WorldWideScience

Sample records for normal adaptive immunity

  1. Origins of adaptive immunity.

    Science.gov (United States)

    Liongue, Clifford; John, Liza B; Ward, Alister

    2011-01-01

    Adaptive immunity, involving distinctive antibody- and cell-mediated responses to specific antigens based on "memory" of previous exposure, is a hallmark of higher vertebrates. It has been argued that adaptive immunity arose rapidly, as articulated in the "big bang theory" surrounding its origins, which stresses the importance of coincident whole-genome duplications. Through a close examination of the key molecules and molecular processes underpinning adaptive immunity, this review suggests a less-extreme model, in which adaptive immunity emerged as part of longer evolutionary journey. Clearly, whole-genome duplications provided additional raw genetic materials that were vital to the emergence of adaptive immunity, but a variety of other genetic events were also required to generate some of the key molecules, whereas others were preexisting and simply co-opted into adaptive immunity.

  2. The Immune System: Basis of so much Health and Disease: 3. Adaptive Immunity.

    Science.gov (United States)

    Scully, Crispian; Georgakopoulou, Eleni A; Hassona, Yazan

    2017-04-01

    The immune system is the body’s primary defence mechanism against infections, and disturbances in the system can cause disease if the system fails in defence functions (in immunocompromised people), or if the activity is detrimental to the host (as in auto-immune and auto-inflammatory states). A healthy immune system is also essential to normal health of dental and oral tissues. This series presents the basics for the understanding of the immune system; this article covers adaptive immunity. Clinical relevance: Dental clinicians need a basic understanding of the immune system as it underlies health and disease.

  3. The Basic Immune Simulator: An agent-based model to study the interactions between innate and adaptive immunity

    Directory of Open Access Journals (Sweden)

    Orosz Charles G

    2007-09-01

    Full Text Available Abstract Background We introduce the Basic Immune Simulator (BIS, an agent-based model created to study the interactions between the cells of the innate and adaptive immune system. Innate immunity, the initial host response to a pathogen, generally precedes adaptive immunity, which generates immune memory for an antigen. The BIS simulates basic cell types, mediators and antibodies, and consists of three virtual spaces representing parenchymal tissue, secondary lymphoid tissue and the lymphatic/humoral circulation. The BIS includes a Graphical User Interface (GUI to facilitate its use as an educational and research tool. Results The BIS was used to qualitatively examine the innate and adaptive interactions of the immune response to a viral infection. Calibration was accomplished via a parameter sweep of initial agent population size, and comparison of simulation patterns to those reported in the basic science literature. The BIS demonstrated that the degree of the initial innate response was a crucial determinant for an appropriate adaptive response. Deficiency or excess in innate immunity resulted in excessive proliferation of adaptive immune cells. Deficiency in any of the immune system components increased the probability of failure to clear the simulated viral infection. Conclusion The behavior of the BIS matches both normal and pathological behavior patterns in a generic viral infection scenario. Thus, the BIS effectively translates mechanistic cellular and molecular knowledge regarding the innate and adaptive immune response and reproduces the immune system's complex behavioral patterns. The BIS can be used both as an educational tool to demonstrate the emergence of these patterns and as a research tool to systematically identify potential targets for more effective treatment strategies for diseases processes including hypersensitivity reactions (allergies, asthma, autoimmunity and cancer. We believe that the BIS can be a useful addition to

  4. Adaptation in the innate immune system and heterologous innate immunity.

    Science.gov (United States)

    Martin, Stefan F

    2014-11-01

    The innate immune system recognizes deviation from homeostasis caused by infectious or non-infectious assaults. The threshold for its activation seems to be established by a calibration process that includes sensing of microbial molecular patterns from commensal bacteria and of endogenous signals. It is becoming increasingly clear that adaptive features, a hallmark of the adaptive immune system, can also be identified in the innate immune system. Such adaptations can result in the manifestation of a primed state of immune and tissue cells with a decreased activation threshold. This keeps the system poised to react quickly. Moreover, the fact that the innate immune system recognizes a wide variety of danger signals via pattern recognition receptors that often activate the same signaling pathways allows for heterologous innate immune stimulation. This implies that, for example, the innate immune response to an infection can be modified by co-infections or other innate stimuli. This "design feature" of the innate immune system has many implications for our understanding of individual susceptibility to diseases or responsiveness to therapies and vaccinations. In this article, adaptive features of the innate immune system as well as heterologous innate immunity and their implications are discussed.

  5. A role of the adaptive immune system in glucose homeostasis.

    Science.gov (United States)

    Bronsart, Laura L; Contag, Christopher H

    2016-01-01

    The immune system, including the adaptive immune response, has recently been recognized as having a significant role in diet-induced insulin resistance. In this study, we aimed to determine if the adaptive immune system also functions in maintaining physiological glucose homeostasis in the absence of diet-induced disease. SCID mice and immunocompetent control animals were phenotypically assessed for variations in metabolic parameters and cytokine profiles. Additionally, the glucose tolerance of SCID and immunocompetent control animals was assessed following introduction of a high-fat diet. SCID mice on a normal chow diet were significantly insulin resistant relative to control animals despite having less fat mass. This was associated with a significant increase in the innate immunity-stimulating cytokines granulocyte colony-stimulating factor, monocyte chemoattractant protein 1 (MCP1), and MCP3. Additionally, the SCID mouse phenotype was exacerbated in response to a high-fat diet as evidenced by the further significant progression of glucose intolerance. These results support the notion that the adaptive immune system plays a fundamental biological role in glucose homeostasis, and that the absence of functional B and T cells results in disruption in the concentrations of various cytokines associated with macrophage proliferation and recruitment. Additionally, the absence of functional B and T cells is not protective against diet-induced pathology.

  6. The Major Players in Adaptive Immunity-Cell-mediated Immunity

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 6. The Major Players in Adaptive Immunity - Cell-mediated Immunity. Asma Ahmed Banishree Saha Anand Patwardhan Shwetha Shivaprasad Dipankar Nandi. General Article Volume 14 Issue 6 June 2009 pp 610-621 ...

  7. Heme oxygenase and the immune system in normal and pathological pregnancies

    Directory of Open Access Journals (Sweden)

    Maide eOzen

    2015-04-01

    Full Text Available Normal pregnancy is an immunotolerant state. Many factors, including environmental, socioeconomic, genetic, and immunologic changes by infection and/or other causes of inflammation, may contribute to inter-individual differences resulting in a normal or pathologic pregnancy. In particular, imbalances in the immune system can cause many pregnancy-related diseases, such as infertility, abortions, pre-eclampsia, and preterm labor, which result in maternal/fetal death, prematurity, or small-for-gestational age newborns. New findings imply that myeloid regulatory cells and regulatory T cells (Tregs may mediate immunotolerance during normal pregnancy. Effector T cells (Teffs have, in contrast, been implicated to cause adverse pregnancy outcomes. Furthermore, feto-maternal tolerance affects the developing fetus. It has been shown that the Treg/Teff balance affects litter size and adoptive transfer of pregnancy-induced Tregs can prevent fetal rejection in the mouse. Heme oxygenase-1 (HO-1 has a protective role in many conditions through its anti-inflammatory, anti-apoptotic, antioxidative, and anti-proliferative actions. HO-1 is highly expressed in the placenta and plays a role in angiogenesis and placental vascular development and in regulating vascular tone in pregnancy. In addition, HO-1 is a major regulator of immune homeostasis by mediating crosstalk between innate and adaptive immune systems. Moreover, HO-1 can inhibit inflammation-induced phenotypic maturation of immune effector cells and pro-inflammatory cytokine secretion and promote anti-inflammatory cytokine production. HO-1 may also be associated with T-cell activation and can limit immune-based tissue injury by promoting Treg suppression of effector responses. Thus, HO-1 and its byproducts may protect against pregnancy complications by its immunomodulatory effects, and the regulation of HO-1 or its downstream effects has the potential to prevent or treat pregnancy complications and

  8. Immune genes undergo more adaptive evolution than non-immune system genes in Daphnia pulex

    Directory of Open Access Journals (Sweden)

    McTaggart Seanna J

    2012-05-01

    Full Text Available Abstract Background Understanding which parts of the genome have been most influenced by adaptive evolution remains an unsolved puzzle. Some evidence suggests that selection has the greatest impact on regions of the genome that interact with other evolving genomes, including loci that are involved in host-parasite co-evolutionary processes. In this study, we used a population genetic approach to test this hypothesis by comparing DNA sequences of 30 putative immune system genes in the crustacean Daphnia pulex with 24 non-immune system genes. Results In support of the hypothesis, results from a multilocus extension of the McDonald-Kreitman (MK test indicate that immune system genes as a class have experienced more adaptive evolution than non-immune system genes. However, not all immune system genes show evidence of adaptive evolution. Additionally, we apply single locus MK tests and calculate population genetic parameters at all loci in order to characterize the mode of selection (directional versus balancing in the genes that show the greatest deviation from neutral evolution. Conclusions Our data are consistent with the hypothesis that immune system genes undergo more adaptive evolution than non-immune system genes, possibly as a result of host-parasite arms races. The results of these analyses highlight several candidate loci undergoing adaptive evolution that could be targeted in future studies.

  9. PPARγ Agonists in Adaptive Immunity: What Do Immune Disorders and Their Models Have to Tell Us?

    Directory of Open Access Journals (Sweden)

    Laurindo Ferreira da Rocha Junior

    2013-01-01

    Full Text Available Adaptive immunity has evolved as a very powerful and highly specialized tool of host defense. Its classical protagonists are lymphocytes of the T- and B-cell lineage. Cytokines and chemokines play a key role as effector mechanisms of the adaptive immunity. Some autoimmune and inflammatory diseases are caused by disturbance of the adaptive immune system. Recent advances in understanding the pathogenesis of autoimmune diseases have led to research on new molecular and therapeutic targets. PPARγ are members of the nuclear receptor superfamily and are transcription factors involved in lipid metabolism as well as innate and adaptive immunity. PPARγ is activated by synthetic and endogenous ligands. Previous studies have shown that PPAR agonists regulate T-cell survival, activation and T helper cell differentiation into effector subsets: Th1, Th2, Th17, and Tregs. PPARγ has also been associated with B cells. The present review addresses these issues by placing PPARγ agonists in the context of adaptive immune responses and the relation of the activation of these receptors with the expression of cytokines involved in adaptive immunity.

  10. Quantifying adaptive evolution in the Drosophila immune system.

    Directory of Open Access Journals (Sweden)

    Darren J Obbard

    2009-10-01

    Full Text Available It is estimated that a large proportion of amino acid substitutions in Drosophila have been fixed by natural selection, and as organisms are faced with an ever-changing array of pathogens and parasites to which they must adapt, we have investigated the role of parasite-mediated selection as a likely cause. To quantify the effect, and to identify which genes and pathways are most likely to be involved in the host-parasite arms race, we have re-sequenced population samples of 136 immunity and 287 position-matched non-immunity genes in two species of Drosophila. Using these data, and a new extension of the McDonald-Kreitman approach, we estimate that natural selection fixes advantageous amino acid changes in immunity genes at nearly double the rate of other genes. We find the rate of adaptive evolution in immunity genes is also more variable than other genes, with a small subset of immune genes evolving under intense selection. These genes, which are likely to represent hotspots of host-parasite coevolution, tend to share similar functions or belong to the same pathways, such as the antiviral RNAi pathway and the IMD signalling pathway. These patterns appear to be general features of immune system evolution in both species, as rates of adaptive evolution are correlated between the D. melanogaster and D. simulans lineages. In summary, our data provide quantitative estimates of the elevated rate of adaptive evolution in immune system genes relative to the rest of the genome, and they suggest that adaptation to parasites is an important force driving molecular evolution.

  11. Suppression of adoptive antituberculosis immunity by normal recipient animals

    International Nuclear Information System (INIS)

    Lefford, M.J.

    1983-01-01

    Adoptive immunity is poorly expressed in normal syngeneic mice. This phenomenon was studied by using experimental antituberculosis immunity as a model system representing pure cell-mediated immunity. Expression of adoptive immunity was facilitated by pretreating recipients with sublethal ionizing radiation (500 rads) or high doses (200 mg/kg) of cyclophosphamide or by using adult thymectomized, lethally irradiated, bone-marrow-reconstituted (TXB) mice. Adult thymectomy was less effective, and a low dose of cyclophosphamide (20 mg/kg) was completely ineffective. The beneficial effect of sublethal irradiation was reduced over time; it persisted for 4 weeks and was absent after 8 weeks. Attempts to restore the suppressed state of normal mice to sublethally irradiated mice by using normal spleen or thymus cells did not succeed. Even in rats, which express adoptive antituberculosis immunity without immunosuppressive treatment, the use of sublethally irradiated or TXB recipients potentiated adoptive immunity. It was concluded that suppression of adoptive immunization in normal recipient mice is mediated predominantly, if not exclusively, by T lymphocytes that are sensitive to a number of immunosuppressive agents. The suppressor cells are long-lived and can be regenerated from precursors that are resistant to 500 but not to 900 rads of ionizing radiation

  12. Integration of the immune system: a complex adaptive supersystem

    Science.gov (United States)

    Crisman, Mark V.

    2001-10-01

    Immunity to pathogenic organisms is a complex process involving interacting factors within the immune system including circulating cells, tissues and soluble chemical mediators. Both the efficiency and adaptive responses of the immune system in a dynamic, often hostile, environment are essential for maintaining our health and homeostasis. This paper will present a brief review of one of nature's most elegant, complex adaptive systems.

  13. Alternative adaptive immunity in invertebrates

    DEFF Research Database (Denmark)

    Kurtz, Joachim; Armitage, Sophie Alice Octavia

    2006-01-01

    Vertebrate adaptive immunity is characterized by challenge-specific long-term protection. This specific memory is achieved through the vast diversity of somatically rearranged immunological receptors such as antibodies. Whether or not invertebrates are capable of a comparable phenotypic plasticity...

  14. Computational Strategies for Dissecting the High-Dimensional Complexity of Adaptive Immune Repertoires

    Directory of Open Access Journals (Sweden)

    Enkelejda Miho

    2018-02-01

    Full Text Available The adaptive immune system recognizes antigens via an immense array of antigen-binding antibodies and T-cell receptors, the immune repertoire. The interrogation of immune repertoires is of high relevance for understanding the adaptive immune response in disease and infection (e.g., autoimmunity, cancer, HIV. Adaptive immune receptor repertoire sequencing (AIRR-seq has driven the quantitative and molecular-level profiling of immune repertoires, thereby revealing the high-dimensional complexity of the immune receptor sequence landscape. Several methods for the computational and statistical analysis of large-scale AIRR-seq data have been developed to resolve immune repertoire complexity and to understand the dynamics of adaptive immunity. Here, we review the current research on (i diversity, (ii clustering and network, (iii phylogenetic, and (iv machine learning methods applied to dissect, quantify, and compare the architecture, evolution, and specificity of immune repertoires. We summarize outstanding questions in computational immunology and propose future directions for systems immunology toward coupling AIRR-seq with the computational discovery of immunotherapeutics, vaccines, and immunodiagnostics.

  15. Mechanisms Underlying the Regulation of Innate and Adaptive Immunity by Vitamin D.

    Science.gov (United States)

    Wei, Ran; Christakos, Sylvia

    2015-09-24

    Non-classical actions of vitamin D were first suggested over 30 years ago when receptors for the active form of vitamin D, 1,25-dihydroxyvitamin D3 (1,25(OH)2D3), were detected in various tissues and cells that are not associated with the regulation of calcium homeostasis, including activated human inflammatory cells. The question that remained was the biological significance of the presence of vitamin D receptors in the different tissues and cells and, with regard to the immune system, whether or not vitamin D plays a role in the normal immune response and in modifying immune mediated diseases. In this article findings indicating that vitamin D is a key factor regulating both innate and adaptive immunity are reviewed with a focus on the molecular mechanisms involved. In addition, the physiological significance of vitamin D action, as suggested by in vivo studies in mouse models is discussed. Together, the findings indicate the importance of 1,25(OH)2D3 as a regulator of key components of the immune system. An understanding of the mechanisms involved will lead to potential therapeutic applications for the treatment of immune mediated diseases.

  16. Adaptive Immunity to Cryptococcus neoformans Infections

    Directory of Open Access Journals (Sweden)

    Liliane Mukaremera

    2017-11-01

    Full Text Available The Cryptococcus neoformans/Cryptococcus gattii species complex is a group of fungal pathogens with different phenotypic and genotypic diversity that cause disease in immunocompromised patients as well as in healthy individuals. The immune response resulting from the interaction between Cryptococcus and the host immune system is a key determinant of the disease outcome. The species C. neoformans causes the majority of human infections, and therefore almost all immunological studies focused on C. neoformans infections. Thus, this review presents current understanding on the role of adaptive immunity during C. neoformans infections both in humans and in animal models of disease.

  17. Immune and stress responses in oysters with insights on adaptation.

    Science.gov (United States)

    Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude

    2015-09-01

    Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. The Memories of NK Cells: Innate-Adaptive Immune Intrinsic Crosstalk.

    Science.gov (United States)

    Gabrielli, Sara; Ortolani, Claudio; Del Zotto, Genny; Luchetti, Francesca; Canonico, Barbara; Buccella, Flavia; Artico, Marco; Papa, Stefano; Zamai, Loris

    2016-01-01

    Although NK cells are considered part of the innate immune system, a series of evidences has demonstrated that they possess characteristics typical of the adaptive immune system. These NK adaptive features, in particular their memory-like functions, are discussed from an ontogenetic and evolutionary point of view.

  19. The role of the adaptive immune system in regulation of gut microbiota.

    Science.gov (United States)

    Kato, Lucia M; Kawamoto, Shimpei; Maruya, Mikako; Fagarasan, Sidonia

    2014-07-01

    The gut nourishes rich bacterial communities that affect profoundly the functions of the immune system. The relationship between gut microbiota and the immune system is one of reciprocity. The microbiota contributes to nutrient processing and the development, maturation, and function of the immune system. Conversely, the immune system, particularly the adaptive immune system, plays a key role in shaping the repertoire of gut microbiota. The fitness of host immune system is reflected in the gut microbiota, and deficiencies in either innate or adaptive immunity impact on diversity and structures of bacterial communities in the gut. Here, we discuss the mechanisms that underlie this reciprocity and emphasize how the adaptive immune system via immunoglobulins (i.e. IgA) contributes to diversification and balance of gut microbiota required for immune homeostasis. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. The Memories of NK Cells: Innate-Adaptive Immune Intrinsic Crosstalk

    Directory of Open Access Journals (Sweden)

    Sara Gabrielli

    2016-01-01

    Full Text Available Although NK cells are considered part of the innate immune system, a series of evidences has demonstrated that they possess characteristics typical of the adaptive immune system. These NK adaptive features, in particular their memory-like functions, are discussed from an ontogenetic and evolutionary point of view.

  1. Dynamic Nature of Noncoding RNA Regulation of Adaptive Immune Response

    Directory of Open Access Journals (Sweden)

    Franca Citarella

    2013-08-01

    Full Text Available Immune response plays a fundamental role in protecting the organism from infections; however, dysregulation often occurs and can be detrimental for the organism, leading to a variety of immune-mediated diseases. Recently our understanding of the molecular and cellular networks regulating the immune response, and, in particular, adaptive immunity, has improved dramatically. For many years, much of the focus has been on the study of protein regulators; nevertheless, recent evidence points to a fundamental role for specific classes of noncoding RNAs (ncRNAs in regulating development, activation and homeostasis of the immune system. Although microRNAs (miRNAs are the most comprehensive and well-studied, a number of reports suggest the exciting possibility that long ncRNAs (lncRNAs could mediate host response and immune function. Finally, evidence is also accumulating that suggests a role for miRNAs and other small ncRNAs in autocrine, paracrine and exocrine signaling events, thus highlighting an elaborate network of regulatory interactions mediated by different classes of ncRNAs during immune response. This review will explore the multifaceted roles of ncRNAs in the adaptive immune response. In particular, we will focus on the well-established role of miRNAs and on the emerging role of lncRNAs and circulating ncRNAs, which all make indispensable contributions to the understanding of the multilayered modulation of the adaptive immune response.

  2. Functional aspects of the adaptive immune system in arthritis

    NARCIS (Netherlands)

    Jansen, D.T.S.L.

    2017-01-01

    The adaptive immune system is the part of the immune system that is highly specific and generates memory resulting in a fast and specific immune response upon a second infection with the same pathogen. However, when this response is specific for a part of the body itself instead of a pathogen,

  3. CRISPR-Cas systems: Prokaryotes upgrade to adaptive immunity.

    Science.gov (United States)

    Barrangou, Rodolphe; Marraffini, Luciano A

    2014-04-24

    Clustered regularly interspaced short palindromic repeats (CRISPR), and associated proteins (Cas) comprise the CRISPR-Cas system, which confers adaptive immunity against exogenic elements in many bacteria and most archaea. CRISPR-mediated immunization occurs through the uptake of DNA from invasive genetic elements such as plasmids and viruses, followed by its integration into CRISPR loci. These loci are subsequently transcribed and processed into small interfering RNAs that guide nucleases for specific cleavage of complementary sequences. Conceptually, CRISPR-Cas shares functional features with the mammalian adaptive immune system, while also exhibiting characteristics of Lamarckian evolution. Because immune markers spliced from exogenous agents are integrated iteratively in CRISPR loci, they constitute a genetic record of vaccination events and reflect environmental conditions and changes over time. Cas endonucleases, which can be reprogrammed by small guide RNAs have shown unprecedented potential and flexibility for genome editing and can be repurposed for numerous DNA targeting applications including transcriptional control. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity

    Science.gov (United States)

    Barrangou, Rodolphe; Marraffini, Luciano A.

    2014-01-01

    Summary Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), and associated proteins (Cas) comprise the CRISPR-Cas system, which confers adaptive immunity against exogenic elements in many bacteria and most archaea. CRISPR-mediated immunization occurs through the uptake of DNA from invasive genetic elements such as plasmids and viruses, followed by its integration into CRISPR loci. These loci are subsequently transcribed and processed into small interfering RNAs that guide nucleases for specific cleavage of complementary sequences. Conceptually, CRISPR-Cas shares functional features with the mammalian adaptive immune system, while also exhibiting characteristics of Lamarckian evolution. Because immune markers spliced from exogenous agents are integrated iteratively in CRISPR loci, they constitute a genetic record of vaccination events and reflect environmental conditions and changes over time. Cas endonucleases, which can be reprogrammed by small guide RNAs have shown unprecedented potential and flexibility for genome editing, and can be repurposed for numerous DNA targeting applications including transcriptional control. PMID:24766887

  5. Innate and Adaptive Immunity to Mucorales.

    Science.gov (United States)

    Ghuman, Harlene; Voelz, Kerstin

    2017-09-05

    Mucormycosis is an invasive fungal infection characterised by rapid filamentous growth, which leads to angioinvasion, thrombosis, and tissue necrosis. The high mortality rates (50-100%) associated with mucormycosis are reflective of not only the aggressive nature of the infection and the poor therapeutics currently employed, but also the failure of the human immune system to successfully clear the infection. Immune effector interaction with Mucorales is influenced by the developmental stage of the mucormycete spore. In a healthy immune environment, resting spores are resistant to phagocytic killing. Contrarily, swollen spores and hyphae are susceptible to damage and degradation by macrophages and neutrophils. Under the effects of immune suppression, the recruitment and efficacy of macrophage and neutrophil activity against mucormycetes is considerably reduced. Following penetration of the endothelial lining, Mucorales encounter platelets. Platelets adhere to both mucormycete spores and hyphae, and exhibit germination suppression and hyphal damage capacity in vitro. Dendritic cells are activated in response to Mucorales hyphae only, and induce adaptive immunity. It is crucial to further knowledge regarding our immune system's failure to eradicate resting spores under intact immunity and inhibit fungal growth under immunocompromised conditions, in order to understand mucormycosis pathogenicity and enhance therapeutic strategies for mucormycosis.

  6. Adaptive immunity and histopathology in frog virus 3-infected Xenopus

    International Nuclear Information System (INIS)

    Robert, Jacques; Morales, Heidi; Buck, Wayne; Cohen, Nicholas; Marr, Shauna; Gantress, Jennifer

    2005-01-01

    Xenopus has been used as an experimental model to evaluate the contribution of adaptive cellular immunity in amphibian host susceptibility to the emerging ranavirus FV3. Conventional histology and immunohistochemistry reveal that FV3 has a strong tropism for the proximal tubular epithelium of the kidney and is rarely disseminated elsewhere in Xenopus hosts unless their immune defenses are impaired or developmentally immature as in larvae. In such cases, virus is found widespread in most tissues. Adults, immunocompromised by depletion of CD8 + T cells or by sub-lethal γ-irradiation, show increased susceptibility to FV3 infection. Larvae and irradiated (but not normal) adults can be cross-infected through water by infected adult conspecifics (irradiated or not). The natural MHC class I deficiency and the absence of effect of anti-CD8 treatment on both larval CD8 + T cells and larval susceptibility to FV3 are consistent with an inefficient CD8 + T cell effector function during this developmental period

  7. Regulation of intestinal homeostasis by innate and adaptive immunity.

    Science.gov (United States)

    Kayama, Hisako; Takeda, Kiyoshi

    2012-11-01

    The intestine is a unique tissue where an elaborate balance is maintained between tolerance and immune responses against a variety of environmental factors such as food and the microflora. In a healthy individual, the microflora stimulates innate and adaptive immune systems to maintain gut homeostasis. However, the interaction of environmental factors with particular genetic backgrounds can lead to dramatic changes in the composition of the microflora (i.e. dysbiosis). Many of the specific commensal-bacterial products and the signaling pathways they trigger have been characterized. The role of T(h)1, T(h)2 and T(h)17 cells in inflammatory bowel disease has been widely investigated, as has the contribution of epithelial cells and subsets of dendritic cells and macrophages. To date, multiple regulatory cells in adaptive immunity, such as regulatory T cells and regulatory B cells, have been shown to maintain gut homeostasis by preventing inappropriate innate and adaptive immune responses to commensal bacteria. Additionally, regulatory myeloid cells have recently been identified that prevent intestinal inflammation by inhibiting T-cell proliferation. An increasing body of evidence has shown that multiple regulatory mechanisms contribute to the maintenance of gut homeostasis.

  8. Genetic adaptation of the antibacterial human innate immunity network.

    Science.gov (United States)

    Casals, Ferran; Sikora, Martin; Laayouni, Hafid; Montanucci, Ludovica; Muntasell, Aura; Lazarus, Ross; Calafell, Francesc; Awadalla, Philip; Netea, Mihai G; Bertranpetit, Jaume

    2011-07-11

    Pathogens have represented an important selective force during the adaptation of modern human populations to changing social and other environmental conditions. The evolution of the immune system has therefore been influenced by these pressures. Genomic scans have revealed that immune system is one of the functions enriched with genes under adaptive selection. Here, we describe how the innate immune system has responded to these challenges, through the analysis of resequencing data for 132 innate immunity genes in two human populations. Results are interpreted in the context of the functional and interaction networks defined by these genes. Nucleotide diversity is lower in the adaptors and modulators functional classes, and is negatively correlated with the centrality of the proteins within the interaction network. We also produced a list of candidate genes under positive or balancing selection in each population detected by neutrality tests and showed that some functional classes are preferential targets for selection. We found evidence that the role of each gene in the network conditions the capacity to evolve or their evolvability: genes at the core of the network are more constrained, while adaptation mostly occurred at particular positions at the network edges. Interestingly, the functional classes containing most of the genes with signatures of balancing selection are involved in autoinflammatory and autoimmune diseases, suggesting a counterbalance between the beneficial and deleterious effects of the immune response.

  9. Organization of an optimal adaptive immune system

    Science.gov (United States)

    Walczak, Aleksandra; Mayer, Andreas; Balasubramanian, Vijay; Mora, Thierry

    The repertoire of lymphocyte receptors in the adaptive immune system protects organisms from a diverse set of pathogens. A well-adapted repertoire should be tuned to the pathogenic environment to reduce the cost of infections. I will discuss a general framework for predicting the optimal repertoire that minimizes the cost of infections contracted from a given distribution of pathogens. The theory predicts that the immune system will have more receptors for rare antigens than expected from the frequency of encounters and individuals exposed to the same infections will have sparse repertoires that are largely different, but nevertheless exploit cross-reactivity to provide the same coverage of antigens. I will show that the optimal repertoires can be reached by dynamics that describes the competitive binding of antigens by receptors, and selective amplification of stimulated receptors.

  10. Type 2 immunity and wound healing: evolutionary refinement of adaptive immunity by helminths

    Science.gov (United States)

    Gause, William C.; Wynn, Thomas A.; Allen, Judith E.

    2013-01-01

    Helminth-induced type 2 immune responses, which are characterized by the T helper 2 cell-associated cytokines interleukin-4 (IL-4) and IL-13, mediate host protection through enhanced tissue repair, the control of inflammation and worm expulsion. In this Opinion article, we consider type 2 immunity in the context of helminth-mediated tissue damage. We examine the relationship between the control of helminth infection and the mechanisms of wound repair, and we provide a new understanding of the adaptive type 2 immune response and its contribution to both host tolerance and resistance. PMID:23827958

  11. Necroptotic signaling in adaptive and innate immunity.

    Science.gov (United States)

    Lu, Jennifer V; Chen, Helen C; Walsh, Craig M

    2014-11-01

    The vertebrate immune system is highly dependent on cell death for efficient responsiveness to microbial pathogens and oncogenically transformed cells. Cell death pathways are vital to the function of many immune cell types during innate, humoral and cellular immune responses. In addition, cell death regulation is imperative for proper adaptive immune self-tolerance and homeostasis. While apoptosis has been found to be involved in several of these roles in immunity, recent data demonstrate that alternative cell death pathways are required. Here, we describe the involvement of a programmed form of cellular necrosis called "necroptosis" in immunity. We consider the signaling pathways that promote necroptosis downstream of death receptors, type I transmembrane proteins of the tumor necrosis factor (TNF) receptor family. The involvement of necroptotic signaling through a "RIPoptosome" assembled in response to innate immune stimuli or genotoxic stress is described. We also characterize the induction of necroptosis following antigenic stimulation in T cells lacking caspase-8 or FADD function. While necroptotic signaling remains poorly understood, it is clear that this pathway is an essential component to effective vertebrate immunity. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Convergence of the innate and adaptive immunity during human aging

    Directory of Open Access Journals (Sweden)

    Branca Isabel Pereira

    2016-11-01

    Full Text Available Aging is associated with profound changes in the human immune system, a phenomenon referred to as immunosenescence. This complex immune remodeling affects the adaptive immune system and the CD8+ T cell compartment in particular, leading to the accumulation of terminally differentiated T cells, which can rapidly exert their effector functions at the expenses of a limited proliferative potential. In this review we will discuss evidence suggesting that senescent αβCD8+ T cells acquire the hallmarks of innate-like T cells and use recently acquired NK cell receptors as an alternative mechanism to mediate rapid effector functions. These cells concomitantly lose expression of co-stimulatory receptors and exhibit decreased TCR signaling suggesting a functional shift away from antigen specific activation. The convergence of innate and adaptive features in senescent T cells challenges the classic division between innate and adaptive immune systems. Innate-like T cells are particularly important for stress and tumor surveillance and we propose a new role for these cells in aging, where the acquisition of innate-like functions may represent a beneficial adaptation to an increased burden of malignancy with age, although it may also pose a higher risk of autoimmune disorders.

  13. Genetic adaptation of the antibacterial human innate immunity network

    Directory of Open Access Journals (Sweden)

    Lazarus Ross

    2011-07-01

    Full Text Available Abstract Background Pathogens have represented an important selective force during the adaptation of modern human populations to changing social and other environmental conditions. The evolution of the immune system has therefore been influenced by these pressures. Genomic scans have revealed that immune system is one of the functions enriched with genes under adaptive selection. Results Here, we describe how the innate immune system has responded to these challenges, through the analysis of resequencing data for 132 innate immunity genes in two human populations. Results are interpreted in the context of the functional and interaction networks defined by these genes. Nucleotide diversity is lower in the adaptors and modulators functional classes, and is negatively correlated with the centrality of the proteins within the interaction network. We also produced a list of candidate genes under positive or balancing selection in each population detected by neutrality tests and showed that some functional classes are preferential targets for selection. Conclusions We found evidence that the role of each gene in the network conditions the capacity to evolve or their evolvability: genes at the core of the network are more constrained, while adaptation mostly occurred at particular positions at the network edges. Interestingly, the functional classes containing most of the genes with signatures of balancing selection are involved in autoinflammatory and autoimmune diseases, suggesting a counterbalance between the beneficial and deleterious effects of the immune response.

  14. Aberrant Pregnancy Adaptations in the Peripheral Immune Response in Type 1 Diabetes: A Rat Model.

    Directory of Open Access Journals (Sweden)

    Bart Groen

    Full Text Available Despite tight glycemic control, pregnancy complication rate in type 1 diabetes patients is higher than in normal pregnancy. Other etiological factors may be responsible for the development of adverse pregnancy outcome. Acceptance of the semi-allogeneic fetus is accompanied by adaptations in the maternal immune-response. Maladaptations of the immune-response has been shown to contribute to pregnancy complications. We hypothesized that type 1 diabetes, as an autoimmune disease, may be associated with maladaptations of the immune-response to pregnancy, possibly resulting in pregnancy complications.We studied pregnancy outcome and pregnancy-induced immunological adaptations in a normoglycemic rat-model of type 1 diabetes, i.e. biobreeding diabetes-prone rats (BBDP; 5 non-pregnant rats, 7 pregnant day 10 rats and 6 pregnant day 18 rats , versus non-diabetic control rats (i.e. congenic non-diabetic biobreeding diabetes-resistant (BBDR; 6 non-pregnant rats, 6 pregnant day 10 rats and 6 pregnant day 18 rats and Wistar-rats (6 non-pregnant, 6 pregnant day 10 rats and 5 pregnant day 18 rats.We observed reduced litter size, lower fetal weight of viable fetuses and increased numbers of resorptions versus control rats. These complications are accompanied by various differences in the immune-response between BBDP and control rats in both pregnant and non-pregnant animals. The immune-response in non-pregnant BBDP-rats was characterized by decreased percentages of lymphocytes, increased percentages of effector T-cells, regulatory T-cells and natural killer cells, an increased Th1/Th2-ratio and activated monocytes versus Wistar and BBDR-rats. Furthermore, pregnancy-induced adaptations in BBDP-rats coincided with an increased Th1/Th2-ratio, a decreased mean fluorescence intensity CD161a/NKR-P1b ratio and no further activation of monocytes versus non-diabetic control rats.This study suggests that even in the face of strict normoglycemia, pregnancy complications

  15. Adaptive immunity to rhinoviruses: sex and age matter

    Directory of Open Access Journals (Sweden)

    Pritchard Antonia L

    2010-12-01

    Full Text Available Abstract Background Rhinoviruses (RV are key triggers in acute asthma exacerbations. Previous studies suggest that men suffer from infectious diseases more frequently and with greater severity than women. Additionally, the immune response to most infections and vaccinations decreases with age. Most immune function studies do not account for such differences, therefore the aim of this study was to determine if the immune response to rhinovirus varies with sex or age. Methods Blood mononuclear cells were isolated from 63 healthy individuals and grouped by sex and age (≤50 years old and ≥52 years old. Cells were cultured with rhinovirus 16 at a multiplicity of infection of 1. The chemokine IP-10 was measured at 24 h as an index of innate immunity while IFNγ and IL-13 were measured at 5 days as an index of adaptive immunity. Results Rhinovirus induced IFNγ and IL-13 was significantly higher in ≤50 year old women than in age matched men (p 0.005. There was no sex or age based difference in rhinovirus induced IP-10 expression. Both IFNγ and IL-13 were negatively correlated with age in women but not in men. Conclusions This study suggests that pre-menopausal women have a stronger adaptive immune response to rhinovirus infection than men and older people, though the mechanisms responsible for these differences remain to be determined. Our findings highlight the importance of gender and age balance in clinical studies and in the development of new treatments and vaccines.

  16. Parser Adaptation for Social Media by Integrating Normalization

    NARCIS (Netherlands)

    van der Goot, Rob; van Noord, Gerardus

    This work explores normalization for parser adaptation. Traditionally, normalization is used as separate pre-processing step. We show that integrating the normalization model into the parsing algorithm is beneficial. This way, multiple normalization candidates can be leveraged, which improves

  17. The role of adaptive immunity as an ecological filter on the gut microbiota in zebrafish.

    Science.gov (United States)

    Stagaman, Keaton; Burns, Adam R; Guillemin, Karen; Bohannan, Brendan Jm

    2017-07-01

    All animals live in intimate association with communities of microbes, collectively referred to as their microbiota. Certain host traits can influence which microbial taxa comprise the microbiota. One potentially important trait in vertebrate animals is the adaptive immune system, which has been hypothesized to act as an ecological filter, promoting the presence of some microbial taxa over others. Here we surveyed the intestinal microbiota of 68 wild-type zebrafish, with functional adaptive immunity, and 61 rag1 - zebrafish, lacking functional B- and T-cell receptors, to test the role of adaptive immunity as an ecological filter on the intestinal microbiota. In addition, we tested the robustness of adaptive immunity's filtering effects to host-host interaction by comparing the microbiota of fish populations segregated by genotype to those containing both genotypes. The presence of adaptive immunity individualized the gut microbiota and decreased the contributions of neutral processes to gut microbiota assembly. Although mixing genotypes led to increased phylogenetic diversity in each, there was no significant effect of adaptive immunity on gut microbiota composition in either housing condition. Interestingly, the most robust effect on microbiota composition was co-housing within a tank. In all, these results suggest that adaptive immunity has a role as an ecological filter of the zebrafish gut microbiota, but it can be overwhelmed by other factors, including transmission of microbes among hosts.

  18. Diverse Roles of Inhibitor of Differentiation 2 in Adaptive Immunity

    Directory of Open Access Journals (Sweden)

    Lucille Rankin

    2011-01-01

    Full Text Available The helix-loop-helix (HLH transcription factor inhibitor of DNA binding 2 (Id2 has been implicated as a regulator of hematopoiesis and embryonic development. While its role in early lymphopoiesis has been well characterized, new roles in adaptive immune responses have recently been uncovered opening exciting new directions for investigation. In the innate immune system, Id2 is required for the development of mature natural killer (NK cells, lymphoid tissue-inducer (LTi cells, and the recently identified interleukin (IL-22 secreting nonconventional innate lymphocytes found in the gut. In addition, Id2 has been implicated in the development of specific dendritic cell (DC subsets, decisions determining the formation of αβ and γδ T-cell development, NK T-cell behaviour, and in the maintenance of effector and memory CD8+ T cells in peripheral tissues. Here, we review the current understanding of the role of Id2 in lymphopoiesis and in the development of the adaptive immune response required for maintaining immune homeostasis and immune protection.

  19. Chronic grouped social restriction triggers long-lasting immune system adaptations.

    Science.gov (United States)

    Tian, Rui; Hou, Gonglin; Song, Liuwei; Zhang, Jianming; Yuan, Ti-Fei

    2017-05-16

    Chronic stress triggers rigorous psychological and physiological changes, including immunological system adaptations. However, the effects of long-term social restriction on human immune system have not been investigated. The present study is to investigate the effect of chronic stress on immune changes in human blood, with the stress stimuli controlled.10 male volunteers were group isolated from the modern society in a 50-meter-square room for 150 days, with enriched nutrition and good living conditions provided. Serum examination of immune system markers demonstrated numerous changes in different aspects of the immune functions. The changes were observed as early as 30 days and could last for another 150 days after the termination of the restriction period (300 days' time point). The results strongly argued for the adaptation of immunological system under chronic social restriction stress in adult human, preceding a clear change in psychological conditions. The changes of these immune system factors could as well act as the serum biomarkers in clinical early-diagnosis of stress-related disorders.

  20. Let's Tie the Knot: Marriage of Complement and Adaptive Immunity in Pathogen Evasion, for Better or Worse.

    Science.gov (United States)

    Bennett, Kaila M; Rooijakkers, Suzan H M; Gorham, Ronald D

    2017-01-01

    The complement system is typically regarded as an effector arm of innate immunity, leading to recognition and killing of microbial invaders in body fluids. Consequently, pathogens have engaged in an arms race, evolving molecules that can interfere with proper complement responses. However, complement is no longer viewed as an isolated system, and links with other immune mechanisms are continually being discovered. Complement forms an important bridge between innate and adaptive immunity. While its roles in innate immunity are well-documented, its function in adaptive immunity is less characterized. Therefore, it is no surprise that the field of pathogenic complement evasion has focused on blockade of innate effector functions, while potential inhibition of adaptive immune responses (via complement) has been overlooked to a certain extent. In this review, we highlight past and recent developments on the involvement of complement in the adaptive immune response. We discuss the mechanisms by which complement aids in lymphocyte stimulation and regulation, as well as in antigen presentation. In addition, we discuss microbial complement evasion strategies, and highlight specific examples in the context of adaptive immune responses. These emerging ties between complement and adaptive immunity provide a catalyst for future discovery in not only the field of adaptive immune evasion but in elucidating new roles of complement.

