechanism by which they achieve a normal response of stroke volume to exercise; these differences must be taken into account when measurements of cardiac function during exercise stress are used for diagnostic purposes

Ventral frontal satiation-mediated responses to food aromas in obese and normal-weight women123

Science.gov (United States)

Eiler, William JA; Dzemidzic, Mario; Case, K Rose; Armstrong, Cheryl LH; Mattes, Richard D; Cyders, Melissa A; Considine, Robert V; Kareken, David A

2014-01-01

Background: Sensory properties of foods promote and guide consumption in hunger states, whereas satiation should dampen the sensory activation of ingestive behaviors. Such activation may be disordered in obese individuals. Objective: Using functional magnetic resonance imaging (fMRI), we studied regional brain responses to food odor stimulation in the sated state in obese and normal-weight individuals targeting ventral frontal regions known to be involved in coding for stimulus reward value. Design: Forty-eight women (25 normal weight; 23 obese) participated in a 2-day (fed compared with fasting) fMRI study while smelling odors of 2 foods and an inedible, nonfood object. Analyses were conducted to permit an examination of both general and sensory-specific satiation (satiation effects specific to a given food). Results: Normal-weight subjects showed significant blood oxygen level–dependent responses in the ventromedial prefrontal cortex (vmPFC) to food aromas compared with responses induced by the odor of an inedible object. Normal-weight subjects also showed general (but not sensory-specific) satiation effects in both the vmPFC and orbitofrontal cortex. Obese subjects showed no differential response to the aromas of food and the inedible object when fasting. Within- and between-group differences in satiation were driven largely by changes in the response to the odor of the inedible stimulus. Responses to food aromas in the obese correlated with trait negative urgency, the tendency toward negative affect-provoked impulsivity. Conclusions: Ventral frontal signaling of reward value may be disordered in obesity, with negative urgency heightening responses to food aromas. The observed nature of responses to food and nonfood stimuli suggests that future research should independently quantify each to fully understand brain reward signaling in obesity. This trial was registered at clinicaltrials.gov as NCT02041039. PMID:24695888

Application of MR diffusion-weighted imaging in the evaluation of salivary glands with gustatory stimulation

International Nuclear Information System (INIS)

Zhang Yunyan; Ou Dan; Gu Yajia; He Xiayun; Mao Jian; Shen Xigang; Yue Lei; Peng Weijun

2012-01-01

Objective: To evaluate the function of the salivary glands with gustatory stimulation by using MR DWI. Methods: A prospective study was conducted in 30 patients with nasopharyngeal carcinoma who had normal salivary function. A DWI sequence was performed on the salivary glands at resting state, and continually repeated on the parotid immediately after oral ascorbic acid stimulation over a period of 21 minutes (once every 18 seconds). The multiple b-values (0, 400, 600, 800, 1000 s/mm 2 ) were used. ADC maps were evaluated with a manually placed region of interest including the entire salivary gland. The ADC of each gland was obtained by taking the mean of values on three contiguous sections containing the largest areas of the gland. The paired two-tailed Student t test was used to compare the ADC values of the parotid and the submandibular glands at rest, and of the parotid before and after stimulation. Results: The mean ADC value at rest was significantly lower in the parotid [(1.23 ±0.12) × 10 -3 mm 2 /s] than in the submandibular glands [(1.34 ± 0.07) × 10 -3 mm 2 /s, t=4.545, P<0.01]. After acid stimulation,the ADC value increased from the baseline to (1.41 ±0.19) × 10 -3 mm 2 /s firstly and then fluctuated at the following time, with a peak value of (1.49 ± 0.20) × 10 -3 mm 2 /s and the average value of (1.36 ±0.17) × 10 -3 mm 2 /s. The average value was significantly different from the baseline value (t=15.127, t=11.905, P<0.01). The minimum value [ ( 1.24 ± 0.14) × 10 -3 mm 2 /s] was not significantly different compared to the baseline value (t=1.329, P>0.05). Conclusion: MR DWI can noninvasively evaluate the physiologic changes of salivary glands before and after acid stimulation. (authors)

Molecular evolution of the odorant and gustatory receptor genes in lepidopteran insects: implications for their adaptation and speciation.

Science.gov (United States)

Engsontia, Patamarerk; Sangket, Unitsa; Chotigeat, Wilaiwan; Satasook, Chutamas

2014-08-01

Lepidoptera (comprised of butterflies and moths) is one of the largest groups of insects, including more than 160,000 described species. Chemoreception plays important roles in the adaptation of these species to a wide range of niches, e.g., plant hosts, egg-laying sites, and mates. This study investigated the molecular evolution of the lepidopteran odorant (Or) and gustatory receptor (Gr) genes using recently identified genes from Bombyx mori, Danaus plexippus, Heliconius melpomene, Plutella xylostella, Heliothis virescens, Manduca sexta, Cydia pomonella, and Spodoptera littoralis. A limited number of cases of large lineage-specific gene expansion are observed (except in the P. xylostella lineage), possibly due to selection against tandem gene duplication. There has been strong purifying selection during the evolution of both lepidopteran odorant and gustatory genes, as shown by the low ω values estimated through CodeML analysis, ranging from 0.0093 to 0.3926. However, purifying selection has been relaxed on some amino acid sites in these receptors, leading to sequence divergence, which is a precursor of positive selection on these sequences. Signatures of positive selection were detected only in a few loci from the lineage-specific analysis. Estimation of gene gains and losses suggests that the common ancestor of the Lepidoptera had fewer Or genes compared to extant species and an even more reduced number of Gr genes, particularly within the bitter receptor clade. Multiple gene gains and a few gene losses occurred during the evolution of Lepidoptera. Gene family expansion may be associated with the adaptation of lepidopteran species to plant hosts, especially after angiosperm radiation. Phylogenetic analysis of the moth sex pheromone receptor genes suggested that chromosomal translocations have occurred several times. New sex pheromone receptors have arisen through tandem gene duplication. Positive selection was detected at some amino acid sites predicted to be

Feeding response of the silkworm, Bombyx mori, to UV irradiation of mulberry leaves

International Nuclear Information System (INIS)

Yazawa, M.; Shimizu, T.; Hirao, T.

1992-01-01

Ultraviolet irradiation of mulberry leaves caused a reduced feeding response in Bombyx mori larvae (ca. 22% reduction in consumption as compared with control). Sucrose content of the foliage decreased after exposure to UV irradiation (0.5 mW/cm 2 ) for 1 hr. Electrophysiological responses of the sensilla styloconica-I to sucrose concentration (ca. 0-80 mg/g) showed a reduced response to UV-irradiated foliage when compared with the control. From feeding, gustatory, and electrophysiological responses, as well as the measurement of sucrose contents of the leaves, we concluded that the reduced feeding response to UV-irradiated leaves is due to the reduced sucrose content of the mulberry leaves, thus reducing pleogostimulatory levels

The influence of dose fractionation and dose rate on normal tissue responses

International Nuclear Information System (INIS)

Barendsen, G.W.

1982-01-01

An analysis of responses of a variety of normal tissues in animals to fractionated irradiations has been made with the aim of developing a formalism for the prediction of tolerance doses as a function of the dose per fraction and the overall treatment time. An important feature of the formalism is that it is directly based on radiological insights and therefore provides a logical concept to account for the diversity of tissue responses. (Auth.)

Estimating Non-Normal Latent Trait Distributions within Item Response Theory Using True and Estimated Item Parameters

Science.gov (United States)

Sass, D. A.; Schmitt, T. A.; Walker, C. M.

2008-01-01

Item response theory (IRT) procedures have been used extensively to study normal latent trait distributions and have been shown to perform well; however, less is known concerning the performance of IRT with non-normal latent trait distributions. This study investigated the degree of latent trait estimation error under normal and non-normal…

Tarsal taste neuron activity and proboscis extension reflex in response to sugars and amino acids in Helicoverpa armigera (Hubner).

Science.gov (United States)

Zhang, Yun-Feng; van Loon, Joop J A; Wang, Chen-Zhu

2010-08-15

In adult female Helicoverpa armigera (Hübner), the fifth tarsomere of the prothoracic legs bears 14 gustatory trichoid chemosensilla. These chemosensilla were characterized through electrophysiological experiments by stimulating with sucrose, glucose, fructose, maltose, myo-inositol and 20 common amino acids. In electrophysiological recordings from nine sensilla, responses were obtained to certain compounds tested at 100 mmol l(-1), and the response spectra differed from broad to narrow. The four sugars excited the same receptor neuron in sensillum a and sensillum b; sucrose and myo-inositol, sucrose and lysine, myo-inositol and lysine excited two different receptor neurons respectively in sensillum a; fructose and lysine excited two different receptor neurons in sensillum n. Furthermore, the four sugars, myo-inositol and lysine all elicited concentration-dependent electrophysiological responses. These six compounds also induced the proboscis extension reflex (PER) followed by ingestion of the solution when they were applied on the tarsi. Lysine and sucrose caused the strongest electrophysiological responses. However, sucrose had the strongest stimulatory effect on the PER whereas lysine had the weakest. Mixtures of sucrose with the other sugars or with lysine had a similar stimulatory effect on the PER as sucrose alone. The electrophysiological and behavioural responses caused by a range of sucrose concentrations were positively correlated. We conclude that the tarsal gustatory sensilla play an essential role in perceiving sugars available in floral nectar and provide chemosensory information determining feeding behaviour. Tarsal taste-receptor-neuron responses to lysine are implicated in oviposition behaviour.

It's in the eye of the beholder: selective attention to drink properties during tasting influences brain activation in gustatory and reward regions.

Science.gov (United States)

van Rijn, Inge; de Graaf, Cees; Smeets, Paul A M

2018-04-01

Statements regarding pleasantness, taste intensity or caloric content on a food label may influence the attention consumers pay to such characteristics during consumption. There is little research on the effects of selective attention on taste perception and associated brain activation in regular drinks. The aim of this study was to investigate the effect of selective attention on hedonics, intensity and caloric content on brain responses during tasting drinks. Using functional MRI brain responses of 27 women were measured while they paid attention to the intensity, pleasantness or caloric content of fruit juice, tomato juice and water. Brain activation during tasting largely overlapped between the three selective attention conditions and was found in the rolandic operculum, insula and overlying frontal operculum, striatum, amygdala, thalamus, anterior cingulate cortex and middle orbitofrontal cortex (OFC). Brain activation was higher during selective attention to taste intensity compared to calories in the right middle OFC and during selective attention to pleasantness compared to intensity in the right putamen, right ACC and bilateral middle insula. Intensity ratings correlated with brain activation during selective attention to taste intensity in the anterior insula and lateral OFC. Our data suggest that not only the anterior insula but also the middle and lateral OFC are involved in evaluating taste intensity. Furthermore, selective attention to pleasantness engaged regions associated with food reward. Overall, our results indicate that selective attention to food properties can alter the activation of gustatory and reward regions. This may underlie effects of food labels on the consumption experience of consumers.

Plasma catecholamine responses to physiologic stimuli in normal human pregnancy.

Science.gov (United States)

Barron, W M; Mujais, S K; Zinaman, M; Bravo, E L; Lindheimer, M D

1986-01-01

The dynamic response of the sympathoadrenal system was evaluated during and after pregnancy in 13 healthy women with a protocol that compared cardiovascular parameters and plasma catecholamine levels during the basal state, after postural maneuvers, and following isometric exercise. Plasma epinephrine and norepinephrine levels were similar during and after gestation when the women rested on their sides, but heart rate was greater in pregnancy. Ten minutes of supine recumbency produced minimal changes, but attenuation of the anticipated increases in heart rate and plasma norepinephrine levels during standing and isometric exercise were observed during pregnancy. In contrast, alterations in plasma epinephrine appeared unaffected by gestation. Plasma renin activity and aldosterone levels were, as expected, greater during pregnancy; however, increments in response to upright posture were similar in pregnant and postpartum women. To the extent that circulating catecholamines may be considered indices of sympathoadrenal function, these data suggest that normal pregnancy alters cardiovascular and sympathetic nervous system responses to physiologic stimuli.

Ejection fraction response to exercise in patients with chest pain and normal coronary arteriograms

International Nuclear Information System (INIS)

Gibbons, R.L.; Lee, K.L.; Cobb, F.; Jones, R.H.

1981-01-01

In this study we describe the ejection fraction response to upright exercise using first-pass radionuclide angiocardiography in a group of 60 patients with chest pain, normal coronary ateriograms and normal resting ventricular function. A wide range of resting function (heart rate and ejection fraction) and exercise function (heart rate, ejection fraction, peak work load and estimated peak oxygen uptake) were measured. The ejection fraction response to exercise demonstrated wide variation, ranging from a decrease of 23% to an increase of 24%. Six of 22 clinical and radionuclide angiocardiographic variables (resting ejection fraction, peak work load, age, sex, body surface area and the change in end-diastolic volume index with exercise) were significant univariate predictors of the ejection fraction response to exercise. Multivariable analysis identified resting ejection fraction, the change in end-diastolic volume index with exercise and either sex or peak work load as variables that provided significant independent predictive information. These observations indicate that the ejection fraction response to exercise is a complex response that is influenced by multiple physiologic variables. The wide variation in this population suggests that the ejection fraction response to exercise is not a reliable test for the diagnosis of coronary artery disease because of its low specificity

Memory, verbal fluency, and response inhibition in normal aging

Directory of Open Access Journals (Sweden)

Gaurav Thapliyal

2016-01-01

Full Text Available Background: The concepts of aging-related cognitive changes have appeared to be a major challenge in the society. In this context, the present study was planned to find out the functioning of aging population on different neurocognitive measures. Aims: The aim of the study was to find out the neurocognitive functioning, namely memory, verbal fluency, and response inhibition of normal aging population. Materials and Methods: Following purposive sampling technique, a total of 50 healthy subjects (30 males and 20 females in the age range of 60-70 years were recruited from Jaipur city of Rajasthan. Mini-mental state Examination, PGI memory scale, animal names test, and Stroop test were administered. Results: The findings reveal dysfunction in almost all the domains of memory, namely mental balance, attention and concentration, delayed recall, verbal retention for dissimilar pairs, visual retention and recognition, immediate recall, verbal retention for similar pairs, and visual retention. In domain of verbal fluency, all subjects gave low responses on the animal names test. In domain of response inhibition, all the subjects took less time in color test as compared to color word test on the Stroop task. Conclusions: Findings suggest that there are dysfunction in the area of memory, verbal fluency, and response inhibition in persons aged 60-70 years. However, recent and remote memory were found to be intact.

ERK1/2 activation in human taste bud cells regulates fatty acid signaling and gustatory perception of fat in mice and humans.

Science.gov (United States)

Subramaniam, Selvakumar; Ozdener, Mehmet Hakan; Abdoul-Azize, Souleymane; Saito, Katsuyoshi; Malik, Bilal; Maquart, Guillaume; Hashimoto, Toshihiro; Marambaud, Philippe; Aribi, Mourad; Tordoff, Michael G; Besnard, Philippe; Khan, Naim Akhtar

2016-10-01

Obesity is a major public health problem. An in-depth knowledge of the molecular mechanisms of oro-sensory detection of dietary lipids may help fight it. Humans and rodents can detect fatty acids via lipido-receptors, such as CD36 and GPR120. We studied the implication of the MAPK pathways, in particular, ERK1/2, in the gustatory detection of fatty acids. Linoleic acid, a dietary fatty acid, induced via CD36 the phosphorylation of MEK1/2-ERK1/2-ETS-like transcription factor-1 cascade, which requires Fyn-Src kinase and lipid rafts in human taste bud cells (TBCs). ERK1/2 cascade was activated by Ca 2+ signaling via opening of the calcium-homeostasis modulator-1 (CALHM1) channel. Furthermore, fatty acid-evoked Ca 2+ signaling and ERK1/2 phosphorylation were decreased in both human TBCs after small interfering RNA knockdown of CALHM1 channel and in TBCs from Calhm1 -/- mice. Targeted knockdown of ERK1/2 by small interfering RNA or PD0325901 (MEK1/2 inhibitor) in the tongue and genetic ablation of Erk1 or Calhm1 genes impaired preference for dietary fat in mice. Lingual inhibition of ERK1/2 in healthy volunteers also decreased orogustatory sensitivity for linoleic acid. Our data demonstrate that ERK1/2-MAPK cascade is regulated by the opening of CALHM1 Ca 2+ channel in TBCs to modulate orogustatory detection of dietary lipids in mice and humans.-Subramaniam, S., Ozdener, M. H., Abdoul-Azize, S., Saito, K., Malik, B., Maquart, G., Hashimoto, T., Marambaud, P., Aribi, M., Tordoff, M. G., Besnard, P., Khan, N. A. ERK1/2 activation in human taste bud cells regulates fatty acid signaling and gustatory perception of fat in mice and humans. © FASEB.

Brief exposure to sensory cues elicits stimulus-nonspecific general sensitization in an insect.

Directory of Open Access Journals (Sweden)

Sebastian Minoli

Full Text Available The effect of repeated exposure to sensory stimuli, with or without reward is well known to induce stimulus-specific modifications of behaviour, described as different forms of learning. In recent studies we showed that a brief single pre-exposure to the female-produced sex pheromone or even a predator sound can increase the behavioural and central nervous responses to this pheromone in males of the noctuid moth Spodoptera littoralis. To investigate if this increase in sensitivity might be restricted to the pheromone system or is a form of general sensitization, we studied here if a brief pre-exposure to stimuli of different modalities can reciprocally change behavioural and physiological responses to olfactory and gustatory stimuli. Olfactory and gustatory pre-exposure and subsequent behavioural tests were carried out to reveal possible intra- and cross-modal effects. Attraction to pheromone, monitored with a locomotion compensator, increased after exposure to olfactory and gustatory stimuli. Behavioural responses to sucrose, investigated using the proboscis extension reflex, increased equally after pre-exposure to olfactory and gustatory cues. Pheromone-specific neurons in the brain and antennal gustatory neurons did, however, not change their sensitivity after sucrose exposure. The observed intra- and reciprocal cross-modal effects of pre-exposure may represent a new form of stimulus-nonspecific general sensitization originating from modifications at higher sensory processing levels.

Genomic instability: potential contributions to tumour and normal tissue response, and second tumours, after radiotherapy

International Nuclear Information System (INIS)

Hendry, Jolyon H.

2001-01-01

Purpose: Induced genomic instability generally refers to a type of damage which is transmissible down cell generations, and which results in a persistently enhanced frequency of de novo mutations, chromosomal abnormalities or lethality in a significant fraction of the descendant cell population. The potential contribution of induced genomic instability to tumour and normal tissue response, and second tumours, after radiotherapy, is explored. Results: The phenomenon of spontaneous genomic instability is well known in some rare genetic diseases (e.g. Gorlin's syndrome), and there is evidence in such cases that it can lead to a greater propensity for carcinogenesis (with shortened latency) which is enhanced after irradiation. It is unclear what role induced genomic instability plays in the response of normal individuals, but persistent chromosomal instability has been detected in vivo in lymphocytes and keratinocytes from irradiated normal individuals. Such induced genomic instability might play some role in tumour response in a subset of tumours with specific defects in damage response genes, but again its contribution to radiocurability in the majority of cancer patients is unclear. In normal tissues, genomic instability induced in wild-type cells leading to delayed cell death might contribute to more severe or prolonged early reactions as a consequence of increased cell loss, a longer time required for recovery, and greater residual injury. In tumours, induced genomic instability reflected in delayed reductions in clonogenic capacity might contribute to the radiosensitivity of primary tumours, and also to a lower incidence, longer latency and slower growth rate of recurrences and metastases. Conclusions: The evidence which is reviewed shows that there is little information at present to support these propositions, but what exists is consistent with their expectations. Also, it is not yet clear to what extent mutations associated with genomic instability

Normalize the response of EPID in pursuit of linear accelerator dosimetry standardization.

Science.gov (United States)

Cai, Bin; Goddu, S Murty; Yaddanapudi, Sridhar; Caruthers, Douglas; Wen, Jie; Noel, Camille; Mutic, Sasa; Sun, Baozhou

2018-01-01

Normalize the response of electronic portal imaging device (EPID) is the first step toward an EPID-based standardization of Linear Accelerator (linac) dosimetry quality assurance. In this study, we described an approach to generate two-dimensional (2D) pixel sensitivity maps (PSM) for EPIDs response normalization utilizing an alternative beam and dark-field (ABDF) image acquisition technique and large overlapping field irradiations. The automated image acquisition was performed by XML-controlled machine operation and the PSM was generated based on a recursive calculation algorithm for Varian linacs equipped with aS1000 and aS1200 imager panels. Cross-comparisons of normalized beam profiles and 1.5%/1.5 mm 1D Gamma analysis was adopted to quantify the improvement of beam profile matching before and after PSM corrections. PSMs were derived for both photon (6, 10, 15 MV) and electron (6, 20 MeV) beams via proposed method. The PSM-corrected images reproduced a horn-shaped profile for photon beams and a relative uniform profiles for electrons. For dosimetrically matched linacs equipped with aS1000 panels, PSM-corrected images showed increased 1D-Gamma passing rates for all energies, with an average 10.5% improvement for crossline and 37% for inline beam profiles. Similar improvements in the phantom study were observed with a maximum improvement of 32% for 15 MV and 22% for 20 MeV. The PSM value showed no significant change for all energies over a 3-month period. In conclusion, the proposed approach correct EPID response for both aS1000 and aS1200 panels. This strategy enables the possibility to standardize linac dosimetry QA and to benchmark linac performance utilizing EPID as the common detector. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

Biological responses of progestogen metabolites in normal and cancerous human breast.

Science.gov (United States)

Pasqualini, Jorge R; Chetrite, Gérard S

2010-12-01

At present, more than 200 progestogen molecules are available, but their biological response is a function of various factors: affinity to progesterone or other receptors, their structure, the target tissues considered, biological response, experimental conditions, dose, method of administration and metabolic transformations. Metabolic transformation is of huge importance because in various biological processes the metabolic product(s) not only control the activity of the maternal hormone but also have an important activity of its own. In this regard, it was observed that the 20-dihydro derivative of the progestogen dydrogesterone (Duphaston®) is significantly more active than the parent compound in inhibiting sulfatase and 17β-hydroxysteroid dehydrogenase in human breast cancer cells. Estrone sulfatase activity is also inhibited by norelgestromin, a norgestimate metabolite. Interesting information was obtained with a similar progestogen, tibolone, which is rapidly metabolized into the active 3α/3β-hydroxy and 4-ene metabolites. All these metabolites can inhibit sulfatase and 17β-hydroxysteroid dehydrogenase and stimulate sulfotransferase in human breast cancer cells. Another attractive aspect is the metabolic transformation of progesterone itself in human breast tissues. In the normal breast progesterone is mainly converted to 4-ene derivatives, whereas in the tumor tissue it is converted mostly to 5α-pregnane derivatives. 20α-Dihydroprogesterone is found mainly in normal breast tissue and possesses antiproliferative properties as well as the ability to act as an anti-aromatase agent. Consequently, this progesterone metabolite could be involved in the control of estradiol production in the normal breast and therefore implicated in one of the multifactorial mechanisms of the breast carcinogenesis process. In conclusion, a better understanding of both natural and synthetic hormone metabolic transformations and their control could potentially provide

Responses of some normal tissues to low doses of γ-radiation

International Nuclear Information System (INIS)

Withers, H.R.

1975-01-01

The response of four normal tissues to low doses of γ-radiation was measured in mice using three indirect methods. The survival curves for cells of the tissues studied (colon, jejunum, testis and haemoleucopoietic system) may be exponential over an uncertain dose range (from zero to between 100 to 230 rad), the slope being about one third of that in the high-dose region. Some of the uncertainties in the data probably reflect variations in age-density distribution. (author)

Nystagmus responses in a group of normal humans during earth-horizontal axis rotation

Science.gov (United States)

Wall, Conrad, III; Furman, Joseph M. R.

1989-01-01

Horizontal eye movement responses to earth-horizontal yaw axis rotation were evaluated in 50 normal human subjects who were uniformly distributed in age (20-69 years) and each age group was then divided by gender. Subjects were rotated with eyes open in the dark, using clockwise and counter-clockwise 60 deg velocity trapezoids. The nystagmus slow component velocity is analyzed. It is shown that, despite large intersubject variability, parameters which describe earth-horizontal yaw axis responses are loosely interrelated, and some of them vary significantly with gender and age.

Normal mitogen-induced suppression of the interleukin-6 (IL-6) response and its deficiency in systemic lupus erythematosus

International Nuclear Information System (INIS)

Warrington, R.J.; Rutherford, W.J.

1990-01-01

A low-frequency suppressor-cell population in normal peripheral blood inhibits the B-cell CESS response to IL-6, following pokeweed mitogen stimulation. The suppression of IL-6 responsiveness is radiation sensitive, directed against CESS targets and not mediated by inhibition of IL-6 production, and associated with nonspecific cytotoxic activity against CESS targets. The generation of these cytolytic cells is also radiation sensitive. A correlation was found between PWM-induced cytotoxicity against CESS and the suppression of IL-6-dependent IgG production. But cytotoxicity toward CESS targets is not responsible for this suppression because IL-2 induces equivalent or greater nonspecific cytotoxicity against CESS in the total absence of suppression of CESS-derived IgG production and suppression is also induced by mitogen-activated PBL separated from CESS targets by a cell-impermeable membrane. This suppression was not mediated by TNF alpha/beta or IFN-gamma. In systemic lupus erythematosus, suppression of IL-6-dependent IgG production is impaired in patients with active disease (29.2 +/- 13.7%) compared to patients with inactive disease (70 +/- 19.5%) or normal controls (82.8 +/- 9.2%). There is also a defect in mitogen-induced nonspecific cytotoxicity in active SLE (specific lysis 15.1 +/- 3.5%, compared to 34 +/- 4% in normals). Pokeweed mitogen-activated PBL can therefore normally induce suppression of B-cell IL-6 responses and this response is deficient in lupus

Angiogenesis for tumor vascular normalization of Endostar on hepatoma 22 tumor-bearing mice is involved in the immune response.

Science.gov (United States)

Xu, Qingyu; Gu, Junfei; Lv, You; Yuan, Jiarui; Yang, Nan; Chen, Juan; Wang, Chunfei; Hou, Xuefeng; Jia, Xiaobin; Feng, Liang; Yin, Guowen

2018-03-01

Tumor vascular normalization involved in immune response is beneficial to the chemotherapy of tumors. Recombinant human endostatin (Endostar), an angiogenesis inhibitor, has been demonstrated to be effective in hepatocellular cancer (HCC). However, its vascular normalization in HCC and the role of the immune response in angiogenesis were unclear. In the present study, effects of Endostar on tumor vascular normalization were evaluated in hepatoma 22 (H22) tumor-bearing mice. Endostar was able to inhibit the proliferation and infiltration of tumor cells and improve α-fetoprotein, tumor necrosis factor-α and cyclic adenosine 5'-phosphate levels in the serum of H22-bearing mice, as well as the protein expression levels of the immune factors interferon-γ and cluster of differentiation (CD)86 in liver tissue. Endostar also exhibited more marked downregulation of the levels of vascular endothelial growth factor, CD31, matrix metalloproteinase (MMP)-2, MMP-9 and interleukin-17 during day 3-9 treatment, resulting in short-term normalization of tumor blood vessels. The period of vascular normalization was 3-9 days. The results of the present study demonstrated that Endostar was able to induce the period of vascular normalization, contributing to a more efficacious means of HCC treatment combined with other chemotherapy, and this effect was associated with the immune response. It may be concluded that Endostar inhibited immunity-associated angiogenesis behaviors of vascular endothelial cells in response to HCC. The results of the present study provided more reasonable possibility for the combination therapy of Endostar for the treatment of HCC.

Effect of short-term fasting on lipolytic responsiveness in normal and obese human subjects

International Nuclear Information System (INIS)

Wolfe, R.R.; Peters, E.J.; Klein, S.; Holland, O.B.; Rosenblatt, J.; Gary, H. Jr.

1987-01-01

In this study the rate of lipolysis (fatty acid and glycerol release into blood) has been quantified in both normal weight and obese volunteers after both 15 and 87 h of fasting. In each study, the basal rate and subsequent response to epinephrine infusion were determined. The rate of appearance (R/sub a/) of free fatty acids (FFA) and glycerol were quantified by infusion of [1- 13 C]palmitate and D-5-glycerol, respectively. Substrate flux rates per unit of body fat mass and lean body mass were calculated from total body water measurements using H 2 18 O dilution. In normal volunteers, the basal R/sub a/ FFA and R/sub a/ glycerol rose markedly with 87 h of fasting, whereas the increases were more modest in the obese subjects. However, the rate of mobilization of fat, in relation to the lean body mass, was higher in the obese subjects than in the normal subjects after 15 h of fasting, and the values were similar in both groups after 87 h of fasting. There was an increased lipolytic response to epinephrine after fasting in both groups. This increased sensitivity may have resulted from the enhancement of fatty acid-triglyceride substrate cycling that occurred after fasting

Over-the-road tests of nuclear materials package response to normal environments

International Nuclear Information System (INIS)

Gwinn, K.W.; Glass, R.E.; Edwards, K.R.

1991-12-01

In support of the development of American National Standards Institute standards for the transport of radioactive materials, Sandia has a program to characterize the normal transport environment. This program includes both analytical modeling of package and trailer responses, and over-the-road tests to measure those responses. This paper presents the results of a series of over-the-road tests performed using Chem-Nuclear equipment in the Barnwell, SC, area. The test events included a variety of road types such as rough concrete, shock events such as railroad grade crossings, and driver responses such as sharp turns. The response of the package and trailer to these events was measured with accelerometers at various locations to determine the inertial loads. Either load cells or strain gages were used to measure tiedown response. These accelerations and loads were measured on systems with flexible and ''rigid'' tiedowns. The results indicated that while significant accelerations occur on the trailer bed, these do not translate into equivalent loads in either the package or the tiedown system. This indicates that trailer-bed response should not be used in determining the load factor for fatigue calculations of the package components or in determining design loads for tiedowns

Neurochemical characterization of sea lamprey taste buds and afferent gustatory fibers: presence of serotonin, calretinin, and CGRP immunoreactivity in taste bud bi-ciliated cells of the earliest vertebrates.

Science.gov (United States)

Barreiro-Iglesias, Antón; Villar-Cerviño, Verona; Villar-Cheda, Begoña; Anadón, Ramón; Rodicio, María Celina

2008-12-01

Neuroactive substances such as serotonin and other monoamines have been suggested to be involved in the transmission of gustatory signals from taste bud cells to afferent fibers. Lampreys are the earliest vertebrates that possess taste buds, although these differ in structure from taste buds in jawed vertebrates, and their neurochemistry remains unknown. We used immunofluorescence methods with antibodies raised against serotonin, tyrosine hydroxylase (TH), gamma-aminobutyric acid (GABA), glutamate, calcitonin gene-related peptide (CGRP), neuropeptide Y (NPY), calretinin, and acetylated alpha-tubulin to characterize the neurochemistry and innervation of taste buds in the sea lamprey, Petromyzon marinus L. For localization of proliferative cells in taste buds we used bromodeoxyuridine labeling and proliferating cell nuclear antigen immunohistochemistry. Results with both markers indicate that proliferating cells are restricted to a few basal cells and that almost all cells in taste buds are nonproliferating. A large number of serotonin-, calretinin-, and CGRP-immunoreactive bi-ciliated cells were revealed in lamprey taste buds. This suggests that serotonin participates in the transmission of gustatory signals and indicates that this substance appeared early on in vertebrate evolution. The basal surface of the bi-ciliated taste bud cells was contacted by tubulin-immunoreactive fibers. Some of the fibers surrounding the taste bud were calretinin immunoreactive. Lamprey taste bud cells or afferent fibers did not exhibit TH, GABA, glutamate, or NPY immunoreactivity, which suggests that expression of these substances evolved in taste buds of some gnathostomes lines after the separation of gnathostomes and lampreys. (c) 2008 Wiley-Liss, Inc.

Canine tumor and normal tissue response to heat and radiation

International Nuclear Information System (INIS)

Gillette, E.L.; McChesney, S.L.

1985-01-01

Oral squamous cell carcinomas of dogs were treated with either irradiation alone or combined with hyperthermia. Tumor control was assessed as no evidence of disease one year following treatment. Dogs were randomized to variable radiation doses which were given in ten fractions three times a week for three weeks. Heat was given three hours after the first and third radiation dose each week for seven treatments. The attempt was made to achieve a minimum tumor temperature of 42 0 C for thirty minutes with a maximum normal tissue temperature of 40 0 C. It was usually possible to selectively heat tumors. The TCD 50 for irradiation alone was about 400 rads greater than for heat plus irradiation. The dose response curve for heat plus radiation was much steeper than for radiation alone indicating less heterogeneity of tumor response. That also implies a much greater effectiveness of radiation combined with heat at higher tumor control probabilities. Early necrosis caused by heating healed with conservative management. No increase in late radiation necrosis was observed

The response of normal and ataxia-telangiectasia human fibroblasts to the lethal effects of far, mid and near ultraviolet radiations

International Nuclear Information System (INIS)

Keyse, S.M.; McAleer, M.A.; Davies, D.J.G.; Moss, S.H.

1985-01-01

The responses of two ataxia-telangiectasia (A-T) cell strains to the lethal effects of monochromatic far, mid and near ultraviolet radiations have been determined and compared with the responses of three normal human cell strains. The authors results confirm a previous observation that the A-T cell strain AT4BI is abnormally sensitive to the lethal effects of mid u.v. (313 nm) radiation. After far u.v. (254 nm) radiation the strain AT4BI exhibits a small but statistically significant increase in sensitivity compared to the normal strains. Of most interest, in terms of a mechanistic interpretation of the sensitivity of A-T strains, the survival responses of neither A-T strain tested to near u.v. (365 nm) radiation differed significantly from the mean response of the normal strains, although it is of interest that one normal strain (48BR) was found to be significantly more resistant to near u.v. radiation than any of the other strains tested. The results are discussed in terms of the possible induction of radiogenic lesions in DNA by ultraviolet radiations and the possible mechanisms of radiation sensitivity in ataxia-telangiectasia. (author)

Analysis of a Dynamic Viscoelastic Contact Problem with Normal Compliance, Normal Damped Response, and Nonmonotone Slip Rate Dependent Friction

Directory of Open Access Journals (Sweden)

Mikaël Barboteu

2016-01-01

Full Text Available We consider a mathematical model which describes the dynamic evolution of a viscoelastic body in frictional contact with an obstacle. The contact is modelled with a combination of a normal compliance and a normal damped response law associated with a slip rate-dependent version of Coulomb’s law of dry friction. We derive a variational formulation and an existence and uniqueness result of the weak solution of the problem is presented. Next, we introduce a fully discrete approximation of the variational problem based on a finite element method and on an implicit time integration scheme. We study this fully discrete approximation schemes and bound the errors of the approximate solutions. Under regularity assumptions imposed on the exact solution, optimal order error estimates are derived for the fully discrete solution. Finally, after recalling the solution of the frictional contact problem, some numerical simulations are provided in order to illustrate both the behavior of the solution related to the frictional contact conditions and the theoretical error estimate result.

Comparison of the responses of the chorda tympani and glossopharyngeal nerves to taste stimuli in C57BL/6J mice

Directory of Open Access Journals (Sweden)

Hellekant Göran

2003-03-01

Full Text Available Abstract Background Recent progress in discernment of molecular pathways of taste transduction underscores the need for comprehensive phenotypic information for the understanding of the influence of genetic factors in taste. To obtain information that can be used as a base line for assessment of effects of genetic manipulations in mice taste, we have recorded the whole-nerve integrated responses to a wide array of taste stimuli in the chorda tympani (CT and glossopharyngeal (NG nerves, the two major taste nerves from the tongue. Results In C57BL/6J mice the responses in the two nerves were not the same. In general sweeteners gave larger responses in the CT than in the NG, while responses to bitter taste in the NG were larger. Thus the CT responses to cyanosuosan, fructose, NC00174, D-phenylalanline and sucrose at all concentrations were significantly larger than in the NG, whereas for acesulfame-K, L-proline, saccharin and SC45647 the differences were not significant. Among bitter compounds amiloride, atropine, cycloheximide, denatonium benzoate, L-phenylalanine, 6-n-propyl-2-thiouracil (PROP and tetraethyl ammonium chloride (TEA gave larger responses in the NG, while the responses to brucine, chloroquine, quinacrine, quinine hydrochloride (QHCl, sparteine and strychnine, known to be very bitter to humans, were not significantly larger in the NG than in the CT. Conclusion These data provide a comprehensive survey and comparison of the taste sensitivity of the normal C57BL/6J mouse against which the effects of manipulations of its gustatory system can be better assessed.

c-Fos expression is elevated in GABAergic interneurons of the gustatory cortex following novel taste learning.

Science.gov (United States)

Doron, Guy; Rosenblum, Kobi

2010-07-01

Long-term sensory memories are considered to be stored in the relevant cortical region subserving the given modality. We and others have recently identified a series of molecular alterations in the gustatory cortex (GC) of the rat at different time intervals following novel taste learning. Some of these correlative modifications were also necessary for taste memory acquisition and/or consolidation. However, very little is known about the localization of these molecular modifications within the GC or about the functional activation of the GC hours after novel taste learning. Here, we hypothesize that inhibitory interneurons are activated in the GC on a scale of hours following learning and used c-Fos expression and confocal microscopy with different markers to test this hypothesis. We found that GABAergic interneurons are activated in the GC in correlation with novel taste learning. The activation was evident in the deep but not superficial layers of the dysgranular insular cortex. These results suggest that the GABAergic machinery in the deep layers of the GC participates in the processing of taste information hours after learning, and provide evidence for the involvement of a local cortical circuit not only during acquisition of new information but also during off-line processing and consolidation of taste information.

A dose-response strategy reveals differences between normal-weight and obese men in their metabolic and inflammatory responses to a high-fat meal.

Science.gov (United States)

Schwander, Flurina; Kopf-Bolanz, Katrin A; Buri, Caroline; Portmann, Reto; Egger, Lotti; Chollet, Magali; McTernan, Philip G; Piya, Milan K; Gijs, Martin A M; Vionnet, Nathalie; Pralong, François; Laederach, Kurt; Vergères, Guy

2014-10-01

A dose-response strategy may not only allow investigation of the impact of foods and nutrients on human health but may also reveal differences in the response of individuals to food ingestion based on their metabolic health status. In a randomized crossover study, we challenged 19 normal-weight (BMI: 20-25 kg/m(2)) and 18 obese (BMI: >30 kg/m(2)) men with 500, 1000, and 1500 kcal of a high-fat (HF) meal (60.5% energy from fat). Blood was taken at baseline and up to 6 h postprandially and analyzed for a range of metabolic, inflammatory, and hormonal variables, including plasma glucose, lipids, and C-reactive protein and serum insulin, glucagon-like peptide-1, interleukin-6 (IL-6), and endotoxin. Insulin was the only variable that could differentiate the postprandial response of normal-weight and obese participants at each of the 3 caloric doses. A significant response of the inflammatory marker IL-6 was only observed in the obese group after ingestion of the HF meal containing 1500 kcal [net incremental AUC (iAUC) = 22.9 ± 6.8 pg/mL × 6 h, P = 0.002]. Furthermore, the net iAUC for triglycerides significantly increased from the 1000 to the 1500 kcal meal in the obese group (5.0 ± 0.5 mmol/L × 6 h vs. 6.0 ± 0.5 mmol/L × 6 h; P = 0.015) but not in the normal-weight group (4.3 ± 0.5 mmol/L × 6 h vs. 4.8 ± 0.5 mmol/L × 6 h; P = 0.31). We propose that caloric dose-response studies may contribute to a better understanding of the metabolic impact of food on the human organism. This study was registered at clinicaltrials.gov as NCT01446068. © 2014 American Society for Nutrition.

Proprietary tomato extract improves metabolic response to high-fat meal in healthy normal weight subjects

Directory of Open Access Journals (Sweden)

Xavier Deplanque

2016-10-01

Full Text Available Background: Low-density lipoprotein (LDL oxidation is a risk factor for atherosclerosis. Lycopene and tomato-based products have been described as potent inhibitors of LDL oxidation. Objectives: To evaluate the effect of a 2-week supplementation with a carotenoid-rich tomato extract (CRTE standardized for a 1:1 ratio of lycopene and phytosterols, on post-prandial LDL oxidation after a high-fat meal. Design: In a randomized, double-blind, parallel-groups, placebo-controlled study, 146 healthy normal weight individuals were randomly assigned to a daily dose of CRTE standardized for tomato phytonutrients or placebo during 2 weeks. Oxidized LDL (OxLDL, glucose, insulin, and triglyceride (TG responses were measured for 8 h after ingestion of a high-fat meal before and at the end of intervention. Results: Plasma lycopene, phytofluene, and phytoene were increased throughout the study period in the CRTE group compared to placebo. CRTE ingestion significantly improved changes in OxLDL response to high-fat meal compared to placebo after 2 weeks (p<0.0001. Changes observed in glucose, insulin, and TG responses were not statistically significant after 2 weeks of supplementation, although together they may suggest a trend of favorable effect on metabolic outcomes after a high-fat meal. Conclusions: Two-week supplementation with CRTE increased carotenoids levels in plasma and improved oxidized LDL response to a high-fat meal in healthy normal weight individuals.

Responsiveness of cardiodynamics to exercise loading in normal subjects and in patients with idiopathic cardiomyopathy

International Nuclear Information System (INIS)

Fukuoka, Yukie; Matsuda, Takeshi

1996-01-01

In the present study, we examined the responses of the left ventricular systolic function and diastolic function to exertion by cardiac blood pool scintigraphy using 99mTc in reference to changes with aging and changes in the cases of idiopathic cardiomyopathy. In order to study the functional response with aging to exertion, 38 normal subjects were divided by age. Subsequently, 28 hypertrophic cardiomyopathy cases (Group H), 13 dilated cardiomyopathy cases (Group D) and 14 normal cases (Group N) were studied. Ejection Fraction (EF) and Peak Ejection Rate (PER) were used as the indicators for the systolic function. Peak Filling Rate (PER), 1/3 Filling Rate (1/3FR) and Time to Peak Filling (TPF) were used as the indicators for the diastolic function. When comparison was made among the normal subjects by age, the systolic function and diastolic function at rest, varied as they were, showed no significant change with aging. The %delta EF and %delta PER tended to decrease linearly with aging (Y=-4E-X+28, p<0.0001; Y=-X+57, p<0.0001). As to the %delta PFR, %delta 1/3FR and %delta TPF, however, correlation with aging was not found. In comparing hypertrophic cardiomyopathy and dilated cardiomyopathy, Group D showed significantly lower values before exertion and after maximum exertion than the other two groups. A difference in the response of the systolic function and diastolic function to exertion was noted in both the comparative study on aging of the normal subjects and the study of cases of cardiomyopathy. The presence of the compensatory mechanism due to elevation of the left atrial pressure and an increase in the left atrial contractile power may be mentioned as a reservoir of blood and also as a booster pump. Particularly, the effect of the latter compensates for the decline in the left ventricular compliance, which may lead to the maintenance of the diastolic function. (K.H.)

Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

International Nuclear Information System (INIS)

Brock, W.A.; Wike, J.; Tucker, S.L.

1995-01-01

To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs

Radiobiological predictors of tumor and acute normal tissue response in radiotherapy for head and neck cancers

International Nuclear Information System (INIS)

Maciejewski, B.; Skladowski, K.; Zajusz, A.

1991-01-01

The importance of measurements of the potential doubling time (T pot. ) and of the survival fraction at 2.0 Gy (SF 2 ), and a method modifying acute radiation response of normal oral mucosa are discussed. Tumor clonogen repopulation accelerates around day 28 of the treatment, and the rate of repopulation is not constant but continuously increases from about 0.3 Gy/day to 1.0-1.3 Gy/day between day 28 and 65 of the treatment. This may suggest that T pot. values decrease correspondingly. The relevance of prior-to-treatment T pot. measurements to clinical situations is discussed. The SF 2 value reflects the intrinsic radiosensitivity of human tumors. The SF 2 values are expected to be valuable as predictors for tumor response to irradiation. Variations in the SF 2 values depending on tumor characteristics and assay methods are discussed in relation to the dose response and tumor cure probability. The effect of modifying the repopulation rate in the oral mucosa by stimulation with a 2% silver nitrate solution is discussed. Although these prognosticators are different in their nature, they might provide a rational basis for selecting patients into optimal irradiation treatment and might allow to modify the radiation response of dose-limiting normal tissues. (author). 5 figs., 1 tab., 28 refs

A Dose-Response Strategy Reveals Differences between Normal-Weight and Obese Men in Their Metabolic and Inflammatory Responses to a High-Fat Meal123

Science.gov (United States)

Schwander, Flurina; Kopf-Bolanz, Katrin A.; Buri, Caroline; Portmann, Reto; Egger, Lotti; Chollet, Magali; McTernan, Philip G.; Piya, Milan K.; Gijs, Martin A. M.; Vionnet, Nathalie; Pralong, François; Laederach, Kurt; Vergères, Guy

2014-01-01

A dose-response strategy may not only allow investigation of the impact of foods and nutrients on human health but may also reveal differences in the response of individuals to food ingestion based on their metabolic health status. In a randomized crossover study, we challenged 19 normal-weight (BMI: 20–25 kg/m2) and 18 obese (BMI: >30 kg/m2) men with 500, 1000, and 1500 kcal of a high-fat (HF) meal (60.5% energy from fat). Blood was taken at baseline and up to 6 h postprandially and analyzed for a range of metabolic, inflammatory, and hormonal variables, including plasma glucose, lipids, and C-reactive protein and serum insulin, glucagon-like peptide-1, interleukin-6 (IL-6), and endotoxin. Insulin was the only variable that could differentiate the postprandial response of normal-weight and obese participants at each of the 3 caloric doses. A significant response of the inflammatory marker IL-6 was only observed in the obese group after ingestion of the HF meal containing 1500 kcal [net incremental AUC (iAUC) = 22.9 ± 6.8 pg/mL × 6 h, P = 0.002]. Furthermore, the net iAUC for triglycerides significantly increased from the 1000 to the 1500 kcal meal in the obese group (5.0 ± 0.5 mmol/L × 6 h vs. 6.0 ± 0.5 mmol/L × 6 h; P = 0.015) but not in the normal-weight group (4.3 ± 0.5 mmol/L × 6 h vs. 4.8 ± 0.5 mmol/L × 6 h; P = 0.31). We propose that caloric dose-response studies may contribute to a better understanding of the metabolic impact of food on the human organism. This study was registered at clinicaltrials.gov as NCT01446068. PMID:24812072

Ensembles of gustatory cortical neurons anticipate and discriminate between tastants in a single lick

Directory of Open Access Journals (Sweden)

Jennifer R Stapleton

2007-10-01

Full Text Available The gustatory cortex (GC processes chemosensory and somatosensory information and is involved in learning and anticipation. Previously we found that a subpopulation of GC neurons responded to tastants in a single lick (Stapleton et al., 2006. Here we extend this investigation to determine if small ensembles of GC neurons, obtained while rats received blocks of tastants on a fixed ratio schedule (FR5, can discriminate between tastants and their concentrations after a single 50 µL delivery. In the FR5 schedule subjects received tastants every fifth (reinforced lick and the intervening licks were unreinforced. The ensemble firing patterns were analyzed with a Bayesian generalized linear model whose parameters included the firing rates and temporal patterns of the spike trains. We found that when both the temporal and rate parameters were included, 12 of 13 ensembles correctly identified single tastant deliveries. We also found that the activity during the unreinforced licks contained signals regarding the identity of the upcoming tastant, which suggests that GC neurons contain anticipatory information about the next tastant delivery. To support this finding we performed experiments in which tastant delivery was randomized within each block and found that the neural activity following the unreinforced licks did not predict the upcoming tastant. Collectively, these results suggest that after a single lick ensembles of GC neurons can discriminate between tastants, that they may utilize both temporal and rate information, and when the tastant delivery is repetitive ensembles contain information about the identity of the upcoming tastant delivery.

Electroretinogram responses of the normal thoroughbred horse sedated with detomidine hydrochloride.

Science.gov (United States)

Church, Melanie L; Norman, Joanna C

2012-09-01

The main objective was to record electroretinogram (ERG) parameters of normal thoroughbred mares using the HMsERG, a mini-Ganzfeld electroretinographic unit, and a contact lens electrode. The second objective was to determine whether IV detomidine hydrochloride at 0.015 mg/kg is consistently an effective choice for sedation of horses undergoing this ERG protocol. The study population consisted of 30 normal thoroughbred mares. ERG data were harvested using a protocol that included three different light intensities (10, 3000, and 10,000 mcd s/m(2)) and a 30-Hz flicker at 3000 mcd s/m(2). Mean, median, standard deviation, and estimated normal ranges using the 5-95% of the data for a- and b-wave implicit times (IT), amplitudes (AMP), and b/a ratios were reported. Scotopic results at low intensity (10 mcd s/m(2)) had estimated ranges for b-wave IT of 41.8-72.9 ms and AMP of 19.8-173.3 μV. Middle intensity (3000 mcd s/m(2)) a-wave IT was 13.2-14.7 ms with a-wave AMP of 68.4-144 μV; the b-wave IT was 28.7-41.5 ms with b-wave AMP of 105.7-271.5 μV; and the b/a ratio was 0.95-2.71. The high-intensity (10,000 mcd s/m(2)) average recordings showed an a-wave IT of 13-14.9 ms, a-wave AMP of 85.7-186.8 μV; b-wave IT of 26.6-45.4 ms, b-wave AMP of 104.7-250.6 μV; and a b/a wave ratio of 0.7-2.0. The 30-Hz cone flicker showed an IT of 22.8-28.9 ms and AMP of 44.1-117.1 μV. Results of normal thoroughbred ERG responses are reported. The protocol proved to be simple and safe and provided consistent results. © 2012 American College of Veterinary Ophthalmologists.

Comparison of incidences of normal tissue complications with tumor response in a phase III trial comparing heat plus radiation to radiation alone

International Nuclear Information System (INIS)

Dewhirst, M.W.; Sim, D.A.; Grochowski, K.J.

1984-01-01

The success of hyperthermia (/sup Δ/) as an adjuvant to radiation (XRT) will depend on whether the increase in tumor control is greater than that for normal tissue reactions. One hundred and thirty dogs and cats were stratified by histology and randomized to receive XRT (460 rads per fraction, two fractions per week, for eight fractions) or /sup Δ/ + XRT (30 min. at 44 +-2 0 C; one fraction per week, four fractions; immediately prior to XRT). Heat induced changes in tumor and normal tissue responses were made by comparing ratios of incidence for /sup Δ/ + XRT and XRT alone (TRR; Thermal Relative Risk). Change in tumor response duration was calculated from statistical analysis of response duration curves (RRR; Relative Relapse Rate). Heat increased early normal tissue reactions (moist desquamation and mucositis by a factor of 1.08. Tumor complete response, by comparison, was significantly improved (TRR = 2.12, p < .001). Late skin fibrosis was also increased (TRR = 1.51), but the prolongation in tumor response was greater (RRR 1.85). The degree of thermal enhancement for all tissues was dependent on the minimum temperature achieved on the first treatment, but the values for tumor were consistently greater than those achieved for normal tissues

Postprandial glucose response to selected tropical fruits in normal glucose-tolerant Nigerians.

Science.gov (United States)

Edo, A; Eregie, A; Adediran, O; Ohwovoriole, A; Ebengho, S

2011-01-01

The glycemic response to commonly eaten fruits in Nigeria has not been reported. Therefore, this study assessed the plasma glucose response to selected fruits in Nigeria. Ten normal glucose-tolerant subjects randomly consumed 50 g carbohydrate portions of three fruits: banana (Musa paradisiaca), pineapple (Ananus comosus), and pawpaw (Carica papaya), and a 50-g glucose load at 1-week intervals. Blood samples were collected in the fasting state and half-hourly over a 2-h period post-ingestion of the fruits or glucose. The samples were analyzed for plasma glucose concentrations. Plasma glucose responses were assessed by the peak plasma glucose concentration, maximum increase in plasma glucose, 2-h postprandial plasma glucose level, and incremental area under the glucose curve and glycemic index (GI). The results showed that the blood glucose response to these three fruits was similar in terms of their incremental areas under the glucose curve, maximum increase in plasma glucose, and glycemic indices (GIs). The 2-h postprandial plasma glucose level of banana was significantly higher than that of pineapple, P < 0.025. The mean ± SEM GI values were as follows: pawpaw; 86 ± 26.8%; banana, 75.1 ± 21.8%; pineapple, 64.5 ± 11.3%. The GI of glucose is taken as 100. The GI of pineapple was significantly lower than that of glucose (P < 0.05). Banana, pawpaw, and pineapple produced a similar postprandial glucose response. Measured portions of these fruits may be used as fruit exchanges with pineapple having the most favorable glycemic response.

A radioactive waste transportation package monitoring system for normal transport and accident emergency response conditions

International Nuclear Information System (INIS)

Brown, G.S.; Cashwell, J.W.; Apple, M.L.

1993-01-01

This paper addresses spent fuel and high level waste transportation history and prospects, discusses accident histories of radioactive material transport, discusses emergency responder needs and provides a general description of the Transportation Intelligent Monitoring System (TRANSIMS) design. The key objectives of the monitoring system are twofold: (1) to facilitate effective emergency response to accidents involving a radioactive waste transportation package, while minimizing risk to the public and emergency first-response personnel, and (2) to allow remote monitoring of transportation vehicle and payload conditions to enable research into radioactive material transportation for normal and accident conditions. (J.P.N.)

The effect of palm oil, lard, and puff-pastry margarine on postprandial lipid and hormone responses in normal-weight and obese young women.