  1. Viral Diversity Threshold for Adaptive Immunity in Prokaryotes

    Science.gov (United States)

    Weinberger, Ariel D.; Wolf, Yuri I.; Lobkovsky, Alexander E.; Gilmore, Michael S.; Koonin, Eugene V.

    2012-01-01

    ABSTRACT Bacteria and archaea face continual onslaughts of rapidly diversifying viruses and plasmids. Many prokaryotes maintain adaptive immune systems known as clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated genes (Cas). CRISPR-Cas systems are genomic sensors that serially acquire viral and plasmid DNA fragments (spacers) that are utilized to target and cleave matching viral and plasmid DNA in subsequent genomic invasions, offering critical immunological memory. Only 50% of sequenced bacteria possess CRISPR-Cas immunity, in contrast to over 90% of sequenced archaea. To probe why half of bacteria lack CRISPR-Cas immunity, we combined comparative genomics and mathematical modeling. Analysis of hundreds of diverse prokaryotic genomes shows that CRISPR-Cas systems are substantially more prevalent in thermophiles than in mesophiles. With sequenced bacteria disproportionately mesophilic and sequenced archaea mostly thermophilic, the presence of CRISPR-Cas appears to depend more on environmental temperature than on bacterial-archaeal taxonomy. Mutation rates are typically severalfold higher in mesophilic prokaryotes than in thermophilic prokaryotes. To quantitatively test whether accelerated viral mutation leads microbes to lose CRISPR-Cas systems, we developed a stochastic model of virus-CRISPR coevolution. The model competes CRISPR-Cas-positive (CRISPR-Cas+) prokaryotes against CRISPR-Cas-negative (CRISPR-Cas−) prokaryotes, continually weighing the antiviral benefits conferred by CRISPR-Cas immunity against its fitness costs. Tracking this cost-benefit analysis across parameter space reveals viral mutation rate thresholds beyond which CRISPR-Cas cannot provide sufficient immunity and is purged from host populations. These results offer a simple, testable viral diversity hypothesis to explain why mesophilic bacteria disproportionately lack CRISPR-Cas immunity. More generally, fundamental limits on the adaptability of biological

  2. Deficiency of adaptive immunity does not interfere with Wallerian degeneration.

    Directory of Open Access Journals (Sweden)

    Christopher R Cashman

    Full Text Available Following injury, distal axons undergo the process of Wallerian degeneration, and then cell debris is cleared to create a permissive environment for axon regeneration. The innate and adaptive immune systems are believed to be critical for facilitating the clearance of myelin and axonal debris during this process. However, immunodeficient animal models are regularly used in transplantation studies investigating cell therapies to modulate the degenerative/regenerative response. Given the importance of the immune system in preparing a permissive environment for regeneration by clearing debris, animals lacking, in part or in full, a functional immune system may have an impaired ability to regenerate due to poor myelin clearance, and may, thus, be poor hosts to study modulators of regeneration and degeneration. To study this hypothesis, three different mouse models with impaired adaptive immunity were compared to wild type animals in their ability to degenerate axons and clear myelin debris one week following sciatic nerve transection. Immunofluorescent staining for axons and quantitation of axon density with nerve histomorphometry of the distal stump showed no consistent discrepancy between immunodeficient and wild type animals, suggesting axons tended to degenerate equally between the two groups. Debris clearance was assessed by macrophage density and relative myelin basic protein expression within the denervated nerve stump, and no consistent impairment of debris clearance was found. These data suggested deficiency of the adaptive immune system does not have a substantial effect on axon degeneration one week following axonal injury.

  3. Evasion of adaptive and innate immune response mechanisms by γ-herpesviruses

    Science.gov (United States)

    Feng, Pinghui; Moses, Ashlee; Früh, Klaus

    2015-01-01

    γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies. PMID:23735334

  4. Let’s Tie the Knot: Marriage of Complement and Adaptive Immunity in Pathogen Evasion, for Better or Worse

    Science.gov (United States)

    Bennett, Kaila M.; Rooijakkers, Suzan H. M.; Gorham, Ronald D.

    2017-01-01

    The complement system is typically regarded as an effector arm of innate immunity, leading to recognition and killing of microbial invaders in body fluids. Consequently, pathogens have engaged in an arms race, evolving molecules that can interfere with proper complement responses. However, complement is no longer viewed as an isolated system, and links with other immune mechanisms are continually being discovered. Complement forms an important bridge between innate and adaptive immunity. While its roles in innate immunity are well-documented, its function in adaptive immunity is less characterized. Therefore, it is no surprise that the field of pathogenic complement evasion has focused on blockade of innate effector functions, while potential inhibition of adaptive immune responses (via complement) has been overlooked to a certain extent. In this review, we highlight past and recent developments on the involvement of complement in the adaptive immune response. We discuss the mechanisms by which complement aids in lymphocyte stimulation and regulation, as well as in antigen presentation. In addition, we discuss microbial complement evasion strategies, and highlight specific examples in the context of adaptive immune responses. These emerging ties between complement and adaptive immunity provide a catalyst for future discovery in not only the field of adaptive immune evasion but in elucidating new roles of complement. PMID:28197139

  5. Targeting innate immunity to downmodulate adaptive immunity and reverse type 1 diabetes

    Directory of Open Access Journals (Sweden)

    Itoh A

    2017-05-01

    Full Text Available Arata Itoh, William M Ridgway Division of Immunology, Allergy and Rheumatology, University of Cincinnati College of Medicine, Cincinnati, OH, USA Abstract: Type 1 diabetes (T1D is characterized by specific destruction of pancreatic insulin-producing beta cells accompanied by evidence of beta-cell-directed autoimmunity such as autoreactive T cells and islet autoantibodies (IAAs. Currently, T1D cannot be prevented or reversed in humans. T1D is easy to prevent in the nonobese diabetic (NOD spontaneous mouse model but reversing new-onset T1D in mice is more difficult. Since the discovery of the T-cell receptor in the 1980s and the subsequent identification of autoreactive T cells directed toward beta-cell antigens (eg, insulin, glutamic acid decarboxylase, the dream of antigen-specific immunotherapy has dominated the field with its promise of specificity and limited side effects. While such approaches have worked in the NOD mouse, however, dozens of human trials have failed. Broader immunosuppressive approaches (originally cyclosporine, subsequently anti-CD3 antibody have shown partial successes (e.g., prolonged C peptide preservation but no major therapeutic efficacy or disease reversal. Human prevention trials have failed, despite the ease of such approaches in the NOD mouse. In the past 50 years, the incidence of T1D has increased dramatically, and one explanation is the “hygiene hypothesis”, which suggests that decreased exposure of the innate immune system to environmental immune stimulants (e.g., bacterial products such as Toll-like receptor (TLR 4-stimulating lipopolysaccharide [LPS] dramatically affects the adaptive immune system and increases subsequent autoimmunity. We have tested the role of innate immunity in autoimmune T1D by treating acute-onset T1D in NOD mice with anti-TLR4/MD-2 agonistic antibodies and have shown a high rate of disease reversal. The TLR4 antibodies do not directly stimulate T cells but induce tolerogenic

  6. Masturbation, sexuality, and adaptation: normalization in adolescence.

    Science.gov (United States)

    Shapiro, Theodore

    2008-03-01

    During adolescence the central masturbation fantasy that is formulated during childhood takes its final form and paradoxically must now be directed outward for appropriate object finding and pair matching in the service of procreative aims. This is a step in adaptation that requires a further developmental landmark that I have called normalization. The path toward airing these private fantasies is facilitated by chumship relationships as a step toward further exposure to the social surround. Hartmann's structuring application of adaptation within psychoanalysis is used as a framework for understanding the process that simultaneously serves intrapsychic and social demands and permits goals that follow evolutionary principles. Variations in the normalization process from masturbatory isolation to a variety of forms of sexual socialization are examined in sociological data concerning current adolescent sexual behavior and in case examples that indicate some routes to normalized experience and practice.

  7. Genes of the major histocompatibility complex highlight interactions of the innate and adaptive immune system

    Directory of Open Access Journals (Sweden)

    Barbara Lukasch

    2017-08-01

    Full Text Available Background A well-functioning immune defence is crucial for fitness, but our knowledge about the immune system and its complex interactions is still limited. Major histocompatibility complex (MHC molecules are involved in T-cell mediated adaptive immune responses, but MHC is also highly upregulated during the initial innate immune response. The aim of our study was therefore to determine to what extent the highly polymorphic MHC is involved in interactions of the innate and adaptive immune defence and if specific functional MHC alleles (FA or heterozygosity at the MHC are more important. Methods To do this we used captive house sparrows (Passer domesticus to survey MHC diversity and immune function controlling for several environmental factors. MHC class I alleles were identified using parallel amplicon sequencing and to mirror immune function, several immunological tests that correspond to the innate and adaptive immunity were conducted. Results Our results reveal that MHC was linked to all immune tests, highlighting its importance for the immune defence. While all innate responses were associated with one single FA, adaptive responses (cell-mediated and humoral were associated with several different alleles. Discussion We found that repeated injections of an antibody in nestlings and adults were linked to different FA and hence might affect different areas of the immune system. Also, individuals with a higher number of different FA produced a smaller secondary response, indicating a disadvantage of having numerous MHC alleles. These results demonstrate the complexity of the immune system in relation to the MHC and lay the foundation for other studies to further investigate this topic.

  8. Genes of the major histocompatibility complex highlight interactions of the innate and adaptive immune system.

    Science.gov (United States)

    Lukasch, Barbara; Westerdahl, Helena; Strandh, Maria; Winkler, Hans; Moodley, Yoshan; Knauer, Felix; Hoi, Herbert

    2017-01-01

    A well-functioning immune defence is crucial for fitness, but our knowledge about the immune system and its complex interactions is still limited. Major histocompatibility complex (MHC) molecules are involved in T-cell mediated adaptive immune responses, but MHC is also highly upregulated during the initial innate immune response. The aim of our study was therefore to determine to what extent the highly polymorphic MHC is involved in interactions of the innate and adaptive immune defence and if specific functional MHC alleles (FA) or heterozygosity at the MHC are more important. To do this we used captive house sparrows ( Passer domesticus ) to survey MHC diversity and immune function controlling for several environmental factors. MHC class I alleles were identified using parallel amplicon sequencing and to mirror immune function, several immunological tests that correspond to the innate and adaptive immunity were conducted. Our results reveal that MHC was linked to all immune tests, highlighting its importance for the immune defence. While all innate responses were associated with one single FA, adaptive responses (cell-mediated and humoral) were associated with several different alleles. We found that repeated injections of an antibody in nestlings and adults were linked to different FA and hence might affect different areas of the immune system. Also, individuals with a higher number of different FA produced a smaller secondary response, indicating a disadvantage of having numerous MHC alleles. These results demonstrate the complexity of the immune system in relation to the MHC and lay the foundation for other studies to further investigate this topic.

  9. Adaptive nonlinear control using input normalized neural networks

    International Nuclear Information System (INIS)

    Leeghim, Henzeh; Seo, In Ho; Bang, Hyo Choong

    2008-01-01

    An adaptive feedback linearization technique combined with the neural network is addressed to control uncertain nonlinear systems. The neural network-based adaptive control theory has been widely studied. However, the stability analysis of the closed-loop system with the neural network is rather complicated and difficult to understand, and sometimes unnecessary assumptions are involved. As a result, unnecessary assumptions for stability analysis are avoided by using the neural network with input normalization technique. The ultimate boundedness of the tracking error is simply proved by the Lyapunov stability theory. A new simple update law as an adaptive nonlinear control is derived by the simplification of the input normalized neural network assuming the variation of the uncertain term is sufficiently small

  10. Regionalized Development and Maintenance of the Intestinal Adaptive Immune Landscape

    DEFF Research Database (Denmark)

    Agace, William Winston; McCoy, Kathy D.

    2017-01-01

    The intestinal immune system has the daunting task of protecting us from pathogenic insults while limiting inflammatory responses against the resident commensal microbiota and providing tolerance to food antigens. This role is particularly impressive when one considers the vast mucosal surface...... and changing landscape that the intestinal immune system must monitor. In this review, we highlight regional differences in the development and composition of the adaptive immune landscape of the intestine and the impact of local intrinsic and environmental factors that shape this process. To conclude, we...... review the evidence for a critical window of opportunity for early-life exposures that affect immune development and alter disease susceptibility later in life....

  11. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

    1987-01-01

    The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

  12. Triggering the adaptive immune system with commensal gut bacteria protects against insulin resistance and dysglycemia

    Directory of Open Access Journals (Sweden)

    Céline Pomié

    2016-06-01

    Full Text Available Objective: To demonstrate that glycemia and insulin resistance are controlled by a mechanism involving the adaptive immune system and gut microbiota crosstalk. Methods: We triggered the immune system with microbial extracts specifically from the intestinal ileum contents of HFD-diabetic mice by the process of immunization. 35 days later, immunized mice were fed a HFD for up to two months in order to challenge the development of metabolic features. The immune responses were quantified. Eventually, adoptive transfer of immune cells from the microbiota-immunized mice to naïve mice was performed to demonstrate the causality of the microbiota-stimulated adaptive immune system on the development of metabolic disease. The gut microbiota of the immunized HFD-fed mice was characterized in order to demonstrate whether the manipulation of the microbiota to immune system interaction reverses the causal deleterious effect of gut microbiota dysbiosis on metabolic disease. Results: Subcutaneous injection (immunization procedure of ileum microbial extracts prevented hyperglycemia and insulin resistance in a dose-dependent manner in response to a HFD. The immunization enhanced the proliferation of CD4 and CD8 T cells in lymphoid organs, also increased cytokine production and antibody secretion. As a mechanism explaining the metabolic improvement, the immunization procedure reversed gut microbiota dysbiosis. Finally, adoptive transfer of immune cells from immunized mice improved metabolic features in response to HFD. Conclusions: Glycemia and insulin sensitivity can be regulated by triggering the adaptive immunity to microbiota interaction. This reduces the gut microbiota dysbiosis induced by a fat-enriched diet. Keywords: Gut microbiota and metabolic diseases, Immunity, Insulin resistance

  13. Multi-user cognitive radio network resource allocation based on the adaptive niche immune genetic algorithm

    International Nuclear Information System (INIS)

    Zu Yun-Xiao; Zhou Jie

    2012-01-01

    Multi-user cognitive radio network resource allocation based on the adaptive niche immune genetic algorithm is proposed, and a fitness function is provided. Simulations are conducted using the adaptive niche immune genetic algorithm, the simulated annealing algorithm, the quantum genetic algorithm and the simple genetic algorithm, respectively. The results show that the adaptive niche immune genetic algorithm performs better than the other three algorithms in terms of the multi-user cognitive radio network resource allocation, and has quick convergence speed and strong global searching capability, which effectively reduces the system power consumption and bit error rate. (geophysics, astronomy, and astrophysics)

  14. An Immune-inspired Adaptive Automated Intrusion Response System Model

    Directory of Open Access Journals (Sweden)

    Ling-xi Peng

    2012-09-01

    Full Text Available An immune-inspired adaptive automated intrusion response system model, named as , is proposed. The descriptions of self, non-self, immunocyte, memory detector, mature detector and immature detector of the network transactions, and the realtime network danger evaluation equations are given. Then, the automated response polices are adaptively performed or adjusted according to the realtime network danger. Thus, not only accurately evaluates the network attacks, but also greatly reduces the response times and response costs.

  15. TIPE2, a negative regulator of innate and adaptive immunity that maintains immune homeostasis.

    Science.gov (United States)

    Sun, Honghong; Gong, Shunyou; Carmody, Ruaidhri J; Hilliard, Anja; Li, Li; Sun, Jing; Kong, Li; Xu, Lingyun; Hilliard, Brendan; Hu, Shimin; Shen, Hao; Yang, Xiaolu; Chen, Youhai H

    2008-05-02

    Immune homeostasis is essential for the normal functioning of the immune system, and its breakdown leads to fatal inflammatory diseases. We report here the identification of a member of the tumor necrosis factor-alpha-induced protein-8 (TNFAIP8) family, designated TIPE2, that is required for maintaining immune homeostasis. TIPE2 is preferentially expressed in lymphoid tissues, and its deletion in mice leads to multiorgan inflammation, splenomegaly, and premature death. TIPE2-deficient animals are hypersensitive to septic shock, and TIPE2-deficient cells are hyper-responsive to Toll-like receptor (TLR) and T cell receptor (TCR) activation. Importantly, TIPE2 binds to caspase-8 and inhibits activating protein-1 and nuclear factor-kappaB activation while promoting Fas-induced apoptosis. Inhibiting caspase-8 significantly blocks the hyper-responsiveness of TIPE2-deficient cells. These results establish that TIPE2 is an essential negative regulator of TLR and TCR function, and its selective expression in the immune system prevents hyperresponsiveness and maintains immune homeostasis.

  16. Autologous Stem Cell Transplantation Disrupts Adaptive Immune Responses during Rebound Simian/Human Immunodeficiency Virus Viremia.

    Science.gov (United States)

    Reeves, Daniel B; Peterson, Christopher W; Kiem, Hans-Peter; Schiffer, Joshua T

    2017-07-01

    Primary HIV-1 infection induces a virus-specific adaptive/cytolytic immune response that impacts the plasma viral load set point and the rate of progression to AIDS. Combination antiretroviral therapy (cART) suppresses plasma viremia to undetectable levels that rebound upon cART treatment interruption. Following cART withdrawal, the memory component of the virus-specific adaptive immune response may improve viral control compared to primary infection. Here, using primary infection and treatment interruption data from macaques infected with simian/human immunodeficiency virus (SHIV), we observe a lower peak viral load but an unchanged viral set point during viral rebound. The addition of an autologous stem cell transplant before cART withdrawal alters viral dynamics: we found a higher rebound set point but similar peak viral loads compared to the primary infection. Mathematical modeling of the data that accounts for fundamental immune parameters achieves excellent fit to heterogeneous viral loads. Analysis of model output suggests that the rapid memory immune response following treatment interruption does not ultimately lead to better viral containment. Transplantation decreases the durability of the adaptive immune response following cART withdrawal and viral rebound. Our model's results highlight the impact of the endogenous adaptive immune response during primary SHIV infection. Moreover, because we capture adaptive immune memory and the impact of transplantation, this model will provide insight into further studies of cure strategies inspired by the Berlin patient. IMPORTANCE HIV patients who interrupt combination antiretroviral therapy (cART) eventually experience viral rebound, the return of viral loads to pretreatment levels. However, the "Berlin patient" remained free of HIV rebound over a decade after stopping cART. His cure is attributed to leukemia treatment that included an HIV-resistant stem cell transplant. Inspired by this case, we studied the impact

  17. No evidence of local adaptation of immune responses to Gyrodactylus in three-spined stickleback (Gasterosteus aculeatus).

    Science.gov (United States)

    Robertson, Shaun; Bradley, Janette E; MacColl, Andrew D C

    2017-01-01

    Parasitism represents one of the most widespread lifestyles in the animal kingdom, with the potential to drive coevolutionary dynamics with their host population. Where hosts and parasites evolve together, we may find local adaptation. As one of the main host defences against infection, there is the potential for the immune response to be adapted to local parasites. In this study, we used the three-spined stickleback and its Gyrodactylus parasites to examine the extent of local adaptation of parasite infection dynamics and the immune response to infection. We took two geographically isolated host populations infected with two distinct Gyrodactylus species and performed a reciprocal cross-infection experiment in controlled laboratory conditions. Parasite burdens were monitored over the course of the infection, and individuals were sampled at multiple time points for immune gene expression analysis. We found large differences in virulence between parasite species, irrespective of host, and maladaptation of parasites to their sympatric host. The immune system responded to infection, with a decrease in expression of innate and Th1-type adaptive response genes in fish infected with the less virulent parasite, representing a marker of a possible resistance mechanism. There was no evidence of local adaptation in immune gene expression levels. Our results add to the growing understanding of the extent of host-parasite local adaptation, and demonstrate a systemic immune response during infection with a common ectoparasite. Further immunological studies using the stickleback-Gyrodactylus system can continue to contribute to our understanding of the function of the immune response in natural populations. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Staphylococcal Immune Evasion Proteins: Structure, Function, and Host Adaptation.

    Science.gov (United States)

    Koymans, Kirsten J; Vrieling, Manouk; Gorham, Ronald D; van Strijp, Jos A G

    2017-01-01

    Staphylococcus aureus is a successful human and animal pathogen. Its pathogenicity is linked to its ability to secrete a large amount of virulence factors. These secreted proteins interfere with many critical components of the immune system, both innate and adaptive, and hamper proper immune functioning. In recent years, numerous studies have been conducted in order to understand the molecular mechanism underlying the interaction of evasion molecules with the host immune system. Structural studies have fundamentally contributed to our understanding of the mechanisms of action of the individual factors. Furthermore, such studies revealed one of the most striking characteristics of the secreted immune evasion molecules: their conserved structure. Despite high-sequence variability, most immune evasion molecules belong to a small number of structural categories. Another remarkable characteristic is that S. aureus carries most of these virulence factors on mobile genetic elements (MGE) or ex-MGE in its accessory genome. Coevolution of pathogen and host has resulted in immune evasion molecules with a highly host-specific function and prevalence. In this review, we explore how these shared structures and genomic locations relate to function and host specificity. This is discussed in the context of therapeutic options for these immune evasion molecules in infectious as well as in inflammatory diseases.

  19. Innate and adaptive immune interactions at the fetal-maternal interface in healthy human pregnancy and preeclampsia

    Directory of Open Access Journals (Sweden)

    Peter eHsu

    2014-03-01

    Full Text Available Maternal immune tolerance of the fetus is indispensible for a healthy pregnancy outcome. Nowhere is this immune tolerance more important than at the fetal-maternal interface – the decidua, the site of implantation and placentation. Indeed, many lines of evidence suggest an immunological origin to the common pregnancy-related disorder, preeclampsia. Within the innate immune system, decidual NK cells and antigen presenting cells (including dendritic cells and macrophages make up a large proportion of the decidual leukocyte population, and are thought to modulate vascular remodeling and trophoblast invasion. On the other hand, within the adaptive immune system, Foxp3+ regulatory T (Treg cells are crucial for ensuring immune tolerance towards the semi-allogeneic fetus. Additionally, another population of CD4+HLA-G+ suppressor T cells has also been identified as a potential player in the maintenance of immune tolerance. More recently, studies are beginning to unravel the potential interactions between the innate and the adaptive immune system within the decidua, that are required to maintain a healthy pregnancy. In this review, we discuss the recent advances exploring the complex crosstalk between the innate and the adaptive immune system during human pregnancy.

  20. Evolution of vertebrate adaptive immunity: immune cells and tissues, and AID/APOBEC cytidine deaminases.

    Science.gov (United States)

    Hirano, Masayuki

    2015-08-01

    All surviving jawed vertebrate representatives achieve diversity in immunoglobulin-based B and T cell receptors for antigen recognition through recombinatorial rearrangement of V(D)J segments. However, the extant jawless vertebrates, lampreys and hagfish, instead generate three types of variable lymphocyte receptors (VLRs) through a template-mediated combinatorial assembly of different leucine-rich repeat (LRR) sequences. The clonally diverse VLRB receptors are expressed by B-like lymphocytes, while the VLRA and VLRC receptors are expressed by lymphocyte lineages that resemble αβ and γδ T lymphocytes, respectively. These findings suggest that three basic types of lymphocytes, one B-like and two T-like, are an essential feature of vertebrate adaptive immunity. Around 500 million years ago, a common ancestor of jawed and jawless vertebrates evolved a genetic program for the development of prototypic lymphoid cells as a foundation for an adaptive immune system. This acquisition preceded the convergent evolution of alternative types of clonally diverse receptors for antigens in all vertebrates, as reviewed in this article. © 2015 WILEY Periodicals, Inc.

  1. Inactivated Influenza Vaccine That Provides Rapid, Innate-Immune-System-Mediated Protection and Subsequent Long-Term Adaptive Immunity.

    Science.gov (United States)

    Chua, Brendon Y; Wong, Chinn Yi; Mifsud, Edin J; Edenborough, Kathryn M; Sekiya, Toshiki; Tan, Amabel C L; Mercuri, Francesca; Rockman, Steve; Chen, Weisan; Turner, Stephen J; Doherty, Peter C; Kelso, Anne; Brown, Lorena E; Jackson, David C

    2015-10-27

    The continual threat to global health posed by influenza has led to increased efforts to improve the effectiveness of influenza vaccines for use in epidemics and pandemics. We show in this study that formulation of a low dose of inactivated detergent-split influenza vaccine with a Toll-like receptor 2 (TLR2) agonist-based lipopeptide adjuvant (R4Pam2Cys) provides (i) immediate, antigen-independent immunity mediated by the innate immune system and (ii) significant enhancement of antigen-dependent immunity which exhibits an increased breadth of effector function. Intranasal administration of mice with vaccine formulated with R4Pam2Cys but not vaccine alone provides protection against both homologous and serologically distinct (heterologous) viral strains within a day of administration. Vaccination in the presence of R4Pam2Cys subsequently also induces high levels of systemic IgM, IgG1, and IgG2b antibodies and pulmonary IgA antibodies that inhibit hemagglutination (HA) and neuraminidase (NA) activities of homologous but not heterologous virus. Improved primary virus nucleoprotein (NP)-specific CD8(+) T cell responses are also induced by the use of R4Pam2Cys and are associated with robust recall responses to provide heterologous protection. These protective effects are demonstrated in wild-type and antibody-deficient animals but not in those depleted of CD8(+) T cells. Using a contact-dependent virus transmission model, we also found that heterologous virus transmission from vaccinated mice to naive mice is significantly reduced. These results demonstrate the potential of adding a TLR2 agonist to an existing seasonal influenza vaccine to improve its utility by inducing immediate short-term nonspecific antiviral protection and also antigen-specific responses to provide homologous and heterologous immunity. The innate and adaptive immune systems differ in mechanisms, specificities, and times at which they take effect. The innate immune system responds within hours of

  2. Ebola Virus Altered Innate and Adaptive Immune Response Signalling Pathways: Implications for Novel Therapeutic Approaches.

    Science.gov (United States)

    Kumar, Anoop

    2016-01-01

    Ebola virus (EBOV) arise attention for their impressive lethality by the poor immune response and high inflammatory reaction in the patients. It causes a severe hemorrhagic fever with case fatality rates of up to 90%. The mechanism underlying this lethal outcome is poorly understood. In 2014, a major outbreak of Ebola virus spread amongst several African countries, including Leone, Sierra, and Guinea. Although infections only occur frequently in Central Africa, but the virus has the potential to spread globally. Presently, there is no vaccine or treatment is available to counteract Ebola virus infections due to poor understanding of its interaction with the immune system. Accumulating evidence indicates that the virus actively alters both innate and adaptive immune responses and triggers harmful inflammatory responses. In the literature, some reports have shown that alteration of immune signaling pathways could be due to the ability of EBOV to interfere with dendritic cells (DCs), which link innate and adaptive immune responses. On the other hand, some reports have demonstrated that EBOV, VP35 proteins act as interferon antagonists. So, how the Ebola virus altered the innate and adaptive immune response signaling pathways is still an open question for the researcher to be explored. Thus, in this review, I try to summarize the mechanisms of the alteration of innate and adaptive immune response signaling pathways by Ebola virus which will be helpful for designing effective drugs or vaccines against this lethal infection. Further, potential targets, current treatment and novel therapeutic approaches have also been discussed.

  3. Senescence of the adaptive immune system in health and aging-associated autoimmune disease

    NARCIS (Netherlands)

    van der Geest, Kornelis Stephan Mario

    2015-01-01

    Aging of the immune system may contribute to the development of aging-associated autoimmune diseases, such as giant cell arteritis, polymyalgia rheumatica and rheumatoid arthritis. The aim of this thesis was to identify aging-dependent changes of the adaptive immune system that promote autoimmunity

  4. Dynamics of immune system vulnerabilities

    Science.gov (United States)

    Stromberg, Sean P.

    The adaptive immune system can be viewed as a complex system, which adapts, over time, to reflect the history of infections experienced by the organism. Understanding its operation requires viewing it in terms of tradeoffs under constraints and evolutionary history. It typically displays "robust, yet fragile" behavior, meaning common tasks are robust to small changes but novel threats or changes in environment can have dire consequences. In this dissertation we use mechanistic models to study several biological processes: the immune response, the homeostasis of cells in the lymphatic system, and the process that normally prevents autoreactive cells from entering the lymphatic system. Using these models we then study the effects of these processes interacting. We show that the mechanisms that regulate the numbers of cells in the immune system, in conjunction with the immune response, can act to suppress autoreactive cells from proliferating, thus showing quantitatively how pathogenic infections can suppress autoimmune disease. We also show that over long periods of time this same effect can thin the repertoire of cells that defend against novel threats, leading to an age correlated vulnerability. This vulnerability is shown to be a consequence of system dynamics, not due to degradation of immune system components with age. Finally, modeling a specific tolerance mechanism that normally prevents autoimmune disease, in conjunction with models of the immune response and homeostasis we look at the consequences of the immune system mistakenly incorporating pathogenic molecules into its tolerizing mechanisms. The signature of this dynamic matches closely that of the dengue virus system.

  5. Biogenesis pathways of RNA guides in archaeal and bacterial CRISPR-Cas adaptive immunity

    NARCIS (Netherlands)

    Charpentier, Emmanuelle; Richter, Hagen; Oost, van der John; White, Malcolm F.

    2015-01-01

    CRISPR-Cas is an RNA-mediated adaptive immune system that defends bacteria and archaea against mobile genetic elements. Short mature CRISPR RNAs (crRNAs) are key elements in the interference step of the immune pathway. A CRISPR array composed of a series of repeats interspaced by spacer sequences

  6. Factors of Innate and Adaptive Local Immunity in Children with Primary Deficiencies of Antibody Formation

    Directory of Open Access Journals (Sweden)

    L.I. Chernyshova

    2013-10-01

    Full Text Available In 40 children with various types of primary immunodeficiencies (PID of antibody formation we examined factors of local immunity in saliva. It is found that in the saliva of children with PID of antibody formation in comparison with immunocompetent children the concentration of factors of adaptive immunity is significantly reduced. Lack of adaptive immunity in the PID of antibody formation to some extent is compensated by increased concentrations of innate immune factors on the mucous membranes — the free Sc, as well as lactoferrin in selective immunodeficiency of IgA. At PID of antibody formation we observed increased TNF-α level in the saliva, which may indicate the persistence of local inflammation on the membranes of the respiratory tract.

  7. A locally adaptive normal distribution

    DEFF Research Database (Denmark)

    Arvanitidis, Georgios; Hansen, Lars Kai; Hauberg, Søren

    2016-01-01

    entropy distribution under the given metric. The underlying metric is, however, non-parametric. We develop a maximum likelihood algorithm to infer the distribution parameters that relies on a combination of gradient descent and Monte Carlo integration. We further extend the LAND to mixture models......The multivariate normal density is a monotonic function of the distance to the mean, and its ellipsoidal shape is due to the underlying Euclidean metric. We suggest to replace this metric with a locally adaptive, smoothly changing (Riemannian) metric that favors regions of high local density...

  8. Rationale for combination of therapeutic antibodies targeting tumor cells and immune checkpoint receptors: Harnessing innate and adaptive immunity through IgG1 isotype immune effector stimulation.

    Science.gov (United States)

    Ferris, Robert L; Lenz, Heinz-Josef; Trotta, Anna Maria; García-Foncillas, Jesús; Schulten, Jeltje; Audhuy, François; Merlano, Marco; Milano, Gerard

    2018-02-01

    Immunoglobulin (Ig) G1 antibodies stimulate antibody-dependent cell-mediated cytotoxicity (ADCC). Cetuximab, an IgG1 isotype monoclonal antibody, is a standard-of-care treatment for locally advanced and recurrent and/or metastatic squamous cell carcinoma of the head and neck (SCCHN) and metastatic colorectal cancer (CRC). Here we review evidence regarding the clinical relevance of cetuximab-mediated ADCC and other immune functions and provide a biological rationale concerning why this property positions cetuximab as an ideal partner for immune checkpoint inhibitors (ICIs) and other emerging immunotherapies. We performed a nonsystematic review of available preclinical and clinical data involving cetuximab-mediated immune activity and combination approaches of cetuximab with other immunotherapies, including ICIs, in SCCHN and CRC. Indeed, cetuximab mediates ADCC activity in the intratumoral space and primes adaptive and innate cellular immunity. However, counterregulatory mechanisms may lead to immunosuppressive feedback loops. Accordingly, there is a strong rationale for combining ICIs with cetuximab for the treatment of advanced tumors, as targeting CTLA-4, PD-1, and PD-L1 can ostensibly overcome these immunosuppressive counter-mechanisms in the tumor microenvironment. Moreover, combining ICIs (or other immunotherapies) with cetuximab is a promising strategy for boosting immune response and enhancing response rates and durability of response. Cetuximab immune activity-including, but not limited to, ADCC-provides a strong rationale for its combination with ICIs or other immunotherapies to synergistically and fully mobilize the adaptive and innate immunity against tumor cells. Ongoing prospective studies will evaluate the clinical effect of these combination regimens and their immune effect in CRC and SCCHN and in other indications. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Genome complexity in the coelacanth is reflected in its adaptive immune system

    Science.gov (United States)

    Saha, Nil Ratan; Ota, Tatsuya; Litman, Gary W.; Hansen, John; Parra, Zuly; Hsu, Ellen; Buonocore, Francesco; Canapa, Adriana; Cheng, Jan-Fang; Amemiya, Chris T.

    2014-01-01

    We have analyzed the available genome and transcriptome resources from the coelacanth in order to characterize genes involved in adaptive immunity. Two highly distinctive IgW-encoding loci have been identified that exhibit a unique genomic organization, including a multiplicity of tandemly repeated constant region exons. The overall organization of the IgW loci precludes typical heavy chain class switching. A locus encoding IgM could not be identified either computationally or by using several different experimental strategies. Four distinct sets of genes encoding Ig light chains were identified. This includes a variant sigma-type Ig light chain previously identified only in cartilaginous fishes and which is now provisionally denoted sigma-2. Genes encoding α/β and γ/δ T-cell receptors, and CD3, CD4, and CD8 co-receptors also were characterized. Ig heavy chain variable region genes and TCR components are interspersed within the TCR α/δ locus; this organization previously was reported only in tetrapods and raises questions regarding evolution and functional cooption of genes encoding variable regions. The composition, organization and syntenic conservation of the major histocompatibility complex locus have been characterized. We also identified large numbers of genes encoding cytokines and their receptors, and other genes associated with adaptive immunity. In terms of sequence identity and organization, the adaptive immune genes of the coelacanth more closely resemble orthologous genes in tetrapods than those in teleost fishes, consistent with current phylogenomic interpretations. Overall, the work reported described herein highlights the complexity inherent in the coelacanth genome and provides a rich catalog of immune genes for future investigations.

  10. The activation of the adaptive immune system: cross-talk between antigen-presenting cells, T cells and B cells.

    Science.gov (United States)

    den Haan, Joke M M; Arens, Ramon; van Zelm, Menno C

    2014-12-01

    The adaptive immune system consists of T and B cells that express clonally distributed antigen receptors. To achieve functional adaptive immune responses, antigen-specific T cell populations are stimulated by professional antigen-presenting cells like dendritic cells (DCs), which provide crucial stimulatory signals for efficient expansion and development of effector functions. Antigen-specific B cells receive costimulatory signals from helper T cells to stimulate affinity maturation and isotype switching. Here we elaborate on the interactions between DCs, T cells and B cells, and on the important signals for efficient induction of adaptive immune responses. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Effect of Scoparia dulcis on noise stress induced adaptive immunity and cytokine response in immunized Wistar rats

    Directory of Open Access Journals (Sweden)

    Loganathan Sundareswaran

    2017-01-01

    Conclusion: S. dulcis (SD has normalized and prevented the noise induced changes in cell-mediated and humoral immunity and it could be the presence of anti-stressor and immuno stimulant activity of the plant.

  12. Future targets for immune therapy in colitis?

    DEFF Research Database (Denmark)

    Kristensen, Nanna Ny; Claesson, M H

    2008-01-01

    Crohn's disease and Ulcerative Colitis, collectively termed inflammatory bowel disease (IBD), are chronic inflammatory disorders of the bowel. It is generally accepted that the pathology associated with IBD is characterized by a hyper-reactive immune response in the gut wall directed against...... the commensal intestinal bacterial flora, and that the CD4+ T cells dominate the adaptive immune response. Chemokines are small proteins involved in the guidance of migration of immune cells during normal homeostasis and inflammation. Chemokines have been shown to play a central role in recruiting inflammatory...... cells from congenic normal mice are transplanted into immune deficient mice, which in turn develop a chronic lethal colitis within 1-2 months. By simultaneous transplantation of CD4+CD25+ regulatory T cells (Tregs) it is possible to hinder development of colitis. Thus the model is well suited...

  13. Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response

    Directory of Open Access Journals (Sweden)

    Manns Michael P

    2007-06-01

    Full Text Available Abstract Spontaneous clearance of hepatitis C virus (HCV has frequently been associated with the presence of HCV-specific cellular immunity. However, there had been also reports in chimpanzees demonstrating clearance of HCV-viremia in the absence of significant levels of detectable HCV-specific cellular immune responses. We here report seven asymptomatic acute hepatitis C cases with peak HCV-RNA levels between 300 and 100.000 copies/ml who all cleared HCV-RNA spontaneously. Patients were identified by a systematic screening of 1176 consecutive new incoming offenders in a German young offender institution. Four of the seven patients never developed anti-HCV antibodies and had normal ALT levels throughout follow-up. Transient weak HCV-specific CD4+ T cell responses were detectable in five individuals which did not differ in strength and breadth from age- and sex-matched patients with chronic hepatitis C and long-term recovered patients. In contrast, HCV-specific MHC-class-I-tetramer-positive cells were found in 3 of 4 HLA-A2-positive patients. Thus, these cases highlight that clearance of low levels of HCV viremia is possible in the absence of a strong adaptive immune response which might explain the low seroconversion rate after occupational exposure to HCV.

  14. Porphyromonas gingivalis suppresses adaptive immunity in periodontitis, atherosclerosis, and Alzheimer’s disease

    Directory of Open Access Journals (Sweden)

    Ingar Olsen

    2016-11-01

    Full Text Available Porphyromonas gingivalis, a keystone pathogen in chronic periodontitis, has been found to associate with remote body organ inflammatory pathologies, including atherosclerosis and Alzheimer’s disease (AD. Although P. gingivalis has a plethora of virulence factors, much of its pathogenicity is surprisingly related to the overall immunosuppression of the host. This review focuses on P. gingivalis aiding suppression of the host’s adaptive immune system involving manipulation of cellular immunological responses, specifically T cells and B cells in periodontitis and related conditions. In periodontitis, this bacterium inhibits the synthesis of IL-2 and increases humoral responses. This reduces the inflammatory responses related to T- and B-cell activation, and subsequent IFN-γ secretion by a subset of T cells. The T cells further suppress upregulation of programmed cell death-1 (PD-1-receptor on CD+cells and its ligand PD-L1 on CD11b+-subset of T cells. IL-2 downregulates genes regulated by immune response and induces a cytokine pattern in which the Th17 lineage is favored, thereby modulating the Th17/T-regulatory cell (Treg imbalance. The suppression of IFN-γ-stimulated release of interferon-inducible protein-10 (IP-10 chemokine ligands [ITAC (CXCL11 and Mig (CXCL9] by P. gingivalis capsular serotypes triggers distinct T cell responses and contributes to local immune evasion by release of its outer membrane vesicles. In atherosclerosis, P. gingivalis reduces Tregs, transforms growth factor beta-1 (TGFβ-1, and causes imbalance in the Th17 lineage of the Treg population. In AD, P. gingivalis may affect the blood–brain barrier permeability and inhibit local IFN-γ response by preventing entry of immune cells into the brain. The scarcity of adaptive immune cells in AD neuropathology implies P. gingivalis infection of the brain likely causing impaired clearance of insoluble amyloid and inducing immunosuppression. By the effective manipulation of

  15. Innate and adaptive immune traits are differentially affected by genetic and environmental factors

    Science.gov (United States)

    Mangino, Massimo; Roederer, Mario; Beddall, Margaret H.; Nestle, Frank O.; Spector, Tim D.