Science.gov (United States)

Jensen, J; Bysted, A; Dawids, S; Hermansen, K; Hølmer, G

1999-12-01

Only a few studies have been published on the postprandial effects of different fatty acids in obese subjects. Therefore, the present study investigated the effects of three test meals containing palm oil (PO), lard (LD), or puff-pastry margarine (PPM), all normal dietary ingredients, on postprandial lipid and hormone responses in normal-weight and obese young women. The study was performed as a randomized, crossover design. The fats differed in the content of palmitic acid, stearic acid, and trans monounsaturated fatty acids allowing a dietary comparison of different 'solid' fatty acids. The obese women had significantly higher fasting concentrations and postprandial responses of plasma total triacylglycerol (TAG), chylomicron-TAG, and insulin compared with the normal-weight women but there was no significant difference in the postprandial responses between the three test meals. The obese women had fasting concentrations of leptin four times greater than the normal-weight women. There were no postprandial changes in the concentrations of leptin. The fasting concentrations of HDL-cholesterol were significantly lower in the obese women than in the normal-weight women, whereas there was no significant difference between the two groups in the concentrations of total cholesterol or LDL-cholesterol. These results provide evidence that obese women have exaggerated lipid and hormone responses compared with normal-weight women but the different contents of saturated and trans monounsaturated fatty acids provided by PO, LD, and PPM have no effect in either group.

Drosophila pheromone-sensing neurons expressing the ppk25 ion channel subunit stimulate male courtship and female receptivity.

Science.gov (United States)

Vijayan, Vinoy; Thistle, Rob; Liu, Tong; Starostina, Elena; Pikielny, Claudio W

2014-03-01

As in many species, gustatory pheromones regulate the mating behavior of Drosophila. Recently, several ppk genes, encoding ion channel subunits of the DEG/ENaC family, have been implicated in this process, leading to the identification of gustatory neurons that detect specific pheromones. In a subset of taste hairs on the legs of Drosophila, there are two ppk23-expressing, pheromone-sensing neurons with complementary response profiles; one neuron detects female pheromones that stimulate male courtship, the other detects male pheromones that inhibit male-male courtship. In contrast to ppk23, ppk25, is only expressed in a single gustatory neuron per taste hair, and males with impaired ppk25 function court females at reduced rates but do not display abnormal courtship of other males. These findings raised the possibility that ppk25 expression defines a subset of pheromone-sensing neurons. Here we show that ppk25 is expressed and functions in neurons that detect female-specific pheromones and mediates their stimulatory effect on male courtship. Furthermore, the role of ppk25 and ppk25-expressing neurons is not restricted to responses to female-specific pheromones. ppk25 is also required in the same subset of neurons for stimulation of male courtship by young males, males of the Tai2 strain, and by synthetic 7-pentacosene (7-P), a hydrocarbon normally found at low levels in both males and females. Finally, we unexpectedly find that, in females, ppk25 and ppk25-expressing cells regulate receptivity to mating. In the absence of the third antennal segment, which has both olfactory and auditory functions, mutations in ppk25 or silencing of ppk25-expressing neurons block female receptivity to males. Together these results indicate that ppk25 identifies a functionally specialized subset of pheromone-sensing neurons. While ppk25 neurons are required for the responses to multiple pheromones, in both males and females these neurons are specifically involved in stimulating

Radiogenic responses of normal cells induced by fractionated irradiation -a simulation study. Pt. 2. Late responses

International Nuclear Information System (INIS)

Duechting, W.; Ulmer, W.; Ginsberg, T.; Kikhounga-N'Got, O.; Saile, C.

1995-01-01

Based on controlled theory, a computed simulation model has been constructed which describes the time course of slowly responding normal cells after irradiation exposure. Subsequently, different clinical irradiation schemes are compared in regard to their delayed radiogenic responses referred to as late effects in radiological terminology. A cybernetic model of a paraenchymal tissue consisting of dominantly resting functional cells has been developed and transferred into a computer model. The radiation effects are considered by characteristic cell parameters as well as by the linear-quadratic model. Three kinds of tissue (brain and lung parenchym of the mouse, liver parenchym of rat) have been irradiated in the model according to standard-, super-, hyperfractionation and a single high dose per week. The simulation studies indicate that the late reaction of brain parenchym to hyperfractionation (3 x 1.5 Gy per day) and of lung parenchym tissue with regard to all fractionation schemes applied is particularly severe. The behavior of liver parenchym is not unique. A comparison of the simulation results basing to the survival of cell numbers with clinical experience and practice shows that the clinical reality can qualitatively be represented by the model. This opens the door for connecting side effects to normal tissue with the corresponding tumor efficacy (discussed in previous papers). The model is open to further refinement and to discussions referring to the phenomenon of late effects. (orig.) [de

Absence of diurnal variation in visceromotor response to colorectal distention in normal Long Evans rats [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Sara Botschuijver

2016-01-01

Full Text Available Background: Enhanced colorectal sensitivity (i.e. visceral hypersensitivity is thought to be a pathophysiological mechanism in irritable bowel syndrome (IBS. In healthy men a circadian variation in rectal perception to colonic distention was described. Disturbed day and night rhythms, which occur in shift work and trans meridian flights, are associated with the prevalence of IBS. This raises the question whether disruptions of circadian control are responsible for the observed pathology in IBS. Prior to investigating altered rhythmicity in relation to visceral hypersensitivity in a rat model for IBS, it is relevant to establish whether normal rats display circadian variation similar to healthy men.  Methodology and findings: In rodents colorectal distension leads to reproducible contractions of abdominal musculature. We used quantification of this so called visceromotor response (VMR by electromyography (EMG to assess visceral sensitivity in rats. We assessed the VMR in normal male Long Evans rats at different time points of the light/dark cycle. Although a control experiment with male maternal separated rats confirmed that intentionally inflicted (i.e. stress induced changes in VMR can be detected, normal male Long Evans rats showed no variation in VMR along the light/dark cycle in response to colorectal distension. Conclusions: In the absence of a daily rhythm of colorectal sensitivity in normal control rats it is not possible to investigate possible aberrancies in our rat model for IBS.

Using Animal Models to Determine the Role of Gustatory Neural Input in the Control of Ingestive Behavior and the Maintenance of Body Weight.

Science.gov (United States)

Ciullo, Dana L; Dotson, Cedrick D

2015-08-01

Decades of research have suggested that nutritional intake contributes to the development of human disease, mainly by influencing the development of obesity and obesity-related conditions. A relatively large body of research indicates that functional variation in human taste perception can influence nutritional intake as well as body mass accumulation. However, there are a considerable number of studies that suggest that no link between these variables actually exists. These discrepancies in the literature likely result from the confounding influence of a variety of other, uncontrolled, factors that can influence ingestive behavior. In this review, the use of controlled animal experimentation to alleviate at least some of these issues related to the lack of control of experimental variables is discussed. Specific examples of the use of some of these techniques are examined. The review will close with some specific suggestions aimed at strengthening the link between gustatory neural input and its putative influence on ingestive behaviors and the maintenance of body weight.

Proteinase-activated receptors - mediators of early and delayed normal tissue radiation responses

International Nuclear Information System (INIS)

Hauer-Jensen, M.

2003-01-01

Proteinase-activated receptors (PARs) are G-protein coupled receptors that are activated by proteolytic exposure of a receptor-tethered ligand. The discovery of this receptor family represents one of the most intriguing recent developments in signal transduction. PARs are involved in the regulation of many normal and pathophysiological processes, notably inflammatory and fibroproliferative responses to injury. Preclinical studies performed in our laboratory suggest that proteinase-activated receptor-1 (PAR-1) plays a critical role in the mechanism of chronicity of radiation fibrosis, while proteinase-activated receptor-2 (PAR-2) may mediate important fibroproliferative responses in irradiated intestine. Specifically, activation of PAR-1 by thrombin, and PAR-2 by pancreatic trypsin and mast cell proteinases, appears to be involved in acute radiation-induced inflammation, as well as in subsequent extracellular matrix deposition, leading to the development of intestinal wall fibrosis and clinical complications. Pharmacological modulators of PAR-1 or PAR-2 expression or activation would be potentially useful as preventive or therapeutic agents in patients who receive radiation therapy, especially if blockade could be targeted to specific tissues or cellular compartments

Estimation of low-dose radiation-responsive proteins in the absence of genomic instability in normal human fibroblast cells.

Science.gov (United States)

Yim, Ji-Hye; Yun, Jung Mi; Kim, Ji Young; Nam, Seon Young; Kim, Cha Soon

2017-11-01

Low-dose radiation has various biological effects such as adaptive responses, low-dose hypersensitivity, as well as beneficial effects. However, little is known about the particular proteins involved in these effects. Here, we sought to identify low-dose radiation-responsive phosphoproteins in normal fibroblast cells. We assessed genomic instability and proliferation of fibroblast cells after γ-irradiation by γ-H2AX foci and micronucleus formation analyses and BrdU incorporation assay, respectively. We screened fibroblast cells 8 h after low-dose (0.05 Gy) γ-irradiation using Phospho Explorer Antibody Microarray and validated two differentially expressed phosphoproteins using Western blotting. Cell proliferation proceeded normally in the absence of genomic instability after low-dose γ-irradiation. Phospho antibody microarray analysis and Western blotting revealed increased expression of two phosphoproteins, phospho-NFκB (Ser536) and phospho-P70S6K (Ser418), 8 h after low-dose radiation. Our findings suggest that low-dose radiation of normal fibroblast cells activates the expression of phospho-NFκB (Ser536) and phospho-P70S6K (Ser418) in the absence of genomic instability. Therefore, these proteins may be involved in DNA damage repair processes.

Comparisons of amino acids, body constituents and antioxidative response between long-time HD and normal HD.

Science.gov (United States)

Torigoe, Akira; Sato, Emiko; Mori, Takefumi; Ieiri, Norio; Takahashi, Chika; Ishida, Yoko; Hotta, Osamu; Ito, Sadayoshi

2016-10-01

Introduction Oxidative stress is one of the main mediators of progression of chronic kidney diseases (CKD). Nuclear factor E2-related factor 2 (Nrf2) is the transcription factor of antioxidant and detoxifying enzymes and related proteins which play an important role in cellular defense. Long-time hemodialysis (HD) therapy (8 hours) has been considered to be more beneficial compared to normal HD therapy (4 hours). We investigated oxidative response related to Nrf2 in peripheral blood mononuclear cells (PBMCs) of long-time HD and normal HD patients. Methods Eight adult long-time HD therapy patients (44.5 ± 3.0 years) and 10 normal HD therapy patients (68.1 ± 2.7 years) were enrolled. PBMCs were isolated and processed for expression of Nrf2 and its related genes by qRT-PCR. Plasma indoxyl sulfate, amino acids, and body constituents were measured. Findings Plasma indoxyl sulfate was significantly low after long-time HD therapy compare to that of normal HD therapy. Although, skeletal muscle mass, lean body mass, mineral and protein were significantly decreased 2 months in normal HD patients, those in long-time HD patients were significantly increased after 2 months. Almost of amino acids were significantly decreased after HD therapy in both HD therapies. Plasma amino acids were significantly low in long-time HD patients compared to normal HD patients. In PBMCs, the expression of Nrf2 was significantly decreased and hemooxygenase-1 expression was significantly increased in long-time HD compared to normal HD. Conclusion These observations indicate the beneficial effects of in long-time HD in improving oxidative stress in patients. © 2016 International Society for Hemodialysis.

Influence of ventilation and hypocapnia on sympathetic nerve responses to hypoxia in normal humans.

Science.gov (United States)

Somers, V K; Mark, A L; Zavala, D C; Abboud, F M

1989-11-01

The sympathetic response to hypoxia depends on the interaction between chemoreceptor stimulation (CRS) and the associated hyperventilation. We studied this interaction by measuring sympathetic nerve activity (SNA) to muscle in 13 normal subjects, while breathing room air, 14% O2, 10% O2, and 10% O2 with added CO2 to maintain isocapnia. Minute ventilation (VE) and blood pressure (BP) increased significantly more during isocapnic hypoxia (IHO) than hypocapnic hypoxia (HHO). In contrast, SNA increased more during HHO [40 +/- 10% (SE)] than during IHO (25 +/- 19%, P less than 0.05). To determine the reason for the lesser increase in SNA with IHO, 11 subjects underwent voluntary apnea during HHO and IHO. Apnea potentiated the SNA responses to IHO more than to HHO. SNA responses to IHO were 17 +/- 7% during breathing and 173 +/- 47% during apnea whereas SNA responses to HHO were 35 +/- 8% during breathing and 126 +/- 28% during apnea. During ventilation, the sympathoexcitation of IHO (compared with HHO) is suppressed, possibly for two reasons: 1) because of the inhibitory influence of activation of pulmonary afferents as a result of a greater increase in VE, and 2) because of the inhibitory influence of baroreceptor activation due to a greater rise in BP. Thus in humans, the ventilatory response to chemoreceptor stimulation predominates and restrains the sympathetic response. The SNA response to chemoreceptor stimulation represents the net effect of the excitatory influence of the chemoreflex and the inhibitory influence of pulmonary afferents and baroreceptor afferents.

Relating normalization to neuronal populations across cortical areas.

Science.gov (United States)

Ruff, Douglas A; Alberts, Joshua J; Cohen, Marlene R

2016-09-01

Normalization, which divisively scales neuronal responses to multiple stimuli, is thought to underlie many sensory, motor, and cognitive processes. In every study where it has been investigated, neurons measured in the same brain area under identical conditions exhibit a range of normalization, ranging from suppression by nonpreferred stimuli (strong normalization) to additive responses to combinations of stimuli (no normalization). Normalization has been hypothesized to arise from interactions between neuronal populations, either in the same or different brain areas, but current models of normalization are not mechanistic and focus on trial-averaged responses. To gain insight into the mechanisms underlying normalization, we examined interactions between neurons that exhibit different degrees of normalization. We recorded from multiple neurons in three cortical areas while rhesus monkeys viewed superimposed drifting gratings. We found that neurons showing strong normalization shared less trial-to-trial variability with other neurons in the same cortical area and more variability with neurons in other cortical areas than did units with weak normalization. Furthermore, the cortical organization of normalization was not random: neurons recorded on nearby electrodes tended to exhibit similar amounts of normalization. Together, our results suggest that normalization reflects a neuron's role in its local network and that modulatory factors like normalization share the topographic organization typical of sensory tuning properties. Copyright © 2016 the American Physiological Society.

DESCRIPTION OF BRAINSTEM AUDITORY EVOKED RESPONSES (AIR AND BONE CONDUCTION IN CHILDREN WITH NORMAL HEARING

Directory of Open Access Journals (Sweden)

A. V. Pashkov

2014-01-01

Full Text Available Diagnosis of hearing level in small children with conductive hearing loss associated with congenital craniofacial abnormalities, particularly with agenesis of external ear and external auditory meatus is a pressing issue. Conventional methods of assessing hearing in the first years of life, i. e. registration of brainstem auditory evoked responses to acoustic stimuli in the event of air conduction, does not give an indication of the auditory analyzer’s condition due to potential conductive hearing loss in these patients. This study was aimed at assessing potential of diagnosing the auditory analyzer’s function with registering brainstem auditory evoked responses (BAERs to acoustic stimuli transmitted by means of a bone vibrator. The study involved 17 children aged 3–10 years with normal hearing. We compared parameters of registering brainstem auditory evoked responses (peak V depending on the type of stimulus transmission (air/bone in children with normal hearing. The data on thresholds of the BAERs registered to acoustic stimuli in the event of air and bone conduction obtained in this study are comparable; hearing thresholds in the event of acoustic stimulation by means of a bone vibrator correlates with the results of the BAERs registered to the stimuli transmitted by means of air conduction earphones (r = 0.9. High correlation of thresholds of BAERs to the stimuli transmitted by means of a bone vibrator with thresholds of BAERs registered when air conduction earphones were used helps to assess auditory analyzer’s condition in patients with any form of conductive hearing loss.  

A dynamic elastic-visco-plastic unilateral contact problem with normal damped response and Coulomb friction

Czech Academy of Sciences Publication Activity Database

Eck, Ch.; Jarušek, Jiří; Sofonea, M.

2010-01-01

Roč. 21, č. 3 (2010), s. 229-251 ISSN 0956-7925 R&D Projects: GA AV ČR IAA100750802 Institutional research plan: CEZ:AV0Z10190503 Keywords : elastic-vosco plastic material * dynamic contact problem * normal damped response * unilateral constraint * Coulomb friction * weak solution * penalitazion * smoothing Subject RIV: BA - General Mathematics Impact factor: 1.480, year: 2010 http://journals.cambridge.org/action/displayAbstract?fromPage=online&aid=7675484&fileId=S0956792510000045

Visual-gustatory interaction: orbitofrontal and insular cortices mediate the effect of high-calorie visual food cues on taste pleasantness.

Science.gov (United States)

Ohla, Kathrin; Toepel, Ulrike; le Coutre, Johannes; Hudry, Julie

2012-01-01

Vision provides a primary sensory input for food perception. It raises expectations on taste and nutritional value and drives acceptance or rejection. So far, the impact of visual food cues varying in energy content on subsequent taste integration remains unexplored. Using electrical neuroimaging, we assessed whether high- and low-calorie food cues differentially influence the brain processing and perception of a subsequent neutral electric taste. When viewing high-calorie food images, participants reported the subsequent taste to be more pleasant than when low-calorie food images preceded the identical taste. Moreover, the taste-evoked neural activity was stronger in the bilateral insula and the adjacent frontal operculum (FOP) within 100 ms after taste onset when preceded by high- versus low-calorie cues. A similar pattern evolved in the anterior cingulate (ACC) and medial orbitofrontal cortex (OFC) around 180 ms, as well as, in the right insula, around 360 ms. The activation differences in the OFC correlated positively with changes in taste pleasantness, a finding that is an accord with the role of the OFC in the hedonic evaluation of taste. Later activation differences in the right insula likely indicate revaluation of interoceptive taste awareness. Our findings reveal previously unknown mechanisms of cross-modal, visual-gustatory, sensory interactions underlying food evaluation.

Gustatory Behaviour in Caenorhabditis elegans

NARCIS (Netherlands)

R.K. Hukema (Renate)

2006-01-01

textabstractThe nematode C. elegans is an ideal model-organism to study the genetics of behaviour (Brenner, 1974). It is capable of sensing salts and we discriminate three different responses: it is attracted to low salt concentrations (Ward, 1973; Dusenbery et al., 1974), it avoids high salt

Members of Bitter Taste Receptor Cluster Tas2r143/Tas2r135/Tas2r126 Are Expressed in the Epithelium of Murine Airways and Other Non-gustatory Tissues

Directory of Open Access Journals (Sweden)

Shuya Liu

2017-10-01

Full Text Available The mouse bitter taste receptors Tas2r143, Tas2r135, and Tas2r126 are encoded by genes that cluster on chromosome 6 and have been suggested to be expressed under common regulatory elements. Previous studies indicated that the Tas2r143/Tas2r135/Tas2r126 cluster is expressed in the heart, but other organs had not been systematically analyzed. In order to investigate the expression of this bitter taste receptor gene cluster in non-gustatory tissues, we generated a BAC (bacterial artificial chromosome based transgenic mouse line, expressing CreERT2 under the control of the Tas2r143 promoter. After crossing this line with a mouse line expressing EGFP after Cre-mediated recombination, we were able to validate the Tas2r143-CreERT2 transgenic mouse line and monitor the expression of Tas2r143. EGFP-positive cells, indicating expression of members of the cluster, were found in about 47% of taste buds, and could also be found in several other organs. A population of EGFP-positive cells was identified in thymic epithelial cells, in the lamina propria of the intestine and in vascular smooth muscle cells of cardiac blood vessels. EGFP-positive cells were also identified in the epithelium of organs readily exposed to pathogens including lower airways, the gastrointestinal tract, urethra, vagina, and cervix. With respect to the function of cells expressing this bitter taste receptor cluster, RNA-seq analysis in EGFP-positive cells isolated from the epithelium of trachea and stomach showed expression of genes related to innate immunity. These data further support the concept that bitter taste receptors serve functions outside the gustatory system.

Plasma Catecholamines, Sweat Electrolytes and Physiological Responses of Exercised Normal, Partial Anhidrotic and Anhidrotic Horses

OpenAIRE

A. Bashir; A. Rasedee

2009-01-01

Problem statement: Malaysia imports horses from temperate countries to develop equine sports in the country. Several of these horses developed partial and complete anhidrosis. Approach: Normal, partial anhidrotic and anhidrotic horses were exercised to determine their sweating and physiological responses to exercise. The heart and respiratory rates, rectal temperature and blood samples were obtained before the horses were lunged at 10 km h-­1 for 1 h and at again at 15, 30, 45, 60 min and 24 ...

A Drosophila protein family implicated in pheromone perception is related to Tay-Sachs GM2-activator protein.

Science.gov (United States)

Starostina, Elena; Xu, Aiguo; Lin, Heping; Pikielny, Claudio W

2009-01-02

Low volatility, lipid-like cuticular hydrocarbon pheromones produced by Drosophila melanogaster females play an essential role in triggering and modulating mating behavior, but the chemosensory mechanisms involved remain poorly understood. Recently, we showed that the CheB42a protein, which is expressed in only 10 pheromone-sensing taste hairs on the front legs of males, modulates progression to late stages of male courtship behavior in response to female-specific cuticular hydrocarbons. Here we report that expression of all 12 genes in the CheB gene family is predominantly or exclusively gustatory-specific, and occurs in many different, often non-overlapping patterns. Only the Gr family of gustatory receptor genes displays a comparable variety of gustatory-specific expression patterns. Unlike Grs, however, expression of all but one CheB gene is sexually dimorphic. Like CheB42a, other CheBs may therefore function specifically in gustatory perception of pheromones. We also show that CheBs belong to the ML superfamily of lipid-binding proteins, and are most similar to human GM2-activator protein (GM2-AP). In particular, GM2-AP residues involved in ligand binding are conserved in CheBs but not in other ML proteins. Finally, CheB42a is specifically secreted into the inner lumen of pheromone-sensing taste hairs, where pheromones interact with membrane-bound receptors. We propose that CheB proteins interact directly with lipid-like Drosophila pheromones and modulate their detection by the gustatory signal transduction machinery. Furthermore, as loss of GM2-AP in Tay-Sachs disease prevents degradation of GM2 gangliosides and results in neurodegeneration, the function of CheBs in pheromone response may involve biochemical mechanisms critical for lipid metabolism in human neurons.

A Drosophila Protein Family Implicated in Pheromone Perception Is Related to Tay-Sachs GM2-Activator Protein*

Science.gov (United States)

Starostina, Elena; Xu, Aiguo; Lin, Heping; Pikielny, Claudio W.

2009-01-01

Low volatility, lipid-like cuticular hydrocarbon pheromones produced by Drosophila melanogaster females play an essential role in triggering and modulating mating behavior, but the chemosensory mechanisms involved remain poorly understood. Recently, we showed that the CheB42a protein, which is expressed in only 10 pheromone-sensing taste hairs on the front legs of males, modulates progression to late stages of male courtship behavior in response to female-specific cuticular hydrocarbons. Here we report that expression of all 12 genes in the CheB gene family is predominantly or exclusively gustatory-specific, and occurs in many different, often non-overlapping patterns. Only the Gr family of gustatory receptor genes displays a comparable variety of gustatory-specific expression patterns. Unlike Grs, however, expression of all but one CheB gene is sexually dimorphic. Like CheB42a, other CheBs may therefore function specifically in gustatory perception of pheromones. We also show that CheBs belong to the ML superfamily of lipid-binding proteins, and are most similar to human GM2-activator protein (GM2-AP). In particular, GM2-AP residues involved in ligand binding are conserved in CheBs but not in other ML proteins. Finally, CheB42a is specifically secreted into the inner lumen of pheromone-sensing taste hairs, where pheromones interact with membrane-bound receptors. We propose that CheB proteins interact directly with lipid-like Drosophila pheromones and modulate their detection by the gustatory signal transduction machinery. Furthermore, as loss of GM2-AP in Tay-Sachs disease prevents degradation of GM2 gangliosides and results in neurodegeneration, the function of CheBs in pheromone response may involve biochemical mechanisms critical for lipid metabolism in human neurons. PMID:18952610

Thresholds of Tone Burst Auditory Brainstem Responses for Infants and Young Children with Normal Hearing in Taiwan

Directory of Open Access Journals (Sweden)

Chung-Yi Lee

2007-10-01

Conclusion: Based on the published research and our study, we suggest setting the normal criterion levels for infants and young children in Taiwan of the tone burst auditory brainstem response to air-conducted tones as 30 dB nHL for 500 and 1000 Hz, and 25 dB nHL for 2000 and 4000 Hz.

Peek-a-What? Infants' Response to the Still-Face Task after Normal and Interrupted Peek-a-Boo

Science.gov (United States)

Bigelow, Ann E.; Best, Caitlin

2013-01-01

Infants' sensitivity to the vitality or tension envelope within dyadic social exchanges was investigated by examining their responses following normal and interrupted games of peek-a-boo embedded in a Still-Face Task. Infants 5-6 months old engaged in two modified Still-Face Tasks with their mothers. In one task, the initial interaction ended with…

Biochemical response of normal albino rats to the addition of ...

African Journals Online (AJOL)

Experiments were conducted to determine the biochemical effect of Hibiscus cannabinus and Murraya koenigii extracts on normal albino rats using standard methods. Analyses carried out indicated that the aqueous leaf extract of H. cannabinus and M. koenigii exhibited significant hypolipideamic activity in normal rats.

Artichoke compound cynarin differentially affects the survival, growth and stress response of normal, immortalized and cancerous human cells

DEFF Research Database (Denmark)

Gezer, Ceren; Yücecan, Sevinç; Rattan, Suresh Inder Singh

2015-01-01

of CYN on the proliferative potential, survival, morphology, and stress response (SR) markers haemoxygenase-1 (HO-1) and heat shock protein-70 (HSP70) in normal human skin fibroblasts (FSF-1), telomerase-immortalized mesenchymal stem cells (hTERT-MSC) and cervical cancer cells, HeLa. Effects of CYN...

CT in normal pressure hydrocephalus. Correlation between CT and clinical response to shunting

Energy Technology Data Exchange (ETDEWEB)

Fujita, K.; Nogaki, H.; Noda, M.; Kusunoki, T.; Tamaki, N. (Kobe Univ. (Japan). School of Medicine)

1981-02-01

CT scans were obtained on 33 patients (age 73y. to 31y.) with the diagnosis of normal pressure hydrocephalus. In each case, the diagnosis was made on the basis of the symptoms, CT and cisternographic findings. Underlying diseases of normal pressure hydrocephalus are ruptured aneurysms (21 cases), arteriovenous malformations (2 cases), head trauma (1 case), cerebrovascular accidents (1 case) and idiopathie (8 cases). Sixteen of 33 patients showed marked improvement, five, moderate or minimal improvement, and twelve, no change. The results were compared with CT findings and clinical response to shunting. CT findings were classified into five types, bases on the degree of periventricular hypodensity (P.V.H.), the extent of brain damage by underlying diseases, and the degree of cortical atrophy. In 17 cases of type (I), CT shows the presence of P.V.H. with or without minimal frontal lobe damage and no cortical atrophy. The good surgical improvements were achieved in all cases of type (I) by shunting. In 4 cases of type (II), CT shows the presence of P.V.H. and severe brain damage without cortical atrophy. The fair clinical improvements were achieved in 2 cases (50%) by shunting. In one case of type (III), CT shows the absence of P.V.H. without brain damage nor cortical atrophy. No clinical improvement was obtained by shunting in this type. In 9 cases of type (IV) with mild cortical atrophy, the fair clinical improvement was achieved in two cases (22%) and no improvement in 7 cases. In 2 cases of type (V) with moderate or marked cortical atrophy, no clinical improvement was obtained by shunting. In conclusion, it appeared from the present study that there was a good correlation between the result of shunting and the type of CT, and clinical response to shunting operation might be predicted by classification of CT findings.

Autonomous parvoviruses neither stimulate nor are inhibited by the type I interferon response in human normal or cancer cells.

Science.gov (United States)

Paglino, Justin C; Andres, Wells; van den Pol, Anthony N

2014-05-01

Members of the genus Parvovirus are small, nonenveloped single-stranded DNA viruses that are nonpathogenic in humans but have potential utility as cancer therapeutics. Because the innate immune response to parvoviruses has received relatively little attention, we compared the response to parvoviruses to that of several other types of viruses in human cells. In normal human glia, fibroblasts, or melanocytes, vesicular stomatitis virus evoked robust beta interferon (IFN-β) responses. Cytomegalovirus, pseudorabies virus, and Sindbis virus all evoked a 2-log-unit or greater upregulation of IFN-β in glia; in contrast, LuIII and MVMp parvoviruses did not evoke a detectable IFN-β or interferon-stimulated gene (ISG; MX1, oligoadenylate synthetase [OAS], IFIT-1) response in the same cell types. The lack of response raised the question of whether parvoviral infection can be attenuated by IFN; interestingly, we found that IFN did not decrease parvovirus (MVMp, LuIII, and H-1) infectivity in normal human glia, fibroblasts, or melanocytes. The same was true in human cancers, including glioma, sarcoma, and melanoma. Similarly, IFN failed to attenuate transduction by the dependovirus vector adeno-associated virus type 2. Progeny production of parvoviruses was also unimpaired by IFN in both glioma and melanoma, whereas vesicular stomatitis virus replication was blocked. Sarcoma cells with upregulated IFN signaling that show high levels of resistance to other viruses showed strong infection by LuIII. Unlike many other oncolytic viruses, we found no evidence that impairment of innate immunity in cancer cells plays a role in the oncoselectivity of parvoviruses in human cells. Parvoviral resistance to the effects of IFN in cancer cells may constitute an advantage in the virotherapy of some tumors. Understanding the interactions between oncolytic viruses and the innate immune system will facilitate employing these viruses as therapeutic agents in cancer patients. The cancer

Differences in response to conventional vitamin D therapy among obese and normal weight children and adolescents in Qazvin, Iran

Directory of Open Access Journals (Sweden)

Fatemeh Saffari

2017-09-01

Full Text Available Background: Vitamin D (Vit D deficiency is one of the major nutritional deficiencies in children. Obesity has inverse association with vitamin D levels. The aim of this study was to determine the differences in response to conventional treatment for Vit D deficiency and insufficiency in obese and normal weight children and adolescents.Methods: This nested case control study was conducted in 69 obese children and 133 normal weight matched control suffering from Vit D insufficiency or deficiency. Vit D deficiency was defined as serum 25(OH D

Comparison on taste threshold between adult male white cigarette and clove cigarette smokers using Murphy clinical test method

OpenAIRE

Ronald Reyses Tapilatu; Edeh Rolleta Haroen; Rosiliwati Wihardja

2008-01-01

The habit of smoking white cigarettes and clove cigarettes may affect the gustatory function, that is, it will cause damage to taste buds, resulting in an increase in gustatory threshold. This research used the descriptive comparative method and had the purpose of obtaining an illustration of gustatory threshold and compare gustatory threshold in white cigarette smokers and clove cigarette smokers in young, male adults. For gustatory threshold evaluation, the Murphy method was used to obtain ...

Near-infrared spectroscopy can detect differences in vascular responsiveness to a hyperglycaemic challenge in individuals with obesity compared to normal-weight individuals.

Science.gov (United States)

Soares, Rogério Nogueira; Reimer, Raylene A; Alenezi, Zaid; Doyle-Baker, Patricia K; Murias, Juan Manuel

2018-01-01

To examine whether the near-infrared spectroscopy combined with vascular occlusion test technique could detect differences in vascular responsiveness during hyperglycaemia between normal-weight individuals and individuals with obesity. A total of 16 normal-weight individuals (body mass index, 21.3 ± 1.7 kg/m 2 ) and 13 individuals with obesity (body mass index, 34.4 ± 2.0 kg/m 2 ) were submitted to five vascular occlusion tests (Pre, 30, 60, 90 and 120 min after glucose challenge). Vascular responsiveness was determined by the Slope 2 (Slope 2 StO 2 ) and the area under the curve (StO 2AUC ) of oxygen saturation derived from near-infrared spectroscopy-vascular occlusion test. The Slope 2 StO 2 increased from 1.07 ± 0.16%/s (Pre) to 1.53 ± 0.21%/s at 90 min ( p obese it increased from 0.71 ± 0.09%/s (Pre) to 0.92 ± 0.14%/s at 60 min ( p obesity. Near-infrared spectroscopy-vascular occlusion test technique was capable of detecting differences in vascular responsiveness during hyperglycaemia between normal-weight individuals and individuals with obesity.

Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

International Nuclear Information System (INIS)

Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

1995-01-01

Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

Why a disaster is not just normal business ramped up: Disaster response among ED nurses.

Science.gov (United States)

Hammad, Karen S; Arbon, Paul; Gebbie, Kristine; Hutton, Alison

2017-11-15

The emergency department (ED) is a familiar place for the emergency nurse who spends their working days inside it. A disaster threatens that familiarity and creates changes that make working in the ED during a disaster response different from the everyday experience of working in the ED. This research reports on an aspect of the findings from a larger study about the experience of working as a nurse in the ED during a disaster response. Thirteen nurses from 8 different countries were interviewed about their experience. The findings from this research demonstrate that a disaster event leads to a chain reaction of changes in process, space and practice. Nurses' respond to the news of a disaster event with shock and disbelief. The ED may change as a result of the event requiring nurses to work in an altered environment or a completely different setting. These changes provoke nurses to alter their behaviour and practice and reflect on the experience after the response. Emergency nurses have a high likelihood of participating in disaster response and as such should be adequately prepared. This highlights how disaster response is different and leads to recommendations to enhance training for emergency nurses which will better prepare them Disasterresponse is not normal business ramped up. There are a number of challenges and changes that should be considered when preparing emergency nurses for the realities of disaster response. Copyright © 2017 College of Emergency Nursing Australasia. All rights reserved.

Benazepril, an angiotensin converting enzyme inhibitor: drug interaction with salbutamol and bronchial response to histamine in normal subjects

Science.gov (United States)

Bauer, K. G.; Brunel, P.; Nell, G.; Quinn, G.; Kaik, G. A.

1997-01-01

Aims To investigate the effect of the angiotensin converting enzyme inhibitor, benazepril, on pulmonary function. Methods We investigated the influence of benazepril, on lung function and the interaction with inhaled salbutamol (0.1 to 6.6 mg) and histamine (0.03 to 30.69 g l−1 ) in normal subjects. Benazepril 20 mg, salbutamol 8 mg, propranolol 160 mg, and placebo were given orally once daily over 10 days. Results On day 8, there was no difference in the area under the salbutamol dose-response curves between benazepril, placebo and oral salbutamol (P >0.05), propranolol shifted the curves to the right (Pbenazepril 1.04 (0.99–1.08), salbutamol 1.19 (1.13–1.25), propranolol 0.57 (0.50–0.65). Conclusions Benazepril had no influence on baseline lung function, caused no interaction with inhaled salbutamol and the bronchial response to histamine was similar to placebo. However, our findings in normal subjects cannot be extrapolated automatically to asthmatics. PMID:9431834

SU-E-J-212: MR Diffusion Tensor Imaging for Assessment of Tumor and Normal Brain Tissue Responses of Juvenile Pilocytic Astrocytoma Treated by Proton Therapy

Energy Technology Data Exchange (ETDEWEB)

Hou, P; Park, P; Li, H; Zhu, X; Mahajan, A; Grosshans, D [M.D. Anderson Cancer Center, Houston, TX (United States)

2015-06-15

Purpose: Diffusion tensor imaging (DTI) can measure molecular mobility at the cellular level, quantified by the apparent diffusion coefficient (ADC). DTI may also reveal axonal fiber directional information in the white matter, quantified by the fractional anisotropy (FA). Juvenile pilocytic astrocytoma (JPA) is a rare brain tumor that occurs in children and young adults. Proton therapy (PT) is increasingly used in the treatment of pediatric brain tumors including JPA. However, the response of both tumors and normal tissues to PT is currently under investigation. We report tumor and normal brain tissue responses for a pediatric case of JPA treated with PT assessed using DTI. Methods: A ten year old male with JPA of the left thalamus received passive scattered PT to a dose of 50.4 Gy (RBE) in 28 fractions. Post PT, the patient has been followed up in seven years. At each follow up, MRI imaging including DTI was performed to assess response. MR images were registered to the treatment planning CT and the GTV mapped onto each MRI. The GTV contour was then mirrored to the right side of brain through the patient’s middle line to represent normal brain tissue. ADC and FA were measured within the ROIs. Results: Proton therapy can completely spare contra lateral brain while the target volume received full prescribed dose. From a series of MRI ADC images before and after PT at different follow ups, the enhancement corresponding to GTV had nearly disappeared more than 2 years after PT. Both ADC and FA demonstrate that contralateral normal brain tissue were not affect by PT and the tumor volume reverted to normal ADC and FA values. Conclusion: DTI allowed quantitative evaluation of tumor and normal brain tissue responses to PT. Further study in a larger cohort is warranted.

SU-E-J-212: MR Diffusion Tensor Imaging for Assessment of Tumor and Normal Brain Tissue Responses of Juvenile Pilocytic Astrocytoma Treated by Proton Therapy

International Nuclear Information System (INIS)

Hou, P; Park, P; Li, H; Zhu, X; Mahajan, A; Grosshans, D

2015-01-01

Purpose: Diffusion tensor imaging (DTI) can measure molecular mobility at the cellular level, quantified by the apparent diffusion coefficient (ADC). DTI may also reveal axonal fiber directional information in the white matter, quantified by the fractional anisotropy (FA). Juvenile pilocytic astrocytoma (JPA) is a rare brain tumor that occurs in children and young adults. Proton therapy (PT) is increasingly used in the treatment of pediatric brain tumors including JPA. However, the response of both tumors and normal tissues to PT is currently under investigation. We report tumor and normal brain tissue responses for a pediatric case of JPA treated with PT assessed using DTI. Methods: A ten year old male with JPA of the left thalamus received passive scattered PT to a dose of 50.4 Gy (RBE) in 28 fractions. Post PT, the patient has been followed up in seven years. At each follow up, MRI imaging including DTI was performed to assess response. MR images were registered to the treatment planning CT and the GTV mapped onto each MRI. The GTV contour was then mirrored to the right side of brain through the patient’s middle line to represent normal brain tissue. ADC and FA were measured within the ROIs. Results: Proton therapy can completely spare contra lateral brain while the target volume received full prescribed dose. From a series of MRI ADC images before and after PT at different follow ups, the enhancement corresponding to GTV had nearly disappeared more than 2 years after PT. Both ADC and FA demonstrate that contralateral normal brain tissue were not affect by PT and the tumor volume reverted to normal ADC and FA values. Conclusion: DTI allowed quantitative evaluation of tumor and normal brain tissue responses to PT. Further study in a larger cohort is warranted

Estrogen responsiveness of the TFIID subunit TAF4B in the normal mouse ovary and in ovarian tumors.

Science.gov (United States)

Wardell, Jennifer R; Hodgkinson, Kendra M; Binder, April K; Seymour, Kimberly A; Korach, Kenneth S; Vanderhyden, Barbara C; Freiman, Richard N

2013-11-01

Estrogen signaling in the ovary is a fundamental component of normal ovarian function, and evidence also indicates that excessive estrogen is a risk factor for ovarian cancer. We have previously demonstrated that the gonadally enriched TFIID subunit TAF4B, a paralog of the general transcription factor TAF4A, is required for fertility in mice and for the proliferation of ovarian granulosa cells following hormonal stimulation. However, the relationship between TAF4B and estrogen signaling in the normal ovary or during ovarian tumor initiation and progression has yet to be defined. Herein, we show that Taf4b mRNA and TAF4B protein, but not Taf4a mRNA or TAF4A protein, are increased in whole ovaries and granulosa cells of the ovary after exposure to 17beta-estradiol or the synthetic estrogen diethylstilbestrol and that this response occurs within hours after stimulation. Furthermore, this increase occurs via nuclear estrogen receptors both in vivo and in a mouse granulosa cancer cell line, NT-1. We observe a significant increase in Taf4b mRNA in estrogen-supplemented mouse ovarian tumors, which correlates with diminished survival of these mice. These data highlight the novel response of the general transcription factor TAF4B to estrogen in the normal ovary and during ovarian tumor progression in the mouse, suggesting its potential role in regulating actions downstream of estrogen stimulation.

Dynamic response characteristics of high temperature superconducting maglev systems: Comparison between Halbach-type and normal permanent magnet guideways

Science.gov (United States)

Wang, B.; Zheng, J.; Che, T.; Zheng, B. T.; Si, S. S.; Deng, Z. G.

2015-12-01

The permanent magnet guideway (PMG) is very important for the performance of the high temperature superconducting (HTS) system in terms of electromagnetic force and operational stability. The dynamic response characteristics of a HTS maglev model levitating on two types of PMG, which are the normal PMG with iron flux concentration and Halbach-type PMG, were investigated by experiments. The dynamic signals for different field-cooling heights (FCHs) and loading/unloading processes were acquired and analyzed by a vibration analyzer and laser displacement sensors. The resonant frequency, stiffness and levitation height of the model were discussed. It was found that the maglev model on the Halbach-type PMG has higher resonant frequency and higher vertical stiffness compared with the normal PMG. However, the low lateral stiffness of the model on the Halbach-type PMG indicates poor lateral stability. Besides, the Halbach-type PMG has better loading capacity than the normal PMG. These results are helpful to design a suitable PMG for the HTS system in practical applications.

The medical reshaping of disabled bodies as a response to stigma and a route to normality.

Science.gov (United States)

McLaughlin, Janice

2017-12-01

Disabled people are said to experience stigma because their embodied presence in the world does not fit with how others interact and use their bodies to be social participants. In response they can turn to medical procedures, such as surgery or physiotherapy, in order to reshape their bodies to more closely approximate norms of social interaction and embodiment. This paper explores how medicine plays a role in attempts to be recognised by others as normal and acceptable by minimising disability. It will do so via a focus on disabled young people, in order to explore how their emerging identities and aspirations for the future influence how they think about their bodies, what normality means and their participation in multiple activities that work on their bodies. The paper draws from an Economic and Social Research Council (ESRC) project that used a range of qualitative research methods with a group of disabled young people. The project explored ways in which participants actively worked on their bodies to be more normal and examined the disciplinary and agency dynamics involved in this work. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Drosophila fatty acid taste signals through the PLC pathway in sugar-sensing neurons.

Directory of Open Access Journals (Sweden)

Pavel Masek

Full Text Available Taste is the primary sensory system for detecting food quality and palatability. Drosophila detects five distinct taste modalities that include sweet, bitter, salt, water, and the taste of carbonation. Of these, sweet-sensing neurons appear to have utility for the detection of nutritionally rich food while bitter-sensing neurons signal toxicity and confer repulsion. Growing evidence in mammals suggests that taste for fatty acids (FAs signals the presence of dietary lipids and promotes feeding. While flies appear to be attracted to fatty acids, the neural basis for fatty acid detection and attraction are unclear. Here, we demonstrate that a range of FAs are detected by the fly gustatory system and elicit a robust feeding response. Flies lacking olfactory organs respond robustly to FAs, confirming that FA attraction is mediated through the gustatory system. Furthermore, flies detect FAs independent of pH, suggesting the molecular basis for FA taste is not due to acidity. We show that low and medium concentrations of FAs serve as an appetitive signal and they are detected exclusively through the same subset of neurons that sense appetitive sweet substances, including most sugars. In mammals, taste perception of sweet and bitter substances is dependent on phospholipase C (PLC signaling in specialized taste buds. We find that flies mutant for norpA, a Drosophila ortholog of PLC, fail to respond to FAs. Intriguingly, norpA mutants respond normally to other tastants, including sucrose and yeast. The defect of norpA mutants can be rescued by selectively restoring norpA expression in sweet-sensing neurons, corroborating that FAs signal through sweet-sensing neurons, and suggesting PLC signaling in the gustatory system is specifically involved in FA taste. Taken together, these findings reveal that PLC function in Drosophila sweet-sensing neurons is a conserved molecular signaling pathway that confers attraction to fatty acids.

Corticocortical feedback increases the spatial extent of normalization.

Science.gov (United States)

Nassi, Jonathan J; Gómez-Laberge, Camille; Kreiman, Gabriel; Born, Richard T

2014-01-01

Normalization has been proposed as a canonical computation operating across different brain regions, sensory modalities, and species. It provides a good phenomenological description of non-linear response properties in primary visual cortex (V1), including the contrast response function and surround suppression. Despite its widespread application throughout the visual system, the underlying neural mechanisms remain largely unknown. We recently observed that corticocortical feedback contributes to surround suppression in V1, raising the possibility that feedback acts through normalization. To test this idea, we characterized area summation and contrast response properties in V1 with and without feedback from V2 and V3 in alert macaques and applied a standard normalization model to the data. Area summation properties were well explained by a form of divisive normalization, which computes the ratio between a neuron's driving input and the spatially integrated activity of a "normalization pool." Feedback inactivation reduced surround suppression by shrinking the spatial extent of the normalization pool. This effect was independent of the gain modulation thought to mediate the influence of contrast on area summation, which remained intact during feedback inactivation. Contrast sensitivity within the receptive field center was also unaffected by feedback inactivation, providing further evidence that feedback participates in normalization independent of the circuit mechanisms involved in modulating contrast gain and saturation. These results suggest that corticocortical feedback contributes to surround suppression by increasing the visuotopic extent of normalization and, via this mechanism, feedback can play a critical role in contextual information processing.

Orosensory and Homeostatic Functions of the Insular Taste Cortex.

Science.gov (United States)

de Araujo, Ivan E; Geha, Paul; Small, Dana M

2012-03-01

The gustatory aspect of the insular cortex is part of the brain circuit that controls ingestive behaviors based on chemosensory inputs. However, the sensory properties of foods are not restricted to taste and should also include salient features such as odor, texture, temperature, and appearance. Therefore, it is reasonable to hypothesize that specialized circuits within the central taste pathways must be involved in representing several other oral sensory modalities in addition to taste. In this review, we evaluate current evidence indicating that the insular gustatory cortex functions as an integrative circuit, with taste-responsive regions also showing heightened sensitivity to olfactory, somatosensory, and even visual stimulation. We also review evidence for modulation of taste-responsive insular areas by changes in physiological state, with taste-elicited neuronal responses varying according to the nutritional state of the organism. We then examine experimental support for a functional map within the insular cortex that might reflect the various sensory and homeostatic roles associated with this region. Finally, we evaluate the potential role of the taste insular cortex in weight-gain susceptibility. Taken together, the current experimental evidence favors the view that the insular gustatory cortex functions as an orosensory integrative system that not only enables the formation of complex flavor representations but also mediates their modulation by the internal state of the body, playing therefore a central role in food intake regulation.

Group normalization for genomic data.

Science.gov (United States)

Ghandi, Mahmoud; Beer, Michael A

2012-01-01

Data normalization is a crucial preliminary step in analyzing genomic datasets. The goal of normalization is to remove global variation to make readings across different experiments comparable. In addition, most genomic loci have non-uniform sensitivity to any given assay because of variation in local sequence properties. In microarray experiments, this non-uniform sensitivity is due to different DNA hybridization and cross-hybridization efficiencies, known as the probe effect. In this paper we introduce a new scheme, called Group Normalization (GN), to remove both global and local biases in one integrated step, whereby we determine the normalized probe signal by finding a set of reference probes with similar responses. Compared to conventional normalization methods such as Quantile normalization and physically motivated probe effect models, our proposed method is general in the sense that it does not require the assumption that the underlying signal distribution be identical for the treatment and control, and is flexible enough to correct for nonlinear and higher order probe effects. The Group Normalization algorithm is computationally efficient and easy to implement. We also describe a variant of the Group Normalization algorithm, called Cross Normalization, which efficiently amplifies biologically relevant differences between any two genomic datasets.

Muscular hypertrophy and atrophy in normal rats provoked by the administration of normal and denervated muscle extracts.

Science.gov (United States)

Agüera, Eduardo; Castilla, Salvador; Luque, Evelio; Jimena, Ignacio; Leiva-Cepas, Fernando; Ruz-Caracuel, Ignacio; Peña, José

2016-12-01

This study was conducted to determine the effects of extracts obtained from both normal and denervated muscles on different muscle types. Wistar rats were used and were divided into a control group and four experimental groups. Each experimental group was treated intraperitoneally during 10 consecutive days with a different extract. These extracts were obtained from normal soleus muscle, denervated soleus, normal extensor digitorum longus, and denervated extensor digitorum longus. Following treatment, the soleus and extensor digitorum longus muscles were obtained for study under optic and transmission electron microscope; morphometric parameters and myogenic responses were also analyzed. The results demonstrated that the treatment with normal soleus muscle and denervated soleus muscle extracts provoked hypertrophy and increased myogenic activity. In contrast, treatment with extracts from the normal and denervated EDL had a different effect depending on the muscle analyzed. In the soleus muscle it provoked hypertrophy of type I fibers and increased myogenic activity, while in the extensor digitorum longus atrophy of the type II fibers was observed without changes in myogenic activity. This suggests that the muscular responses of atrophy and hypertrophy may depend on different factors related to the muscle type which could be related to innervation.

Water as an Independent Taste Modality

Directory of Open Access Journals (Sweden)

Andrew M Rosen

2010-10-01

Full Text Available To qualify as a basic taste quality or modality, defined as a group of chemicals that taste alike, three empirical benchmarks have commonly been used. The first is that a candidate group of tastants must have a dedicated transduction mechanism in the peripheral nervous system. The second is that the tastants evoke physiological responses in dedicated afferent taste nerves innervating the oropharyngeal cavity. Last, the taste stimuli evoke activity in central gustatory neurons, some of which may respond only to that group of tastants. Here we argue that water may also be an independent taste modality. This argument is based on the identification of a water dedicated transduction mechanism in the peripheral nervous system, water responsive fibers of the peripheral taste nerves and the observation of water responsive neurons in all gustatory regions within the central nervous system. We have described electrophysiological responses from single neurons in nucleus of the solitary tract (NTS and parabrachial nucleus of the pons (PbN, respectively the first two central relay nuclei in the rodent brainstem, to water presented as a taste stimulus in anesthetized rats. Responses to water were in some cases as robust as responses to other taste qualities and sometimes occurred in the absence of responses to other tastants. Both excitatory and inhibitory responses were observed. Also, the temporal features of the water response resembled those of other taste responses. We argue that water may constitute an independent taste modality that is processed by dedicated neural channels at all levels of the gustatory neuraxis. Water-dedicated neurons in the brainstem may constitute key elements in the regulatory system for fluid in the body, i.e. thirst, and as part of the swallowing reflex circuitry.

Egr-1 induction provides a genetic response to food aversion in zebrafish

Directory of Open Access Journals (Sweden)

Brigitte eBoyer

2013-05-01

Full Text Available As soon as zebrafish larvae start eating, they exhibit a marked aversion for bitter and acidic substances, as revealed by a consumption assay, in which fluorescent Tetrahymena serve as a feeding basis, to which various stimuli can be added. Bitter and acidic substances elicited an increase in mRNA accumulation of the immediate-early response gene egr-1, as revealed by in situ hybridization. Conversely, chemostimulants that did not induce aversion did not induce egr-1 response. Maximum labelling was observed in cells located in the oropharyngeal cavity and on the gill rakers. Gustatory areas of the brain were also labelled. Interestingly, when bitter tastants were repeatedly associated with food reward, zebrafish juveniles learned to ingest food in the presence of the bitter compound. After habituation, the acquisition of acceptance for bitterness was accompanied by a loss of egr-1 labelling. Altogether, our data indicate that egr-1 participates specifically in food aversion. The existence of reward-coupled changes in taste sensitivity in humans suggests that our results are relevant to situations in humans.

Egr-1 induction provides a genetic response to food aversion in zebrafish.

Science.gov (United States)

Boyer, Brigitte; Ernest, Sylvain; Rosa, Frédéric

2013-01-01

As soon as zebrafish larvae start eating, they exhibit a marked aversion for bitter and acidic substances, as revealed by a consumption assay, in which fluorescent Tetrahymena serve as a feeding basis, to which various stimuli can be added. Bitter and acidic substances elicited an increase in mRNA accumulation of the immediate-early response gene egr-1, as revealed by in situ hybridization. Conversely, chemostimulants that did not induce aversion did not induce egr-1 response. Maximum labeling was observed in cells located in the oropharyngeal cavity and on the gill rakers. Gustatory areas of the brain were also labeled. Interestingly, when bitter tastants were repeatedly associated with food reward, zebrafish juveniles learned to ingest food in the presence of the bitter compound. After habituation, the acquisition of acceptance for bitterness was accompanied by a loss of egr-1 labeling. Altogether, our data indicate that egr-1 participates specifically in food aversion. The existence of reward-coupled changes in taste sensitivity in humans suggests that our results are relevant to situations in humans.

Acidic Food pH Increases Palatability and Consumption and Extends Drosophila Lifespan.