    2017-01-01

    The diversity and activity of leukocytes is controlled by genetic and environmental influences to maintain balanced immune responses. However, the relative contribution of environmental compared with genetic factors that affect variations in immune traits is unknown. Here we analyse 23,394 immune phenotypes in 497 adult female twins. 76% of these traits show a predominantly heritable influence, whereas 24% are mostly influenced by environment. These data highlight the importance of shared childhood environmental influences such as diet, infections or microbes in shaping immune homeostasis for monocytes, B1 cells, γδ T cells and NKT cells, whereas dendritic cells, B2 cells, CD4+ T and CD8+ T cells are more influenced by genetics. Although leukocyte subsets are influenced by genetics and environment, adaptive immune traits are more affected by genetics, whereas innate immune traits are more affected by environment. PMID:28054551

  16. Immune Regulation by Self-Recognition

    DEFF Research Database (Denmark)

    Andersen, Mads Hald

    2015-01-01

    Circulating T cells that specifically target normal self-proteins expressed by regulatory immune cells were first described in patients with cancer, but can also be detected in healthy individuals. The adaptive immune system is distinguished for its ability to differentiate between self......-antigens and foreign antigens. Thus, it was remarkable to discover T cells that apparently lacked tolerance to important self-proteins, eg, IDO, PD-L1, and FoxP3, expressed in regulatory immune cells. The ability of self-reactive T cells to react to and eliminate regulatory immune cells can influence general immune...... reactions. This suggests that they may be involved in immune homeostasis. It is here proposed that these T cells should be termed antiregulatory T cells (anti-Tregs). The role of anti-Tregs in immune-regulatory networks may be diverse. For example, pro-inflammatory self-reactive T cells that react...

  17. Strains of bacterial species induce a greatly varied acute adaptive immune response: The contribution of the accessory genome.

    Directory of Open Access Journals (Sweden)

    Uri Sela

    2018-01-01

    Full Text Available A fundamental question in human susceptibility to bacterial infections is to what extent variability is a function of differences in the pathogen species or in individual humans. To focus on the pathogen species, we compared in the same individual the human adaptive T and B cell immune response to multiple strains of two major human pathogens, Staphylococcus aureus and Streptococcus pyogenes. We found wide variability in the acute adaptive immune response induced by various strains of a species, with a unique combination of activation within the two arms of the adaptive response. Further, this was also accompanied by a dramatic difference in the intensity of the specific protective T helper (Th response. Importantly, the same immune response differences induced by the individual strains were maintained across multiple healthy human donors. A comparison of isogenic phage KO strains, demonstrated that of the pangenome, prophages were the major contributor to inter-strain immune heterogeneity, as the T cell response to the remaining "core genome" was noticeably blunted. Therefore, these findings extend and modify the notion of an adaptive response to a pathogenic bacterium, by implying that the adaptive immune response signature of a bacterial species should be defined either per strain or alternatively to the species' 'core genome', common to all of its strains. Further, our results demonstrate that the acquired immune response variation is as wide among different strains within a single pathogenic species as it is among different humans, and therefore may explain in part the clinical heterogeneity observed in patients infected with the same species.

  18. Modulatory Effects of Antibody Replacement Therapy to Innate and Adaptive Immune Cells

    Directory of Open Access Journals (Sweden)

    Isabella Quinti

    2017-06-01

    Full Text Available Intravenous immunoglobulin administered at replacement dosages modulates innate and adaptive immune cells in primary antibody deficiencies (PAD in a different manner to what observed when high dosages are used or when their effect is analyzed by in vitro experimental conditions. The effects seem to be beneficial on innate cells in that dendritic cells maturate, pro-inflammatory monocytes decrease, and neutrophil function is preserved. The effects are less clear on adaptive immune cells. IVIg induced a transient increase of Treg and a long-term increase of CD4 cells. More complex and less understood is the interplay of IVIg with defective B cells of PAD patients. The paucity of data underlies the need of more studies on patients with PAD before drawing conclusions on the in vivo mechanisms of action of IVIg based on in vitro investigations.

  19. Analysis and comparison of immune reactivity in guinea-pigs immunized with equivalent numbers of normal or radiation-attenuated cercariae of Schistosoma mansoni

    International Nuclear Information System (INIS)

    Rogers, M.V.; McLaren, D.J.

    1987-01-01

    Guinea-pigs immunized with equivalent numbers of normal or radiation-attenuated cercariae of Schistosoma mansoni develop close to complete resistance to reinfection at weeks 12 and 4.5 respectively. We here analyse and compare the immune responses induced by the two populations of cercariae. Both radiation-attenuated and normal parasites of S. mansoni elicited an extensive germinal centre response in guinea-pigs by week 4.5 post-immunization. The anti-parasite antibody titre and cytotoxic activity of serum from 4.5-week-vaccinated, or 4.5-week-infected guinea-pigs were approximately equal, but sera from 12-week-infected individuals had high titres of anti-parasite antibody, which promoted significant larvicidal activity in vitro. In all cases, larvicidal activity was mediated by the IgG 2 fraction of the immune serum. Lymphocyte transformation tests conducted on splenic lymphocytes from 4.5-week vaccinated guinea-pigs revealed maximal stimulation against cercarial, 2-week and 3-week worm antigens, whereas spleen cells from 4.5-week-infected guinea-pigs were maximally stimulated by cercarial and 6-week worm antigens. The splenic lymphocyte responses of 12-week infected animals were dramatic against antigens prepared from all life-stages of the parasite. (author)

  20. CRISPR-Cas: evolution of an RNA-based adaptive immunity system in prokaryotes.

    Science.gov (United States)

    Koonin, Eugene V; Makarova, Kira S

    2013-05-01

    The CRISPR-Cas (clustered regularly interspaced short palindromic repeats, CRISPR-associated genes) is an adaptive immunity system in bacteria and archaea that functions via a distinct self-non-self recognition mechanism that is partially analogous to the mechanism of eukaryotic RNA interference (RNAi). The CRISPR-Cas system incorporates fragments of virus or plasmid DNA into the CRISPR repeat cassettes and employs the processed transcripts of these spacers as guide RNAs to cleave the cognate foreign DNA or RNA. The Cas proteins, however, are not homologous to the proteins involved in RNAi and comprise numerous, highly diverged families. The majority of the Cas proteins contain diverse variants of the RNA recognition motif (RRM), a widespread RNA-binding domain. Despite the fast evolution that is typical of the cas genes, the presence of diverse versions of the RRM in most Cas proteins provides for a simple scenario for the evolution of the three distinct types of CRISPR-cas systems. In addition to several proteins that are directly implicated in the immune response, the cas genes encode a variety of proteins that are homologous to prokaryotic toxins that typically possess nuclease activity. The predicted toxins associated with CRISPR-Cas systems include the essential Cas2 protein, proteins of COG1517 that, in addition to a ligand-binding domain and a helix-turn-helix domain, typically contain different nuclease domains and several other predicted nucleases. The tight association of the CRISPR-Cas immunity systems with predicted toxins that, upon activation, would induce dormancy or cell death suggests that adaptive immunity and dormancy/suicide response are functionally coupled. Such coupling could manifest in the persistence state being induced and potentially providing conditions for more effective action of the immune system or in cell death being triggered when immunity fails.

  1. Increased innate and adaptive immune responses in induced sputum of young smokers

    Directory of Open Access Journals (Sweden)

    Agnese Kislina

    2015-01-01

    Conclusions: This study demonstrates that young smokers have early inflammatory changes in their airways that not only initiate nonspecific mechanisms recruiting neutrophils, but also involve specific immune mechanisms with recruitment of T regulatory lymphocytes. The lymphocyte response is probably adaptive.

  2. Meta-Analysis of Maternal and Fetal Transcriptomic Data Elucidates the Role of Adaptive and Innate Immunity in Preterm Birth

    Science.gov (United States)

    Vora, Bianca; Wang, Aolin; Kosti, Idit; Huang, Hongtai; Paranjpe, Ishan; Woodruff, Tracey J.; MacKenzie, Tippi; Sirota, Marina

    2018-01-01

    Preterm birth (PTB) is the leading cause of newborn deaths around the world. Spontaneous preterm birth (sPTB) accounts for two-thirds of all PTBs; however, there remains an unmet need of detecting and preventing sPTB. Although the dysregulation of the immune system has been implicated in various studies, small sizes and irreproducibility of results have limited identification of its role. Here, we present a cross-study meta-analysis to evaluate genome-wide differential gene expression signals in sPTB. A comprehensive search of the NIH genomic database for studies related to sPTB with maternal whole blood samples resulted in data from three separate studies consisting of 339 samples. After aggregating and normalizing these transcriptomic datasets and performing a meta-analysis, we identified 210 genes that were differentially expressed in sPTB relative to term birth. These genes were enriched in immune-related pathways, showing upregulation of innate immunity and downregulation of adaptive immunity in women who delivered preterm. An additional analysis found several of these differentially expressed at mid-gestation, suggesting their potential to be clinically relevant biomarkers. Furthermore, a complementary analysis identified 473 genes differentially expressed in preterm cord blood samples. However, these genes demonstrated downregulation of the innate immune system, a stark contrast to findings using maternal blood samples. These immune-related findings were further confirmed by cell deconvolution as well as upstream transcription and cytokine regulation analyses. Overall, this study identified a strong immune signature related to sPTB as well as several potential biomarkers that could be translated to clinical use.

  3. Meta-Analysis of Maternal and Fetal Transcriptomic Data Elucidates the Role of Adaptive and Innate Immunity in Preterm Birth

    Directory of Open Access Journals (Sweden)

    Bianca Vora

    2018-05-01

    Full Text Available Preterm birth (PTB is the leading cause of newborn deaths around the world. Spontaneous preterm birth (sPTB accounts for two-thirds of all PTBs; however, there remains an unmet need of detecting and preventing sPTB. Although the dysregulation of the immune system has been implicated in various studies, small sizes and irreproducibility of results have limited identification of its role. Here, we present a cross-study meta-analysis to evaluate genome-wide differential gene expression signals in sPTB. A comprehensive search of the NIH genomic database for studies related to sPTB with maternal whole blood samples resulted in data from three separate studies consisting of 339 samples. After aggregating and normalizing these transcriptomic datasets and performing a meta-analysis, we identified 210 genes that were differentially expressed in sPTB relative to term birth. These genes were enriched in immune-related pathways, showing upregulation of innate immunity and downregulation of adaptive immunity in women who delivered preterm. An additional analysis found several of these differentially expressed at mid-gestation, suggesting their potential to be clinically relevant biomarkers. Furthermore, a complementary analysis identified 473 genes differentially expressed in preterm cord blood samples. However, these genes demonstrated downregulation of the innate immune system, a stark contrast to findings using maternal blood samples. These immune-related findings were further confirmed by cell deconvolution as well as upstream transcription and cytokine regulation analyses. Overall, this study identified a strong immune signature related to sPTB as well as several potential biomarkers that could be translated to clinical use.

  4. Long-term in vitro and in vivo effects of γ-irradiated BCG on innate and adaptive immunity

    DEFF Research Database (Denmark)

    Arts, Rob J W; Blok, Bastiaan A; Aaby, Peter

    2015-01-01

    were less strong than those induced by live BCG. γBCG vaccination in volunteers had only minimal effects on innate immunity, whereas a significant increase in heterologous Th1/Th17 immunity was observed. Our results indicate that γBCG induces long-term training of innate immunity in vitro. In vivo, γ......BCG vaccination is associated with a reduced mortality from nonmycobacterial infections. This is likely to be mediated by a combination of innate-immune memory ("trained immunity") and heterologous effects on adaptive immunity. As such, BCG could be used to boost host immunity...

  5. Alterations in adaptive immunity persist during long-duration spaceflight

    Science.gov (United States)

    Crucian, Brian; Stowe, Raymond P; Mehta, Satish; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2015-01-01

    Background: It is currently unknown whether immune system alterations persist during long-duration spaceflight. In this study various adaptive immune parameters were assessed in astronauts at three intervals during 6-month spaceflight on board the International Space Station (ISS). AIMS: To assess phenotypic and functional immune system alterations in astronauts participating in 6-month orbital spaceflight. Methods: Blood was collected before, during, and after flight from 23 astronauts participating in 6-month ISS expeditions. In-flight samples were returned to Earth within 48 h of collection for immediate analysis. Assays included peripheral leukocyte distribution, T-cell function, virus-specific immunity, and mitogen-stimulated cytokine production profiles. Results: Redistribution of leukocyte subsets occurred during flight, including an elevated white blood cell (WBC) count and alterations in CD8+ T-cell maturation. A reduction in general T-cell function (both CD4+ and CD8+) persisted for the duration of the 6-month spaceflights, with differential responses between mitogens suggesting an activation threshold shift. The percentage of CD4+ T cells capable of producing IL-2 was depressed after landing. Significant reductions in mitogen-stimulated production of IFNγ, IL-10, IL-5, TNFα, and IL-6 persisted during spaceflight. Following lipopolysaccharide (LPS) stimulation, production of IL-10 was reduced, whereas IL-8 production was increased during flight. Conclusions: The data indicated that immune alterations persist during long-duration spaceflight. This phenomenon, in the absence of appropriate countermeasures, has the potential to increase specific clinical risks for crewmembers during exploration-class deep space missions. PMID:28725716

  6. Interactions between Innate Lymphoid Cells and Cells of the Innate and Adaptive Immune System.

    Science.gov (United States)

    Symowski, Cornelia; Voehringer, David

    2017-01-01

    Type 2 innate lymphoid cells (ILC2s) are a major source of cytokines, which are also produced by Th2 cells and several cell types of the innate immune system. Work over the past few years indicates that ILC2s play a central role in regulating type 2 immune responses against allergens and helminths. ILC2s can interact with a variety of cells types of the innate and adaptive immune system by cell-cell contacts or by communication via soluble factors. In this review, we provide an overview about recent advances in our understanding how ILC2s orchestrate type 2 immune responses with focus on direct interactions between ILC2s and other cells of the immune system.

  7. Suppression of Adaptive Immune Cell Activation Does Not Alter Innate Immune Adipose Inflammation or Insulin Resistance in Obesity.

    Directory of Open Access Journals (Sweden)

    Manikandan Subramanian

    Full Text Available Obesity-induced inflammation in visceral adipose tissue (VAT is a major contributor to insulin resistance and type 2 diabetes. Whereas innate immune cells, notably macrophages, contribute to visceral adipose tissue (VAT inflammation and insulin resistance, the role of adaptive immunity is less well defined. To address this critical gap, we used a model in which endogenous activation of T cells was suppressed in obese mice by blocking MyD88-mediated maturation of CD11c+ antigen-presenting cells. VAT CD11c+ cells from Cd11cCre+Myd88fl/fl vs. control Myd88fl/fl mice were defective in activating T cells in vitro, and VAT T and B cell activation was markedly reduced in Cd11cCre+Myd88fl/fl obese mice. However, neither macrophage-mediated VAT inflammation nor systemic inflammation were altered in Cd11cCre+Myd88fl/fl mice, thereby enabling a focused analysis on adaptive immunity. Unexpectedly, fasting blood glucose, plasma insulin, and the glucose response to glucose and insulin were completely unaltered in Cd11cCre+Myd88fl/fl vs. control obese mice. Thus, CD11c+ cells activate VAT T and B cells in obese mice, but suppression of this process does not have a discernible effect on macrophage-mediated VAT inflammation or systemic glucose homeostasis.

  8. Adaptive Immunity to Francisella tularensis and Considerations for Vaccine Development

    Directory of Open Access Journals (Sweden)

    Lydia M. Roberts

    2018-04-01

    Full Text Available Francisella tularensis is an intracellular bacterium that causes the disease tularemia. There are several subspecies of F. tularensis whose ability to cause disease varies in humans. The most virulent subspecies, tularensis, is a Tier One Select Agent and a potential bioweapon. Although considerable effort has made to generate efficacious tularemia vaccines, to date none have been licensed for use in the United States. Despite the lack of a tularemia vaccine, we have learned a great deal about the adaptive immune response the underlies protective immunity. Herein, we detail the animal models commonly used to study tularemia and their recapitulation of human disease, the field's current understanding of vaccine-mediated protection, and discuss the challenges associated with new vaccine development.

  9. Angiogenesis for tumor vascular normalization of Endostar on hepatoma 22 tumor-bearing mice is involved in the immune response.

    Science.gov (United States)

    Xu, Qingyu; Gu, Junfei; Lv, You; Yuan, Jiarui; Yang, Nan; Chen, Juan; Wang, Chunfei; Hou, Xuefeng; Jia, Xiaobin; Feng, Liang; Yin, Guowen

    2018-03-01

    Tumor vascular normalization involved in immune response is beneficial to the chemotherapy of tumors. Recombinant human endostatin (Endostar), an angiogenesis inhibitor, has been demonstrated to be effective in hepatocellular cancer (HCC). However, its vascular normalization in HCC and the role of the immune response in angiogenesis were unclear. In the present study, effects of Endostar on tumor vascular normalization were evaluated in hepatoma 22 (H22) tumor-bearing mice. Endostar was able to inhibit the proliferation and infiltration of tumor cells and improve α-fetoprotein, tumor necrosis factor-α and cyclic adenosine 5'-phosphate levels in the serum of H22-bearing mice, as well as the protein expression levels of the immune factors interferon-γ and cluster of differentiation (CD)86 in liver tissue. Endostar also exhibited more marked downregulation of the levels of vascular endothelial growth factor, CD31, matrix metalloproteinase (MMP)-2, MMP-9 and interleukin-17 during day 3-9 treatment, resulting in short-term normalization of tumor blood vessels. The period of vascular normalization was 3-9 days. The results of the present study demonstrated that Endostar was able to induce the period of vascular normalization, contributing to a more efficacious means of HCC treatment combined with other chemotherapy, and this effect was associated with the immune response. It may be concluded that Endostar inhibited immunity-associated angiogenesis behaviors of vascular endothelial cells in response to HCC. The results of the present study provided more reasonable possibility for the combination therapy of Endostar for the treatment of HCC.

  10. Asymmetric T lymphocyte division in the initiation of adaptive immune responses.

    Science.gov (United States)

    Chang, John T; Palanivel, Vikram R; Kinjyo, Ichiko; Schambach, Felix; Intlekofer, Andrew M; Banerjee, Arnob; Longworth, Sarah A; Vinup, Kristine E; Mrass, Paul; Oliaro, Jane; Killeen, Nigel; Orange, Jordan S; Russell, Sarah M; Weninger, Wolfgang; Reiner, Steven L

    2007-03-23

    A hallmark of mammalian immunity is the heterogeneity of cell fate that exists among pathogen-experienced lymphocytes. We show that a dividing T lymphocyte initially responding to a microbe exhibits unequal partitioning of proteins that mediate signaling, cell fate specification, and asymmetric cell division. Asymmetric segregation of determinants appears to be coordinated by prolonged interaction between the T cell and its antigen-presenting cell before division. Additionally, the first two daughter T cells displayed phenotypic and functional indicators of being differentially fated toward effector and memory lineages. These results suggest a mechanism by which a single lymphocyte can apportion diverse cell fates necessary for adaptive immunity.

  11. Innate and adaptive immunity in the development of depression: An update on current knowledge and technological advances.

    Science.gov (United States)

    Haapakoski, Rita; Ebmeier, Klaus P; Alenius, Harri; Kivimäki, Mika

    2016-04-03

    The inflammation theory of depression, proposed over 20years ago, was influenced by early studies on T cell responses and since then has been a stimulus for numerous research projects aimed at understanding the relationship between immune function and depression. Observational studies have shown that indicators of immunity, especially C reactive protein and proinflammatory cytokines, such as interleukin 6, are associated with an increased risk of depressive disorders, although the evidence from randomized trials remains limited and only few studies have assessed the interplay between innate and adaptive immunity in depression. In this paper, we review current knowledge on the interactions between central and peripheral innate and adaptive immune molecules and the potential role of immune-related activation of microglia, inflammasomes and indoleamine-2,3-dioxygenase in the development of depressive symptoms. We highlight how combining basic immune methods with more advanced 'omics' technologies would help us to make progress in unravelling the complex associations between altered immune function and depressive disorders, in the identification of depression-specific biomarkers and in developing immunotherapeutic treatment strategies that take individual variability into account. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Engineered Murine HSCs Reconstitute Multi-lineage Hematopoiesis and Adaptive Immunity

    Directory of Open Access Journals (Sweden)

    Yi-Fen Lu

    2016-12-01

    Full Text Available Hematopoietic stem cell (HSC transplantation is curative for malignant and genetic blood disorders, but is limited by donor availability and immune-mismatch. Deriving HSCs from patient-matched embryonic/induced-pluripotent stem cells (ESCs/iPSCs could address these limitations. Prior efforts in murine models exploited ectopic HoxB4 expression to drive self-renewal and enable multi-lineage reconstitution, yet fell short in delivering robust lymphoid engraftment. Here, by titrating exposure of HoxB4-ESC-HSC to Notch ligands, we report derivation of engineered HSCs that self-renew, repopulate multi-lineage hematopoiesis in primary and secondary engrafted mice, and endow adaptive immunity in immune-deficient recipients. Single-cell analysis shows that following engraftment in the bone marrow niche, these engineered HSCs further specify to a hybrid cell type, in which distinct gene regulatory networks of hematopoietic stem/progenitors and differentiated hematopoietic lineages are co-expressed. Our work demonstrates engineering of fully functional HSCs via modulation of genetic programs that govern self-renewal and lineage priming.

  13. Adaptive Value Normalization in the Prefrontal Cortex Is Reduced by Memory Load

    Science.gov (United States)

    Burke, C. J.; Seifritz, E.; Tobler, P. N.

    2017-01-01

    Abstract Adaptation facilitates neural representation of a wide range of diverse inputs, including reward values. Adaptive value coding typically relies on contextual information either obtained from the environment or retrieved from and maintained in memory. However, it is unknown whether having to retrieve and maintain context information modulates the brain’s capacity for value adaptation. To address this issue, we measured hemodynamic responses of the prefrontal cortex (PFC) in two studies on risky decision-making. In each trial, healthy human subjects chose between a risky and a safe alternative; half of the participants had to remember the risky alternatives, whereas for the other half they were presented visually. The value of safe alternatives varied across trials. PFC responses adapted to contextual risk information, with steeper coding of safe alternative value in lower-risk contexts. Importantly, this adaptation depended on working memory load, such that response functions relating PFC activity to safe values were steeper with presented versus remembered risk. An independent second study replicated the findings of the first study and showed that similar slope reductions also arose when memory maintenance demands were increased with a secondary working memory task. Formal model comparison showed that a divisive normalization model fitted effects of both risk context and working memory demands on PFC activity better than alternative models of value adaptation, and revealed that reduced suppression of background activity was the critical parameter impairing normalization with increased memory maintenance demand. Our findings suggest that mnemonic processes can constrain normalization of neural value representations. PMID:28462394

  14. The Hayflick Limit and Age-Related Adaptive Immune Deficiency.

    Science.gov (United States)

    Gill, Zoe; Nieuwoudt, Martin; Ndifon, Wilfred

    2018-01-01

    The adaptive immune system (AIS) acquires significant deficiency during chronological ageing, making older individuals more susceptible to infections and less responsive to vaccines compared to younger individuals. At the cellular level, one of the most striking features of this ageing-related immune deficiency is the dramatic loss of T-cell diversity that occurs in elderly humans. After the age of 70 years, there is a sharp decline in the diversity of naïve T cells, including a >10-fold decrease in the CD4+ compartment and a >100-fold decrease in the CD8+ compartment. Such changes are detrimental because the AIS relies on a diverse naïve T-cell pool to respond to novel pathogens. Recent work suggests that this collapse of naïve T-cell diversity results from T cells reaching the Hayflick limit and being eliminated through both antigen-dependent and -independent pathways. The progressive attrition of telomeres is the molecular mechanism that underlies this Hayflick limit. Therefore, we propose that by measuring the telomere lengths of T cells with high resolution, it is possible to develop a unique biomarker of immune deficiency, potentially much better correlated with individual susceptibility to diseases compared to chronological age alone. © 2017 S. Karger AG, Basel.

  15. A change in inflammatory footprint precedes plaque instability: a systematic evaluation of cellular aspects of the adaptive immune response in human atherosclerosis

    NARCIS (Netherlands)

    van Dijk, R. A.; Duinisveld, A. J. F.; Schaapherder, A. F.; Mulder-Stapel, A.; Hamming, J. F.; Kuiper, J.; de Boer, O. J.; van der Wal, A. C.; Kolodgie, F. D.; Virmani, R.; Lindeman, J. H. N.

    2015-01-01

    Experimental studies characterize adaptive immune response as a critical factor in the progression and complications of atherosclerosis. Yet, it is unclear whether these observations translate to the human situation. This study systematically evaluates cellular components of the adaptive immune

  16. Roles of Zinc Signaling in the Immune System.

    Science.gov (United States)

    Hojyo, Shintaro; Fukada, Toshiyuki

    2016-01-01

    Zinc (Zn) is an essential micronutrient for basic cell activities such as cell growth, differentiation, and survival. Zn deficiency depresses both innate and adaptive immune responses. However, the precise physiological mechanisms of the Zn-mediated regulation of the immune system have been largely unclear. Zn homeostasis is tightly controlled by the coordinated activity of Zn transporters and metallothioneins, which regulate the transport, distribution, and storage of Zn. There is growing evidence that Zn behaves like a signaling molecule, facilitating the transduction of a variety of signaling cascades in response to extracellular stimuli. In this review, we highlight the emerging functional roles of Zn and Zn transporters in immunity, focusing on how crosstalk between Zn and immune-related signaling guides the normal development and function of immune cells.

  17. A cascade reaction network mimicking the basic functional steps of adaptive immune response.

    Science.gov (United States)

    Han, Da; Wu, Cuichen; You, Mingxu; Zhang, Tao; Wan, Shuo; Chen, Tao; Qiu, Liping; Zheng, Zheng; Liang, Hao; Tan, Weihong

    2015-10-01

    Biological systems use complex 'information-processing cores' composed of molecular networks to coordinate their external environment and internal states. An example of this is the acquired, or adaptive, immune system (AIS), which is composed of both humoral and cell-mediated components. Here we report the step-by-step construction of a prototype mimic of the AIS that we call an adaptive immune response simulator (AIRS). DNA and enzymes are used as simple artificial analogues of the components of the AIS to create a system that responds to specific molecular stimuli in vitro. We show that this network of reactions can function in a manner that is superficially similar to the most basic responses of the vertebrate AIS, including reaction sequences that mimic both humoral and cellular responses. As such, AIRS provides guidelines for the design and engineering of artificial reaction networks and molecular devices.

  18. The M3 muscarinic receptor is required for optimal adaptive immunity to helminth and bacterial infection.

    Directory of Open Access Journals (Sweden)

    Matthew Darby

    2015-01-01

    Full Text Available Innate immunity is regulated by cholinergic signalling through nicotinic acetylcholine receptors. We show here that signalling through the M3 muscarinic acetylcholine receptor (M3R plays an important role in adaptive immunity to both Nippostrongylus brasiliensis and Salmonella enterica serovar Typhimurium, as M3R-/- mice were impaired in their ability to resolve infection with either pathogen. CD4 T cell activation and cytokine production were reduced in M3R-/- mice. Immunity to secondary infection with N. brasiliensis was severely impaired, with reduced cytokine responses in M3R-/- mice accompanied by lower numbers of mucus-producing goblet cells and alternatively activated macrophages in the lungs. Ex vivo lymphocyte stimulation of cells from intact BALB/c mice infected with N. brasiliensis and S. typhimurium with muscarinic agonists resulted in enhanced production of IL-13 and IFN-γ respectively, which was blocked by an M3R-selective antagonist. Our data therefore indicate that cholinergic signalling via the M3R is essential for optimal Th1 and Th2 adaptive immunity to infection.

  19. The adaptive immune system promotes initiation of prostate carcinogenesis in a human c-Myc transgenic mouse model.

    Science.gov (United States)

    Melis, Monique H M; Nevedomskaya, Ekaterina; van Burgsteden, Johan; Cioni, Bianca; van Zeeburg, Hester J T; Song, Ji-Ying; Zevenhoven, John; Hawinkels, Lukas J A C; de Visser, Karin E; Bergman, Andries M

    2017-11-07

    Increasing evidence from epidemiological and pathological studies suggests a role of the immune system in the initiation and progression of multiple cancers, including prostate cancer. Reports on the contribution of the adaptive immune system are contradictive, since both suppression and acceleration of disease development have been reported. This study addresses the functional role of lymphocytes in prostate cancer development using a genetically engineered mouse model (GEMM) of human c-Myc driven prostate cancer (Hi-Myc mice) combined with B and T cell deficiency (RAG1 -/- mice). From a pre-cancerous stage on, Hi-Myc mice showed higher accumulation of immune cells in their prostates then wild-type mice, of which macrophages were the most abundant. The onset of invasive adenocarcinoma was delayed in Hi-MycRAG1 -/- compared to Hi-Myc mice and associated with decreased infiltration of leukocytes into the prostate. In addition, lower levels of the cytokines CXCL2, CCL5 and TGF-β1 were detected in Hi-MycRAG1 -/- compared to Hi-Myc mouse prostates. These results from a GEMM of prostate cancer provide new insights into the promoting role of the adaptive immune system in prostate cancer development. Our findings indicate that the endogenous adaptive immune system does not protect against de novo prostate carcinogenesis in Hi-Myc transgenic mice, but rather accelerates the formation of invasive adenocarcinomas. This may have implications for the development of novel treatment strategies.

  20. The 3 major types of innate and adaptive cell-mediated effector immunity.

    Science.gov (United States)

    Annunziato, Francesco; Romagnani, Chiara; Romagnani, Sergio

    2015-03-01

    The immune system has tailored its effector functions to optimally respond to distinct species of microbes. Based on emerging knowledge on the different effector T-cell and innate lymphoid cell (ILC) lineages, it is clear that the innate and adaptive immune systems converge into 3 major kinds of cell-mediated effector immunity, which we propose to categorize as type 1, type 2, and type 3. Type 1 immunity consists of T-bet(+) IFN-γ-producing group 1 ILCs (ILC1 and natural killer cells), CD8(+) cytotoxic T cells (TC1), and CD4(+) TH1 cells, which protect against intracellular microbes through activation of mononuclear phagocytes. Type 2 immunity consists of GATA-3(+) ILC2s, TC2 cells, and TH2 cells producing IL-4, IL-5, and IL-13, which induce mast cell, basophil, and eosinophil activation, as well as IgE antibody production, thus protecting against helminthes and venoms. Type 3 immunity is mediated by retinoic acid-related orphan receptor γt(+) ILC3s, TC17 cells, and TH17 cells producing IL-17, IL-22, or both, which activate mononuclear phagocytes but also recruit neutrophils and induce epithelial antimicrobial responses, thus protecting against extracellular bacteria and fungi. On the other hand, type 1 and 3 immunity mediate autoimmune diseases, whereas type 2 responses can cause allergic diseases. Copyright © 2014 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  1. Alternative Immune Systems

    Directory of Open Access Journals (Sweden)

    Luis Fernando Cadavid Gutierrez

    2011-09-01

    Full Text Available The immune system in animals is a complex network of molecules, cells and tissues that coordinately maintain the physiological and genetic integrity of the organism. Traditionally, two classes of immunity have been considered, the innate immunity and the adaptive immunity. The former is ancestral, with limited variability and low discrimination. The latter is highly variable, specific and limited to jawed vertebrates. Adaptive immunity is based on antigen receptors that rearrange somatically to generate a nearly unlimited diversity of molecules. Likely, this mechanism of somatic recombination arose as a consequence of a horizontal transfer of transposons and transposases from bacterial genomes in the ancestor of jawed vertebrates. The recent discovery in jawless vertebrates and invertebrates of alternative adaptive immune mechanisms, suggests during evolution different animal groups have found alternative solutions to the problem of immune recognition.

  2. Adaptive Convergence Rates of a Dirichlet Process Mixture of Multivariate Normals

    OpenAIRE

    Tokdar, Surya T.

    2011-01-01

    It is shown that a simple Dirichlet process mixture of multivariate normals offers Bayesian density estimation with adaptive posterior convergence rates. Toward this, a novel sieve for non-parametric mixture densities is explored, and its rate adaptability to various smoothness classes of densities in arbitrary dimension is demonstrated. This sieve construction is expected to offer a substantial technical advancement in studying Bayesian non-parametric mixture models based on stick-breaking p...

  3. FORMATION OF INNATE AND ADAPTIVE IMMUNE RESPONSE UNDER THE INFLUENCE OF DIFFERENT FLAVIVIRUS VACCINES

    Directory of Open Access Journals (Sweden)

    N. V. Krylova

    2015-01-01

    Full Text Available The review examines in a comparative perspective the key moments of formation of innate and adaptive immune responses to different types of current flavivirus vaccines: live attenuated against yellow fever virus and inactivated whole virus against tick-borne encephalitis virus. Particular attention is paid to the ability of these different vaccines, containing exogenous pathogen-associated molecular structures, to stimulate innate immunity. Live attenuated vaccine by infecting several subtypes of dendritic cells activates them through various pattern-recognition receptors, such as Tolland RIG-I-like receptors, which leads to significant production of proinflammatory cytokines, including interferon-α primary mediator of innate antiviral immunity. By simulating natural viral infection, this vaccine quickly spreads over the vascular network, and the dendritic cells, activated by it, migrate to the draining lymph nodes and trigger multiple foci of Tand B-cell activation. Inactivated vaccine stimulates the innate immunity predominantly at the injection site, and for the sufficient activation requires the presence in its composition of an adjuvant (aluminum hydroxide, which effects the formation and activation of inflammasomes, ensuring the formation and secretion of IL-1β and IL-18 that, in turn, trigger a cascade of cellular and humoral innate immune responses. We demonstrated the possibility of involvement in the induction of innate immunity, mediated by the inactivated vaccine, endogenous pathogenassociated molecular patterns (uric acid and host cell DNA, forming at the vaccine injection site. We discuss the triggering of Band T-cell responses by flavivirus vaccines that determine various duration of protection against various pathogens. A single injection of the live vaccine against yellow fever virus induces polyvalent adaptive immune response, including the production of cytotoxic T-lymphocytes, Th1and Th2-cells and neutralizing antibodies

  4. STSV2 as a Model Crenarchaeal Virus for Studying Virus-Host Interactions and CRISPR-Cas Adaptive Immunity

    DEFF Research Database (Denmark)

    León Sobrino, Carlos

    , the archaea harbour their own viruses, which constitute an extraordinarily diverse group with exotic morphologies and unique features. Prokaryotes possess a variety of defence mechanisms. The CRISPR-Cas adaptive immune system is of great importance for archaea –84% of them possess it, compared to 45...... generate immune memory by inserting in its own genome short invader-derived DNA fragments forming a database –the CRISPR locus. Little was known about this system until recent years, and the generation of immune memory has been the most elusive step. In this work, the interactions of the spindle......-shaped monocaudavirus STSV2 and its host Sulfolobus islandicus REY15A were studied. This interaction produced, after several days, de novo CRISPR adaptation – that is, without any previous memory that can act as a trigger. We employed transcriptome sequencing to characterise the long-term progression...

  5. Design of Immune-Algorithm-Based Adaptive Fuzzy Controllers for Active Suspension Systems

    Directory of Open Access Journals (Sweden)

    Ming-Yuan Shieh

    2014-04-01

    Full Text Available The aim of this paper is to integrate the artificial immune systems and adaptive fuzzy control for the automobile suspension system, which is regarded as a multiobjective optimization problem. Moreover, the fuzzy control rules and membership controls are then introduced for identification and memorization. It leads fast convergence in the search process. Afterwards, by using the diversity of the antibody group, trapping into local optimum can be avoided, and the system possesses a global search capacity and a faster local search for finding a global optimal solution. Experimental results show that the artificial immune system with the recognition and memory functions allows the system to rapidly converge and search for the global optimal approximate solutions.

  6. Clinical dosing regimen of selinexor maintains normal immune homeostasis and T cell effector function in mice: implications for combination with immunotherapy

    Science.gov (United States)

    Tyler, Paul M.; Servos, Mariah M.; de Vries, Romy C.; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K.

    2017-01-01

    Selinexor (KPT-330) is a first in class nuclear transport inhibitor currently in clinical trials as an anti-cancer agent. To determine how selinexor might impact anti-tumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T cell development, a progressive loss of CD8 T cells and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T cell development and function. We determined the minimum concentration of selinexor required to block T cell activation, and showed that T cell inhibitory effects of selinexor occur at levels above 100nM, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 5 day drug holiday led to intratumoral IFNγ+, granzyme B+ cytotoxic CD8 T cells that were comparable to vehicle treated mice. Overall, selinexor treatment leads to transient inhibition of T cell activation but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T cell functioning and development of anti-tumor immunity. PMID:28148714

  7. Interleukin-4 Receptor Alpha: From Innate to Adaptive Immunity in Murine Models of Cutaneous Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Ramona Hurdayal

    2017-11-01

    Full Text Available The interleukin (IL-4 receptor alpha (IL-4Rα, ubiquitously expressed on both innate and adaptive immune cells, controls the signaling of archetypal type 2 immune regulators; IL-4 and IL-13, which elicit their signaling action by the type 1 IL-4Rα/gamma common and/or the type 2 IL-4Rα/IL-13Rα complexes. Global gene-deficient mouse models targeting IL-4, IL-13, or the IL-4Rα chain, followed by the development of conditional mice and generation of important cell-type-specific IL-4Rα-deficient mouse models, were indeed critical to gaining in-depth understanding of detrimental T helper (Th 2 mechanisms in type 1-controlled diseases. A primary example being cutaneous leishmaniasis, which is caused by the protozoan parasite Leishmania major, among others. The disease is characterized by localized self-healing cutaneous lesions and necrosis for which, currently, not a single vaccine has made it to a stage that can be considered effective. The spectrum of human leishmaniasis belongs to the top 10 infectious diseases according to the World Health Organization. As such, 350 million humans are at risk of infection and disease, with an incidence of 1.5–2 million new cases being reported annually. A major aim of our research is to identify correlates of host protection and evasion, which may aid in vaccine design and therapeutic interventions. In this review, we focus on the immune-regulatory role of the IL-4Rα chain from innate immune responses to the development of beneficial type 1 and detrimental type 2 adaptive immune responses during cutaneous Leishmania infection. We discuss the cell-specific requirements of the IL-4Rα chain on crucial innate immune cells during L. major infection, including, IL-4Rα-responsive skin keratinocytes, macrophages, and neutrophils, as well as dendritic cells (DCs. The latter, contributing to one of the paradigm shifts with respect to the role of IL-4 instructing DCs in vivo, to promote Th1 responses against L

  8. Linking autoimmunity to the origin of the adaptive immune system.

    Science.gov (United States)

    Bayersdorf, Robert; Fruscalzo, Arrigo; Catania, Francesco

    2018-01-01

    In jawed vertebrates, the adaptive immune system (AIS) cooperates with the innate immune system (IIS) to protect hosts from infections. Although targeting non-self-components, the AIS also generates self-reactive antibodies which, when inadequately counter-selected, can give rise to autoimmune diseases (ADs). ADs are on the rise in western countries. Why haven't ADs been eliminated during the evolution of a ∼500 million-year old system? And why have they become more frequent in recent decades? Self-recognition is an attribute of the phylogenetically more ancient IIS and empirical data compellingly show that some self-reactive antibodies, which are classifiable as elements of the IIS rather then the AIS, may protect from (rather than cause) ADs. Here, we propose that the IIS's self-recognition system originally fathered the AIS and, as a consequence of this relationship, its activity is dampened in hygienic environments. Rather than a mere breakdown or failure of the mechanisms of self-tolerance, ADs might thus arise from architectural constraints.

  9. Cutting edge: impairment of dendritic cells and adaptive immunity by Ebola and Lassa viruses.

    Science.gov (United States)

    Mahanty, Siddhartha; Hutchinson, Karen; Agarwal, Sudhanshu; McRae, Michael; Rollin, Pierre E; Pulendran, Bali

    2003-03-15

    Acute infection of humans with Ebola and Lassa viruses, two principal etiologic agents of hemorrhagic fevers, often results in a paradoxical pattern of immune responses: early infection, characterized by an outpouring of inflammatory mediators such as TNF-alpha, IL-1 beta, and IL-6, vs late stage infections, which are associated with poor immune responses. The mechanisms underlying these diverse outcomes are poorly understood. In particular, the role played by cells of the innate immune system, such as dendritic cells (DC), is not known. In this study, we show that Ebola and Lassa viruses infect human monocyte-derived DC and impair their function. Monocyte-derived DC exposed to either virus fail to secrete proinflammatory cytokines, do not up-regulate costimulatory molecules, and are poor stimulators of T cells. These data represent the first evidence for a mechanism by which Ebola and Lassa viruses target DC to impair adaptive immunity.

  10. Quantitative proteomics and terminomics to elucidate the role of ubiquitination and proteolysis in adaptive immunity.

    Science.gov (United States)

    Klein, Theo; Viner, Rosa I; Overall, Christopher M

    2016-10-28

    Adaptive immunity is the specialized defence mechanism in vertebrates that evolved to eliminate pathogens. Specialized lymphocytes recognize specific protein epitopes through antigen receptors to mount potent immune responses, many of which are initiated by nuclear factor-kappa B activation and gene transcription. Most, if not all, pathways in adaptive immunity are further regulated by post-translational modification (PTM) of signalling proteins, e.g. phosphorylation, citrullination, ubiquitination and proteolytic processing. The importance of PTMs is reflected by genetic or acquired defects in these pathways that lead to a dysfunctional immune response. Here we discuss the state of the art in targeted proteomics and systems biology approaches to dissect the PTM landscape specifically regarding ubiquitination and proteolysis in B- and T-cell activation. Recent advances have occurred in methods for specific enrichment and targeted quantitation. Together with improved instrument sensitivity, these advances enable the accurate analysis of often rare PTM events that are opaque to conventional proteomics approaches, now rendering in-depth analysis and pathway dissection possible. We discuss published approaches, including as a case study the profiling of the N-terminome of lymphocytes of a rare patient with a genetic defect in the paracaspase protease MALT1, a key regulator protease in antigen-driven signalling, which was manifested by elevated linear ubiquitination.This article is part of the themed issue 'Quantitative mass spectrometry'. © 2016 The Authors.

  11. Immune cells in the normal ovary and spontaneous ovarian tumors in the laying hen (Gallus domesticus) model of human ovarian cancer.

    Science.gov (United States)

    Bradaric, Michael J; Penumatsa, Krishna; Barua, Animesh; Edassery, Seby L; Yu, Yi; Abramowicz, Jacques S; Bahr, Janice M; Luborsky, Judith L

    2013-01-01

    Spontaneous ovarian cancer in chickens resembles human tumors both histologically and biochemically. The goal was to determine if there are differences in lymphocyte content between normal ovaries and ovarian tumors in chickens as a basis for further studies to understand the role of immunity in human ovarian cancer progression. Hens were selected using grey scale and color Doppler ultrasound to determine if they had normal or tumor morphology. Cells were isolated from ovaries (n = 6 hens) and lymphocyte numbers were determined by flow cytometry using antibodies to avian CD4 and CD8 T and B (Bu1a) cells. Ovarian sections from another set of hens (n = 26) were assessed to verify tumor type and stage and to count CD4, CD8 and Bu1a immunostained cells by morphometric analysis. T and B cells were more numerous in ovarian tumors than in normal ovaries by flow cytometry and immunohistochemistry. There were less CD4+ cells than CD8+ and Bu1a+ cells in normal ovaries or ovarian tumors. CD8+ cells were the dominant T cell sub-type in both ovarian stroma and in ovarian follicles compared to CD4+ cells. Bu1a+ cells were consistently found in the stroma of normal ovaries and ovarian tumors but were not associated with follicles. The number of immune cells was highest in late stage serous tumors compared to endometrioid and mucinous tumors. The results suggest that similar to human ovarian cancer there are comparatively more immune cells in chicken ovarian tumors than in normal ovaries, and the highest immune cell content occurs in serous tumors. Thus, this study establishes a foundation for further study of tumor immune responses in a spontaneous model of ovarian cancer which will facilitate studies of the role of immunity in early ovarian cancer progression and use of the hen in pre-clinical vaccine trials.

  12. Clinical Dosing Regimen of Selinexor Maintains Normal Immune Homeostasis and T-cell Effector Function in Mice: Implications for Combination with Immunotherapy.

    Science.gov (United States)

    Tyler, Paul M; Servos, Mariah M; de Vries, Romy C; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K

    2017-03-01

    Selinexor (KPT-330) is a first-in-class nuclear transport inhibitor currently in clinical trials as an anticancer agent. To determine how selinexor might affect antitumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T-cell development, a progressive loss of CD8 T cells, and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T-cell development and function. We determined the minimum concentration of selinexor required to block T-cell activation and showed that T-cell-inhibitory effects of selinexor occur at levels above 100 nmol/L, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 4-day drug holiday led to intratumoral IFNγ + , granzyme B + cytotoxic CD8 T cells that were comparable with vehicle-treated mice. Overall, selinexor treatment leads to transient inhibition of T-cell activation, but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T-cell functioning and development of antitumor immunity. Mol Cancer Ther; 16(3); 428-39. ©2017 AACR See related article by Farren et al., p. 417 . ©2017 American Association for Cancer Research.

  13. Co-ordinating innate and adaptive immunity to viral infection: mobility is the key

    DEFF Research Database (Denmark)

    Wern, Jeanette Erbo; Thomsen, Allan Randrup

    2009-01-01

    The host counters a viral infection through a complex response made up of components belonging to both the innate and the adaptive immune system. In this report, we review the mechanisms underlying this response, how it is induced and how it is co-ordinated. As cell-cell communication represents...... the very essence of immune system physiology, a key to a rapid, efficient and optimally regulated immune response is the ability of the involved cells to rapidly shift between a stationary and a mobile state, combined with stringent regulation of cell migration during the mobile state. Through the co......-ordinated recruitment of different cell types intended to work in concert, cellular co-operation is optimized particularly under conditions that may involve rare cells. Consequently, a major focus is placed on presenting an overview of the co-operative events and the associated cell migration, which is essential...

  14. Effect of Scoparia dulcis on noise stress induced adaptive immunity and cytokine response in immunized Wistar rats.

    Science.gov (United States)

    Sundareswaran, Loganathan; Srinivasan, Sakthivel; Wankhar, Wankupar; Sheeladevi, Rathinasamy

    Noise acts as a stressor and is reported to have impact on individual health depending on nature, type, intensity and perception. Modern medicine has no effective drugs or cure to prevent its consequences. Being an environmental stressor noise cannot be avoided; instead minimizing its exposure or consuming anti-stressor and adaptogens from plants can be considered. The present study was carried out to evaluate the anti-stressor, adaptogen and immunostimulatory activity of Scoparia dulcis against noise-induced stress in Wistar rat models. Noise stress in rats was created by broadband white noise generator, 100 dB A/4 h daily/15 days and S. dulcis (200 mg/kg b.w.) was administered orally. 8 groups of rats were used consisting of 6 animals each; 4 groups for unimmunized and 4 groups for immunized. For immunization, sheep red blood cells (5 × 10 9  cells/ml) were injected intraperitoneally. Sub-acute noise exposed rats showed a significant increase in corticosterone and IL-4 levels in both immunized and unimmunized rats whereas lymphocytes, antibody titration, soluble immune complex, IL-4 showed a marked increase with a significant decrease in IL-2, TNF-α, IFN-γ cytokines only in unimmunized rats. Immunized noise exposed rats presented increased leukocyte migration index and decreased foot pad thickness, IL-2, TNF-α, IFN-γ with no changes in the lymphocytes. S. dulcis (SD) has normalized and prevented the noise induced changes in cell-mediated and humoral immunity and it could be the presence of anti-stressor and immuno stimulant activity of the plant. Copyright © 2016 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Published by Elsevier B.V. All rights reserved.

  15. BACH transcription factors in innate and adaptive immunity.

    Science.gov (United States)

    Igarashi, Kazuhiko; Kurosaki, Tomohiro; Roychoudhuri, Rahul

    2017-07-01

    BTB and CNC homology (BACH) proteins are transcriptional repressors of the basic region leucine zipper (bZIP) transcription factor family. Recent studies indicate widespread roles of BACH proteins in controlling the development and function of the innate and adaptive immune systems, including the differentiation of effector and memory cells of the B and T cell lineages, CD4 + regulatory T cells and macrophages. Here, we emphasize similarities at a molecular level in the cell-type-specific activities of BACH factors, proposing that competitive interactions of BACH proteins with transcriptional activators of the bZIP family form a common mechanistic theme underlying their diverse actions. The findings contribute to a general understanding of how transcriptional repressors shape lineage commitment and cell-type-specific functions through repression of alternative lineage programmes.

  16. Functional neuroimaging of normal aging: Declining brain, adapting brain.

    Science.gov (United States)

    Sugiura, Motoaki

    2016-09-01

    Early functional neuroimaging research on normal aging brain has been dominated by the interest in cognitive decline. In this framework the age-related compensatory recruitment of prefrontal cortex, in terms of executive system or reduced lateralization, has been established. Further details on these compensatory mechanisms and the findings reflecting cognitive decline, however, remain the matter of intensive investigations. Studies in another framework where age-related neural alteration is considered adaptation to the environmental change are recently burgeoning and appear largely categorized into three domains. The age-related increase in activation of the sensorimotor network may reflect the alteration of the peripheral sensorimotor systems. The increased susceptibility of the network for the mental-state inference to the socioemotional significance may be explained by the age-related motivational shift due to the altered social perception. The age-related change in activation of the self-referential network may be relevant to the focused positive self-concept of elderly driven by a similar motivational shift. Across the domains, the concept of the self and internal model may provide the theoretical bases of this adaptation framework. These two frameworks complement each other to provide a comprehensive view of the normal aging brain. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Dendritic Cell Migration to Skin-Draining Lymph Nodes Is Controlled by Dermatan Sulfate and Determines Adaptive Immunity Magnitude

    Directory of Open Access Journals (Sweden)

    Reza Nadafi

    2018-02-01

    Full Text Available For full activation of naïve adaptive lymphocytes in skin-draining lymph nodes (LNs, presentation of peptide:MHC complexes by LN-resident and skin-derived dendritic cells (DCs that encountered antigens (Ags is an absolute prerequisite. To get to the nearest draining LN upon intradermal immunization, DCs need to migrate from the infection site to the afferent lymphatics, which can only be reached by traversing a collagen-dense network located in the dermis of the skin through the activity of proteolytic enzymes. Here, we show that mice with altered collagen fibrillogenesis resulting in thicker collagen fibers in the skin display a reduced DC migration to the draining LN upon immune challenge. Consequently, the initiation of the cellular and humoral immune response was diminished. Ag-specific CD8+ and CD4+ T cells as well as Ag-specific germinal center B cells and serum immunoglobulin levels were significantly decreased. Hence, we postulate that alterations to the production of extracellular matrix, as seen in various connective tissue disorders, may in the end affect the qualitative outcome of adaptive immunity.

  18. Suppression of adaptive immunity to heterologous antigens during Plasmodium infection through hemozoin-induced failure of dendritic cell function

    Directory of Open Access Journals (Sweden)

    Phillips R

    2006-04-01

    Full Text Available Abstract Background Dendritic cells (DCs are central to the initiation and regulation of the adaptive immune response during infection. Modulation of DC function may therefore allow evasion of the immune system by pathogens. Significant depression of the host's systemic immune response to both concurrent infections and heterologous vaccines has been observed during malaria infection, but the mechanisms underlying this immune hyporesponsiveness are controversial. Results Here, we demonstrate that the blood stages of malaria infection induce a failure of DC function in vitro and in vivo, causing suboptimal activation of T cells involved in heterologous immune responses. This effect on T-cell activation can be transferred to uninfected recipients by DCs isolated from infected mice. Significantly, T cells activated by these DCs subsequently lack effector function, as demonstrated by a failure to migrate to lymphoid-organ follicles, resulting in an absence of B-cell responses to heterologous antigens. Fractionation studies show that hemozoin, rather than infected erythrocyte (red blood cell membranes, reproduces the effect of intact infected red blood cells on DCs. Furthermore, hemozoin-containing DCs could be identified in T-cell areas of the spleen in vivo. Conclusion Plasmodium infection inhibits the induction of adaptive immunity to heterologous antigens by modulating DC function, providing a potential explanation for epidemiological studies linking endemic malaria with secondary infections and reduced vaccine efficacy.

  19. Control Systems with Normalized and Covariance Adaptation by Optimal Control Modification

    Science.gov (United States)

    Nguyen, Nhan T. (Inventor); Burken, John J. (Inventor); Hanson, Curtis E. (Inventor)

    2016-01-01

    Disclosed is a novel adaptive control method and system called optimal control modification with normalization and covariance adjustment. The invention addresses specifically to current challenges with adaptive control in these areas: 1) persistent excitation, 2) complex nonlinear input-output mapping, 3) large inputs and persistent learning, and 4) the lack of stability analysis tools for certification. The invention has been subject to many simulations and flight testing. The results substantiate the effectiveness of the invention and demonstrate the technical feasibility for use in modern aircraft flight control systems.

  20. Computational tool for immunotoxic assessment of pyrethroids toward adaptive immune cell receptors.

    Science.gov (United States)

    Kumar, Anoop; Behera, Padma Charan; Rangra, Naresh Kumar; Dey, Suddhasattya; Kant, Kamal

    2018-01-01

    Pyrethroids have prominently known for their insecticidal actions worldwide, but recent reports as anticancer and antiviral applications gained a lot of interest to further understand their safety and immunotoxicity. This encouraged us to carry out our present study to evaluate the interactions of pyrethroids toward adaptive immune cell receptors. Type 1 and Type 2 pyrethroids were tested on T (CD4 and CD8) and B (CD28 and CD45) immune cell receptors using Maestro 9.3 (Schrödinger, LLC, Cambridge, USA). In addition, top-ranked tested ligands were too explored for toxicity prediction in rodents using ProTOX tool. Pyrethroids (specifically type 2) such as fenvalerate (-5.534 kcal/mol: CD8), fluvalinate (-4.644 and - 4.431 kcal/mol: CD4 and CD45), and cypermethrin (-3.535 kcal/mol: CD28) have outcome in less energy or more affinity for B-cell and T-cell immune receptors which may later result in the immunosuppressive and hypersensitivity reactions. The current findings have uncovered that there is a further need to assess the Type 2 pyrethroids with wet laboratory experiments to understand the chemical nature of pyrethroid-induced immunotoxicity. Fenvalerate showed apex glide score toward CD8 immune receptor, while fluvalinate confirmed top-ranked binding with CD4 and CD45 immune proteinsIn addition, cypermethrin outcame in top glide score against CD28 immune receptorTop dock hits (Type 2) pyrethroids have shown probable toxicity targets toward AOFA: Amine oxidase (flavin-containing) A and PGH1: Prostaglandin G/H synthase 1, respectively. Abbreviations used: PDB: Protein Data Bank; AOFA: Amine oxidase (flavin-containing) A; PGH 1: Prostaglandin G/H synthase 1.

  1. Immune System Dysfunction in the Elderly.

    Science.gov (United States)

    Fuentes, Eduardo; Fuentes, Manuel; Alarcón, Marcelo; Palomo, Iván

    2017-01-01

    Human aging is characterized by both physical and physiological frailty that profoundly affects the immune system. In this context aging is associated with declines in adaptive and innate immunity established as immunosenescence. Immunosenescence is a new concept that reflects the age-associated restructuring changes of innate and adaptive immune functions. Thus elderly individuals usually present chronic low-level inflammation, higher infection rates and chronic diseases. A study of alterations in the immune system during aging could provide a potentially useful biomarker for the evaluation of immune senescence treatment. The immune system is the result of the interplay between innate and adaptive immunity, yet the impact of aging on this function is unclear. In this article the function of the immune system during aging is explored.

  2. Immunity peculiarities of neonates in case of perinatal pathology

    Directory of Open Access Journals (Sweden)

    О. S. Godovanets

    2018-02-01

    of the evidences of immune system components participation in perinatal pathology pathogenesis is detected correlation between immune disorders severity and clinical manifestation of diseases, as well as immune indices normalization in a long-term organism adaptation formation. Conclusions. Based on the data obtained it has been concluded that immune system status determination is reasonable for diagnostics of disadaptation syndrome severity in early neonatal period.

  3. Innate and adaptive immunity gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Lanziani, Larissa Elias; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    Evaluate the expression profile of genes related to Innate and Adaptive Immune System (IAIS) of human Primary Epidermal keratinocytes (hPEKP) of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific IAIS PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 63% of these genes were differentially expressed, of which 77% were repressed and 23% were hyper-regulated. Among these, the following genes (fold increase or decrease): IL8 (41), IL6 (32), TNF (-92), HLA-E (-86), LYS (-74), CCR6 (- 73), CD86 (-41) and HLA-A (-35). This study contributes to the understanding of the molecular mechanisms underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  4. Recognition of extracellular bacteria by NLRs and its role in the development of adaptive immunity

    Directory of Open Access Journals (Sweden)

    Jonathan eFerrand

    2013-10-01

    Full Text Available Innate immune recognition of bacteria is the first requirement for mounting an effective immune response able to control infection. Over the previous decade, the general paradigm was that extracellular bacteria were only sensed by cell surface-expressed Toll-like receptors (TLRs, whereas cytoplasmic sensors, including members of the Nod-like receptor (NLR family, were specific to pathogens capable of breaching the host cell membrane. It has become apparent, however, that intracellular innate immune molecules, such as the NLRs, play key roles in the sensing of not only intracellular, but also extracellular bacterial pathogens or their components. In this review, we will discuss the various mechanisms used by bacteria to activate NLR signaling in host cells. These mechanisms include bacterial secretion systems, pore-forming toxins and outer membrane vesicles. We will then focus on the influence of NLR activation on the development of adaptive immune responses in different cell types.

  5. In vivo immunoprotective role of Indigofera tinctoria and Scoparia dulcis aqueous extracts against chronic noise stress induced immune abnormalities in Wistar albino rats

    Directory of Open Access Journals (Sweden)

    Boothapandi Madakkannu

    Full Text Available Indigofera tinctoria and Scoparia dulcis are being widely used in Indian folk medicine for the treatment of various disorders. Environmental noise pollution is thought to be an important factor for many health problems and it causes immune abnormalities. In the present study immune-regulating potential of I. tinctoria and S. dulcis aqueous extracts on innate and adaptive immune system of wistar albino rats was evaluated during normal and chronic noise induced stress conditions. The results demonstrated that both I. tinctoria and S. dulcis aqueous extracts (200 mg/kg b.w showed immunostimulant effect on both innate and adaptive immune response of wistar albino rat compared to control group under normal condition. The noise stress (100 dB for 1 h, 20 days induced animals showed suppressive effects on immune response by decreasing macrophage phagocytosis, antibody secretion by spleen cells, humoral immune response, proliferation of lymphocytes, cytotoxicity, TNF α expression, granzyme B and perforin expression in splenic NK cells. Similarly, noise stress also caused DNA damage in tissues. However, the suppressed effects induced by noise stress on rat immune system were significantly prevented by oral administration of both I. tinctoria and S. dulcis aqueous extracts. Considering all these results it is suggested that the selected medicinal plant’s aqueous extracts have the potential to prevent the effects of noise stress induced rat immune system and explore a strong immunostimulant potential applicable to clinical practices. Keywords: Indigofera tinctoria, Scoparia dulcis, Chronic noise stress, Immunomodulatory, Innate immunity, Adaptive immunity

  6. Normalized value coding explains dynamic adaptation in the human valuation process.

    Science.gov (United States)

    Khaw, Mel W; Glimcher, Paul W; Louie, Kenway

    2017-11-28

    The notion of subjective value is central to choice theories in ecology, economics, and psychology, serving as an integrated decision variable by which options are compared. Subjective value is often assumed to be an absolute quantity, determined in a static manner by the properties of an individual option. Recent neurobiological studies, however, have shown that neural value coding dynamically adapts to the statistics of the recent reward environment, introducing an intrinsic temporal context dependence into the neural representation of value. Whether valuation exhibits this kind of dynamic adaptation at the behavioral level is unknown. Here, we show that the valuation process in human subjects adapts to the history of previous values, with current valuations varying inversely with the average value of recently observed items. The dynamics of this adaptive valuation are captured by divisive normalization, linking these temporal context effects to spatial context effects in decision making as well as spatial and temporal context effects in perception. These findings suggest that adaptation is a universal feature of neural information processing and offer a unifying explanation for contextual phenomena in fields ranging from visual psychophysics to economic choice.

  7. Peripheral dendritic cells are essential for both the innate and adaptive antiviral immune responses in the central nervous system

    International Nuclear Information System (INIS)

    Steel, Christina D.; Hahto, Suzanne M.; Ciavarra, Richard P.

    2009-01-01

    Intranasal application of vesicular stomatitis virus (VSV) causes acute infection of the central nervous system (CNS). However, VSV encephalitis is not invariably fatal, suggesting that the CNS may contain a professional antigen-presenting cell (APC) capable of inducing or propagating a protective antiviral immune response. To examine this possibility, we first characterized the cellular elements that infiltrate the brain as well as the activation status of resident microglia in the brains of normal and transgenic mice acutely ablated of peripheral dendritic cells (DCs) in vivo. VSV encephalitis was characterized by a pronounced infiltrate of myeloid cells (CD45 high CD11b + ) and CD8 + T cells containing a subset that was specific for the immunodominant VSV nuclear protein epitope. This T cell response correlated temporally with a rapid and sustained upregulation of MHC class I expression on microglia, whereas class II expression was markedly delayed. Ablation of peripheral DCs profoundly inhibited the inflammatory response as well as infiltration of virus-specific CD8 + T cells. Unexpectedly, the VSV-induced interferon-gamma (IFN-γ) response in the CNS remained intact in DC-deficient mice. Thus, both the inflammatory and certain components of the adaptive primary antiviral immune response in the CNS are dependent on peripheral DCs in vivo.

  8. GYF-21, an Epoxide 2-(2-Phenethyl-Chromone Derivative, Suppresses Innate and Adaptive Immunity via Inhibiting STAT1/3 and NF-κB Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Ran Guo

    2017-05-01

    Full Text Available Multiple sclerosis is a chronic inflammatory autoimmune disease of the central nervous system characterized by demyelinating plaques and axonal loss. Inhibition on over activation of innate and adaptive immunity provides a rationale strategy for treatment of multiple sclerosis. In the present study, we investigated the inhibitory effects of GYF-21, an epoxide 2-(2-phenethyl-chromone derivative isolated from Chinese agarwood, on innate and adaptive immunity for revealing its potential to treat multiple sclerosis. The results showed that GYF-21 markedly inhibited the activation of microglia, and dendritic cells as well as neutrophils, all of which play important roles in innate immunity. Furthermore, GYF-21 significantly suppressed adaptive immunity via inhibiting the differentiation of naive CD4+ T cells into T helper 1 (Th1 and T helper 17 (Th17 cells, and suppressing the activation, proliferation, and IFN-γ secretion of CD8+ T cells. The mechanism study showed that GYF-21 evidently inhibited the activation of STAT1/3 and NF-κB signaling pathways in microglia. In conclusion, we demonstrated that GYF-21 can significantly inhibit innate and adaptive immunity via suppressing STAT1/3 and NF-κB signaling pathways, and has potential to be developed into therapeutic drug for multiple sclerosis.

  9. Differences in innate and adaptive immune response traits of Pahari (Indian non-descript indigenous breed) and Jersey crossbred cattle.

    Science.gov (United States)

    Verma, Subhash; Thakur, Aneesh; Katoch, Shailja; Shekhar, Chander; Wani, Aasim Habib; Kumar, Sandeep; Dohroo, Shweta; Singh, Geetanjali; Sharma, Mandeep

    2017-10-01

    Cattle are an integral part of the largely agrarian economy of India. Indigenous breeds of cattle comprise about 80% of total cattle population of the country and contribute significantly to the overall milk production. There are 40 recognized indigenous breeds of cattle and a number of uncharacterized non-descript cattle. Pahari cattle of Himachal Pradesh in Northern India are one such non-descript indigenous breed. Here we describe a comprehensive evaluation of haematobiochemical parameters and innate and adaptive immune response traits of Pahari cattle and a comparison with Jersey crossbred cattle. The study shows demonstrable differences in the two breeds with respect to some innate and adaptive immunological traits. This is a first attempt to characterize immune response traits of Pahari cattle and the results of the study provide an understanding of breed differences in immune status of cattle which could be useful for their breeding and conservations programs. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. HIV-1 Adaptation to Antigen Processing Results in Population-Level Immune Evasion and Affects Subtype Diversification

    DEFF Research Database (Denmark)

    Tenzer, Stefan; Crawford, Hayley; Pymm, Phillip

    2014-01-01

    these regions encode epitopes presented by ~30 more common HLA variants. By combining epitope processing and computational analyses of the two HIV subtypes responsible for ~60% of worldwide infections, we identified a hitherto unrecognized adaptation to the antigen-processing machinery through substitutions...... of intrapatient adaptations, is predictable, facilitates viral subtype diversification, and increases global HIV diversity. Because low epitope abundance is associated with infrequent and weak T cell responses, this most likely results in both population-level immune evasion and inadequate responses in most...

  11. A Comparison of Adaptive Behaviors among Mentally Retarded and Normal Individuals: A guide to Prevention and Treatment

    Directory of Open Access Journals (Sweden)

    Leyla Sadros

    2010-01-01

    Full Text Available Objectives: Because of the importance of adaptive behaviors in socialand domestic lives, this study aimed at a comparison of various domainsof adaptive behaviors, between mentally retarded and normalindividuals.Methods: A number of 246 normal and 74 mentally retarded individuals(7-18 years of age, mean: 12±3.5 years, participated this study inTehran, Iran. Their adaptive behaviors scores, were obtained using"Adaptive Behavioral Scale, Residential & Community" (ABS-RC: 2,consisting of 18 domains of behavior. The scale was first translatedinto Persian by the professionals and then retranslated into English byanother translator, to ensure content non-distortion.Results: The following domains were significantly lower in mentallyretarded than in normal individuals: independent functioning, economicactivity, language development, number & time, prevocational/vocational activity, self direction, responsibility, socialization,disturbing interpersonal behavior, domestic activity, social engagement,conformity and trustworthiness. No significant difference was documentedin the physical development, stereotype & hyperactive behaviors,sexual behavior as well as self abuse behavior domains, betweenthe two groups.Conclusions: As mentally deficient subjects did worse than normalones in terms of many adaptive behavioral domains, it implies that theadaptive behavioral issues in such people might need a great deal ofattention and intervention. For these retarded people to function betterin their social and residential environment, it would be necessary todevelop their adaptive behaviors. This study may shed light on theimportance of attention to the adaptive behavioral domains of mentallyretarded people and also indicates the necessity of preventive measures,even for normal individuals.

  12. Mammalian Gut Immunity

    Science.gov (United States)

    Chassaing, Benoit; Kumar, Manish; Baker, Mark T.; Singh, Vishal; Vijay-Kumar, Matam

    2016-01-01

    The mammalian intestinal tract is the largest immune organ in the body and comprises cells from non-hemopoietic (epithelia, Paneth cells, goblet cells) and hemopoietic (macrophages, dendritic cells, T-cells) origin, and is also a dwelling for trillions of microbes collectively known as the microbiota. The homeostasis of this large microbial biomass is prerequisite to maintain host health by maximizing beneficial symbiotic relationships and minimizing the risks of living in such close proximity. Both microbiota and host immune system communicate with each other to mutually maintain homeostasis in what could be called a “love–hate relationship.” Further, the host innate and adaptive immune arms of the immune system cooperate and compensate each other to maintain the equilibrium of a highly complex gut ecosystem in a stable and stringent fashion. Any imbalance due to innate or adaptive immune deficiency or aberrant immune response may lead to dysbiosis and low-grade to robust gut inflammation, finally resulting in metabolic diseases. PMID:25163502

  13. Immunity's ancient arms

    OpenAIRE

    Litman, Gary W.; Cannon, John P.

    2009-01-01

    Diverse receptors on two types of cell mediate adaptive immunity in jawed vertebrates. In the lamprey, a jawless vertebrate, immunity is likewise compartmentalized but the molecular mechanics are very different.

  14. Microbial-immune cross-talk and regulation of the immune system.

    Science.gov (United States)

    Cahenzli, Julia; Balmer, Maria L; McCoy, Kathy D

    2013-01-01

    We are all born germ-free. Following birth we enter into a lifelong relationship with microbes residing on our body's surfaces. The lower intestine is home to the highest microbial density in our body, which is also the highest microbial density known on Earth (up to 10(12) /g of luminal contents). With our indigenous microbial cells outnumbering our human cells by an order of magnitude our body is more microbial than human. Numerous immune adaptations confine these microbes within the mucosa, enabling most of us to live in peaceful homeostasis with our intestinal symbionts. Intestinal epithelial cells not only form a physical barrier between the bacteria-laden lumen and the rest of the body but also function as multi-tasking immune cells that sense the prevailing microbial (apical) and immune (basolateral) milieus, instruct the underlying immune cells, and adapt functionally. In the constant effort to ensure intestinal homeostasis, the immune system becomes educated to respond appropriately and in turn immune status can shape the microbial consortia. Here we review how the dynamic immune-microbial dialogue underlies maturation and regulation of the immune system and discuss recent findings on the impact of diet on both microbial ecology and immune function. © 2012 The Authors. Immunology © 2012 Blackwell Publishing Ltd.

  15. Lithocholic acid controls adaptive immune responses by inhibition of Th1 activation through the Vitamin D receptor.

    Science.gov (United States)

    Pols, Thijs W H; Puchner, Teresa; Korkmaz, H Inci; Vos, Mariska; Soeters, Maarten R; de Vries, Carlie J M

    2017-01-01

    Bile acids are established signaling molecules next to their role in the intestinal emulsification and uptake of lipids. We here aimed to identify a potential interaction between bile acids and CD4+ Th cells, which are central in adaptive immune responses. We screened distinct bile acid species for their potency to affect T cell function. Primary human and mouse CD4+ Th cells as well as Jurkat T cells were used to gain insight into the mechanism underlying these effects. We found that unconjugated lithocholic acid (LCA) impedes Th1 activation as measured by i) decreased production of the Th1 cytokines IFNγ and TNFαα, ii) decreased expression of the Th1 genes T-box protein expressed in T cells (T-bet), Stat-1 and Stat4, and iii) decreased STAT1α/β phosphorylation. Importantly, we observed that LCA impairs Th1 activation at physiological relevant concentrations. Profiling of MAPK signaling pathways in Jurkat T cells uncovered an inhibition of ERK-1/2 phosphorylation upon LCA exposure, which could provide an explanation for the impaired Th1 activation. LCA induces these effects via Vitamin D receptor (VDR) signaling since VDR RNA silencing abrogated these effects. These data reveal for the first time that LCA controls adaptive immunity via inhibition of Th1 activation. Many factors influence LCA levels, including bile acid-based drugs and gut microbiota. Our data may suggest that these factors also impact on adaptive immunity via a yet unrecognized LCA-Th cell axis.

  16. In immune defense: redefining the role of the immune system in chronic disease.

    Science.gov (United States)

    Rubinow, Katya B; Rubinow, David R

    2017-03-01

    The recognition of altered immune system function in many chronic disease states has proven to be a pivotal advance in biomedical research over the past decade. For many metabolic and mood disorders, this altered immune activity has been characterized as inflammation, with the attendant assumption that the immune response is aberrant. However, accumulating evidence challenges this assumption and suggests that the immune system may be mounting adaptive responses to chronic stressors. Further, the inordinate complexity of immune function renders a simplistic, binary model incapable of capturing critical mechanistic insights. In this perspective article, we propose alternative paradigms for understanding the role of the immune system in chronic disease. By invoking allostasis or systems biology rather than inflammation, we can ascribe greater functional significance to immune mediators, gain newfound appreciation of the adaptive facets of altered immune activity, and better avoid the potentially disastrous effects of translating erroneous assumptions into novel therapeutic strategies.

  17. Interferon alpha inhibits replication of a live-attenuated porcine reproductive and respiratory syndrome virus vaccine preventing development of an adaptive immune response in swine.

    Science.gov (United States)

    Brockmeier, Susan L; Loving, Crystal L; Eberle, Kirsten C; Hau, Samantha J; Buckley, Alexandra; Van Geelen, Albert; Montiel, Nestor A; Nicholson, Tracy; Lager, Kelly M

    2017-12-01

    Type I interferons, such as interferon alpha (IFN-α), contribute to innate antiviral immunity by promoting production of antiviral mediators and are also involved in promoting an adaptive immune response. Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most devastating and costly viruses to the swine industry world-wide and has been shown to induce a meager IFN-α response. Previously we administered porcine IFN-α using a replication-defective adenovirus vector (Ad5-IFN-α) at the time of challenge with virulent PRRSV and demonstrated an increase in the number of virus-specific IFNγ secreting cells, indicating that the presence of IFN-α at the time of infection can alter the adaptive immune responses to PRRSV. In the current experiment, we explored the use of IFN-α as an adjuvant administered with live-attenuated PRRSV vaccine as a method to enhance immune response to the vaccine. Unlike the previous studies with fully virulent virus, one injection of the Ad5-IFN-α abolished replication of the vaccine virus and as a result there was no detectible adaptive immune response. Although IFN-α did not have the desired adjuvant effect, the results further highlight the use of IFN-α as a treatment for PRRSV infection. Published by Elsevier B.V.

  18. Persistence and Adaptation in Immunity: T Cells Balance the Extent and Thoroughness of Search.

    Directory of Open Access Journals (Sweden)

    G Matthew Fricke

    2016-03-01

    Full Text Available Effective search strategies have evolved in many biological systems, including the immune system. T cells are key effectors of the immune response, required for clearance of pathogenic infection. T cell activation requires that T cells encounter antigen-bearing dendritic cells within lymph nodes, thus, T cell search patterns within lymph nodes may be a crucial determinant of how quickly a T cell immune response can be initiated. Previous work suggests that T cell motion in the lymph node is similar to a Brownian random walk, however, no detailed analysis has definitively shown whether T cell movement is consistent with Brownian motion. Here, we provide a precise description of T cell motility in lymph nodes and a computational model that demonstrates how motility impacts T cell search efficiency. We find that both Brownian and Lévy walks fail to capture the complexity of T cell motion. Instead, T cell movement is better described as a correlated random walk with a heavy-tailed distribution of step lengths. Using computer simulations, we identify three distinct factors that contribute to increasing T cell search efficiency: 1 a lognormal distribution of step lengths, 2 motion that is directionally persistent over short time scales, and 3 heterogeneity in movement patterns. Furthermore, we show that T cells move differently in specific frequently visited locations that we call "hotspots" within lymph nodes, suggesting that T cells change their movement in response to the lymph node environment. Our results show that like foraging animals, T cells adapt to environmental cues, suggesting that adaption is a fundamental feature of biological search.

  19. Persistence and Adaptation in Immunity: T Cells Balance the Extent and Thoroughness of Search

    Science.gov (United States)

    Fricke, G. Matthew; Letendre, Kenneth A.; Moses, Melanie E.; Cannon, Judy L.

    2016-01-01

    Effective search strategies have evolved in many biological systems, including the immune system. T cells are key effectors of the immune response, required for clearance of pathogenic infection. T cell activation requires that T cells encounter antigen-bearing dendritic cells within lymph nodes, thus, T cell search patterns within lymph nodes may be a crucial determinant of how quickly a T cell immune response can be initiated. Previous work suggests that T cell motion in the lymph node is similar to a Brownian random walk, however, no detailed analysis has definitively shown whether T cell movement is consistent with Brownian motion. Here, we provide a precise description of T cell motility in lymph nodes and a computational model that demonstrates how motility impacts T cell search efficiency. We find that both Brownian and Lévy walks fail to capture the complexity of T cell motion. Instead, T cell movement is better described as a correlated random walk with a heavy-tailed distribution of step lengths. Using computer simulations, we identify three distinct factors that contribute to increasing T cell search efficiency: 1) a lognormal distribution of step lengths, 2) motion that is directionally persistent over short time scales, and 3) heterogeneity in movement patterns. Furthermore, we show that T cells move differently in specific frequently visited locations that we call “hotspots” within lymph nodes, suggesting that T cells change their movement in response to the lymph node environment. Our results show that like foraging animals, T cells adapt to environmental cues, suggesting that adaption is a fundamental feature of biological search. PMID:26990103

  20. MiR-155-regulated molecular network orchestrates cell fate in the innate and adaptive immune response to Mycobacterium tuberculosis.

    Science.gov (United States)

    Rothchild, Alissa C; Sissons, James R; Shafiani, Shahin; Plaisier, Christopher; Min, Deborah; Mai, Dat; Gilchrist, Mark; Peschon, Jacques; Larson, Ryan P; Bergthaler, Andreas; Baliga, Nitin S; Urdahl, Kevin B; Aderem, Alan

    2016-10-11

    The regulation of host-pathogen interactions during Mycobacterium tuberculosis (Mtb) infection remains unresolved. MicroRNAs (miRNAs) are important regulators of the immune system, and so we used a systems biology approach to construct an miRNA regulatory network activated in macrophages during Mtb infection. Our network comprises 77 putative miRNAs that are associated with temporal gene expression signatures in macrophages early after Mtb infection. In this study, we demonstrate a dual role for one of these regulators, miR-155. On the one hand, miR-155 maintains the survival of Mtb-infected macrophages, thereby providing a niche favoring bacterial replication; on the other hand, miR-155 promotes the survival and function of Mtb-specific T cells, enabling an effective adaptive immune response. MiR-155-induced cell survival is mediated through the SH2 domain-containing inositol 5-phosphatase 1 (SHIP1)/protein kinase B (Akt) pathway. Thus, dual regulation of the same cell survival pathway in innate and adaptive immune cells leads to vastly different outcomes with respect to bacterial containment.

  1. A Protocol for the Comprehensive Flow Cytometric Analysis of Immune Cells in Normal and Inflamed Murine Non-Lymphoid Tissues

    Science.gov (United States)

    Yu, Yen-Rei A.; O’Koren, Emily G.; Hotten, Danielle F.; Kan, Matthew J.; Kopin, David; Nelson, Erik R.; Que, Loretta; Gunn, Michael D.

    2016-01-01

    Flow cytometry is used extensively to examine immune cells in non-lymphoid tissues. However, a method of flow cytometric analysis that is both comprehensive and widely applicable has not been described. We developed a protocol for the flow cytometric analysis of non-lymphoid tissues, including methods of tissue preparation, a 10-fluorochrome panel for cell staining, and a standardized gating strategy, that allows the simultaneous identification and quantification of all major immune cell types in a variety of normal and inflamed non-lymphoid tissues. We demonstrate that our basic protocol minimizes cell loss, reliably distinguishes macrophages from dendritic cells (DC), and identifies all major granulocytic and mononuclear phagocytic cell types. This protocol is able to accurately quantify 11 distinct immune cell types, including T cells, B cells, NK cells, neutrophils, eosinophils, inflammatory monocytes, resident monocytes, alveolar macrophages, resident/interstitial macrophages, CD11b- DC, and CD11b+ DC, in normal lung, heart, liver, kidney, intestine, skin, eyes, and mammary gland. We also characterized the expression patterns of several commonly used myeloid and macrophage markers. This basic protocol can be expanded to identify additional cell types such as mast cells, basophils, and plasmacytoid DC, or perform detailed phenotyping of specific cell types. In examining models of primary and metastatic mammary tumors, this protocol allowed the identification of several distinct tumor associated macrophage phenotypes, the appearance of which was highly specific to individual tumor cell lines. This protocol provides a valuable tool to examine immune cell repertoires and follow immune responses in a wide variety of tissues and experimental conditions. PMID:26938654

  2. Heat and immunity: an experimental heat wave alters immune functions in three-spined sticklebacks (Gasterosteus aculeatus).

    Science.gov (United States)

    Dittmar, Janine; Janssen, Hannah; Kuske, Andra; Kurtz, Joachim; Scharsack, Jörn P

    2014-07-01

    Global climate change is predicted to lead to increased temperatures and more extreme climatic events. This may influence host-parasite interactions, immunity and therefore the impact of infectious diseases on ecosystems. However, little is known about the effects of rising temperatures on immune defence, in particular in ectothermic animals, where the immune system is directly exposed to external temperature change. Fish are ideal models for studying the effect of temperature on immunity, because they are poikilothermic, but possess a complete vertebrate immune system with both innate and adaptive immunity. We used three-spined sticklebacks ( Gasterosteus aculeatus) originating from a stream and a pond, whereby the latter supposedly were adapted to higher temperature variation. We studied the effect of increasing and decreasing temperatures and a simulated heat wave with subsequent recovery on body condition and immune parameters. We hypothesized that the immune system might be less active at low temperatures, but will be even more suppressed at temperatures towards the upper tolerable temperature range. Contrary to our expectation, we found innate and adaptive immune activity to be highest at a temperature as low as 13 °C. Exposure to a simulated heat wave induced long-lasting immune disorders, in particular in a stickleback population that might be less adapted to temperature variation in its natural environment. The results show that the activity of the immune system of an ectothermic animal species is temperature dependent and suggest that heat waves associated with global warming may immunocompromise host species, thereby potentially facilitating the spread of infectious diseases. © 2014 The Authors. Journal of Animal Ecology © 2014 British Ecological Society.

  3. Effects of ultraviolet radiation on the immune system in humans

    International Nuclear Information System (INIS)

    Morison, W.L.