Science.gov (United States)

Deshpande, Sonali A; Yamada, Ryuichi; Mak, Christine M; Hunter, Brooke; Soto Obando, Alina; Hoxha, Sany; Ja, William W

2015-12-01

Despite the prevalent use of Drosophila as a model in studies of nutrition, the effects of fundamental food properties, such as pH, on animal health and behavior are not well known. We examined the effect of food pH on adult Drosophila lifespan, feeding behavior, and microbiota composition and tested the hypothesis that pH-mediated changes in palatability and total consumption are required for modulating longevity. We measured the effect of buffered food (pH 5, 7, or 9) on male gustatory responses (proboscis extension), total food intake, and male and female lifespan. The effect of food pH on germfree male lifespan was also assessed. Changes in fly-associated microbial composition as a result of food pH were determined by 16S ribosomal RNA gene sequencing. Male gustatory responses, total consumption, and male and female longevity were additionally measured in the taste-defective Pox neuro (Poxn) mutant and its transgenic rescue control. An acidic diet increased Drosophila gustatory responses (40-230%) and food intake (5-50%) and extended survival (10-160% longer median lifespan) compared with flies on either neutral or alkaline pH food. Alkaline food pH shifted the composition of fly-associated bacteria and resulted in greater lifespan extension (260% longer median survival) after microbes were eliminated compared with flies on an acidic (50%) or neutral (130%) diet. However, germfree flies lived longer on an acidic diet (5-20% longer median lifespan) compared with those on either neutral or alkaline pH food. Gustatory responses, total consumption, and longevity were unaffected by food pH in Poxn mutant flies. Food pH can directly influence palatability and feeding behavior and affect parameters such as microbial growth to ultimately affect Drosophila lifespan. Fundamental food properties altered by dietary or drug interventions may therefore contribute to changes in animal physiology, metabolism, and survival. © 2015 American Society for Nutrition.

Corticocortical feedback increases the spatial extent of normalization

Science.gov (United States)

Nassi, Jonathan J.; Gómez-Laberge, Camille; Kreiman, Gabriel; Born, Richard T.

2014-01-01

Normalization has been proposed as a canonical computation operating across different brain regions, sensory modalities, and species. It provides a good phenomenological description of non-linear response properties in primary visual cortex (V1), including the contrast response function and surround suppression. Despite its widespread application throughout the visual system, the underlying neural mechanisms remain largely unknown. We recently observed that corticocortical feedback contributes to surround suppression in V1, raising the possibility that feedback acts through normalization. To test this idea, we characterized area summation and contrast response properties in V1 with and without feedback from V2 and V3 in alert macaques and applied a standard normalization model to the data. Area summation properties were well explained by a form of divisive normalization, which computes the ratio between a neuron's driving input and the spatially integrated activity of a “normalization pool.” Feedback inactivation reduced surround suppression by shrinking the spatial extent of the normalization pool. This effect was independent of the gain modulation thought to mediate the influence of contrast on area summation, which remained intact during feedback inactivation. Contrast sensitivity within the receptive field center was also unaffected by feedback inactivation, providing further evidence that feedback participates in normalization independent of the circuit mechanisms involved in modulating contrast gain and saturation. These results suggest that corticocortical feedback contributes to surround suppression by increasing the visuotopic extent of normalization and, via this mechanism, feedback can play a critical role in contextual information processing. PMID:24910596

Helicon normal modes in Proto-MPEX

Science.gov (United States)

Piotrowicz, P. A.; Caneses, J. F.; Green, D. L.; Goulding, R. H.; Lau, C.; Caughman, J. B. O.; Rapp, J.; Ruzic, D. N.

2018-05-01

The Proto-MPEX helicon source has been operating in a high electron density ‘helicon-mode’. Establishing plasma densities and magnetic field strengths under the antenna that allow for the formation of normal modes of the fast-wave are believed to be responsible for the ‘helicon-mode’. A 2D finite-element full-wave model of the helicon antenna on Proto-MPEX is used to identify the fast-wave normal modes responsible for the steady-state electron density profile produced by the source. We also show through the simulation that in the regions of operation in which core power deposition is maximum the slow-wave does not deposit significant power besides directly under the antenna. In the case of a simulation where a normal mode is not excited significant edge power is deposited in the mirror region. ).

Estrogen Responsiveness of the TFIID Subunit TAF4B in the Normal Mouse Ovary and in Ovarian Tumors1

Science.gov (United States)

Wardell, Jennifer R.; Hodgkinson, Kendra M.; Binder, April K.; Seymour, Kimberly A.; Korach, Kenneth S.; Vanderhyden, Barbara C.; Freiman, Richard N.

2013-01-01

ABSTRACT Estrogen signaling in the ovary is a fundamental component of normal ovarian function, and evidence also indicates that excessive estrogen is a risk factor for ovarian cancer. We have previously demonstrated that the gonadally enriched TFIID subunit TAF4B, a paralog of the general transcription factor TAF4A, is required for fertility in mice and for the proliferation of ovarian granulosa cells following hormonal stimulation. However, the relationship between TAF4B and estrogen signaling in the normal ovary or during ovarian tumor initiation and progression has yet to be defined. Herein, we show that Taf4b mRNA and TAF4B protein, but not Taf4a mRNA or TAF4A protein, are increased in whole ovaries and granulosa cells of the ovary after exposure to 17beta-estradiol or the synthetic estrogen diethylstilbestrol and that this response occurs within hours after stimulation. Furthermore, this increase occurs via nuclear estrogen receptors both in vivo and in a mouse granulosa cancer cell line, NT-1. We observe a significant increase in Taf4b mRNA in estrogen-supplemented mouse ovarian tumors, which correlates with diminished survival of these mice. These data highlight the novel response of the general transcription factor TAF4B to estrogen in the normal ovary and during ovarian tumor progression in the mouse, suggesting its potential role in regulating actions downstream of estrogen stimulation. PMID:24068106

Response of cultured normal human mammary epithelial cells to X rays

International Nuclear Information System (INIS)

Yang, T.C.; Stampfer, M.R.; Smith, H.S.

1983-01-01

The effect of X rays on the reproductive death of cultured normal human mammary epithelial cells was examined. Techniques were developed for isolating and culturing normal human mammary epithelial cells which provide sufficient cells at second passage for radiation studies, and an efficient clonogenic assay suitable for measuring radiation survival curves. It was found that the survival curves for epithelial cells from normal breast tissue were exponential and had D 0 values of about 109-148 rad for 225 kVp X rays. No consistent change in cell radiosensitivity with the age of donor was observed, and no sublethal damage repair in these cells could be detected with the split-dose technique

Enhancing the radiation response of tumors but not early or late responding normal tissues using a vascular disrupting agent

DEFF Research Database (Denmark)

Horsman, Michael R

2017-01-01

INTRODUCTION: Vascular disrupting agents (VDAs) damage tumor vasculature and enhance tumor radiation response. In this pre-clinical study, we combined radiation with the leading VDA in clinical development, combretastatin A-4 phosphate (CA4P), and compared the effects seen in tumors and relevant...... normal tissues. MATERIAL AND METHODS: Radiation was applied locally to tissues in CDF1 mice to produce full radiation dose-response curves. CA4P (250 mg/kg) was intraperitoneally (i.p.) injected within 30 minutes after irradiating. Response of 200 mm3 foot implanted C3H mammary carcinomas was assessed......% increase in ventilation rate measured by plethysmography within 9 months). A Chi-squared test was used for statistical comparisons (significance level of p 4P. The radiation...

Effects of short-term glucocorticoid deprivation on growth hormone (GH) response to GH-releasing peptide-6: Studies in normal men and in patients with adrenal insufficiency

OpenAIRE

Pinto, Ana Claudia de Assis Rocha [UNIFESP; Dias-da-Silva, Magnus Régios [UNIFESP; Martins, Manoel R. [UNIFESP; Brunner, Elisa [UNIFESP; Lengyel, Ana Maria Judith [UNIFESP

2000-01-01

There are no data in the literature about the effects of glucocorticoid deprivation on GH-releasing peptide-g (GHRP-6)-induced GH release. the aims of this study were to evaluate GH responsiveness to GHRP-6 1) after metyrapone administration in normal men, and 2) in patients with chronic hypocortisolism after glucocorticoid withdrawal for 72 h. in normal subjects, metyrapone ingestion did not alter significantly GH responsiveness to GHRP-6 [n = 8; peak, 39.3 +/- 7.1 mu g/L; area under the cur...

Group normalization for genomic data.

Directory of Open Access Journals (Sweden)

Mahmoud Ghandi

Full Text Available Data normalization is a crucial preliminary step in analyzing genomic datasets. The goal of normalization is to remove global variation to make readings across different experiments comparable. In addition, most genomic loci have non-uniform sensitivity to any given assay because of variation in local sequence properties. In microarray experiments, this non-uniform sensitivity is due to different DNA hybridization and cross-hybridization efficiencies, known as the probe effect. In this paper we introduce a new scheme, called Group Normalization (GN, to remove both global and local biases in one integrated step, whereby we determine the normalized probe signal by finding a set of reference probes with similar responses. Compared to conventional normalization methods such as Quantile normalization and physically motivated probe effect models, our proposed method is general in the sense that it does not require the assumption that the underlying signal distribution be identical for the treatment and control, and is flexible enough to correct for nonlinear and higher order probe effects. The Group Normalization algorithm is computationally efficient and easy to implement. We also describe a variant of the Group Normalization algorithm, called Cross Normalization, which efficiently amplifies biologically relevant differences between any two genomic datasets.

Normalization as a canonical neural computation

Science.gov (United States)

Carandini, Matteo; Heeger, David J.

2012-01-01

There is increasing evidence that the brain relies on a set of canonical neural computations, repeating them across brain regions and modalities to apply similar operations to different problems. A promising candidate for such a computation is normalization, in which the responses of neurons are divided by a common factor that typically includes the summed activity of a pool of neurons. Normalization was developed to explain responses in the primary visual cortex and is now thought to operate throughout the visual system, and in many other sensory modalities and brain regions. Normalization may underlie operations such as the representation of odours, the modulatory effects of visual attention, the encoding of value and the integration of multisensory information. Its presence in such a diversity of neural systems in multiple species, from invertebrates to mammals, suggests that it serves as a canonical neural computation. PMID:22108672

Effects of stimulus duration on gustatory evoked potentials

DEFF Research Database (Denmark)

Rotvel, Camilla Arndal; Møller, Stine; Kivisaar, Kätlin

The objective of the present study was to investigate the effect of tastant stimulus duration on the brain response. The brain response was measured by electroencephalography (EEG) which measures neural processes with high temporal resolution and may therefore complement sensory panel assessments...

Three-dimensional analysis of tarsal bone response to axial loading in patients with hallux valgus and normal feet.

Science.gov (United States)

Watanabe, Kota; Ikeda, Yasutoshi; Suzuki, Daisuke; Teramoto, Atsushi; Kobayashi, Takuma; Suzuki, Tomoyuki; Yamashita, Toshihiko

2017-02-01

Patients with hallux valgus present a variety of symptoms that may be related to the type of deformity. Weightbearing affects the deformities, and the evaluation of the load response of tarsal bones has been mainly performed using two-dimensional plane radiography. The purpose of this study was to investigate and compare structural changes in the medial foot arch between patients with hallux valgus and normal controls using a computer image analysis technique and weightbearing computed tomography data. Eleven patients with hallux valgus and eleven normal controls were included. Computed tomograms were obtained with and without simulated weightbearing using a compression device. Computed tomography data were transferred into a personal computer, and a three-dimensional bone model was created using image analysis software. The load responses of each tarsal bone in the medial foot arch were measured three-dimensionally and statistically compared between the two groups. Displacement of each tarsal bone under two weightbearing conditions was visually observed by creating three-dimensional bone models. At the first metatarsophalangeal joint, the proximal phalanges of the hallux valgus group showed significantly different displacements in multiple directions. Moreover, opposite responses to axial loading were also observed in both translation and rotation between the two groups. Weightbearing caused deterioration of the hallux valgus deformity three-dimensionally at the first metatarsophalangeal joint. Information from the computer image analysis was useful for understanding details of the pathology of foot disorders related to the deformities or instability and may contribute to the development of effective conservative and surgical treatments. Copyright © 2017 Elsevier Ltd. All rights reserved.

Family history of alcoholism and the human brain response to oral sucrose.

Science.gov (United States)

Eiler, William J A; Dzemidzic, Mario; Soeurt, Christina M; Carron, Claire R; Oberlin, Brandon G; Considine, Robert V; Harezlak, Jaroslaw; Kareken, David A

2018-01-01

A heightened hedonic response to sweet tastes has been associated with increased alcohol preference and alcohol consumption in both humans and animals. The principal goal of this study was to examine blood oxygenation level dependent (BOLD) activation to high- and low-concentration sweet solutions in subjects who are either positive (FHP) or negative (FHN) for a family history of alcoholism. Seventy-four non-treatment seeking, community-recruited, healthy volunteers (22.8 ± 1.6 SD years; 43% men) rated a range of sucrose concentrations in a taste test and underwent functional magnetic resonance imaging (fMRI) during oral delivery of water, 0.83 M, and 0.10 M sucrose. Sucrose compared to water produced robust activation in primary gustatory cortex, ventral insula, amygdala, and ventral striatum. FHP subjects displayed greater bilateral amygdala activation than FHN subjects in the low sucrose concentration (0.10 M). In secondary analyses, the right amygdala response to the 0.10 M sucrose was greatest in FHP women. When accounting for group differences in drinks per week, the family history groups remained significantly different in their right amygdala response to 0.10 M sucrose. Our findings suggest that the brain response to oral sucrose differs with a family history of alcoholism, and that this response to a mildly reinforcing primary reward might be an endophenotypic marker of alcoholism risk.

Effects of radiotherapy on the sense of taste

Energy Technology Data Exchange (ETDEWEB)

Umeyama, Masayoshi; Suzaki, Harumi [Showa Univ., Tokyo (Japan). School of Medicine

2001-07-01

The adverse effects of radiotherapy for cancer in the head and neck region include impairment of the sense of taste and smell and dry mouth. The present study was conducted to examine the effects of such radiotherapy on the sense of taste, in view of its influence on the quality of life of patients with malignant tumors of the head and neck following treatment. In 18 patients with malignant tumors of the head and neck (mean age, 59.9 years) the sense of taste was tested using the filter-paper disc method, serially before and after radiotherapy with {sup 60}Co {gamma} rays, in order to analyze the changes in gustatory threshold after radiotherapy. The patients were also observed for subjective symptoms, including dry mouth and impairment of the sense of taste, and changes in the lingual surface over the course of radiotherapy. No increase in the gustatory threshold or subjective impairment of the sense of taste was noted after radiotherapy when the field of irradiation did not include the tongue (4 cases of laryngeal cancer). When the field of irradiation included a part of the tongue (3 cases of maxillary cancer, 3 cases of hypopharyngeal cancer, 1 case of epipharyngeal cancer) or the entire tongue (2 cases of lingual cancer, 2 cases of cancer of the floor of the mouth, 3 cases of mesopharyngeal cancer), dry mouth was noted after irradiation at 7.2-39.6 Gy, and the gustatory threshold increased after irradiation at 12-40 Gy. Subjective impairment of the sense of taste was also reported after irradiation at 10-25.2 Gy, which was restored to normal within 2-3 months after the end of radiotherapy. In relation to the quality of taste, the gustatory threshold for sweet tastes increased the slowest, and was restored rapidly. In contrast, the gustatory threshold for sour tastes increased most rapidly, and was restored slowly. The relationship between the serum zinc level and the increase in gustatory threshold was unclear. There was a tendency for the lingual surface to

Effects of radiotherapy on the sense of taste

International Nuclear Information System (INIS)

Umeyama, Masayoshi; Suzaki, Harumi

2001-01-01

The adverse effects of radiotherapy for cancer in the head and neck region include impairment of the sense of taste and smell and dry mouth. The present study was conducted to examine the effects of such radiotherapy on the sense of taste, in view of its influence on the quality of life of patients with malignant tumors of the head and neck following treatment. In 18 patients with malignant tumors of the head and neck (mean age, 59.9 years) the sense of taste was tested using the filter-paper disc method, serially before and after radiotherapy with 60 Co γ rays, in order to analyze the changes in gustatory threshold after radiotherapy. The patients were also observed for subjective symptoms, including dry mouth and impairment of the sense of taste, and changes in the lingual surface over the course of radiotherapy. No increase in the gustatory threshold or subjective impairment of the sense of taste was noted after radiotherapy when the field of irradiation did not include the tongue (4 cases of laryngeal cancer). When the field of irradiation included a part of the tongue (3 cases of maxillary cancer, 3 cases of hypopharyngeal cancer, 1 case of epipharyngeal cancer) or the entire tongue (2 cases of lingual cancer, 2 cases of cancer of the floor of the mouth, 3 cases of mesopharyngeal cancer), dry mouth was noted after irradiation at 7.2-39.6 Gy, and the gustatory threshold increased after irradiation at 12-40 Gy. Subjective impairment of the sense of taste was also reported after irradiation at 10-25.2 Gy, which was restored to normal within 2-3 months after the end of radiotherapy. In relation to the quality of taste, the gustatory threshold for sweet tastes increased the slowest, and was restored rapidly. In contrast, the gustatory threshold for sour tastes increased most rapidly, and was restored slowly. The relationship between the serum zinc level and the increase in gustatory threshold was unclear. There was a tendency for the lingual surface to become dry

Effects of age and nutritional state on the expression of gustatory receptors in the honeybee (Apis mellifera.

Directory of Open Access Journals (Sweden)

Nicola K Simcock

Full Text Available Gustatory receptors (Grs expressed in insect taste neurons signal the presence of carbohydrates, sugar alcohols, CO2, bitter compounds and oviposition stimulants. The honeybee (Apis mellifera has one of the smallest Gr gene sets (12 Gr genes of any insect whose genome has been sequenced. Honeybees live in eusocial colonies with a division of labour and perform age-dependent behavioural tasks, primarily food collection. Here, we used RT-qPCR to quantify Gr mRNA in honeybees at two ages (newly-emerged and foraging-age adults to examine the relationship between age-related physiology and expression of Gr genes. We measured the Gr mRNAs in the taste organs and also the brain and gut. The mRNA of all Gr genes was detected in all tissues analysed but showed plasticity in relative expression across tissues and in relation to age. Overall, Gr gene expression was higher in the taste organs than in the internal tissues but did not show an overall age-dependent difference. In contrast Gr gene expression in brain was generally higher in foragers, which may indicate greater reliance on internal nutrient sensing. Expression of the candidate sugar receptors AmGr1, AmGr2 and AmGr3 in forager brain was affected by the types of sugars bees fed on. The levels of expression in the brain were greater for AmGr1 but lower for AmGr2 and AmGr3 when bees were fed with glucose and fructose compared with sucrose. Additionally, AmGr3 mRNA was increased in starved bees compared to bees provided ad libitum sucrose. Thus, expression of these Grs in forager brain reflects both the satiety state of the bee (AmGr3 and the type of sugar on which the bee has fed.

On- and off-response ERGs elicited by sawtooth stimuli in normal subjects and glaucoma patients.

Science.gov (United States)

Pangeni, Gobinda; Lämmer, Robert; Tornow, Ralf P; Horn, Folkert K; Kremers, Jan

2012-06-01

The aim of this study is to measure the on- and off-responses and their response asymmetries elicited by sawtooth stimuli in normal subjects and glaucoma patients. Furthermore, the correlation between the ERGs and other functional and structural parameters are investigated. Full-field stimuli were produced using a Ganzfeld bowl with Light Emitting Diodes (LEDs) as light sources. On- and off-response ERGs were recorded from 17 healthy subjects, 12 pre-perimetric and 15 perimetric glaucoma patients using 4-Hz luminance rapid-on and rapid-off sawtooth stimuli (white light; mean luminance 55 cd/m(2)) at 100% contrast. The on- and off-responses were added to study response asymmetries. In addition, flash ERGs were elicited by red stimuli (200 cd/m(2)) on a blue background (10 cd/m(2)). The mean deviations (MD) of the visual field defects were obtained by standard automated perimetry. The retinal nerve fibre layer thickness (RNFLT) was measured with Spectral Domain Optical Coherence Tomography (SOCT). We studied the correlation between ERG response amplitudes, visual field mean deviation (MDs) and RNFLT values. The on-responses showed an initial negative (N-on) followed by a positive (P-on), a late positive (LP-on) and a late negative responses (LN-on). The off-responses showed an initial positive (P-off) a late positive (LP-off) and a late negative response (LN-off). The addition of on- and off-responses revealed an initial positive (P-add) and a late negative response (LN-add). The on-response components (N-on, P-on and LN-on) in the glaucoma patients were relatively similar to those of the control subjects. However, the LP-on was significantly elevated (p = 0.03) in perimetric patients. The LP-off was significantly elevated (p < 0.001), and the amplitude of LN-off was significantly reduced in perimetric patients (p = 0.02). The LN-add amplitude was significantly reduced (p < 0.001) and delayed (p = 0.03) in perimetric patients. The amplitudes of the LN-off and LN

Functional brain response to food images in successful adolescent weight losers compared with normal-weight and overweight controls.

Science.gov (United States)

Jensen, Chad D; Kirwan, C Brock

2015-03-01

Research conducted with adults suggests that successful weight losers demonstrate greater activation in brain regions associated with executive control in response to viewing high-energy foods. No previous studies have examined these associations in adolescents. Functional neuroimaging was used to assess brain response to food images among groups of overweight (OW), normal-weight (NW), and successful weight-losing (SWL) adolescents. Eleven SWL, 12 NW, and 11 OW participants underwent functional magnetic resonance imaging while viewing images of high- and low-energy foods. When viewing high-energy food images, SWLs demonstrated greater activation in the dorsolateral prefrontal cortex (DLPFC) compared with OW and NW controls. Compared with NW and SWL groups, OW individuals demonstrated greater activation in the ventral striatum and anterior cingulate in response to food images. Adolescent SWLs demonstrated greater neural activation in the DLPFC compared with OW/NW controls when viewing high-energy food stimuli, which may indicate enhanced executive control. OW individuals' brain responses to food stimuli may indicate greater reward incentive processes than either SWL or NW groups. © 2015 The Obesity Society.

Neural responses to silent lipreading in normal hearing male and female subjects

NARCIS (Netherlands)

Ruytjens, Liesbet; Albers, Frans; van Dijk, Pim; Wit, Hero; Willemsen, Antoon

In the past, researchers investigated silent lipreading in normal hearing subjects with functional neuroimaging tools and showed how the brain processes visual stimuli that are normally accompanied by an auditory counterpart. Previously, we showed activation differences between males and females in

Empathy, normality and responsiveness among street-level bureaucrats

DEFF Research Database (Denmark)

Møller, Marie Østergaard; Nielsen, Vibeke Lehmann

2014-01-01

Within the public sector it is a permanent dilemma that we on one hand – on the grounds of effectiveness and flexibility – want employees to have discretion and autonomy, but at the same time want to make sure that citizens and clients of the public sector are treated equally and independent of w...... this paper discusses and analyzes how perceptions of local target group’s problem portfolio (normality perceptions) conditions the behavioral effects of personal attributes/personality traits (differences in empathy)....

Targeted taste cell-specific overexpression of brain-derived neurotrophic factor in adult taste buds elevates phosphorylated TrkB protein levels in taste cells, increases taste bud size, and promotes gustatory innervation.

Science.gov (United States)

Nosrat, Irina V; Margolskee, Robert F; Nosrat, Christopher A

2012-05-11

Brain-derived neurotrophic factor (BDNF) is the most potent neurotrophic factor in the peripheral taste system during embryonic development. It is also expressed in adult taste buds. There is a lack of understanding of the role of BDNF in the adult taste system. To address this, we generated novel transgenic mice in which transgene expression was driven by an α-gustducin promoter coupling BDNF expression to the postnatal expression of gustducin in taste cells. Immunohistochemistry revealed significantly stronger BDNF labeling in taste cells of high BDNF-expressing mouse lines compared with controls. We show that taste buds in these mice are significantly larger and have a larger number of taste cells compared with controls. To examine whether innervation was affected in Gust-BDNF mice, we used antibodies to neural cell adhesion molecule (NCAM) and ATP receptor P2X3. The total density of general innervation and specifically the gustatory innervation was markedly increased in high BDNF-expressing mice compared with controls. TrkB and NCAM gene expression in laser capture microdissected taste epithelia were significantly up-regulated in these mice. Up-regulation of TrkB transcripts in taste buds and elevated taste cell-specific TrkB phosphorylation in response to increased BDNF levels indicate that BDNF controls the expression and activation of its high affinity receptor in taste cells. This demonstrates a direct taste cell function for BDNF. BDNF also orchestrates and maintains taste bud innervation. We propose that the Gust-BDNF transgenic mouse models can be employed to further dissect the specific roles of BDNF in the adult taste system.

Normal modes of weak colloidal gels

Science.gov (United States)

Varga, Zsigmond; Swan, James W.

2018-01-01

The normal modes and relaxation rates of weak colloidal gels are investigated in calculations using different models of the hydrodynamic interactions between suspended particles. The relaxation spectrum is computed for freely draining, Rotne-Prager-Yamakawa, and accelerated Stokesian dynamics approximations of the hydrodynamic mobility in a normal mode analysis of a harmonic network representing several colloidal gels. We find that the density of states and spatial structure of the normal modes are fundamentally altered by long-ranged hydrodynamic coupling among the particles. Short-ranged coupling due to hydrodynamic lubrication affects only the relaxation rates of short-wavelength modes. Hydrodynamic models accounting for long-ranged coupling exhibit a microscopic relaxation rate for each normal mode, λ that scales as l-2, where l is the spatial correlation length of the normal mode. For the freely draining approximation, which neglects long-ranged coupling, the microscopic relaxation rate scales as l-γ, where γ varies between three and two with increasing particle volume fraction. A simple phenomenological model of the internal elastic response to normal mode fluctuations is developed, which shows that long-ranged hydrodynamic interactions play a central role in the viscoelasticity of the gel network. Dynamic simulations of hard spheres that gel in response to short-ranged depletion attractions are used to test the applicability of the density of states predictions. For particle concentrations up to 30% by volume, the power law decay of the relaxation modulus in simulations accounting for long-ranged hydrodynamic interactions agrees with predictions generated by the density of states of the corresponding harmonic networks as well as experimental measurements. For higher volume fractions, excluded volume interactions dominate the stress response, and the prediction from the harmonic network density of states fails. Analogous to the Zimm model in polymer

Tarsal taste neuron activity and proboscis extension reflex in response to sugars and amino acids in Helicoverpa armigera (Hübner)

NARCIS (Netherlands)

Zhang, Y.F.; Loon, van J.J.A.; Wang, C.Z.

2010-01-01

In adult female Helicoverpa armigera (Hübner), the fifth tarsomere of the prothoracic legs bears 14 gustatory trichoid chemosensilla. These chemosensilla were characterized through electrophysiological experiments by stimulating with sucrose, glucose, fructose, maltose, myo-inositol and 20 common

Central leptin action on euglycemia restoration in type 1 diabetes: Restraining responses normally induced by fasting?

Science.gov (United States)

Xu, Yuanzhong; Tong, Qingchun

2017-07-01

Leptin monotherapy is sufficient to restore euglycemia in insulinopenic type 1 diabetes (T1D), yet the underlying mechanism remains poorly understood. Accumulating evidence demonstrates that the brain mediates the leptin action on euglycemia restoration. Here, we first review evidence supporting that symptoms in T1D resemble an uncontrolled response to fasting. Then, we discuss recent research progress on brain neurons and their neurotransmitters that potentially mediate the leptin action. Finally, peripheral effective pathways, which are normally involved in fasting responses and associated with leptin action on euglycemia restoration in T1D, will also be discussed. This summary complements several previous excellent reviews on this topic (Meek and Morton, 2016; Perry et al., 2016; Fujikawa and Coppari, 2015). A deep understanding of neurocircuitry and the peripheral effective pathways that mediate the leptin action on euglycemia restoration will likely lead to novel targets for an insulin-independent therapeutics against T1D. Copyright © 2016 Elsevier Ltd. All rights reserved.

Frequency Domain Electroretinography in Retinitis Pigmentosa versus Normal Eyes

Directory of Open Access Journals (Sweden)

Homa Hassan-Karimi

2012-01-01

Full Text Available Purpose: To compare electroretinogram (ERG characteristics in patients with retinitis pigmentosa (RP and normal subjects using frequency domain analysis. Methods: Five basic ERG recordings were performed in normal subjects and patients with a clinical diagnosis of RP according to the ISCEV (International Society of Clinical Electrophysiology of Vision protocol. Frequency domain analysis was performed by MATLAB software. Different frequency domain parameters were compared between the study groups. Results: Peak frequency (Fmod of flicker and oscillatory responses in RP patients showed significant (P<0.0001 high pass response as compared to normal controls. Peak frequency (Fmod of the other responses was not significantly different between the two groups. Conclusion: In addition to conventional ERG using time domain methods, frequency domain analysis may be useful for diagnosis of RP. Oscillatory and flicker responses may be analyzed in frequency domain. Fast Fourier transform may reveal two distinct high pass responses (shift to higher frequencies in Fmod. Time and frequency domain analyses may be performed simultaneously with many modern ERG machines and may therefore be recommended in RP patients.

Dynamics of oligodendrocyte responses to anterograde axonal (Wallerian) and terminal degeneration in normal and TNF-transgenic mice

DEFF Research Database (Denmark)

Drøjdahl, Nina; Fenger, Christina; Nielsen, Helle H

2004-01-01

degeneration and lesion-induced axonal sprouting in the hippocampal dentate gyrus in TNF-transgenic mice with the response in genetically normal mice. Transectioning of the entorhino-dentate perforant path axonal projection increased hippocampal TNF mRNA expression in both types of mice, but to significantly...... larger levels in the TNF-transgenics. At 5 days after axonal transection, numbers of oligodendrocytes and myelin basic protein (MBP) mRNA expression in the denervated dentate gyrus in TNF-transgenic mice had increased to the same extent as in nontransgenic littermates. At this time, transgenics showed...

Hair-Normalized Cortisol Waking Response as a Novel Biomarker of Hypothalamic-Pituitary-Adrenal Axis Activity following Acute Trauma: A Proof-of-Concept Study with Pilot Results

Directory of Open Access Journals (Sweden)

David M. Walton

2013-01-01

Full Text Available The mechanisms underlying the development of persistent posttraumatic pain and disability remain elusive. Recent evidence suggests that disordered stress-system pathway (hypothalamic-pituitary-adrenal axis activity may be responsible for the genesis and maintenance of long-term sensory and emotional problems. However, confidence in current evidence is limited by the necessarily retrospective collection of data. Hair cortisol can serve as a calendar of HPA axis activity going back several months prior to injury. The purposes of this pilot study were to determine the feasibility of using hair cortisol and hair-normalized salivary cortisol as biomarkers of distress following traumatic injuries of whiplash or distal radius fracture. Ten subjects provided complete data within 3 weeks of injury. Hair cortisol, cortisol waking response (CWR, and mean daily cortisol (MDC were captured at inception, as were self-report indicators of pain, disability, and pain catastrophizing. Pain and disability were also captured 3 months after injury. Results indicate that cortisol waking response may be a useful biomarker of current distress as measured using the pain catastrophizing scale, especially when normalized to 3-month hair cortisol (r=0.77 raw, 0.93 normalized. Hair-normalized CWR may also have predictive capacity, correlating with 3-month self-reported disability at r=0.70. While promising, the results must be viewed in light of the small sample.

Brainstem auditory evoked response characteristics in normal-hearing subjects with chronic tinnitus and in non-tinnitus group

Directory of Open Access Journals (Sweden)

Shadman Nemati

2014-06-01

Full Text Available Background and Aim: While most of the people with tinnitus have some degrees of hearing impairment, a small percent of patients admitted to ear, nose and throat clinics or hearing evaluation centers are those who complain of tinnitus despite having normal hearing thresholds. This study was performed to better understanding of the reasons of probable causes of tinnitus and to investigate possible changes in the auditory brainstem function in normal-hearing patients with chronic tinnitus.Methods: In this comparative cross-sectional, descriptive and analytic study, 52 ears (26 with and 26 without tinnitus were examined. Components of the auditory brainstem response (ABR including wave latencies and wave amplitudes were determined in the two groups and analyzed using appropriate statistical methods.Results: The mean differences between the absolute latencies of waves I, III and V was less than 0.1 ms between the two groups that was not statistically significant. Also, the interpeak latency values of waves I-III, III-V and I-V in both groups had no significant difference. Only, the V/I amplitude ratio in the tinnitus group was significantly higher (p=0.04.Conclusion: The changes observed in amplitude of waves, especially in the latter ones, can be considered as an indication of plastic changes in neuronal activity and its possible role in generation of tinnitus in normal-hearing patients.

Sonic hedgehog from both nerves and epithelium is a key trophic factor for taste bud maintenance.

Science.gov (United States)

Castillo-Azofeifa, David; Losacco, Justin T; Salcedo, Ernesto; Golden, Erin J; Finger, Thomas E; Barlow, Linda A

2017-09-01

The integrity of taste buds is intimately dependent on an intact gustatory innervation, yet the molecular nature of this dependency is unknown. Here, we show that differentiation of new taste bud cells, but not progenitor proliferation, is interrupted in mice treated with a hedgehog (Hh) pathway inhibitor (HPI), and that gustatory nerves are a source of sonic hedgehog (Shh) for taste bud renewal. Additionally, epithelial taste precursor cells express Shh transiently, and provide a local supply of Hh ligand that supports taste cell renewal. Taste buds are minimally affected when Shh is lost from either tissue source. However, when both the epithelial and neural supply of Shh are removed, taste buds largely disappear. We conclude Shh supplied by taste nerves and local taste epithelium act in concert to support continued taste bud differentiation. However, although neurally derived Shh is in part responsible for the dependence of taste cell renewal on gustatory innervation, neurotrophic support of taste buds likely involves a complex set of factors. © 2017. Published by The Company of Biologists Ltd.

Normal spectrum of pulmonary parametric response map to differentiate lung collapsibility: distribution of densitometric classifications in healthy adult volunteers

International Nuclear Information System (INIS)

Silva, Mario; Nemec, Stefan F.; Dufresne, Valerie; Occhipinti, Mariaelena; Heidinger, Benedikt H.; Bankier, Alexander A.; Chamberlain, Ryan

2016-01-01

Pulmonary parametric response map (PRM) was proposed for quantitative densitometric phenotypization of chronic obstructive pulmonary disease. However, little is known about this technique in healthy subjects. The purpose of this study was to describe the normal spectrum of densitometric classification of pulmonary PRM in a group of healthy adults. 15 healthy volunteers underwent spirometrically monitored chest CT at total lung capacity (TLC) and functional residual capacity (FRC). The paired CT scans were analyzed by PRM for voxel-by-voxel characterization of lung parenchyma according to 4 densitometric classifications: normal lung (TLC ≥ -950 HU, FRC ≥ -856 HU); expiratory low attenuation area (LAA) (TLC ≥ -950 HU, FRC < -856 HU); dual LAA (TLC<-950 HU, FRC < -856 HU); uncharacterized (TLC < -950 HU, FRC ≥ -856 HU). PRM spectrum was 78 % ± 10 % normal lung, 20 % ± 8 % expiratory LAA, and 1 % ± 1 % dual LAA. PRM was similar between genders, there was moderate correlation between dual LAA and spirometrically assessed TLC (R = 0.531; p = 0.042), and between expiratory LAA and Vol Exp/Insp ratio (R = -0.572; p = 0.026). PRM reflects the predominance of normal lung parenchyma in a group of healthy volunteers. However, PRM also confirms the presence of physiological expiratory LAA seemingly related to air trapping and a minimal amount of dual LAA likely reflecting emphysema. (orig.)

Normal people working in normal organizations with normal equipment: system safety and cognition in a mid-air collision.

Science.gov (United States)

de Carvalho, Paulo Victor Rodrigues; Gomes, José Orlando; Huber, Gilbert Jacob; Vidal, Mario Cesar

2009-05-01

A fundamental challenge in improving the safety of complex systems is to understand how accidents emerge in normal working situations, with equipment functioning normally in normally structured organizations. We present a field study of the en route mid-air collision between a commercial carrier and an executive jet, in the clear afternoon Amazon sky in which 154 people lost their lives, that illustrates one response to this challenge. Our focus was on how and why the several safety barriers of a well structured air traffic system melted down enabling the occurrence of this tragedy, without any catastrophic component failure, and in a situation where everything was functioning normally. We identify strong consistencies and feedbacks regarding factors of system day-to-day functioning that made monitoring and awareness difficult, and the cognitive strategies that operators have developed to deal with overall system behavior. These findings emphasize the active problem-solving behavior needed in air traffic control work, and highlight how the day-to-day functioning of the system can jeopardize such behavior. An immediate consequence is that safety managers and engineers should review their traditional safety approach and accident models based on equipment failure probability, linear combinations of failures, rules and procedures, and human errors, to deal with complex patterns of coincidence possibilities, unexpected links, resonance among system functions and activities, and system cognition.

DNA-repair, cell killing and normal tissue damage

International Nuclear Information System (INIS)

Dahm-Daphi, J.; Dikomey, E.; Brammer, I.

1998-01-01

Background: Side effects of radiotherapy in normal tissue is determined by a variety of factors of which cellular and genetic contributions are described here. Material and methods: Review. Results: Normal tissue damage after irradiation is largely due to loss of cellular proliferative capacity. This can be due to mitotic cell death, apoptosis, or terminal differentiation. Dead or differentiated cells release cytokines which additionally modulate the tissue response. DNA damage, in particular non-reparable or misrepaired double-strand breaks are considered the basic lesion leading to G1-arrest and ultimately to cell inactivation. Conclusion: Evidence for genetic bases of normal tissue response, cell killing and DNA-repair capacity is presented. However, a direct link of all 3 endpoints has not yet been proved directly. (orig.) [de

A subset of sweet-sensing neurons identified by IR56d are necessary and sufficient for fatty acid taste.

Directory of Open Access Journals (Sweden)

John M Tauber

2017-11-01

Full Text Available Fat represents a calorically potent food source that yields approximately twice the amount of energy as carbohydrates or proteins per unit of mass. The highly palatable taste of free fatty acids (FAs, one of the building blocks of fat, promotes food consumption, activates reward circuitry, and is thought to contribute to hedonic feeding underlying many metabolism-related disorders. Despite a role in the etiology of metabolic diseases, little is known about how dietary fats are detected by the gustatory system to promote feeding. Previously, we showed that a broad population of sugar-sensing taste neurons expressing Gustatory Receptor 64f (Gr64f is required for reflexive feeding responses to both FAs and sugars. Here, we report a genetic silencing screen to identify specific populations of taste neurons that mediate fatty acid (FA taste. We find neurons identified by expression of Ionotropic Receptor 56d (IR56d are necessary and sufficient for reflexive feeding response to FAs. Functional imaging reveals that IR56d-expressing neurons are responsive to short- and medium-chain FAs. Silencing IR56d neurons selectively abolishes FA taste, and their activation is sufficient to drive feeding responses. Analysis of co-expression with Gr64f identifies two subpopulations of IR56d-expressing neurons. While physiological imaging reveals that both populations are responsive to FAs, IR56d/Gr64f neurons are activated by medium-chain FAs and are sufficient for reflexive feeding response to FAs. Moreover, flies can discriminate between sugar and FAs in an aversive taste memory assay, indicating that FA taste is a unique modality in Drosophila. Taken together, these findings localize FA taste within the Drosophila gustatory center and provide an opportunity to investigate discrimination between different categories of appetitive tastants.

A subset of sweet-sensing neurons identified by IR56d are necessary and sufficient for fatty acid taste.

Science.gov (United States)

Tauber, John M; Brown, Elizabeth B; Li, Yuanyuan; Yurgel, Maria E; Masek, Pavel; Keene, Alex C

2017-11-01

Fat represents a calorically potent food source that yields approximately twice the amount of energy as carbohydrates or proteins per unit of mass. The highly palatable taste of free fatty acids (FAs), one of the building blocks of fat, promotes food consumption, activates reward circuitry, and is thought to contribute to hedonic feeding underlying many metabolism-related disorders. Despite a role in the etiology of metabolic diseases, little is known about how dietary fats are detected by the gustatory system to promote feeding. Previously, we showed that a broad population of sugar-sensing taste neurons expressing Gustatory Receptor 64f (Gr64f) is required for reflexive feeding responses to both FAs and sugars. Here, we report a genetic silencing screen to identify specific populations of taste neurons that mediate fatty acid (FA) taste. We find neurons identified by expression of Ionotropic Receptor 56d (IR56d) are necessary and sufficient for reflexive feeding response to FAs. Functional imaging reveals that IR56d-expressing neurons are responsive to short- and medium-chain FAs. Silencing IR56d neurons selectively abolishes FA taste, and their activation is sufficient to drive feeding responses. Analysis of co-expression with Gr64f identifies two subpopulations of IR56d-expressing neurons. While physiological imaging reveals that both populations are responsive to FAs, IR56d/Gr64f neurons are activated by medium-chain FAs and are sufficient for reflexive feeding response to FAs. Moreover, flies can discriminate between sugar and FAs in an aversive taste memory assay, indicating that FA taste is a unique modality in Drosophila. Taken together, these findings localize FA taste within the Drosophila gustatory center and provide an opportunity to investigate discrimination between different categories of appetitive tastants.

How task demands shape brain responses to visual food cues.

Science.gov (United States)

Pohl, Tanja Maria; Tempelmann, Claus; Noesselt, Toemme

2017-06-01

Several previous imaging studies have aimed at identifying the neural basis of visual food cue processing in humans. However, there is little consistency of the functional magnetic resonance imaging (fMRI) results across studies. Here, we tested the hypothesis that this variability across studies might - at least in part - be caused by the different tasks employed. In particular, we assessed directly the influence of task set on brain responses to food stimuli with fMRI using two tasks (colour vs. edibility judgement, between-subjects design). When participants judged colour, the left insula, the left inferior parietal lobule, occipital areas, the left orbitofrontal cortex and other frontal areas expressed enhanced fMRI responses to food relative to non-food pictures. However, when judging edibility, enhanced fMRI responses to food pictures were observed in the superior and middle frontal gyrus and in medial frontal areas including the pregenual anterior cingulate cortex and ventromedial prefrontal cortex. This pattern of results indicates that task sets can significantly alter the neural underpinnings of food cue processing. We propose that judging low-level visual stimulus characteristics - such as colour - triggers stimulus-related representations in the visual and even in gustatory cortex (insula), whereas discriminating abstract stimulus categories activates higher order representations in both the anterior cingulate and prefrontal cortex. Hum Brain Mapp 38:2897-2912, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Oro-gustatory perception of dietary lipids and calcium signaling in taste bud cells are altered in nutritionally obesity-prone Psammomys obesus.

Science.gov (United States)

Abdoul-Azize, Souleymane; Atek-Mebarki, Feriel; Bitam, Arezki; Sadou, Hassimi; Koceïr, Elhadj Ahmed; Khan, Naim Akhtar

2013-01-01

Since the increasing prevalence of obesity is one of the major health problems of the modern era, understanding the mechanisms of oro-gustatory detection of dietary fat is critical for the prevention and treatment of obesity. We have conducted the present study on Psammomys obesus, the rodent desert gerbil which is a unique polygenic natural animal model of obesity. Our results show that obese animals exhibit a strong preference for lipid solutions in a two-bottle test. Interestingly, the expression of CD36, a lipido-receptor, in taste buds cells (TBC), isolated from circumvallate papillae, was decreased at mRNA level, but remained unaltered at protein level, in obese animals. We further studied the effects of linoleic acid (LA), a long-chain fatty acid, on the increases in free intracellular calcium (Ca(2+)) concentrations, [Ca(2+)]i, in the TBC of P. obesus. LA induced increases in [Ca(2+)]i, largely via CD36, from intracellular pool, followed by the opening of store-operated Ca(2+) (SOC) channels in the TBC of these animals. The action of this fatty acid on the increases in [Ca(2+)]i was higher in obese animals than that in controls. However, the release of Ca(2+) from intracellular stores, studied also by employing thapsigargin, was lower in TBC of obese animals than control rodents. In this study, we show, for the first time, that increased lipid intake and altered Ca(2+) signaling in TBC are associated with obesity in Psammomys obesus.

Modulation of taste responsiveness by the satiation hormone peptide YY

Science.gov (United States)

La Sala, Michael S.; Hurtado, Maria D.; Brown, Alicia R.; Bohórquez, Diego V.; Liddle, Rodger A.; Herzog, Herbert; Zolotukhin, Sergei; Dotson, Cedrick D.

2013-01-01

It has been hypothesized that the peripheral taste system may be modulated in the context of an animal's metabolic state. One purported mechanism for this phenomenon is that circulating gastrointestinal peptides modulate the functioning of the peripheral gustatory system. Recent evidence suggests endocrine signaling in the oral cavity can influence food intake (FI) and satiety. We hypothesized that these hormones may be affecting FI by influencing taste perception. We used immunohistochemistry along with genetic knockout models and the specific reconstitution of peptide YY (PYY) in saliva using gene therapy protocols to identify a role for PYY signaling in taste. We show that PYY is expressed in subsets of taste cells in murine taste buds. We also show, using brief-access testing with PYY knockouts, that PYY signaling modulates responsiveness to bitter-tasting stimuli, as well as to lipid emulsions. We show that salivary PYY augmentation, via viral vector therapy, rescues behavioral responsiveness to a lipid emulsion but not to bitter stimuli and that this response is likely mediated via activation of Y2 receptors localized apically in taste cells. Our findings suggest distinct functions for PYY produced locally in taste cells vs. that circulating systemically.—La Sala, M. S., Hurtado, M. D., Brown, A. R., Bohórquez, D. V., Liddle, R. A., Herzog, H., Zolotukhin, S., Dotson, C. D. Modulation of taste responsiveness by the satiation hormone peptide YY. PMID:24043261

DNA damage and the bystander response in tumor and normal cells exposed to X-rays.

Science.gov (United States)

Subhashree, M; Venkateswarlu, R; Karthik, K; Shangamithra, V; Venkatachalam, P

2017-09-01

Monolayer and suspension cultures of tumor (BMG-1, CCRF-CEM), normal (AG1522, HADF, lymphocytes) and ATM-mutant (GM4405) human cells were exposed to X-rays at doses used in radiotherapy (high dose and high dose-rate) or radiological imaging (low dose and low dose-rate). Radiation-induced DNA damage, its persistence, and possible bystander effects were evaluated, based on DNA damage markers (γ-H2AX, p53 ser15 ) and cell-cycle-specific cyclins (cyclin B1 and cyclin D1). Dose-dependent DNA damage and a dose-independent bystander response were seen after exposure to high dose and high dose-rate radiation. The level of induced damage (expression of p53 ser15 , γ-H2AX) depended on ATM status. However, low dose and dose-rate exposures neither increased expression of marker proteins nor induced a bystander response, except in the CCRF-CEM cells. Bystander effects after high-dose irradiation may contribute to stochastic and deterministic effects. Precautions to protect unexposed regions or to inhibit transmission of DNA damage signaling might reduce radiation risks. Copyright © 2017 Elsevier B.V. All rights reserved.

Ultradian rhythmicity of plasma cortisol is necessary for normal emotional and cognitive responses in man.

Science.gov (United States)

Kalafatakis, K; Russell, G M; Harmer, C J; Munafo, M R; Marchant, N; Wilson, A; Brooks, J C; Durant, C; Thakrar, J; Murphy, P; Thai, N J; Lightman, S L

2018-04-24

Glucocorticoids (GCs) are secreted in an ultradian, pulsatile pattern that emerges from delays in the feedforward-feedback interaction between the anterior pituitary and adrenal glands. Dynamic oscillations of GCs are critical for normal cognitive and metabolic function in the rat and have been shown to modulate the pattern of GC-sensitive gene expression, modify synaptic activity, and maintain stress responsiveness. In man, current cortisol replacement therapy does not reproduce physiological hormone pulses and is associated with psychopathological symptoms, especially apathy and attenuated motivation in engaging with daily activities. In this work, we tested the hypothesis that the pattern of GC dynamics in the brain is of crucial importance for regulating cognitive and behavioral processes. We provide evidence that exactly the same dose of cortisol administered in different patterns alters the neural processing underlying the response to emotional stimulation, the accuracy in recognition and attentional bias toward/away from emotional faces, the quality of sleep, and the working memory performance of healthy male volunteers. These data indicate that the pattern of the GC rhythm differentially impacts human cognition and behavior under physiological, nonstressful conditions and has major implications for the improvement of cortisol replacement therapy.

Specificity of tumor necrosis factor toxicity for human mammary carcinomas relative to normal mammary epithelium and correlation with response to doxorubicin

International Nuclear Information System (INIS)

Dollbaum, C.; Creasey, A.A.; Dairkee, S.H.; Hiller, A.J.; Rudolph, A.R.; Lin, L.; Vitt, C.; Smith, H.S.

1988-01-01

By using a unique short-term culture system capable of growing both normal and malignant breast epithelial tissue, human recombinant tumor necrosis factor (TNF) showed preferential cytotoxicity to malignant cells as compared to the corresponding nonmalignant cells. Most of the malignant specimens were sensitive to TNF with 13 of 18 specimens showing 90% inhibition of clonal growth (ID 90 ). In contrast, all 13 nonmalignant specimens tested clustered at the resistant end of the TNF response spectrum. This differential sensitivity to TNF was seen in three cases in which malignant and nonmalignant breast epithelial tissues from the same patient were studied. To investigate the mechanism of resistance to TNF by normal cells, the presence of receptors for TNF was determined. Five of six cultures showed specific binding of 125 I-labeled TNF and there was no relationship between the degree of resistance and the degree of specific binding. Simultaneous comparison of tumor responsiveness to doxorubicin and TNF revealed a positive correlation in ID 90 values; these results may have important implications for the clinical use of TNF in cancer patients heavily pretreated with doxorubicin

Trigemino-gustatory interactions: a randomized controlled clinical trial assessing the effects of selective anesthesia of dental afferents on taste thresholds.

Science.gov (United States)

Lecor, Papa Abdou; Touré, Babacar; Boucher, Yves

2018-03-01

This study aimed at analyzing the effect of the temporary removal of trigeminal dental afferents on electrogustometric thresholds (EGMt). EGMt were measured in 300 healthy subjects randomized in three groups, in nine loci on the right and left side (RS, LS) of the tongue surface before and after anesthesia. Group IAN (n = 56 RS, n = 44 LS) received intraosseous local anesthesia of the inferior alveolar nerve (IAN). Group MdN received mandibular nerve (MdN) block targeting IAN before its entrance into the mandibular foramen (n = 60, RS, and n = 40, LS); group MxN receiving maxillary nerve (MxN) anesthesia (n = 56 RS and n = 44 LS) was the control group. Differences between mean EGMt were analyzed with the Wilcoxon test; correlation between type of anesthesia and EGMt was performed with Spearman's rho, all with a level of significance set at p ≤ 0.05. Significant EGMt (μA) differences before and after anesthesia were found in all loci with MdN and IAN on the ipsilateral side (p Anesthesia of the MdN was positively correlated with the increase in EGMt (p anesthesia of IAN was positively correlated only with the increase in EGMt measured at posterior and dorsal loci of the tongue surface (p anesthesia suggests a participation of dental afferents in taste perception. Extraction of teeth may impair food intake not only due to impaired masticatory ability but also to alteration of neurological trigemino-gustatory interactions. PACTR201602001452260.

"Normality of Residuals Is a Continuous Variable, and Does Seem to Influence the Trustworthiness of Confidence Intervals: A Response to, and Appreciation of, Williams, Grajales, and Kurkiewicz (2013"

Directory of Open Access Journals (Sweden)

Jason W. Osborne

2013-09-01

Full Text Available Osborne and Waters (2002 focused on checking some of the assumptions of multiple linear.regression. In a critique of that paper, Williams, Grajales, and Kurkiewicz correctly clarify that.regression models estimated using ordinary least squares require the assumption of normally.distributed errors, but not the assumption of normally distributed response or predictor variables..They go on to discuss estimate bias and provide a helpful summary of the assumptions of multiple.regression when using ordinary least squares. While we were not as precise as we could have been.when discussing assumptions of normality, the critical issue of the 2002 paper remains -' researchers.often do not check on or report on the assumptions of their statistical methods. This response.expands on the points made by Williams, advocates a thorough examination of data prior to.reporting results, and provides an example of how incremental improvements in meeting the.assumption of normality of residuals incrementally improves the accuracy of confidence intervals.

Family history of alcoholism and the human brain response to oral sucrose

Directory of Open Access Journals (Sweden)

William J.A. Eiler, II

2018-01-01

Full Text Available A heightened hedonic response to sweet tastes has been associated with increased alcohol preference and alcohol consumption in both humans and animals. The principal goal of this study was to examine blood oxygenation level dependent (BOLD activation to high- and low-concentration sweet solutions in subjects who are either positive (FHP or negative (FHN for a family history of alcoholism. Seventy-four non-treatment seeking, community-recruited, healthy volunteers (22.8 ± 1.6 SD years; 43% men rated a range of sucrose concentrations in a taste test and underwent functional magnetic resonance imaging (fMRI during oral delivery of water, 0.83 M, and 0.10 M sucrose. Sucrose compared to water produced robust activation in primary gustatory cortex, ventral insula, amygdala, and ventral striatum. FHP subjects displayed greater bilateral amygdala activation than FHN subjects in the low sucrose concentration (0.10 M. In secondary analyses, the right amygdala response to the 0.10 M sucrose was greatest in FHP women. When accounting for group differences in drinks per week, the family history groups remained significantly different in their right amygdala response to 0.10 M sucrose. Our findings suggest that the brain response to oral sucrose differs with a family history of alcoholism, and that this response to a mildly reinforcing primary reward might be an endophenotypic marker of alcoholism risk.

Implementing a finite-state off-normal and fault response system for disruption avoidance in tokamaks

Science.gov (United States)

Eidietis, N. W.; Choi, W.; Hahn, S. H.; Humphreys, D. A.; Sammuli, B. S.; Walker, M. L.

2018-05-01

A finite-state off-normal and fault response (ONFR) system is presented that provides the supervisory logic for comprehensive disruption avoidance and machine protection in tokamaks. Robust event handling is critical for ITER and future large tokamaks, where plasma parameters will necessarily approach stability limits and many systems will operate near their engineering limits. Events can be classified as off-normal plasmas events, e.g. neoclassical tearing modes or vertical displacements events, or faults, e.g. coil power supply failures. The ONFR system presented provides four critical features of a robust event handling system: sequential responses to cascading events, event recovery, simultaneous handling of multiple events and actuator prioritization. The finite-state logic is implemented in Matlab®/Stateflow® to allow rapid development and testing in an easily understood graphical format before automated export to the real-time plasma control system code. Experimental demonstrations of the ONFR algorithm on the DIII-D and KSTAR tokamaks are presented. In the most complex demonstration, the ONFR algorithm asynchronously applies ‘catch and subdue’ electron cyclotron current drive (ECCD) injection scheme to suppress a virulent 2/1 neoclassical tearing mode, subsequently shuts down ECCD for machine protection when the plasma becomes over-dense, and enables rotating 3D field entrainment of the ensuing locked mode to allow a safe rampdown, all in the same discharge without user intervention. When multiple ONFR states are active simultaneously and requesting the same actuator (e.g. neutral beam injection or gyrotrons), actuator prioritization is accomplished by sorting the pre-assigned priority values of each active ONFR state and giving complete control of the actuator to the state with highest priority. This early experience makes evident that additional research is required to develop an improved actuator sharing protocol, as well as a methodology to

Overweight adolescents' brain response to sweetened beverages mirrors addiction pathways.

Science.gov (United States)

Feldstein Ewing, Sarah W; Claus, Eric D; Hudson, Karen A; Filbey, Francesca M; Yakes Jimenez, Elizabeth; Lisdahl, Krista M; Kong, Alberta S

2017-08-01

Many adolescents struggle with overweight/obesity, which exponentially increases in the transition to adulthood. Overweight/obesity places youth at risk for serious health conditions, including type 2 diabetes. In adults, neural substrates implicated in addiction (e.g., orbitofrontal cortex (OFC), striatum, amygdala, and ventral tegmental area) have been found to be relevant to risk for overweight/obesity. In this study, we examined three hypotheses to disentangle the potential overlap between addiction and overweight/obesity processing by examining (1) brain response to high vs. low calorie beverages, (2) the strength of correspondence between biometrics, including body mass index (BMI) and insulin resistance, and brain response and (3) the relationship between a measure of food addiction and brain response using an established fMRI gustatory cue exposure task with a sample of overweight/obese youth (M age = 16.46; M BMI = 33.1). Greater BOLD response was observed across the OFC, inferior frontal gyrus (IFG), nucleus accumbens, right amygdala, and additional frontoparietal and temporal regions in neural processing of high vs. low calorie beverages. Further, BMI scores positively correlated with BOLD activation in the high calorie > low calorie contrast in the right postcentral gyrus and central operculum. Insulin resistance positively correlated with BOLD activation across the bilateral middle/superior temporal gyrus, left OFC, and superior parietal lobe. No relationships were observed between measures of food addiction and brain response. These findings support the activation of parallel addiction-related neural pathways in adolescents' high calorie processing, while also suggesting the importance of refining conceptual and neurocognitive models to fit this developmental period.

Evaluation of fault-normal/fault-parallel directions rotated ground motions for response history analysis of an instrumented six-story building

Science.gov (United States)

Kalkan, Erol; Kwong, Neal S.

2012-01-01

According to regulatory building codes in United States (for example, 2010 California Building Code), at least two horizontal ground-motion components are required for three-dimensional (3D) response history analysis (RHA) of buildings. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHA analyses should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak responses of engineering demand parameters (EDPs) were obtained for rotation angles ranging from 0° through 180° for evaluating the FN/FP directions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.

Normal and Abnormal Behavior in Early Childhood

OpenAIRE

Spinner, Miriam R.

1981-01-01

Evaluation of normal and abnormal behavior in the period to three years of age involves many variables. Parental attitudes, determined by many factors such as previous childrearing experience, the bonding process, parental psychological status and parental temperament, often influence the labeling of behavior as normal or abnormal. This article describes the forms of crying, sleep and wakefulness, and affective responses from infancy to three years of age.

Targeted Taste Cell-specific Overexpression of Brain-derived Neurotrophic Factor in Adult Taste Buds Elevates Phosphorylated TrkB Protein Levels in Taste Cells, Increases Taste Bud Size, and Promotes Gustatory Innervation*

Science.gov (United States)

Nosrat, Irina V.; Margolskee, Robert F.; Nosrat, Christopher A.

2012-01-01

Brain-derived neurotrophic factor (BDNF) is the most potent neurotrophic factor in the peripheral taste system during embryonic development. It is also expressed in adult taste buds. There is a lack of understanding of the role of BDNF in the adult taste system. To address this, we generated novel transgenic mice in which transgene expression was driven by an α-gustducin promoter coupling BDNF expression to the postnatal expression of gustducin in taste cells. Immunohistochemistry revealed significantly stronger BDNF labeling in taste cells of high BDNF-expressing mouse lines compared with controls. We show that taste buds in these mice are significantly larger and have a larger number of taste cells compared with controls. To examine whether innervation was affected in Gust-BDNF mice, we used antibodies to neural cell adhesion molecule (NCAM) and ATP receptor P2X3. The total density of general innervation and specifically the gustatory innervation was markedly increased in high BDNF-expressing mice compared with controls. TrkB and NCAM gene expression in laser capture microdissected taste epithelia were significantly up-regulated in these mice. Up-regulation of TrkB transcripts in taste buds and elevated taste cell-specific TrkB phosphorylation in response to increased BDNF levels indicate that BDNF controls the expression and activation of its high affinity receptor in taste cells. This demonstrates a direct taste cell function for BDNF. BDNF also orchestrates and maintains taste bud innervation. We propose that the Gust-BDNF transgenic mouse models can be employed to further dissect the specific roles of BDNF in the adult taste system. PMID:22442142

Dynamic response characteristics of high temperature superconducting maglev systems: Comparison between Halbach-type and normal permanent magnet guideways

International Nuclear Information System (INIS)

Wang, B.; Zheng, J.; Che, T.; Zheng, B.T.; Si, S.S.; Deng, Z.G.

2015-01-01

Highlights: • The loading weight affects the RF tremendously. • Reducing the FCH can improve the stability of the maglev vehicle. • The Halbach-type PMG has better loading capacity than the conventional PMG. • Pre-load is an effective way to enhance the dynamic characteristic of the HTS maglev vehicle. - Abstract: The permanent magnet guideway (PMG) is very important for the performance of the high temperature superconducting (HTS) system in terms of electromagnetic force and operational stability. The dynamic response characteristics of a HTS maglev model levitating on two types of PMG, which are the normal PMG with iron flux concentration and Halbach-type PMG, were investigated by experiments. The dynamic signals for different field-cooling heights (FCHs) and loading/unloading processes were acquired and analyzed by a vibration analyzer and laser displacement sensors. The resonant frequency, stiffness and levitation height of the model were discussed. It was found that the maglev model on the Halbach-type PMG has higher resonant frequency and higher vertical stiffness compared with the normal PMG. However, the low lateral stiffness of the model on the Halbach-type PMG indicates poor lateral stability. Besides, the Halbach-type PMG has better loading capacity than the normal PMG. These results are helpful to design a suitable PMG for the HTS system in practical applications.

Dynamic response characteristics of high temperature superconducting maglev systems: Comparison between Halbach-type and normal permanent magnet guideways

Energy Technology Data Exchange (ETDEWEB)

Wang, B. [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); Zheng, J., E-mail: jzheng@swjtu.cn [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); Che, T. [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); Zheng, B.T.; Si, S.S. [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China); School of Electrical Engineering, Southwest Jiaotong University, Chengdu 610031, P R China (China); Deng, Z.G., E-mail: deng@swjtu.cn [Applied Superconductivity Laboratory, State Key Laboratory of Traction Power, Southwest Jiaotong University, Chengdu 610031, P R China (China)

2015-12-15

Highlights: • The loading weight affects the RF tremendously. • Reducing the FCH can improve the stability of the maglev vehicle. • The Halbach-type PMG has better loading capacity than the conventional PMG. • Pre-load is an effective way to enhance the dynamic characteristic of the HTS maglev vehicle. - Abstract: The permanent magnet guideway (PMG) is very important for the performance of the high temperature superconducting (HTS) system in terms of electromagnetic force and operational stability. The dynamic response characteristics of a HTS maglev model levitating on two types of PMG, which are the normal PMG with iron flux concentration and Halbach-type PMG, were investigated by experiments. The dynamic signals for different field-cooling heights (FCHs) and loading/unloading processes were acquired and analyzed by a vibration analyzer and laser displacement sensors. The resonant frequency, stiffness and levitation height of the model were discussed. It was found that the maglev model on the Halbach-type PMG has higher resonant frequency and higher vertical stiffness compared with the normal PMG. However, the low lateral stiffness of the model on the Halbach-type PMG indicates poor lateral stability. Besides, the Halbach-type PMG has better loading capacity than the normal PMG. These results are helpful to design a suitable PMG for the HTS system in practical applications.

Developmental, gustatory, and behavioral responses of leafroller larvae, Choristoneura rosaceana, to tannic acid and glucose.

Science.gov (United States)

Panzuto, M; Mauffette, Y; Alber, P J

2002-01-01

Soluble sugars are essential nutrients generally perceived as phagostimulants to most insects studied. However, tannins are known as digestibility reducers, hence deleterious to caterpillar development, and as deterrents as well. Previous work demonstrated that larvae of the polyphagous oblique-banded leafroller, Choristoneura rosaceana, performed better when reared on a control + 0.5% tannic acid diet than on the standard control diet and that larvae reared on a control + 5% glucose diet had slower development and reduced survival. This study was designed to elucidate the behavioral and neurophysiological components of the larval responses to tannic acid and glucose. C. rosaceana larvae were reared individually from the first to the sixth instar on one of four different artificial diets: (1) control; (2) control + 5% glucose; (3) control + 0.5% tannic acid; (4) control + 5% glucose + 0.5% tannic acid. After 14 days, larvae reared on the control + 5% glucose diet had not developed past the fourth instar, whereas a considerable proportion of larvae reared on the control + 0.5% tannic acid diet had already attained the pupal stage. Insects reared on the control or the control + 5% glucose + 0.5% tannic acid diet had intermediate development. with most larvae in the fifth instar. In addition, once the mid-sixth instar was reached, the feeding preferences to 25 and 300 mM glucose, 25 mM tannic acid, and 25 mM glucose + 25 mM tannic acid over water were assessed in two-choice tests. Feeding affected preference. Control-reared insects preferred feeding on treatments containing glucose and were not deterred by tannic acid. However, larvae that had been exposed to tannic acid during their development were deterred by tannic acid and their glucose discrimination was impaired. The sensitivity to glucose was also examined from neurophysiological recordings by stimulating the sugar-sensitive cell (cell 1) on the lateral styloconic sensillum of the maxillary galea with

Postsynaptic P2X3-containing receptors in gustatory nerve fibres mediate responses to all taste qualities in mice.

Science.gov (United States)

Vandenbeuch, Aurelie; Larson, Eric D; Anderson, Catherine B; Smith, Steven A; Ford, Anthony P; Finger, Thomas E; Kinnamon, Sue C

2015-03-01

Taste buds release ATP to activate ionotropic purinoceptors composed of P2X2 and P2X3 subunits, present on the taste nerves. Mice with genetic deletion of P2X2 and P2X3 receptors (double knockout mice) lack responses to all taste stimuli presumably due to the absence of ATP-gated receptors on the afferent nerves. Recent experiments on the double knockout mice showed, however, that their taste buds fail to release ATP, suggesting the possibility of pleiotropic deficits in these global knockouts. To test further the role of postsynaptic P2X receptors in afferent signalling, we used AF-353, a selective antagonist of P2X3-containing receptors to inhibit the receptors acutely during taste nerve recording and behaviour. The specificity of AF-353 for P2X3-containing receptors was tested by recording Ca(2+) transients to exogenously applied ATP in fura-2 loaded isolated geniculate ganglion neurons from wild-type and P2X3 knockout mice. ATP responses were completely inhibited by 10 μm or 100 μm AF-353, but neither concentration blocked responses in P2X3 single knockout mice wherein the ganglion cells express only P2X2-containing receptors. Furthermore, AF-353 had no effect on taste-evoked ATP release from taste buds. In wild-type mice, i.p. injection of AF-353 or simple application of the drug directly to the tongue, inhibited taste nerve responses to all taste qualities in a dose-dependent fashion. A brief access behavioural assay confirmed the electrophysiological results and showed that preference for a synthetic sweetener, SC-45647, was abolished following i.p. injection of AF-353. These data indicate that activation of P2X3-containing receptors is required for transmission of all taste qualities. © 2015 The Authors. The Journal of Physiology © 2015 The Physiological Society.

The Spatial Musical Association of Response Codes does not depend on a normal visual experience: A study with early blind individuals.

Science.gov (United States)

Cattaneo, Zaira; Lega, Carlotta; Rinaldi, Luca; Fantino, Micaela; Ferrari, Chiara; Merabet, Lotfi B; Vecchi, Tomaso

2018-02-26

Converging evidence suggests that the perception of auditory pitch exhibits a characteristic spatial organization. This pitch-space association can be demonstrated experimentally by the Spatial Musical Association of Response Codes (SMARC) effect. This is characterized by faster response times when a low-positioned key is pressed in response to a low-pitched tone, and a high-positioned key is pressed in response to a high-pitched tone. To investigate whether the development of this pitch-space association is mediated by normal visual experience, we tested a group of early blind individuals on a task that required them to discriminate the timbre of different instrument sounds with varying pitch. Results revealed a comparable pattern in the SMARC effect in both blind participants and sighted controls, suggesting that the lack of prior visual experience does not prevent the development of an association between pitch height and vertical space.

Regulation of bitter taste responses by tumor necrosis factor.

Science.gov (United States)

Feng, Pu; Jyotaki, Masafumi; Kim, Agnes; Chai, Jinghua; Simon, Nirvine; Zhou, Minliang; Bachmanov, Alexander A; Huang, Liquan; Wang, Hong

2015-10-01

Inflammatory cytokines are important regulators of metabolism and food intake. Over production of inflammatory cytokines during bacterial and viral infections leads to anorexia and reduced food intake. However, it remains unclear whether any inflammatory cytokines are involved in the regulation of taste reception, the sensory mechanism governing food intake. Previously, we showed that tumor necrosis factor (TNF), a potent proinflammatory cytokine, is preferentially expressed in a subset of taste bud cells. The level of TNF in taste cells can be further induced by inflammatory stimuli. To investigate whether TNF plays a role in regulating taste responses, in this study, we performed taste behavioral tests and gustatory nerve recordings in TNF knockout mice. Behavioral tests showed that TNF-deficient mice are significantly less sensitive to the bitter compound quinine than wild-type mice, while their responses to sweet, umami, salty, and sour compounds are comparable to those of wild-type controls. Furthermore, nerve recording experiments showed that the chorda tympani nerve in TNF knockout mice is much less responsive to bitter compounds than that in wild-type mice. Chorda tympani nerve responses to sweet, umami, salty, and sour compounds are similar between TNF knockout and wild-type mice, consistent with the results from behavioral tests. We further showed that taste bud cells express the two known TNF receptors TNFR1 and TNFR2 and, therefore, are potential targets of TNF. Together, our results suggest that TNF signaling preferentially modulates bitter taste responses. This mechanism may contribute to taste dysfunction, particularly taste distortion, associated with infections and some chronic inflammatory diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

Trans-generational desensitization and within-generational resensitization of a sucrose-best neuron in the polyphagous herbivore Helicoverpa armigera (Lepidoptera: Noctuidae)

NARCIS (Netherlands)

Ma, Ying; Li, Jingjing; Tang, Qingbo; Zhang, Xuening; Zhao, Xincheng; Yan, Fengming; Loon, van Joop J.A.

2016-01-01

Dietary exposure of insects to a feeding deterrent substance for hours to days can induce habituation and concomitant desensitization of the response of peripheral gustatory neurons to such a substance. In the present study, larvae of the herbivore Helicoverpa armigera were fed on diets

The effects of shear and normal stress paths on rock friction

International Nuclear Information System (INIS)

Olsson, W.A.

1990-01-01

The effect of variable normal stress on the coefficient of friction of smooth artificial surfaces in welded tuff was studied. The shear stress response to changes in normal stress during constant-velocity sliding suggests that friction depends on the history of the normal stress; or, more generally, the path in shear/normal stress space. 6 refs., 5 figs

Abnormal Auditory Brainstem Response (ABR Findings in a Near-Normal Hearing Child with Noonan Syndrome

Directory of Open Access Journals (Sweden)

Bahram Jalaei

2017-01-01

Full Text Available Introduction: Noonan syndrome (NS is a heterogeneous genetic disease that affects many parts of the body. It was named after Dr. Jacqueline Anne Noonan, a paediatric cardiologist.Case Report: We report audiological tests and auditory brainstem response (ABR findings in a 5-year old Malay boy with NS. Despite showing the marked signs of NS, the child could only produce a few meaningful words. Audiological tests found him to have bilateral mild conductive hearing loss at low frequencies. In ABR testing, despite having good waveform morphology, the results were atypical. Absolute latency of wave V was normal but interpeak latencies of wave’s I-V, I-II, II-III were prolonged. Interestingly, interpeak latency of waves III-V was abnormally shorter.Conclusion:Abnormal ABR results are possibly due to abnormal anatomical condition of brainstem and might contribute to speech delay.

Radiogenomics: predicting clinical normal tissue radiosensitivity

DEFF Research Database (Denmark)

Alsner, Jan

2006-01-01

Studies on the genetic basis of normal tissue radiosensitivity, or  'radiogenomics', aims at predicting clinical radiosensitivity and optimize treatment from individual genetic profiles. Several studies have now reported links between variations in certain genes related to the biological response...... to radiation injury and risk of normal tissue morbidity in cancer patients treated with radiotherapy. However, after these initial association studies including few genes, we are still far from being able to predict clinical radiosensitivity on an individual level. Recent data from our own studies on risk...

Pros and cons of rotating ground motion records to fault-normal/parallel directions for response history analysis of buildings

Science.gov (United States)

Kalkan, Erol; Kwong, Neal S.

2014-01-01

According to the regulatory building codes in the United States (e.g., 2010 California Building Code), at least two horizontal ground motion components are required for three-dimensional (3D) response history analysis (RHA) of building structures. For sites within 5 km of an active fault, these records should be rotated to fault-normal/fault-parallel (FN/FP) directions, and two RHAs should be performed separately (when FN and then FP are aligned with the transverse direction of the structural axes). It is assumed that this approach will lead to two sets of responses that envelope the range of possible responses over all nonredundant rotation angles. This assumption is examined here, for the first time, using a 3D computer model of a six-story reinforced-concrete instrumented building subjected to an ensemble of bidirectional near-fault ground motions. Peak values of engineering demand parameters (EDPs) were computed for rotation angles ranging from 0 through 180° to quantify the difference between peak values of EDPs over all rotation angles and those due to FN/FP direction rotated motions. It is demonstrated that rotating ground motions to FN/FP directions (1) does not always lead to the maximum responses over all angles, (2) does not always envelope the range of possible responses, and (3) does not provide maximum responses for all EDPs simultaneously even if it provides a maximum response for a specific EDP.

Experienced Sensory Modalities in Dream Recall

OpenAIRE

岡田, 斉

2000-01-01

The purpose of the present study is to survey the frequency of visual, auditory, kinaesthetic, cutaneous, organic, gustatory, and olfactory experience in dream recall. A total of 1267 undergraduate students completed a dream recall frequency questionnaire, which contained a question about dream recall frequency and about recall frequency of seven sensory modalities. Results showed that seven sensory modalities were divided into two groups; normally perceived sensory modalities in dreaming, wh...

Oro-gustatory perception of dietary lipids and calcium signaling in taste bud cells are altered in nutritionally obesity-prone Psammomys obesus.

Directory of Open Access Journals (Sweden)

Souleymane Abdoul-Azize

Full Text Available Since the increasing prevalence of obesity is one of the major health problems of the modern era, understanding the mechanisms of oro-gustatory detection of dietary fat is critical for the prevention and treatment of obesity. We have conducted the present study on Psammomys obesus, the rodent desert gerbil which is a unique polygenic natural animal model of obesity. Our results show that obese animals exhibit a strong preference for lipid solutions in a two-bottle test. Interestingly, the expression of CD36, a lipido-receptor, in taste buds cells (TBC, isolated from circumvallate papillae, was decreased at mRNA level, but remained unaltered at protein level, in obese animals. We further studied the effects of linoleic acid (LA, a long-chain fatty acid, on the increases in free intracellular calcium (Ca(2+ concentrations, [Ca(2+]i, in the TBC of P. obesus. LA induced increases in [Ca(2+]i, largely via CD36, from intracellular pool, followed by the opening of store-operated Ca(2+ (SOC channels in the TBC of these animals. The action of this fatty acid on the increases in [Ca(2+]i was higher in obese animals than that in controls. However, the release of Ca(2+ from intracellular stores, studied also by employing thapsigargin, was lower in TBC of obese animals than control rodents. In this study, we show, for the first time, that increased lipid intake and altered Ca(2+ signaling in TBC are associated with obesity in Psammomys obesus.

Ethics and "normal birth".

Science.gov (United States)

Lyerly, Anne Drapkin

2012-12-01

The concept of "normal birth" has been promoted as ideal by several international organizations, although debate about its meaning is ongoing. In this article, I examine the concept of normalcy to explore its ethical implications and raise a trio of concerns. First, in its emphasis on nonuse of technology as a goal, the concept of normalcy may marginalize women for whom medical intervention is necessary or beneficial. Second, in its emphasis on birth as a socially meaningful event, the mantra of normalcy may unintentionally avert attention to meaning in medically complicated births. Third, the emphasis on birth as a normal and healthy event may be a contributor to the long-standing tolerance for the dearth of evidence guiding the treatment of illness during pregnancy and the failure to responsibly and productively engage pregnant women in health research. Given these concerns, it is worth debating not just what "normal birth" means, but whether the term as an ideal earns its keep. © 2012, Copyright the Authors Journal compilation © 2012, Wiley Periodicals, Inc.

99mTc-sestamibi muscle scintigraphy to assess the response to neuromuscular electrical stimulation of normal quadriceps femoris muscle

International Nuclear Information System (INIS)

Pekindil, Y.; Sarikaya, A.; Birtane, M.; Pekindil, G.; Salan, A.

2001-01-01

Neuromuscular electrical stimulation (NMES) is widely used for improving muscle strength by simultaneous contraction in the prevention of muscle atrophy. Although there exist many clinical methods for evaluating the therapeutic response of muscles, 99m Tc-sestamibi which is a skeletal muscle perfusion and metabolism agent has not previously been used for this purpose. The aim of our work was to ascertain whether 99m Tc-sestamibi muscle scintigraphy is useful in the monitoring of therapeutic response to NMES in healthy women. The study included 16 women aged between 21 and 45, with a mean age of 32.7±6.4. Both quadriceps femoris muscles (QFM) of each patient were studied. After randomization to remove the effect of the dominant side, one QFM of each patient was subjected to the NMES procedure for a period of 20 days. NMES was performed with an alternating biphasic rectangular current, from a computed electrical stimulator daily for 23 minutes. After measurement of skinfold thickness over the thigh, pre- and post-NMES girth measurements were assessed in centimeters. Sixty minutes after injections of 555 MBq 99m Tc-sestamibi, static images of the thigh were obtained for 5 minutes. The thigh-to-knee uptake ratio was calculated by semiquantitative analysis and normalized to body surface area (NUR=normalized uptake ratio). The difference between the pre and post NMES NUR values was significant (1.76±0.31 versus 2.25±0.38, p=0.0000). The percentage (%) increase in NUR values also well correlated with the % increase in thigh girth measurements (r=0.89, p=0.0000). These results indicated that 99m Tc-sestamibi muscle scintigraphy as a new tool may be useful in evaluating therapeutic response to NMES. (author)

Expression map of a complete set of gustatory receptor genes in chemosensory organs of Bombyx mori.

Science.gov (United States)

Guo, Huizhen; Cheng, Tingcai; Chen, Zhiwei; Jiang, Liang; Guo, Youbing; Liu, Jianqiu; Li, Shenglong; Taniai, Kiyoko; Asaoka, Kiyoshi; Kadono-Okuda, Keiko; Arunkumar, Kallare P; Wu, Jiaqi; Kishino, Hirohisa; Zhang, Huijie; Seth, Rakesh K; Gopinathan, Karumathil P; Montagné, Nicolas; Jacquin-Joly, Emmanuelle; Goldsmith, Marian R; Xia, Qingyou; Mita, Kazuei

2017-03-01

Most lepidopteran species are herbivores, and interaction with host plants affects their gene expression and behavior as well as their genome evolution. Gustatory receptors (Grs) are expected to mediate host plant selection, feeding, oviposition and courtship behavior. However, due to their high diversity, sequence divergence and extremely low level of expression it has been difficult to identify precisely a complete set of Grs in Lepidoptera. By manual annotation and BAC sequencing, we improved annotation of 43 gene sequences compared with previously reported Grs in the most studied lepidopteran model, the silkworm, Bombyx mori, and identified 7 new tandem copies of BmGr30 on chromosome 7, bringing the total number of BmGrs to 76. Among these, we mapped 68 genes to chromosomes in a newly constructed chromosome distribution map and 8 genes to scaffolds; we also found new evidence for large clusters of BmGrs, especially from the bitter receptor family. RNA-seq analysis of diverse BmGr expression patterns in chemosensory organs of larvae and adults enabled us to draw a precise organ specific map of BmGr expression. Interestingly, most of the clustered genes were expressed in the same tissues and more than half of the genes were expressed in larval maxillae, larval thoracic legs and adult legs. For example, BmGr63 showed high expression levels in all organs in both larval and adult stages. By contrast, some genes showed expression limited to specific developmental stages or organs and tissues. BmGr19 was highly expressed in larval chemosensory organs (especially antennae and thoracic legs), the single exon genes BmGr53 and BmGr67 were expressed exclusively in larval tissues, the BmGr27-BmGr31 gene cluster on chr7 displayed a high expression level limited to adult legs and the candidate CO 2 receptor BmGr2 was highly expressed in adult antennae, where few other Grs were expressed. Transcriptional analysis of the Grs in B. mori provides a valuable new reference for

Immunoregulatory activities of human immunodeficiency virus (HIV) proteins: Effect of HIV recombinant and synthetic peptides on immunoglobulin synthesis and proliferative responses by normal lymphocytes

International Nuclear Information System (INIS)

Nair, M.P.N.; Pottathil, R.; Heimer, E.P.; Schwartz, S.A.

1988-01-01

Recombinant and synthetic peptides corresponding to envelope proteins of the human immunodeficiency virus (HIV) were examined for their effects on the activities of lymphocytes from normal donors in vitro. Although lymphocytes cultured with env-gag peptides produced significant amounts of IgG, addition of env-gag peptides to a pokeweed mitogen-induced B-cell activation system resulted in suppression of immunoglobulin synthesis by normal lymphocytes. Recombinant antigens, env-gag and env-80 dihydrofolate reductase (DHFR), produced a substantial proliferative response by peripheral blood mononuclear cells (PBMC) as determined by [ 3 H]thymidine incorporation. PBMC precultured with HIV synthetic peptide env 578-608 also manifested significant proliferative responses as compared to control cultures. CD3 + lymphocytes precultured with recombinant HIV antigens, env-gag and env-80 DHFR, and synthetic HIV peptide, env 487-511, showed moderate but significant proliferative responses. Both recombinant antigens and synthetic peptides also produced a dose-dependent stimulatory effect on proliferation by CD3 - lymphocytes. These studies demonstrate that recombinant and synthetic peptides of the HIV genome express immunoregulatory T- and B-cell epitopes. Identification of unique HIV epitopes with immunogenic and immunoregulatory activities is necessary for the development of an effective vaccine against HIV infection

Is abdominal wall contraction important for normal voiding in the female rat?

Directory of Open Access Journals (Sweden)

Boone Timothy B

2007-03-01

Full Text Available Abstract Background Normal voiding behavior in urethane-anesthetized rats includes contraction of the abdominal wall striated muscle, similar to the visceromotor response (VMR to noxious bladder distension. Normal rat voiding requires pulsatile release of urine from a pressurized bladder. The abdominal wall contraction accompanying urine flow may provide a necessary pressure increment for normal efficient pulsatile voiding. This study aimed to evaluate the occurrence and necessity of the voiding-associated abdominal wall activity in urethane-anesthetized female rats Methods A free-voiding model was designed to allow assessment of abdominal wall activity during voiding resulting from physiologic bladder filling, in the absence of bladder or urethral instrumentation. Physiologic diuresis was promoted by rapid intravascular hydration. Intercontraction interval (ICI, voided volumes and EMG activity of the rectus abdominis were quantified. The contribution of abdominal wall contraction to voiding was eliminated in a second group of rats by injecting botulinum-A (BTX, 5 U into each rectus abdominis to induce local paralysis. Uroflow parameters were compared between intact free-voiding and BTX-prepared animals. Results Abdominal wall response is present in free voiding. BTX preparation eliminated the voiding-associated EMG activity. Average per-void volume decreased from 1.8 ml to 1.1 ml (p Conclusion The voiding-associated abdominal wall response is a necessary component of normal voiding in urethane anesthetized female rats. As the proximal urethra may be the origin of the afferent signaling which results in the abdominal wall response, the importance of the bladder pressure increment due to this response may be in maintaining a normal duration intermittent pulsatile high frequency oscillatory (IPHFO/flow phase and thus efficient voiding. We propose the term Voiding-associated Abdominal Response (VAR for the physiologic voiding-associated EMG

How Does Food Taste in Anorexia and Bulimia Nervosa? A Protocol for a Quasi-Experimental, Cross-Sectional Design to Investigate Taste Aversion or Increased Hedonic Valence of Food in Eating Disorders

Directory of Open Access Journals (Sweden)

David Garcia-Burgos

2018-03-01

Full Text Available Background: Despite on-going efforts to better understand dysregulated eating, the olfactory-gustatory deficits and food preferences in eating disorders (ED, and the mechanisms underlying the perception of and responses to food properties in anorexia nervosa (AN and bulimia nervosa (BN remain largely unknown; both during the course of the illness and compared to healthy populations. It is, therefore, necessary to systematically investigate the gustatory perception and hedonics of taste in patients with AN and BN. To this end, we will examine whether aversions to the taste of high-calorie food is related to the suppression of energy intake in restricting-type AN, and whether an increased hedonic valence of sweet, caloric-dense foods may be part of the mechanisms triggering binge-eating episodes in BN. In addition, the role of cognitions influencing these mechanisms will be examined.Method: In study 1, four mixtures of sweet-fat stimuli will be presented in a sensory two-alternative forced-choice test involving signal detection analysis. In study 2, a full-scale taste reactivity test will be carried out, including psychophysiological and behavioral measures to assess subtle and covert hedonic changes. We will compare the responses of currently-ill AN and BN patients to those who have recovered from AN and BN, and also to those of healthy normal-weight and underweight individuals without any eating disorder pathology.Discussion: If taste response profiles are differentially linked to ED types, then future studies should investigate whether taste responsiveness represents a useful diagnostic measure in the prevention, assessment and treatment of EDs. The expected results on cognitive mechanisms in the top-down processes of food hedonics will complement current models and contribute to the refinement of interventions to change cognitive aspects of taste aversions, to establish functional food preferences and to better manage food cravings associated

How Does Food Taste in Anorexia and Bulimia Nervosa? A Protocol for a Quasi-Experimental, Cross-Sectional Design to Investigate Taste Aversion or Increased Hedonic Valence of Food in Eating Disorders

Science.gov (United States)

Garcia-Burgos, David; Maglieri, Sabine; Vögele, Claus; Munsch, Simone

2018-01-01

Background: Despite on-going efforts to better understand dysregulated eating, the olfactory-gustatory deficits and food preferences in eating disorders (ED), and the mechanisms underlying the perception of and responses to food properties in anorexia nervosa (AN) and bulimia nervosa (BN) remain largely unknown; both during the course of the illness and compared to healthy populations. It is, therefore, necessary to systematically investigate the gustatory perception and hedonics of taste in patients with AN and BN. To this end, we will examine whether aversions to the taste of high-calorie food is related to the suppression of energy intake in restricting-type AN, and whether an increased hedonic valence of sweet, caloric-dense foods may be part of the mechanisms triggering binge-eating episodes in BN. In addition, the role of cognitions influencing these mechanisms will be examined. Method: In study 1, four mixtures of sweet-fat stimuli will be presented in a sensory two-alternative forced-choice test involving signal detection analysis. In study 2, a full-scale taste reactivity test will be carried out, including psychophysiological and behavioral measures to assess subtle and covert hedonic changes. We will compare the responses of currently-ill AN and BN patients to those who have recovered from AN and BN, and also to those of healthy normal-weight and underweight individuals without any eating disorder pathology. Discussion: If taste response profiles are differentially linked to ED types, then future studies should investigate whether taste responsiveness represents a useful diagnostic measure in the prevention, assessment and treatment of EDs. The expected results on cognitive mechanisms in the top-down processes of food hedonics will complement current models and contribute to the refinement of interventions to change cognitive aspects of taste aversions, to establish functional food preferences and to better manage food cravings associated with binge

How Does Food Taste in Anorexia and Bulimia Nervosa? A Protocol for a Quasi-Experimental, Cross-Sectional Design to Investigate Taste Aversion or Increased Hedonic Valence of Food in Eating Disorders.

Science.gov (United States)

Garcia-Burgos, David; Maglieri, Sabine; Vögele, Claus; Munsch, Simone

2018-01-01

Background: Despite on-going efforts to better understand dysregulated eating, the olfactory-gustatory deficits and food preferences in eating disorders (ED), and the mechanisms underlying the perception of and responses to food properties in anorexia nervosa (AN) and bulimia nervosa (BN) remain largely unknown; both during the course of the illness and compared to healthy populations. It is, therefore, necessary to systematically investigate the gustatory perception and hedonics of taste in patients with AN and BN. To this end, we will examine whether aversions to the taste of high-calorie food is related to the suppression of energy intake in restricting-type AN, and whether an increased hedonic valence of sweet, caloric-dense foods may be part of the mechanisms triggering binge-eating episodes in BN. In addition, the role of cognitions influencing these mechanisms will be examined. Method: In study 1, four mixtures of sweet-fat stimuli will be presented in a sensory two-alternative forced-choice test involving signal detection analysis. In study 2, a full-scale taste reactivity test will be carried out, including psychophysiological and behavioral measures to assess subtle and covert hedonic changes. We will compare the responses of currently-ill AN and BN patients to those who have recovered from AN and BN, and also to those of healthy normal-weight and underweight individuals without any eating disorder pathology. Discussion: If taste response profiles are differentially linked to ED types, then future studies should investigate whether taste responsiveness represents a useful diagnostic measure in the prevention, assessment and treatment of EDs. The expected results on cognitive mechanisms in the top-down processes of food hedonics will complement current models and contribute to the refinement of interventions to change cognitive aspects of taste aversions, to establish functional food preferences and to better manage food cravings associated with binge

Normalizing Catastrophe: Sustainability and Scientism

Science.gov (United States)

Bonnett, Michael

2013-01-01

Making an adequate response to our deteriorating environmental situation is a matter of ever increasing urgency. It is argued that a central obstacle to achieving this is the way that scientism has become normalized in our thinking about environmental issues. This is taken to reflect on an underlying "metaphysics of mastery" that vitiates proper…

Visual attention and flexible normalization pools

Science.gov (United States)

Schwartz, Odelia; Coen-Cagli, Ruben

2013-01-01

Attention to a spatial location or feature in a visual scene can modulate the responses of cortical neurons and affect perceptual biases in illusions. We add attention to a cortical model of spatial context based on a well-founded account of natural scene statistics. The cortical model amounts to a generalized form of divisive normalization, in which the surround is in the normalization pool of the center target only if they are considered statistically dependent. Here we propose that attention influences this computation by accentuating the neural unit activations at the attended location, and that the amount of attentional influence of the surround on the center thus depends on whether center and surround are deemed in the same normalization pool. The resulting form of model extends a recent divisive normalization model of attention (Reynolds & Heeger, 2009). We simulate cortical surround orientation experiments with attention and show that the flexible model is suitable for capturing additional data and makes nontrivial testable predictions. PMID:23345413

The effect of palm oil, lard, and puff-pastry margarine on postprandial lipid and hormone responses in normal-weight and obese young women

DEFF Research Database (Denmark)

Jensen, Janne J. Dyrsborg; Bysted, Anette; Dawids, Steen

1999-01-01

, on postprandial lipid and hormone responses in normal-weight and obese young women. The study was performed as a randomized, crossover design. The fats differed in the content of palmitic acid, stearic acid, and traits monounsaturated fatty acids allowing a dietary comparison of different 'solid' fatty acids......Only a few studies have been published on the postprandial effects of different fatty acids in obese subjects. Therefore, the present study investigated the effects of three test meals containing palm oil (PO), lard (LD), or puff-pastry margarine (PPM), all normal dietary ingredients...... acids provided by PO, LD, and PPM have no effect in either group....

Normal and sublethally irradiated stem and granulocyte progenitor cell regeneration in an in vivo culture system. The cellular response to humoral factors released through the action of cyclophosphamide

International Nuclear Information System (INIS)

MacVittie, T.

1977-01-01

The in vivo diffusion chamber (DC) method of marrow culture was used to determine if the injection of host mice with cyclophosphamide (CY) caused, through its cytoxic action, the release of a humoral factor(s) capable of initiating stem cell (CFU-s) and granulocyte-macrophage progenitor cell (CFU-c) proliferation. Host mice were injected with CY 1-4 days prior to 800 rad of 60 Co WBI and implantation of DCs containing normal or 400 rad sublethally irradiated (SLI) marrow cells. The greatest proliferative response within CFU-s and CFU-c populations occurred in those mice injected with CY 3 days prior to implant. The marked CFU-s and CFU-c regeneration was initiated during the initial 24 hr of culture in both normal and SLI marrow cells. Thereafter growth rates were approximately the same. SLI marrow, however, showed a greater response to the humoral effects of CY injection than did normal marrow. These data provided evidence that CY induced the release of a diffusible factor(s) capable of accelerating regeneration of normal and sublethally irradiated CFU-s and CFU-c, the magnitude of which was dependent upon the time elapsed between CY injected and implantation of DCs. The marked proliferative response of the SLI stem and progenitor cells to the humoral stimulation may be indicative of the heterogeneity of both CFU-s and CFU-c populations surviving sublethal radiation exposure. The target cells may have possessed a differential sensitivity to the factor(s) initiating cell proliferation

Identification and Comparative Study of Chemosensory Genes Related to Host Selection by Legs Transcriptome Analysis in the Tea Geometrid Ectropis obliqua.

Directory of Open Access Journals (Sweden)

Long Ma

Full Text Available Host selection by female moths is fundamental to the survival of their larvae. Detecting and perceiving the non-volatile chemicals of the plant surface involved in gustatory detection determine the host preference. In many lepidopteran species, tarsal chemosensilla are sensitive to non-volatile chemicals and responsible for taste detection. The tea geometrid Ectropis obliqua is one devastating chewing pest selectively feeding on limited plants, requiring the specialized sensors to forage certain host for oviposition. In present study, we revealed the distribution of chemosensilla in the ventral side of female fifth tarsomere in E. obliqua. To investigate its molecular mechanism of gustatory perception, we performed HiSeq 2500 sequencing of the male- and female- legs transcriptome and identified 24 candidate odorant binding proteins (OBPs, 21 chemosensory proteins (CSPs, 2 sensory neuron membrane proteins (SNMPs, 3 gustatory receptors (GRs and 4 odorant receptors (ORs. Several leg-specific or enriched chemosensory genes were screened by tissue expression analysis, and clustered with functionally validated genes from other moths, suggesting the potential involvement in taste sensation or other physiological processes. The RPKM value analysis revealed that 9 EoblOBPs showed sex discrepancy in the leg expression, 8 being up-regulated in female and only 1 being over expressed in male. These female-biased EoblOBPs indicated an ecological adaption related with host-seeking and oviposition behaviors. Our work will provide basic knowledge for further studies on the molecular mechanism of gustatory perception, and enlighten a host-selection-based control strategy of insect pests.

Normal Peace: A New Strategic Narrative of Intervention

Directory of Open Access Journals (Sweden)

Nicolas Lemay-Hebert

2017-09-01

Full Text Available International actors have used multiple discursive frameworks for justifying interventions, from human security to the responsibility to protect, and, most recently, resilience-building. We argue that the language of normalization, hidden behind these narratives of interventions, has also contributed to structure the intervention landscape, albeit in less obvious and overt ways than other competing narratives of intervention. This article disentangles the different practices of normalization in order to highlight their ramifications. It introduces the concept of normal peace—a new conceptual reference to understand interventions undertaken by the international community to impose, restore or accept normalcy in turbulent societies. The article argues that the optimization of interventions entails selective responses to govern risk and adapt to the transitional international order. The art of what is politically possible underlines the choice of optimal intervention, be that to impose an external order of normalcy, restore the previous order of normalcy, or accept the existing order of normalcy.

A normalization of the physical tests for external irradiation measuring detectors

International Nuclear Information System (INIS)

1977-05-01

This report is the result of a normalization work, realized within the Radioprotection Services of the C.E.A., of the physical tests for detectors measuring external irradiation. Among the various tests mentionned are treated more in details, calibration and the establishment of the relative spectral response. As far as calibration is concerned, the normalization refers to: the reference detector, the reference radiation source, the installation and calibration procedure. As for the relative spectral response the normalization refers to: the reference detector, the radiation sources to be used. Finally, a chapter is consecrated to the high flux detectors and to those for pulsed electromagnetic radiations [fr

The Role of Cholecystokinin in Peripheral Taste Signaling in Mice

Directory of Open Access Journals (Sweden)

Ryusuke Yoshida

2017-10-01

Full Text Available Cholecystokinin (CCK is a gut hormone released from enteroendocrine cells. CCK functions as an anorexigenic factor by acting on CCK receptors expressed on the vagal afferent nerve and hypothalamus with a synergistic interaction between leptin. In the gut, tastants such as amino acids and bitter compounds stimulate CCK release from enteroendocrine cells via activation of taste transduction pathways. CCK is also expressed in taste buds, suggesting potential roles of CCK in taste signaling in the peripheral taste organ. In the present study, we focused on the function of CCK in the initial responses to taste stimulation. CCK was coexpressed with type II taste cell markers such as Gα-gustducin, phospholipase Cβ2, and transient receptor potential channel M5. Furthermore, a small subset (~30% of CCK-expressing taste cells expressed a sweet/umami taste receptor component, taste receptor type 1 member 3, in taste buds. Because type II taste cells are sweet, umami or bitter taste cells, the majority of CCK-expressing taste cells may be bitter taste cells. CCK-A and -B receptors were expressed in both taste cells and gustatory neurons. CCK receptor knockout mice showed reduced neural responses to bitter compounds compared with wild-type mice. Consistently, intravenous injection of CCK-Ar antagonist lorglumide selectively suppressed gustatory nerve responses to bitter compounds. Intravenous injection of CCK-8 transiently increased gustatory nerve activities in a dose-dependent manner whereas administration of CCK-8 did not affect activities of bitter-sensitive taste cells. Collectively, CCK may be a functionally important neurotransmitter or neuromodulator to activate bitter nerve fibers in peripheral taste tissues.

Deconstructing Interocular Suppression: Attention and Divisive Normalization.

Directory of Open Access Journals (Sweden)

Hsin-Hung Li

2015-10-01

Full Text Available In interocular suppression, a suprathreshold monocular target can be rendered invisible by a salient competitor stimulus presented in the other eye. Despite decades of research on interocular suppression and related phenomena (e.g., binocular rivalry, flash suppression, continuous flash suppression, the neural processing underlying interocular suppression is still unknown. We developed and tested a computational model of interocular suppression. The model included two processes that contributed to the strength of interocular suppression: divisive normalization and attentional modulation. According to the model, the salient competitor induced a stimulus-driven attentional modulation selective for the location and orientation of the competitor, thereby increasing the gain of neural responses to the competitor and reducing the gain of neural responses to the target. Additional suppression was induced by divisive normalization in the model, similar to other forms of visual masking. To test the model, we conducted psychophysics experiments in which both the size and the eye-of-origin of the competitor were manipulated. For small and medium competitors, behavioral performance was consonant with a change in the response gain of neurons that responded to the target. But large competitors induced a contrast-gain change, even when the competitor was split between the two eyes. The model correctly predicted these results and outperformed an alternative model in which the attentional modulation was eye specific. We conclude that both stimulus-driven attention (selective for location and feature and divisive normalization contribute to interocular suppression.

Deconstructing Interocular Suppression: Attention and Divisive Normalization.

Science.gov (United States)

Li, Hsin-Hung; Carrasco, Marisa; Heeger, David J

2015-10-01

In interocular suppression, a suprathreshold monocular target can be rendered invisible by a salient competitor stimulus presented in the other eye. Despite decades of research on interocular suppression and related phenomena (e.g., binocular rivalry, flash suppression, continuous flash suppression), the neural processing underlying interocular suppression is still unknown. We developed and tested a computational model of interocular suppression. The model included two processes that contributed to the strength of interocular suppression: divisive normalization and attentional modulation. According to the model, the salient competitor induced a stimulus-driven attentional modulation selective for the location and orientation of the competitor, thereby increasing the gain of neural responses to the competitor and reducing the gain of neural responses to the target. Additional suppression was induced by divisive normalization in the model, similar to other forms of visual masking. To test the model, we conducted psychophysics experiments in which both the size and the eye-of-origin of the competitor were manipulated. For small and medium competitors, behavioral performance was consonant with a change in the response gain of neurons that responded to the target. But large competitors induced a contrast-gain change, even when the competitor was split between the two eyes. The model correctly predicted these results and outperformed an alternative model in which the attentional modulation was eye specific. We conclude that both stimulus-driven attention (selective for location and feature) and divisive normalization contribute to interocular suppression.

{sup 99m}Tc-sestamibi muscle scintigraphy to assess the response to neuromuscular electrical stimulation of normal quadriceps femoris muscle

Energy Technology Data Exchange (ETDEWEB)

Pekindil, Y.; Sarikaya, A.; Birtane, M.; Pekindil, G.; Salan, A. [Trakya Univ., Edirne (Turkey). Hospital

2001-08-01

Neuromuscular electrical stimulation (NMES) is widely used for improving muscle strength by simultaneous contraction in the prevention of muscle atrophy. Although there exist many clinical methods for evaluating the therapeutic response of muscles, {sup 99m}Tc-sestamibi which is a skeletal muscle perfusion and metabolism agent has not previously been used for this purpose. The aim of our work was to ascertain whether {sup 99m}Tc-sestamibi muscle scintigraphy is useful in the monitoring of therapeutic response to NMES in healthy women. The study included 16 women aged between 21 and 45, with a mean age of 32.7{+-}6.4. Both quadriceps femoris muscles (QFM) of each patient were studied. After randomization to remove the effect of the dominant side, one QFM of each patient was subjected to the NMES procedure for a period of 20 days. NMES was performed with an alternating biphasic rectangular current, from a computed electrical stimulator daily for 23 minutes. After measurement of skinfold thickness over the thigh, pre- and post-NMES girth measurements were assessed in centimeters. Sixty minutes after injections of 555 MBq {sup 99m}Tc-sestamibi, static images of the thigh were obtained for 5 minutes. The thigh-to-knee uptake ratio was calculated by semiquantitative analysis and normalized to body surface area (NUR=normalized uptake ratio). The difference between the pre and post NMES NUR values was significant (1.76{+-}0.31 versus 2.25{+-}0.38, p=0.0000). The percentage (%) increase in NUR values also well correlated with the % increase in thigh girth measurements (r=0.89, p=0.0000). These results indicated that {sup 99m}Tc-sestamibi muscle scintigraphy as a new tool may be useful in evaluating therapeutic response to NMES. (author)

Proportionate-type normalized last mean square algorithms

CERN Document Server

Wagner, Kevin

2013-01-01

The topic of this book is proportionate-type normalized least mean squares (PtNLMS) adaptive filtering algorithms, which attempt to estimate an unknown impulse response by adaptively giving gains proportionate to an estimate of the impulse response and the current measured error. These algorithms offer low computational complexity and fast convergence times for sparse impulse responses in network and acoustic echo cancellation applications. New PtNLMS algorithms are developed by choosing gains that optimize user-defined criteria, such as mean square error, at all times. PtNLMS algorithms ar

Strength of Gamma Rhythm Depends on Normalization

Science.gov (United States)

Ray, Supratim; Ni, Amy M.; Maunsell, John H. R.

2013-01-01

Neuronal assemblies often exhibit stimulus-induced rhythmic activity in the gamma range (30–80 Hz), whose magnitude depends on the attentional load. This has led to the suggestion that gamma rhythms form dynamic communication channels across cortical areas processing the features of behaviorally relevant stimuli. Recently, attention has been linked to a normalization mechanism, in which the response of a neuron is suppressed (normalized) by the overall activity of a large pool of neighboring neurons. In this model, attention increases the excitatory drive received by the neuron, which in turn also increases the strength of normalization, thereby changing the balance of excitation and inhibition. Recent studies have shown that gamma power also depends on such excitatory–inhibitory interactions. Could modulation in gamma power during an attention task be a reflection of the changes in the underlying excitation–inhibition interactions? By manipulating the normalization strength independent of attentional load in macaque monkeys, we show that gamma power increases with increasing normalization, even when the attentional load is fixed. Further, manipulations of attention that increase normalization increase gamma power, even when they decrease the firing rate. Thus, gamma rhythms could be a reflection of changes in the relative strengths of excitation and normalization rather than playing a functional role in communication or control. PMID:23393427

Normal stresses in semiflexible polymer hydrogels

Science.gov (United States)

Vahabi, M.; Vos, Bart E.; de Cagny, Henri C. G.; Bonn, Daniel; Koenderink, Gijsje H.; MacKintosh, F. C.

2018-03-01

Biopolymer gels such as fibrin and collagen networks are known to develop tensile axial stress when subject to torsion. This negative normal stress is opposite to the classical Poynting effect observed for most elastic solids including synthetic polymer gels, where torsion provokes a positive normal stress. As shown recently, this anomalous behavior in fibrin gels depends on the open, porous network structure of biopolymer gels, which facilitates interstitial fluid flow during shear and can be described by a phenomenological two-fluid model with viscous coupling between network and solvent. Here we extend this model and develop a microscopic model for the individual diagonal components of the stress tensor that determine the axial response of semiflexible polymer hydrogels. This microscopic model predicts that the magnitude of these stress components depends inversely on the characteristic strain for the onset of nonlinear shear stress, which we confirm experimentally by shear rheometry on fibrin gels. Moreover, our model predicts a transient behavior of the normal stress, which is in excellent agreement with the full time-dependent normal stress we measure.

Radiation-induced normal tissue damage: implications for radiotherapy

International Nuclear Information System (INIS)

Prasanna, Pataje G.

2014-01-01

Radiotherapy is an important treatment modality for many malignancies, either alone or as a part of combined modality treatment. However, despite technological advances in physical treatment delivery, patients suffer adverse effects from radiation therapy due to normal tissue damage. These side effects may be acute, occurring during or within weeks after therapy, or intermediate to late, occurring months to years after therapy. Minimizing normal tissue damage from radiotherapy will allow enhancement of tumor killing and improve tumor control and patients quality of life. Understanding mechanisms through which radiation toxicity develops in normal tissue will facilitate the development of next generation radiation effect modulators. Translation of these agents to the clinic will also require an understanding of the impact of these protectors and mitigators on tumor radiation response. In addition, normal tissues vary in radiobiologically important ways, including organ sensitivity to radiation, cellular turnover rate, and differences in mechanisms of injury manifestation and damage response. Therefore, successful development of radiation modulators may require multiple approaches to address organ/site-specific needs. These may include treatments that modify cellular damage and death processes, inflammation, alteration of normal flora, wound healing, tissue regeneration and others, specifically to counter cancer site-specific adverse effects. Further, an understanding of mechanisms of normal tissue damage will allow development of predictive biomarkers; however harmonization of such assays is critical. This is a necessary step towards patient-specific treatment customization. Examples of important adverse effects of radiotherapy either alone or in conjunction with chemotherapy, and important limitations in the current approaches of using radioprotectors for improving therapeutic outcome will be highlighted. (author)

Cross Correlation versus Normalized Mutual Information on Image Registration

Science.gov (United States)

Tan, Bin; Tilton, James C.; Lin, Guoqing

2016-01-01

This is the first study to quantitatively assess and compare cross correlation and normalized mutual information methods used to register images in subpixel scale. The study shows that the normalized mutual information method is less sensitive to unaligned edges due to the spectral response differences than is cross correlation. This characteristic makes the normalized image resolution a better candidate for band to band registration. Improved band-to-band registration in the data from satellite-borne instruments will result in improved retrievals of key science measurements such as cloud properties, vegetation, snow and fire.

25-Hydroxycholecalciferol response to single oral cholecalciferol loading in the normal weight, overweight, and obese.