    1989-01-01

    In experimental animals, exposure to UV-B radiation produces selective alterations of immune function which are mainly in the form of suppression of normal immune responses. This immune suppression is important in the development of nonmelanoma skin cancer, may influence the development and course of infectious disease and possibly protects against autoimmune reactions. The evidence that this form of immune suppression occurs in humans is less compelling and very incomplete. The wavelengths of radiation most affected by a depletion of the stratospheric ozone layer are those known to be most immunosuppressive in animals and it is likely that such depletion will increase any suppressive effect of sunlight on immunity in humans. In addition to establishing whether or not UV-B radiation can cause suppression of immune function in humans, studies are required to determine if melanin can provide protection against such suppression, the role of this suppression in the pathogenesis of skin cancer, the development of infectious disease and vaccine effectiveness, and the capacity for humans to develop adaptive, protective mechanisms which may limit damage from continued exposure to UV-B radiation. (author)

  4. Evolution of Alternative Adaptive Immune Systems in Vertebrates.

    Science.gov (United States)

    Boehm, Thomas; Hirano, Masayuki; Holland, Stephen J; Das, Sabyasachi; Schorpp, Michael; Cooper, Max D

    2018-04-26

    Adaptive immunity in jawless fishes is based on antigen recognition by three types of variable lymphocyte receptors (VLRs) composed of variable leucine-rich repeats, which are differentially expressed by two T-like lymphocyte lineages and one B-like lymphocyte lineage. The T-like cells express either VLRAs or VLRCs of yet undefined antigen specificity, whereas the VLRB antibodies secreted by B-like cells bind proteinaceous and carbohydrate antigens. The incomplete VLR germline genes are assembled into functional units by a gene conversion-like mechanism that employs flanking variable leucine-rich repeat sequences as templates in association with lineage-specific expression of cytidine deaminases. B-like cells develop in the hematopoietic typhlosole and kidneys, whereas T-like cells develop in the thymoid, a thymus-equivalent region at the gill fold tips. Thus, the dichotomy between T-like and B-like cells and the presence of dedicated lymphopoietic tissues emerge as ancestral vertebrate features, whereas the somatic diversification of structurally distinct antigen receptor genes evolved independently in jawless and jawed vertebrates.

  5. The immune system, adaptation, and machine learning

    Science.gov (United States)

    Farmer, J. Doyne; Packard, Norman H.; Perelson, Alan S.

    1986-10-01

    The immune system is capable of learning, memory, and pattern recognition. By employing genetic operators on a time scale fast enough to observe experimentally, the immune system is able to recognize novel shapes without preprogramming. Here we describe a dynamical model for the immune system that is based on the network hypothesis of Jerne, and is simple enough to simulate on a computer. This model has a strong similarity to an approach to learning and artificial intelligence introduced by Holland, called the classifier system. We demonstrate that simple versions of the classifier system can be cast as a nonlinear dynamical system, and explore the analogy between the immune and classifier systems in detail. Through this comparison we hope to gain insight into the way they perform specific tasks, and to suggest new approaches that might be of value in learning systems.

  6. Towards adapting a normal patient database for SPECT brain perfusion imaging

    International Nuclear Information System (INIS)

    Smith, N D; Soleimani, M; Mitchell, C N; Holmes, R B; Evans, M J; Cade, S C

    2012-01-01

    Single-photon emission computerized tomography (SPECT) is a tool which can be used to image perfusion in the brain. Clinicians can use such images to help diagnose dementias such as Alzheimer's disease. Due to the intrinsic stochasticity in the photon imaging system, some form of statistical comparison of an individual image with a 'normal' patient database gives a clinician additional confidence in interpreting the image. Due to the variations between SPECT camera systems, ideally a normal patient database is required for each individual system. However, cost or ethical considerations often prohibit the collection of such a database for each new camera system. Some method of adapting existing normal patient databases to new camera systems would be beneficial. This paper introduces a method which may be regarded as a 'first-pass' attempt based on 2-norm regularization and a codebook of discrete spatially stationary convolutional kernels. Some preliminary illustrative results are presented, together with discussion on limitations and possible improvements

  7. Lithocholic acid controls adaptive immune responses by inhibition of Th1 activation through the Vitamin D receptor

    NARCIS (Netherlands)

    Pols, Thijs W. H.; Puchner, Teresa; Korkmaz, H. Inci; Vos, Mariska; Soeters, Maarten R.; de Vries, Carlie J. M.

    2017-01-01

    Bile acids are established signaling molecules next to their role in the intestinal emulsification and uptake of lipids. We here aimed to identify a potential interaction between bile acids and CD4+ Th cells, which are central in adaptive immune responses. We screened distinct bile acid species for

  8. Modulation of immune cells and Th1/Th2 cytokines in insulin-treated ...

    African Journals Online (AJOL)

    and Th2 cytokines and the frequencies of innate and adaptive immunity cells .... As inclusion criteria, all participants were non- .... Ranges of normal values: Fasting glucose: 3.88-6.10 mM (0.7-1.10 g/L); .... of HbA1c, reflecting a poor control of diabetes37 and a .... rophage recruitment and adipose tissue inflammation in.

  9. Improved Discovery of Molecular Interactions in Genome-Scale Data with Adaptive Model-Based Normalization

    Science.gov (United States)

    Brown, Patrick O.

    2013-01-01

    Background High throughput molecular-interaction studies using immunoprecipitations (IP) or affinity purifications are powerful and widely used in biology research. One of many important applications of this method is to identify the set of RNAs that interact with a particular RNA-binding protein (RBP). Here, the unique statistical challenge presented is to delineate a specific set of RNAs that are enriched in one sample relative to another, typically a specific IP compared to a non-specific control to model background. The choice of normalization procedure critically impacts the number of RNAs that will be identified as interacting with an RBP at a given significance threshold – yet existing normalization methods make assumptions that are often fundamentally inaccurate when applied to IP enrichment data. Methods In this paper, we present a new normalization methodology that is specifically designed for identifying enriched RNA or DNA sequences in an IP. The normalization (called adaptive or AD normalization) uses a basic model of the IP experiment and is not a variant of mean, quantile, or other methodology previously proposed. The approach is evaluated statistically and tested with simulated and empirical data. Results and Conclusions The adaptive (AD) normalization method results in a greatly increased range in the number of enriched RNAs identified, fewer false positives, and overall better concordance with independent biological evidence, for the RBPs we analyzed, compared to median normalization. The approach is also applicable to the study of pairwise RNA, DNA and protein interactions such as the analysis of transcription factors via chromatin immunoprecipitation (ChIP) or any other experiments where samples from two conditions, one of which contains an enriched subset of the other, are studied. PMID:23349766

  10. Aircraft Abnormal Conditions Detection, Identification, and Evaluation Using Innate and Adaptive Immune Systems Interaction

    Science.gov (United States)

    Al Azzawi, Dia

    Abnormal flight conditions play a major role in aircraft accidents frequently causing loss of control. To ensure aircraft operation safety in all situations, intelligent system monitoring and adaptation must rely on accurately detecting the presence of abnormal conditions as soon as they take place, identifying their root cause(s), estimating their nature and severity, and predicting their impact on the flight envelope. Due to the complexity and multidimensionality of the aircraft system under abnormal conditions, these requirements are extremely difficult to satisfy using existing analytical and/or statistical approaches. Moreover, current methodologies have addressed only isolated classes of abnormal conditions and a reduced number of aircraft dynamic parameters within a limited region of the flight envelope. This research effort aims at developing an integrated and comprehensive framework for the aircraft abnormal conditions detection, identification, and evaluation based on the artificial immune systems paradigm, which has the capability to address the complexity and multidimensionality issues related to aircraft systems. Within the proposed framework, a novel algorithm was developed for the abnormal conditions detection problem and extended to the abnormal conditions identification and evaluation. The algorithm and its extensions were inspired from the functionality of the biological dendritic cells (an important part of the innate immune system) and their interaction with the different components of the adaptive immune system. Immunity-based methodologies for re-assessing the flight envelope at post-failure and predicting the impact of the abnormal conditions on the performance and handling qualities are also proposed and investigated in this study. The generality of the approach makes it applicable to any system. Data for artificial immune system development were collected from flight tests of a supersonic research aircraft within a motion-based flight

  11. Innate immune functions of microglia isolated from human glioma patients

    Directory of Open Access Journals (Sweden)

    Grimm Elizabeth

    2006-03-01

    Full Text Available Abstract Background Innate immunity is considered the first line of host defense and microglia presumably play a critical role in mediating potent innate immune responses to traumatic and infectious challenges in the human brain. Fundamental impairments of the adaptive immune system in glioma patients have been investigated; however, it is unknown whether microglia are capable of innate immunity and subsequent adaptive anti-tumor immune responses within the immunosuppressive tumor micro-environment of human glioma patients. We therefore undertook a novel characterization of the innate immune phenotype and function of freshly isolated human glioma-infiltrating microglia (GIM. Methods GIM were isolated by sequential Percoll purification from patient tumors immediately after surgical resection. Flow cytometry, phagocytosis and tumor cytotoxicity assays were used to analyze the phenotype and function of these cells. Results GIM expressed significant levels of Toll-like receptors (TLRs, however they do not secrete any of the cytokines (IL-1β, IL-6, TNF-α critical in developing effective innate immune responses. Similar to innate macrophage functions, GIM can mediate phagocytosis and non-MHC restricted cytotoxicity. However, they were statistically less able to mediate tumor cytotoxicity compared to microglia isolated from normal brain. In addition, the expression of Fas ligand (FasL was low to absent, indicating that apoptosis of the incoming lymphocyte population may not be a predominant mode of immunosuppression by microglia. Conclusion We show for the first time that despite the immunosuppressive environment of human gliomas, GIM are capable of innate immune responses such as phagocytosis, cytotoxicity and TLR expression but yet are not competent in secreting key cytokines. Further understanding of these innate immune functions could play a critical role in understanding and developing effective immunotherapies to malignant human gliomas.

  12. Endometrial immune markers are potential predictors of normal fertility and pregnancy after in vitro fertilization.

    Science.gov (United States)

    Kofod, Louise; Lindhard, Anette; Bzorek, Michael; Eriksen, Jens Ole; Larsen, Lise Grupe; Hviid, Thomas Vauvert F

    2017-09-01

    Elucidating immune mechanisms in the endometrium, which lead to the success of implantation and pregnancy, is important in reproductive medicine. Studies of immune cell abundance have shown conflicting results, and the expression and importance of HLA class Ib proteins in pre-implantation endometrium have not yet been investigated. The study population consisted of four subgroups: a hydrosalpinx, a salpingectomy, an unexplained infertility, and a fertile control group. Endometrial samples were collected during the implantation window. Immune markers (CD56 + and CD16 + cells, FoxP3 + Tregs, HLA-G, HLA-F) were quantified in the samples. The outcome of the subsequent IVF treatment was recorded. Increased CD56 + uNK cells and high HLA-G expression served as predictor for successful pregnancy outcome. HLA-F expression was positively correlated with uNK cells, being indirectly predictive for achieving pregnancy. Endometrial uNK cell abundance in the pre-implantation endometrium seems to be important for normal fertility and pregnancy success, and they may be used as clinical markers to predict implantation success in IVF. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Postnatal Innate Immune Development: From Birth to Adulthood

    Directory of Open Access Journals (Sweden)

    Anastasia Georgountzou

    2017-08-01

    Full Text Available It is well established that adaptive immune responses are deficient in early life, contributing to increased mortality and morbidity. The developmental trajectories of different components of innate immunity are only recently being explored. Individual molecules, cells, or pathways of innate recognition and signaling, within different compartments/anatomical sites, demonstrate variable maturation patterns. Despite some discrepancies among published data, valuable information is emerging, showing that the developmental pattern of cytokine responses during early life is age and toll-like receptor specific, and may be modified by genetic and environmental factors. Interestingly, specific environmental exposures have been linked both to innate function modifications and the occurrence of chronic inflammatory disorders, such as respiratory allergies. As these conditions are on the rise, our knowledge on innate immune development and its modulating factors needs to be expanded. Improved understanding of the sequence of events associated with disease onset and persistence will lead toward meaningful interventions. This review describes the state-of-the-art on normal postnatal innate immune ontogeny and highlights research areas that are currently explored or should be further addressed.

  14. Nubbin isoform antagonism governs Drosophila intestinal immune homeostasis.

    Directory of Open Access Journals (Sweden)

    Bo G Lindberg

    2018-03-01

    Full Text Available Gut immunity is regulated by intricate and dynamic mechanisms to ensure homeostasis despite a constantly changing microbial environment. Several regulatory factors have been described to participate in feedback responses to prevent aberrant immune activity. Little is, however, known about how transcriptional programs are directly tuned to efficiently adapt host gut tissues to the current microbiome. Here we show that the POU/Oct gene nubbin (nub encodes two transcription factor isoforms, Nub-PB and Nub-PD, which antagonistically regulate immune gene expression in Drosophila. Global transcriptional profiling of adult flies overexpressing Nub-PB in immunocompetent tissues revealed that this form is a strong transcriptional activator of a large set of immune genes. Further genetic analyses showed that Nub-PB is sufficient to drive expression both independently and in conjunction with nuclear factor kappa B (NF-κB, JNK and JAK/STAT pathways. Similar overexpression of Nub-PD did, conversely, repress expression of the same targets. Strikingly, isoform co-overexpression normalized immune gene transcription, suggesting antagonistic activities. RNAi-mediated knockdown of individual nub transcripts in enterocytes confirmed antagonistic regulation by the two isoforms and that both are necessary for normal immune gene transcription in the midgut. Furthermore, enterocyte-specific Nub-PB expression levels had a strong impact on gut bacterial load as well as host lifespan. Overexpression of Nub-PB enhanced bacterial clearance of ingested Erwinia carotovora carotovora 15. Nevertheless, flies quickly succumbed to the infection, suggesting a deleterious immune response. In line with this, prolonged overexpression promoted a proinflammatory signature in the gut with induction of JNK and JAK/STAT pathways, increased apoptosis and stem cell proliferation. These findings highlight a novel regulatory mechanism of host-microbe interactions mediated by antagonistic

  15. Frequent adaptive immune responses against arginase-1

    DEFF Research Database (Denmark)

    Martinenaite, Evelina; Mortensen, Rasmus Erik Johansson; Hansen, Morten

    2018-01-01

    The enzyme arginase-1 reduces the availability of arginine to tumor-infiltrating immune cells, thus reducing T-cell functionality in the tumor milieu. Arginase-1 is expressed by some cancer cells and by immune inhibitory cells, such as myeloid-derived suppressor cells (MDSCs) and tumor-associated...

  16. Psychosocial Adaptation of Fathers of Children with Autism, Down Syndrome, and Normal Development.

    Science.gov (United States)

    Rodrigue, James R.; And Others

    1992-01-01

    This study compared fathers of 20 autistic, 20 Down's syndrome, and 20 developmentally normal children on measures of psychosocial adaptation. Groups differed on measures of intrapersonal and family functioning but not on social-ecological variables. There were few differences between fathers of children with autism and those of children with…

  17. MiR-155–regulated molecular network orchestrates cell fate in the innate and adaptive immune response to Mycobacterium tuberculosis

    Science.gov (United States)

    Rothchild, Alissa C.; Sissons, James R.; Shafiani, Shahin; Plaisier, Christopher; Min, Deborah; Mai, Dat; Gilchrist, Mark; Peschon, Jacques; Larson, Ryan P.; Bergthaler, Andreas; Baliga, Nitin S.; Urdahl, Kevin B.; Aderem, Alan

    2016-01-01

    The regulation of host–pathogen interactions during Mycobacterium tuberculosis (Mtb) infection remains unresolved. MicroRNAs (miRNAs) are important regulators of the immune system, and so we used a systems biology approach to construct an miRNA regulatory network activated in macrophages during Mtb infection. Our network comprises 77 putative miRNAs that are associated with temporal gene expression signatures in macrophages early after Mtb infection. In this study, we demonstrate a dual role for one of these regulators, miR-155. On the one hand, miR-155 maintains the survival of Mtb-infected macrophages, thereby providing a niche favoring bacterial replication; on the other hand, miR-155 promotes the survival and function of Mtb-specific T cells, enabling an effective adaptive immune response. MiR-155–induced cell survival is mediated through the SH2 domain-containing inositol 5-phosphatase 1 (SHIP1)/protein kinase B (Akt) pathway. Thus, dual regulation of the same cell survival pathway in innate and adaptive immune cells leads to vastly different outcomes with respect to bacterial containment. PMID:27681624

  18. Immune surveillance properties of human NK cell-derived exosomes.

    Science.gov (United States)

    Lugini, Luana; Cecchetti, Serena; Huber, Veronica; Luciani, Francesca; Macchia, Gianfranco; Spadaro, Francesca; Paris, Luisa; Abalsamo, Laura; Colone, Marisa; Molinari, Agnese; Podo, Franca; Rivoltini, Licia; Ramoni, Carlo; Fais, Stefano

    2012-09-15

    Exosomes are nanovesicles released by normal and tumor cells, which are detectable in cell culture supernatant and human biological fluids, such as plasma. Functions of exosomes released by "normal" cells are not well understood. In fact, several studies have been carried out on exosomes derived from hematopoietic cells, but very little is known about NK cell exosomes, despite the importance of these cells in innate and adaptive immunity. In this paper, we report that resting and activated NK cells, freshly isolated from blood of healthy donors, release exosomes expressing typical protein markers of NK cells and containing killer proteins (i.e., Fas ligand and perforin molecules). These nanovesicles display cytotoxic activity against several tumor cell lines and activated, but not resting, immune cells. We also show that NK-derived exosomes undergo uptake by tumor target cells but not by resting PBMC. Exosomes purified from plasma of healthy donors express NK cell markers, including CD56+ and perforin, and exert cytotoxic activity against different human tumor target cells and activated immune cells as well. The results of this study propose an important role of NK cell-derived exosomes in immune surveillance and homeostasis. Moreover, this study supports the use of exosomes as an almost perfect example of biomimetic nanovesicles possibly useful in future therapeutic approaches against various diseases, including tumors.

  19. Immune regulation by pericytes: modulating innate and adaptive immunity

    DEFF Research Database (Denmark)

    Navarro, Rocio; Compte, Marta; Álvarez-Vallina, Luis

    2016-01-01

    Pericytes (PC) are mural cells that surround endothelial cells (EC) in small blood vessels. PC have traditionally been endowed with structural functions, being essential for vessel maturation and stabilization. However, accumulating evidence suggest that PC also display immune properties. They ca...

  20. Physical model of the immune response of bacteria against bacteriophage through the adaptive CRISPR-Cas immune system

    Energy Technology Data Exchange (ETDEWEB)

    Han, Pu; Niestemski, Liang Ren; Deem, Michael W [Department of Physics and Astronomy, Rice University, Houston, TX 77005 (United States); Barrick, Jeffrey E, E-mail: mwdeem@rice.edu [Department of Chemistry and Biochemistry, The University of Texas at Austin, Austin, TX 78712 (United States)

    2013-04-15

    Bacteria and archaea have evolved an adaptive, heritable immune system that recognizes and protects against viruses or plasmids. This system, known as the CRISPR-Cas system, allows the host to recognize and incorporate short foreign DNA or RNA sequences, called 'spacers' into its CRISPR system. Spacers in the CRISPR system provide a record of the history of bacteria and phage coevolution. We use a physical model to study the dynamics of this coevolution as it evolves stochastically over time. We focus on the impact of mutation and recombination on bacteria and phage evolution and evasion. We discuss the effect of different spacer deletion mechanisms on the coevolutionary dynamics. We make predictions about bacteria and phage population growth, spacer diversity within the CRISPR locus, and spacer protection against the phage population. (paper)

  1. Physical model of the immune response of bacteria against bacteriophage through the adaptive CRISPR-Cas immune system

    Science.gov (United States)

    Han, Pu; Niestemski, Liang Ren; Barrick, Jeffrey E.; Deem, Michael W.

    2013-04-01

    Bacteria and archaea have evolved an adaptive, heritable immune system that recognizes and protects against viruses or plasmids. This system, known as the CRISPR-Cas system, allows the host to recognize and incorporate short foreign DNA or RNA sequences, called ‘spacers’ into its CRISPR system. Spacers in the CRISPR system provide a record of the history of bacteria and phage coevolution. We use a physical model to study the dynamics of this coevolution as it evolves stochastically over time. We focus on the impact of mutation and recombination on bacteria and phage evolution and evasion. We discuss the effect of different spacer deletion mechanisms on the coevolutionary dynamics. We make predictions about bacteria and phage population growth, spacer diversity within the CRISPR locus, and spacer protection against the phage population.

  2. Physical model of the immune response of bacteria against bacteriophage through the adaptive CRISPR-Cas immune system

    International Nuclear Information System (INIS)

    Han, Pu; Niestemski, Liang Ren; Deem, Michael W; Barrick, Jeffrey E

    2013-01-01

    Bacteria and archaea have evolved an adaptive, heritable immune system that recognizes and protects against viruses or plasmids. This system, known as the CRISPR-Cas system, allows the host to recognize and incorporate short foreign DNA or RNA sequences, called ‘spacers’ into its CRISPR system. Spacers in the CRISPR system provide a record of the history of bacteria and phage coevolution. We use a physical model to study the dynamics of this coevolution as it evolves stochastically over time. We focus on the impact of mutation and recombination on bacteria and phage evolution and evasion. We discuss the effect of different spacer deletion mechanisms on the coevolutionary dynamics. We make predictions about bacteria and phage population growth, spacer diversity within the CRISPR locus, and spacer protection against the phage population. (paper)

  3. The influence of innate and adaptative immune responses on the differential clinical outcomes of leprosy.

    Science.gov (United States)

    Fonseca, Adriana Barbosa de Lima; Simon, Marise do Vale; Cazzaniga, Rodrigo Anselmo; de Moura, Tatiana Rodrigues; de Almeida, Roque Pacheco; Duthie, Malcolm S; Reed, Steven G; de Jesus, Amelia Ribeiro

    2017-02-06

    Leprosy is a chronic infectious disease caused by Mycobacterium leprae. According to official reports from 121 countries across five WHO regions, there were 213 899 newly diagnosed cases in 2014. Although leprosy affects the skin and peripheral nerves, it can present across a spectrum of clinical and histopathological forms that are strongly influenced by the immune response of the infected individuals. These forms comprise the extremes of tuberculoid leprosy (TT), with a M. leprae-specific Th1, but also a Th17, response that limits M. leprae multiplication, through to lepromatous leprosy (LL), with M. leprae-specific Th2 and T regulatory responses that do not control M. leprae replication but rather allow bacterial dissemination. The interpolar borderline clinical forms present with similar, but less extreme, immune biases. Acute inflammatory episodes, known as leprosy reactions, are complications that may occur before, during or after treatment, and cause further neurological damages that can cause irreversible chronic disabilities. This review discusses the innate and adaptive immune responses, and their interactions, that are known to affect pathogenesis and influence the clinical outcome of leprosy.

  4. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

    Science.gov (United States)

    Ruiz, Lorena; Espinosa-Martos, Irene; García-Carral, Cristina; Manzano, Susana; McGuire, Michelle K.; Meehan, Courtney L.; McGuire, Mark A.; Williams, Janet E.; Foster, James; Sellen, Daniel W.; Kamau-Mbuthia, Elizabeth W.; Kamundia, Egidioh W.; Mbugua, Samwel; Moore, Sophie E.; Kvist, Linda J.; Otoo, Gloria E.; Lackey, Kimberly A.; Flores, Katherine; Pareja, Rossina G.; Bode, Lars; Rodríguez, Juan M.

    2017-01-01

    Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα), acquired immunity factors (IL2, IL4, IL10, IL13, IL17), chemokines (IL8, Groα, MCP1, MIP1β), growth factors [IL5, IL7, epidermal growth factor (EGF), granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM), in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not) common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid. Clinical Trial Registration: www.ClinicalTrials.gov, identifier NCT02670278. PMID:28713365

  5. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

    Directory of Open Access Journals (Sweden)

    Lorena Ruiz

    2017-06-01

    Full Text Available Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα, acquired immunity factors (IL2, IL4, IL10, IL13, IL17, chemokines (IL8, Groα, MCP1, MIP1β, growth factors [IL5, IL7, epidermal growth factor (EGF, granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM, in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid.Clinical Trial Registration:www.ClinicalTrials.gov, identifier NCT02670278.

  6. In vivo immunoprotective role of Indigofera tinctoria and Scoparia dulcis aqueous extracts against chronic noise stress induced immune abnormalities in Wistar albino rats.

    Science.gov (United States)

    Madakkannu, Boothapandi; Ravichandran, Ramanibai

    2017-01-01

    Indigofera tinctoria and Scoparia dulcis are being widely used in Indian folk medicine for the treatment of various disorders. Environmental noise pollution is thought to be an important factor for many health problems and it causes immune abnormalities. In the present study immune-regulating potential of I. tinctoria and S. dulcis aqueous extracts on innate and adaptive immune system of wistar albino rats was evaluated during normal and chronic noise induced stress conditions. The results demonstrated that both I. tinctoria and S. dulcis aqueous extracts (200 mg/kg b.w) showed immunostimulant effect on both innate and adaptive immune response of wistar albino rat compared to control group under normal condition. The noise stress (100 dB for 1 h, 20 days) induced animals showed suppressive effects on immune response by decreasing macrophage phagocytosis, antibody secretion by spleen cells, humoral immune response, proliferation of lymphocytes, cytotoxicity, TNF α expression, granzyme B and perforin expression in splenic NK cells. Similarly, noise stress also caused DNA damage in tissues. However, the suppressed effects induced by noise stress on rat immune system were significantly prevented by oral administration of both I. tinctoria and S. dulcis aqueous extracts. Considering all these results it is suggested that the selected medicinal plant's aqueous extracts have the potential to prevent the effects of noise stress induced rat immune system and explore a strong immunostimulant potential applicable to clinical practices.

  7. Characterization of an adaptive immune response in microsatellite-instable colorectal cancer

    Science.gov (United States)

    Boissière-Michot, Florence; Lazennec, Gwendal; Frugier, Hélène; Jarlier, Marta; Roca, Lise; Duffour, Jacqueline; Du Paty, Emilie; Laune, Daniel; Blanchard, France; Le Pessot, Florence; Sabourin, Jean-Christophe; Bibeau, Frédéric

    2014-01-01

    Sporadic or hereditary colorectal cancer (CRC) with microsatellite instability (MSI) is frequently characterized by inflammatory lymphocytic infiltration and tends to be associated with a better outcome than microsatellite stable (MSS) CRC, probably reflecting a more effective immune response. We investigated inflammatory mechanisms in 48 MSI CRCs and 62 MSS CRCs by analyzing: (1) the expression of 48 cytokines using Bio-Plex multiplex cytokine assays, and (2) the in situ immune response by immunohistochemical analysis with antibodies against CD3 (T lymphocytes), CD8 (cytotoxic T lymphocytes), CD45RO (memory T lymphocytes), T-bet (Th1 CD4 cells), and FoxP3 (regulatory T cells). MSI CRC exhibited significantly higher expression of CCL5 (RANTES), CXCL8 (IL-8), CXCL9 (MIG), IL-1β, CXCL10 (IP-10), IL-16, CXCL1 (GROα), and IL-1ra, and lower expression of MIF, compared with MSS CRC. Immunohistochemistry combined with image analysis indicated that the density of CD3+, CD8+, CD45RO+, and T-bet+ T lymphocytes was higher in MSI CRC than in MSS CRC, whereas the number of regulatory T cells (FoxP3+) was not statistically different between the groups. These results indicate that MSI CRC is associated with a specific cytokine expression profile that includes CCL5, CXCL10, and CXCL9, which are involved in the T helper type 1 (Th1) response and in the recruitment of memory CD45RO+ T cells. Our findings highlight the major role of adaptive immunity in MSI CRC and provide a possible explanation for the more favorable prognosis of this CRC subtype. PMID:25101223

  8. Immune cells in term and preterm labor

    Science.gov (United States)

    Gomez-Lopez, Nardhy; StLouis, Derek; Lehr, Marcus A; Sanchez-Rodriguez, Elly N; Arenas-Hernandez, Marcia

    2014-01-01

    Labor resembles an inflammatory response that includes secretion of cytokines/chemokines by resident and infiltrating immune cells into reproductive tissues and the maternal/fetal interface. Untimely activation of these inflammatory pathways leads to preterm labor, which can result in preterm birth. Preterm birth is a major determinant of neonatal mortality and morbidity; therefore, the elucidation of the process of labor at a cellular and molecular level is essential for understanding the pathophysiology of preterm labor. Here, we summarize the role of innate and adaptive immune cells in the physiological or pathological activation of labor. We review published literature regarding the role of innate and adaptive immune cells in the cervix, myometrium, fetal membranes, decidua and the fetus in late pregnancy and labor at term and preterm. Accumulating evidence suggests that innate immune cells (neutrophils, macrophages and mast cells) mediate the process of labor by releasing pro-inflammatory factors such as cytokines, chemokines and matrix metalloproteinases. Adaptive immune cells (T-cell subsets and B cells) participate in the maintenance of fetomaternal tolerance during pregnancy, and an alteration in their function or abundance may lead to labor at term or preterm. Also, immune cells that bridge the innate and adaptive immune systems (natural killer T (NKT) cells and dendritic cells (DCs)) seem to participate in the pathophysiology of preterm labor. In conclusion, a balance between innate and adaptive immune cells is required in order to sustain pregnancy; an alteration of this balance will lead to labor at term or preterm. PMID:24954221

  9. [Advances in molecular mechanisms of adaptive immunity mediated by type I-E CRISPR/Cas system--A review].

    Science.gov (United States)

    Sun, Dongchang; Qiu, Juanping

    2016-01-04

    To better adapt to the environment, prokaryocyte can take up exogenous genes (from bacteriophages, plasmids or genomes of other species) through horizontal gene transfer. Accompanied by the acquisition of exogenous genes, prokaryocyte is challenged by the invasion of 'selfish genes'. Therefore, to protect against the risk of gene transfer, prokaryocyte needs to establish mechanisms for selectively taking up or degrading exogenous DNA. In recent years, researchers discovered an adaptive immunity, which is mediated by the small RNA guided DNA degradation, prevents the invasion of exogenous genes in prokaryocyte. During the immune process, partial DNA fragments are firstly integrated.to the clustered regularly interspaced short palindromic repeats (CRISPR) located within the genome DNA, and then the mature CRISPR RNA transcript and the CRISPR associated proteins (Cas) form a complex CRISPR/Cas for degrading exogenous DNA. In this review, we will first briefly describe the CRISPR/Cas systems and then mainly focus on the recent advances of the function mechanism and the regulation mechanism of the type I-E CRISPR/Cas system in Escherichia coli.

  10. Humoral Immunity to AAV-6, 8, and 9 in Normal and Dystrophic Dogs

    Science.gov (United States)

    Shin, Jin-Hong; Yue, Yongping; Smith, Bruce

    2012-01-01

    Abstract Adeno-associated virus (AAV)-6, 8, and 9 are promising gene-delivery vectors for testing novel Duchenne muscular dystrophy gene therapy in the canine model. Humoral immunity greatly influences in vivo AAV transduction. However, neutralizing antibodies to AAV-6, 8, and 9 have not been systemically examined in normal and dystrophic dogs. To gain information on the seroprevalence of antibodies to AAV-6, 8, and 9, we measured neutralizing antibody titers using an in vitro transduction inhibition assay. We examined 72 naive serum samples and 26 serum samples obtained from dogs that had received AAV gene transfer. Our data demonstrated that AAV-6 neutralizing antibody was the most prevalent antibody in dogs irrespective of age, gender, disease status (dystrophic or not), and prior parvovirus vaccination history. Surprisingly, high-level anti-AAV-6 antibody was detected at birth in newborn puppies. Further, a robust antibody response was induced in affected, but not normal newborn dogs following systemic AAV gene transfer. Taken together, our data have provided an important baseline on the seroprevalence of AAV-6, 8, and 9 neutralizing antibodies in normal and Duchenne muscular dystrophy dogs. These results will help guide translational AAV gene-therapy studies in dog models of muscular dystrophy. PMID:22040468

  11. Imbalanced immune homeostasis in immune thrombocytopenia.

    Science.gov (United States)

    Yazdanbakhsh, Karina

    2016-04-01

    Immune thrombocytopenia (ITP) is an autoimmune bleeding disorder resulting from low platelet counts caused by inadequate production as well as increased destruction by autoimmune mechanisms. As with other autoimmune disorders, chronic ITP is characterized by perturbations of immune homeostasis with hyperactivated effector cells as well as defective regulatory arm of the adaptive immune system, which will be reviewed here. Interestingly, some ITP treatments are associated with restoring the regulatory imbalance, although it remains unclear whether the immune system is redirected to a state of tolerance once treatment is discontinued. Understanding the mechanisms that result in breakdown of immune homeostasis in ITP will help to identify novel pathways for restoring tolerance and inhibiting effector cell responses. This information can then be translated into developing therapies for averting autoimmunity not only in ITP but also many autoimmune disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Transcriptomic and proteomic insights into innate immunity and adaptations to a symbiotic lifestyle in the gutless marine worm Olavius algarvensis.

    Science.gov (United States)

    Wippler, Juliane; Kleiner, Manuel; Lott, Christian; Gruhl, Alexander; Abraham, Paul E; Giannone, Richard J; Young, Jacque C; Hettich, Robert L; Dubilier, Nicole

    2016-11-21

    The gutless marine worm Olavius algarvensis has a completely reduced digestive and excretory system, and lives in an obligate nutritional symbiosis with bacterial symbionts. While considerable knowledge has been gained of the symbionts, the host has remained largely unstudied. Here, we generated transcriptomes and proteomes of O. algarvensis to better understand how this annelid worm gains nutrition from its symbionts, how it adapted physiologically to a symbiotic lifestyle, and how its innate immune system recognizes and responds to its symbiotic microbiota. Key adaptations to the symbiosis include (i) the expression of gut-specific digestive enzymes despite the absence of a gut, most likely for the digestion of symbionts in the host's epidermal cells; (ii) a modified hemoglobin that may bind hydrogen sulfide produced by two of the worm's symbionts; and (iii) the expression of a very abundant protein for oxygen storage, hemerythrin, that could provide oxygen to the symbionts and the host under anoxic conditions. Additionally, we identified a large repertoire of proteins involved in interactions between the worm's innate immune system and its symbiotic microbiota, such as peptidoglycan recognition proteins, lectins, fibrinogen-related proteins, Toll and scavenger receptors, and antimicrobial proteins. We show how this worm, over the course of evolutionary time, has modified widely-used proteins and changed their expression patterns in adaptation to its symbiotic lifestyle and describe expressed components of the innate immune system in a marine oligochaete. Our results provide further support for the recent realization that animals have evolved within the context of their associations with microbes and that their adaptive responses to symbiotic microbiota have led to biological innovations.

  13. Linear ubiquitination signals in adaptive immune responses.

    Science.gov (United States)

    Ikeda, Fumiyo

    2015-07-01

    Ubiquitin can form eight different linkage types of chains using the intrinsic Met 1 residue or one of the seven intrinsic Lys residues. Each linkage type of ubiquitin chain has a distinct three-dimensional topology, functioning as a tag to attract specific signaling molecules, which are so-called ubiquitin readers, and regulates various biological functions. Ubiquitin chains linked via Met 1 in a head-to-tail manner are called linear ubiquitin chains. Linear ubiquitination plays an important role in the regulation of cellular signaling, including the best-characterized tumor necrosis factor (TNF)-induced canonical nuclear factor-κB (NF-κB) pathway. Linear ubiquitin chains are specifically generated by an E3 ligase complex called the linear ubiquitin chain assembly complex (LUBAC) and hydrolyzed by a deubiquitinase (DUB) called ovarian tumor (OTU) DUB with linear linkage specificity (OTULIN). LUBAC linearly ubiquitinates critical molecules in the TNF pathway, such as NEMO and RIPK1. The linear ubiquitin chains are then recognized by the ubiquitin readers, including NEMO, which control the TNF pathway. Accumulating evidence indicates an importance of the LUBAC complex in the regulation of apoptosis, development, and inflammation in mice. In this article, I focus on the role of linear ubiquitin chains in adaptive immune responses with an emphasis on the TNF-induced signaling pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Interferon alpha inhibits viral replication of a live-attenuated porcine reproductive and respiratory syndrome virus vaccine preventing development of an adaptive immune response in swine

    Science.gov (United States)

    Type I interferons, such as interferon alpha (IFNa), contribute to innate antiviral immunity by promoting production of antiviral mediators and are also involved in promoting an adaptive immune response. Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most devastating and c...

  15. Phylogeny, longevity and evolution of adaptive immunity

    Czech Academy of Sciences Publication Activity Database

    Vinkler, Michal; Albrecht, Tomáš

    2011-01-01

    Roč. 60, č. 3 (2011), s. 277-282 ISSN 0139-7893 R&D Projects: GA ČR GA206/08/0640; GA ČR GA206/08/1281; GA ČR GAP505/10/1871 Institutional research plan: CEZ:AV0Z60930519 Keywords : acquired immunity * evolutionary immunology * immunological priming * innate immunity * invertebrates Subject RIV: EG - Zoology Impact factor: 0.554, year: 2011

  16. Oral immune therapy: targeting the systemic immune system via the gut immune system for the treatment of inflammatory bowel disease.

    Science.gov (United States)

    Ilan, Yaron

    2016-01-01

    Inflammatory bowel diseases (IBD) are associated with an altered systemic immune response leading to inflammation-mediated damage to the gut and other organs. Oral immune therapy is a method of systemic immune modulation via alteration of the gut immune system. It uses the inherit ability of the innate system of the gut to redirect the systemic innate and adaptive immune responses. Oral immune therapy is an attractive clinical approach to treat autoimmune and inflammatory disorders. It can induce immune modulation without immune suppression, has minimal toxicity and is easily administered. Targeting the systemic immune system via the gut immune system can serve as an attractive novel therapeutic method for IBD. This review summarizes the current data and discusses several examples of oral immune therapeutic methods for using the gut immune system to generate signals to reset systemic immunity as a treatment for IBD.

  17. Adaptive maternal immune deviations as a ground for autism spectrum disorders development in children.

    Science.gov (United States)

    Poletaev, Alexander B; Poletaeva, Alina A; Pukhalenko, Alexander I; Zamaleeva, Roza S; Cherepanova, Natalia A; Frizin, Dmitry V

    2014-01-01

    Autism is a vexed problem today. Overall, there is a high frequency of birth children (1:80 - 1:150) with late diagnosed autism spectrum disorders (ASD) and this trend is getting progressively stronger. The causes for the currently increased frequency of ASD and the pathogenesis of ASD are not fully understood yet. One of the most likely mechanisms inducing ASD may be a maternal immune imprinting. This phenomenon is based on transplacental translocation of maternal antibodies of IgG class and, as a consequence, on the epigenetic "tuning" of immune system of the fetus and child. This mechanism provides development of child's anti-infection resistance before meeting with microorganisms, but it can be also a cause of inborn pathology including the ASD appearance. The quantitative changes in maternal blood serum autoantibodies depend on a specific microbial population, or are induced by environmental chemical pollutants in association with some individual features of the maternal metabolism. These immune changes are adaptive in most cases for the maternal organism, but can be pathogenic for the fetus in some cases. We discuss in the present paper the possibilities to predict the risk from abnormal development of nervous system in fetus and early diagnosis of ASD in high-risk group of children.

  18. The role of idiotypic interactions in the adaptive immune system: a belief-propagation approach

    Science.gov (United States)

    Bartolucci, Silvia; Mozeika, Alexander; Annibale, Alessia

    2016-08-01

    In this work we use belief-propagation techniques to study the equilibrium behaviour of a minimal model for the immune system comprising interacting T and B clones. We investigate the effect of the so-called idiotypic interactions among complementary B clones on the system’s activation. Our results show that B-B interactions increase the system’s resilience to noise, making clonal activation more stable, while increasing the cross-talk between different clones. We derive analytically the noise level at which a B clone gets activated, in the absence of cross-talk, and find that this increases with the strength of idiotypic interactions and with the number of T cells sending signals to the B clones. We also derive, analytically and numerically, via population dynamics, the critical line where clonal cross-talk arises. Our approach allows us to derive the B clone size distribution, which can be experimentally measured and gives important information about the adaptive immune system response to antigens and vaccination.

  19. Antitumor effect of malaria parasite infection in a murine Lewis lung cancer model through induction of innate and adaptive immunity.