Science.gov (United States)

Camozzi, V; Frigo, A C; Zaninotto, M; Sanguin, F; Plebani, M; Boscaro, M; Schiavon, L; Luisetto, G

2016-08-01

After a single cholecalciferol load, peak serum 25-hydroxycholecalciferol (25OHD) is lower in individuals with a higher body mass index (BMI), probably due to it being distributed in a greater volume. Its subsequent disappearance from the serum is slower the higher the individual's BMI, probably due to the combination of a larger body volume and a slower release into the circulation of vitamin D stored in adipose tissue. The aim of the study is to examine 25-hydroxycholecalciferol (25OHD) response to a single oral load of cholecalciferol in the normal weight, overweight, and obese. We considered 55 healthy women aged from 25 to 67 years (mean ± SD, 50.8 ± 9.5) with a BMI ranging from 18.7 to 42 kg/m(2) (mean ± SD, 27.1 ± 6.0). The sample was divided into three groups by BMI: 20 were normal weight (BMI ≤ 25 kg/m(2)), 21 overweight (25.1 ≤ BMI ≤ 29.9 kg/ m(2)), and 14 obese (BMI ≥ 30 kg/m(2)). Each subject was given 300,000 IU of cholecalciferol orally during lunch. A fasting blood test was obtained before cholecalciferol loading and then 7, 30, and 90 days afterwards to measure serum 25OHD, 1,25 dihydroxyvitamin D [1,25 (OH)2D], parathyroid hormone (PTH), calcium (Ca), and phosphorus (P). Participants' absolute fat mass was measured using dual energy X-ray absorptiometry (DEXA). The fat mass of the normal weight subjects was significantly lower than that of the overweight, which in turn was lower than that of the obese participants. Serum 25OHD levels increased significantly in all groups, peaking 1 week after the cholecalciferol load. Peak serum 25OHD levels were lower the higher the individuals' BMI. After peaking, the 25OHD levels gradually decreased, following a significantly different trend in the three groups. The slope was similar for the overweight and obese, declining significantly more slowly than in the normal weight group. In the sample as a whole, there was a weakly significant negative correlation

Fos and Egr1 Expression in the Rat Brain in Response to Olfactory Cue after Taste-Potentiated Odor Aversion Retrieval

Science.gov (United States)

Cattarelli, Martine; Dardou, David; Datiche, Frederique

2006-01-01

When an odor is paired with a delayed illness, rats acquire a relatively weak odor aversion. In contrast, rats develop a strong aversion to an olfactory cue paired with delayed illness if it is presented simultaneously with a gustatory cue. Such a conditioning effect has been referred to as taste-potentiated odor aversion learning (TPOA). TPOA is…

An Experiential Learning Activity Demonstrating Normal and Phobic Anxiety

Science.gov (United States)

Canu, Will H.

2008-01-01

This article describes an activity for an undergraduate abnormal psychology course that used student-generated data to illustrate normal versus clinically significant anxiety responses related to specific phobias. Students (N = 37) viewed 14 images of low- or high-anxiety valence and rated their subjective response to each. Discussion in a…

Feeding stimulants in an omnivorous species, crucian carp Carassiuscarassius (Linnaeus 1758)

OpenAIRE

Olsén, K Håkan; Lundh, Torbjörn

2016-01-01

Many fish are during feeding dependent on both an olfactory and gustatory sense. Olfaction that acts as the distance sense induces arousal, food search behaviour and attraction to the source, followed by examination of food items by the gustatory sense. During buccal handling the fish decide if the feed will be rejected or swallowed. Amino acids are often stimulatory to the gustatory sense and can act as feeding stimulants. There are, however, inter-species differences concerning what kinds o...

Normalization reduces intersubject variability in cervical vestibular evoked myogenic potentials.

Science.gov (United States)

van Tilburg, Mark J; Herrmann, Barbara S; Guinan, John J; Rauch, Steven D

2014-09-01

Cervical vestibular evoked myogenic potentials are used to assess saccular and inferior vestibular nerve function. Normalization of the VEMP waveform has been proposed to reduce the variability in vestibular evoked myogenic potentials by correcting for muscle activation. In this study, we test the hypothesis that normalization of the raw cervical VEMP waveform causes a significant decrease in the intersubject variability. Prospective cohort study. Large specialty hospital, department of otolaryngology. Twenty healthy subjects were used in this study. All subjects underwent cervical vestibular evoked myogenic potential testing using short tone bursts at 250, 500, 750, and 1,000 Hz. Both intersubject and intrasubject variability was assessed. Variability between raw and normalized peak-to-peak amplitudes was compared using the coefficient of variation. Intrasubject variability was assessed using the intraclass correlation coefficient and interaural asymmetry ratio. cVEMPs were present in most ears. Highest peak-to-peak amplitudes were recorded at 750 Hz. Normalization did not alter cVEMP tuning characteristics. Normalization of the cVEMP response caused a significant reduction in intersubject variability of the peak-to-peak amplitude. No significant change was seen in the intrasubject variability. Normalization significantly reduces cVEMP intersubject variability in healthy subjects without altering cVEMP characteristics. By reducing cVEMP amplitude variation due to nonsaccular, muscle-related factors, cVEMP normalization is expected to improve the ability to distinguish between healthy and pathologic responses in the clinical application of cVEMP testing.

Dichotic and dichoptic digit perception in normal adults.

Science.gov (United States)

Lawfield, Angela; McFarland, Dennis J; Cacace, Anthony T

2011-06-01

Verbally based dichotic-listening experiments and reproduction-mediated response-selection strategies have been used for over four decades to study perceptual/cognitive aspects of auditory information processing and make inferences about hemispheric asymmetries and language lateralization in the brain. Test procedures using dichotic digits have also been used to assess for disorders of auditory processing. However, with this application, limitations exist and paradigms need to be developed to improve specificity of the diagnosis. Use of matched tasks in multiple sensory modalities is a logical approach to address this issue. Herein, we use dichotic listening and dichoptic viewing of visually presented digits for making this comparison. To evaluate methodological issues involved in using matched tasks of dichotic listening and dichoptic viewing in normal adults. A multivariate assessment of the effects of modality (auditory vs. visual), digit-span length (1-3 pairs), response selection (recognition vs. reproduction), and ear/visual hemifield of presentation (left vs. right) on dichotic and dichoptic digit perception. Thirty adults (12 males, 18 females) ranging in age from 18 to 30 yr with normal hearing sensitivity and normal or corrected-to-normal visual acuity. A computerized, custom-designed program was used for all data collection and analysis. A four-way repeated measures analysis of variance (ANOVA) evaluated the effects of modality, digit-span length, response selection, and ear/visual field of presentation. The ANOVA revealed that performances on dichotic listening and dichoptic viewing tasks were dependent on complex interactions between modality, digit-span length, response selection, and ear/visual hemifield of presentation. Correlation analysis suggested a common effect on overall accuracy of performance but isolated only an auditory factor for a laterality index. The variables used in this experiment affected performances in the auditory modality to a

Microvascular resistance in response to iodinated contrast media in normal and functionally impaired kidneys.

Science.gov (United States)

Kurihara, Osamu; Takano, Masamichi; Uchiyama, Saori; Fukuizumi, Isamu; Shimura, Tetsuro; Matsushita, Masato; Komiyama, Hidenori; Inami, Toru; Murakami, Daisuke; Munakata, Ryo; Ohba, Takayoshi; Hata, Noritake; Seino, Yoshihiko; Shimizu, Wataru

2015-12-01

Contrast-induced nephropathy (CIN) is considered to result from intrarenal vasoconstriction, and occurs more frequently in impaired than in normal kidneys. It was hypothesized that iodinated contrast media would markedly change renal blood flow and vascular resistance in functionally impaired kidneys. Thirty-six patients were enrolled (32 men; mean age, 75.3 ± 7.6 years) undergoing diagnostic coronary angiography and were divided into two groups based on the presence of chronic kidney disease (CKD), defined as an estimated glomerular filtration rate (eGFR) of contrast media. The APV and the RI were positively and inversely correlated with the eGFR at baseline, respectively (APV, R = 0.545, P = 0.001; RI, R = -0.627, P contrast media administration in the non-CKD group, but not in the CKD group (APV, P = 0.258; RI, P = 0.707). Although renal arterial resistance was higher in patients with CKD, it was not affected by contrast media administration, suggesting that patients with CKD could have an attenuated response to contrast media. © 2015 The Authors. Clinical and Experimental Pharmacology and Physiology Published by Wiley Publishing Asia Pty Ltd.

Altered insula response to sweet taste processing after recovery from anorexia and bulimia nervosa.

Science.gov (United States)

Oberndorfer, Tyson A; Frank, Guido K W; Simmons, Alan N; Wagner, Angela; McCurdy, Danyale; Fudge, Julie L; Yang, Tony T; Paulus, Martin P; Kaye, Walter H

2013-10-01

Recent studies suggest that altered function of higher-order appetitive neural circuitry may contribute to restricted eating in anorexia nervosa and overeating in bulimia nervosa. This study used sweet tastes to interrogate gustatory neurocircuitry involving the anterior insula and related regions that modulate sensory-interoceptive-reward signals in response to palatable foods. Participants who had recovered from anorexia nervosa and bulimia nervosa were studied to avoid confounding effects of altered nutritional state. Functional MRI measured brain response to repeated tastes of sucrose and sucralose to disentangle neural processing of caloric and noncaloric sweet tastes. Whole-brain functional analysis was constrained to anatomical regions of interest. Relative to matched comparison women (N=14), women recovered from anorexia nervosa (N=14) had significantly diminished and women recovered from bulimia nervosa (N=14) had significantly elevated hemodynamic response to tastes of sucrose in the right anterior insula. Anterior insula response to sucrose compared with sucralose was exaggerated in the recovered group (lower in women recovered from anorexia nervosa and higher in women recovered from bulimia nervosa). The anterior insula integrates sensory reward aspects of taste in the service of nutritional homeostasis. One possibility is that restricted eating and weight loss occur in anorexia nervosa because of a failure to accurately recognize hunger signals, whereas overeating in bulimia nervosa could represent an exaggerated perception of hunger signals. This response may reflect the altered calibration of signals related to sweet taste and the caloric content of food and may offer a pathway to novel and more effective treatments.

Biting off more than you can chew: sexual selection on the free amino acid composition of the spermatophylax in decorated crickets

Science.gov (United States)

Gershman, Susan N.; Mitchell, Christopher; Sakaluk, Scott K.; Hunt, John

2012-01-01

Nuptial food gifts function to enhance male fertilization success, but their consumption is not always beneficial to females. In decorated crickets, the spermatophore transferred at mating includes a gelatinous mass, the spermatophylax, which is consumed by females after mating. However, females often discard spermatophylaxes shortly after mating, whereupon they terminate sperm transfer. We hypothesized that females discard gifts based on their assessment of the gift itself, and specifically the composition of free amino acids. We tested this hypothesis by comparing spermatophylaxes discarded by females after mating with those that were destined to be fully consumed, and employed multivariate selection analysis to quantify the strength and form of multivariate sexual selection operating on the free amino acid composition of gifts. The analysis yielded a saddle-shaped fitness surface with two local peaks. Different amino acid profiles appear to elicit continued feeding on the spermatophylax either because they offer the same level of gustatory appeal, or because they differentially affect both the gustatory appeal and texture of the spermatophylax. We conclude that the gustatory response of females to males' nuptial food gifts represents an important avenue of post-copulatory mate choice, imposing significant sexual selection on the free amino acid composition of the spermatophylax. PMID:22357263

Revisiting the slow force response: the role of the PKG signaling pathway in the normal and the ischemic heart.

Science.gov (United States)

Castro-Ferreira, Ricardo; Neves, João Sérgio; Ladeiras-Lopes, Ricardo; Leite-Moreira, André M; Neiva-Sousa, Manuel; Almeida-Coelho, João; Ferreira-Martins, João; F Leite-Moreira, Adelino

2014-09-01

The myocardial response to acute stretch consists of a two-phase increase in contractility: an acute increase by the Frank-Starling mechanism and a gradual and time-dependent increase in force generated known as the slow force response (SFR). The SFR is actively modulated by different signaling pathways, but the role of protein kinase G (PKG) signaling is unknown. In this study we aim to characterize the role of the PKG signaling pathway in the SFR under normal and ischemic conditions. Rabbit papillary muscles were stretched from 92 to 100% of maximum length (Lmax) under basal conditions, in the absence (1) or presence of: a PKG agonist (2) and a PKG inhibitor (3); under ischemic conditions in the absence (4) or presence of: a PKG agonist (5); a nitric oxide (NO) donor (6) and a phosphodiesterase 5 (PDE5) inhibitor (7). Under normoxia, the SFR was significantly attenuated by inhibition of PKG and remained unaltered with PKG activation. Ischemia induced a progressive decrease in myocardial contractility after stretch. Neither the PKG agonist nor the NO donor altered the myocardial response to stretch under ischemic conditions. However, the use of a PDE5 inhibitor in ischemia partially reversed the progressive deterioration in contractility. PKG activity is essential for the SFR. During ischemia, a progressive decline in the force is observed in response to acute myocardial stretch. This dysfunctional response can be partially reversed by the use of PDE5 inhibitors. Copyright © 2013 Sociedade Portuguesa de Cardiologia. Published by Elsevier España. All rights reserved.

Expression of an engineered heterologous antimicrobial peptide in potato alters plant development and mitigates normal abiotic and biotic responses.

Directory of Open Access Journals (Sweden)

Ravinder K Goyal

Full Text Available Antimicrobial cationic peptides (AMPs are ubiquitous small proteins used by living cells to defend against a wide spectrum of pathogens. Their amphipathic property helps their interaction with negatively charged cellular membrane of the pathogen causing cell lysis and death. AMPs also modulate signaling pathway(s and cellular processes in animal models; however, little is known of cellular processes other than the pathogen-lysis phenomenon modulated by AMPs in plants. An engineered heterologous AMP, msrA3, expressed in potato was previously shown to cause resistance of the transgenic plants against selected fungal and bacterial pathogens. These lines together with the wild type were studied for growth habits, and for inducible defense responses during challenge with biotic (necrotroph Fusarium solani and abiotic stressors (dark-induced senescence, wounding and temperature stress. msrA3-expression not only conferred protection against F. solani but also delayed development of floral buds and prolonged vegetative phase. Analysis of select gene transcript profiles showed that the transgenic potato plants were suppressed in the hypersensitive (HR and reactive oxygen species (ROS responses to both biotic and abiotic stressors. Also, the transgenic leaves accumulated lesser amounts of the defense hormone jasmonic acid upon wounding with only a slight change in salicylic acid as compared to the wild type. Thus, normal host defense responses to the pathogen and abiotic stressors were mitigated by msrA3 expression suggesting MSRA3 regulates a common step(s of these response pathways. The stemming of the pathogen growth and mitigating stress response pathways likely contributes to resource reallocation for higher tuber yield.

Normal Movement Selectivity in Autism

OpenAIRE

Dinstein, Ilan; Thomas, Cibu; Humphreys, Kate; Minshew, Nancy; Behrmann, Marlene; Heeger, David J.

2010-01-01

It has been proposed that individuals with autism have difficulties understanding the goals and intentions of others because of a fundamental dysfunction in the mirror neuron system. Here, however, we show that individuals with autism exhibited not only normal fMRI responses in mirror system areas during observation and execution of hand movements, but also exhibited typical movement-selective adaptation (repetition suppression) when observing or executing the same movement repeatedly. Moveme...

Empirical Radiometric Normalization of Road Points from Terrestrial Mobile Lidar System

Directory of Open Access Journals (Sweden)

Tee-Ann Teo

2015-05-01

Full Text Available Lidar data provide both geometric and radiometric information. Radiometric information is influenced by sensor and target factors and should be calibrated to obtain consistent energy responses. The radiometric correction of airborne lidar system (ALS converts the amplitude into a backscatter cross-section with physical meaning value by applying a model-driven approach. The radiometric correction of terrestrial mobile lidar system (MLS is a challenging task because it does not completely follow the inverse square range function at near-range. This study proposed a radiometric normalization workflow for MLS using a data-driven approach. The scope of this study is to normalize amplitude of road points for road surface classification, assuming that road points from different scanners or strips should have similar responses in overlapped areas. The normalization parameters for range effect were obtained from crossroads. The experiment showed that the amplitude difference between scanners and strips decreased after radiometric normalization and improved the accuracy of road surface classification.

Response of right ventricular size, function, and pressure to supine exercise: a comparison of patients with chronic obstructive lung disease and normal subjects

Energy Technology Data Exchange (ETDEWEB)

Slutsky, R; Hooper, W; Ackerman, W; Moser, K

1982-12-01

The response of right ventricular ejection fraction (RVEF) and right ventricular end-diastolic volume (RVEDV) to exercise was studied in 11 patients with severe (FEV/sub 25/sub(%)sub(-)/sub 75/sub(%)=0.32+-0.13, mean+-SD) chronic obstructive pulmonary disease (COPD). Using gated radionuclide cardiac blood pool imaging techniques, the response of the patients with COPD was compared with that of 15 control subjects. Arterial blood gases, pulmonary arterial pressures, wedge pressure, and right ventricular pressures also were monitored in patients with COPD. The resting RVEF was lower and the resting RVEDV was higher in patients with COPD than in normals (both, P<0.01). Two of the 11 COPD patients had a RVEF during rest that was below lower limits, while 10 of 11 patients had RV dilation. Right ventricular end-diastolic pressure, measured during rest in patients with COPD, was normal (6.1+-2.1 mm Hg) and cardiac index was within normal limits (3.55+-0.82 l/min/m/sup 2/). With exercise this cardiac index rose to 5.52+-1.7/min/m/sup 2/(P<0.01) due to the increase in heart rate (83+-18 to 125+-25 beats/min; P<0.01) while stroke volume did not significantly change. During exercise, normal subjects showed an increase in RVEF while RVEDV did not change; in patients with COPD, the RVEF fell and the RVEDV increased. In the patients with COPD, mild resting arterial hypoxemia and hypercapnia were both exaggerated during exercise; and mild resting pulmonary arterial hypertension (PAm=24.3+-7.65 mm Hg) also worsened with exercise (PAm=41+-19 mm Hg, P<0.01). Correlation between change in RVEF and PAm was -0.58, and between change in RVEDV and PAm was 0.63. We conclude that patients with severe COPD often have right ventricular dilation at rest and commonly respond to supine exercise with a fall in FV ejection fraction and further dilation of the right ventricle.

Radiotherapy- and chemotherapy-induced normal tissue damage. The role of cytokines and adhesion molecules

International Nuclear Information System (INIS)

Plevova, P.

2002-01-01

Background. Ionising radiation and cytostatic agents used in cancer therapy exert damaging effects on normal tissues and induce a complex response at the cellular and molecular levels. Cytokines and adhesion molecules are involved in this response. Methods. Published data on the given topic have been reviewed. Results and conclusions. Various cytokines and adhesion molecules, including tumor necrosis factor α, interleukins- 1,-2,-4, and -6, interferon γ, granulocyte macrophage- and macrophage- colony stimulating factors, transforming growth factor β, platelet-derived growth factor, insulin-like growth factor I, fibroblast and epidermal growth factors, platelet-activating factor, intercellular adhesion molecule-1, vascular cell adhesion molecule-1, E- and P-selectins are involved in the response of normal tissues to ionizing radiation- and chemotherapy- induced normal tissues damage and are co-responsible for some side effects of these treatment modalities, including fever, anorexia and fatigue, suppression of hematopoiesis, both acute and late local tissue response. (author)

Mouse genetic approaches applied to the normal tissue radiation response

International Nuclear Information System (INIS)

Haston, Christina K.

2012-01-01

The varying responses of inbred mouse models to radiation exposure present a unique opportunity to dissect the genetic basis of radiation sensitivity and tissue injury. Such studies are complementary to human association studies as they permit both the analysis of clinical features of disease, and of specific variants associated with its presentation, in a controlled environment. Herein I review how animal models are studied to identify specific genetic variants influencing predisposition to radiation-induced traits. Among these radiation-induced responses are documented strain differences in repair of DNA damage and in extent of tissue injury (in the lung, skin, and intestine) which form the base for genetic investigations. For example, radiation-induced DNA damage is consistently greater in tissues from BALB/cJ mice, than the levels in C57BL/6J mice, suggesting there may be an inherent DNA damage level per strain. Regarding tissue injury, strain specific inflammatory and fibrotic phenotypes have been documented for principally, C57BL/6 C3H and A/J mice but a correlation among responses such that knowledge of the radiation injury in one tissue informs of the response in another is not evident. Strategies to identify genetic differences contributing to a trait based on inbred strain differences, which include linkage analysis and the evaluation of recombinant congenic (RC) strains, are presented, with a focus on the lung response to irradiation which is the only radiation-induced tissue injury mapped to date. Such approaches are needed to reveal genetic differences in susceptibility to radiation injury, and also to provide a context for the effects of specific genetic variation uncovered in anticipated clinical association studies. In summary, mouse models can be studied to uncover heritable variation predisposing to specific radiation responses, and such variations may point to pathways of importance to phenotype development in the clinic.

Hypothalamic amenorrhea with normal body weight: ACTH, allopregnanolone and cortisol responses to corticotropin-releasing hormone test.

Science.gov (United States)

Meczekalski, B; Tonetti, A; Monteleone, P; Bernardi, F; Luisi, S; Stomati, M; Luisi, M; Petraglia, F; Genazzani, A R

2000-03-01

Hypothalamic amenorrhea (HA) is a functional disorder caused by disturbances in gonadotropin-releasing hormone (GnRH) pulsatility. The mechanism by which stress alters GnRH release is not well known. Recently, the role of corticotropin-releasing hormone (CRH) and neurosteroids in the pathophysiology of HA has been considered. The aim of the present study was to explore further the role of the hypothalamic-pituitary-adrenal axis in HA. We included 8 patients (aged 23.16+/-1.72 years) suffering from hypothalamic stress-related amenorrhea with normal body weight and 8 age-matched healthy controls in the follicular phase of the menstrual cycle. We measured basal serum levels of FSH, LH, and estradiol and evaluated ACTH, allopregnanolone and cortisol responses to CRH test in both HA patients and healthy women. Serum basal levels of FSH, LH, and estradiol as well as basal levels of allopregnanolone were significantly lower in HA patients than in controls (P<0.001) while basal ACTH and cortisol levels were significantly higher in amenorrheic patients with respect to controls (P<0.001). The response (area under the curve) of ACTH, allopregnanolone and cortisol to CRH was significantly lower in amenorrheic women compared with controls (P<0.001, P<0.05, P<0.05 respectively). In conclusion, women with HA, despite the high ACTH and cortisol levels and, therefore, hypothalamus-pituitary-adrenal axis hyperactivity, are characterized by low allopregnanolone basal levels, deriving from an impairment of both adrenal and ovarian synthesis. The blunted ACTH, allopregnanolone and cortisol responses to CRH indicate that, in hypothalamic amenorrhea, there is a reduced sensitivity and expression of CRH receptor. These results open new perspectives on the role of neurosteroids in the pathogenesis of hypothalamic amenorrhea.

Using the ovarian sensitivity index to define poor, normal, and high response after controlled ovarian hyperstimulation in the long gonadotropin-releasing hormone-agonist protocol: suggestions for a new principle to solve an old problem.

Science.gov (United States)

Huber, Malin; Hadziosmanovic, Nermin; Berglund, Lars; Holte, Jan

2013-11-01

To explore the utility of using the ratio between oocyte yield and total dose of FSH, i.e., the ovarian sensitivity index (OSI), to define ovarian response patterns. Retrospective cross-sectional study. University-affiliated private center. The entire unselected cohort of 7,520 IVF/intracytoplasmic sperm injection treatments (oocyte pick-ups [OPUs]) during an 8-year period (long GnRH agonist-recombinant FSH protocol). None. The distribution of the OSI (oocytes recovered × 1,000/total dose of FSH), the cutoff levels for poor and high response, set at ±1 SD, and the relationship between OSI and treatment outcome. OSI showed a log-normal distribution with cutoff levels for poor and high response at 1.697/IU and 10.07/IU, respectively. A nomogram is presented. Live-birth rates per OPU were 10.5 ± 0.1%, 26.9 ± 0.6%, and 36.0 ± 1.4% for poor, normal, and high response treatments, respectively. The predictive power (C-statistic) for OSI to predict live birth was superior to that of oocyte yield. The OSI improves the definition of ovarian response patterns because it takes into account the degree of stimulation. The nomogram presents evidence-based cutoff levels for poor, normal, and high response and could be used for unifying study designs involving ovarian response patterns. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Radionuclide ventriculography during rest and exercise: normal values

International Nuclear Information System (INIS)

Ludwig, E.B.; Marroni, B.J.; Achutti, A.C.; Anselmi, O.E.; Rabin, M.

1983-01-01

Twenty young volunteers of both sexes were examined by radioisotopic techniques to establish the normal range of ventricular function at rest and the response to a stress test (systolic arterious pressure X cardiac frequency > 25000). (M.A.C.) [pt

Numerical Study on Dynamic Response of a Horizontal Layered-Structure Rock Slope under a Normally Incident Sv Wave

Directory of Open Access Journals (Sweden)

Zhifa Zhan

2017-07-01

Full Text Available Several post-earthquake investigations have indicated that the slope structure plays a leading role in the stability of rock slopes under dynamic loads. In this paper, the dynamic response of a horizontal layered-structure rock slope under harmonic Sv wave is studied by making use of the Fast Lagrangian Analysis of Continua method (FLAC. The suitability of FLAC for studying wave transmission across rock joints is validated through comparison with analytical solutions. After parametric studies on Sv wave transmission across the horizontal layered-structure rock slope, it is found that the acceleration amplification coefficient η, which is defined as the ratio of the acceleration at the monitoring point to the value at the toe, wavily increases with an increase of the height along the slope surface. Meanwhile, the fluctuation weakens with normalized joint stiffness K increasing and enhances with normalized joint spacing ξ increasing. The acceleration amplification coefficient of the slope crest ηcrest does not monotonously increase with the increase of ξ, but decreases with the increase of K. Additionally, ηcrest is more sensitive to ξ compared to K. From the contour figures, it can also be found that the contour figures of η take on rhythm, and the effects of ξ on the acceleration amplification coefficient are more obvious compared to the effects on K.

Imunidade na gestação normal e na paciente com lúpus eritematoso sistêmico (LES Immunity in the normal pregnancy and in the patient with systemic lupus erythematosus (SLE

Directory of Open Access Journals (Sweden)

Alessandra Cardoso Pereira

2005-06-01

Full Text Available A gravidez é uma condição fisiológica na qual ocorrem várias mudanças imunoendócrinas com a finalidade de facilitar a imunossupressão e a tolerância aos antígenos paternos e fetais. Na gravidez humana normal existe uma relativa supressão de citocinas tipo Th1 na resposta dos linfócitos, levando a uma prevalência na resposta do tipo Th2. No LES, onde prevalece a resposta imune do tipo Th2, a gravidez pode estar relacionada com a ativação da doença. Este artigo é uma revisão dessas alterações relacionadas com a resposta imune durante a gestação normal e na da paciente com LES.Pregnancy is a physiologic condition where several immuno-endocrine changes take place with the aim of facilitating immunosuppression and tolerance towards paternal and fetal antigens. In normal human pregnancy there is a relative suppression of Th1 type cytokines in response to lymphocytes, leading to a Th2 type response. In SLE, where a Th2 type response prevails, pregnancy may exacerbate the disease. This article reviews the alterations related to the immune response during normal pregnancy and in SLE patients.

Single Cell Chemical Cytometry of Akt Activity in Rheumatoid Arthritis and Normal Fibroblast-like Synoviocytes in Response to Tumor Necrosis Factor α.

Science.gov (United States)

Mainz, Emilie R; Serafin, D Stephen; Nguyen, Tuong T; Tarrant, Teresa K; Sims, Christopher E; Allbritton, Nancy L

2016-08-02

The etiology of rheumatoid arthritis (RA) is poorly understood, and 30% of patients are unresponsive to established treatments targeting tumor necrosis factor α (TNFα). Akt kinase is implicated in TNFα signaling and may act as a barometer of patient responses to biologic therapies. Fluorescent peptide sensors and chemical cytometry were employed to directly measure Akt activity as well as proteolytic activity in individual fibroblast-like synoviocytes (FLS) from RA and normal subjects. The specificity of the peptide reporter was evaluated and shown to be a valid measure of Akt activity in single cells. The effect of TNFα treatment on Akt activity was highly heterogeneous between normal and RA subjects, which was not observable in bulk analyses. In 2 RA subjects, a bimodal distribution of Akt activity was observed, primarily due to a subpopulation (21.7%: RA Subject 5; 23.8%: RA Subject 6) of cells in which >60% of the reporter was phosphorylated. These subjects also possessed statistically elevated proteolytic cleavage of the reporter relative to normal subjects, suggesting heterogeneity in Akt and protease activity that may play a role in the RA-affected joint. We expect that chemical cytometry studies pairing peptide reporters with capillary electrophoresis will provide valuable data regarding aberrant kinase activity from small samples of clinical interest.

Prolactin-sensitive neurons express estrogen receptor-α and depend on sex hormones for normal responsiveness to prolactin.

Science.gov (United States)

Furigo, Isadora C; Kim, Ki Woo; Nagaishi, Vanessa S; Ramos-Lobo, Angela M; de Alencar, Amanda; Pedroso, João A B; Metzger, Martin; Donato, Jose

2014-05-30

Estrogens and prolactin share important target tissues, including the gonads, brain, liver, kidneys and some types of cancer cells. Herein, we sought anatomical and functional evidence of possible crosstalk between prolactin and estrogens in the mouse brain. First, we determined the distribution of prolactin-responsive neurons that express the estrogen receptor α (ERα). A large number of prolactin-induced pSTAT5-immunoreactive neurons expressing ERα mRNA were observed in several brain areas, including the anteroventral periventricular nucleus, medial preoptic nucleus, arcuate nucleus of the hypothalamus, ventrolateral subdivision of the ventromedial nucleus of the hypothalamus (VMH), medial nucleus of the amygdala and nucleus of the solitary tract. However, although the medial preoptic area, periventricular nucleus of the hypothalamus, paraventricular nucleus of the hypothalamus, retrochiasmatic area, dorsomedial subdivision of the VMH, lateral hypothalamic area, dorsomedial nucleus of the hypothalamus and ventral premammillary nucleus contained significant numbers of prolactin-responsive neurons, these areas showed very few pSTAT5-immunoreactive cells expressing ERα mRNA. Second, we evaluated prolactin sensitivity in ovariectomized mice and observed that sex hormones are required for a normal responsiveness to prolactin as ovariectomized mice showed a lower number of prolactin-induced pSTAT5 immunoreactive neurons in all analyzed brain nuclei compared to gonad-intact females. In addition, we performed hypothalamic gene expression analyses to determine possible post-ovariectomy changes in components of prolactin signaling. We observed no significant changes in the mRNA expression of prolactin receptor, STAT5a or STAT5b. In summary, sex hormones exert a permissive role in maintaining the brain's prolactin sensitivity, most likely through post-transcriptional mechanisms. Copyright © 2014 Elsevier B.V. All rights reserved.

Effect of luminance contrast on BOLD-fMRI response in deaf and normal occipital visual cortex

International Nuclear Information System (INIS)

Xue Yanping; Zhai Renyou; Jiang Tao; Cui Yong; Zhou Tiangang; Rao Hengyi; Zhuo Yan

2002-01-01

Objective: To examine the effect of luminance contrast stimulus by using blood oxygenation level dependent functional magnetic resonance imaging (BOLD-fMRI) within deaf occipital visual cortex, and to compare the distribution, extent, and intensity of activated areas between deaf subjects and normal hearing subjects. Methods: Twelve deaf subjects (average age 16.5) and 15 normal hearing subjects (average age 23.7) were stimulated by 4 kinds of luminance contrast (0.7, 2.2, 50.0, 180.0 lm). The fMRI data were collected on GE 1.5 T Signa Horizon LX MRI system and analyzed by AFNI to generate the activation map. Results: Responding to all 4 kinds of stimulus luminance contrast, all deaf and normal subjects showed significant activations in occipital visual cortex. For both deaf and normal subjects, the number of activated pixels increased significantly with increasing luminance contrast (F normal = 4.27, P deaf = 6.41, P 0.05). The local mean activation level for all activated pixels remained constant with increasing luminance contrast. However, there was an increase in the mean activation level for those activated pixels common to all trials as the stimulus luminance contrast was increased, but no significant difference was found within them (F normal = 0.79, P > 0.05; F deaf = 1.6, P > 0.05). Conclusion: The effect of luminance contrast on occipital visual cortex of deaf is similar to but somewhat higher than that of normal hearing subjects. In addition, it also proved that fMRI is a feasible method in the study of the deaf visual cortex

Are cancer cells really softer than normal cells?

Science.gov (United States)

Alibert, Charlotte; Goud, Bruno; Manneville, Jean-Baptiste

2017-05-01

Solid tumours are often first diagnosed by palpation, suggesting that the tumour is more rigid than its surrounding environment. Paradoxically, individual cancer cells appear to be softer than their healthy counterparts. In this review, we first list the physiological reasons indicating that cancer cells may be more deformable than normal cells. Next, we describe the biophysical tools that have been developed in recent years to characterise and model cancer cell mechanics. By reviewing the experimental studies that compared the mechanics of individual normal and cancer cells, we argue that cancer cells can indeed be considered as softer than normal cells. We then focus on the intracellular elements that could be responsible for the softening of cancer cells. Finally, we ask whether the mechanical differences between normal and cancer cells can be used as diagnostic or prognostic markers of cancer progression. © 2017 Société Française des Microscopies and Société de Biologie Cellulaire de France. Published by John Wiley & Sons Ltd.

Evidence for a role of glutamate as an efferent transmitter in taste buds

Directory of Open Access Journals (Sweden)

Anderson Catherine B

2010-06-01

Full Text Available Abstract Background Glutamate has been proposed as a transmitter in the peripheral taste system in addition to its well-documented role as an umami taste stimulus. Evidence for a role as a transmitter includes the presence of ionotropic glutamate receptors in nerve fibers and taste cells, as well as the expression of the glutamate transporter GLAST in Type I taste cells. However, the source and targets of glutamate in lingual tissue are unclear. In the present study, we used molecular, physiological and immunohistochemical methods to investigate the origin of glutamate as well as the targeted receptors in taste buds. Results Using molecular and immunohistochemical techniques, we show that the vesicular transporters for glutamate, VGLUT 1 and 2, but not VGLUT3, are expressed in the nerve fibers surrounding taste buds but likely not in taste cells themselves. Further, we show that P2X2, a specific marker for gustatory but not trigeminal fibers, co-localizes with VGLUT2, suggesting the VGLUT-expressing nerve fibers are of gustatory origin. Calcium imaging indicates that GAD67-GFP Type III taste cells, but not T1R3-GFP Type II cells, respond to glutamate at concentrations expected for a glutamate transmitter, and further, that these responses are partially blocked by NBQX, a specific AMPA/Kainate receptor antagonist. RT-PCR and immunohistochemistry confirm the presence of the Kainate receptor GluR7 in Type III taste cells, suggesting it may be a target of glutamate released from gustatory nerve fibers. Conclusions Taken together, the results suggest that glutamate may be released from gustatory nerve fibers using a vesicular mechanism to modulate Type III taste cells via GluR7.

Changes in phosphatidylcholine fatty acid composition are associated with altered skeletal muscle insulin responsiveness in normal man.

Science.gov (United States)

Clore, J N; Harris, P A; Li, J; Azzam, A; Gill, R; Zuelzer, W; Rizzo, W B; Blackard, W G

2000-02-01

The fatty acid composition of skeletal muscle cell membrane phospholipids (PLs) is known to influence insulin responsiveness in man. We have recently shown that the fatty acid composition of phosphatidylcholine (PC), and not phosphatidylethanolamine (PE), from skeletal muscle membranes is of particular importance in this relationship. Efforts to alter the PL fatty acid composition in animal models have demonstrated induction of insulin resistance. However, it has been more difficult to determine if changes in insulin sensitivity are associated with changes in the skeletal muscle membrane fatty acid composition of PL in man. Using nicotinic acid (NA), an agent known to induce insulin resistance in man, 9 normal subjects were studied before and after treatment for 1 month. Skeletal muscle membrane fatty acid composition of PC and PE from biopsies of vastus lateralis was correlated with insulin responsiveness using a 3-step hyperinsulinemic-euglycemic clamp. Treatment with NA was associated with a 25% increase in the half-maximal insulin concentration ([ED50] 52.0 +/- 7.5 to 64.6 +/- 9.0 microU/mL, P insulin sensitivity. Significant changes in the fatty acid composition of PC, but not PE, were also observed after NA administration. An increase in the percentage of 16:0 (21% +/- 0.3% to 21.7% +/- 0.4%, P insulin resistance with NA is associated with changes in the fatty acid composition of PC in man.

Attention and normalization circuits in macaque V1

Science.gov (United States)

Sanayei, M; Herrero, J L; Distler, C; Thiele, A

2015-01-01

Attention affects neuronal processing and improves behavioural performance. In extrastriate visual cortex these effects have been explained by normalization models, which assume that attention influences the circuit that mediates surround suppression. While normalization models have been able to explain attentional effects, their validity has rarely been tested against alternative models. Here we investigate how attention and surround/mask stimuli affect neuronal firing rates and orientation tuning in macaque V1. Surround/mask stimuli provide an estimate to what extent V1 neurons are affected by normalization, which was compared against effects of spatial top down attention. For some attention/surround effect comparisons, the strength of attentional modulation was correlated with the strength of surround modulation, suggesting that attention and surround/mask stimulation (i.e. normalization) might use a common mechanism. To explore this in detail, we fitted multiplicative and additive models of attention to our data. In one class of models, attention contributed to normalization mechanisms, whereas in a different class of models it did not. Model selection based on Akaike's and on Bayesian information criteria demonstrated that in most cells the effects of attention were best described by models where attention did not contribute to normalization mechanisms. This demonstrates that attentional influences on neuronal responses in primary visual cortex often bypass normalization mechanisms. PMID:25757941

Mitogen-stimulated phospholipid synthesis in normal and immune-deficient human B cells

International Nuclear Information System (INIS)

Chien, M.M.; Yokoyama, W.M.; Ashman, R.F.

1986-01-01

Eight patients with common variable panhypogammaglobulinemia were shown in the in vitro Ig biosynthesis assay to have defective B cell responses to pokeweed mitogen (PWM). Phospholipid synthesis was assessed in the B cell plus monocyte fraction (MB) and irradiated T cells (T*) of patients and paired normal controls. Cell populations were studied separately and in the four possible combinations (1:1), with and without PWM, to reveal the effect of cell interactions. At 16 to 20 hr the mean stimulation index (SI) +/- standard error for MB cells alone was 1.01 +/- 0.02 for eight patients and 0.99 +/- 0.02 for the paired normals; the T* cell SI was 1.25 +/- 0.04 for patients and 1.28 +/- 0.05 for normals. Combinations of normal MB cells with normal T* cells showed significantly higher SI when compared with the combinations of normal MB cells with patient T* cells (p less than 0.005). However, the combination of patient MB cells with patient T* cells and the combination of patient MB cells with normal T* cells were not significantly different in SI (0.05 less than p less than 0.1). Isolation of patient and normal B cells, T* cells, and monocytes after the choline pulse showed that patient B cells gave a higher SI with normal T* help than with patient T* help. Of greatest interest is the finding that patient B cells that were defective in PWM-stimulated Ig production nevertheless showed a phospholipid synthesis response to PWM in the normal range, suggesting that the maturation defect in these B cells occurs later than the phospholipid synthesis acceleration step, or on a different pathway

Trans-generational desensitization and within-generational resensitization of a sucrose-best neuron in the polyphagous herbivore Helicoverpa armigera (Lepidoptera: Noctuidae)

OpenAIRE

Ying Ma; Jingjing Li; Qingbo Tang; Xuening Zhang; Xincheng Zhao; Fengming Yan; Joop J. A. van Loon

2016-01-01

Dietary exposure of insects to a feeding deterrent substance for hours to days can induce habituation and concomitant desensitization of the response of peripheral gustatory neurons to such a substance. In the present study, larvae of the herbivore Helicoverpa armigera were fed on diets containing either a high, medium or low concentration of sucrose, a major feeding stimulant. The responsiveness of the sucrose-best neuron in the lateral sensilla styloconica on the galea was quantified. Resul...

Nonischemic changes in right ventricular function on exercise. Do normal volunteers differ from patients with normal coronary arteries

International Nuclear Information System (INIS)

Caplin, J.L.; Maltz, M.B.; Flatman, W.D.; Dymond, D.S.

1988-01-01

Factors other than ischemia may alter right ventricular function both at rest and on exercise. Normal volunteers differ from cardiac patients with normal coronary arteries with regard to their left ventricular response to exercise. This study examined changes in right ventricular function on exercise in 21 normal volunteers and 13 patients with normal coronary arteries, using first-pass radionuclide angiography. There were large ranges of right ventricular ejection fraction in the two groups, both at rest and on exercise. Resting right ventricular ejection fraction was 40.2 +/- 10.6% (mean +/- SD) in the volunteers and 38.6 +/- 9.7% in the patients, p = not significant, and on exercise rose significantly in both groups to 46.1 +/- 9.9% and 45.8 +/- 9.7%, respectively. The difference between the groups was not significant. In both groups some subjects with high resting values showed large decreases in ejection fraction on exercise, and there were significant negative correlations between resting ejection fraction and the change on exercise, r = -0.59 (p less than 0.01) in volunteers, and r = -0.66 (p less than 0.05) in patients. Older volunteers tended to have lower rest and exercise ejection fractions, but there was no difference between normotensive and hypertensive patients in their rest or exercise values. In conclusion, changes in right ventricular function on exercise are similar in normal volunteers and in patients with normal coronary arteries. Some subjects show decreases in right ventricular ejection fraction on exercise which do not appear to be related to ischemia

The quest for predicting sustained shunt response in normal pressure hydrocephalus: an analysis of the callosal angle's utility.

Science.gov (United States)

Grahnke, Kurt; Jusue-Torres, Ignacio; Szujewski, Caroline; Joyce, Cara; Schneck, Michael; Prabhu, Vikram; Anderson, Douglas

2018-04-30

Diagnosing normal pressure hydrocephalus (NPH) and selecting patients who will experience a sustained benefit from fluid diversion surgery remains challenging. This study seeks to evaluate the association between the callosal angle (CA) and the long-term post-operative response to ventriculoperitoneal shunt (VPS) surgery in a different subgroup population than previously studied to assess its generalizability. We studied 73 patients with idiopathic NPH who underwent VPS surgery and had at least 18 months of follow-up between 2000-2016. We recorded their pre and postoperative symptoms according to the NPH Eide scale and their comorbidities with the Kiefer index. Their CA, as well as Evan's Index, ventricular height, and transependymal signal were measured. Multivariable statistical models were used to determine which factors were associated with postoperative improvement, while controlling for the presence of the NPH triad. Fifty-nine patients (82%) demonstrated a successful response to surgery at their first postoperative follow-up. However, this declined to 54 patients (75%) at one year and 45 (62.5%) patients at their last follow-up. When controlling for the presence of the triad of symptoms, the CA significantly predicted a good, sustained response to surgery; for every degree decrease in the CA, a patient is 4% more likely to experience benefit from surgery. The CA is a useful preoperative prognostic tool for predicting which patients will experience a sustained benefit from surgery. Further studies are required to clarify this disease in the context of old age, comorbidity, and possible concomitant neurodegenerative diseases. Copyright © 2018 Elsevier Inc. All rights reserved.

Normal postural responses preceding shoulder flexion: co-activation or asymmetric activation of transverse abdominis?

Science.gov (United States)

Davarian, Sanaz; Maroufi, Nader; Ebrahimi, Esmaeil; Parnianpour, Mohammad; Farahmand, Farzam

2014-01-01

It is suggested that activation of the transverse abdominis muscle has a stabilizing effect on the lumbar spine by raising intra-abdominal pressure without added disc compression. However, its feedforward activity has remained a controversial issue. In addition, research regarding bilateral activation of trunk muscles during a unilateral arm movement is limited. The aim of this study was to evaluate bilateral anticipatory activity of trunk muscles during unilateral arm flexion. Eighteen healthy subjects (aged 25 ± 3.96 years) participated in this study and performed 10 trials of rapid arm flexion in response to a visual stimulus. The electromyographic activity of the right anterior deltoid (AD) and bilateral trunk muscles including the transverse abdominis/internal oblique (TA/IO), superficial lumbar multifidus (SLM) and lumbar erector spine (LES) was recorded. The onset latency and anticipatory activity of the recorded trunk muscles were calculated. The first muscle activated in anticipation of the right arm flexion was the left TA/IO. The right TA/IO activated significantly later than all other trunk muscles (P 0.05). Healthy subjects showed no bilateral anticipatory co-activation of TA/IO in unilateral arm elevation. Further investigations are required to delineate normal muscle activation pattern in healthy subjects prior to prescribing bilateral activation training of transverse abdominis for subjects with chronic low back pain.

Normalization of multidirectional red and NIR reflectances with the SAVI

Science.gov (United States)

Huete, A. R.; Hua, G.; Qi, J.; Chehbouni, A.; Van Leeuwen, W. J. D.

1992-01-01

Directional reflectance measurements were made over a semi-desert gramma grassland at various times of the growing season. View angle measurements from +40 to -40 degrees were made at various solar zenith angles and soil moisture conditions. The sensitivity of the Normalized Difference Vegetation Index (NDVI) and the Soil Adjusted Vegetation Index (SAVI) to bidirectional measurements was assessed for purposes of improving remote temporal monitoring of vegetation dynamics. The SAVI view angle response was found to be symmetric about nadir while the NDVI response was strongly anisotropic. This enabled the view angle behavior of the SAVI to be normalized with a cosine function. In contrast to the NDVI, the SAVI was able to minimize soil moisture and shadow influences for all measurement conditions.

Normalized modes at selected points without normalization

Science.gov (United States)

Kausel, Eduardo

2018-04-01

As every textbook on linear algebra demonstrates, the eigenvectors for the general eigenvalue problem | K - λM | = 0 involving two real, symmetric, positive definite matrices K , M satisfy some well-defined orthogonality conditions. Equally well-known is the fact that those eigenvectors can be normalized so that their modal mass μ =ϕT Mϕ is unity: it suffices to divide each unscaled mode by the square root of the modal mass. Thus, the normalization is the result of an explicit calculation applied to the modes after they were obtained by some means. However, we show herein that the normalized modes are not merely convenient forms of scaling, but that they are actually intrinsic properties of the pair of matrices K , M, that is, the matrices already "know" about normalization even before the modes have been obtained. This means that we can obtain individual components of the normalized modes directly from the eigenvalue problem, and without needing to obtain either all of the modes or for that matter, any one complete mode. These results are achieved by means of the residue theorem of operational calculus, a finding that is rather remarkable inasmuch as the residues themselves do not make use of any orthogonality conditions or normalization in the first place. It appears that this obscure property connecting the general eigenvalue problem of modal analysis with the residue theorem of operational calculus may have been overlooked up until now, but which has in turn interesting theoretical implications.Á

Normalization methods in time series of platelet function assays

Science.gov (United States)

Van Poucke, Sven; Zhang, Zhongheng; Roest, Mark; Vukicevic, Milan; Beran, Maud; Lauwereins, Bart; Zheng, Ming-Hua; Henskens, Yvonne; Lancé, Marcus; Marcus, Abraham

2016-01-01

Abstract Platelet function can be quantitatively assessed by specific assays such as light-transmission aggregometry, multiple-electrode aggregometry measuring the response to adenosine diphosphate (ADP), arachidonic acid, collagen, and thrombin-receptor activating peptide and viscoelastic tests such as rotational thromboelastometry (ROTEM). The task of extracting meaningful statistical and clinical information from high-dimensional data spaces in temporal multivariate clinical data represented in multivariate time series is complex. Building insightful visualizations for multivariate time series demands adequate usage of normalization techniques. In this article, various methods for data normalization (z-transformation, range transformation, proportion transformation, and interquartile range) are presented and visualized discussing the most suited approach for platelet function data series. Normalization was calculated per assay (test) for all time points and per time point for all tests. Interquartile range, range transformation, and z-transformation demonstrated the correlation as calculated by the Spearman correlation test, when normalized per assay (test) for all time points. When normalizing per time point for all tests, no correlation could be abstracted from the charts as was the case when using all data as 1 dataset for normalization. PMID:27428217

Gustatory response and longevity in Aphidius parasitoids and their hyperparasitoid Dendrocerus aphidum

NARCIS (Netherlands)

Goelen, Tim; Baets, Dieter; Kos, Martine; Paulussen, Caroline; Lenaerts, Marijke; Rediers, Hans; Wäckers, F.L.; Jacquemyn, Hans; Lievens, Bart

2018-01-01

Aphid parasitoids are commonly used in the biological control of aphids. However, their success in biological control largely depends on the availability of carbohydrate-rich food as an energy source for maintenance and reproduction. Therefore, as these resources have become rare in modern

Comparison on taste threshold between adult male white cigarette and clove cigarette smokers using Murphy clinical test method

Directory of Open Access Journals (Sweden)

Ronald Reyses Tapilatu

2008-03-01

Full Text Available The habit of smoking white cigarettes and clove cigarettes may affect the gustatory function, that is, it will cause damage to taste buds, resulting in an increase in gustatory threshold. This research used the descriptive comparative method and had the purpose of obtaining an illustration of gustatory threshold and compare gustatory threshold in white cigarette smokers and clove cigarette smokers in young, male adults. For gustatory threshold evaluation, the Murphy method was used to obtain a value for perception threshold and taste identification threshold using sucrose solution of 0.0006 M-0.06 M concentration. Research results indicate that the perception threshold and identification threshold of young, male adult smokers are 0.0119 M and 0.0292 M. Young, male adult clove cigarette smokers have a perception threshold and identification threshold of 0.0151 M and 0.0348 M. The conclusion of this research is that the perception threshold of young, male adult white cigarette smokers and clove cigarette smokers are the same, whereas the identification threshold of young, male adult white cigarette smokers and clove cigarette smokers are different, that is, the identification threshold of clove cigarette smokers is higher than that of white cigarette smokers.

Attention and normalization circuits in macaque V1.

Science.gov (United States)

Sanayei, M; Herrero, J L; Distler, C; Thiele, A

2015-04-01

Attention affects neuronal processing and improves behavioural performance. In extrastriate visual cortex these effects have been explained by normalization models, which assume that attention influences the circuit that mediates surround suppression. While normalization models have been able to explain attentional effects, their validity has rarely been tested against alternative models. Here we investigate how attention and surround/mask stimuli affect neuronal firing rates and orientation tuning in macaque V1. Surround/mask stimuli provide an estimate to what extent V1 neurons are affected by normalization, which was compared against effects of spatial top down attention. For some attention/surround effect comparisons, the strength of attentional modulation was correlated with the strength of surround modulation, suggesting that attention and surround/mask stimulation (i.e. normalization) might use a common mechanism. To explore this in detail, we fitted multiplicative and additive models of attention to our data. In one class of models, attention contributed to normalization mechanisms, whereas in a different class of models it did not. Model selection based on Akaike's and on Bayesian information criteria demonstrated that in most cells the effects of attention were best described by models where attention did not contribute to normalization mechanisms. This demonstrates that attentional influences on neuronal responses in primary visual cortex often bypass normalization mechanisms. © 2015 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

Non-invasive screening for Alzheimer's disease by sensing salivary sugar using Drosophila cells expressing gustatory receptor (Gr5a immobilized on an extended gate ion-sensitive field-effect transistor (EG-ISFET biosensor.

Directory of Open Access Journals (Sweden)

Hui-Chong Lau

Full Text Available Body fluids are often used as specimens for medical diagnosis. With the advent of advanced analytical techniques in biotechnology, the diagnostic potential of saliva has been the focus of many studies. We recently reported the presence of excess salivary sugars, in patients with Alzheimer's disease (AD. In the present study, we developed a highly sensitive, cell-based biosensor to detect trehalose levels in patient saliva. The developed biosensor relies on the overexpression of sugar sensitive gustatory receptors (Gr5a in Drosophila cells to detect the salivary trehalose. The cell-based biosensor was built on the foundation of an improved extended gate ion-sensitive field-effect transistor (EG-ISFET. Using an EG-ISFET, instead of a traditional ion-sensitive field-effect transistor (ISFET, resulted in an increase in the sensitivity and reliability of detection. The biosensor was designed with the gate terminals segregated from the conventional ISFET device. This design allows the construction of an independent reference and sensing region for simultaneous and accurate measurements of samples from controls and patients respectively. To investigate the efficacy of the cell-based biosensor for AD screening, we collected 20 saliva samples from each of the following groups: participants diagnosed with AD, participants diagnosed with Parkinson's disease (PD, and a control group composed of healthy individuals. We then studied the response generated from the interaction of the salivary trehalose of the saliva samples and the Gr5a in the immobilized cells on an EG-ISFET sensor. The cell-based biosensor significantly distinguished salivary sugar, trehalose of the AD group from the PD and control groups. Based on these findings, we propose that salivary trehalose, might be a potential biomarker for AD and could be detected using our cell-based EG-ISFET biosensor. The cell-based EG-ISFET biosensor provides a sensitive and direct approach for salivary sugar

Non-invasive screening for Alzheimer's disease by sensing salivary sugar using Drosophila cells expressing gustatory receptor (Gr5a) immobilized on an extended gate ion-sensitive field-effect transistor (EG-ISFET) biosensor.

Science.gov (United States)

Lau, Hui-Chong; Lee, In-Kyu; Ko, Pan-Woo; Lee, Ho-Won; Huh, Jeung-Soo; Cho, Won-Ju; Lim, Jeong-Ok

2015-01-01

Body fluids are often used as specimens for medical diagnosis. With the advent of advanced analytical techniques in biotechnology, the diagnostic potential of saliva has been the focus of many studies. We recently reported the presence of excess salivary sugars, in patients with Alzheimer's disease (AD). In the present study, we developed a highly sensitive, cell-based biosensor to detect trehalose levels in patient saliva. The developed biosensor relies on the overexpression of sugar sensitive gustatory receptors (Gr5a) in Drosophila cells to detect the salivary trehalose. The cell-based biosensor was built on the foundation of an improved extended gate ion-sensitive field-effect transistor (EG-ISFET). Using an EG-ISFET, instead of a traditional ion-sensitive field-effect transistor (ISFET), resulted in an increase in the sensitivity and reliability of detection. The biosensor was designed with the gate terminals segregated from the conventional ISFET device. This design allows the construction of an independent reference and sensing region for simultaneous and accurate measurements of samples from controls and patients respectively. To investigate the efficacy of the cell-based biosensor for AD screening, we collected 20 saliva samples from each of the following groups: participants diagnosed with AD, participants diagnosed with Parkinson's disease (PD), and a control group composed of healthy individuals. We then studied the response generated from the interaction of the salivary trehalose of the saliva samples and the Gr5a in the immobilized cells on an EG-ISFET sensor. The cell-based biosensor significantly distinguished salivary sugar, trehalose of the AD group from the PD and control groups. Based on these findings, we propose that salivary trehalose, might be a potential biomarker for AD and could be detected using our cell-based EG-ISFET biosensor. The cell-based EG-ISFET biosensor provides a sensitive and direct approach for salivary sugar detection and

Model-based normalization for iterative 3D PET image

International Nuclear Information System (INIS)

Bai, B.; Li, Q.; Asma, E.; Leahy, R.M.; Holdsworth, C.H.; Chatziioannou, A.; Tai, Y.C.

2002-01-01

We describe a method for normalization in 3D PET for use with maximum a posteriori (MAP) or other iterative model-based image reconstruction methods. This approach is an extension of previous factored normalization methods in which we include separate factors for detector sensitivity, geometric response, block effects and deadtime. Since our MAP reconstruction approach already models some of the geometric factors in the forward projection, the normalization factors must be modified to account only for effects not already included in the model. We describe a maximum likelihood approach to joint estimation of the count-rate independent normalization factors, which we apply to data from a uniform cylindrical source. We then compute block-wise and block-profile deadtime correction factors using singles and coincidence data, respectively, from a multiframe cylindrical source. We have applied this method for reconstruction of data from the Concorde microPET P4 scanner. Quantitative evaluation of this method using well-counter measurements of activity in a multicompartment phantom compares favourably with normalization based directly on cylindrical source measurements. (author)

Clarifying Normalization

Science.gov (United States)

Carpenter, Donald A.

2008-01-01

Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

A normal mode treatment of semi-diurnal body tides on an aspherical, rotating and anelastic Earth

Science.gov (United States)

Lau, Harriet C. P.; Yang, Hsin-Ying; Tromp, Jeroen; Mitrovica, Jerry X.; Latychev, Konstantin; Al-Attar, David

2015-08-01

Normal mode treatments of the Earth's body tide response were developed in the 1980s to account for the effects of Earth rotation, ellipticity, anelasticity and resonant excitation within the diurnal band. Recent space-geodetic measurements of the Earth's crustal displacement in response to luni-solar tidal forcings have revealed geographical variations that are indicative of aspherical deep mantle structure, thus providing a novel data set for constraining deep mantle elastic and density structure. In light of this, we make use of advances in seismic free oscillation literature to develop a new, generalized normal mode theory for the tidal response within the semi-diurnal and long-period tidal band. Our theory involves a perturbation method that permits an efficient calculation of the impact of aspherical structure on the tidal response. In addition, we introduce a normal mode treatment of anelasticity that is distinct from both earlier work in body tides and the approach adopted in free oscillation seismology. We present several simple numerical applications of the new theory. First, we compute the tidal response of a spherically symmetric, non-rotating, elastic and isotropic Earth model and demonstrate that our predictions match those based on standard Love number theory. Second, we compute perturbations to this response associated with mantle anelasticity and demonstrate that the usual set of seismic modes adopted for this purpose must be augmented by a family of relaxation modes to accurately capture the full effect of anelasticity on the body tide response. Finally, we explore aspherical effects including rotation and we benchmark results from several illustrative case studies of aspherical Earth structure against independent finite-volume numerical calculations of the semi-diurnal body tide response. These tests confirm the accuracy of the normal mode methodology to at least the level of numerical error in the finite-volume predictions. They also demonstrate

Correlated random sampling for multivariate normal and log-normal distributions

International Nuclear Information System (INIS)

Žerovnik, Gašper; Trkov, Andrej; Kodeli, Ivan A.

2012-01-01

A method for correlated random sampling is presented. Representative samples for multivariate normal or log-normal distribution can be produced. Furthermore, any combination of normally and log-normally distributed correlated variables may be sampled to any requested accuracy. Possible applications of the method include sampling of resonance parameters which are used for reactor calculations.

Normalization of energy-dependent gamma survey data.

Science.gov (United States)

Whicker, Randy; Chambers, Douglas

2015-05-01

Instruments and methods for normalization of energy-dependent gamma radiation survey data to a less energy-dependent basis of measurement are evaluated based on relevant field data collected at 15 different sites across the western United States along with a site in Mongolia. Normalization performance is assessed relative to measurements with a high-pressure ionization chamber (HPIC) due to its "flat" energy response and accurate measurement of the true exposure rate from both cosmic and terrestrial radiation. While analytically ideal for normalization applications, cost and practicality disadvantages have increased demand for alternatives to the HPIC. Regression analysis on paired measurements between energy-dependent sodium iodide (NaI) scintillation detectors (5-cm by 5-cm crystal dimensions) and the HPIC revealed highly consistent relationships among sites not previously impacted by radiological contamination (natural sites). A resulting generalized data normalization factor based on the average sensitivity of NaI detectors to naturally occurring terrestrial radiation (0.56 nGy hHPIC per nGy hNaI), combined with the calculated site-specific estimate of cosmic radiation, produced reasonably accurate predictions of HPIC readings at natural sites. Normalization against two to potential alternative instruments (a tissue-equivalent plastic scintillator and energy-compensated NaI detector) did not perform better than the sensitivity adjustment approach at natural sites. Each approach produced unreliable estimates of HPIC readings at radiologically impacted sites, though normalization against the plastic scintillator or energy-compensated NaI detector can address incompatibilities between different energy-dependent instruments with respect to estimation of soil radionuclide levels. The appropriate data normalization method depends on the nature of the site, expected duration of the project, survey objectives, and considerations of cost and practicality.

Responses of catecholestrogen metabolism to acute graded exercise in normal menstruating women before and after training.

Science.gov (United States)

De Crée, C; Ball, P; Seidlitz, B; Van Kranenburg, G; Geurten, P; Keizer, H A

1997-10-01

It has been hypothesized that exercise-related hypo-estrogenemia occurs as a consequence of increased competition of catecholestrogens (CE) for catechol-O-methyltransferase (COMT). This may result in higher norepinephrine (NE) concentrations, which could interfere with normal gonadotropin pulsatility. The present study investigates the effects of training on CE responses to acute exercise stress. Nine untrained eumenorrheic women (mean percentage of body fat +/-SD: 24.8 +/- 3.1%) volunteered for an intensive 5-day training program. Resting, submaximal, and maximal (tmax) exercise plasma CE, estrogen, and catecholamine responses were determined pre- and post training in both the follicular (FPh) and luteal phase (LPh). Acute exercise stress increased total primary estrogens (E) but had little effect on total 2-hydroxyestrogens (2-OHE) and 2-hydroxyestrogen-monomethylethers (2-MeOE) (= O-methylated CE after competition for catechol-O-methyltransferase). This pattern was not significantly changed by training. However, posttraining LPh mean (+/-SE) plasma E, 2-OHE, and 2-MeOE concentrations were significantly lower (P Training produced opposite effects on 2-OHE:E ratios (an estimation of CE formation) during acute exercise in the FPh (reduction) and LPh (increase). The 2-MeOE:2-OHE ratio (an estimation of CE activity) showed significantly higher values at tmax in both menstrual phases after training (FPh: +11%; LPh: +23%; P training, NE values were significantly higher (P training lowers absolute concentrations of plasma estrogens and CE; the acute exercise challenge altered plasma estrogens but had little effect on CE; estimation of the formation and activity of CE suggests that formation and O-methylation of CE proportionately increases. These findings may be of importance for NE-mediated effects on gonadotropin release.

Freeze-all cycle for all normal responders?

Science.gov (United States)

Roque, Matheus; Valle, Marcello; Guimarães, Fernando; Sampaio, Marcos; Geber, Selmo

2017-02-01

The purpose of this study is to evaluate the freeze-all strategy in subgroups of normal responders, to assess whether this strategy is beneficial regardless of ovarian response, and to evaluate the possibility of implementing an individualized embryo transfer (iET) based on ovarian response. This was an observational, cohort study performed in a private IVF center. A total of 938 IVF cycles were included in this study. The patients were submitted to controlled ovarian stimulation (COS) with a gonadotropin-releasing hormone (GnRH) antagonist protocol and a cleavage-stage day 3 embryo transfer. We performed a comparison of outcomes between the fresh embryo transfer (n = 523) and the freeze-all cycles (n = 415). The analysis was performed in two subgroups of patients based on the number of retrieved oocytes: Group 1 (4-9 oocytes) and Group 2 (10-15 oocytes). In Group 1 (4-9 retrieved oocytes), the implantation rates (IR) were 17.9 and 20.5% (P = 0.259) in the fresh and freeze-all group, respectively; the ongoing pregnancy rates (OPR) were 31 and 33% (P = 0.577) in the fresh and freeze-all group, respectively. In Group 2 (10-15 oocytes), the IR were 22.1 and 30.1% (P = 0.028) and the OPR were 34 and 47% (P = 0.021) in the fresh and freeze-all groups, respectively. Although the freeze-all policy may be related to better in vitro fertilization (IVF) outcomes in normal responders, these potential advantages decrease with worsening ovarian response. Patients with poorer ovarian response do not benefit from the freeze-all strategy.

Altered lipid and salt taste responsivity in ghrelin and GOAT null mice.

Directory of Open Access Journals (Sweden)

Huan Cai

Full Text Available Taste perception plays an important role in regulating food preference, eating behavior and energy homeostasis. Taste perception is modulated by a variety of factors, including gastric hormones such as ghrelin. Ghrelin can regulate growth hormone release, food intake, adiposity, and energy metabolism. Octanoylation of ghrelin by ghrelin O-acyltransferase (GOAT is a specific post-translational modification which is essential for many biological activities of ghrelin. Ghrelin and GOAT are both widely expressed in many organs including the gustatory system. In the current study, overall metabolic profiles were assessed in wild-type (WT, ghrelin knockout (ghrelin(-/-, and GOAT knockout (GOAT(-/- mice. Ghrelin(-/- mice exhibited decreased food intake, increased plasma triglycerides and increased ketone bodies compared to WT mice while demonstrating WT-like body weight, fat composition and glucose control. In contrast GOAT(-/- mice exhibited reduced body weight, adiposity, resting glucose and insulin levels compared to WT mice. Brief access taste behavioral tests were performed to determine taste responsivity in WT, ghrelin(-/- and GOAT(-/- mice. Ghrelin and GOAT null mice possessed reduced lipid taste responsivity. Furthermore, we found that salty taste responsivity was attenuated in ghrelin(-/- mice, yet potentiated in GOAT(-/- mice compared to WT mice. Expression of the potential lipid taste regulators Cd36 and Gpr120 were reduced in the taste buds of ghrelin and GOAT null mice, while the salt-sensitive ENaC subunit was increased in GOAT(-/- mice compared with WT mice. The altered expression of Cd36, Gpr120 and ENaC may be responsible for the altered lipid and salt taste perception in ghrelin(-/- and GOAT(-/- mice. The data presented in the current study potentially implicates ghrelin signaling activity in the modulation of both lipid and salt taste modalities.

Role of the normal gut microbiota.

Science.gov (United States)

Jandhyala, Sai Manasa; Talukdar, Rupjyoti; Subramanyam, Chivkula; Vuyyuru, Harish; Sasikala, Mitnala; Nageshwar Reddy, D

2015-08-07

Relation between the gut microbiota and human health is being increasingly recognised. It is now well established that a healthy gut flora is largely responsible for overall health of the host. The normal human gut microbiota comprises of two major phyla, namely Bacteroidetes and Firmicutes. Though the gut microbiota in an infant appears haphazard, it starts resembling the adult flora by the age of 3 years. Nevertheless, there exist temporal and spatial variations in the microbial distribution from esophagus to the rectum all along the individual's life span. Developments in genome sequencing technologies and bioinformatics have now enabled scientists to study these microorganisms and their function and microbe-host interactions in an elaborate manner both in health and disease. The normal gut microbiota imparts specific function in host nutrient metabolism, xenobiotic and drug metabolism, maintenance of structural integrity of the gut mucosal barrier, immunomodulation, and protection against pathogens. Several factors play a role in shaping the normal gut microbiota. They include (1) the mode of delivery (vaginal or caesarean); (2) diet during infancy (breast milk or formula feeds) and adulthood (vegan based or meat based); and (3) use of antibiotics or antibiotic like molecules that are derived from the environment or the gut commensal community. A major concern of antibiotic use is the long-term alteration of the normal healthy gut microbiota and horizontal transfer of resistance genes that could result in reservoir of organisms with a multidrug resistant gene pool.

Motor-evoked potential amplitudes elicited by transcranial magnetic stimulation do not differentiate between patients and normal controls.

Science.gov (United States)

Grunhaus, Leon; Polak, Dana; Amiaz, Revital; Dannon, Pinhas N

2003-12-01

Transcranial magnetic stimulation (TMS) applied over the motor cortex depolarizes neurons and leads to motor-evoked potentials (MEP). To assess cortico-spinal excitability we compared the motor threshold (MT) and the averaged MEP amplitude generated by TMS in patients with major depression (MD) and matched controls. Nineteen patients, who where participants in a protocol comparing the antidepressant effects of rTMS with those of ECT, and thirteen age- and gender-matched normal controls were studied. MT was similar between patients and normal controls. The MEP amplitude response was significantly increased by rTMS, however, the magnitude of the response was similar in patients and normal controls. Correlations between the averaged MEP amplitude and age revealed that older subjects demonstrated significantly lower responses at all time-points. We conclude that cortico-spinal excitability is increased following rTMS, however, differences between patients and normal controls were not apparent with the paradigm used.

Lovastatin attenuates ionizing radiation-induced normal tissue damage in vivo

International Nuclear Information System (INIS)

Ostrau, Christian; Huelsenbeck, Johannes; Herzog, Melanie; Schad, Arno; Torzewski, Michael; Lackner, Karl J.; Fritz, Gerhard

2009-01-01

Background and purpose: HMG-CoA-reductase inhibitors (statins) are widely used lipid-lowering drugs. Moreover, they have pleiotropic effects on cellular stress responses, proliferation and apoptosis in vitro. Here, we investigated whether lovastatin attenuates acute and subchronic ionizing radiation-induced normal tissue toxicity in vivo. Materials and methods: Four hours to 24 h after total body irradiation (6 Gy) of Balb/c mice, acute pro-inflammatory and pro-fibrotic responses were analyzed. To comprise subchronic radiation toxicity, mice were irradiated twice with 2.5 Gy and analyses were performed 3 weeks after the first radiation treatment. Molecular markers of inflammation and fibrosis as well as organ toxicities were measured. Results: Lovastatin attenuated IR-induced activation of NF-κB, mRNA expression of cell adhesion molecules and mRNA expression of pro-inflammatory and pro-fibrotic marker genes (i.e. TNFα, IL-6, TGFβ, CTGF, and type I and type III collagen) in a tissue- and time-dependent manner. γH2AX phosphorylation stimulated by IR was not affected by lovastatin, indicating that the statin has no major impact on the induction of DNA damage in vivo. Radiation-induced thrombopenia was significantly alleviated by lovastatin. Conclusions: Lovastatin inhibits both acute and subchronic IR-induced pro-inflammatory and pro-fibrotic responses and cell death in normal tissue in vivo. Therefore, lovastatin might be useful for selectively attenuating acute and subchronic normal tissue damage caused by radiotherapy.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Obese but not normal-weight women with polycystic ovary syndrome are characterized by metabolic and microvascular insulin resistance.

Science.gov (United States)

Ketel, Iris J G; Stehouwer, Coen D A; Serné, Erik H; Korsen, Ted J M; Hompes, Peter G A; Smulders, Yvo M; de Jongh, Renate T; Homburg, Roy; Lambalk, Cornelis B

2008-09-01

Polycystic ovary syndrome (PCOS) and obesity are associated with diabetes and cardiovascular disease, but it is unclear to what extent PCOS contributes independently of obesity. The objective of the study was to investigate whether insulin sensitivity and insulin's effects on the microcirculation are impaired in normal-weight and obese women with PCOS. Thirty-five women with PCOS (19 normal weight and 16 obese) and 27 age- and body mass index-matched controls (14 normal weight and 13 obese) were included. Metabolic Insulin sensitivity (isoglycemic-hyperinsulinemic clamp) and microvascular insulin sensitivity [endothelium dependent (acetylcholine [ACh])] and endothelium-independent [sodium nitroprusside (SNP)] vasodilation with laser Doppler flowmetry was assessed at baseline and during hyperinsulinemia. Metabolic insulin sensitivity (M/I value) and the area under the response curves to ACh and SNP curves were measured to assess microcirculatory function at baseline and during insulin infusion (microvascular insulin sensitivity). Obese women were more insulin resistant than normal-weight women (P PCOS women were more resistant than obese controls (P = 0.02). In contrast, normal-weight women with PCOS had similar insulin sensitivity, compared with normal-weight women without PCOS. Baseline responses to ACh showed no difference in the four groups. ACh responses during insulin infusion were significantly greater in normal-weight PCOS and controls than in obese PCOS and controls. PCOS per se had no significant influence on ACh responses during insulin infusion. During hyperinsulinemia, SNP-dependent vasodilatation did not significantly increase, compared with baseline in the four groups. PCOS per se was not associated with impaired metabolic insulin sensitivity in normal-weight women but aggravates impairment of metabolic insulin sensitivity in obese women. In obese but not normal-weight women, microvascular and metabolic insulin sensitivity are decreased, independent

DNA Double-Strand Break Rejoining in Complex Normal Tissues

International Nuclear Information System (INIS)

Ruebe, Claudia E.; Dong, Xiaorong; Kuehne, Martin; Fricke, Andreas; Kaestner, Lars; Lipp, Peter; Ruebe, Christian

2008-01-01

Purpose: The clinical radiation responses of different organs vary widely and likely depend on the intrinsic radiosensitivities of their different cell populations. Double-strand breaks (DSBs) are the most deleterious form of DNA damage induced by ionizing radiation, and the cells' capacity to rejoin radiation-induced DSBs is known to affect their intrinsic radiosensitivity. To date, only little is known about the induction and processing of radiation-induced DSBs in complex normal tissues. Using an in vivo model with repair-proficient mice, the highly sensitive γH2AX immunofluorescence was established to investigate whether differences in DSB rejoining could account for the substantial differences in clinical radiosensitivity observed among normal tissues. Methods and Materials: After whole body irradiation of C57BL/6 mice (0.1, 0.5, 1.0, and 2.0 Gy), the formation and rejoining of DSBs was analyzed by enumerating γH2AX foci in various organs representative of both early-responding (small intestine) and late-responding (lung, brain, heart, kidney) tissues. Results: The linear dose correlation observed in all analyzed tissues indicated that γH2AX immunofluorescence allows for the accurate quantification of DSBs in complex organs. Strikingly, the various normal tissues exhibited identical kinetics for γH2AX foci loss, despite their clearly different clinical radiation responses. Conclusion: The identical kinetics of DSB rejoining measured in different organs suggest that tissue-specific differences in radiation responses are independent of DSB rejoining. This finding emphasizes the fundamental role of DSB repair in maintaining genomic integrity, thereby contributing to cellular viability and functionality and, thus, tissue homeostasis

Causal signal transmission by quantum fields. III: Coherent response of fermions

International Nuclear Information System (INIS)

Plimak, L.I.; Stenholm, S.

2009-01-01

Structural response properties of fermionic fields are investigated. In the presence of fermions the key technical concept becomes response combination, or R-normal product, of field operators. It generalises the notion of time-normal operator product to response problems. Time-normal products are a special case of R-normal products without inputs; this paper thus also generalises the concept of time-normal ordering to fermions. Explicit causality of R-normal products of arbitrary (bosonic and/or fermionic) field operators is proven, and explicit relations expressing them by conventional Green's functions of quantum field theory are derived

Determination of rolling resistance coefficient based on normal tyre stiffness

Science.gov (United States)

Rykov, S. P.; Tarasuyk, V. N.; Koval, V. S.; Ovchinnikova, N. I.; Fedotov, A. I.; Fedotov, K. V.

2018-03-01

The purpose of the article is to develop analytical dependence of wheel rolling resistance coefficient based on the mathematical description of normal tyre stiffness. The article uses the methods of non-holonomic mechanics and plane section methods. The article shows that the abscissa of gravity center of tyre stiffness expansion by the length of the contact area is the shift of normal road response. It can be used for determining rolling resistance coefficient. When determining rolling resistance coefficient using ellipsis and power function equations, one can reduce labor costs for testing and increase assessment accuracy.

Evaluation of the palatabilities in 10 different famotidine orally disintegrating tablets by combination of disintegration device and taste sensor.

Science.gov (United States)

Yoshida, Miyako; Hazekawa, Mai; Haraguchi, Tamami; Uchida, Takahiro

2015-01-01

The purpose of this study was to evaluate the palatabilities of the original and nine generic versions of famotidine orally disintegrating tablets (FODTs) by means of disintegration times and bitterness intensities determined using in combination disintegration device and taste sensor comparison of human gustatory sensation tests. The disintegration times were determined using a new disintegration testing equipment for ODTs, the OD-mate and bitterness intensities were determined using the SA501C taste-sensing system. The disintegration time and bitterness of each FODT was evaluated in gustatory sensation tests. There was a good correlation between the disintegration times of 10 FODTs estimated in human gustatory testing and those found using the OD-mate. The bitterness intensities of FODTs at 10, 20 and 30 s after starting the disintegration using the OD-mate and the values determined by the taste sensor were highly correlated with the bitterness intensities determined in gustatory sensation testing. A combination of the OD-mate and the SA501C was capable of predicting the palatabilities, disintegration properties and bitterness intensity of FODTs.

Magnetic measurements on human erythrocytes: Normal, beta thalassemia major, and sickle

Science.gov (United States)

Sakhnini, Lama

2003-05-01

In this article magnetic measurements were made on human erythrocytes at different hemoglobin states (normal and reduced hemoglobin). Different blood samples: normal, beta thalassemia major, and sickle were studied. Beta thalassemia major and sickle samples were taken from patients receiving lifelong blood transfusion treatment. All samples examined exhibited diamagnetic behavior. Beta thalassemia major and sickle samples showed higher diamagnetic susceptibilities than that for the normal, which was attributed to the increase of membrane to hemoglobin volume ratio of the abnormal cells. Magnetic measurements showed that the erythrocytes in the reduced state showed less diamagnetic response in comparison with erythrocytes in the normal state. Analysis of the paramagnetic component of magnetization curves gave an effective magnetic moment of μeff=7.6 μB per reduced hemoglobin molecule. The same procedure was applied to sickle and beta thalassemia major samples and values for μeff were found to be comparable to that of the normal erythrocytes.

The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

NARCIS (Netherlands)

Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

1987-01-01

The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

Practice guideline: Idiopathic normal pressure hydrocephalus: Response to shunting and predictors of response: Report of the Guideline Development, Dissemination, and Implementation Subcommittee of the American Academy of Neurology.

Science.gov (United States)

Halperin, John J; Kurlan, Roger; Schwalb, Jason M; Cusimano, Michael D; Gronseth, Gary; Gloss, David

2015-12-08

We evaluated evidence for utility of shunting in idiopathic normal pressure hydrocephalus (iNPH) and for predictors of shunting effectiveness. We identified and classified relevant published studies according to 2004 and 2011 American Academy of Neurology methodology. Of 21 articles, we identified 3 Class I articles. Shunting is possibly effective in iNPH (96% chance subjective improvement, 83% chance improvement on timed walk test at 6 months) (3 Class III). Serious adverse event risk was 11% (1 Class III). Predictors of success included elevated Ro (1 Class I, multiple Class II), impaired cerebral blood flow reactivity to acetazolamide (by SPECT) (1 Class I), and positive response to either external lumbar drainage (1 Class III) or repeated lumbar punctures. Age may not be a prognostic factor (1 Class II). Data are insufficient to judge efficacy of radionuclide cisternography or aqueductal flow measurement by MRI. Clinicians may choose to offer shunting for subjective iNPH symptoms and gait (Level C). Because of significant adverse event risk, risks and benefits should be carefully weighed (Level B). Clinicians should inform patients with iNPH with elevated Ro and their families that they have an increased chance of responding to shunting compared with those without such elevation (Level B). Clinicians may counsel patients with iNPH and their families that (1) positive response to external lumbar drainage or to repeated lumbar punctures increases the chance of response to shunting, and (2) increasing age does not decrease the chance of shunting being successful (both Level C). © 2015 American Academy of Neurology.

Short-term effects of a low glycemic index carob-containing snack on energy intake, satiety, and glycemic response in normal-weight, healthy adults: Results from two randomized trials.

Science.gov (United States)

Papakonstantinou, Emilia; Orfanakos, Nickolaos; Farajian, Paul; Kapetanakou, Anastasia E; Makariti, Ifigenia P; Grivokostopoulos, Nikolaos; Ha, Marie-Ann; Skandamis, Panagiotis N

2017-10-01

The potential positive health effects of carob-containing snacks are largely unknown. Therefore, the aims of these studies were to determine the glycemic index (GI) of a carob snack compared with chocolate cookie containing equal amounts of available carbohydrates and to compare the effects of a carob versus chocolate cookie preload consumed as snack before a meal on (a) short-term satiety response measured by subsequent ad libitum meal intake, (b) subjective satiety as assessed by visual analog scales and (c) postprandial glycemic response. Ten healthy, normal-weight volunteers participated in GI investigation. Then, 50 healthy, normal-weight individuals consumed, crossover, in random order, the preloads as snack, with 1-wk washout period. Ad libitum meal (lunch and dessert) was offered. Capillary blood glucose samples were collected at baseline, 2 h after breakfast, just before preload consumption, 2 h after preload, 3 h after preload, just before meal (lunch and dessert), 1 h after meal, and 2 h after meal consumption. The carob snack was a low GI food, whereas the chocolate cookie was a high GI food (40 versus 78, respectively, on glucose scale). Consumption of the carob preload decreased the glycemic response to a following meal and to the individual's feelings of hunger, desire to eat, preoccupation with food, and thirst between snack and meal, as assessed with the use of visual analog scales. Subsequently, participants consumed less amounts of food (g) and had lower total energy intake at mealtimes. The carob snack led to increased satiety, lower energy intake at meal, and decreased postmeal glycemic response possibly due to its low GI value. Identifying foods that promote satiety and decrease glycemic response without increasing the overall energy intake may offer advantages to body weight and glycemic control. Copyright © 2017 Elsevier Inc. All rights reserved.

Normalization: A Preprocessing Stage

OpenAIRE

Patro, S. Gopal Krishna; Sahu, Kishore Kumar

2015-01-01

As we know that the normalization is a pre-processing stage of any type problem statement. Especially normalization takes important role in the field of soft computing, cloud computing etc. for manipulation of data like scale down or scale up the range of data before it becomes used for further stage. There are so many normalization techniques are there namely Min-Max normalization, Z-score normalization and Decimal scaling normalization. So by referring these normalization techniques we are ...

Associations between postprandial insulin and blood glucose responses, appetite sensations and energy intake in normal weight and overweight individuals: a meta-analysis of test meal studies

DEFF Research Database (Denmark)

Flint, Anne; Gregersen, Nikolaj T.; Gluud, Lise L.

2007-01-01

is unclear whether postprandial blood glucose or insulin exerts a regulatory function in short-term appetite regulation in humans. The aim of this study was to investigate, by use of meta-analysis, the role of blood glucose and insulin in short-term appetite sensation and energy intake (EI......) in normal weight and overweight participants. Data from seven test meal studies were used, including 136 healthy participants (ALL) (92 normal weight (NW) and 44 overweight or obese (OW)). All meals were served as breakfasts after an overnight fast, and appetite sensations and blood samples were obtained...... frequently in the postprandial period. Finally, an ad libitum lunch was served. Data were analysed by fixed effects study level (SL) meta-regression analysis and individual participant data (IPD) regression analysis, using STATA software. In SL analysis, postprandial insulin response was associated...

Is applying the same exercise-based inpatient program to normal and reduced left ventricular function patients the best strategy after coronary surgery? A focus on autonomic cardiac response.

Science.gov (United States)

Mendes, Renata Gonçalves; Simões, Rodrigo Polaquini; Costa, Fernando de Souza Melo; Pantoni, Camila Bianca Falasco; Di Thommazo-Luporini, Luciana; Luzzi, Sérgio; Amaral-Neto, Othon; Arena, Ross; Catai, Aparecida Maria; Borghi-Silva, Audrey

2014-01-01

To assess whether the same exercise-based inpatient program applied to patients with normal and reduced left ventricular function (LVF) evokes a similar cardiac autonomic response after coronary artery bypass graft (CABG). Forty-four patients post-CABG, subgrouped according to normal LVF [LVFN: n = 23; left ventricular ejection fraction (LVEF) ≥ 55%] and reduced LVF (LVFR: n = 21; LVEF 35-54%), were included. All initiated the exercise protocol on post-operative day 1 (PO1), following a whole progressive program until discharge. Cardiac autonomic response was assessed by the indices of heart rate variability (HRV) at rest and during exercise (extremity range of motion and ambulation). During ambulation, lower values of HRV indices were found in the LVFR group compared with the LVFN group [standard deviation of all RR (STDRR; 6.1 ± 2.7 versus 8.9 ± 4.7 ms), baseline width of the RR histogram (TINN; 30.6 ± 14.8 versus 45.8 ± 24.9 ms), SD2 (14.8 ± 8.0 versus 21.3 ± 9.0 ms), Shannon entropy (3.6 ± 0.5 versus 3.9 ± 0.4) and correlation dimension (0.08 ± 0.2 versus 0.2 ± 0.2)]. Also, when comparing the ambulation to rest change, lower values were observed in the LVFR group for linear (STDRR, TINN, RR TRI, rMSSD) and non-linear (SD2 and correlation dimension) HRV indices (p exercise (extremity range of motion), for mean intervals between heart beats and heart rate. For patients with LVFN, the same inpatient exercise protocol triggered a more attenuated autonomic response compared with patients with LVFR. These findings have implications as to how exercise should be prescribed according to LVF in the early stages following recovery from CABG. Implications for Rehabilitation Exercise-based inpatient program, performed by post-CABG patients who have normal left ventricular function, triggered a more attenuated cardiac autonomic response compared with patients with reduced left ventricular function. Volume of the inpatient exercises should be prescribed according

Topological resilience in non-normal networked systems

Science.gov (United States)

Asllani, Malbor; Carletti, Timoteo

2018-04-01

The network of interactions in complex systems strongly influences their resilience and the system capability to resist external perturbations or structural damages and to promptly recover thereafter. The phenomenon manifests itself in different domains, e.g., parasitic species invasion in ecosystems or cascade failures in human-made networks. Understanding the topological features of the networks that affect the resilience phenomenon remains a challenging goal for the design of robust complex systems. We hereby introduce the concept of non-normal networks, namely networks whose adjacency matrices are non-normal, propose a generating model, and show that such a feature can drastically change the global dynamics through an amplification of the system response to exogenous disturbances and eventually impact the system resilience. This early stage transient period can induce the formation of inhomogeneous patterns, even in systems involving a single diffusing agent, providing thus a new kind of dynamical instability complementary to the Turing one. We provide, first, an illustrative application of this result to ecology by proposing a mechanism to mute the Allee effect and, second, we propose a model of virus spreading in a population of commuters moving using a non-normal transport network, the London Tube.

Bitter taste stimuli induce differential neural codes in mouse brain.

Directory of Open Access Journals (Sweden)

David M Wilson

Full Text Available A growing literature suggests taste stimuli commonly classified as "bitter" induce heterogeneous neural and perceptual responses. Here, the central processing of bitter stimuli was studied in mice with genetically controlled bitter taste profiles. Using these mice removed genetic heterogeneity as a factor influencing gustatory neural codes for bitter stimuli. Electrophysiological activity (spikes was recorded from single neurons in the nucleus tractus solitarius during oral delivery of taste solutions (26 total, including concentration series of the bitter tastants quinine, denatonium benzoate, cycloheximide, and sucrose octaacetate (SOA, presented to the whole mouth for 5 s. Seventy-nine neurons were sampled; in many cases multiple cells (2 to 5 were recorded from a mouse. Results showed bitter stimuli induced variable gustatory activity. For example, although some neurons responded robustly to quinine and cycloheximide, others displayed concentration-dependent activity (p<0.05 to quinine but not cycloheximide. Differential activity to bitter stimuli was observed across multiple neurons recorded from one animal in several mice. Across all cells, quinine and denatonium induced correlated spatial responses that differed (p<0.05 from those to cycloheximide and SOA. Modeling spatiotemporal neural ensemble activity revealed responses to quinine/denatonium and cycloheximide/SOA diverged during only an early, at least 1 s wide period of the taste response. Our findings highlight how temporal features of sensory processing contribute differences among bitter taste codes and build on data suggesting heterogeneity among "bitter" stimuli, data that challenge a strict monoguesia model for the bitter quality.

Observation of regenerated fungiform taste buds after severing the chorda tympani nerve using confocal laser scanning microscopy in vivo.

Science.gov (United States)

Saito, Takehisa; Ito, Tetsufumi; Kato, Yuji; Yamada, Takechiyo; Manabe, Yasuhiro; Narita, Norihiko

2014-03-01

To evaluate whether regenerated fungiform taste buds after severing the chorda tympani nerve can be detected by confocal laser scanning microscopy in vivo. Retrospective study. University hospital. Six patients with a normal gustatory function (Group 1), 9 patients with taste function recovery after severing the CTN (Group 2), and 5 patients without taste function recovery (Group 3) were included. In Groups 2 and 3, canal wall up (closed) tympanoplasty or canal wall down with canal reconstruction tympanoplasty was performed in all patients. Diagnostic. The severed nerves were readapted or approximated on the temporalis muscle fascia used to reconstruct the eardrum during surgery. Preoperative and postoperative gustatory functions were assessed using electrogustometry. Twelve to 260 months after severing the CTN, the surface of the midlateral region of the tongue was observed with a confocal laser microscope. EGM thresholds showed no response 1 month after surgery in all patients of Groups 2 and 3. In Group 2, EGM thresholds showed recovery 1 to 2 years after surgery and before confocal microscopy (-1.3 ± 6.5 dB). There was a significant difference between Group 1 (-5.7 ± 2.0 dB; p taste buds were observed in each FP, and 55 (79.7%) of 69 FP contained at least 1 taste bud. The mean number of taste bud per papilla was 3.7 ± 3.6. In patients with a recovered taste function (Group 2), 0 to 8 taste buds were observed in each FP. In this group, 54 (56.2%) of 94 FP contained at least 1 taste bud. The mean number of taste bud per papilla was 2.0 ± 2.2 (p taste bud was observed. Regenerated fungiform taste bud could be observed in vivo using confocal laser scanning microscopy, indicating that regenerated taste bud can be detected without biopsy.

Quantitative computed tomography determined regional lung mechanics in normal nonsmokers, normal smokers and metastatic sarcoma subjects.

Directory of Open Access Journals (Sweden)

Jiwoong Choi

Full Text Available Extra-thoracic tumors send out pilot cells that attach to the pulmonary endothelium. We hypothesized that this could alter regional lung mechanics (tissue stiffening or accumulation of fluid and inflammatory cells through interactions with host cells. We explored this with serial inspiratory computed tomography (CT and image matching to assess regional changes in lung expansion.We retrospectively assessed 44 pairs of two serial CT scans on 21 sarcoma patients: 12 without lung metastases and 9 with lung metastases. For each subject, two or more serial inspiratory clinically-derived CT scans were retrospectively collected. Two research-derived control groups were included: 7 normal nonsmokers and 12 asymptomatic smokers with two inspiratory scans taken the same day or one year apart respectively. We performed image registration for local-to-local matching scans to baseline, and derived local expansion and density changes at an acinar scale. Welch two sample t test was used for comparison between groups. Statistical significance was determined with a p value < 0.05.Lung regions of metastatic sarcoma patients (but not the normal control group demonstrated an increased proportion of normalized lung expansion between the first and second CT. These hyper-expanded regions were associated with, but not limited to, visible metastatic lung lesions. Compared with the normal control group, the percent of increased normalized hyper-expanded lung in sarcoma subjects was significantly increased (p < 0.05. There was also evidence of increased lung "tissue" volume (non-air components in the hyper-expanded regions of the cancer subjects relative to non-hyper-expanded regions. "Tissue" volume increase was present in the hyper-expanded regions of metastatic and non-metastatic sarcoma subjects. This putatively could represent regional inflammation related to the presence of tumor pilot cell-host related interactions.This new quantitative CT (QCT method for linking

Radiobiology in clinical radiation therapy - Part III: Normal tissue damage

International Nuclear Information System (INIS)

Travis, Elizabeth L.

1996-01-01

Objective: This is the third part of a course designed for residents in radiation oncology preparing for their boards. This part of the course will focus on the mechanisms underlying damage in normal tissues. Although conventional wisdom long held that killing and depletion of a critical cell(s) in a tissue was responsible for the later expression of damage, histopathologic changes in normal tissue can now be explained and better understood in terms of the new molecular biology. The concept that depletion of a single cell type is responsible for the observed histopathologic changes in normal tissues has been replaced by the hypothesis that damage results from the interaction of many different cell systems, including epithelial, endothelial, macrophages and fibroblasts, via the production of specific autocrine, paracrine and endocrine growth factors. A portion of this course will discuss the clinical and experimental data on the production and interaction of those cytokines and cell systems considered to be critical to tissue damage. It had long been suggested that interindividual differences in radiation-induced normal tissue damage was genetically regulated, at least in part. Both clinical and experimental data supported this hypothesis but it is the recent advances in human and mouse molecular genetics which have provided the tools to dissect out the genetic component of normal tissue damage. These data will be presented and related to the potential to develop genetic markers to identify sensitive individuals. The impact on clinical outcome of the ability to identify prospectively sensitive patients will be discussed. Clinically it is well-accepted that the volume of tissue irradiated is a critical factor in determining tissue damage. A profusion of mathematical models for estimating dose-volume relationships in a number of organs have been published recently despite the fact that little data are available to support these models. This course will review the

Responses to sugar and sugar receptor gene expression in different social roles of the honeybee (Apis mellifera).

Science.gov (United States)

Değirmenci, Laura; Thamm, Markus; Scheiner, Ricarda

2018-04-01

Honeybees (Apis mellifera) are well-known for their sophisticated division of labor with each bee performing sequentially a series of social tasks. Colony organization is largely based on age-dependent division of labor. While bees perform several tasks inside the hive such as caring for brood ("nursing"), cleaning or sealing brood cells or producing honey, older bees leave to colony to collect pollen (proteins) and nectar (carbohydrates) as foragers. The most pronounced behavioral transition occurs when nurse bees become foragers. For both social roles, the detection and evaluation of sugars is decisive for optimal task performance. Nurse bees rely on their gustatory senses to prepare brood food, while foragers evaluate a nectar source before starting to collect food from it. To test whether social organization is related to differential sensing of sugars we compared the taste of nurse bees and foragers for different sugars. Searching for molecular correlates for differences in sugar perception, we further quantified expression of gustatory receptor genes in both behavioral groups. Our results demonstrate that nurse bees and foragers perceive and evaluate different sugars differently. Both groups, however, prefer sucrose over fructose. At least part of the taste differences between social roles could be related to a differential expression of taste receptors in the antennae and brain. Our results suggest that differential expression of sugar receptor genes might be involved in regulating division of labor through nutrition-related signaling pathways. Copyright © 2017 Elsevier Ltd. All rights reserved.

Time-invariant component-based normalization for a simultaneous PET-MR scanner.

Science.gov (United States)

Belzunce, M A; Reader, A J

2016-05-07

Component-based normalization is a method used to compensate for the sensitivity of each of the lines of response acquired in positron emission tomography. This method consists of modelling the sensitivity of each line of response as a product of multiple factors, which can be classified as time-invariant, time-variant and acquisition-dependent components. Typical time-variant factors are the intrinsic crystal efficiencies, which are needed to be updated by a regular normalization scan. Failure to do so would in principle generate artifacts in the reconstructed images due to the use of out of date time-variant factors. For this reason, an assessment of the variability and the impact of the crystal efficiencies in the reconstructed images is important to determine the frequency needed for the normalization scans, as well as to estimate the error obtained when an inappropriate normalization is used. Furthermore, if the fluctuations of these components are low enough, they could be neglected and nearly artifact-free reconstructions become achievable without performing a regular normalization scan. In this work, we analyse the impact of the time-variant factors in the component-based normalization used in the Biograph mMR scanner, but the work is applicable to other PET scanners. These factors are the intrinsic crystal efficiencies and the axial factors. For the latter, we propose a new method to obtain fixed axial factors that was validated with simulated data. Regarding the crystal efficiencies, we assessed their fluctuations during a period of 230 d and we found that they had good stability and low dispersion. We studied the impact of not including the intrinsic crystal efficiencies in the normalization when reconstructing simulated and real data. Based on this assessment and using the fixed axial factors, we propose the use of a time-invariant normalization that is able to achieve comparable results to the standard, daily updated, normalization factors used in this

Effect of retinol on the hyperthermal response of normal tissue in vivo

International Nuclear Information System (INIS)

Rogers, M.A.; Marigold, J.C.L.; Hume, S.P.

1983-01-01

The effect of prior administration of retinol, a membrane labilizer, on the in vivo hyperthermal response of lysosomes was investigated in the mouse spleen using a quantitative histochemical assay for the lysosomal enzyme acid phosphatase. A dose of retinol which had no effect when given alone enhanced the thermal response of the lysosome, causing an increase in lysosomal membrane permeability. In contrast, the same dose of retinol had no effect on the gross hyperthermal response of mouse intestine; a tissue which is relatively susceptible to hyperthermia. Thermal damage to intestine was assayed directly by crypt loss 1 day after treatment or assessed as thermal enhancement of x-ray damage by counting crypt microcolonies 4 days after a combined heat and x-ray treatment. Thus, although the hyperthermal response of the lysosome could be enhanced by the administration of retinol, thermal damage at a gross tissue level appeared to be unaffected, suggesting that lysosomal membrane injury is unlikely to be a primary event in hyperthermal cell killing

Making nuclear 'normal'

International Nuclear Information System (INIS)

Haehlen, Peter; Elmiger, Bruno

2000-01-01

The mechanics of the Swiss NPPs' 'come and see' programme 1995-1999 were illustrated in our contributions to all PIME workshops since 1996. Now, after four annual 'waves', all the country has been covered by the NPPs' invitation to dialogue. This makes PIME 2000 the right time to shed some light on one particular objective of this initiative: making nuclear 'normal'. The principal aim of the 'come and see' programme, namely to give the Swiss NPPs 'a voice of their own' by the end of the nuclear moratorium 1990-2000, has clearly been attained and was commented on during earlier PIMEs. It is, however, equally important that Swiss nuclear energy not only made progress in terms of public 'presence', but also in terms of being perceived as a normal part of industry, as a normal branch of the economy. The message that Swiss nuclear energy is nothing but a normal business involving normal people, was stressed by several components of the multi-prong campaign: - The speakers in the TV ads were real - 'normal' - visitors' guides and not actors; - The testimonials in the print ads were all real NPP visitors - 'normal' people - and not models; - The mailings inviting a very large number of associations to 'come and see' activated a typical channel of 'normal' Swiss social life; - Spending money on ads (a new activity for Swiss NPPs) appears to have resulted in being perceived by the media as a normal branch of the economy. Today we feel that the 'normality' message has well been received by the media. In the controversy dealing with antinuclear arguments brought forward by environmental organisations journalists nowadays as a rule give nuclear energy a voice - a normal right to be heard. As in a 'normal' controversy, the media again actively ask themselves questions about specific antinuclear claims, much more than before 1990 when the moratorium started. The result is that in many cases such arguments are discarded by journalists, because they are, e.g., found to be

Normal movement selectivity in autism.

Science.gov (United States)

Dinstein, Ilan; Thomas, Cibu; Humphreys, Kate; Minshew, Nancy; Behrmann, Marlene; Heeger, David J

2010-05-13

It has been proposed that individuals with autism have difficulties understanding the goals and intentions of others because of a fundamental dysfunction in the mirror neuron system. Here, however, we show that individuals with autism exhibited not only normal fMRI responses in mirror system areas during observation and execution of hand movements but also exhibited typical movement-selective adaptation (repetition suppression) when observing or executing the same movement repeatedly. Movement selectivity is a defining characteristic of neurons involved in movement perception, including mirror neurons, and, as such, these findings argue against a mirror system dysfunction in autism. Copyright 2010 Elsevier Inc. All rights reserved.

HPA axis response to social stress is attenuated in schizophrenia but normal in depression: evidence from a meta-analysis of existing studies.

Science.gov (United States)

Ciufolini, Simone; Dazzan, Paola; Kempton, Matthew J; Pariante, Carmine; Mondelli, Valeria

2014-11-01

We conducted a meta-analysis to investigate the HPA axis response to social stress in studies that used the Trier Social Stress Test (TSST), or comparable distressing paradigms, in individuals with either depression or schizophrenia. Sample size-adjusted effect sizes (Hedge's g statistic) were calculated to estimate the HPA axis stress response to social stress. We used a meta-regression model to take into account the moderating effect of the baseline cortisol level. Participants with depression show an activation pattern to social stress similar to that of healthy controls. Despite a normal cortisol production rate, individuals with schizophrenia have lower cortisol levels than controls both in anticipation and after exposure to social stress. Participants with depression and higher cortisol levels before the task have an increased cortisol production and reached higher cortisol levels during the task. This may be explained by the presence of an impaired negative feedback. The activation pattern present in schizophrenia may explain the reduced ability to appropriately contextualize past experiences shown by individuals with psychosis in social stressful situation. Copyright © 2014 Elsevier Ltd. All rights reserved.

A lower dose threshold for the in vivo protective adaptive response to radiation. Tumorigenesis in chronically exposed normal and Trp53 heterozygous C57BL/6 mice

International Nuclear Information System (INIS)

Mitchel, R.E.J.; Burchart, P.; Wyatt, H.

2008-01-01

Low doses of ionizing radiation to cells and animals may induce adaptive responses that reduce the risk of cancer. However, there are upper dose thresholds above which these protective adaptive responses do not occur. We have now tested the hypothesis that there are similar lower dose thresholds that must be exceeded in order to induce protective effects in vivo. We examined the effects of low dose/low dose rate fractionated exposures on cancer formation in Trp53 normal or cancer-prone Trp53 heterozygous female C57BL/6 mice. Beginning at 6 weeks of age, mice were exposed 5 days/week to single daily doses (0.33 mGy, 0.7 mGy/h) totaling 48, 97 or 146 mGy over 30, 60 or 90 weeks. The exposures for shorter times (up to 60 weeks) appeared to be below the level necessary to induce overall protective adaptive responses in Trp53 normal mice, and detrimental effects (shortened lifespan, increased frequency) evident for only specific tumor types (B- and T-cell lymphomas), were produced. Only when the exposures were continued for 90 weeks did the dose become sufficient to induce protective adaptive responses, balancing the detrimental effects for these specific cancers, and reducing the risk level back to that of the unexposed animals. Detrimental effects were not seen for other tumor types, and a protective effect was seen for sarcomas after 60 weeks of exposure, which was then lost when the exposure continued for 90 weeks. As previously shown for the upper dose threshold for protection by low doses, the lower dose boundary between protection and harm was influenced by Trp53 functionality. Neither protection nor harm was observed in exposed Trp53 heterozygous mice, indicating that reduced Trp53 function raises the lower dose/dose rate threshold for both detrimental and protective tumorigenic effects. (author)

Cell survival of human tumor cells compared with normal fibroblasts following 60Co gamma irradiation

International Nuclear Information System (INIS)

Lloyd, E.L.; Henning, C.B.; Reynolds, S.D.; Holmblad, G.L.; Trier, J.E.

1982-01-01

Three tumor cell lines, two of which were shown to be HeLa cells, were irradiated with 60 Co gamma irradiation, together with two cell cultures of normal human diploid fibroblasts. Cell survival was studied in three different experiments over a dose range of 2 to 14 gray. All the tumor cell lines showed a very wide shoulder in the dose response curves in contrast to the extremely narrow shoulder of the normal fibroblasts. In addition, the D/sub o/ values for the tumor cell lines were somewhat greater. These two characteristics of the dose response curves resulted in up to 2 orders of magnitude less sensitivity for cell inactivation of HeLa cells when compared with normal cells at high doses (10 gray). Because of these large differences, the extrapolation of results from the irradiation of HeLa cells concerning the mechanisms of normal cell killing should be interpreted with great caution

A Neural Signature of Divisive Normalization at the Level of Multisensory Integration in Primate Cortex.

Science.gov (United States)

Ohshiro, Tomokazu; Angelaki, Dora E; DeAngelis, Gregory C

2017-07-19

Studies of multisensory integration by single neurons have traditionally emphasized empirical principles that describe nonlinear interactions between inputs from two sensory modalities. We previously proposed that many of these empirical principles could be explained by a divisive normalization mechanism operating in brain regions where multisensory integration occurs. This normalization model makes a critical diagnostic prediction: a non-preferred sensory input from one modality, which activates the neuron on its own, should suppress the response to a preferred input from another modality. We tested this prediction by recording from neurons in macaque area MSTd that integrate visual and vestibular cues regarding self-motion. We show that many MSTd neurons exhibit the diagnostic form of cross-modal suppression, whereas unisensory neurons in area MT do not. The normalization model also fits population responses better than a model based on subtractive inhibition. These findings provide strong support for a divisive normalization mechanism in multisensory integration. Copyright © 2017 Elsevier Inc. All rights reserved.

Effects of hyperthermia and ionizing radiation in normal and ataxia telangiectasia human fibroblast lines

International Nuclear Information System (INIS)

Mitchel, R.E.J.; Chan, A.; Smith, B.P.; Child, S.D.; Paterson, M.C.

1984-01-01

The effects of 45 0 C hyperthermia and γ radiation have been studied in three normal human fibroblast lines (GM38, GM730, WI38) and compared to the effects in two lines derived from patients with the hereditary disease ataxia telangiectasia (AR3BI, AT5BI). All lines, both normal and γ-sensitive AT, showed a similar resistance to killing by heat alone, suggesting that the defect responsible for the increased radiation sensitivity in AT lines does not confer increased heat sensitivity. Shouldered survival curves were obtained in each case indicating the ability to accumulate sublethal heat damage. All normal and AT cell lines exhibited increased resistance to the lethal effects of heat in response to a thermal stress, indicating that the defect that causes radiosensitivity in AT cell lines does not prevent the induction of thermotolerance. It was hypothesized that in normal cells, this heat treatment inactivates the process which is already defective in AT lines, and that this process may be required for the proper rejoining of double-strand breaks produced during the repair of other radiation-induced lesions

Normal pressure hydrocephalus. Influences on cerebral hemodynamic and cerebrospinal fluid pressure--chemical autoregulation

International Nuclear Information System (INIS)

Meyer, J.S.; Tachibana, H.; Hardenberg, J.P.; Dowell, R.E. Jr.; Kitagawa, Y.; Mortel, K.F.

1984-01-01

Blood flow in the cerebral gray matter was measured in normal pressure hydrocephalus and Alzheimer disease by 133Xe inhalation. Flow values in the frontal and temporal gray matter increased after lowering cerebrospinal fluid (CSF) pressure by lumbar puncture in normal pressure hydrocephalus (p less than 0.05) and also after shunting. One case with cerebral complications did not improve clinically. In Alzheimer disease the reverse (decreases in flow in the gray matter) occurred after removal of CSF. Normal pressure hydrocephalus was associated with impaired cerebral vasomotor responsiveness during 100% oxygen and 5% carbon dioxide inhalation. This complication was restored toward normal after CSF removal and/or shunting. Cerebral blood flow measurements appear to be useful for confirming the diagnosis of normal pressure hydrocephalus and predicting the clinical benefit from shunting

Use of Sine Shaped High-Frequency Rhythmic Visual Stimuli Patterns for SSVEP Response Analysis and Fatigue Rate Evaluation in Normal Subjects

Directory of Open Access Journals (Sweden)

Ahmadreza Keihani

2018-05-01

Full Text Available Background: Recent EEG-SSVEP signal based BCI studies have used high frequency square pulse visual stimuli to reduce subjective fatigue. However, the effect of total harmonic distortion (THD has not been considered. Compared to CRT and LCD monitors, LED screen displays high-frequency wave with better refresh rate. In this study, we present high frequency sine wave simple and rhythmic patterns with low THD rate by LED to analyze SSVEP responses and evaluate subjective fatigue in normal subjects.Materials and Methods: We used patterns of 3-sequence high-frequency sine waves (25, 30, and 35 Hz to design our visual stimuli. Nine stimuli patterns, 3 simple (repetition of each of above 3 frequencies e.g., P25-25-25 and 6 rhythmic (all of the frequencies in 6 different sequences e.g., P25-30-35 were chosen. A hardware setup with low THD rate (<0.1% was designed to present these patterns on LED. Twenty two normal subjects (aged 23–30 (25 ± 2.1 yrs were enrolled. Visual analog scale (VAS was used for subjective fatigue evaluation after presentation of each stimulus pattern. PSD, CCA, and LASSO methods were employed to analyze SSVEP responses. The data including SSVEP features and fatigue rate for different visual stimuli patterns were statistically evaluated.Results: All 9 visual stimuli patterns elicited SSVEP responses. Overall, obtained accuracy rates were 88.35% for PSD and > 90% for CCA and LASSO (for TWs > 1 s. High frequency rhythmic patterns group with low THD rate showed higher accuracy rate (99.24% than simple patterns group (98.48%. Repeated measure ANOVA showed significant difference between rhythmic pattern features (P < 0.0005. Overall, there was no significant difference between the VAS of rhythmic [3.85 ± 2.13] compared to the simple patterns group [3.96 ± 2.21], (P = 0.63. Rhythmic group had lower within group VAS variation (min = P25-30-35 [2.90 ± 2.45], max = P35-25-30 [4.81 ± 2.65] as well as least individual pattern VAS (P25

Birkhoff normalization

NARCIS (Netherlands)

Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

2003-01-01

The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for

Pancreatic beta-cell responses to GLP-1 after near-normalization of blood glucose in patients with type 2 diabetes

DEFF Research Database (Denmark)

Asmar, Meena; Højberg, Patricia V; Deacon, Carolyn F

2010-01-01

glucose (BG) using insulin (mean diurnal BG: 6.4+/-0.3 mmol/l; HbA(1)c: 6.6+/-0.3%). Nine matched healthy subjects acted as controls. In controls, area-under-curve (AUC) for amylin, C-peptide and proinsulin were higher with GLP-1 than saline (PAUC amylin/C-peptide ratio was similar on both......This study investigated the effects of strict glycaemic control on beta-cell function in nine obese subjects with type 2 diabetes (T2DM), using graded glucose infusions together with infusions of saline or GLP-1 before (HbA(1)c: 8.0+/-0.4%) and after four weeks of near-normalization of blood...... amylin/C-peptide ratios rose to control levels. Near-normoglycaemia tended to reduce AUC proinsulin/C-peptide ratio, which was significant (P=0.04) with GLP-1, but still higher than with saline (P=0.004). In conclusion, amylin, C-peptide and proinsulin responses to glucose were unaffected by four weeks...