    Science.gov (United States)

    Chen, Lili; He, Zhengxiang; Qin, Li; Li, Qinyan; Shi, Xibao; Zhao, Siting; Chen, Ling; Zhong, Nanshan; Chen, Xiaoping

    2011-01-01

    Lung cancer is the most common malignancy in humans and its high fatality means that no effective treatment is available. Developing new therapeutic strategies for lung cancer is urgently needed. Malaria has been reported to stimulate host immune responses, which are believed to be efficacious for combating some clinical cancers. This study is aimed to provide evidence that malaria parasite infection is therapeutic for lung cancer. Antitumor effect of malaria infection was examined in both subcutaneously and intravenously implanted murine Lewis lung cancer (LLC) model. The results showed that malaria infection inhibited LLC growth and metastasis and prolonged the survival of tumor-bearing mice. Histological analysis of tumors from mice infected with malaria revealed that angiogenesis was inhibited, which correlated with increased terminal deoxynucleotidyl transferase-mediated (TUNEL) staining and decreased Ki-67 expression in tumors. Through natural killer (NK) cell cytotoxicity activity, cytokine assays, enzyme-linked immunospot assay, lymphocyte proliferation, and flow cytometry, we demonstrated that malaria infection provided anti-tumor effects by inducing both a potent anti-tumor innate immune response, including the secretion of IFN-γ and TNF-α and the activation of NK cells as well as adaptive anti-tumor immunity with increasing tumor-specific T-cell proliferation and cytolytic activity of CD8(+) T cells. Notably, tumor-bearing mice infected with the parasite developed long-lasting and effective tumor-specific immunity. Consequently, we found that malaria parasite infection could enhance the immune response of lung cancer DNA vaccine pcDNA3.1-hMUC1 and the combination produced a synergistic antitumor effect. Malaria infection significantly suppresses LLC growth via induction of innate and adaptive antitumor responses in a mouse model. These data suggest that the malaria parasite may provide a novel strategy or therapeutic vaccine vector for anti-lung cancer

  20. Antitumor effect of malaria parasite infection in a murine Lewis lung cancer model through induction of innate and adaptive immunity.

    Directory of Open Access Journals (Sweden)

    Lili Chen

    Full Text Available BACKGROUND: Lung cancer is the most common malignancy in humans and its high fatality means that no effective treatment is available. Developing new therapeutic strategies for lung cancer is urgently needed. Malaria has been reported to stimulate host immune responses, which are believed to be efficacious for combating some clinical cancers. This study is aimed to provide evidence that malaria parasite infection is therapeutic for lung cancer. METHODOLOGY/PRINCIPAL FINDINGS: Antitumor effect of malaria infection was examined in both subcutaneously and intravenously implanted murine Lewis lung cancer (LLC model. The results showed that malaria infection inhibited LLC growth and metastasis and prolonged the survival of tumor-bearing mice. Histological analysis of tumors from mice infected with malaria revealed that angiogenesis was inhibited, which correlated with increased terminal deoxynucleotidyl transferase-mediated (TUNEL staining and decreased Ki-67 expression in tumors. Through natural killer (NK cell cytotoxicity activity, cytokine assays, enzyme-linked immunospot assay, lymphocyte proliferation, and flow cytometry, we demonstrated that malaria infection provided anti-tumor effects by inducing both a potent anti-tumor innate immune response, including the secretion of IFN-γ and TNF-α and the activation of NK cells as well as adaptive anti-tumor immunity with increasing tumor-specific T-cell proliferation and cytolytic activity of CD8(+ T cells. Notably, tumor-bearing mice infected with the parasite developed long-lasting and effective tumor-specific immunity. Consequently, we found that malaria parasite infection could enhance the immune response of lung cancer DNA vaccine pcDNA3.1-hMUC1 and the combination produced a synergistic antitumor effect. CONCLUSIONS/SIGNIFICANCE: Malaria infection significantly suppresses LLC growth via induction of innate and adaptive antitumor responses in a mouse model. These data suggest that the malaria

  1. Experimental studies on possible regulatory role of nitric oxide on the differential effects of chronic predictable and unpredictable stress on adaptive immune responses.

    Science.gov (United States)

    Thakur, Tarun; Gulati, Kavita; Rai, Nishant; Ray, Arunabha

    2017-09-01

    The present study was designed to investigate the effects of chronic predictable stress (CPS) and chronic unpredictable stress (CUS) on immunological responses in KLH-sensitized rats and involvement of NOergic signaling pathways mediating such responses. Male Wistar rats (200-250g) were exposed to either CPS or CUS for 14days and IgG antibody levels and delayed type hypersensitivity (DTH) response was determined to assess changes in adaptive immunity. To evaluate the role of nitric oxide during such immunomodulation, biochemical estimation of stable metabolite of nitric oxide (NOx) and 3-nitrotyrosine (3-NT, a marker of peroxynitrite formation) were done in both blood and brain. Chronic stress exposure resulted in suppression of IgG and DTH response and elevated NOx and 3-NT levels, with a difference in magnitude of response in CPS vs CUS. Pretreatment with aminoguanidine (iNOS inhibitor) caused further reduction of adaptive immune responses and attenuated the increased NOx and 3-NT levels in CPS or CUS exposed rats. On the other hand 7-NI (nNOS inhibitor) did not significantly affect these estimated parameters. The results suggest involvement of iNOS and lesser/no role of nNOS during modulation of adaptive immunity to stress. Thus, the result showed that predictability of stressors results in differential degree of modulation of immune responses and complex NO-mediated signaling mechanisms may be involved during responses. Copyright © 2017. Published by Elsevier B.V.

  2. Enhancement of human adaptive immune responses by administration of a high-molecular-weight polysaccharide extract from the cyanobacterium Arthrospira platensis

    DEFF Research Database (Denmark)

    Pedersen, Morten Løbner; Walsted, Anette; Larsen, Rune

    2008-01-01

    The effect of consumption of Immulina, a high-molecular-weight polysaccharide extract from the cyanobacterium Arthrospira platensis, on adaptive immune responses was investigated by evaluation of changes in leukocyte responsiveness to two foreign recall antigens, Candida albicans (CA) and tetanus...

  3. The CD47-SIRPα signaling axis as an innate immune checkpoint in cancer.

    Science.gov (United States)

    Matlung, Hanke L; Szilagyi, Katka; Barclay, Neil A; van den Berg, Timo K

    2017-03-01

    Immune checkpoint inhibitors, including those targeting CTLA-4/B7 and the PD-1/PD-L1 inhibitory pathways, are now available for clinical use in cancer patients, with other interesting checkpoint inhibitors being currently in development. Most of these have the purpose to promote adaptive T cell-mediated immunity against cancer. Here, we review another checkpoint acting to potentiate the activity of innate immune cells towards cancer. This innate immune checkpoint is composed of what has become known as the 'don't-eat me' signal CD47, which is a protein broadly expressed on normal cells and often overexpressed on cancer cells, and its counter-receptor, the myeloid inhibitory immunoreceptor SIRPα. Blocking CD47-SIRPα interactions has been shown to promote the destruction of cancer cells by phagocytes, including macrophages and neutrophils. Furthermore, there is growing evidence that targeting of the CD47-SIRPα axis may also promote antigen-presenting cell function and thereby stimulate adaptive T cell-mediated anti-cancer immunity. The development of CD47-SIRPα checkpoint inhibitors and the potential side effects that these may have are discussed. Collectively, this identifies the CD47-SIRPα axis as a promising innate immune checkpoint in cancer, and with data of the first clinical studies with CD47-SIRPα checkpoint inhibitors expected within the coming years, this is an exciting and rapidly developing field. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Adaptive immunity in autoimmune hepatitis.

    Science.gov (United States)

    Longhi, Maria Serena; Ma, Yun; Mieli-Vergani, Giorgina; Vergani, Diego

    2010-01-01

    The histological lesion of interface hepatitis, with its dense portal cell infiltrate consisting of lymphocytes, monocytes/macrophages and plasma cells, was the first to suggest an autoaggressive cellular immune attack in the pathogenesis of autoimmune hepatitis (AIH). Immunohistochemical studies, focused on the phenotype of inflammatory cells infiltrating the liver parenchyma, have shown a predominance of alphabeta-T cells. Amongst these cells, the majority have been CD4 helper/inducers, while a sizeable minority have consisted of CD8 cytotoxic/suppressors. Lymphocytes on non-T cell lineage included natural killer cells, monocytes/macrophages and B lymphocytes. For autoimmunity to arise, the self-antigenic peptide, embraced by an human leukocyte antigen (HLA) class II molecule, must be presented to an uncommitted T helper (T(H)0) lymphocyte by professional antigen-presenting cells. Once activated and according to the presence in the milieu of interleukin 12 (IL-12) or IL-4, T(H)0 lymphocytes can differentiate into T(H)1 cells, which are pivotal to macrophage activation; enhance HLA class I expression, rendering liver cells vulnerable to CD8 T-cell attack; and induce HLA class II expression on hepatocytes; or they can differentiate into T(H)2 cells, which produce IL-4, IL-10 and IL-13, cytokines favouring autoantibody production by B lymphocytes. Autoantigen recognition is tightly controlled by regulatory mechanisms, such as those exerted by CD4+CD25(high) regulatory T cells. Numerical and functional regulatory T cell impairment characterises AIH and permits the perpetuation of effector immune responses with ensuing persistent liver destruction. Advances in the study of autoreactive T cells stem mostly from AIH type 2, where the main autoantigen, cytochrome P450IID6 (CYP2D6), is known to enable characterisation of antigen-specific immune responses. Copyright 2010 S. Karger AG, Basel.

  5. The two sides of complement C3d: evolution of electrostatics in a link between innate and adaptive immunity.

    Science.gov (United States)

    Kieslich, Chris A; Morikis, Dimitrios

    2012-01-01

    The interaction between complement fragment C3d and complement receptor 2 (CR2) is a key aspect of complement immune system activation, and is a component in a link between innate and adaptive immunities. The complement immune system is an ancient mechanism for defense, and can be found in species that have been on Earth for the last 600 million years. However, the link between the complement system and adaptive immunity, which is formed through the association of the B-cell co-receptor complex, including the C3d-CR2 interaction, is a much more recent adaptation. Human C3d and CR2 have net charges of -1 and +7 respectively, and are believed to have evolved favoring the role of electrostatics in their functions. To investigate the role of electrostatics in the function and evolution of human C3d and CR2, we have applied electrostatic similarity methods to identify regions of evolutionarily conserved electrostatic potential based on 24 homologues of complement C3d and 4 homologues of CR2. We also examine the effects of structural perturbation, as introduced through molecular dynamics and mutations, on spatial distributions of electrostatic potential to identify perturbation resistant regions, generated by so-called electrostatic "hot-spots". Distributions of electrostatic similarity based on families of perturbed structures illustrate the presence of electrostatic "hot-spots" at the two functional sites of C3d, while the surface of CR2 lacks electrostatic "hot-spots" despite its excessively positive nature. We propose that the electrostatic "hot-spots" of C3d have evolved to optimize its dual-functionality (covalently attaching to pathogen surfaces and interaction with CR2), which are both necessary for the formation B-cell co-receptor complexes. Comparison of the perturbation resistance of the electrostatic character of the homologues of C3d suggests that there was an emergence of a new role of electrostatics, and a transition in the function of C3d, after the

  6. The two sides of complement C3d: evolution of electrostatics in a link between innate and adaptive immunity.

    Directory of Open Access Journals (Sweden)

    Chris A Kieslich

    Full Text Available The interaction between complement fragment C3d and complement receptor 2 (CR2 is a key aspect of complement immune system activation, and is a component in a link between innate and adaptive immunities. The complement immune system is an ancient mechanism for defense, and can be found in species that have been on Earth for the last 600 million years. However, the link between the complement system and adaptive immunity, which is formed through the association of the B-cell co-receptor complex, including the C3d-CR2 interaction, is a much more recent adaptation. Human C3d and CR2 have net charges of -1 and +7 respectively, and are believed to have evolved favoring the role of electrostatics in their functions. To investigate the role of electrostatics in the function and evolution of human C3d and CR2, we have applied electrostatic similarity methods to identify regions of evolutionarily conserved electrostatic potential based on 24 homologues of complement C3d and 4 homologues of CR2. We also examine the effects of structural perturbation, as introduced through molecular dynamics and mutations, on spatial distributions of electrostatic potential to identify perturbation resistant regions, generated by so-called electrostatic "hot-spots". Distributions of electrostatic similarity based on families of perturbed structures illustrate the presence of electrostatic "hot-spots" at the two functional sites of C3d, while the surface of CR2 lacks electrostatic "hot-spots" despite its excessively positive nature. We propose that the electrostatic "hot-spots" of C3d have evolved to optimize its dual-functionality (covalently attaching to pathogen surfaces and interaction with CR2, which are both necessary for the formation B-cell co-receptor complexes. Comparison of the perturbation resistance of the electrostatic character of the homologues of C3d suggests that there was an emergence of a new role of electrostatics, and a transition in the function of C3

  7. Cold-adapted influenza and recombinant adenovirus vaccines induce cross-protective immunity against pH1N1 challenge in mice.

    Directory of Open Access Journals (Sweden)

    Mark R Soboleski

    Full Text Available The rapid spread of the 2009 H1N1 pandemic influenza virus (pH1N1 highlighted problems associated with relying on strain-matched vaccines. A lengthy process of strain identification, manufacture, and testing is required for current strain-matched vaccines and delays vaccine availability. Vaccines inducing immunity to conserved viral proteins could be manufactured and tested in advance and provide cross-protection against novel influenza viruses until strain-matched vaccines became available. Here we test two prototype vaccines for cross-protection against the recent pandemic virus.BALB/c and C57BL/6 mice were intranasally immunized with a single dose of cold-adapted (ca influenza viruses from 1977 or recombinant adenoviruses (rAd expressing 1934 nucleoprotein (NP and consensus matrix 2 (M2 (NP+M2-rAd. Antibodies against the M2 ectodomain (M2e were seen in NP+M2-rAd immunized BALB/c but not C57BL/6 mice, and cross-reacted with pH1N1 M2e. The ca-immunized mice did not develop antibodies against M2e. Despite sequence differences between vaccine and challenge virus NP and M2e epitopes, extensive cross-reactivity of lung T cells with pH1N1 peptides was detected following immunization. Both ca and NP+M2-rAd immunization protected BALB/c and C57BL/6 mice against challenge with a mouse-adapted pH1N1 virus.Cross-protective vaccines such as NP+M2-rAd and ca virus are effective against pH1N1 challenge within 3 weeks of immunization. Protection was not dependent on recognition of the highly variable external viral proteins and could be achieved with a single vaccine dose. The rAd vaccine was superior to the ca vaccine by certain measures, justifying continued investigation of this experimental vaccine even though ca vaccine is already available. This study highlights the potential for cross-protective vaccines as a public health option early in an influenza pandemic.

  8. PERINATAL MALNUTRITION AND THE PROTECTIVE ROLE OF THE PHYSICAL TRAINING ON THE IMMUNE SYSTEM.

    Science.gov (United States)

    Moreno Senna, Sueli; Ferraz, José Cândido; Leandro, Carol Góis

    2015-09-01

    Developing organisms have the ability to cope with environmental demands through physiologic and morphologic adaptations. Early life malnutrition has been recognized as an environmental stimulus that is related with down-regulation of immune responses. Some of these effects are explained by the epigenetics and the programming of hormones and cytokines impairing the modulation of the immune cells in response to environmental stimuli. Recently, it has been demonstrated that these effects are not deterministic and current environment, such as physical activity, can positively influence the immune system. Here, we discuss the effects of perinatal malnutrition on the immune system and how it can be modulated by physical training. The mechanism includes the normalization of some hormones concentrations related to growth and metabolism such as leptin, IGF-1 and glucocorticoids. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  9. Adaptive Linear and Normalized Combination of Radial Basis Function Networks for Function Approximation and Regression

    Directory of Open Access Journals (Sweden)

    Yunfeng Wu

    2014-01-01

    Full Text Available This paper presents a novel adaptive linear and normalized combination (ALNC method that can be used to combine the component radial basis function networks (RBFNs to implement better function approximation and regression tasks. The optimization of the fusion weights is obtained by solving a constrained quadratic programming problem. According to the instantaneous errors generated by the component RBFNs, the ALNC is able to perform the selective ensemble of multiple leaners by adaptively adjusting the fusion weights from one instance to another. The results of the experiments on eight synthetic function approximation and six benchmark regression data sets show that the ALNC method can effectively help the ensemble system achieve a higher accuracy (measured in terms of mean-squared error and the better fidelity (characterized by normalized correlation coefficient of approximation, in relation to the popular simple average, weighted average, and the Bagging methods.

  10. Oncolytic Viral Therapy and the Immune System: A Double-Edged Sword Against Cancer.

    Science.gov (United States)

    Marelli, Giulia; Howells, Anwen; Lemoine, Nicholas R; Wang, Yaohe

    2018-01-01

    Oncolytic viral therapy is a new promising strategy against cancer. Oncolytic viruses (OVs) can replicate in cancer cells but not in normal cells, leading to lysis of the tumor mass. Beside this primary effect, OVs can also stimulate the immune system. Tumors are an immuno-suppressive environment in which the immune system is silenced in order to avoid the immune response against cancer cells. The delivery of OVs into the tumor wakes up the immune system so that it can facilitate a strong and durable response against the tumor itself. Both innate and adaptive immune responses contribute to this process, producing an immune response against tumor antigens and facilitating immunological memory. However, viruses are recognized by the immune system as pathogens and the consequent anti-viral response could represent a big hurdle for OVs. Finding a balance between anti-tumor and anti-viral immunity is, under this new light, a priority for researchers. In this review, we provide an overview of the various ways in which different components of the immune system can be allied with OVs. We have analyzed the different immune responses in order to highlight the new and promising perspectives leading to increased anti-tumor response and decreased immune reaction to the OVs.

  11. The twilight of immunity: emerging concepts in aging of the immune system.

    Science.gov (United States)

    Nikolich-Žugich, Janko

    2018-01-01

    Immunosenescence is a series of age-related changes that affect the immune system and, with time, lead to increased vulnerability to infectious diseases. This Review addresses recent developments in the understanding of age-related changes that affect key components of immunity, including the effect of aging on cells of the (mostly adaptive) immune system, on soluble molecules that guide the maintenance and function of the immune system and on lymphoid organs that coordinate both the maintenance of lymphocytes and the initiation of immune responses. I further address the effect of the metagenome and exposome as key modifiers of immune-system aging and discuss a conceptual framework in which age-related changes in immunity might also affect the basic rules by which the immune system operates.

  12. The interaction between regulatory T cells and NKT cells in the liver: a CD1d bridge links innate and adaptive immunity.

    Science.gov (United States)

    Hua, Jing; Liang, Shuwen; Ma, Xiong; Webb, Tonya J; Potter, James P; Li, Zhiping

    2011-01-01

    Regulatory T cells (Tregs) and natural killer T (NKT) cells are two distinct lymphocyte subsets that independently regulate hepatic adaptive and innate immunity, respectively. In the current study, we examine the interaction between Tregs and NKT cells to understand the mechanisms of cross immune regulation by these cells. The frequency and function of Tregs were evaluated in wild type and NKT cell deficient (CD1dko) mice. In vitro lymphocyte proliferation and apoptosis assays were performed with NKT cells co-cultured with Tregs. The ability of Tregs to inhibit NKT cells in vivo was examined by adoptive transfer of Tregs in a model of NKT cell mediated hepatitis. CD1dko mice have a significant reduction in hepatic Tregs. Although, the Tregs from CD1dko mice remain functional and can suppress conventional T cells, their ability to suppress activation induced NKT cell proliferation and to promote NKT cell apoptosis is greatly diminished. These effects are CD1d dependent and require cell to cell contact. Adoptive transfer of Tregs inhibits NKT cell-mediated liver injury. NKT cells promote Tregs, and Tregs inhibit NKT cells in a CD1d dependent manner requiring cell to cell contact. These cross-talk immune regulations provide a linkage between innate and adaptive immunity.

  13. The role of the adaptive immune system in burn-induced heterotopic ossification and mesenchymal cell osteogenic differentiation.

    Science.gov (United States)

    Ranganathan, Kavitha; Agarwal, Shailesh; Cholok, David; Loder, Shawn; Li, Jonathan; Sung Hsieh, Hsiao Hsin; Wang, Stewart C; Buchman, Steven R; Levi, Benjamin

    2016-11-01

    Heterotopic ossification (HO) is the pathologic process of extraskeletal bone formation. Although the exact etiology remains unknown, inflammation appears to catalyze disease progression. The goal of this study is to determine the impact of the adaptive immune system on HO. HO was induced in 8-wk-old control C57BL/6 and immunocompromised Rag1tm1Mom (Rag1 KO) male mice deficient in B- and T-lymphocytes via combined Achilles tenotomy and burn injury. Microcomputed tomography quantified the extent of HO formation at the tenotomy site. Adipose-derived mesenchymal stem cells were harvested to evaluate osteogenic differentiation potential. Areas of developing HO demonstrated substantial enrichment of CD45 + leukocytes at 3 wk after injury. HO from Rag1 KO mice was substantially less mature with foci of cartilage and disorganized trabecular bone present 12 wk after injury. Rag1 KO mice formed 60% less bone compared to immunocompetent controls (4.67 ± 1.5 mm versus 7.76 ± 0.65 mm; P = 0.001). Tartrate-resistant acid phosphatase staining and immunofluorescent analysis of osteoprotegerin and nuclear factor kappa-light-chain-enhancer of activated B cells demonstrated no appreciable difference in osteoclast number or activation. Alizarin red staining in vitro demonstrated a significant decrease in osteogenic potential in immunocompromised mice compared to controls (29.1 ± 0.54 mm versus 12.1 ± 0.14 mm; P role for the adaptive immune system in the development of HO. In the absence of mature B- and T-lymphocytes, HO growth and development are attenuated. Furthermore, we demonstrate that mesenchymal populations from B- and T-cell deficient mice are inherently less osteogenic. This study identifies a potential therapeutic role for modulation of the adaptive immune system in the treatment of HO. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity

    Science.gov (United States)

    2006-07-06

    P.J. (1989) Effect of Streptococcus pneumoniae on human respiratory epithelium in vitro. Infect. Immun. 57: 2006-2013. Stoop, J.N., van der Molen ...antibiotics. Clin. Microbiol. Rev. 3: 171-196. Knapp, S., Wieland, C.W., van ’t Veer, C., Takeuchi, O., Akira, S., Florquin, S., and van der Poll...R.G., Baan, C.C., van der Laan, L.J., Kuipers, E.J., Kusters, J.G., and Janssen, H.L. (2005) Regulatory T cells contribute to the impaired immune

  15. Starvation stress affects the interplay among shrimp gut microbiota, digestion and immune activities.

    Science.gov (United States)

    Dai, Wen-Fang; Zhang, Jin-Jie; Qiu, Qiong-Fen; Chen, Jiong; Yang, Wen; Ni, Sui; Xiong, Jin-Bo

    2018-05-24

    Aquatic animals are frequently suffered from starvation due to restricted food availability or deprivation. It is currently known that gut microbiota assists host in nutrient acquisition. Thus, exploring the gut microbiota responses would improve our understanding on physiological adaptation to starvation. To achieve this, we investigated how the gut microbiota and shrimp digestion and immune activities were affected under starvation stress. The results showed that the measured digestion activities in starved shrimp were significantly lower than in normal cohorts; while the measured immune activities exhibited an opposite trend. A structural equation modeling (SEM) revealed that changes in the gut bacterial community were directly related to digestive and immune enzyme activities, which in turn markedly affected shrimp growth traits. Notably, several gut bacterial indicators that characterized the shrimp nutrient status were identified, with more abundant opportunistic pathogens in starved shrimp, although there were no statistical differences in the overall diversity and the structures of gut bacterial communities between starved and normal shrimp. Starved shrimp exhibited less connected and cooperative interspecies interaction as compared with normal cohorts. Additionally, the functional pathways involved in carbohydrate and protein digestion, glycan biosynthesis, lipid and enzyme metabolism remarkably decreased in starved shrimp. These attenuations could increase the susceptibility of starved shrimp to pathogens infection. In summary, this study provides novel insights into the interplay among shrimp digestion, immune activities and gut microbiota in response to starvation stress. Copyright © 2018. Published by Elsevier Ltd.

  16. Cardiac allograft immune activation: current perspectives

    Directory of Open Access Journals (Sweden)

    Chang D

    2014-12-01

    Full Text Available David Chang, Jon Kobashigawa Cedars-Sinai Heart Institute, Los Angeles, CA, USA Abstract: Heart transplant remains the most durable option for end-stage heart disease. Cardiac allograft immune activation and heart transplant rejection remain among the main complications limiting graft and recipient survival. Mediators of the immune system can cause different forms of rejection post-heart transplant. Types of heart transplant rejection include hyperacute rejection, cellular rejection, antibody-mediated rejection, and chronic rejection. In this review, we will summarize the innate and adaptive immune responses which influence the post-heart transplant recipient. Different forms of rejection and their clinical presentation, detection, and immune monitoring will be discussed. Treatment of heart transplant rejection will be examined. We will discuss potential treatment strategies for preventing rejection post-transplant in immunologically high-risk patients with antibody sensitization. Keywords: heart transplant, innate immunity, adaptive immunity, rejection, immunosuppression

  17. MenTORing Immunity: mTOR Signaling in the Development and Function of Tissue-Resident Immune Cells.

    Science.gov (United States)

    Jones, Russell G; Pearce, Edward J

    2017-05-16

    Tissue-resident immune cells must balance survival in peripheral tissues with the capacity to respond rapidly upon infection or tissue damage, and in turn couple these responses with intrinsic metabolic control and conditions in the tissue microenvironment. The serine/threonine kinase mammalian/mechanistic target of rapamycin (mTOR) is a central integrator of extracellular and intracellular growth signals and cellular metabolism and plays important roles in both innate and adaptive immune responses. This review discusses the function of mTOR signaling in the differentiation and function of tissue-resident immune cells, with focus on the role of mTOR as a metabolic sensor and its impact on metabolic regulation in innate and adaptive immune cells. We also discuss the impact of metabolic constraints in tissues on immune homeostasis and disease, and how manipulating mTOR activity with drugs such as rapamycin can modulate immunity in these contexts. Copyright © 2017. Published by Elsevier Inc.

  18. Pressure Induced Changes in Adaptive Immune Function in Belugas (Delphinapterus leucas; implications for dive physiology and health

    Directory of Open Access Journals (Sweden)

    Laura A Thompson

    2016-09-01

    Full Text Available Increased pressure, associated with diving, can alter cell function through several mechanisms and has been shown to impact immune functions performed by peripheral blood mononuclear cells (PBMC in humans. While marine mammals possess specific adaptations which protect them from dive related injury, it is unknown how their immune system is adapted to the challenges associated with diving. The purpose of this study was to measure PBMC activation (IL2R expression and Concanavalin A induced lymphocyte proliferation (BrdU incorporation in belugas following in vitro pressure exposures during baseline, Out of Water Examination (OWE and capture/release conditions. Beluga blood samples (n=4 were obtained from animals at the Mystic Aquarium and from free ranging animals in Alaska (n=9. Human blood samples (n=4 (Biological Specialty Corporation were run for comparison. In vivo catecholamines and cortisol were measured in belugas to characterize the neuroendocrine response. Comparison of cellular responses between controls and pressure exposed cells, between conditions in belugas, between belugas and humans as well as between dive profiles, were run using mixed generalized linear models (α=0.05. Cortisol was significantly higher in wild belugas and OWE samples as compared with baseline for aquarium animals. Both IL2R expression and proliferation displayed significant pressure induced changes, and these responses varied between conditions in belugas. Both belugas and humans displayed increased IL2R expression, while lymphocyte proliferation decreased for aquarium animals and increased for humans and wild belugas. Results suggest beluga PBMC function is altered during diving and changes may represent dive adaptation as the response differs from humans, a non-dive adapted mammal. In addition, characteristics of a dive (i.e., duration, depth as well as neuroendocrine activity can alter the response of beluga cells, potentially impacting the ability of animals

  19. EFSA NDA Panel (EFSA Panel on Dietetic Products, Nutrition and Allergies), 2014 . Scientific Opinion on the substantiation of a health claim related to zinc and normal function of the immune system pursuant to Article 14 of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    substantiation of a health claim related to zinc and normal function of the immune system. The food constituent, zinc, which is the subject of the health claim is sufficiently characterised. Normal function of the immune system is a beneficial physiological effect for infants and young children. A claim on zinc...... and function of the immune system in the general population has already been assessed with a favourable outcome. The Panel considers that the role of zinc in normal function of the immune system applies to all ages, including infants and young children (from birth to three years). The Panel concludes...... that a cause and effect relationship has been established between the dietary intake of zinc and normal function of the immune system. The following wording reflects the scientific evidence: “zinc contributes to normal function of the immune system”....

  20. Influence of phthalates on in vitro innate and adaptive immune responses.

    Directory of Open Access Journals (Sweden)

    Juliana Frohnert Hansen

    Full Text Available Phthalates are a group of endocrine disrupting chemicals, suspected to influence the immune system. The aim of this study was to investigate the influence of phthalates on cytokine secretion from human peripheral blood mononuclear cells. Escherichia coli lipopolysaccharide and phytohemagglutinin-P were used for stimulation of monocytes/macrophages and T cells, respectively. Cells were exposed for 20 to 22 hours to either di-ethyl, di-n-butyl or mono-n-butyl phthalate at two different concentrations. Both diesters were metabolised to their respective monoester and influenced cytokine secretion from both monocytes/macrophages and T cells in a similar pattern: the secretion of interleukin (IL-6, IL-10 and the chemokine CXCL8 by monocytes/macrophages was enhanced, while tumour necrosis factor (TNF-α secretion by monocytes/macrophages was impaired, as was the secretion of IL-2 and IL-4, TNF-α and interferon-γ by T cells. The investigated phthalate monoester also influenced cytokine secretion from monocytes/macrophages similar to that of the diesters. In T cells, however, the effect of the monoester was different compared to the diesters. The influence of the phthalates on the cytokine secretion did not seem to be a result of cell death. Thus, results indicate that both human innate and adaptive immunity is influenced in vitro by phthalates, and that phthalates therefore may affect cell differentiation and regenerative and inflammatory processes in vivo.

  1. Vitamin B5 Reduces Bacterial Growth via Regulating Innate Immunity and Adaptive Immunity in Mice Infected with Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Wenting He

    2018-02-01

    Full Text Available The mechanisms by which vitamins regulate immunity and their effect as an adjuvant treatment for tuberculosis have gradually become very important research topics. Studies have found that vitamin B5 (VB5 can promote epithelial cells to express inflammatory cytokines. We aimed to examine the proinflammatory and antibacterial effect of VB5 in macrophages infected with Mycobacterium tuberculosis (MTB strain H37Rv and the therapeutic potential of VB5 in vivo with tuberculosis. We investigated the activation of inflammatory signal molecules (NF-κB, AKT, JNK, ERK, and p38, the expression of two primary inflammatory cytokines (tumor necrosis factor and interleukin-6 and the bacterial burdens in H37Rv-infected macrophages stimulated with VB5 to explore the effect of VB5 on the inflammatory and antibacterial responses of macrophages. We further treated the H37Rv-infected mice with VB5 to explore VB5’s promotion of the clearance of H37Rv in the lungs and the effect of VB5 on regulating the percentage of inflammatory cells. Our data showed that VB5 enhanced the phagocytosis and inflammatory response in macrophages infected with H37Rv. Oral administration of VB5 decreased the number of colony-forming units of H37Rv in lungs of mice at 1, 2, and 4 weeks after infection. In addition, VB5 regulated the percentage of macrophages and promoted CD4+ T cells to express interferon-γ and interleukin-17; however, it had no effect on the percentage of polymorphonuclear neutrophils, CD4+ and CD8+ T cells. In conclusion, VB5 significantly inhibits the growth of MTB by regulating innate immunity and adaptive immunity.

  2. Cellular immune responses to respiratory viruses

    NARCIS (Netherlands)

    van Helden, M.J.G.

    2011-01-01

    When a respiratory virus successfully infects the lungs, cascades of immune responses are initiated aimed to remove the pathogen. Immediate non-specific protection is provided by the innate immune system and this reduces the viral load during the first days of infection. The adaptive immune response

  3. The role of extracellular vesicles when innate meets adaptive.

    Science.gov (United States)

    Groot Kormelink, Tom; Mol, Sanne; de Jong, Esther C; Wauben, Marca H M

    2018-04-03

    Innate immune cells are recognized for their rapid and critical contribution to the body's first line of defense against invading pathogens and harmful agents. These actions can be further amplified by specific adaptive immune responses adapted to the activating stimulus. Recently, the awareness has grown that virtually all innate immune cells, i.e., mast cells, neutrophils, macrophages, eosinophils, basophils, and NK cells, are able to communicate with dendritic cells (DCs) and/or T and B cells, and thereby significantly contribute to the orchestration of adaptive immune responses. The means of communication that are thus far primarily associated with this function are cell-cell contacts and the release of a broad range of soluble mediators. Moreover, the possible contribution of innate immune cell-derived extracellular vesicles (EVs) to the modulation of adaptive immunity will be outlined in this review. EVs are submicron particles composed of a lipid bilayer, proteins, and nucleic acids released by cells in a regulated fashion. EVs are involved in intercellular communication between multiple cell types, including those of the immune system. A good understanding of the mechanisms by which innate immune cell-derived EVs influence adaptive immune responses, or vice versa, may reveal novel insights in the regulation of the immune system and can open up new possibilities for EVs (or their components) in controlling immune responses, either as a therapy, target, or as an adjuvant in future immune modulating treatments.

  4. Reversibility of alcohol-induced immune depression

    DEFF Research Database (Denmark)

    Tønnesen, H; Kaiser, A H; Nielsen, B B

    1992-01-01

    Alcohol abusers have suppressed cellular immune function. The aim of the study was to investigate the time of sobriety required to normalize immune function. Delayed hypersensitivity was investigated during disulfiram controlled abstinence in ten heavy alcoholics and in seven moderate drinkers...... months of abstinence. The results suggest that while 2 weeks of abstinence from alcohol will improve the depressed cellular immunity, 2 months of sobriety is necessary to normalize it....

  5. Regulation of intestinal homeostasis by innate immune cells.

    Science.gov (United States)

    Kayama, Hisako; Nishimura, Junichi; Takeda, Kiyoshi

    2013-12-01

    The intestinal immune system has an ability to distinguish between the microbiota and pathogenic bacteria, and then activate pro-inflammatory pathways against pathogens for host defense while remaining unresponsive to the microbiota and dietary antigens. In the intestine, abnormal activation of innate immunity causes development of several inflammatory disorders such as inflammatory bowel diseases (IBD). Thus, activity of innate immunity is finely regulated in the intestine. To date, multiple innate immune cells have been shown to maintain gut homeostasis by preventing inadequate adaptive immune responses in the murine intestine. Additionally, several innate immune subsets, which promote Th1 and Th17 responses and are implicated in the pathogenesis of IBD, have recently been identified in the human intestinal mucosa. The demonstration of both murine and human intestinal innate immune subsets contributing to regulation of adaptive immunity emphasizes the conserved innate immune functions across species and might promote development of the intestinal innate immunity-based clinical therapy.

  6. Trichomoniasis immunity and the involvement of the purinergic signaling

    Directory of Open Access Journals (Sweden)

    Camila Braz Menezes

    2016-08-01

    Full Text Available Innate and adaptive immunity play a significant role in trichomoniasis, the most common non-viral sexually transmitted disease worldwide. In the urogenital tract, innate immunity is accomplished by a defense physical barrier constituted by epithelial cells, mucus, and acidic pH. During infection, immune cells, antimicrobial peptides, cytokines, chemokines, and adaptive immunity evolve in the reproductive tract, and a proinflammatory response is generated to eliminate the invading extracellular pathogen Trichomonas vaginalis. However, the parasite has developed complex evolutionary mechanisms to evade the host immune response through cysteine proteases, phenotypic variation, and molecular mimicry. The purinergic system constitutes a signaling cellular net where nucleotides and nucleosides, enzymes, purinoceptors and transporters are involved in almost all cells and tissues signaling pathways, especially in central and autonomic nervous systems, endocrine, respiratory, cardiac, reproductive, and immune systems, during physiological as well as pathological processes. The involvement of the purinergic system in T. vaginalis biology and infection has been demonstrated and this review highlights the participation of this signaling pathway in the parasite immune evasion strategies. Keywords: Trichomoniasis, Innate immune response, Adaptive immune response, Evasion mechanisms, Purinergic signaling

  7. Cold-Adapted Influenza and Recombinant Adenovirus Vaccines Induce Cross-Protective Immunity against pH1N1 Challenge in Mice

    Science.gov (United States)

    Soboleski, Mark R.; Gabbard, Jon D.; Price, Graeme E.; Misplon, Julia A.; Lo, Chia-Yun; Perez, Daniel R.; Ye, Jianqiang; Tompkins, S. Mark; Epstein, Suzanne L.

    2011-01-01

    Background The rapid spread of the 2009 H1N1 pandemic influenza virus (pH1N1) highlighted problems associated with relying on strain-matched vaccines. A lengthy process of strain identification, manufacture, and testing is required for current strain-matched vaccines and delays vaccine availability. Vaccines inducing immunity to conserved viral proteins could be manufactured and tested in advance and provide cross-protection against novel influenza viruses until strain-matched vaccines became available. Here we test two prototype vaccines for cross-protection against the recent pandemic virus. Methodology/Principal Findings BALB/c and C57BL/6 mice were intranasally immunized with a single dose of cold-adapted (ca) influenza viruses from 1977 or recombinant adenoviruses (rAd) expressing 1934 nucleoprotein (NP) and consensus matrix 2 (M2) (NP+M2-rAd). Antibodies against the M2 ectodomain (M2e) were seen in NP+M2-rAd immunized BALB/c but not C57BL/6 mice, and cross-reacted with pH1N1 M2e. The ca-immunized mice did not develop antibodies against M2e. Despite sequence differences between vaccine and challenge virus NP and M2e epitopes, extensive cross-reactivity of lung T cells with pH1N1 peptides was detected following immunization. Both ca and NP+M2-rAd immunization protected BALB/c and C57BL/6 mice against challenge with a mouse-adapted pH1N1 virus. Conclusion/Significance Cross-protective vaccines such as NP+M2-rAd and ca virus are effective against pH1N1 challenge within 3 weeks of immunization. Protection was not dependent on recognition of the highly variable external viral proteins and could be achieved with a single vaccine dose. The rAd vaccine was superior to the ca vaccine by certain measures, justifying continued investigation of this experimental vaccine even though ca vaccine is already available. This study highlights the potential for cross-protective vaccines as a public health option early in an influenza pandemic. PMID:21789196

  8. Immune Evasion by Epstein-Barr Virus.

    Science.gov (United States)

    Ressing, Maaike E; van Gent, Michiel; Gram, Anna M; Hooykaas, Marjolein J G; Piersma, Sytse J; Wiertz, Emmanuel J H J

    2015-01-01

    Epstein-Bar virus (EBV) is widespread within the human population with over 90% of adults being infected. In response to primary EBV infection, the host mounts an antiviral immune response comprising both innate and adaptive effector functions. Although the immune system can control EBV infection to a large extent, the virus is not cleared. Instead, EBV establishes a latent infection in B lymphocytes characterized by limited viral gene expression. For the production of new viral progeny, EBV reactivates from these latently infected cells. During the productive phase of infection, a repertoire of over 80 EBV gene products is expressed, presenting a vast number of viral antigens to the primed immune system. In particular the EBV-specific CD4+ and CD8+ memory T lymphocytes can respond within hours, potentially destroying the virus-producing cells before viral replication is completed and viral particles have been released. Preceding the adaptive immune response, potent innate immune mechanisms provide a first line of defense during primary and recurrent infections. In spite of this broad range of antiviral immune effector mechanisms, EBV persists for life and continues to replicate. Studies performed over the past decades have revealed a wide array of viral gene products interfering with both innate and adaptive immunity. These include EBV-encoded proteins as well as small noncoding RNAs with immune-evasive properties. The current review presents an overview of the evasion strategies that are employed by EBV to facilitate immune escape during latency and productive infection. These evasion mechanisms may also compromise the elimination of EBV-transformed cells, and thus contribute to malignancies associated with EBV infection.

  9. Filoviral Immune Evasion Mechanisms

    Directory of Open Access Journals (Sweden)

    Christopher F. Basler

    2011-09-01

    Full Text Available The Filoviridae family of viruses, which includes the genera Ebolavirus (EBOV and Marburgvirus (MARV, causes severe and often times lethal hemorrhagic fever in humans. Filoviral infections are associated with ineffective innate antiviral responses as a result of virally encoded immune antagonists, which render the host incapable of mounting effective innate or adaptive immune responses. The Type I interferon (IFN response is critical for establishing an antiviral state in the host cell and subsequent activation of the adaptive immune responses. Several filoviral encoded components target Type I IFN responses, and this innate immune suppression is important for viral replication and pathogenesis. For example, EBOV VP35 inhibits the phosphorylation of IRF-3/7 by the TBK-1/IKKε kinases in addition to sequestering viral RNA from detection by RIG-I like receptors. MARV VP40 inhibits STAT1/2 phosphorylation by inhibiting the JAK family kinases. EBOV VP24 inhibits nuclear translocation of activated STAT1 by karyopherin-α. The examples also represent distinct mechanisms utilized by filoviral proteins in order to counter immune responses, which results in limited IFN-α/β production and downstream signaling.