Pancreatic ß-cell responses to GLP-1 after near-normalization of blood glucose in patients with type 2 diabetes

DEFF Research Database (Denmark)

Asmar, Meena; Højberg, Patricia; Deacon, Carolyn F.

2010-01-01

glucose (BG) using insulin (mean diurnal BG: 6.4+/-0.3 mmol/l; HbA(1)c: 6.6+/-0.3%). Nine matched healthy subjects acted as controls. In controls, area-under-curve (AUC) for amylin, C-peptide and proinsulin were higher with GLP-1 than saline (PAUC amylin/C-peptide ratio was similar on both......This study investigated the effects of strict glycaemic control on beta-cell function in nine obese subjects with type 2 diabetes (T2DM), using graded glucose infusions together with infusions of saline or GLP-1 before (HbA(1)c: 8.0+/-0.4%) and after four weeks of near-normalization of blood...... amylin/C-peptide ratios rose to control levels. Near-normoglycaemia tended to reduce AUC proinsulin/C-peptide ratio, which was significant (P=0.04) with GLP-1, but still higher than with saline (P=0.004). In conclusion, amylin, C-peptide and proinsulin responses to glucose were unaffected by four weeks...

Normal Pressure Hydrocephalus (NPH)

Science.gov (United States)

... local chapter Join our online community Normal Pressure Hydrocephalus (NPH) Normal pressure hydrocephalus is a brain disorder ... Symptoms Diagnosis Causes & risks Treatments About Normal Pressure Hydrocephalus Normal pressure hydrocephalus occurs when excess cerebrospinal fluid ...

Effect of Exogenous Cues on Covert Spatial Orienting in Deaf and Normal Hearing Individuals.

Science.gov (United States)

Prasad, Seema Gorur; Patil, Gouri Shanker; Mishra, Ramesh Kumar

2015-01-01

Deaf individuals have been known to process visual stimuli better at the periphery compared to the normal hearing population. However, very few studies have examined attention orienting in the oculomotor domain in the deaf, particularly when targets appear at variable eccentricity. In this study, we examined if the visual perceptual processing advantage reported in the deaf people also modulates spatial attentional orienting with eye movement responses. We used a spatial cueing task with cued and uncued targets that appeared at two different eccentricities and explored attentional facilitation and inhibition. We elicited both a saccadic and a manual response. The deaf showed a higher cueing effect for the ocular responses than the normal hearing participants. However, there was no group difference for the manual responses. There was also higher facilitation at the periphery for both saccadic and manual responses, irrespective of groups. These results suggest that, owing to their superior visual processing ability, the deaf may orient attention faster to targets. We discuss the results in terms of previous studies on cueing and attentional orienting in deaf.

Cy5 total protein normalization in Western blot analysis.

Science.gov (United States)

Hagner-McWhirter, Åsa; Laurin, Ylva; Larsson, Anita; Bjerneld, Erik J; Rönn, Ola

2015-10-01

Western blotting is a widely used method for analyzing specific target proteins in complex protein samples. Housekeeping proteins are often used for normalization to correct for uneven sample loads, but these require careful validation since expression levels may vary with cell type and treatment. We present a new, more reliable method for normalization using Cy5-prelabeled total protein as a loading control. We used a prelabeling protocol based on Cy5 N-hydroxysuccinimide ester labeling that produces a linear signal response. We obtained a low coefficient of variation (CV) of 7% between the ratio of extracellular signal-regulated kinase (ERK1/2) target to Cy5 total protein control signals over the whole loading range from 2.5 to 20.0μg of Chinese hamster ovary cell lysate protein. Corresponding experiments using actin or tubulin as controls for normalization resulted in CVs of 13 and 18%, respectively. Glyceraldehyde-3-phosphate dehydrogenase did not produce a proportional signal and was not suitable for normalization in these cells. A comparison of ERK1/2 signals from labeled and unlabeled samples showed that Cy5 prelabeling did not affect antibody binding. By using total protein normalization we analyzed PP2A and Smad2/3 levels with high confidence. Copyright © 2015 Elsevier Inc. All rights reserved.

CT in normal pressure hydrocephalus

International Nuclear Information System (INIS)

Fujita, Katsuzo; Nogaki, Hidekazu; Noda, Masaya; Kusunoki, Tadaki; Tamaki, Norihiko

1981-01-01

CT scans were obtained on 33 patients (age 73y. to 31y.) with the diagnosis of normal pressure hydrocephalus. In each case, the diagnosis was made on the basis of the symptoms, CT and cisternographic findings. Underlying diseases of normal pressure hydrocephalus are ruptured aneurysms (21 cases), arteriovenous malformations (2 cases), head trauma (1 case), cerebrovascular accidents (1 case) and idiopathie (8 cases). Sixteen of 33 patients showed marked improvement, five, moderate or minimal improvement, and twelve, no change. The results were compared with CT findings and clinical response to shunting. CT findings were classified into five types, bases on the degree of periventricular hypodensity (P.V.H.), the extent of brain damage by underlying diseases, and the degree of cortical atrophy. In 17 cases of type (I), CT shows the presence of P.V.H. with or without minimal frontal lobe damage and no cortical atrophy. The good surgical improvements were achieved in all cases of type (I) by shunting. In 4 cases of type (II), CT shows the presence of P.V.H. and severe brain damage without cortical atrophy. The fair clinical improvements were achieved in 2 cases (50%) by shunting. In one case of type (III), CT shows the absence of P.V.H. without brain damage nor cortical atrophy. No clinical improvement was obtained by shunting in this type. In 9 cases of type (IV) with mild cortical atrophy, the fair clinical improvement was achieved in two cases (22%) and no improvement in 7 cases. In 2 cases of type (V) with moderate or marked cortical atrophy, no clinical improvement was obtained by shunting. In conclusion, it appeared from the present study that there was a good correlation between the result of shunting and the type of CT, and clinical response to shunting operation might be predicted by classification of CT findings. (author)

Off-normal performance of EBR-II [Experimental Breeder Reactor] driver fuel

International Nuclear Information System (INIS)

Seidel, B.R.; Batte, G.L.; Lahm, C.E.; Fryer, R.M.; Koenig, J.F.; Hofman, G.L.

1986-09-01

The off-normal performance of EBR-II Mark-II driver fuel has been more than satisfactory as demonstrated by robust reliability under repeated transient overpower and undercooled loss-of-flow tests, by benign run-beyond-cladding-breach behavior, and by forgiving response to fabrication defects including lack of bond. Test results have verified that the metallic driver fuel is very tolerant of off-normal events. This behavior has allowed EBR-II to operate in a combined steady-state and transient mode to provide test capability without limitation from the metallic driver fuel

Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

Science.gov (United States)

Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

2016-03-01

Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

Primary pulmonary choriocarcinoma after human chorionic gonadotropin normalization following hydatidiform mole

DEFF Research Database (Denmark)

Maestá, Izildinha; Leite, Fábio Vicente; Michelin, Odair Carlito

2010-01-01

BACKGROUND: Primary pulmonary choriocarcinoma (PPC) is rare and frequently leads to death. CASES: Two young patients presented with previous molar pregnancy and spontaneous serum human chorionic gonadotropin (hCG) normalization. Patient 1 was referred to our center after partial response to chemo...

Normality of raw data in general linear models: The most widespread myth in statistics

Science.gov (United States)

Kery, Marc; Hatfield, Jeff S.

2003-01-01

In years of statistical consulting for ecologists and wildlife biologists, by far the most common misconception we have come across has been the one about normality in general linear models. These comprise a very large part of the statistical models used in ecology and include t tests, simple and multiple linear regression, polynomial regression, and analysis of variance (ANOVA) and covariance (ANCOVA). There is a widely held belief that the normality assumption pertains to the raw data rather than to the model residuals. We suspect that this error may also occur in countless published studies, whenever the normality assumption is tested prior to analysis. This may lead to the use of nonparametric alternatives (if there are any), when parametric tests would indeed be appropriate, or to use of transformations of raw data, which may introduce hidden assumptions such as multiplicative effects on the natural scale in the case of log-transformed data. Our aim here is to dispel this myth. We very briefly describe relevant theory for two cases of general linear models to show that the residuals need to be normally distributed if tests requiring normality are to be used, such as t and F tests. We then give two examples demonstrating that the distribution of the response variable may be nonnormal, and yet the residuals are well behaved. We do not go into the issue of how to test normality; instead we display the distributions of response variables and residuals graphically.

Using an APOS Framework to Understand Teachers' Responses to Questions on the Normal Distribution

Science.gov (United States)

Bansilal, Sarah

2014-01-01

This study is an exploration of teachers' engagement with concepts embedded in the normal distribution. The participants were a group of 290 in-service teachers enrolled in a teacher development program. The research instrument was an assessment task that can be described as an "unknown percentage" problem, which required the application…

Electrophysiological studies of the feasibility of suprachoroidal-transretinal stimulation for artificial vision in normal and RCS rats.

Science.gov (United States)

Kanda, Hiroyuki; Morimoto, Takeshi; Fujikado, Takashi; Tano, Yasuo; Fukuda, Yutaka; Sawai, Hajime

2004-02-01

Assessment of a novel method of retinal stimulation, known as suprachoroidal-transretinal stimulation (STS), which was designed to minimize insult to the retina by implantation of stimulating electrodes for artificial vision. In 17 normal hooded rats and 12 Royal College of Surgeons (RCS) rats, a small area of the retina was focally stimulated with electric currents through an anode placed on the fenestrated sclera and a cathode inserted into the vitreous chamber. Evoked potentials (EPs) in response to STS were recorded from the surface of the superior colliculus (SC) with a silver-ball electrode, and their physiological properties and localization were studied. In both normal and RCS rats, STS elicited triphasic EPs that were vastly diminished by changing polarity of stimulating electrodes and abolished by transecting the optic nerve. The threshold intensity (C) of the EP response to STS was approximately 7.2 +/- 2.8 nC in normal and 12.9 +/- 7.7 nC in RCS rats. The responses to minimal STS were localized in an area on the SC surface measuring 0.12 +/- 0.07 mm(2) in normal rats and 0.24 +/- 0.12 mm(2) in RCS rats. The responsive area corresponded retinotopically to the retinal region immediately beneath the anodic stimulating electrode. STS is less invasive in the retina than stimulation through epiretinal or subretinal implants. STS can generate focal excitation in retinal ganglion cells in normal animals and in those with degenerated photoreceptors, which suggests that this method of retinal stimulation is suitable for artificial vision.

Potential clinical impact of normal-tissue intrinsic radiosensitivity testing

International Nuclear Information System (INIS)

Bentzen, Soeren M.

1997-01-01

A critical appraisal is given of the possible benefit from a reliable pre-treatment knowledge of individual normal-tissue sensitivity to radiotherapy. The considerations are in part, but not exclusively, based on the recent experience with in vitro colony-forming assays of the surviving fraction at 2 Gy, the SF 2 . Three strategies are reviewed: (1) to screen for rare cases with extreme radiosensitivity, so-called over-reactors, and treat these with reduced total dose, (2) to identify the sensitive tail of the distribution of 'normal' radiosensitivities, refer these patients to other treatment, and to escalate the dose to the remaining patients, or (3) to individualize dose prescriptions based on individual radiosensitivity, i.e. treating to isoeffect rather than to a specific dose-fractionation schedule. It is shown that these strategies will have a small, if any, impact on routine radiotherapy. Screening for over-reactors is hampered by the low prevalence of these among otherwise un-selected patients that leads to a low positive predictive value of in vitro radiosensitivity assays. It is argued, that this problem may persist even if the noise on current assays could be reduced to (the unrealistic value of) zero, simply because of the large biological variation in SF 2 . Removing the sensitive tail of the patient population, will only have a minor effect on the dose that could be delivered to the remaining patients, because of the sigmoid shape of empirical dose-response relationships. Finally, individualizing dose prescriptions based exclusively on information from a normal-tissue radiosensitivity assay, leads to a nearly symmetrical distribution of dose-changes that would produce a very small gain, or even a loss, of tumor control probability if implemented in the clinic. From a theoretical point of view, other strategies could be devised and some of these are considered in this review. Right now the most promising clinical use of in vitro radiosensitivity

Controlled cross-over study in normal subjects of naloxone-preceding-lactate infusions; respiratory and subjective responses: relationship to endogenous opioid system, suffocation false alarm theory and childhood parental loss.

Science.gov (United States)

Preter, M; Lee, S H; Petkova, E; Vannucci, M; Kim, S; Klein, D F

2011-02-01

The expanded suffocation false alarm theory (SFA) hypothesizes that dysfunction in endogenous opioidergic regulation increases sensitivity to CO2, separation distress and panic attacks. In panic disorder (PD) patients, both spontaneous clinical panics and lactate-induced panics markedly increase tidal volume (TV), whereas normals have a lesser effect, possibly due to their intact endogenous opioid system. We hypothesized that impairing the opioidergic system by naloxone could make normal controls parallel PD patients' response when lactate challenged. Whether actual separations and losses during childhood (childhood parental loss, CPL) affected naloxone-induced respiratory contrasts was explored. Subjective panic-like symptoms were analyzed although pilot work indicated that the subjective aspect of anxious panic was not well modeled by this specific protocol. Randomized cross-over sequences of intravenous naloxone (2 mg/kg) followed by lactate (10 mg/kg), or saline followed by lactate, were given to 25 volunteers. Respiratory physiology was objectively recorded by the LifeShirt. Subjective symptomatology was also recorded. Impairment of the endogenous opioid system by naloxone accentuates TV and symptomatic response to lactate. This interaction is substantially lessened by CPL. Opioidergic dysregulation may underlie respiratory pathophysiology and suffocation sensitivity in PD. Comparing specific anti-panic medications with ineffective anti-panic agents (e.g. propranolol) can test the specificity of the naloxone+lactate model. A screen for putative anti-panic agents and a new pharmacotherapeutic approach are suggested. Heuristically, the experimental unveiling of the endogenous opioid system impairing effects of CPL and separation in normal adults opens a new experimental, investigatory area.

Controlled cross-over study in normal subjects of naloxone-preceding-lactate infusions; respiratory and subjective responses: relationship to endogenous opioid system, suffocation false alarm theory and childhood parental loss

Science.gov (United States)

Preter, M.; Lee, S. H.; Petkova, E.; Vannucci, M.; Kim, S.; Klein, D. F.

2015-01-01

Background The expanded suffocation false alarm theory (SFA) hypothesizes that dysfunction in endogenous opioidergic regulation increases sensitivity to CO2, separation distress and panic attacks. In panic disorder (PD) patients, both spontaneous clinical panics and lactate-induced panics markedly increase tidal volume (TV), whereas normals have a lesser effect, possibly due to their intact endogenous opioid system. We hypothesized that impairing the opioidergic system by naloxone could make normal controls parallel PD patients' response when lactate challenged. Whether actual separations and losses during childhood (childhood parental loss, CPL) affected naloxone-induced respiratory contrasts was explored. Subjective panic-like symptoms were analyzed although pilot work indicated that the subjective aspect of anxious panic was not well modeled by this specific protocol. Method Randomized cross-over sequences of intravenous naloxone (2 mg/kg) followed by lactate (10 mg/kg), or saline followed by lactate, were given to 25 volunteers. Respiratory physiology was objectively recorded by the LifeShirt. Subjective symptomatology was also recorded. Results Impairment of the endogenous opioid system by naloxone accentuates TV and symptomatic response to lactate. This interaction is substantially lessened by CPL. Conclusions Opioidergic dysregulation may underlie respiratory pathophysiology and suffocation sensitivity in PD. Comparing specific anti-panic medications with ineffective anti-panic agents (e.g. propranolol) can test the specificity of the naloxone + lactate model. A screen for putative anti-panic agents and a new pharmacotherapeutic approach are suggested. Heuristically, the experimental unveiling of the endogenous opioid system impairing effects of CPL and separation in normal adults opens a new experimental, investigatory area. PMID:20444308

On radiation damage to normal tissues and its treatment. Pt. 2

International Nuclear Information System (INIS)

Michalowski, A.S.

1994-01-01

In addition to transiently inhibiting cell cycle progression and sterilizing those cells capable of proliferation, irradiation disturbs the homeostasis effected by endogenous mediators of intercellular communication (humoral component of tissue response to radiation). Changes in the mediator levels may modulate radiation effects either by a assisting a return to normality (e.g., through a rise in H-type cell lineage-specific growth factors) or by aggravating the damage. The latter mode is illustrated with reports on changes in eicosanoid levels after irradiation and on results of empirical treatment of radiation injuries with anti-inflammatory drugs. Prodromal, acute and chronic effects of radiation are accompanied by excessive production of eicosanoids (prostaglandins, prostacyclin, thromboxanes and leukotrienes). These endogenous mediators of inflammatory reactions may be responsible for the vasodilatation, vasoconstriction, increased microvascular permeability, thrombosis and chemotaxis observed after radiation exposure. Glucocorticoids inhibit eicosanoid synthesis primarily by interfering with phospholipase A 2 whilst non-steroidal anti-inflammatory drugs prevent prostaglandin/thromboxane synthesis by inhibiting cycloxygenase. When administered after irradiation on empirical grounds, drugs belonging to both groups tend to attenuate a range of prodomal, acute and chronic effects of radiation in man and animals. Taken together, these two sets of observations are highly suggestive of a contribution of humoral factors to the adverse responses of normal tissues and organs to radiation. A full account of radiation damage should therefore consist of complementary descriptions of cellular and humoral events. Further studies on anti-inflammatory drug treatment of radiation damage to normal organs are justified and desirable. (orig.)

Ghrelin is produced in taste cells and ghrelin receptor null mice show reduced taste responsivity to salty (NaCl and sour (citric acid tastants.

Directory of Open Access Journals (Sweden)

Yu-Kyong Shin

2010-09-01

Full Text Available The gustatory system plays a critical role in determining food preferences, food intake and energy balance. The exact mechanisms that fine tune taste sensitivity are currently poorly defined, but it is clear that numerous factors such as efferent input and specific signal transduction cascades are involved.Using immunohistochemical analyses, we show that ghrelin, a hormone classically considered to be an appetite-regulating hormone, is present within the taste buds of the tongue. Prepro-ghrelin, prohormone convertase 1/3 (PC 1/3, ghrelin, its cognate receptor (GHSR, and ghrelin-O-acyltransferase (GOAT , the enzyme that activates ghrelin are expressed in Type I, II, III and IV taste cells of mouse taste buds. In addition, ghrelin and GHSR co-localize in the same taste cells, suggesting that ghrelin works in an autocrine manner in taste cells. To determine a role for ghrelin in modifying taste perception, we performed taste behavioral tests using GHSR null mice. GHSR null mice exhibited significantly reduced taste responsivity to sour (citric acid and salty (sodium chloride tastants.These findings suggest that ghrelin plays a local modulatory role in determining taste bud signaling and function and could be a novel mechanism for the modulation of salty and sour taste responsivity.

Autobiographical Memory in Normal Ageing and Dementia

Directory of Open Access Journals (Sweden)

Harvey J. Sagar

1991-01-01

Full Text Available Autobiographical memories in young and elderly normal subjects are drawn mostly from the recent past but elderly subjects relate a second peak of memories from early adulthood. Memory for remote past public events is relatively preserved in dementia, possibly reflecting integrity of semantic relative to episodic memory. We examined recall of specific, consistent autobiographical episodes in Alzheimer's disease (AD in response to cue words. Patients and control subjects drew most memories from the recent 20 years: episode age related to anterograde memory function but not subject age or dementia. Subjects also related a secondary peak of memories from early adulthood; episode age related to subject age and severity of dementia. The results suggest that preferential recall of memories from early adulthood is based on the salience of retrieval cues, altered by age and dementia, superimposed on a temporal gradient of semantic memory. Further, AD shows behavioural similarity to normal ageing.

Localization of cells containing sedimented amyloplasts in the shoots of normal and lazy rice seedlings.

Science.gov (United States)

Abe, K; Takahashi, H; Suge, H

1994-12-01

We have examined the localization of the cells containing sedimented amyloplasts (putative statocytes) and its relation to the graviresponding sites in the shoots of normal and lazy rice seedlings. All graviresponsive organs of the shoots of normal rice seedlings, the mesocotyl, the coleoptile and the leaf-sheath base, were found to possess the statocytes. This is the first indication that mesocotyl senses gravity by its own cells in inducing gravitropic bending in rice seedlings. In lazy-Kamenoo, although the shoots lost their gravitropic response with the advance of age, sedimentation of amyloplasts itself might not be attributable to the agravitropic growth of the shoots, because, including those of the leaf-sheath bases that had lost their response to gravity, sedimented amyloplasts appeared to be identical to those of normal Kamenoo and of younger seedlings of lazy-Kamenoo whose gravitropism is still apparent.

Plasma glucagon responses to L-arginine in various diseases

International Nuclear Information System (INIS)

Morita, Nobuto; Hayakawa, Hiroyuki; Kawai, Kohzo; Noto, Yutaka; Ohno, Taro

1978-01-01

To clarify the mechanism of abnormal glucose metabolism in the secondary diabetes, we examined the dynamics of plasma glucagon levels in various diseases which may accompany glucose intolerance. Plasma glucagon responses to L-arginine were observed in 20 liver cirrhotics, 8 patients with chronic renal failure, 6 patients with chronic pancreatitis, 4 patients, with hyperthyroidism, 22 diabetics and 9 normal controls. Plasma glucagon levels were determined by the radioimmunoassay method of Unger using 125 I-glucagon and antiserum 30K which is specific for pancreatic glucagon. In the cirrhotics, the plasma glucagon responses to L-arginine were significantly higher than in normal controls. The patients whose BSP retention at 45 minutes were above 30% showed higher plasma glucagon responses than in the patients whose BSP retention at 45 minutes were below 30%, suggesting that the more severely the liver was damaged, the more the plasma glucagon levels were elevated. In the patients with chronic renal failure, the plasma glucagon responses to L-arginine were also significantly higher than in normal controls. These abnormal levels were not improved by a hemodialysis, although serum creatinine levels were fairly decreased. In the patients with chronic pancreatitis, the plasma glucagon responses to L-arginine were the same as those in normal controls. In the patients with hyperthyroidism the plasma glucagon responses to L-arginine seemed to be lower than normal controls. In the diabetics, the plasma glucagon responses to L-arginine were almost the same as in normal controls. However their glucagon levels seemed to be relatively high, considering the fact that diabetics had high blood glucose levels. (auth.)

Simulation of salt behavior using in situ response

International Nuclear Information System (INIS)

Li, W.T.

1986-01-01

The time-dependent nonlinear structural behavior in a salt formation around the openings can be obtained by either performing computational analysis of measuring in situ responses. However, analysis using laboratory test data may often deviate from the actual in situ conditions and geomechanical instruments can provide information only up to the time when the measurements were taken. A method has been suggested for simulating the salt behavior by utilizing the steady-state portion of in situ response history. Governing equations for computational analysis were normalized to the creep constant, the equations were solved, and the analytical response history was then computed in terms of normalized time. By synchronizing the response history obtained from the analysis to the one measured at the site, the creep constant was determined. Then the structural response of the salt was computed. This paper presents an improved method for simulating the salt behavior. In this method, the governing equations are normalized to the creep function, which represents the transient and the steady-state creep behavior. Both the transient and the steady-state portions of in situ response history are used in determining the creep function. Finally, a nonlinear mapping process relating the normalized and real time domains determines the behavior of the salt

Experimental studies on interactions of radiation and cancer chemotherapeutic drugs in normal tissues and a solid tumour

International Nuclear Information System (INIS)

Maase, H. van der

1986-01-01

The interactions of radiation and seven cancer chemotherapeutic drugs have been investigated in four normal tissues and in a solid C 3 H mouse mammary carcinoma in vivo. The investigated drugs were adriamycin (ADM), bleomycin (BLM), cyclophosphamide (CTX), 5-fluorouracil (5-FU), methotrexate (MTX), mitomycin C (MM-C) and cis-diamminedichloroplatinum(II) (cis-DDP). The drugs enhanced the radiation response in most cases. However, signs of radioprotection was observed for CTX in skin and for MTX in haemopoietic tissue. The interval and the sequence of the two treatment modalities were of utmost importance for the normal tissue reactions. In general, the most serious interactions occurred when drugs were administered simultaneously with or a few hours before radiation. The radiation-modifying effect of the drugs deviated from this pattern in the haemopoietic tissue as the radiation response was most enhanced on drug administration 1-3 days after radiation. Enhancement of the radiation response was generally less pronounced in the tumour model than in the normal tissues. The combined drug-radiation effect was apparently less time-dependent in the tumour than in the normal tissues. (Auth.)

Bicervical normal uterus with normal vagina | Okeke | Annals of ...

African Journals Online (AJOL)

To the best of our knowledge, only few cases of bicervical normal uterus with normal vagina exist in the literature; one of the cases had an anterior‑posterior disposition. This form of uterine abnormality is not explicable by the existing classical theory of mullerian anomalies and suggests that a complex interplay of events ...

Changes in taste bud volume during taste disturbance.

Science.gov (United States)

Srur, Ehab; Pau, Hans Wilhelm; Just, Tino

2011-08-01

On-line mapping and serial volume measurements of taste buds with confocal laser scanning microscopy provide information on the peripheral gustatory organ over time. We report the volumetric measurements of four selected fungiform papillae over 8 weeks in a 62-year-old man with taste disturbance, which was more apparent on the right than on the left side. In the two papillae on the right side, no taste buds were detected within the fungiform papillae in the sixth and eighth week. During sixth and eighth week, there was no response to the highest presented stimuli in electrogustometry (1 mA) on the right-sided tongue tip nor at the tongue edge. The morphology (shape, diameter) of the fungiform papillae on both sides remained unchanged. Comparison of the time course of the volume changes revealed differences corresponding to gustatory sensitivity. These findings suggest that the time course of volume changes indicated taste disturbance in our patient, rather than morphological changes in the fungiform papillae. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Repair replication in cultured normal and transformed human fibroblasts

International Nuclear Information System (INIS)

Smith, C.A.; Hanawalt, P.C.

1976-01-01

Repair replication in response to ultraviolet irradiation has been studied in normal human diploid fibroblast cultures, W138, and an SV40 transformant, VA13. Quantitative comparisons have been made using the combined isotopic and density labelling method for assaying repair replication. No significant difference was found in the amount of repair replication performed, its dose response, or the time course between growing and confluent W138 cells, early passage and senescent cells, or normal W138 cells and the transformed VA13 cells. When [ 3 H]dThd was employed as the isotopic label in the presence of a 30-200 fold excess of unlabelled BrdUrd apparent differences in repair replication were seen between W138 cells shortly after subcultivation and cells which had been allowed to reach confluence. These differences were the same over a wide dose range and regardless of the passage number of the cells, but could be influenced by using different serum lots. The differences were not seen, however, when [ 3 H]BrdUrd provided the isotopic label; thus they reflect either impurities in the [ 3 H]dThd or a slight discrimination by some cellular process

Recognition memory for colored and black-and-white scenes in normal and color deficient observers (dichromats).

Science.gov (United States)

Brédart, Serge; Cornet, Alyssa; Rakic, Jean-Marie

2014-01-01

Color deficient (dichromat) and normal observers' recognition memory for colored and black-and-white natural scenes was evaluated through several parameters: the rate of recognition, discrimination (A'), response bias (B"D), response confidence, and the proportion of conscious recollections (Remember responses) among hits. At the encoding phase, 36 images of natural scenes were each presented for 1 sec. Half of the images were shown in color and half in black-and-white. At the recognition phase, these 36 pictures were intermixed with 36 new images. The participants' task was to indicate whether an image had been presented or not at the encoding phase, to rate their level of confidence in his her/his response, and in the case of a positive response, to classify the response as a Remember, a Know or a Guess response. Results indicated that accuracy, response discrimination, response bias and confidence ratings were higher for colored than for black-and-white images; this advantage for colored images was similar in both groups of participants. Rates of Remember responses were not higher for colored images than for black-and-white ones, whatever the group. However, interestingly, Remember responses were significantly more often based on color information for colored than for black-and-white images in normal observers only, not in dichromats.

Corticostriatal and Dopaminergic Response to Beer Flavor with Both fMRI and [(11) C]raclopride Positron Emission Tomography.

Science.gov (United States)

Oberlin, Brandon G; Dzemidzic, Mario; Harezlak, Jaroslaw; Kudela, Maria A; Tran, Stella M; Soeurt, Christina M; Yoder, Karmen K; Kareken, David A

2016-09-01

Cue-evoked drug-seeking behavior likely depends on interactions between frontal activity and ventral striatal (VST) dopamine (DA) transmission. Using [(11) C]raclopride (RAC) positron emission tomography (PET), we previously demonstrated that beer flavor (absent intoxication) elicited VST DA release in beer drinkers, inferred by RAC displacement. Here, a subset of subjects from this previous RAC-PET study underwent a similar paradigm during functional magnetic resonance imaging (fMRI) to test how orbitofrontal cortex (OFC) and VST blood oxygenation level-dependent (BOLD) responses to beer flavor are related to VST DA release and motivation to drink. Male beer drinkers (n = 28, age = 24 ± 2, drinks/wk = 16 ± 10) from our previous PET study participated in a similar fMRI paradigm wherein subjects tasted their most frequently consumed brand of beer and Gatorade(®) (appetitive control). We tested for correlations between BOLD activation in fMRI and VST DA responses in PET, and drinking-related variables. Compared to Gatorade, beer flavor increased wanting and desire to drink, and induced BOLD responses in bilateral OFC and right VST. Wanting and desire to drink correlated with both right VST and medial OFC BOLD activation to beer flavor. Like the BOLD findings, beer flavor (relative to Gatorade) again induced right VST DA release in this fMRI subject subset, but there was no correlation between DA release and the magnitude of BOLD responses in frontal regions of interest. Both imaging modalities showed a right-lateralized VST response (BOLD and DA release) to a drug-paired conditioned stimulus, whereas fMRI BOLD responses in the VST and medial OFC also reflected wanting and desire to drink. The data suggest the possibility that responses to drug-paired cues may be rightward biased in the VST (at least in right-handed males) and that VST and OFC responses in this gustatory paradigm reflect stimulus wanting. Copyright © 2016 by the Research Society on

Smooth quantile normalization.

Science.gov (United States)

Hicks, Stephanie C; Okrah, Kwame; Paulson, Joseph N; Quackenbush, John; Irizarry, Rafael A; Bravo, Héctor Corrada

2018-04-01

Between-sample normalization is a critical step in genomic data analysis to remove systematic bias and unwanted technical variation in high-throughput data. Global normalization methods are based on the assumption that observed variability in global properties is due to technical reasons and are unrelated to the biology of interest. For example, some methods correct for differences in sequencing read counts by scaling features to have similar median values across samples, but these fail to reduce other forms of unwanted technical variation. Methods such as quantile normalization transform the statistical distributions across samples to be the same and assume global differences in the distribution are induced by only technical variation. However, it remains unclear how to proceed with normalization if these assumptions are violated, for example, if there are global differences in the statistical distributions between biological conditions or groups, and external information, such as negative or control features, is not available. Here, we introduce a generalization of quantile normalization, referred to as smooth quantile normalization (qsmooth), which is based on the assumption that the statistical distribution of each sample should be the same (or have the same distributional shape) within biological groups or conditions, but allowing that they may differ between groups. We illustrate the advantages of our method on several high-throughput datasets with global differences in distributions corresponding to different biological conditions. We also perform a Monte Carlo simulation study to illustrate the bias-variance tradeoff and root mean squared error of qsmooth compared to other global normalization methods. A software implementation is available from https://github.com/stephaniehicks/qsmooth.

Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

Science.gov (United States)

Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

2015-01-01

A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

Increased intensity discrimination thresholds in tinnitus subjects with a normal audiogram

DEFF Research Database (Denmark)

Epp, Bastian; Hots, J.; Verhey, J. L.

2012-01-01

Recent auditory brain stem response measurements in tinnitus subjects with normal audiograms indicate the presence of hidden hearing loss that manifests as reduced neural output from the cochlea at high sound intensities, and results from mice suggest a link to deafferentation of auditory nerve...... fibers. As deafferentation would lead to deficits in hearing performance, the present study investigates whether tinnitus patients with normal hearing thresholds show impairment in intensity discrimination compared to an audiometrically matched control group. Intensity discrimination thresholds were...... significantly increased in the tinnitus frequency range, consistent with the hypothesis that auditory nerve fiber deafferentation is associated with tinnitus....

Normal foot and ankle

International Nuclear Information System (INIS)

Weissman, S.D.

1989-01-01

The foot may be thought of as a bag of bones tied tightly together and functioning as a unit. The bones re expected to maintain their alignment without causing symptomatology to the patient. The author discusses a normal radiograph. The bones must have normal shape and normal alignment. The density of the soft tissues should be normal and there should be no fractures, tumors, or foreign bodies

Pentobarbital anesthesia and the response of tumor and normal tissue in the C3Hf/SED mouse to radiation

International Nuclear Information System (INIS)

Suit, H.D.; Sedlacek, R.S.; Silver, G.; Dosoretz, D.

1985-01-01

Experiments have been performed to assess the effect of sodium pentobarbital (NaPb) on the response of MCaIV, FSaII, and SCCVII using TCD50 and acute reaction of normal skin as end points. The TCD50 was lower or unchanged in the anesthetized than in the conscious mouse. There was no effect of NaPb on the acute reaction of skin. The ERs for NaPb on the TCD50 (ν = 1) for air breathing condition was essentially 1.0 for all three tumors. For the FSaII and SCCVII pentobarbital enhancement ratios were 1.29 and 1.34 for O/sub 2/3ATA conditions. For two dose (ν=2) irradiations ERs for the O/sub 2/3ATA were 1.46, 1.72 and 2.21 for MCaIV, FSaII and SCCVII respectively. For ν = 15, temperature 35 0 C ERs for O/sub 2/3ATA were 1.08 and 1.09 for MCaIV and FSaII but 1.22 for SCCVII

Blood pressure normalization post-jugular venous balloon angioplasty.

Science.gov (United States)

Sternberg, Zohara; Grewal, Prabhjot; Cen, Steven; DeBarge-Igoe, Frances; Yu, Jinhee; Arata, Michael

2015-05-01

This study is the first in a series investigating the relationship between autonomic nervous system dysfunction and chronic cerebrospinal venous insufficiency in multiple sclerosis patients. We screened patients for the combined presence of the narrowing of the internal jugular veins and symptoms of autonomic nervous system dysfunction (fatigue, cognitive dysfunction, sleeping disorders, headache, thermal intolerance, bowel/bladder dysfunction) and determined systolic and diastolic blood pressure responses to balloon angioplasty. The criteria for eligibility for balloon angioplasty intervention included ≥ 50% narrowing in one or both internal jugular veins, as determined by the magnetic resonance venography, and ≥ 3 clinical symptoms of autonomic nervous system dysfunction. Blood pressure was measured at baseline and post-balloon angioplasty. Among patients who were screened, 91% were identified as having internal jugular veins narrowing (with obstructing lesions) combined with the presence of three or more symptoms of autonomic nervous system dysfunction. Balloon angioplasty reduced the average systolic and diastolic blood pressure. However, blood pressure categorization showed a biphasic response to balloon angioplasty. The procedure increased blood pressure in multiple sclerosis patients who presented with baseline blood pressure within lower limits of normal ranges (systolic ≤ 105 mmHg, diastolic ≤ 70 mmHg) but decreased blood pressure in patients with baseline blood pressure above normal ranges (systolic ≥ 130 mmHg, diastolic ≥ 80 mmHg). In addition, gender differences in baseline blood pressure subcategories were observed. The coexistence of internal jugular veins narrowing and symptoms of autonomic nervous system dysfunction suggests that the two phenomena may be related. Balloon angioplasty corrects blood pressure deviation in multiple sclerosis patients undergoing internal jugular vein dilation. Further studies should investigate the

Positron emission tomographic studies using C-11-glucose in normal aging and cerebrovascular dementia

International Nuclear Information System (INIS)

Ujike, Takashi; Terashi, Akiro; Soeda, Toshiyuki; Kitamura, Shin; Kato, Toshiaki; Iio, Masaaki.

1984-01-01

Seven normal volunteers and 11 patients with cerebrovascular dementia were studied about the relations between effect of aging, severity of dementia, cerebral glucose metabolism and metabolic response to verbal stimuli by positron emission tomography (PET) using C-11-glucose. Regional distribution of glycogenic metabolites (RDGM: mg/100 g brain), which was a semi-quantitation of the pool of glycogenic metabolites mainly amino acids, were calculated. The RDGM values in elder normal subjects were significantly low compared with young normal subjects in frontal cortex (p < 0.05). The decline in frontal cortex metabolism could have been caused by the morphological changes in the course of aging. In temporal cortex, there was no significance between two groups. RDGM increased significantly respond to the verbal stimuli in frontal and temporal cortex both young and elder normal subjects. The RDGM values in vascular dementias were significantly low (p < 0.001) compared with elder normal subjects' in frontal and temporal cortex. Significant difference existed between mild and severe dementia in frontal cortex (p < 0.05). However, there was no significance between mild and severe dementias in temporal cortex. In mild dementias, RDGM increased significantly respond to the verbal stimuli in frontal and temporal cortex. In severe dementias, metabolic response to the verbal stimuli was less or lacking. Our results suggest that the cerebral metabolic functional reserve and the ability of the cerebral cortex to function respond to psychophysiologic stimulation are preserved in young and elder normal subjects and mild cerebrovascular dementias. (J.P.N.)

Disrupted-in-Schizophrenia-1 is essential for normal hypothalamic-pituitary-interrenal (HPI) axis function.

Science.gov (United States)

Eachus, Helen; Bright, Charlotte; Cunliffe, Vincent T; Placzek, Marysia; Wood, Jonathan D; Watt, Penelope J

2017-06-01

Psychiatric disorders arise due to an interplay of genetic and environmental factors, including stress. Studies in rodents have shown that mutants for Disrupted-In-Schizophrenia-1 (DISC1), a well-accepted genetic risk factor for mental illness, display abnormal behaviours in response to stress, but the mechanisms through which DISC1 affects stress responses remain poorly understood. Using two lines of zebrafish homozygous mutant for disc1, we investigated behaviour and functioning of the hypothalamic-pituitary-interrenal (HPI) axis, the fish equivalent of the hypothalamic-pituitary-adrenal (HPA) axis. Here, we show that the role of DISC1 in stress responses is evolutionarily conserved and that DISC1 is essential for normal functioning of the HPI axis. Adult zebrafish homozygous mutant for disc1 show aberrant behavioural responses to stress. Our studies reveal that in the embryo, disc1 is expressed in neural progenitor cells of the hypothalamus, a conserved region of the vertebrate brain that centrally controls responses to environmental stressors. In disc1 mutant embryos, proliferating rx3+ hypothalamic progenitors are not maintained normally and neuronal differentiation is compromised: rx3-derived ff1b+ neurons, implicated in anxiety-related behaviours, and corticotrophin releasing hormone (crh) neurons, key regulators of the stress axis, develop abnormally, and rx3-derived pomc+ neurons are disorganised. Abnormal hypothalamic development is associated with dysfunctional behavioural and neuroendocrine stress responses. In contrast to wild type siblings, disc1 mutant larvae show altered crh levels, fail to upregulate cortisol levels when under stress and do not modulate shoal cohesion, indicative of abnormal social behaviour. These data indicate that disc1 is essential for normal development of the hypothalamus and for the correct functioning of the HPA/HPI axis. © The Author 2017. Published by Oxford University Press.

Cortical Thinning in Network-Associated Regions in Cognitively Normal and Below-Normal Range Schizophrenia

Directory of Open Access Journals (Sweden)

R. Walter Heinrichs

2017-01-01

Full Text Available This study assessed whether cortical thickness across the brain and regionally in terms of the default mode, salience, and central executive networks differentiates schizophrenia patients and healthy controls with normal range or below-normal range cognitive performance. Cognitive normality was defined using the MATRICS Consensus Cognitive Battery (MCCB composite score (T=50 ± 10 and structural magnetic resonance imaging was used to generate cortical thickness data. Whole brain analysis revealed that cognitively normal range controls (n=39 had greater cortical thickness than both cognitively normal (n=17 and below-normal range (n=49 patients. Cognitively normal controls also demonstrated greater thickness than patients in regions associated with the default mode and salience, but not central executive networks. No differences on any thickness measure were found between cognitively normal range and below-normal range controls (n=24 or between cognitively normal and below-normal range patients. In addition, structural covariance between network regions was high and similar across subgroups. Positive and negative symptom severity did not correlate with thickness values. Cortical thinning across the brain and regionally in relation to the default and salience networks may index shared aspects of the psychotic psychopathology that defines schizophrenia with no relation to cognitive impairment.

Pancreatic beta-cell responses to GLP-1 after near-normalization of blood glucose in patients with type 2 diabetes.

Science.gov (United States)

Asmar, Meena; Højberg, Patricia V; Deacon, Carolyn F; Hare, Kristine; Holst, Jens J; Madsbad, Sten

2010-02-25

This study investigated the effects of strict glycaemic control on beta-cell function in nine obese subjects with type 2 diabetes (T2DM), using graded glucose infusions together with infusions of saline or GLP-1 before (HbA(1)c: 8.0+/-0.4%) and after four weeks of near-normalization of blood glucose (BG) using insulin (mean diurnal BG: 6.4+/-0.3 mmol/l; HbA(1)c: 6.6+/-0.3%). Nine matched healthy subjects acted as controls. In controls, area-under-curve (AUC) for amylin, C-peptide and proinsulin were higher with GLP-1 than saline (PAUC amylin/C-peptide ratio was similar on both days, while AUC proinsulin/C-peptide ratio was higher with GLP-1 (P=0.02). In the patients, amylin, C-peptide and proinsulin AUCs were unaltered by near-normoglycaemia per se. Proinsulin responses to GLP-1 were unchanged, but amylin and C-peptide AUCs increased (PAUC amylin/C-peptide ratios rose to control levels. Near-normoglycaemia tended to reduce AUC proinsulin/C-peptide ratio, which was significant (P=0.04) with GLP-1, but still higher than with saline (P=0.004). In conclusion, amylin, C-peptide and proinsulin responses to glucose were unaffected by four weeks of near-normoglycaemia, whereas GLP-1 increased amylin and C-peptide secretion and amylin/C-peptide ratio. Near-normoglycaemia reduced proinsulin/C-peptide ratio during stimulation with GLP-1, suggesting that strict glycaemic control might ameliorate some of the disturbances in beta-cell function characterizing T2DM. Copyright 2010 Elsevier B.V. All rights reserved.

Photodynamic therapy in prostate cancer: optical dosimetry and response of normal tissue

Science.gov (United States)

Chen, Qun; Shetty, Sugandh D.; Heads, Larry; Bolin, Frank; Wilson, Brian C.; Patterson, Michael S.; Sirls, Larry T., II; Schultz, Daniel; Cerny, Joseph C.; Hetzel, Fred W.

1993-06-01

The present study explores the possibility of utilizing photodynamic therapy (PDT) in treating localized prostate carcinoma. Optical properties of ex vivo human prostatectomy specimens, and in vivo and ex vivo dog prostate glands were studied. The size of the PDT induced lesion in dog prostate was pathologically evaluated as a biological endpoint. The data indicate that the human normal and carcinoma prostate tissues have similar optical properties. The average effective attenuation depth is less in vivo than that of ex vivo. The PDT treatment generated a lesion size of up to 16 mm in diameter. The data suggest that PDT is a promising modality in prostate cancer treatment. Multiple fiber system may be required for clinical treatment.

Tracking Normalization of Brain Tumor Vasculature by Magnetic Imaging and Proangiogenic Biomarkers

Science.gov (United States)

Hormigo, Adília; Gutin, Philip H.; Rafii, Shahin

2010-01-01

Clinical assessment of the response to antiangiogenic therapy has been cumbersome. A study in this issue of Cancer Cell demonstrates that a combination of magnetic resonance imaging (MRI) for quantification of normalized vessels with measurements of circulating levels of proangiogenic factors, including FGF2, SDF1, and viable circulating endothelial cells, provides an effective means to evaluate the response of recurrent glioblastoma to a prototypical pan-VEGF receptor tyrosine kinase inhibitor, AZD2171. PMID:17222788

15N nitrogen-balance studies in patients with testicular feminization, their relatives, and in normal subjects

International Nuclear Information System (INIS)

Zachman, M.; Zagalak, M.; Voellmin, J.A.; Prader, A.

1975-01-01

Fourteen subjects (4 with testicular feminization, 2 mothers, 1 aunt and 1 father of these patients, 2 normal women, 2 normal men and 2 normal prepubertal boys) were given 0.1 to 0.2 g/kg of 50 percent 15 N-labeled NH 4 Cl before and after 6 daily injections of testosterone (T) 15 mg/m 2 ). In 24-hour urine specimens collected on the test days, 15 N was calculated from total N (Kjeldahl) and the percentage of 15 N (mass spectrometry or 15 N-analyzer Isocommerz). In all normal subjects, urinary 15 N-balance was influenced positively by T (+31.3 +- 8.4 percent), in prepubertal boys more (+43 to +66 percent) than in women (+20 to +30 percent) and men (+6 to +23). In testicular feminization, 15 N-balance not only failed to become more positive, but was even reduced (-24.7 +- 17.6 percent). The father of a patient had only a slight response (+7 percent) as one of the normal males, probably because of higher endogenous T-levels in adult males. One mother and the aunt had no response (-7.4 to + 1.5 percent). In the mother, the balance became slightly positive (+10 percent) on oral contraceptives. The other mother, who was on estrogen treatment prior to and during the test, had a positive but insufficient change of balance (+17 percent). It is concluded that this test allows detection of patients with testicular feminization and possibly also healthy female carriers. In these cases, estrogen treatment appears to positively influence the response to T

Distinguishing normal cells from cancer cells via lysosome-targetable pH biomarkers with benzo[a]phenoxazine skeleton

Energy Technology Data Exchange (ETDEWEB)

Zhan, Yan-Hua [College of Chemistry, Chemical Engineering and Material Science, State and Local Joint Engineering Laboratory for Novel Functional Polymeric Materials, Soochow University, 199 Ren’Ai Road, Suzhou, 215123 (China); Li, Xiao-Jun [School of Radiation Medicine and Protection, Medicine College of Soochow University, Suzhou, 215123 (China); Sun, Ru, E-mail: sunru924@hotmail.com [College of Chemistry, Chemical Engineering and Material Science, State and Local Joint Engineering Laboratory for Novel Functional Polymeric Materials, Soochow University, 199 Ren’Ai Road, Suzhou, 215123 (China); Xu, Yu-Jie [School of Radiation Medicine and Protection, Medicine College of Soochow University, Suzhou, 215123 (China); Ge, Jian-Feng, E-mail: ge_jianfeng@hotmail.com [College of Chemistry, Chemical Engineering and Material Science, State and Local Joint Engineering Laboratory for Novel Functional Polymeric Materials, Soochow University, 199 Ren’Ai Road, Suzhou, 215123 (China); Jiangsu Key Laboratory of Medical Optics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, 215163 (China)

2016-08-24

In this paper, the design of a lysosome-targetable pH probe that has a fluorescent OFF (pH = 4) to ON (pH = 5–6) response is described to identify lysosomes in normal cells. The mechanism of photoinduced electron transfer with a fluorophore-based reaction (FBR-PET) was proposed. Benzo[a]phenoxazines with electro-donating aryl groups were selected, its (2,5-dimethoxyphenyl)imino-, (2-hydroxyphenyl)imino- and (2-hydroxy-5-methoxyphenyl)- imino-derivatives (probes 1a−c) were prepared and their optical responses towards pH were evaluated; their fluorescence pH titration experiments gave regularly changes with the increasing electro-donating abilities at the linked aryl groups, the (2-hydroxy-5-methoxyphenyl)iminobenzo[a]phenoxazine (probe 1c) exhibited a nearly OFF−ON response at 580–800 nm. All probes were reversible, and they showed excellent selectivity toward the proton over other competitive species. Fluorescence confocal images were performed with HeLa, KB cancer cells and V79 normal cells, probes 1a−c are all lysosome-targetable pH probes, and benzo[a]phenoxazine with (2-hydroxy-5-methoxyphenyl)imino-group (probe 1c) has potential applications in selective differentiation of normal cells from cancer cells. - Highlights: • pH probes for lysosome detection in normal cells. • Differentiation of normal cells from cancer cells by lysosome-biomarker. • The PET mechanism promoted by fluorophore based reactions (FBR-PET).

Distinguishing normal cells from cancer cells via lysosome-targetable pH biomarkers with benzo[a]phenoxazine skeleton

International Nuclear Information System (INIS)

Zhan, Yan-Hua; Li, Xiao-Jun; Sun, Ru; Xu, Yu-Jie; Ge, Jian-Feng

2016-01-01

In this paper, the design of a lysosome-targetable pH probe that has a fluorescent OFF (pH = 4) to ON (pH = 5–6) response is described to identify lysosomes in normal cells. The mechanism of photoinduced electron transfer with a fluorophore-based reaction (FBR-PET) was proposed. Benzo[a]phenoxazines with electro-donating aryl groups were selected, its (2,5-dimethoxyphenyl)imino-, (2-hydroxyphenyl)imino- and (2-hydroxy-5-methoxyphenyl)- imino-derivatives (probes 1a−c) were prepared and their optical responses towards pH were evaluated; their fluorescence pH titration experiments gave regularly changes with the increasing electro-donating abilities at the linked aryl groups, the (2-hydroxy-5-methoxyphenyl)iminobenzo[a]phenoxazine (probe 1c) exhibited a nearly OFF−ON response at 580–800 nm. All probes were reversible, and they showed excellent selectivity toward the proton over other competitive species. Fluorescence confocal images were performed with HeLa, KB cancer cells and V79 normal cells, probes 1a−c are all lysosome-targetable pH probes, and benzo[a]phenoxazine with (2-hydroxy-5-methoxyphenyl)imino-group (probe 1c) has potential applications in selective differentiation of normal cells from cancer cells. - Highlights: • pH probes for lysosome detection in normal cells. • Differentiation of normal cells from cancer cells by lysosome-biomarker. • The PET mechanism promoted by fluorophore based reactions (FBR-PET).

Factors Affecting the Normalization of CALL in Chinese Senior High Schools

Science.gov (United States)

He, Bi; Puakpong, Nattaya; Lian, Andrew

2015-01-01

With the development of Information Technology, increasing attention has been paid to Computer Assisted Language Learning (CALL). Meanwhile, increasing enthusiasm is seen for English learning and teaching in China. Yet, few research studies have focused on the normalization of CALL in ethnically diverse areas. In response to this research gap,…

Evaluation of visual stress symptoms in age-matched dyslexic, Meares-Irlen syndrome and normal adults.