  10. Functions of innate immune cells and commensal bacteria in gut homeostasis.

    Science.gov (United States)

    Kayama, Hisako; Takeda, Kiyoshi

    2016-02-01

    The intestinal immune system remains unresponsive to beneficial microbes and dietary antigens while activating pro-inflammatory responses against pathogens for host defence. In intestinal mucosa, abnormal activation of innate immunity, which directs adaptive immune responses, causes the onset and/or progression of inflammatory bowel diseases. Thus, innate immunity is finely regulated in the gut. Multiple innate immune cell subsets have been identified in both murine and human intestinal lamina propria. Some innate immune cells play a key role in the maintenance of gut homeostasis by preventing inappropriate adaptive immune responses while others are associated with the pathogenesis of intestinal inflammation through development of Th1 and Th17 cells. In addition, intestinal microbiota and their metabolites contribute to the regulation of innate/adaptive immune responses. Accordingly, perturbation of microbiota composition can trigger intestinal inflammation by driving inappropriate immune responses. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  11. Paucity of PD-L1 expression in prostate cancer: innate and adaptive immune resistance.

    Science.gov (United States)

    Martin, A M; Nirschl, T R; Nirschl, C J; Francica, B J; Kochel, C M; van Bokhoven, A; Meeker, A K; Lucia, M S; Anders, R A; DeMarzo, A M; Drake, C G

    2015-12-01

    Primary prostate cancers are infiltrated with programmed death-1 (PD-1) expressing CD8+ T-cells. However, in early clinical trials, men with metastatic castrate-resistant prostate cancer did not respond to PD-1 blockade as a monotherapy. One explanation for this unresponsiveness could be that prostate tumors generally do not express programmed death ligand-1 (PD-L1), the primary ligand for PD-1. However, lack of PD-L1 expression in prostate cancer would be surprising, given that phosphatase and tensin homolog (PTEN) loss is relatively common in prostate cancer and several studies have shown that PTEN loss correlates with PD-L1 upregulation--constituting a mechanism of innate immune resistance. This study tested whether prostate cancer cells were capable of expressing PD-L1, and whether the rare PD-L1 expression that occurs in human specimens correlates with PTEN loss. Human prostate cancer cell lines were evaluated for PD-L1 expression and loss of PTEN by flow cytometry and western blotting, respectively. Immunohistochemical (IHC) staining for PTEN was correlated with PD-L1 IHC using a series of resected human prostate cancer samples. In vitro, many prostate cancer cell lines upregulated PD-L1 expression in response to inflammatory cytokines, consistent with adaptive immune resistance. In these cell lines, no association between PTEN loss and PD-L1 expression was apparent. In primary prostate tumors, PD-L1 expression was rare, and was not associated with PTEN loss. These studies show that some prostate cancer cell lines are capable of expressing PD-L1. However, in human prostate cancer, PTEN loss is not associated with PD-L1 expression, arguing against innate immune resistance as a mechanism that mitigates antitumor immune responses in this disease.

  12. Immune-Neuroendocrine Interactions and Autoimmune Diseases

    Directory of Open Access Journals (Sweden)

    Luis J. Jara

    2006-01-01

    Full Text Available The relationship between immune-neuroendocrine system is firmly established. The messengers of this connection are hormones, neuropeptides, neurotransmitters and cytokines. The immune-neuroendocrine system have the capacity to synthesize and release these molecules, which, in turn, can stimulate or suppress the activity of immune or neuroendocrine cells by binding to receptors. In fact, hormones, neuropeptides and neurotransmitters participate in innate and adaptive immune response.

  13. The Involvement of MicroRNAs in Modulation of Innate and Adaptive Immunity in Systemic Lupus Erythematosus and Lupus Nephritis

    Science.gov (United States)

    Köhler, Paulina; von Rauchhaupt, Ekaterina

    2018-01-01

    Noncoding RNAs (ncRNAs), including microRNAs (miRNAs), represent a family of RNA molecules that do not translate into protein. Nevertheless, they have the ability to regulate gene expression and play an essential role in immune cell differentiation and function. MicroRNAs were found to be differentially expressed in various tissues, and changes in their expression have been associated with several pathological processes. Yet, their roles in systemic lupus erythematosus (SLE) and lupus nephritis (LN) remain to be elucidated. Both SLE and LN are characterized by a complex dysfunction of the innate and adaptive immunity. Recently, significant findings have been made in understanding SLE through the use of genetic variant identification and expression pattern analysis and mouse models, as well as epigenetic analyses. Abnormalities in immune cell responses, cytokine and chemokine production, cell activation, and apoptosis have been linked to a unique expression pattern of a number of miRNAs that have been implicated in the immune pathogenesis of this autoimmune disease. The recent evidence that significantly increased the understanding of the pathogenesis of SLE drives a renewed interest in efficient therapy targets. This review aims at providing an overview of the current state of research on the expression and role of miRNAs in the immune pathogenesis of SLE and LN. PMID:29854836

  14. The Involvement of MicroRNAs in Modulation of Innate and Adaptive Immunity in Systemic Lupus Erythematosus and Lupus Nephritis.

    Science.gov (United States)

    Honarpisheh, Mohsen; Köhler, Paulina; von Rauchhaupt, Ekaterina; Lech, Maciej

    2018-01-01

    Noncoding RNAs (ncRNAs), including microRNAs (miRNAs), represent a family of RNA molecules that do not translate into protein. Nevertheless, they have the ability to regulate gene expression and play an essential role in immune cell differentiation and function. MicroRNAs were found to be differentially expressed in various tissues, and changes in their expression have been associated with several pathological processes. Yet, their roles in systemic lupus erythematosus (SLE) and lupus nephritis (LN) remain to be elucidated. Both SLE and LN are characterized by a complex dysfunction of the innate and adaptive immunity. Recently, significant findings have been made in understanding SLE through the use of genetic variant identification and expression pattern analysis and mouse models, as well as epigenetic analyses. Abnormalities in immune cell responses, cytokine and chemokine production, cell activation, and apoptosis have been linked to a unique expression pattern of a number of miRNAs that have been implicated in the immune pathogenesis of this autoimmune disease. The recent evidence that significantly increased the understanding of the pathogenesis of SLE drives a renewed interest in efficient therapy targets. This review aims at providing an overview of the current state of research on the expression and role of miRNAs in the immune pathogenesis of SLE and LN.

  15. Pregnancy immunology: decidual immune cells.

    Science.gov (United States)

    Sanguansermsri, Donruedee; Pongcharoen, Sutatip

    2008-01-01

    Human pregnancy is a complex process. Placental development depends on the function of secretory molecules produced by placental trophoblast cells as well as by maternal uterine immune cells within the decidua. These decidual immune cells are T cells, natural killer cells, macrophages and dendritic cells. The interactions between the trophoblast cells and the maternal immune cells have an impact on the outcome of the pregnancy. Knowledge about the phenotypes and functions of the maternal immune cells in normal and pathological pregnancies including recurrent spontaneous abortions, preeclampsia and hydatidiform moles may improve our understanding of the immunobiology of the normal pregnancy as a whole and may provide approaches for improving the treatment of pathological pregnancies.

  16. Liver X receptor and peroxisome proliferator-activated receptor as integrators of lipid homeostasis and immunity.

    Science.gov (United States)

    Kidani, Yoko; Bensinger, Steven J

    2012-09-01

    Lipid metabolism has emerged as an important modulator of innate and adaptive immune cell fate and function. The lipid-activated transcription factors peroxisome proliferator-activated receptor (PPAR) α, β/δ, γ and liver X receptor (LXR) are members of the nuclear receptor superfamily that have a well-defined role in regulating lipid homeostasis and metabolic diseases. Accumulated evidence over the last decade indicates that PPAR and LXR signaling also influence multiple facets of inflammation and immunity, thereby providing important crosstalk between metabolism and immune system. Herein, we provide a brief introduction to LXR and PPAR biology and review recent discoveries highlighting the importance of PPAR and LXR signaling in the modulation of normal and pathologic states of immunity. We also examine advances in our mechanistic understanding of how nuclear receptors impact immune system function and homeostasis. Finally, we discuss whether LXRs and PPARs could be pharmacologically manipulated to provide novel therapeutic approaches for modulation of the immune system under pathologic inflammation or in the context of allergic and autoimmune disease. © 2012 John Wiley & Sons A/S.

  17. Maternal immune system adaptation to pregnancy - a potential influence on the course of diabetic retinopathy

    Directory of Open Access Journals (Sweden)

    Pavan Josip

    2010-10-01

    Full Text Available Abstract Background Progression of diabetic retinopathy occurs at least temporarily during pregnancy. Although the cause of this progression is not entirely understood, the immune phenomenon and chronic inflammation may play a significant role. During pregnancy in order to avoid fetus rejection, certain components of the immune system that are knowingly implicated in the pathogenesis of diabetic retinopathy are activated including generalized leukocyte activation and an increase in certain cytokine plasma levels. Activated leukocytes with up regulated adhesion molecules have an increased potential to bind to the endothelium cells of blood vessels. Leukocyte-endothelial interaction and the consequent leukostasis with capillary occlusion, ischemia and vascular leakage have a substantial role in the development of diabetic retinopathy. Furthermore, certain increased cytokines are known to cause blood-retinal-barrier breakdown whilst others promote angiogenic and fibrovascular proliferation and thereby can also be implicated in the pathogenesis of this diabetic complication. Presentation of the hypothesis We hypothesized that the activation of the immune system during gestation may have an influence on the course of retinopathy in pregnant diabetic women. Testing the hypothesis We suggest two prospective follow up studies conducted on women with type 1 diabetes mellitus. The first study would include a group of non-pregnant women and a group of diabetic women undergoing normal pregnancy matched for age and duration of diabetes. In the second study pregnant women would be divided into two groups: one with normal pregnancy and the other with preeclampsia. The procedure and data collection in both studies will be identical: a complete ophthalmological examination, glycaemic control, blood pressure measurement and venous blood samples for the determination of plasma levels of cytokines (TNF-alpha, IL-1beta, IL-6, IL-8 and adhesion molecules (ICAM-1

  18. Vitamin E, immunity, and infection

    Science.gov (United States)

    A normally functioning immune system is critical for the body to fight and eliminate invading pathogens from the environment. On the other hand, the immune system also protects the body from internal risks such as neoplasia growing within and autoimmune responses that attack self. The immune system ...

  19. Adaptive immunity alters distinct host feeding pathways during nematode induced inflammation, a novel mechanism in parasite expulsion.

    Directory of Open Access Journals (Sweden)

    John J Worthington

    2013-01-01

    Full Text Available Gastrointestinal infection is often associated with hypophagia and weight loss; however, the precise mechanisms governing these responses remain poorly defined. Furthermore, the possibility that alterations in feeding during infection may be beneficial to the host requires further study. We used the nematode Trichinella spiralis, which transiently inhabits the small intestine before migrating to skeletal muscle, as a biphasic model of infection to determine the cellular and molecular pathways controlling feeding during enteric and peripheral inflammation. Through the infection of genetically modified mice lacking cholecystokinin, Tumor necrosis factor α receptors and T and B-cells, we observed a biphasic hypophagic response to infection resulting from two separate immune-driven mechanisms. The enteroendocrine I-cell derived hormone cholecystokinin is an essential mediator of initial hypophagia and is induced by CD4+ T-cells during enteritis. In contrast, the second hypophagic response is extra-intestinal and due to the anorectic effects of TNFα during peripheral infection of the muscle. Moreover, via maintaining naive levels of the adipose secreted hormone leptin throughout infection we demonstrate a novel feedback loop in the immunoendocrine axis. Immune driven I-cell hyperplasia and resultant weight loss leads to a reduction in the inflammatory adipokine leptin, which in turn heightens protective immunity during infection. These results characterize specific immune mediated mechanisms which reduce feeding during intestinal or peripheral inflammation. Importantly, the molecular mediators of each phase are entirely separate. The data also introduce the first evidence that I-cell hyperplasia is an adaptively driven immune response that directly impinges on the outcome to infection.

  20. CRISPR/Cas and Cmr modules, mobility and evolution of adaptive immune systems

    DEFF Research Database (Denmark)

    Shah, Shiraz Ali; Garrett, Roger Antony

    2011-01-01

    CRISPR/Cas and CRISPR/Cmr immune machineries of archaea and bacteria provide an adaptive and effective defence mechanism directed specifically against viruses and plasmids. Present data suggest that both CRISPR/Cas and Cmr modules can behave like integral genetic elements. They tend to be located...... in the more variable regions of chromosomes and are displaced by genome shuffling mechanisms including transposition. CRISPR loci may be broken up and dispersed in chromosomes by transposons with the potential for creating genetic novelty. Both CRISPR/Cas and Cmr modules appear to exchange readily between...... the significant barriers imposed by their differing conjugative, transcriptional and translational mechanisms. There are parallels between the CRISPR crRNAs and eukaryal siRNAs, most notably to germ cell piRNAs which are directed, with the help of effector proteins, to silence or destroy transposons...

  1. Leptin as immune mediator: Interaction between neuroendocrine and immune system.

    Science.gov (United States)

    Procaccini, Claudio; La Rocca, Claudia; Carbone, Fortunata; De Rosa, Veronica; Galgani, Mario; Matarese, Giuseppe

    2017-01-01

    Leptin is an adipocyte-derived hormone/cytokine that links nutritional status with neuroendocrine and immune functions. Initially described as an anti-obesity hormone, leptin has subsequently been shown to exert pleiotropic effects, being also able to influence haematopoiesis, thermogenesis, reproduction, angiogenesis, and more importantly immune homeostasis. As a cytokine, leptin can affect both innate and adaptive immunity, by inducing a pro-inflammatory response and thus playing a key role in the regulation of the pathogenesis of several autoimmune/inflammatory diseases. In this review, we discuss the most recent advances on the role of leptin as immune-modulator in mammals and we also provide an overview on its main functions in non-mammalian vertebrates. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Genetic association analyses implicate aberrant regulation of innate and adaptive immunity genes in the pathogenesis of systemic lupus erythematosus

    Science.gov (United States)

    Graham, Deborah S Cunninghame; Pinder, Christopher L; Tombleson, Philip; Behrens, Timothy W; Martín, Javier; Fairfax, Benjamin P; Knight, Julian C; Chen, Lingyan; Replogle, Joseph; Syvänen, Ann-Christine; Rönnblom, Lars; Graham, Robert R; Wither, Joan E; Rioux, John D; Alarcón-Riquelme, Marta E; Vyse, Timothy J

    2015-01-01

    Systemic lupus erythematosus (SLE; OMIM 152700) is a genetically complex autoimmune disease characterized by loss of immune tolerance to nuclear and cell surface antigens. Previous genome-wide association studies (GWAS) had modest sample sizes, reducing their scope and reliability. Our study comprised 7,219 cases and 15,991 controls of European ancestry: a new GWAS, meta-analysis with a published GWAS and a replication study. We have mapped 43 susceptibility loci, including 10 novel associations. Assisted by dense genome coverage, imputation provided evidence for missense variants underpinning associations in eight genes. Other likely causal genes were established by examining associated alleles for cis-acting eQTL effects in a range of ex vivo immune cells. We found an over-representation (n=16) of transcription factors among SLE susceptibility genes. This supports the view that aberrantly regulated gene expression networks in multiple cell types in both the innate and adaptive immune response contribute to the risk of developing SLE. PMID:26502338

  3. Nitric oxide and TNFα are critical regulators of reversible lymph node vascular remodeling and adaptive immune response.

    Directory of Open Access Journals (Sweden)

    Stephanie L Sellers

    Full Text Available Lymph node (LN vascular growth, at the level of the main arteriole, was recently characterized for the first time during infection. Arteriole diameter was shown to increase for at least seven days and to occur via a CD4(+ T cell dependent mechanism, with vascular expansion playing a critical role in regulating induction of adaptive immune response. Here, using intravital microscopy of the inguinal LN during herpes simplex type II (HSV-2 infection, the data provides the first studies that demonstrate arteriole expansion during infection is a reversible vascular event that occurs via eutrophic outward remodeling. Furthermore, using genetic ablation models, and pharmacological blockade, we reveal arteriole remodeling and LN hypertrophy to be dependent upon both endothelial nitric oxide synthase (eNOS and TNFα expression. Additionally, we reveal transient changes in nitric oxide (NO levels to be a notable feature of response to viral infection and LN vascular remodeling and provide evidence that mast cells are the critical source of TNFα required to drive arteriole remodeling. Overall, this study is the first to fully characterize LN arteriole vascular changes throughout the course of infection. It effectively reveals a novel role for NO and TNFα in LN cellularity and changes in LN vascularity, which represent key advances in understanding LN vascular physiology and adaptive immune response.

  4. Pro-inflammatory cytokine/chemokine production by reovirus treated melanoma cells is PKR/NF-κB mediated and supports innate and adaptive anti-tumour immune priming

    Directory of Open Access Journals (Sweden)

    Coffey Matt

    2011-02-01

    Full Text Available Abstract Background As well as inducing direct oncolysis, reovirus treatment of melanoma is associated with activation of innate and adaptive anti-tumour immune responses. Results Here we characterise the effects of conditioned media from reovirus-infected, dying human melanoma cells (reoTCM, in the absence of live virus, to address the immune bystander potential of reovirus therapy. In addition to RANTES, IL-8, MIP-1α and MIP-1β, reovirus-infected melanoma cells secreted eotaxin, IP-10 and the type 1 interferon IFN-β. To address the mechanisms responsible for the inflammatory composition of reoTCM, we show that IL-8 and IFN-β secretion by reovirus-infected melanoma cells was associated with activation of NF-κB and decreased by pre-treatment with small molecule inhibitors of NF-κB and PKR; specific siRNA-mediated knockdown further confirmed a role for PKR. This pro-inflammatory milieu induced a chemotactic response in isolated natural killer (NK cells, dendritic cells (DC and anti-melanoma cytotoxic T cells (CTL. Following culture in reoTCM, NK cells upregulated CD69 expression and acquired greater lytic potential against tumour targets. Furthermore, melanoma cell-loaded DC cultured in reoTCM were more effective at priming adaptive anti-tumour immunity. Conclusions These data demonstrate that the PKR- and NF-κB-dependent induction of pro-inflammatory molecules that accompanies reovirus-mediated killing can recruit and activate innate and adaptive effector cells, thus potentially altering the tumour microenvironment to support bystander immune-mediated therapy as well as direct viral oncolysis.

  5. Mast cell activators as novel immune regulators.

    Science.gov (United States)

    Johnson-Weaver, Brandi; Choi, Hae Woong; Abraham, Soman N; Staats, Herman F

    2018-05-26

    Mast cells are an important cell type of the innate immune system that when activated, play a crucial role in generating protective innate host responses after bacterial and viral infection. Additionally, activated mast cells influence lymph node composition to regulate the induction of adaptive immune responses. The recognition that mast cells play a beneficial role in host responses to microbial infection and induction of adaptive immunity has provided the rationale to evaluate mast cell activators for use as antimicrobials or vaccine adjuvants. This review summarizes the role of mast cell activators in antimicrobial responses while also discussing the use of different classes of mast cell activators as potent vaccine adjuvants that enhance the induction of protective immune responses. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Immune Modulation in Normal Human Peripheral Blood Mononuclear Cells (PBMCs) (Lymphocytes) in Response to Benzofuran-2-Carboxylic Acid Derivative KMEG during Spaceflight

    Science.gov (United States)

    Okoro, Elvis; Mann, Vivek; Ellis, Ivory; Mansoor, Elvedina; Olamigoke, Loretta; Marriott, Karla Sue; Denkins, Pamela; Williams, Willie; Sundaresan, Alamelu

    2017-08-01

    Microgravity and radiation exposure during space flight have been widely reported to induce the suppression of normal immune system function, and increase the risk of cancer development in humans. These findings pose a serious risk to manned space missions. Interestingly, recent studies have shown that benzofuran-2-carboxylic acid derivatives can inhibit the progression of some of these devastating effects on earth and in modeled microgravity. However, these studies had not assessed the impacts of benzofuran-2- carboxylic acid and its derivatives on global gene expression under spaceflight conditions. In this study, the ability of a specific benzofuran-2-carboxylic acid derivative (KMEG) to confer protection from radiation and restore normal immune function was investigated following exposure to space flight conditions on the ISS. Normal human peripheral blood mononuclear cells (lymphocytes) treated with 10 µ g/ml of KMEG together with untreated control samples were flown on Nanoracks hardware on Spacex-3 flight. The Samples were returned one month later and gene expression was analyzed. A 1g-ground control experiment was performed in parallel at the Kennedy spaceflight center. The first overall subtractive unrestricted analysis revealed 78 genes, which were differentially expressed in space flight KMEG, untreated lymphocytes as compared to the corresponding ground controls. However, in KMEG-treated space flight lymphocytes, there was an increased expression of a group of genes that mediate increased transcription, translation and innate immune system mediating functions of lymphocytes as compared to KMEG-untreated samples. Analysis of genes related to T cell proliferation in spaceflight KMEG-treated lymphocytes compared to 1g-ground KMEG- treated lymphocytes revealed six T cell proliferation and signaling genes to be significantly upregulated (p trafficking, promote early response, mediating C-myc related proliferation, promote antiapoptotic activity and protects

  7. Regulation of innate and adaptive immunity by the commensal microbiota

    OpenAIRE

    Jarchum, Irene; Pamer, Eric G.

    2011-01-01

    The microbial communities that inhabit the intestinal tract are essential for mammalian health. Communication between the microbiota and the host establishes and maintains immune homeostasis, enabling protective immune responses against pathogens while preventing adverse inflammatory responses to harmless commensal microbes. Specific bacteria, such as segmented filamentous bacteria, Clostridium species, and Bacteroides fragilis, are key contributors to immune homeostasis in the gut. The cellu...

  8. Alcohol, aging, and innate immunity.

    Science.gov (United States)

    Boule, Lisbeth A; Kovacs, Elizabeth J

    2017-07-01

    The global population is aging: in 2010, 8% of the population was older than 65 y, and that is expected to double to 16% by 2050. With advanced age comes a heightened prevalence of chronic diseases. Moreover, elderly humans fair worse after acute diseases, namely infection, leading to higher rates of infection-mediated mortality. Advanced age alters many aspects of both the innate and adaptive immune systems, leading to impaired responses to primary infection and poor development of immunologic memory. An often overlooked, yet increasingly common, behavior in older individuals is alcohol consumption. In fact, it has been estimated that >40% of older adults consume alcohol, and evidence reveals that >10% of this group is drinking more than the recommended limit by the National Institute on Alcohol Abuse and Alcoholism. Alcohol consumption, at any level, alters host immune responses, including changes in the number, phenotype, and function of innate and adaptive immune cells. Thus, understanding the effect of alcohol ingestion on the immune system of older individuals, who are already less capable of combating infection, merits further study. However, there is currently almost nothing known about how drinking alters innate immunity in older subjects, despite innate immune cells being critical for host defense, resolution of inflammation, and maintenance of immune homeostasis. Here, we review the effects of aging and alcohol consumption on innate immune cells independently and highlight the few studies that have examined the effects of alcohol ingestion in aged individuals. © Society for Leukocyte Biology.

  9. Fluorescent dye labeled influenza virus mainly infects innate immune cells and activated lymphocytes and can be used in cell-mediated immune response assay

    OpenAIRE

    Xie, Dongxu

    2009-01-01

    Early results have recognized that influenza virus infects the innate and adaptive immune cells. The data presented in this paper demonstrated that influenza virus labeled with fluorescent dye not only retained the ability to infect and replicate in host cells, but also stimulated a similar human immune response as did unlabeled virus. Influenza virus largely infected the innate and activated adaptive immune cells. Influenza B type virus was different from that of A type virus. B type virus w...

  10. Immunity: Insect Immune Memory Goes Viral.

    Science.gov (United States)

    Ligoxygakis, Petros

    2017-11-20

    Adaptive memory in insect immunity has been controversial. In this issue, Andino and co-workers propose that acquisition of viral sequences in the host genome gives rise to anti-sense, anti-viral piRNAs. Such sequences can be regarded as both a genomic archive of past infections and as an armour of potential heritable memory. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. A stressful microenvironment: opposing effects of the endoplasmic reticulum stress response in the suppression and enhancement of adaptive tumor immunity.

    Science.gov (United States)

    Rausch, Matthew P; Sertil, Aparna Ranganathan

    2015-03-01

    The recent clinical success of immunotherapy in the treatment of certain types of cancer has demonstrated the powerful ability of the immune system to control tumor growth, leading to significantly improved patient survival. However, despite these promising results current immunotherapeutic strategies are still limited and have not yet achieved broad acceptance outside the context of metastatic melanoma. The limitations of current immunotherapeutic approaches can be attributed in part to suppressive mechanisms present in the tumor microenvironment that hamper the generation of robust antitumor immune responses thus allowing tumor cells to escape immune-mediated destruction. The endoplasmic reticulum (ER) stress response has recently emerged as a potent regulator of tumor immunity. The ER stress response is an adaptive mechanism that allows tumor cells to survive in the harsh growth conditions inherent to the tumor milieu such as low oxygen (hypoxia), low pH and low levels of glucose. Activation of ER stress can also alter the cancer cell response to therapies. In addition, the ER stress response promotes tumor immune evasion by inducing the production of protumorigenic inflammatory cytokines and impairing tumor antigen presentation. However, the ER stress response can boost antitumor immunity in some situations by enhancing the processing and presentation of tumor antigens and by inducing the release of immunogenic factors from stressed tumor cells. Here, we discuss the dualistic role of the ER stress response in the modulation of tumor immunity and highlight how strategies to either induce or block ER stress can be employed to improve the clinical efficacy of tumor immunotherapy.

  12. Possible stimulation of anti-tumor immunity using repeated cold stress: a hypothesis

    Directory of Open Access Journals (Sweden)

    Radoja Sasa

    2007-11-01

    Full Text Available Abstract Background The phenomenon of hormesis, whereby small amounts of seemingly harmful or stressful agents can be beneficial for the health and lifespan of laboratory animals has been reported in literature. In particular, there is accumulating evidence that daily brief cold stress can increase both numbers and activity of peripheral cytotoxic T lymphocytes and natural killer cells, the major effectors of adaptive and innate tumor immunity, respectively. This type of regimen (for 8 days has been shown to improve survival of mice infected with intracellular parasite Toxoplasma gondii, which would also be consistent with enhanced cell-mediated immunity. Presentation of the hypothesis This paper hypothesizes that brief cold-water stress repeated daily over many months could enhance anti-tumor immunity and improve survival rate of a non-lymphoid cancer. The possible mechanism of the non-specific stimulation of cellular immunity by repeated cold stress appears to involve transient activation of the sympathetic nervous system, hypothalamic-pituitary-adrenal and hypothalamic-pituitary-thyroid axes, as described in more detail in the text. Daily moderate cold hydrotherapy is known to reduce pain and does not appear to have noticeable adverse effects on normal test subjects, although some studies have shown that it can cause transient arrhythmias in patients with heart problems and can also inhibit humoral immunity. Sudden immersion in ice-cold water can cause transient pulmonary edema and increase permeability of the blood-brain barrier, thereby increasing mortality of neurovirulent infections. Testing the hypothesis The proposed procedure is an adapted cold swim (5–7 minutes at 20 degrees Celsius, includes gradual adaptation to be tested on a mouse tumor model. Mortality, tumor size, and measurements of cellular immunity (numbers and activity of peripheral CD8+ T lymphocytes and natural killer cells of the cold-exposed group would be compared to

  13. Tsetse immune system maturation requires the presence of obligate symbionts in larvae.

    Directory of Open Access Journals (Sweden)

    Brian L Weiss

    2011-05-01

    Full Text Available Beneficial microbial symbionts serve important functions within their hosts, including dietary supplementation and maintenance of immune system homeostasis. Little is known about the mechanisms that enable these bacteria to induce specific host phenotypes during development and into adulthood. Here we used the tsetse fly, Glossina morsitans, and its obligate mutualist, Wigglesworthia glossinidia, to investigate the co-evolutionary adaptations that influence the development of host physiological processes. Wigglesworthia is maternally transmitted to tsetse's intrauterine larvae through milk gland secretions. We can produce flies that lack Wigglesworthia (Gmm(Wgm- yet retain their other symbiotic microbes. Such offspring give rise to adults that exhibit a largely normal phenotype, with the exception being that they are reproductively sterile. Our results indicate that when reared under normal environmental conditions Gmm(Wgm- adults are also immuno-compromised and highly susceptible to hemocoelic E. coli infections while age-matched wild-type individuals are refractory. Adults that lack Wigglesworthia during larval development exhibit exceptionally compromised cellular and humoral immune responses following microbial challenge, including reduced expression of genes that encode antimicrobial peptides (cecropin and attacin, hemocyte-mediated processes (thioester-containing proteins 2 and 4 and prophenoloxidase, and signal-mediating molecules (inducible nitric oxide synthase. Furthermore, Gmm(Wgm- adults harbor a reduced population of sessile and circulating hemocytes, a phenomenon that likely results from a significant decrease in larval expression of serpent and lozenge, both of which are associated with the process of early hemocyte differentiation. Our results demonstrate that Wigglesworthia must be present during the development of immature progeny in order for the immune system to function properly in adult tsetse. This phenomenon provides

  14. NKT Cell Networks in the Regulation of Tumor Immunity

    Science.gov (United States)

    Robertson, Faith C.; Berzofsky, Jay A.; Terabe, Masaki

    2014-01-01

    CD1d-restricted natural killer T (NKT) cells lie at the interface between the innate and adaptive immune systems and are important mediators of immune responses and tumor immunosurveillance. These NKT cells uniquely recognize lipid antigens, and their rapid yet specific reactions influence both innate and adaptive immunity. In tumor immunity, two NKT subsets (type I and type II) have contrasting roles in which they not only cross-regulate one another, but also impact innate immune cell populations, including natural killer, dendritic, and myeloid lineage cells, as well as adaptive populations, especially CD8+ and CD4+ T cells. The extent to which NKT cells promote or suppress surrounding cells affects the host’s ability to prevent neoplasia and is consequently of great interest for therapeutic development. Data have shown the potential for therapeutic use of NKT cell agonists and synergy with immune response modifiers in both pre-clinical studies and preliminary clinical studies. However, there is room to improve treatment efficacy by further elucidating the biological mechanisms underlying NKT cell networks. Here, we discuss the progress made in understanding NKT cell networks, their consequent role in the regulation of tumor immunity, and the potential to exploit that knowledge in a clinical setting. PMID:25389427

  15. NKT cell networks in the regulation of tumor immunity.

    Science.gov (United States)

    Robertson, Faith C; Berzofsky, Jay A; Terabe, Masaki

    2014-01-01

    CD1d-restricted natural killer T (NKT) cells lie at the interface between the innate and adaptive immune systems and are important mediators of immune responses and tumor immunosurveillance. These NKT cells uniquely recognize lipid antigens, and their rapid yet specific reactions influence both innate and adaptive immunity. In tumor immunity, two NKT subsets (type I and type II) have contrasting roles in which they not only cross-regulate one another, but also impact innate immune cell populations, including natural killer, dendritic, and myeloid lineage cells, as well as adaptive populations, especially CD8(+) and CD4(+) T cells. The extent to which NKT cells promote or suppress surrounding cells affects the host's ability to prevent neoplasia and is consequently of great interest for therapeutic development. Data have shown the potential for therapeutic use of NKT cell agonists and synergy with immune response modifiers in both pre-clinical studies and preliminary clinical studies. However, there is room to improve treatment efficacy by further elucidating the biological mechanisms underlying NKT cell networks. Here, we discuss the progress made in understanding NKT cell networks, their consequent role in the regulation of tumor immunity, and the potential to exploit that knowledge in a clinical setting.

  16. NKT cell networks in the regulation of tumor immunity

    Directory of Open Access Journals (Sweden)

    Faith C Robertson

    2014-10-01

    Full Text Available CD1d-restricted natural killer T (NKT cells lie at the interface between the innate and adaptive immune systems and are important mediators of immune responses and tumor immunosurveillance. These NKT cells uniquely recognize lipid antigens, and their rapid yet specific reactions influence both innate and adaptive immunity. In tumor immunity, two NKT subsets (type I and type II have contrasting roles in which they not only cross-regulate one another, but also impact innate immune cell populations, including natural killer, dendritic and myeloid lineage cells, as well as adaptive populations, especially CD8+ and CD4+ T cells. The extent to which NKT cells promote or suppress surrounding cells affects the host’s ability to prevent neoplasia and is consequently of great interest for therapeutic development. Data have shown the potential for therapeutic use of NKT cell agonists and synergy with immune response modifiers in both pre-clinical studies and preliminary clinical studies. However, there is room to improve treatment efficacy by further elucidating the biological mechanisms underlying NKT cell networks. Here, we discuss the progress made in understanding NKT cell networks, their consequent role in the regulation of tumor immunity, and the potential to exploit that knowledge in a clinical setting.

  17. Role of Activin A in Immune Response to Breast Cancer

    Science.gov (United States)

    2014-12-01

    Innate and adaptive immune cells in the tumor microenvironment. Nat Immunol 14:1014-1022, 2013 10. Ji R-R, Chasalow SD, Wang L, et al: An immune... cells also generate reactive oxygen and nitrogen species that modify the chemokine and antigen receptors on CTLs both in the lymphoid organs and in the... cells . endogenous, evolutionarily conserved intracellular molecules that are released upon necrotic cell death. By linking the innate and adaptive immune

  18. Peptide pool immunization and CD8+ T cell reactivity

    DEFF Research Database (Denmark)

    Rasmussen, Susanne B; Harndahl, Mikkel N; Buus, Anette Stryhn

    2013-01-01

    Mice were immunized twice with a pool of five peptides selected among twenty 8-9-mer peptides for their ability to form stable complexes at 37°C with recombinant H-2K(b) (half-lives 10-15h). Vaccine-induced immunity of splenic CD8(+) T cells was studied in a 24h IFNγ Elispot assay. Surprisingly...... peptides induced normal peptide immunity i.e. the specific T cell reactivity in the Elispot culture was strictly dependent on exposure to the immunizing peptide ex vivo. However, immunization with two of the peptides, a VSV- and a Mycobacterium-derived peptide, resulted in IFNγ spot formation without...... peptide in the Elispot culture. Immunization with a mixture of the VSV-peptide and a "normal" peptide also resulted in IFNγ spot formation without addition of peptide to the assay culture. Peptide-tetramer staining of CD8(+) T cells from mice immunized with a mixture of VSV-peptide and "normal" peptide...

  19. Adaptation in CRISPR-Cas Systems.

    Science.gov (United States)

    Sternberg, Samuel H; Richter, Hagen; Charpentier, Emmanuelle; Qimron, Udi

    2016-03-17

    Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins constitute an adaptive immune system in prokaryotes. The system preserves memories of prior infections by integrating short segments of foreign DNA, termed spacers, into the CRISPR array in a process termed adaptation. During the past 3 years, significant progress has been made on the genetic requirements and molecular mechanisms of adaptation. Here we review these recent advances, with a focus on the experimental approaches that have been developed, the insights they generated, and a proposed mechanism for self- versus non-self-discrimination during the process of spacer selection. We further describe the regulation of adaptation and the protein players involved in this fascinating process that allows bacteria and archaea to harbor adaptive immunity. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Differential effects of interleukin-17 receptor signaling on innate and adaptive immunity during central nervous system bacterial infection

    Directory of Open Access Journals (Sweden)

    Vidlak Debbie

    2012-06-01

    Full Text Available Abstract Although IL-17A (commonly referred to as IL-17 has been implicated in the pathogenesis of central nervous system (CNS autoimmune disease, its role during CNS bacterial infections remains unclear. To evaluate the broader impact of IL-17 family members in the context of CNS infection, we utilized IL-17 receptor (IL-17R knockout (KO mice that lack the ability to respond to IL-17, IL-17F and IL-17E (IL-25. In this article, we demonstrate that IL-17R signaling regulates bacterial clearance as well as natural killer T (NKT cell and gamma-delta (γδ T cell infiltrates during Staphylococcus aureus-induced brain abscess formation. Specifically, when compared with wild-type (WT animals, IL-17R KO mice exhibited elevated bacterial burdens at days 7 and 14 following S. aureus infection. Additionally, IL-17R KO animals displayed elevated neutrophil chemokine production, revealing the ability to compensate for the lack of IL-17R activity. Despite these differences, innate immune cell recruitment into brain abscesses was similar in IL-17R KO and WT mice, whereas IL-17R signaling exerted a greater influence on adaptive immune cell recruitment. In particular, γδ T cell influx was increased in IL-17R KO mice at day 7 post-infection. In addition, NK1.1high infiltrates were absent in brain abscesses of IL-17R KO animals and, surprisingly, were rarely detected in the livers of uninfected IL-17R KO mice. Although IL-17 is a key regulator of neutrophils in other infection models, our data implicate an important role for IL-17R signaling in regulating adaptive immunity during CNS bacterial infection.

  1. Adaptive Immunity against Streptococcus pyogenes in Adults Involves Increased IFN-gamma and IgG3 Responses Compared with Children

    DEFF Research Database (Denmark)

    Mortensen, Rasmus; Nissen, Thomas Norrelykke; Blauenfeldt, Thomas

    2015-01-01

    Each year, millions of people are infected with Streptococcus pyogenes, leading to an estimated 500,000 annual deaths worldwide. For unknown reasons, school-aged children have substantially higher infection rates than adults. The goal for this study was to provide, to our knowledge, the first det...... cellular memory response in combination with IgG1/IgG3-dominated humoral immunity that increase with age. The significance of these data regarding both the increased GAS infection rate in children and the development of protective GAS vaccines is discussed.......Each year, millions of people are infected with Streptococcus pyogenes, leading to an estimated 500,000 annual deaths worldwide. For unknown reasons, school-aged children have substantially higher infection rates than adults. The goal for this study was to provide, to our knowledge, the first...... detailed characterization of the human adaptive immune response against S. pyogenes in both children and adults. We report that all adults in our study, as well as most children, showed immunity against the two conserved group A streptococci (GAS) Ags, streptococcal C5a peptidase and immunogenic secreted...

  2. Immune Evasion by Epstein-Barr Virus

    NARCIS (Netherlands)

    Ressing, Maaike E; van Gent, Michiel; Gram, Anna M; Hooykaas, Marjolein J G; Piersma, Sytse J; Wiertz, EJHJ

    2015-01-01

    Epstein-Bar virus (EBV) is widespread within the human population with over 90% of adults being infected. In response to primary EBV infection, the host mounts an antiviral immune response comprising both innate and adaptive effector functions. Although the immune system can control EBV infection to

  3. The Mucosal Immune System of Teleost Fish

    Directory of Open Access Journals (Sweden)

    Irene Salinas

    2015-08-01

    Full Text Available Teleost fish possess an adaptive immune system associated with each of their mucosal body surfaces. Evidence obtained from mucosal vaccination and mucosal infection studies reveal that adaptive immune responses take place at the different mucosal surfaces of teleost. The main mucosa-associated lymphoid tissues (MALT of teleosts are the gut-associated lymphoid tissue (GALT, skin-associated lymphoid tissue (SALT, the gill-associated lymphoid tissue (GIALT and the recently discovered nasopharynx-associated lymphoid tissue (NALT. Teleost MALT includes diffuse B cells and T cells with specific phenotypes different from their systemic counterparts that have co-evolved to defend the microbe-rich mucosal environment. Both B and T cells respond to mucosal infection or vaccination. Specific antibody responses can be measured in the gills, gut and skin mucosal secretions of teleost fish following mucosal infection or vaccination. Rainbow trout studies have shown that IgT antibodies and IgT+ B cells are the predominant B cell subset in all MALT and respond in a compartmentalized manner to mucosal infection. Our current knowledge on adaptive immunity in teleosts is limited compared to the mammalian literature. New research tools and in vivo models are currently being developed in order to help reveal the great intricacy of teleost mucosal adaptive immunity and help improve mucosal vaccination protocols for use in aquaculture.

  4. Host-adaptation of Francisella tularensis alters the bacterium's surface-carbohydrates to hinder effectors of innate and adaptive immunity.