Science.gov (United States)

Alanazi, Mana A; Alanazi, Saud A; Osuagwu, Uchechukwu L

2016-01-01

To examine the prevalence of dyslexia and Meares-Irlen syndrome (MIS) among female students and determine their level of visual stress in comparison with normal subjects. A random sample of 450 female medical students of King Saud University Riyadh (age range, 18-30y) responded to a wide range of questions designed to accomplish the aims of this study. The detailed questionnaire consisted of 54 questions with 12 questions enquiring on ocular history and demography of participants while 42 questions were on visual symptoms. Items were categorized into critical and non-critical questions (CQ and NCQ) and were rated on four point Likert scale. Based on the responses obtained, the subjects were grouped into normal (control), dyslexic with or without MIS (Group 1) and subjects with MIS only (Group 2). Responses were analysed as averages and mean scores were calculated and compared between groups using one way analysis of variance to evaluate total visual stress score (TVSS=NCQ+CQ), critical and non-critical visual stress scores. The relationship between categorical variables such as age, handedness and condition were assessed with Chi-square test. The completion rate was 97.6% and majority of the respondents (92%) were normal readers, 2% dyslexic and 6% had MIS. They were age-matched. More than half of the participants had visited an eye care practitioner in the last 2y. About 13% were recommended eye exercises and one participant experienced pattern glare. Hand preference was not associated with any condition but Group 1 subjects (3/9, 33%) were significantly more likely to be diagnosed of lazy eye than Group 2 (2/27, 7%) and control (27/414, 7%) subjects. The mean±SD of TVSS responses were 63±14 and it was 44±9 for CQ and 19±5 for NCQ. Responses from all three variables were normally distributed but the CQ responses were on the average more positive (82%) in Group 2 and less positive (46%) in Group 1 than control. With NCQ, the responses were equally less positive

Expression of mammalian GPCRs in C. elegans generates novel behavioural responses to human ligands

Directory of Open Access Journals (Sweden)

Jansen Gert

2006-07-01

Full Text Available Abstract Background G-protein-coupled receptors (GPCRs play a crucial role in many biological processes and represent a major class of drug targets. However, purification of GPCRs for biochemical study is difficult and current methods of studying receptor-ligand interactions involve in vitro systems. Caenorhabditis elegans is a soil-dwelling, bacteria-feeding nematode that uses GPCRs expressed in chemosensory neurons to detect bacteria and environmental compounds, making this an ideal system for studying in vivo GPCR-ligand interactions. We sought to test this by functionally expressing two medically important mammalian GPCRs, somatostatin receptor 2 (Sstr2 and chemokine receptor 5 (CCR5 in the gustatory neurons of C. elegans. Results Expression of Sstr2 and CCR5 in gustatory neurons allow C. elegans to specifically detect and respond to somatostatin and MIP-1α respectively in a robust avoidance assay. We demonstrate that mammalian heterologous GPCRs can signal via different endogenous Gα subunits in C. elegans, depending on which cells it is expressed in. Furthermore, pre-exposure of GPCR transgenic animals to its ligand leads to receptor desensitisation and behavioural adaptation to subsequent ligand exposure, providing further evidence of integration of the mammalian GPCRs into the C. elegans sensory signalling machinery. In structure-function studies using a panel of somatostatin-14 analogues, we identified key residues involved in the interaction of somatostatin-14 with Sstr2. Conclusion Our results illustrate a remarkable evolutionary plasticity in interactions between mammalian GPCRs and C. elegans signalling machinery, spanning 800 million years of evolution. This in vivo system, which imparts novel avoidance behaviour on C. elegans, thus provides a simple means of studying and screening interaction of GPCRs with extracellular agonists, antagonists and intracellular binding partners.

Adaptive Value Normalization in the Prefrontal Cortex Is Reduced by Memory Load

Science.gov (United States)

Burke, C. J.; Seifritz, E.; Tobler, P. N.

2017-01-01

Abstract Adaptation facilitates neural representation of a wide range of diverse inputs, including reward values. Adaptive value coding typically relies on contextual information either obtained from the environment or retrieved from and maintained in memory. However, it is unknown whether having to retrieve and maintain context information modulates the brain’s capacity for value adaptation. To address this issue, we measured hemodynamic responses of the prefrontal cortex (PFC) in two studies on risky decision-making. In each trial, healthy human subjects chose between a risky and a safe alternative; half of the participants had to remember the risky alternatives, whereas for the other half they were presented visually. The value of safe alternatives varied across trials. PFC responses adapted to contextual risk information, with steeper coding of safe alternative value in lower-risk contexts. Importantly, this adaptation depended on working memory load, such that response functions relating PFC activity to safe values were steeper with presented versus remembered risk. An independent second study replicated the findings of the first study and showed that similar slope reductions also arose when memory maintenance demands were increased with a secondary working memory task. Formal model comparison showed that a divisive normalization model fitted effects of both risk context and working memory demands on PFC activity better than alternative models of value adaptation, and revealed that reduced suppression of background activity was the critical parameter impairing normalization with increased memory maintenance demand. Our findings suggest that mnemonic processes can constrain normalization of neural value representations. PMID:28462394

In vitro radiation response studies on bone marrow fibroblasts (CFU-F) obtained from normal and chronically irradiated dogs

International Nuclear Information System (INIS)

Klein, A.K.; Stitzel, K.A.; Greenberg, B.; Woo, L.

1984-01-01

The radiation resistance of bone marrow fibroblasts as measured by their proliferative potential was evaluated in chronically irradiated dogs. Bone marrows were obtained from eight dogs that had been chronically irradiated beginning at 21 days of gestation or after birth and eight age-matched controls. Of these irradiated dogs, four were either preleukemic or exhibited frank acute nonlymphocytic leukemia. The other four were clinically normal but demonstrated abnormalities in their marrow that could be attributed to radiation effects and/or other pathologic changes. Fibroblasts from six of the irradiated dogs were significantly more radioresistant than those of their controls. Five of these six dogs subsequently succumbed to hematopathologic disease, while the two irradiated dogs with normal fibroblasts remained clinically normal, suggesting that this observed radioresistance may be linked to the disease process. (author)

β class II tubulin predominates in normal and tumor breast tissues

International Nuclear Information System (INIS)

Dozier, James H; Hiser, Laree; Davis, Jennifer A; Thomas, Nancy Stubbs; Tucci, Michelle A; Benghuzzi, Hamed A; Frankfurter, Anthony; Correia, John J; Lobert, Sharon

2003-01-01

Antimitotic chemotherapeutic agents target tubulin, the major protein in mitotic spindles. Tubulin isotype composition is thought to be both diagnostic of tumor progression and a determinant of the cellular response to chemotherapy. This implies that there is a difference in isotype composition between normal and tumor tissues. To determine whether such a difference occurs in breast tissues, total tubulin was fractionated from lysates of paired normal and tumor breast tissues, and the amounts of β-tubulin classes I + IV, II, and III were measured by competitive enzyme-linked immunosorbent assay (ELISA). Only primary tumor tissues, before chemotherapy, were examined. Her2/neu protein amplification occurs in about 30% of breast tumors and is considered a marker for poor prognosis. To gain insight into whether tubulin isotype levels might be correlated with prognosis, ELISAs were used to quantify Her2/neu protein levels in these tissues. β-Tubulin isotype distributions in normal and tumor breast tissues were similar. The most abundant β-tubulin isotypes in these tissues were β-tubulin classes II and I + IV. Her2/neu levels in tumor tissues were 5–30-fold those in normal tissues, although there was no correlation between the Her2/neu biomarker and tubulin isotype levels. These results suggest that tubulin isotype levels, alone or in combination with Her2/neu protein levels, might not be diagnostic of tumorigenesis in breast cancer. However, the presence of a broad distribution of these tubulin isotypes (for example, 40–75% β-tubulin class II) in breast tissue, in conjunction with other factors, might still be relevant to disease progression and cellular response to antimitotic drugs

Exercise training normalizes renal blood flow responses to acute hypoxia in experimental heart failure: role of the α1-adrenergic receptor.

Science.gov (United States)

Pügge, Carolin; Mediratta, Jai; Marcus, Noah J; Schultz, Harold D; Schiller, Alicia M; Zucker, Irving H

2016-02-01

Recent data suggest that exercise training (ExT) is beneficial in chronic heart failure (CHF) because it improves autonomic and peripheral vascular function. In this study, we hypothesized that ExT in the CHF state ameliorates the renal vasoconstrictor responses to hypoxia and that this beneficial effect is mediated by changes in α1-adrenergic receptor activation. CHF was induced in rabbits. Renal blood flow (RBF) and renal vascular conductance (RVC) responses to 6 min of 5% isocapnic hypoxia were assessed in the conscious state in sedentary (SED) and ExT rabbits with CHF with and without α1-adrenergic blockade. α1-adrenergic receptor expression in the kidney cortex was also evaluated. A significant decline in baseline RBF and RVC and an exaggerated renal vasoconstriction during acute hypoxia occurred in CHF-SED rabbits compared with the prepaced state (P renal denervation (DnX) blocked the hypoxia-induced renal vasoconstriction in CHF-SED rabbits. α1-adrenergic protein in the renal cortex of animals with CHF was increased in SED animals and normalized after ExT. These data provide evidence that the acute decline in RBF during hypoxia is caused entirely by the renal nerves but is only partially mediated by α1-adrenergic receptors. Nonetheless, α1-adrenergic receptors play an important role in the beneficial effects of ExT in the kidney. Copyright © 2016 the American Physiological Society.

Comparison of the suppressor cells found in the spleens of 89Sr-treated mice and in normal murine bone marrow

International Nuclear Information System (INIS)

Levy, E.M.; Corvese, J.S.; Bennett, M.

1981-01-01

Normal murine bone marrow cells and spleen cells of mice treated with 89 Sr both have suppressive activity. These nonspecific suppressor cells inhibit the ability of normal spleen cells to undergo antibody responses in vitro. After being precultured for 24 hr, these cells will also suppress antibody responses in vivo and the responses of normal spleen cells to T and B cell mitogens in vitro. These cells have previously been shown not to be mature T or B lymphocytes or macrophages. Velocity sedimentation and cell-size analysis indicated that both suppressor cells are large (approx. =206 μ 3 ). Mitomycin C treatment eliminated the ability of both suppressor cells to inhibit an in vitro antibody response. In contrast, this treatment did not reduce the ability of the cells to inhibit an in vitro antibody response. In contrast, this treatment did not reduce the ability of the cells to suppress a mitogenic response. Irradiation (1000 R) was also ineffective in eliminating the ability of either cell to suppress a mitogenic response. We conclude that the 2 suppressor cells are closely related if not identical, and we speculate that these cells may function in vivo to suppress immune reactivity in areas of intense hematopoiesis

The Insect SNMP Gene Family

Science.gov (United States)

2009-01-01

CD36. Eur. J. Biochem. 257, 488–494. Robertson, H.M., Wanner, K.W., 2006. The chemoreceptor superfamily in the honey bee , Apis mellifera: expansion of...keywords: Pheromone Receptors Olfactory Gustatory Chemosensory Gustatory Mosquito Fly a b s t r a c t SNMPs are membrane proteins observed to associate with...present indirect evidence based on evolutionary selection (dN/dS) that the dipteran SNMPs are expressed as functional proteins . We observed expansions

Evolutionary origins of taste buds: phylogenetic analysis of purinergic neurotransmission in epithelial chemosensors

OpenAIRE

Kirino, Masato; Parnes, Jason; Hansen, Anne; Kiyohara, Sadao; Finger, Thomas E.

2013-01-01

Taste buds are gustatory endorgans which use an uncommon purinergic signalling system to transmit information to afferent gustatory nerve fibres. In mammals, ATP is a crucial neurotransmitter released by the taste cells to activate the afferent nerve fibres. Taste buds in mammals display a characteristic, highly specific ecto-ATPase (NTPDase2) activity, suggesting a role in inactivation of the neurotransmitter. The purpose of this study was to test whether the presence of markers of purinergi...

Sample size determination for logistic regression on a logit-normal distribution.

Science.gov (United States)

Kim, Seongho; Heath, Elisabeth; Heilbrun, Lance

2017-06-01

Although the sample size for simple logistic regression can be readily determined using currently available methods, the sample size calculation for multiple logistic regression requires some additional information, such as the coefficient of determination ([Formula: see text]) of a covariate of interest with other covariates, which is often unavailable in practice. The response variable of logistic regression follows a logit-normal distribution which can be generated from a logistic transformation of a normal distribution. Using this property of logistic regression, we propose new methods of determining the sample size for simple and multiple logistic regressions using a normal transformation of outcome measures. Simulation studies and a motivating example show several advantages of the proposed methods over the existing methods: (i) no need for [Formula: see text] for multiple logistic regression, (ii) available interim or group-sequential designs, and (iii) much smaller required sample size.

Assessment of Adaptive Rate Response Provided by Accelerometer, Minute Ventilation and Dual Sensor Compared with Normal Sinus Rhythm During Exercise: A Self-controlled Study in Chronotropically Competent Subjects

Directory of Open Access Journals (Sweden)

Yuanyuan Cao

2015-01-01

Full Text Available Background: Dual sensor (DS for rate adaption was supposed to be more physiological. To evaluate its superiority, the DS (accelerometer [ACC] and minute ventilation [MV] and normal sinus rate response were compared in a self-controlled way during exercise treadmill testing. Methods: This self-controlled study was performed in atrioventricular block patients with normal sinus function who met the indications of pacemaker implant. Twenty-one patients came to the 1-month follow-up visit. Patients performed a treadmill test 1-month post implant while programmed in DDDR and sensor passive mode. For these patients, sensor response factors were left at default settings (ACC = 8, MV = 3 and sensor indicated rates (SIRs for DS, ACC and MV sensor were retrieved from the pacemaker memories, along with measured sinus node (SN rates from the beginning to 1-minute after the end of the treadmill test, and compared among study groups. Repeated measures analysis of variance and profile analysis, as well as variance analysis of randomized block designs, were used for statistical analysis. Results: Fifteen patients (15/21 were determined to be chronotropically competent. The mean differences between DS SIRs and intrinsic sinus rates during treadmill testing were smaller than those for ACC and MV sensor (mean difference between SIR and SN rate: ACC vs. SN, MV vs. SN, DS vs. SN, respectively, 34.84, 17.60, 16.15 beats/min, though no sensors could mimic sinus rates under the default settings for sensor response factor (ACC vs. SN P-adjusted < 0.001; MV vs. SN P-adjusted = 0.002; DS vs. SN P-adjusted = 0.005. However, both in the range of 1 st minute and first 3 minutes of exercise, only the DS SIR profile did not differ from sinus rates (P-adjusted = 0.09, 0.90, respectively. Conclusions: The DS under default settings provides more physiological rate response during physical activity than the corresponding single sensors (ACC or MV sensor. Further study is needed to

DNA strand breaking and rejoining in response to ultraviolet light in normal human and xeroderma pigmentosum cells

International Nuclear Information System (INIS)

Dingman, C.W.; Kakunaga, T.

1976-01-01

A description is given of a reproducible technique for measuring DNA strand breaking and rejoining in cells after treatment with U.V.-light. Results obtained with normal human cells, xeroderma pigmentosum cells (XP, complementation group A) and XP variant cells suggested that all three of these cell-types can carry out single-strand incision with equal rapidity. However, the breaks so induced appeared to be only slowly rejoined in the XP variant cells and rejoined not at all in XP complementation group A cells. Furthermore, parental strand rejoining was inhibited by caffeine in XP variant cells but not in normal cells. (author)

Neutron dosimetry and spectrometry with Bonner spheres. Working out a log-normal reference matrix

International Nuclear Information System (INIS)

Zaborowski, Henrick.

1981-11-01

From the experimental and theoretical studies made upon the BONNER's spheres System with a I 6 Li(Eu) crystal and with a miniaturized 3 He counter we get the normalized energy response functions R*sub(i)(E). This normalization is obtained by the mathematization of the Resolution Function R*(i,E) in the Log-Normal distribution hypothesis to mono energetic neutrons given in April 1976 to the International Symposium on Californium 252. The fit of the Log-Normal Hypothesis with the experimental and Theoretical data is very satisfactory. The parameter's tabulated values allow a precise interpolation, at all energies between 0.4 eV and 15 MeV and for all spheres diameters between 2 and 12 inches, of the discretized R*sub(ij) Reference Matrix for the applications to neutron dosimetry and spectrometry [fr

Genetic Dissection of Anopheles gambiae Gut Epithelial Responses to Serratia marcescens

Science.gov (United States)

Stathopoulos, Stavros; Neafsey, Daniel E.; Lawniczak, Mara K. N.; Muskavitch, Marc A. T.; Christophides, George K.

2014-01-01

Genetic variation in the mosquito Anopheles gambiae profoundly influences its ability to transmit malaria. Mosquito gut bacteria are shown to influence the outcome of infections with Plasmodium parasites and are also thought to exert a strong drive on genetic variation through natural selection; however, a link between antibacterial effects and genetic variation is yet to emerge. Here, we combined SNP genotyping and expression profiling with phenotypic analyses of candidate genes by RNAi-mediated silencing and 454 pyrosequencing to investigate this intricate biological system. We identified 138 An. gambiae genes to be genetically associated with the outcome of Serratia marcescens infection, including the peptidoglycan recognition receptor PGRPLC that triggers activation of the antibacterial IMD/REL2 pathway and the epidermal growth factor receptor EGFR. Silencing of three genes encoding type III fibronectin domain proteins (FN3Ds) increased the Serratia load and altered the gut microbiota composition in favor of Enterobacteriaceae. These data suggest that natural genetic variation in immune-related genes can shape the bacterial population structure of the mosquito gut with high specificity. Importantly, FN3D2 encodes a homolog of the hypervariable pattern recognition receptor Dscam, suggesting that pathogen-specific recognition may involve a broader family of immune factors. Additionally, we showed that silencing the gene encoding the gustatory receptor Gr9 that is also associated with the Serratia infection phenotype drastically increased Serratia levels. The Gr9 antibacterial activity appears to be related to mosquito feeding behavior and to mostly rely on changes of neuropeptide F expression, together suggesting a behavioral immune response following Serratia infection. Our findings reveal that the mosquito response to oral Serratia infection comprises both an epithelial and a behavioral immune component. PMID:24603764

Insulin-like peptide response to nutritional input in honey bee workers.

Science.gov (United States)

Ihle, Kate E; Baker, Nicholas A; Amdam, Gro V

2014-10-01

The rise in metabolic disorders in the past decades has heightened focus on achieving a healthy dietary balance in humans. This is also an increasingly important issue in the management of honey bees (Apis mellifera) where poor nutrition has negative effects on health and productivity in agriculture, and nutrition is suggested as a contributing factor in the recent global declines in honey bee populations. As in other organisms, the insulin/insulin-like signaling (IIS) pathway is likely involved in maintaining nutrient homeostasis in honey bees. Honey bees have two insulin-like peptides (Ilps) with differing spatial expression patterns in the fat body suggesting that AmIlp1 potentially functions in lipid metabolism while AmIlp2 is a more general indicator of nutritional status. We fed caged worker bees artificial diets high in carbohydrates, proteins or lipids and measured expression of AmIlp1, AmIlp2, and the insulin receptor substrate (IRS) to test their responses to dietary macronutrients. We also measured lifespan, worker weight and gustatory sensitivity to sugar as measures of individual physical condition. We found that expression of AmIlp1 was affected by diet composition and was highest on a diet high in protein. Expression of AmIlp2 and AmIRS were not affected by diet. Workers lived longest on a diet high in carbohydrates and low in protein and lipids. However, bees fed this diet weighed less than those that received a diet high in protein and low in carbohydrates and lipids. Bees fed the high carbohydrates diet were also more responsive to sugar, potentially indicating greater levels of hunger. These results support a role for AmIlp1 in nutritional homeostasis and provide new insight into how unbalanced diets impact individual honey bee health. Copyright © 2014 Elsevier Ltd. All rights reserved.

A micromechanical study of porous composites under longitudinal shear and transverse normal loading

DEFF Research Database (Denmark)

Ashouri Vajari, Danial

2015-01-01

The mechanical response of porous unidirectional composites under transverse normal and longitudinal shear loading is studied using the finite element analysis. The 3D model includes discrete and random distribution of fibers and voids. The micromechanical failure mechanisms are taken into account....... Finally, the computational prediction of the porous composite in the transverse normal-longitudinal shear stress space is obtained and compared with Puck's model. The results show that both interfaces with low fracture toughness and microvoids with even small void volume fraction can significantly reduce...

Attenuation of the pressor response to exogenous angiotensin by angiotensin receptor blockers and benazepril hydrochloride in clinically normal cats.

Science.gov (United States)

Jenkins, Tiffany L; Coleman, Amanda E; Schmiedt, Chad W; Brown, Scott A

2015-09-01

To compare the attenuation of the angiotensin I-induced blood pressure response by once-daily oral administration of various doses of angiotensin receptor blockers (irbesartan, telmisartan, and losartan), benazepril hydrochloride, or lactose monohydrate (placebo) for 8 days in clinically normal cats. 6 healthy cats (approx 17 months old) with surgically implanted arterial telemetric blood pressure-measuring catheters. Cats were administered orally the placebo or each of the drug treatments (benazepril [2.5 mg/cat], irbesartan [6 and 10 mg/kg], telmisartan [0.5, 1, and 3 mg/kg], and losartan [2.5 mg/kg]) once daily for 8 days in a crossover study. Approximately 90 minutes after capsule administration on day 8, each cat was anesthetized and arterial blood pressure measurements were recorded before and after IV administration of each of 4 boluses of angiotensin I (20, 100, 500, and 1,000 ng/kg). This protocol was repeated 24 hours after benazepril treatment and telmisartan (3 mg/kg) treatment. Differences in the angiotensin I-induced change in systolic arterial blood pressure (ΔSBP) among treatments were determined. At 90 minutes after capsule administration, only losartan did not significantly reduce ΔSBP in response to the 3 higher angiotensin doses, compared with placebo. Among drug treatments, telmisartan (3 mg/kg dosage) attenuated ΔSBP to a significantly greater degree than benazepril and all other treatments. At 24 hours, telmisartan was more effective than benazepril (mean ± SEM ΔSBP, 15.7 ± 1.9 mm Hg vs 55.9 ± 12.42 mm Hg, respectively). Results indicated that telmisartan administration may have advantages over benazepril administration for cats with renal or cardiovascular disease.

The Role of 5-HT3 Receptors in Signaling from Taste Buds to Nerves.

Science.gov (United States)

Larson, Eric D; Vandenbeuch, Aurelie; Voigt, Anja; Meyerhof, Wolfgang; Kinnamon, Sue C; Finger, Thomas E

2015-12-02

Activation of taste buds triggers the release of several neurotransmitters, including ATP and serotonin (5-hydroxytryptamine; 5-HT). Type III taste cells release 5-HT directly in response to acidic (sour) stimuli and indirectly in response to bitter and sweet tasting stimuli. Although ATP is necessary for activation of nerve fibers for all taste stimuli, the role of 5-HT is unclear. We investigated whether gustatory afferents express functional 5-HT3 receptors and, if so, whether these receptors play a role in transmission of taste information from taste buds to nerves. In mice expressing GFP under the control of the 5-HT(3A) promoter, a subset of cells in the geniculate ganglion and nerve fibers in taste buds are GFP-positive. RT-PCR and in situ hybridization confirmed the presence of 5-HT(3A) mRNA in the geniculate ganglion. Functional studies show that only those geniculate ganglion cells expressing 5-HT3A-driven GFP respond to 10 μM 5-HT and this response is blocked by 1 μM ondansetron, a 5-HT3 antagonist, and mimicked by application of 10 μM m-chlorophenylbiguanide, a 5-HT3 agonist. Pharmacological blockade of 5-HT3 receptors in vivo or genetic deletion of the 5-HT3 receptors reduces taste nerve responses to acids and other taste stimuli compared with controls, but only when urethane was used as the anesthetic. We find that anesthetic levels of pentobarbital reduce taste nerve responses apparently by blocking the 5-HT3 receptors. Our results suggest that 5-HT released from type III cells activates gustatory nerve fibers via 5-HT3 receptors, accounting for a significant proportion of the neural taste response. Copyright © 2015 the authors 0270-6474/15/3515984-12$15.00/0.

Immune Modulation in Normal Human Peripheral Blood Mononuclear Cells (PBMCs) (Lymphocytes) in Response to Benzofuran-2-Carboxylic Acid Derivative KMEG during Spaceflight

Science.gov (United States)

Okoro, Elvis; Mann, Vivek; Ellis, Ivory; Mansoor, Elvedina; Olamigoke, Loretta; Marriott, Karla Sue; Denkins, Pamela; Williams, Willie; Sundaresan, Alamelu

2017-08-01

Microgravity and radiation exposure during space flight have been widely reported to induce the suppression of normal immune system function, and increase the risk of cancer development in humans. These findings pose a serious risk to manned space missions. Interestingly, recent studies have shown that benzofuran-2-carboxylic acid derivatives can inhibit the progression of some of these devastating effects on earth and in modeled microgravity. However, these studies had not assessed the impacts of benzofuran-2- carboxylic acid and its derivatives on global gene expression under spaceflight conditions. In this study, the ability of a specific benzofuran-2-carboxylic acid derivative (KMEG) to confer protection from radiation and restore normal immune function was investigated following exposure to space flight conditions on the ISS. Normal human peripheral blood mononuclear cells (lymphocytes) treated with 10 µ g/ml of KMEG together with untreated control samples were flown on Nanoracks hardware on Spacex-3 flight. The Samples were returned one month later and gene expression was analyzed. A 1g-ground control experiment was performed in parallel at the Kennedy spaceflight center. The first overall subtractive unrestricted analysis revealed 78 genes, which were differentially expressed in space flight KMEG, untreated lymphocytes as compared to the corresponding ground controls. However, in KMEG-treated space flight lymphocytes, there was an increased expression of a group of genes that mediate increased transcription, translation and innate immune system mediating functions of lymphocytes as compared to KMEG-untreated samples. Analysis of genes related to T cell proliferation in spaceflight KMEG-treated lymphocytes compared to 1g-ground KMEG- treated lymphocytes revealed six T cell proliferation and signaling genes to be significantly upregulated (p trafficking, promote early response, mediating C-myc related proliferation, promote antiapoptotic activity and protects

A comparison of cytokine responses during prolonged cycling in normal and hot environmental conditions

Directory of Open Access Journals (Sweden)

Ludmila M Cosio-Lima

2011-01-01

Full Text Available Ludmila M Cosio-Lima, Bhargav V Desai, Petra B Schuler, Lesley Keck, Logan ScheelerDepartment of Health, Leisure, and Exercise Science, University of West Florida, Pensacola, FL, USAPurpose: Components of immune function are affected by physical activity in an adverse environment. The purpose of this study was to compare plasma differences in inflammatory cytokines including tumor necrosis factor α (TNF-α and interleukin 6 (IL-6, in addition to the stress hormone cortisol, during prolonged cycling under normal and hot environmental conditions in elite cyclists.Methods and design: Six trained elite male cyclists (27 ± 8 years; 75.5 ± 4 kg; maximum oxygen uptake [VO2max] = 66 ± 6 mL/kg/min, mean ± SD. The cyclists biked for 2.5 h at their prescribed 60% maximum exercise workload (Wmax or 75% VO2max either in an environmental chamber set at 15°C and 40% relative humidity (NEUTRAL or at 35°C and 40% relative humidity (HOT. The cyclists were given 4 mL of water/kg body weight every 15 min under both conditions.Results: Total cortisol concentrations were elevated (P < 0.05 immediately postexercise and 12 h postexercise in both the NEUTRAL and HOT conditions. TNF-α concentrations were only significantly (P = 0.045 elevated postexercise in HOT conditions. During the HOT conditions, a significant (P = 0.006 and 0.007, respectively difference in IL-6 was seen immediately after and 12 h postexercise. During the NEUTRAL condition, IL-6 was only significantly elevated postexercise (P < 0.05.Conclusions: Heat exposure during a long bout of exercise is sufficient to elicit stress response in elite cyclists. However, the degree of release of anti-inflammatory and proinflammatory cytokines might be related to several factors that include the athlete’s fitness level, hydration status, exercise intensity, and length of exposure to hot environments.Keywords: cytokines, inflammation, heat, exercise, performance 

Studies on normal incidence backscattering in nodule areas using the multibeam-hydrosweep system

Digital Repository Service at National Institute of Oceanography (India)

Pathak, D.; Chakraborty, B.

The acoustic response from areas of varying nodule abundance and number densities in the Central Indian Ocean has been studied by using the echo peak amplitudes of the normal incidence beam in the Multibeam Hydrosweep system. It is observed...

Tuned Normalization Explains the Size of Attention Modulations

Science.gov (United States)

Ni, Amy M.; Ray, Supratim; Maunsell, John H. R.

2012-01-01

SUMMARY The effect of attention on firing rates varies considerably within a single cortical area. The firing rate of some neurons is greatly modulated by attention while others are hardly affected. The reason for this variability across neurons is unknown. We found that the variability in attention modulation across neurons in area MT of macaques can be well explained by variability in the strength of tuned normalization across neurons. The presence of tuned normalization also explains a striking asymmetry in attention effects within neurons: when two stimuli are in a neuron’s receptive field, directing attention to the preferred stimulus modulates firing rates more than directing attention to the non-preferred stimulus. These findings show that much of the neuron-to-neuron variability in modulation of responses by attention depends on variability in the way the neurons process multiple stimuli, rather than differences in the influence of top-down signals related to attention. PMID:22365552

Tuned normalization explains the size of attention modulations.

Science.gov (United States)

Ni, Amy M; Ray, Supratim; Maunsell, John H R

2012-02-23

The effect of attention on firing rates varies considerably within a single cortical area. The firing rate of some neurons is greatly modulated by attention while others are hardly affected. The reason for this variability across neurons is unknown. We found that the variability in attention modulation across neurons in area MT of macaques can be well explained by variability in the strength of tuned normalization across neurons. The presence of tuned normalization also explains a striking asymmetry in attention effects within neurons: when two stimuli are in a neuron's receptive field, directing attention to the preferred stimulus modulates firing rates more than directing attention to the nonpreferred stimulus. These findings show that much of the neuron-to-neuron variability in modulation of responses by attention depends on variability in the way the neurons process multiple stimuli, rather than differences in the influence of top-down signals related to attention. Copyright © 2012 Elsevier Inc. All rights reserved.

Cadmium, cobalt and lead cause stress response, cell cycle deregulation and increased steroid as well as xenobiotic metabolism in primary normal human bronchial epithelial cells which is coordinated by at least nine transcription factors

Energy Technology Data Exchange (ETDEWEB)

Glahn, Felix; Wiese, Jan; Foth, Heidi [Martin-Luther-University, Halle-Wittenberg, Institute of Environmental Toxicology, Halle/Saale (Germany); Schmidt-Heck, Wolfgang; Guthke, Reinhard [Leibniz Institute for Natural Product Research and Infection Biology, Hans Knoell Institute, Jena (Germany); Zellmer, Sebastian; Gebhardt, Rolf [University of Leipzig, Institute of Biochemistry, Medical Faculty, Leipzig (Germany); Golka, Klaus; Degen, Gisela H.; Hermes, Matthias; Schormann, Wiebke; Brulport, Marc; Bauer, Alexander; Bedawy, Essam [IfADo, Leibniz Research Centre for Working Environment and Human Factors, Dortmund (Germany); Hergenroeder, Roland [ISAS, Institute for Analytical Sciences, Dortmund (Germany); Lehmann, Thomas [Translational Centre for Regenerative Medicine, Leipzig (Germany); Hengstler, Jan G. [IfADo, Leibniz Research Centre for Working Environment and Human Factors, Dortmund (Germany)

2008-08-15

Workers occupationally exposed to cadmium, cobalt and lead have been reported to have increased levels of DNA damage. To analyze whether in vivo relevant concentrations of heavy metals cause systematic alterations in RNA expression patterns, we performed a gene array study using primary normal human bronchial epithelial cells. Cells were incubated with 15{mu}g/l Cd(II), 25{mu}g/l Co(II) and 550{mu}g/l Pb(II) either with individual substances or in combination. Differentially expressed genes were filtered out and used to identify enriched GO categories as well as KEGG pathways and to identify transcription factors whose binding sites are enriched in a given set of promoters. Interestingly, combined exposure to Cd(II), Co(II) and Pb(II) caused a coordinated response of at least seven stress response-related transcription factors, namely Oct-1, HIC1, TGIF, CREB, ATF4, SRF and YY1. A stress response was further corroborated by up regulation of genes involved in glutathione metabolism. A second major response to heavy metal exposure was deregulation of the cell cycle as evidenced by down regulation of the transcription factors ELK-1 and the Ets transcription factor GABP, as well as deregulation of genes involved in purine and pyrimidine metabolism. A third and surprising response was up regulation of genes involved in steroid metabolism, whereby promoter analysis identified up regulation of SRY that is known to play a role in sex determination. A forth response was up regulation of xenobiotic metabolising enzymes, particularly of dihydrodiol dehydrogenases 1 and 2 (AKR1C1, AKR1C2). Incubations with individual heavy metals showed that the response of AKR1C1 and AKR1C2 was predominantly caused by lead. In conclusion, we have shown that in vivo relevant concentrations of Cd(II), Co(II) and Pb(II) cause a complex and coordinated response in normal human bronchial epithelial cells. This study gives an overview of the most responsive genes. (orig.)

an extended pancreatic normal subjects and ~in pancreatItIs In ...

African Journals Online (AJOL)

function . . patIents. N. H. GILlNSKY, A. S. MEE, I. N. MARKS. Summary. Exocrine pancreatic response was evaluated in patients with varying degrees of pancreatic damage and in control subjects by ... hormones, the Lundh meal and an oral pancreatic function test .... is any different from that of the cells in me normal gland.

Four cases of acoustic neuromas with normal hearing.

Science.gov (United States)

Valente, M; Peterein, J; Goebel, J; Neely, J G

1995-05-01

In 95 percent of the cases, patients with acoustic neuromas will have some magnitude of hearing loss in the affected ear. This paper reports on four patients who had acoustic neuromas and normal hearing. Results from the case history, audiometric evaluation, auditory brainstem response (ABR), electroneurography (ENOG), and vestibular evaluation are reported for each patient. For all patients, the presence of unilateral tinnitus was the most common complaint. Audiologically, elevated or absent acoustic reflex thresholds and abnormal ABR findings were the most powerful diagnostic tools.

Exercise left ventricular performance in patients with chest pain, ischemic-appearing exercise electrocardiograms, and angiographically normal coronary arteries

International Nuclear Information System (INIS)

Berger, H.J.; Sands, M.J.; Davies, R.A.; Wackers, F.J.; Alexander, J.; Lachman, A.S.; Williams, B.W.; Zaret, B.L.

1981-01-01

Left ventricular performance was evaluated using first-pass radionuclide angiocardiography in 31 patients with chest pain, an ischemic-appearing exercise electrocardiogram, and angiographically normal coronary arteries at rest and during maximal upright bicycle exercise. 201 Tl imaging was done in all patients after treadmill exercise and in selected patients after ergonovine provocation. Resting left ventricular performance was normal in all patients. An abnormal ejection fraction response to exercise was detected in 12 of 31 patients. Regional dysfunction was present during exercise in four patients, all of whom also had abnormal global responses. Three of these 12 patients and two additional patients had exercise-induced 201 Tl perfusion defects. In all nine patients who underwent ergonovine testing, there was no suggestion of coronary arterial spasm. Thus, left ventricular dysfunction during exercise, in the presence of normal resting performance, was found in a substantial number of patients with chest pain, an ischemic-appearing exercise electrocardiogram, and normal coronary arteries

Normalization Strategies for Enhancing Spatio-Temporal Analysis of Social Media Responses during Extreme Events: A Case Study based on Analysis of Four Extreme Events using Socio-Environmental Data Explorer (SEDE

Directory of Open Access Journals (Sweden)

J. Ajayakumar

2017-10-01

Full Text Available With social media becoming increasingly location-based, there has been a greater push from researchers across various domains including social science, public health, and disaster management, to tap in the spatial, temporal, and textual data available from these sources to analyze public response during extreme events such as an epidemic outbreak or a natural disaster. Studies based on demographics and other socio-economic factors suggests that social media data could be highly skewed based on the variations of population density with respect to place. To capture the spatio-temporal variations in public response during extreme events we have developed the Socio-Environmental Data Explorer (SEDE. SEDE collects and integrates social media, news and environmental data to support exploration and assessment of public response to extreme events. For this study, using SEDE, we conduct spatio-temporal social media response analysis on four major extreme events in the United States including the “North American storm complex” in December 2015, the “snowstorm Jonas” in January 2016, the “West Virginia floods” in June 2016, and the “Hurricane Matthew” in October 2016. Analysis is conducted on geo-tagged social media data from Twitter and warnings from the storm events database provided by National Centers For Environmental Information (NCEI for analysis. Results demonstrate that, to support complex social media analyses, spatial and population-based normalization and filtering is necessary. The implications of these results suggests that, while developing software solutions to support analysis of non-conventional data sources such as social media, it is quintessential to identify the inherent biases associated with the data sources, and adapt techniques and enhance capabilities to mitigate the bias. The normalization strategies that we have developed and incorporated to SEDE will be helpful in reducing the population bias associated with

Normalization Strategies for Enhancing Spatio-Temporal Analysis of Social Media Responses during Extreme Events: A Case Study based on Analysis of Four Extreme Events using Socio-Environmental Data Explorer (SEDE)

Science.gov (United States)

Ajayakumar, J.; Shook, E.; Turner, V. K.

2017-10-01

With social media becoming increasingly location-based, there has been a greater push from researchers across various domains including social science, public health, and disaster management, to tap in the spatial, temporal, and textual data available from these sources to analyze public response during extreme events such as an epidemic outbreak or a natural disaster. Studies based on demographics and other socio-economic factors suggests that social media data could be highly skewed based on the variations of population density with respect to place. To capture the spatio-temporal variations in public response during extreme events we have developed the Socio-Environmental Data Explorer (SEDE). SEDE collects and integrates social media, news and environmental data to support exploration and assessment of public response to extreme events. For this study, using SEDE, we conduct spatio-temporal social media response analysis on four major extreme events in the United States including the "North American storm complex" in December 2015, the "snowstorm Jonas" in January 2016, the "West Virginia floods" in June 2016, and the "Hurricane Matthew" in October 2016. Analysis is conducted on geo-tagged social media data from Twitter and warnings from the storm events database provided by National Centers For Environmental Information (NCEI) for analysis. Results demonstrate that, to support complex social media analyses, spatial and population-based normalization and filtering is necessary. The implications of these results suggests that, while developing software solutions to support analysis of non-conventional data sources such as social media, it is quintessential to identify the inherent biases associated with the data sources, and adapt techniques and enhance capabilities to mitigate the bias. The normalization strategies that we have developed and incorporated to SEDE will be helpful in reducing the population bias associated with social media data and will be useful

Visual Memories Bypass Normalization.

Science.gov (United States)

Bloem, Ilona M; Watanabe, Yurika L; Kibbe, Melissa M; Ling, Sam

2018-05-01

How distinct are visual memory representations from visual perception? Although evidence suggests that briefly remembered stimuli are represented within early visual cortices, the degree to which these memory traces resemble true visual representations remains something of a mystery. Here, we tested whether both visual memory and perception succumb to a seemingly ubiquitous neural computation: normalization. Observers were asked to remember the contrast of visual stimuli, which were pitted against each other to promote normalization either in perception or in visual memory. Our results revealed robust normalization between visual representations in perception, yet no signature of normalization occurring between working memory stores-neither between representations in memory nor between memory representations and visual inputs. These results provide unique insight into the nature of visual memory representations, illustrating that visual memory representations follow a different set of computational rules, bypassing normalization, a canonical visual computation.

Normal function of immunologic stem cells from aged mice

International Nuclear Information System (INIS)

Harrison, D.E.; Doubleday, J.W.

1975-01-01

Marrow or spleen grafts from aged donor mice produced antibody-forming cells as effectively as did grafts from younger controls in recipients tested 3 to 10 months after the transplantation. All recipients were lethally irradiated, and the T6 chromosome marker was used to demonstrate that they were populated by donor cell lines. Recipients of aged or younger control grafts gave similar responses when stimulated with varying doses of antigen and when tested at different times after the transplantation except in two cases. Recipients of aged spleen grafts gave significantly lower responses than younger controls for the first few weeks after the transplantation. If recipients had been thymectomized before lethal irradiation, aged cell lines (pooled marrow and spleen cells) gave only 37 percent of the responses of younger controls. Given sufficient time and intact young recipients, immunologic stem cell lines from old donors populated recipients with cells having normal immune responses. These results suggest that age-related immunologic defects are not intrinsically timed in the precursor cell lines that populate the immune system. (U.S.)

Vesicles mimicking normal and cancer cell membranes exhibit differential responses to the cell-penetrating peptide Pep-1.

Science.gov (United States)

Almarwani, Bashiyar; Phambu, Esther Nzuzi; Alexander, Christopher; Nguyen, Ha Aimee T; Phambu, Nsoki; Sunda-Meya, Anderson

2018-06-01

The cell-penetrating peptide (CPP) Pep-1 presents a great potential in drug delivery due to its intrinsic property to cross plasma membrane. However, its mechanism of entry into the cell remains unresolved. In this study, we compare the selectivity of Pep-1 towards vesicles mimicking normal and cancer cell membranes. The interaction was performed in a wide range of peptide-to-lipid molar ratios using infrared (IR), fluorescence, scanning electron microscopy (SEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC) techniques. At low peptide concentration, fluorescence experiments show that lipid-phosphatidylserine (PS) seems to enable Pep-1 translocation into cancer cell membrane as evidenced by the blue shift of its maximal emission wavelength. DSC data show that Pep-1 induces segregation of lipids. At high peptide concentration, IR data indicate that the interaction of Pep-1 is relatively stronger with normal cell membrane than with cancer cell membrane through the phosphate groups, while the interaction is weaker with normal cell membrane than with cancer cell membrane through the carbonyl groups. TGA and DSC data reveal that vesicles of normal cell membrane are thermally more stable than vesicles of cancer cell membrane. This suggests that the additional lipid PS included in cancer cell membrane has a destabilizing effect on the membrane structure. SEM images reveal that Pep-1 form superstructures including spherical particles and fibrils in the presence of both model membranes. PS seems to enhance peptide transport across cellular membranes. The biophysical techniques in this study provide valuable insights into the properties of CPPs in drug delivery systems. Copyright © 2018 Elsevier B.V. All rights reserved.

Plasma ceramide levels are altered in low and normal birth weight men in response to short-term high-fat overfeeding

DEFF Research Database (Denmark)

Ribel-Madsen, Amalie; Ribel-Madsen, Rasmus; Nielsen, Kristian Fog

2018-01-01

Low birth weight (LBW) individuals have an increased risk of developing insulin resistance and type 2 diabetes compared with normal birth weight (NBW) individuals. We hypothesised that LBW individuals exhibit an increased fatty acid flux into lipogenesis in non-adipose tissue with a resulting...... accumulation of lipotoxic lipids, including ceramides, in the blood. Therefore, we measured fasting plasma levels of 27 ceramides in 18 young, healthy, LBW men and 25 NBW controls after an isocaloric control diet and a 5-day high-fat, high-calorie diet by HPLC-HRMS. LBW men did not show elevated plasma......:0–18:1/d18:1–18:0 and d18:1–24:2/d18:2–24:1 levels and increased the d18:0–24:1a level in response to overfeeding. Plasma d18:0–24:1a and total ceramide levels were positively associated with the fasting blood glucose level and endogenous glucose production after the control diet, and the total ceramide...

A normalization model suggests that attention changes the weighting of inputs between visual areas.

Science.gov (United States)

Ruff, Douglas A; Cohen, Marlene R

2017-05-16

Models of divisive normalization can explain the trial-averaged responses of neurons in sensory, association, and motor areas under a wide range of conditions, including how visual attention changes the gains of neurons in visual cortex. Attention, like other modulatory processes, is also associated with changes in the extent to which pairs of neurons share trial-to-trial variability. We showed recently that in addition to decreasing correlations between similarly tuned neurons within the same visual area, attention increases correlations between neurons in primary visual cortex (V1) and the middle temporal area (MT) and that an extension of a classic normalization model can account for this correlation increase. One of the benefits of having a descriptive model that can account for many physiological observations is that it can be used to probe the mechanisms underlying processes such as attention. Here, we use electrical microstimulation in V1 paired with recording in MT to provide causal evidence that the relationship between V1 and MT activity is nonlinear and is well described by divisive normalization. We then use the normalization model and recording and microstimulation experiments to show that the attention dependence of V1-MT correlations is better explained by a mechanism in which attention changes the weights of connections between V1 and MT than by a mechanism that modulates responses in either area. Our study shows that normalization can explain interactions between neurons in different areas and provides a framework for using multiarea recording and stimulation to probe the neural mechanisms underlying neuronal computations.

Evaluation of thermal conductivity of heat-cured acrylic resin mixed with A1203

OpenAIRE

Ebadian B.; Parkan MA.

2002-01-01

One of the most important characteristics of denture base is thermal conductivity. This property has a major role in secretions of salivary glands and their enzymes, taste of the food and gustatory response. Polymethyl methacrylate used in prosthodontics is relatively an insulator. Different materials such as metal fillers and ceramics have been used to solve this problem. The aim of this study was the evaluation of AI2O3 effect on thermal conductivity of heat-cured acrylic resin. Acrylic res...

The Role of GPR84 in Medium-chain Saturated Fatty Acid Taste Transduction

OpenAIRE

Liu, Yan

2016-01-01

Previous research has shown the gustatory recognition of the long-chain unsaturated fatty acids. In this study, I showed for the first time that medium-chain saturated fatty acids (MCFAs) are effective taste stimuli at both the cellular and behavioral levels. The mechanisms of gustatory recognition of MCFAs in mice were also partially elucidated using pharmaceutical approaches. The inward currents induced by capric acid in mouse taste cells were significantly inhibited by the antagonists of G...

Effects of synthetic TRH on plasma human prolactin levels in normal subjects and in patients with various endocrine disorders

International Nuclear Information System (INIS)

Ogawa, Norio; Miyoshi, Masanori; Suzuki, Shinya; Ofuji, Tadashi; Furuno, Katsushi

1974-01-01

HPRL was iodinated a modification of the enzymatic method using lactoperoxidase. By solid-phase RIA using antibody-coated disposable plastic microtiter trays, it was confirmed that the second peak consisted of the immunoreactive material that was used for RIA. For the measurement of plasma hPRL levels, the double antibody technique was used to separate bound from free labeled hormones. Basal plasma hPRL levels in normal subjects were less than 20 ng/ml. The mean basal hPRL levels were 10.2 +- 4.9 (Mean+-SD) ng/ml in 13 normal men and 9.6+-5.4 ng/ml in 8 normal women; no statistically significant sex difference was observed. When synthetic TRH was administered intravenously to a normal male subject, the maximum increase in plasma hPRL above the baseline level increased linearly as a function of the log of the TRH dose between 25 and 100 μg of TRH. Intravenous administration of 500 μg of TRH caused a significant increase in plasma hPRL in all of the 10 normal subjects tested. Plasma hPRL levels in 2 patients with Sheehan's syndrome and in a patient with operated-irradiated chromophobe adenoma tended to be low, and they showed no significant increase in plasma hPRL after TRH injection. Basal plasma hPRL levels in most of the patients with hypothalamopituitary tumor tended to be high. Plasma hPRL levels were normal in most patients with pituitary dwarfism. Plasma hPRL levels in 2 patients with hyperthyroidism tended to be low, and they showed no significant hPRL response to TRH, while patients with hypothyroidism showed normal or rather exaggerated hPRL response to TRH. Plasma hPRL levels were normal in most of the patients with Cushing's syndrome and plasma hPRL responses to TRH in these patients were normal. TRH-induced hPRL secretion tended to be impaired in patients receiving long-term and high doses of glucocorticoid. (auth.)

Skeletal muscle phosphatidylcholine fatty acids and insulin sensitivity in normal humans.

Science.gov (United States)

Clore, J N; Li, J; Gill, R; Gupta, S; Spencer, R; Azzam, A; Zuelzer, W; Rizzo, W B; Blackard, W G

1998-10-01

The fatty acid composition of skeletal muscle membrane phospholipids (PL) is known to influence insulin responsiveness in humans. However, the contribution of the major PL of the outer (phosphatidylcholine, PC) and inner (phosphatidylethanolamine, PE) layers of the sarcolemma to insulin sensitivity is not known. Fatty acid composition of PC and PE from biopsies of vastus lateralis from 27 normal men and women were correlated with insulin sensitivity determined by the hyperinsulinemic euglycemic clamp technique at insulin infusion rates of 0.4, 1.0, and 10.0 mU . kg-1 . min-1. Significant variation in the half-maximal insulin concentration (ED50) was observed in the normal volunteers (range 24.0-146.0 microU/ml), which correlated directly with fasting plasma insulin (r = 0.75, P insulin sensitivity was observed in PE (NS). These studies suggest that the fatty acid composition of PC may be of particular importance in the relationship between fatty acids and insulin sensitivity in normal humans.

A study of the up-and-down method for non-normal distribution functions

DEFF Research Database (Denmark)

Vibholm, Svend; Thyregod, Poul

1988-01-01

The assessment of breakdown probabilities is examined by the up-and-down method. The exact maximum-likelihood estimates for a number of response patterns are calculated for three different distribution functions and are compared with the estimates corresponding to the normal distribution. Estimates...

Mutagenesis and lethality following S phase irradiation of xeroderma pigmentosum and normal human diploid fibroblasts with ultraviolet light

International Nuclear Information System (INIS)

Grosovsky, A.J.; Little, J.B.

1983-01-01

The mutagenic and lethal effects of u.v. light exposure in the DNA synthetic phase of the cell cycle were determined in xeroderma pigmentosum complementation group A (XP-A), hereditary adenomatosis of the colon and rectum (ACR), and a normal, foreskin derived cell strain (AG1522). For AG1522, an increased sensitivity to the cytotoxic effects of u.v. light was observed as compared to previous findings for confluent, non-proliferating cultures. XP-A fibroblasts were markedly hypersensitive and ACR fibroblasts exhibited an intermediate response. The mutagenic response of ACR fibroblasts, however, was similar to normal fibroblasts. A threshold of 1.5-2 J/m 2 was observed for u.v. induced mutagenesis in normal and ACR fibroblasts. XP fibroblasts, on the other hand, were strikingly hypermutable and demonstrated little or no threshold. When S phase mutagenesis was considered as a function of survival level rather than u.v. light dose, XP fibroblasts remained significantly hypermutable as compared with normal fibroblasts at all survival levels. Previous mutagenesis results with confluent, non-proliferating cultures of XP and normal fibroblasts were reanalyzed as a function of cytotoxicity; XP hypermutability at all survival levels was also observed. (author)

Neural circuits of eye movements during performance of the visual exploration task, which is similar to the responsive search score task, in schizophrenia patients and normal subjects

International Nuclear Information System (INIS)

Nemoto, Yasundo; Matsuda, Tetsuya; Matsuura, Masato

2004-01-01

Abnormal exploratory eye movements have been studied as a biological marker for schizophrenia. Using functional MRI (fMRI), we investigated brain activations of 12 healthy and 8 schizophrenic subjects during performance of a visual exploration task that is similar to the responsive search score task to clarify the neural basis of the abnormal exploratory eye movement. Performance data, such as the number of eye movements, the reaction time, and the percentage of correct answers showed no significant differences between the two groups. Only the normal subjects showed activations at the bilateral thalamus and the left anterior medial frontal cortex during the visual exploration tasks. In contrast, only the schizophrenic subjects showed activations at the right anterior cingulate gyms during the same tasks. The activation at the different locations between the two groups, the left anterior medial frontal cortex in normal subjects and the right anterior cingulate gyrus in schizophrenia subjects, was explained by the feature of the visual tasks. Hypoactivation at the bilateral thalamus supports a dysfunctional filtering theory of schizophrenia. (author)

Neural correlates to food-related behavior in normal-weight and overweight/obese participants.

Directory of Open Access Journals (Sweden)

Alan Ho

Full Text Available Two thirds of US adults are either obese or overweight and this rate is rising. Although the etiology of obesity is not yet fully understood, neuroimaging studies have demonstrated that the central nervous system has a principal role in regulating eating behavior. In this study, functional magnetic resonance imaging and survey data were evaluated for correlations between food-related problem behaviors and the neural regions underlying responses to visual food cues before and after eating in normal-weight individuals and overweight/obese individuals. In normal-weight individuals, activity in the left amygdala in response to high-calorie food vs. nonfood object cues was positively correlated with impaired satiety scores during fasting, suggesting that those with impaired satiety scores may have an abnormal anticipatory reward response. In overweight/obese individuals, activity in the dorsolateral prefrontal cortex (DLPFC in response to low-calorie food cues was negatively correlated with impaired satiety during fasting, suggesting that individuals scoring lower in satiety impairment were more likely to activate the DLPFC inhibitory system. After eating, activity in both the putamen and the amygdala was positively correlated with impaired satiety scores among obese/overweight participants. While these individuals may volitionally suggest they are full, their functional response to food cues suggests food continues to be salient. These findings suggest brain regions involved in the evaluation of visual food cues may be mediated by satiety-related problems, dependent on calorie content, state of satiation, and body mass index.

Toxicity of aged gasoline exhaust particles to normal and diseased airway epithelia.

Science.gov (United States)

Künzi, Lisa; Krapf, Manuel; Daher, Nancy; Dommen, Josef; Jeannet, Natalie; Schneider, Sarah; Platt, Stephen; Slowik, Jay G; Baumlin, Nathalie; Salathe, Matthias; Prévôt, André S H; Kalberer, Markus; Strähl, Christof; Dümbgen, Lutz; Sioutas, Constantinos; Baltensperger, Urs; Geiser, Marianne

2015-06-29

Particulate matter (PM) pollution is a leading cause of premature death, particularly in those with pre-existing lung disease. A causative link between particle properties and adverse health effects remains unestablished mainly due to complex and variable physico-chemical PM parameters. Controlled laboratory experiments are required. Generating atmospherically realistic aerosols and performing cell-exposure studies at relevant particle-doses are challenging. Here we examine gasoline-exhaust particle toxicity from a Euro-5 passenger car in a uniquely realistic exposure scenario, combining a smog chamber simulating atmospheric ageing, an aerosol enrichment system varying particle number concentration independent of particle chemistry, and an aerosol deposition chamber physiologically delivering particles on air-liquid interface (ALI) cultures reproducing normal and susceptible health status. Gasoline-exhaust is an important PM source with largely unknown health effects. We investigated acute responses of fully-differentiated normal, distressed (antibiotics-treated) normal, and cystic fibrosis human bronchial epithelia (HBE), and a proliferating, single-cell type bronchial epithelial cell-line (BEAS-2B). We show that a single, short-term exposure to realistic doses of atmospherically-aged gasoline-exhaust particles impairs epithelial key-defence mechanisms, rendering it more vulnerable to subsequent hazards. We establish dose-response curves at realistic particle-concentration levels. Significant differences between cell models suggest the use of fully-differentiated HBE is most appropriate in future toxicity studies.

Toxicity of aged gasoline exhaust particles to normal and diseased airway epithelia