    Directory of Open Access Journals (Sweden)

    Tiffany M Zarrella

    Full Text Available The gram-negative bacterium Francisella tularensis survives in arthropods, fresh water amoeba, and mammals with both intracellular and extracellular phases and could reasonably be expected to express distinct phenotypes in these environments. The presence of a capsule on this bacterium has been controversial with some groups finding such a structure while other groups report that no capsule could be identified. Previously we reported in vitro culture conditions for this bacterium which, in contrast to typical methods, yielded a bacterial phenotype that mimics that of the bacterium's mammalian, extracellular phase.SDS-PAGE and carbohydrate analysis of differentially-cultivated F. tularensis LVS revealed that bacteria displaying the host-adapted phenotype produce both longer polymers of LPS O-antigen (OAg and additional HMW carbohydrates/glycoproteins that are reduced/absent in non-host-adapted bacteria. Analysis of wildtype and OAg-mutant bacteria indicated that the induced changes in surface carbohydrates involved both OAg and non-OAg species. To assess the impact of these HMW carbohydrates on the access of outer membrane constituents to antibody we used differentially-cultivated bacteria in vitro to immunoprecipitate antibodies directed against outer membrane moieties. We observed that the surface-carbohydrates induced during host-adaptation shield many outer membrane antigens from binding by antibody. Similar assays with normal mouse serum indicate that the induced HMW carbohydrates also impede complement deposition. Using an in vitro macrophage infection assay, we find that the bacterial HMW carbohydrate impedes TLR2-dependent, pro-inflammatory cytokine production by macrophages. Lastly we show that upon host-adaptation, the human-virulent strain, F. tularensis SchuS4 also induces capsule production with the effect of reducing macrophage-activation and accelerating tularemia pathogenesis in mice.F. tularensis undergoes host-adaptation which

  5. Structural basis of evasion of cellular adaptive immunity by HIV-1 Nef

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Xiaofei; Singh, Rajendra; Homann, Stefanie; Yang, Haitao; Guatelli, John; Xiong, Yong (Yale); (VA); (UCSD)

    2012-10-24

    The HIV-1 protein Nef inhibits antigen presentation by class I major histocompatibility complex (MHC-I). We determined the mechanism of this activity by solving the crystal structure of a protein complex comprising Nef, the MHC-I cytoplasmic domain (MHC-I CD) and the {mu}1 subunit of the clathrin adaptor protein complex 1. A ternary, cooperative interaction clamps the MHC-I CD into a narrow binding groove at the Nef-{mu}1 interface, which encompasses the cargo-recognition site of {mu}1 and the proline-rich strand of Nef. The Nef C terminus induces a previously unobserved conformational change in {mu}1, whereas the N terminus binds the Nef core to position it optimally for complex formation. Positively charged patches on {mu}1 recognize acidic clusters in Nef and MHC-I. The structure shows how Nef functions as a clathrin-associated sorting protein to alter the specificity of host membrane trafficking and enable viral evasion of adaptive immunity.

  6. The relation of innate and adaptive immunity with viral-induced acute asthma attacks: Focusing on IP-10 and cathelicidin.

    Science.gov (United States)

    Arikoglu, T; Akyilmaz, E; Yildirim, D D; Batmaz, S B; Ulger, S T; Aslan, G; Kuyucu, S

    Despite growing evidence suggesting potential association between innate and adaptive immunity in viral-induced acute asthma, there is paucity of data in this area. This study aimed to investigate the association of innate and adaptive immunity with acute asthma attacks by analysing the role of IFN-γ-inducible protein 10 (IP-10), TLR2, cathelicidin, vitamin D and cytokines. This prospective study included 33 patients with viral-induced acute asthma and 30 children with controlled asthma. Nasopharyngeal swab samples were collected for virus identification and asthma attack scores assessed in acute asthma group. Blood sampling for IP-10, TLR2, cathelicidin, vitamin D levels, and spirometric indices were employed. Serum IP-10 and cathelicidin levels of acute asthma group were significantly higher and vitamin D levels were lower than controlled asthma group (IP-10; p=0.006, cathelicidin; p=0.002, vitamin D; pasthma attack severity (p=0.03) in acute asthma group. Higher cathelicidin values showed significant positive relation to IP-10 (beta coefficient: 33, p=0.02). Serum IP-10 levels higher than 38.9pg/ml (sensitivity: 85%, specificity: 47%, p=0.002) were predictive of virus-induced asthma. Serum IP-10 and vitamin D levels were found to be significantly related to viral-asthma attacks (IP-10; aOR: 8.93, p=0.03 and vitamin D; aOR: 0.82, p=0.001). Innate immunity biomarkers such as serum IP-10 and cathelicidin can be used to predict viral-induced acute asthma. These biomarkers may provide potential new treatment targets for acute asthma. Copyright © 2016 SEICAP. Published by Elsevier España, S.L.U. All rights reserved.

  7. Immune Mechanisms in Myelodysplastic Syndrome

    DEFF Research Database (Denmark)

    Glenthøj, Andreas; Ørskov, Andreas Due; Hansen, Jakob Werner

    2016-01-01

    diseases are common in patients with MDS, fueling hypotheses of common etiological mechanisms. Both innate and adaptive immune pathways are overly active in the hematopoietic niche of MDS. Although supportive care, growth factors, and hypomethylating agents are the mainstay of MDS treatment, some patients......-especially younger low-risk patients with HLA-DR15 tissue type-demonstrate impressive response rates after immunosuppressive therapy. This is in contrast to higher-risk MDS patients, where several immune activating treatments, such as immune checkpoint inhibitors, are in the pipeline. Thus, the dual role of immune...... mechanisms in MDS is challenging, and rigorous translational studies are needed to establish the value of immune manipulation as a treatment of MDS....

  8. Efficient community-based control strategies in adaptive networks

    International Nuclear Information System (INIS)

    Yang Hui; Tang Ming; Zhang Haifeng

    2012-01-01

    Most studies on adaptive networks concentrate on the properties of steady state, but neglect transient dynamics. In this study, we pay attention to the emergence of community structure in the transient process and the effects of community-based control strategies on epidemic spreading. First, by normalizing the modularity, we investigate the evolution of community structure during the transient process, and find that a strong community structure is induced by the rewiring mechanism in the early stage of epidemic dynamics, which, remarkably, delays the outbreak of disease. We then study the effects of control strategies started at different stages on the prevalence. Both immunization and quarantine strategies indicate that it is not ‘the earlier, the better’ for the implementation of control measures. And the optimal control effect is obtained if control measures can be efficiently implemented in the period of a strong community structure. For the immunization strategy, immunizing the susceptible nodes on susceptible–infected links and immunizing susceptible nodes randomly have similar control effects. However, for the quarantine strategy, quarantining the infected nodes on susceptible–infected links can yield a far better result than quarantining infected nodes randomly. More significantly, the community-based quarantine strategy performs better than the community-based immunization strategy. This study may shed new light on the forecast and the prevention of epidemics among humans. (paper)

  9. Memory and Specificity in the Insect Immune System: Current Perspectives and Future Challenges

    Directory of Open Access Journals (Sweden)

    Dustin Cooper

    2017-05-01

    Full Text Available The immune response of a host to a pathogen is typically described as either innate or adaptive. The innate form of the immune response is conserved across all organisms, including insects. Previous and recent research has focused on the nature of the insect immune system and the results imply that the innate immune response of insects is more robust and specific than previously thought. Priming of the insect innate immune system involves the exposure of insects to dead or a sublethal dose of microbes in order to elicit an initial response. Comparing subsequent infections in primed insects to non-primed individuals indicates that the insect innate immune response may possess some of the qualities of an adaptive immune system. Although some studies demonstrate that the protective effects of priming are due to a “loitering” innate immune response, others have presented more convincing elements of adaptivity. While an immune mechanism capable of producing the same degree of recognition specificity as seen in vertebrates has yet to be discovered in insects, a few interesting cases have been identified and discussed.

  10. Immune Antibody Libraries: Manipulating The Diverse Immune Repertoire for Antibody Discovery.

    Science.gov (United States)

    Lim, Theam Soon; Chan, Soo Khim

    2016-01-01

    Antibody phage display is highly dependent on the availability of antibody libraries. There are several forms of libraries depending mainly on the origin of the source materials. There are three major classes of libraries, mainly the naïve, immune and synthetic libraries. Immune antibody libraries are designed to isolate specific and high affinity antibodies against disease antigens. The pre-exposure of the host to an infection results in the production of a skewed population of antibodies against the particular infection. This characteristic takes advantage of the in vivo editing machinery to generate bias and specific immune repertoire. The skewed but diverse repertoire of immune libraries has been adapted successfully in the generation of antibodies against a wide range of diseases. We envisage immune antibody libraries to play a greater role in the discovery of antibodies for diseases in the near future. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  11. EFSA NDA Panel (EFSA Panel on Dietetic Products, Nutrition and Allergies), 2015. Scientific Opinion on the substantiation of a health claim related to vitamin D and contribution to the normal function of the immune system pursuant to Article 14 of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    2015-01-01

    on the scientific substantiation of a health claim related to vitamin D and contribution to the normal function of the immune system. The Panel considers that vitamin D is sufficiently characterised. Contribution to the normal function of the immune system is a beneficial physiological effect for children....... The Panel had previously assessed a claim on vitamin D and contribution to the normal function of the immune system with a favourable outcome. The target population was the general population. The Panel considered that vitamin D plays a regulatory role in the functioning of the immune system. The Panel...... considers that the role of vitamin D in the functioning of the immune system applies to all ages, including children. The Panel concludes that a cause and effect relationship has been established between the dietary intake of vitamin D and contribution to the normal function of the immune system...

  12. [The role of the innate immune system in atopic dermatitis].

    Science.gov (United States)

    Volz, T; Kaesler, S; Skabytska, Y; Biedermann, T

    2015-02-01

    The mechanisms how the innate immune system detects microbes and mounts a rapid immune response have been more and more elucidated in the past years. Subsequently it has been shown that innate immunity also shapes adaptive immune responses and determines their quality that can be either inflammatory or tolerogenic. As atopic dermatitis is characterized by disturbances of innate and adaptive immune responses, colonization with pathogens and defects in skin barrier function, insight into mechanisms of innate immunity has helped to understand the vicious circle of ongoing skin inflammation seen in atopic dermatitis patients. Elucidating general mechanisms of the innate immune system and its functions in atopic dermatitis paves the way for developing new therapies. Especially the novel insights into the human microbiome and potential functional consequences make the innate immune system a very fundamental and promising target. As a result atopic dermatitis manifestations can be attenuated or even resolved. These currently developed strategies will be introduced in the current review.

  13. Periodontitis induced by Porphyromonas gingivalis drives periodontal microbiota dysbiosis and insulin resistance via an impaired adaptive immune response.

    Science.gov (United States)

    Blasco-Baque, Vincent; Garidou, Lucile; Pomié, Céline; Escoula, Quentin; Loubieres, Pascale; Le Gall-David, Sandrine; Lemaitre, Mathieu; Nicolas, Simon; Klopp, Pascale; Waget, Aurélie; Azalbert, Vincent; Colom, André; Bonnaure-Mallet, Martine; Kemoun, Philippe; Serino, Matteo; Burcelin, Rémy

    2017-05-01

    To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis ( Pg ), Fusobacterium nucleatum and Prevotella intermedia . The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  14. Retinoic acid signaling in B-cells is essential for oral immunization and microflora composition

    Science.gov (United States)

    Pantazi, Eirini; Marks, Ellen; Stolarczyk, Emilie; Lycke, Nils; Noelle, Randolph J.; Elgueta, Raul

    2015-01-01

    Retinoic acid (RA)3 is a critical regulator of the intestinal adaptive immune response. However, the intrinsic impact of RA on B cell differentiation in the regulation of gut humoral immunity in vivo has never been directly shown. To address this issue, we have been able to generate a mouse model where B-cells specifically express a dominant negative receptor α for RA. Here, we show that the silencing of RA signaling in B-cells reduces the numbers of IgA+ antibody secreting cells (ASC) both in vitro and in vivo, suggesting that RA has a direct effect on IgA plasma cell (PC) differentiation. Moreover, the lack of RA signaling in B-cells abrogates Ag-specific IgA responses after oral immunization and affects the microbiota composition. In conclusion, these results suggest that RA signaling in B-cells through the RA receptor α is important to generate an effective gut humoral response and to maintain a normal microbiota composition. PMID:26163586

  15. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    International Nuclear Information System (INIS)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas

    2011-01-01

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses

  16. Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

    Energy Technology Data Exchange (ETDEWEB)

    Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas, E-mail: tke@uams.edu [Winthrop P. Rockefeller Cancer Institute and Department of Pathology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States)

    2011-11-11

    Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses.

  17. The p36 Isoform of Murine Cytomegalovirus m152 Protein Suffices for Mediating Innate and Adaptive Immune Evasion

    Science.gov (United States)

    Fink, Annette; Renzaho, Angeliqué; Reddehase, Matthias J.; Lemmermann, Niels A. W.

    2013-01-01

    The MHC-class I (MHC-I)-like viral (MHC-Iv) m152 gene product of murine cytomegalovirus (mCMV) was the first immune evasion molecule described for a member of the β-subfamily of herpesviruses as a paradigm for analogous functions of human cytomegalovirus proteins. Notably, by interacting with classical MHC-I molecules and with MHC-I-like RAE1 family ligands of the activatory natural killer (NK) cell receptor NKG2D, it inhibits presentation of antigenic peptides to CD8 T cells and the NKG2D-dependent activation of NK cells, respectively, thus simultaneously interfering with adaptive and innate immune recognition of infected cells. Although the m152 gene product exists in differentially glycosylated isoforms whose individual contributions to immune evasion are unknown, it has entered the scientific literature as m152/gp40, based on the quantitatively most prominent isoform but with no functional justification. By construction of a recombinant mCMV in which all three N-glycosylation sites are mutated (N61Q, N208Q, and N241Q), we show here that N-linked glycosylation is not essential for functional interaction of the m152 immune evasion protein with either MHC-I or RAE1. These data add an important functional detail to recent structural analysis of the m152/RAE1γ complex that has revealed N-glycosylations at positions Asn61 and Asn208 of m152 distant from the m152/RAE1γ interface. PMID:24351798

  18. Dynamics of adaptive and innate immunity in patients treated during primary human immunodeficiency virus infection: results from Maraviroc in HIV Acute Infection (MAIN) randomized clinical trial.

    Science.gov (United States)

    Ripa, M; Pogliaghi, M; Chiappetta, S; Galli, L; Pensieroso, S; Cavarelli, M; Scarlatti, G; De Biasi, S; Cossarizza, A; De Battista, D; Malnati, M; Lazzarin, A; Nozza, S; Tambussi, G

    2015-09-01

    We evaluated the dynamics of innate and adaptive immunity in patients treated with combined antiretroviral therapy (cART) during primary human immunodeficiency virus infection (PHI), enrolled in a prospective randomized trial (MAIN, EUDRACT 2008-007004-29). After 48 weeks of cART, we documented a reduction in activated B cells and CD8(+) T cells. Natural killer cell and dendritic cell frequencies were measured and a decrease in CD16(+) CD56(dim) with a reciprocal rise in CD56(high) natural killer cells and an increase in myeloid and plasmacytoid dendritic cells were recorded. In conclusion, 48 weeks of cART during PHI showed significant benefits for both innate and adaptive immunity. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  19. Immunity to Fish Rhabdoviruses

    OpenAIRE

    Purcell, Maureen K.; Laing, Kerry J.; Winton, James R.

    2012-01-01

    Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabd...

  20. CD47 Promotes Protective Innate and Adaptive Immunity in a Mouse Model of Disseminated Candidiasis

    Science.gov (United States)

    Navarathna, Dhammika H. M. L. P.; Stein, Erica V.; Lessey-Morillon, Elizabeth C.; Nayak, Debasis; Martin-Manso, Gema; Roberts, David D.

    2015-01-01

    CD47 is a widely expressed receptor that regulates immunity by engaging its counter-receptor SIRPα on phagocytes and its secreted ligand thrombospondin-1. Mice lacking CD47 can exhibit enhanced or impaired host responses to bacterial pathogens, but its role in fungal immunity has not been examined. cd47 -/- mice on a C57BL/6 background showed significantly increased morbidity and mortality following Candida albicans infection when compared with wild-type mice. Despite normal fungal colonization at earlier times, cd47 -/- mice at four days post-infection had increased colonization of brain and kidneys accompanied by stronger inflammatory reactions. Neutrophil and macrophage numbers were significantly elevated in kidneys and neutrophils in the brains of infected cd47 -/- mice. However, no defect in phagocytic activity towards C. albicans was observed in cd47 -/- bone-marrow-derived macrophages, and neutrophil and macrophage killing of C. albicans was not impaired. CD47-deficiency did not alter the early humoral immune response to C. albicans. Th1, Th2, and Th17 population of CD4+ T cells were expanded in the spleen, and gene expression profiles of spleen and kidney showed stronger pro-inflammatory signaling in infected cd47 -/- mice. The chemoattractant chemokines MIP-2α and MIP-2β were highly expressed in infected spleens of cd47 -/- mice. G-CSF, GM-CSF, and the inflammasome component NLRP3 were more highly expressed in infected cd47 -/- kidneys than in infected wild-type controls. Circulating pro- (TNF-α, IL-6) and anti-inflammatory cytokines (IL-10) were significantly elevated, but IL-17 was decreased. These data indicate that CD47 plays protective roles against disseminated candidiasis and alters pro-inflammatory and immunosuppressive pathways known to regulate innate and T cell immunity. PMID:26010544

  1. Children after Chernobyl: immune cells adaptive changes and stable alterations under low-dose irradiation

    International Nuclear Information System (INIS)

    Bazyka, D.A.; Chumak, A.A.; Bebeshko, V.G.; Beliaeva, N.V.

    1997-01-01

    Early changes of immune parameters in children evacuated from 30-km zone were characterized by E-rossette forming cells decrease and E-receptor non-stability in theophylline assay, surface Ig changes. Immunological follow-up of children inhabitants of territories contaminated with radionuclides after Chernobyl accident revealed TCR/CD3, CD4 and MHC CD3+, CD4+, CD57+ subsets, RIL-2, TrT expression and calcium channel activity. PMNC percentage with cortical thymocyte phenotype (CD1+, CD4+8+) was elevated during the first years after the accident and seemed to be of a compensatory origin. Combination of heterogenic activation and suppression subset reactions and changes in fine subset (Th1/Th2) organization were suggested. Adaptive and compensatory reactions were supposed and delayed hypersensitivity reactions increase as well. (author)

  2. Active and passive immunity, vaccine types, excipients and licensing.

    Science.gov (United States)

    Baxter, David

    2007-12-01

    Abstract Immunity is the state of protection against infectious disease conferred either through an immune response generated by immunization or previous infection or by other non-immunological factors. This article reviews active and passive immunity and the differences between them: it also describes the four different commercially available vaccine types (live attenuated, killed/inactivated, subunit and toxoid): it also looks at how these different vaccines generate an adaptive immune response.

  3. Eosinophils in mucosal immune responses

    Science.gov (United States)

    Travers, J; Rothenberg, M E

    2015-01-01

    Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184

  4. Optimal adaptive normalized matched filter for large antenna arrays

    KAUST Repository

    Kammoun, Abla

    2016-09-13

    This paper focuses on the problem of detecting a target in the presence of a compound Gaussian clutter with unknown statistics. To this end, we focus on the design of the adaptive normalized matched filter (ANMF) detector which uses the regularized Tyler estimator (RTE) built from N-dimensional observations x, · · ·, x in order to estimate the clutter covariance matrix. The choice for the RTE is motivated by its possessing two major attributes: first its resilience to the presence of outliers, and second its regularization parameter that makes it more suitable to handle the scarcity in observations. In order to facilitate the design of the ANMF detector, we consider the regime in which n and N are both large. This allows us to derive closed-form expressions for the asymptotic false alarm and detection probabilities. Based on these expressions, we propose an asymptotically optimal setting for the regularization parameter of the RTE that maximizes the asymptotic detection probability while keeping the asymptotic false alarm probability below a certain threshold. Numerical results are provided in order to illustrate the gain of the proposed detector over a recently proposed setting of the regularization parameter.

  5. Optimal adaptive normalized matched filter for large antenna arrays

    KAUST Repository

    Kammoun, Abla; Couillet, Romain; Pascal, Fré dé ric; Alouini, Mohamed-Slim

    2016-01-01

    This paper focuses on the problem of detecting a target in the presence of a compound Gaussian clutter with unknown statistics. To this end, we focus on the design of the adaptive normalized matched filter (ANMF) detector which uses the regularized Tyler estimator (RTE) built from N-dimensional observations x, · · ·, x in order to estimate the clutter covariance matrix. The choice for the RTE is motivated by its possessing two major attributes: first its resilience to the presence of outliers, and second its regularization parameter that makes it more suitable to handle the scarcity in observations. In order to facilitate the design of the ANMF detector, we consider the regime in which n and N are both large. This allows us to derive closed-form expressions for the asymptotic false alarm and detection probabilities. Based on these expressions, we propose an asymptotically optimal setting for the regularization parameter of the RTE that maximizes the asymptotic detection probability while keeping the asymptotic false alarm probability below a certain threshold. Numerical results are provided in order to illustrate the gain of the proposed detector over a recently proposed setting of the regularization parameter.

  6. Role and contribution of pulmonary CD103+ dendritic cells in the adaptive immune response to Mycobacterium tuberculosis.

    Science.gov (United States)

    Koh, Vanessa Hui Qi; Ng, See Liang; Ang, Michelle Lay Teng; Lin, Wenwei; Ruedl, Christiane; Alonso, Sylvie

    2017-01-01

    Despite international control programmes, the global burden of tuberculosis remains enormous. Efforts to discover novel drugs have largely focused on targeting the bacterium directly. Alternatively, manipulating the host immune response may represent a valuable approach to enhance immunological clearance of the bacilli, but necessitates a deeper understanding of the immune mechanisms associated with protection against Mycobacterium tuberculosis infection. Here, we examined the various dendritic cells (DC) subsets present in the lung and draining lymph nodes (LN) from mice intra-tracheally infected with M. tuberculosis. We showed that although limited in number, pulmonary CD103 + DCs appeared to be involved in the initial transport of mycobacteria to the draining mediastinal LN and subsequent activation of T cells. Using CLEC9A-DTR transgenic mice enabling the inducible depletion of CD103 + DCs, we established that this DC subset contributes to the control of mycobacterial burden and plays a role in the early activation of T cells, in particular CD8 + T cells. Our findings thus support a previously unidentified role for pulmonary CD103 + DCs in the rapid mobilization of mycobacteria from the lungs to the draining LN soon after exposure to M. tuberculosis, which is a critical step for the development of the host adaptive immune response. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. A simple non-linear model of immune response

    International Nuclear Information System (INIS)

    Gutnikov, Sergei; Melnikov, Yuri

    2003-01-01

    It is still unknown why the adaptive immune response in the natural immune system based on clonal proliferation of lymphocytes requires interaction of at least two different cell types with the same antigen. We present a simple mathematical model illustrating that the system with separate types of cells for antigen recognition and patogen destruction provides more robust adaptive immunity than the system where just one cell type is responsible for both recognition and destruction. The model is over-simplified as we did not have an intention of describing the natural immune system. However, our model provides a tool for testing the proposed approach through qualitative analysis of the immune system dynamics in order to construct more sophisticated models of the immune systems that exist in the living nature. It also opens a possibility to explore specific features of highly non-linear dynamics in nature-inspired computational paradigms like artificial immune systems and immunocomputing . We expect this paper to be of interest not only for mathematicians but also for biologists; therefore we made effort to explain mathematics in sufficient detail for readers without professional mathematical background

  8. Spirochetal Lipoproteins and Immune Evasion

    Science.gov (United States)

    Christodoulides, Alexei; Boyadjian, Ani; Kelesidis, Theodoros

    2017-01-01

    Spirochetes are a major threat to public health. However, the exact pathogenesis of spirochetal diseases remains unclear. Spirochetes express lipoproteins that often determine the cross talk between the host and spirochetes. Lipoproteins are pro-inflammatory, modulatory of immune responses, and enable the spirochetes to evade the immune system. In this article, we review the modulatory effects of spirochetal lipoproteins related to immune evasion. Understanding lipoprotein-induced immunomodulation will aid in elucidating innate pathogenesis processes and subsequent adaptive mechanisms potentially relevant to spirochetal disease vaccine development and treatment. PMID:28424696

  9. The role of the immune system in neurodegenerative disorders: Adaptive or maladaptive?

    Science.gov (United States)

    Doty, Kevin R; Guillot-Sestier, Marie-Victoire; Town, Terrence

    2015-08-18

    Neurodegenerative diseases share common features, including catastrophic neuronal loss that leads to cognitive or motor dysfunction. Neuronal injury occurs in an inflammatory milieu that is populated by resident and sometimes, infiltrating, immune cells - all of which participate in a complex interplay between secreted inflammatory modulators and activated immune cell surface receptors. The importance of these immunomodulators is highlighted by the number of immune factors that have been associated with increased risk of neurodegeneration in recent genome-wide association studies. One of the more difficult tasks for designing therapeutic strategies for immune modulation against neurodegenerative diseases is teasing apart beneficial from harmful signals. In this regard, learning more about the immune components of these diseases has yielded common themes. These unifying concepts should eventually enable immune-based therapeutics for treatment of Alzheimer׳s and Parkinson׳s diseases and amyotrophic lateral sclerosis. Targeted immune modulation should be possible to temper maladaptive factors, enabling beneficial immune responses in the context of neurodegenerative diseases. This article is part of a Special Issue entitled SI: Neuroimmunology in Health And Disease. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Dermatology in the Darwin anniversary. Part 2: Evolution of the skin-associated immune system.

    Science.gov (United States)

    Wölfle, Ute; Martin, Stefan; Emde, Matthias; Schempp, Christoph

    2009-10-01

    The present review highlights the evolution of the skin-associated immune system from the invertebrates to the vertebrates and man. In the invertebrates a non-specific humoral immune response dominates. It includes antimicrobial peptides, oxidases, lysozyme, agglutinins, coagulins and melanin. The cellular immune system initially consists of undifferentiated mesenchymal stem cells. Later migrating phagocytes and natural killer cells occur. From the fishes on, dendritic cells are present, linking innate and adaptive immune responses. In addition to this unspecific but highly effective immune system, the specific immune response, based on genetic recombination, is present in the vertebrates starting with the chondral fishes. The adaptive immune system possesses unlimited numbers of highly specific antibodies and T-cell receptors, increasingly tissue specific MHC restriction, and cellular memory. Elements of the skin-associated adaptive immune system are first detectable in the teleost fishes in the form of intraepithelial IgM positive lymphocytes and dendritic cells. Moving up to mammals and man, the skin-associated immune system became more and more complex and effective.

  11. Zinc and immunity: An essential interrelation.

    Science.gov (United States)

    Maares, Maria; Haase, Hajo

    2016-12-01

    The significance of the essential trace element zinc for immune function has been known for several decades. Zinc deficiency affects immune cells, resulting in altered host defense, increased risk of inflammation, and even death. The micronutrient zinc is important for maintenance and development of immune cells of both the innate and adaptive immune system. A disrupted zinc homeostasis affects these cells, leading to impaired formation, activation, and maturation of lymphocytes, disturbed intercellular communication via cytokines, and weakened innate host defense via phagocytosis and oxidative burst. This review outlines the connection between zinc and immunity by giving a survey on the major roles of zinc in immune cell function, and their potential consequences in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Cholinergic Modulation of Type 2 Immune Responses

    Directory of Open Access Journals (Sweden)

    Goele Bosmans

    2017-12-01

    Full Text Available In recent years, the bidirectional relationship between the nervous and immune system has become increasingly clear, and its role in both homeostasis and inflammation has been well documented over the years. Since the introduction of the cholinergic anti-inflammatory pathway, there has been an increased interest in parasympathetic regulation of both innate and adaptive immune responses, including T helper 2 responses. Increasing evidence has been emerging suggesting a role for the parasympathetic nervous system in the pathophysiology of allergic diseases, including allergic rhinitis, asthma, food allergy, and atopic dermatitis. In this review, we will highlight the role of cholinergic modulation by both nicotinic and muscarinic receptors in several key aspects of the allergic inflammatory response, including barrier function, innate and adaptive immune responses, and effector cells responses. A better understanding of these cholinergic processes mediating key aspects of type 2 immune disorders might lead to novel therapeutic approaches to treat allergic diseases.

  13. The innate and adaptive immune response induced by alveolar macrophages exposed to ambient particulate matter

    International Nuclear Information System (INIS)

    Miyata, Ryohei; Eeden, Stephan F. van

    2011-01-01

    Emerging epidemiological evidence suggests that exposure to particulate matter (PM) air pollution increases the risk of cardiovascular events but the exact mechanism by which PM has adverse effects is still unclear. Alveolar macrophages (AM) play a major role in clearing and processing inhaled PM. This comprehensive review of research findings on immunological interactions between AM and PM provides potential pathophysiological pathways that interconnect PM exposure with adverse cardiovascular effects. Coarse particles (10 μm or less, PM 10 ) induce innate immune responses via endotoxin-toll-like receptor (TLR) 4 pathway while fine (2.5 μm or less, PM 2.5 ) and ultrafine particles (0.1 μm or less, UFP) induce via reactive oxygen species generation by transition metals and/or polyaromatic hydrocarbons. The innate immune responses are characterized by activation of transcription factors [nuclear factor (NF)-κB and activator protein-1] and the downstream proinflammatory cytokine [interleukin (IL)-1β, IL-6, and tumor necrosis factor-α] production. In addition to the conventional opsonin-dependent phagocytosis by AM, PM can also be endocytosed by an opsonin-independent pathway via scavenger receptors. Activation of scavenger receptors negatively regulates the TLR4-NF-κB pathway. Internalized particles are subsequently subjected to adaptive immunity involving major histocompatibility complex class II (MHC II) expression, recruitment of costimulatory molecules, and the modulation of the T helper (Th) responses. AM show atypical antigen presenting cell maturation in which phagocytic activity decreases while both MHC II and costimulatory molecules remain unaltered. PM drives AM towards a Th1 profile but secondary responses in a Th1- or Th-2 up-regulated milieu drive the response in favor of a Th2 profile.

  14. Mathematical and Computational Modeling for Tumor Virotherapy with Mediated Immunity.

    Science.gov (United States)

    Timalsina, Asim; Tian, Jianjun Paul; Wang, Jin

    2017-08-01

    We propose a new mathematical modeling framework based on partial differential equations to study tumor virotherapy with mediated immunity. The model incorporates both innate and adaptive immune responses and represents the complex interaction among tumor cells, oncolytic viruses, and immune systems on a domain with a moving boundary. Using carefully designed computational methods, we conduct extensive numerical simulation to the model. The results allow us to examine tumor development under a wide range of settings and provide insight into several important aspects of the virotherapy, including the dependence of the efficacy on a few key parameters and the delay in the adaptive immunity. Our findings also suggest possible ways to improve the virotherapy for tumor treatment.

  15. Modulation of host immunity by tick saliva

    Czech Academy of Sciences Publication Activity Database

    Kotál, Jan; Langhansová, H.; Lieskovská, J.; Andersen, J. F.; Francischetti, I.M.B.; Chavakis, T.; Kopecký, J.; Pedra, J. H. F.; Kotsyfakis, Michalis; Chmelař, J.

    2015-01-01

    Roč. 128, OCT 14 2015 (2015), s. 58-68 ISSN 1874-3919 R&D Projects: GA ČR GAP502/12/2409 Institutional support: RVO:60077344 Keywords : Adaptive immunity * Innate immunity * Saliva * Salivary glands * Tick Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.867, year: 2015

  16. Mathematical modeling on T-cell mediated adaptive immunity in primary dengue infections.

    Science.gov (United States)

    Sasmal, Sourav Kumar; Dong, Yueping; Takeuchi, Yasuhiro

    2017-09-21

    At present, dengue is the most common mosquito-borne viral disease in the world, and the global dengue incidence is increasing day by day due to climate changing. Here, we present a mathematical model of dengue viruses (DENVs) dynamics in micro-environment (cellular level) consisting of healthy cells, infected cells, virus particles and T-cell mediated adaptive immunity. We have considered the explicit role of cytokines and antibody in our model. We find that the virus load goes down to zero within 6 days as it is common for DENV infection. From our analysis, we have identified the important model parameters and done the numerical simulation with respect to such important parameters. We have shown that the cytokine mediated virus clearance plays a very important role in dengue dynamics. It can change the dynamical behavior of the system and causes essential extinction of the virus. Finally, we have incorporated the antiviral treatment for dengue in our model and shown that the basic reproduction number is directly proportional to the antiviral treatment effects. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. The p36 Isoform of Murine Cytomegalovirus m152 Protein Suffices for Mediating Innate and Adaptive Immune Evasion

    Directory of Open Access Journals (Sweden)

    Annette Fink

    2013-12-01

    Full Text Available The MHC-class I (MHC-I-like viral (MHC-Iv m152 gene product of murine cytomegalovirus (mCMV was the first immune evasion molecule described for a member of the β-subfamily of herpesviruses as a paradigm for analogous functions of human cytomegalovirus proteins. Notably, by interacting with classical MHC-I molecules and with MHC-I-like RAE1 family ligands of the activatory natural killer (NK cell receptor NKG2D, it inhibits presentation of antigenic peptides to CD8 T cells and the NKG2D-dependent activation of NK cells, respectively, thus simultaneously interfering with adaptive and innate immune recognition of infected cells. Although the m152 gene product exists in differentially glycosylated isoforms whose individual contributions to immune evasion are unknown, it has entered the scientific literature as m152/gp40, based on the quantitatively most prominent isoform but with no functional justification. By construction of a recombinant mCMV in which all three N-glycosylation sites are mutated (N61Q, N208Q, and N241Q, we show here that N-linked glycosylation is not essential for functional interaction of the m152 immune evasion protein with either MHC-I or RAE1. These data add an important functional detail to recent structural analysis of the m152/RAE1g complex that has revealed N-glycosylations at positions Asn61 and Asn208 of m152 distant from the m152/RAE1g interface.

  18. Stromal cell contributions to the homeostasis and functionality of the immune system.

    Science.gov (United States)

    Mueller, Scott N; Germain, Ronald N

    2009-09-01

    A defining characteristic of the immune system is the constant movement of many of its constituent cells through the secondary lymphoid tissues, mainly the spleen and lymph nodes, where crucial interactions that underlie homeostatic regulation, peripheral tolerance and the effective development of adaptive immune responses take place. What has only recently been recognized is the role that non-haematopoietic stromal elements have in many aspects of immune cell migration, activation and survival. In this Review, we summarize our current understanding of lymphoid compartment stromal cells, examine their possible heterogeneity, discuss how these cells contribute to immune homeostasis and the efficient initiation of adaptive immune responses, and highlight how targeting of these elements by some pathogens can influence the host immune response.

  19. Laser Therapy Inhibits Tumor Growth in Mice by Promoting Immune Surveillance and Vessel Normalization

    Directory of Open Access Journals (Sweden)

    Giulia Ottaviani

    2016-09-01

    Full Text Available Laser therapy, recently renamed as photobiomodulation, stands as a promising supportive treatment for oral mucositis induced by oncological therapies. However, its mechanisms of action and, more importantly, its safety in cancer patients, are still unclear. Here we explored the anti-cancer effect of 3 laser protocols, set at the most commonly used wavelengths, in B16F10 melanoma and oral carcinogenesis mouse models. While laser light increased cell metabolism in cultured cells, the in vivo outcome was reduced tumor progression. This striking, unexpected result, was paralleled by the recruitment of immune cells, in particular T lymphocytes and dendritic cells, which secreted type I interferons. Laser light also reduced the number of highly angiogenic macrophages within the tumor mass and promoted vessel normalization, an emerging strategy to control tumor progression. Collectively, these results set photobiomodulation as a safety procedure in oncological patients and open the way to its innovative use for cancer therapy.

  20. Anatomical localization of commensal bacteria in immune cell homeostasis and disease.

    Science.gov (United States)

    Fung, Thomas C; Artis, David; Sonnenberg, Gregory F

    2014-07-01

    The mammalian gastrointestinal (GI) tract is colonized by trillions of beneficial commensal bacteria that are essential for promoting normal intestinal physiology. While the majority of commensal bacteria are found in the intestinal lumen, many species have also adapted to colonize different anatomical locations in the intestine, including the surface of intestinal epithelial cells (IECs) and the interior of gut-associated lymphoid tissues. These distinct tissue localization patterns permit unique interactions with the mammalian immune system and collectively influence intestinal immune cell homeostasis. Conversely, dysregulated localization of commensal bacteria can lead to inappropriate activation of the immune system and is associated with numerous chronic infectious, inflammatory, and metabolic diseases. Therefore, regulatory mechanisms that control proper anatomical containment of commensal bacteria are essential to maintain tissue homeostasis and limit pathology. In this review, we propose that commensal bacteria associated with the mammalian GI tract can be anatomically defined as (i) luminal, (ii) epithelial-associated, or (iii) lymphoid tissue-resident, and we discuss the role and regulation of these microbial populations in health and disease. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Mucosal immunity to pathogenic intestinal bacteria.

    Science.gov (United States)

    Perez-Lopez, Araceli; Behnsen, Judith; Nuccio, Sean-Paul; Raffatellu, Manuela

    2016-03-01

    The intestinal mucosa is a particularly dynamic environment in which the host constantly interacts with trillions of commensal microorganisms, known as the microbiota, and periodically interacts with pathogens of diverse nature. In this Review, we discuss how mucosal immunity is controlled in response to enteric bacterial pathogens, with a focus on the species that cause morbidity and mortality in humans. We explain how the microbiota can shape the immune response to pathogenic bacteria, and we detail innate and adaptive immune mechanisms that drive protective immunity against these pathogens. The vast diversity of the microbiota, pathogens and immune responses encountered in the intestines precludes discussion of all of the relevant players in this Review. Instead, we aim to provide a representative overview of how the intestinal immune system responds to pathogenic bacteria.

  2. Immune mediated liver failure.

    Science.gov (United States)

    Wang, Xiaojing; Ning, Qin

    2014-01-01

    Liver failure is a clinical syndrome of various etiologies, manifesting as jaundice, encephalopathy, coagulopathy and circulatory dysfunction, which result in subsequent multiorgan failure. Clinically, liver failure is classified into four categories: acute, subacute, acute-on-chronic and chronic liver failure. Massive hepatocyte death is considered to be the core event in the development of liver failure, which occurs when the extent of hepatocyte death is beyond the liver regenerative capacity. Direct damage and immune-mediated liver injury are two major factors involved in this process. Increasing evidence has suggested the essential role of immune-mediated liver injury in the pathogenesis of liver failure. Here, we review the evolved concepts concerning the mechanisms of immune-mediated liver injury in liver failure from human and animal studies. Both innate and adaptive immunity, especially the interaction of various immune cells and molecules as well as death receptor signaling system are discussed. In addition, we highlight the concept of "immune coagulation", which has been shown to be related to the disease progression and liver injury exacerbation in HBV related acute-on-chronic liver failure.

  3. Innate immunity in the pathogenesis of psoriasis.

    LENUS (Irish Health Repository)

    Sweeney, Cheryl M

    2011-12-01

    Psoriasis is a common, immune-mediated inflammatory skin disorder. T helper(h)1 and Th17 lymphocytes contribute to the pathogenesis of psoriasis through the release of inflammatory cytokines that promote further recruitment of immune cells, keratinocyte proliferation and sustained inflammation. The innate immune system is the first line of defence against infection and plays a crucial role in the initiation of the adaptive immune response. The presence of innate immune cells and their products in psoriatic skin plaques suggests a role for innate immunity in this disease. In addition, the innate immune system can direct the development of pathogenic Th cells in psoriasis. In this article, we will summarise the role of the innate immune system in psoriasis with particular emphasis on the role of cytokines, signalling pathways and cells of the innate immune system.

  4. Molecular adjuvants based on nonpyrogenic lipophilic derivatives of norAbuMDP/GMDP formulated in nanoliposomes: stimulation of innate and adaptive immunity.

    Science.gov (United States)

    Knotigová, Pavlína Turánek; Zyka, Daniel; Mašek, Josef; Kovalová, Anna; Křupka, Michal; Bartheldyová, Eliška; Kulich, Pavel; Koudelka, Štěpán; Lukáč, Róbert; Kauerová, Zuzana; Vacek, Antonín; Horynová, Milada Stuchlová; Kozubík, Alois; Miller, Andrew D; Fekete, Ladislav; Kratochvílová, Irena; Ježek, Jan; Ledvina, Miroslav; Raška, Milan; Turánek, Jaroslav

    2015-04-01

    The aim of this work was to demonstrate an immunostimulatory and adjuvant effect of new apyrogenic lipophilic derivatives of norAbuMDP and norAbuGMDP formulated in nanoliposomes. Nanoliposomes and metallochelating nanoliposomes were prepared by lipid film hydration and extrusion methods. The structure of the liposomal formulation was studied by electron microscopy, AF microscopy, and dynamic light scattering. Sublethal and lethal γ-irradiation mice models were used to demonstrate stimulation of innate immune system. Recombinant Hsp90 antigen (Candida albicans) bound onto metallochelating nanoliposomes was used for immunisation of mice to demonstrate adjuvant activities of tested compounds. Safety and stimulation of innate and adaptive immunity were demonstrated on rabbits and mice. The liposomal formulation of norAbuMDP/GMDP was apyrogenic in rabbit test and lacking any side effect in vivo. Recovery of bone marrow after sublethal γ-irradiation as well as increased survival of mice after lethal irradiation was demonstrated. Enhancement of specific immune response was demonstrated for some derivatives incorporated in metallochelating nanoliposomes with recombinant Hsp90 protein antigen. Liposomal formulations of new lipophilic derivatives of norAbuMDP/GMDP proved themselves as promising adjuvants for recombinant vaccines as well as immunomodulators for stimulation of innate immunity and bone-marrow recovery after chemo/radio therapy of cancer.

  5. The Immune Epitope Database 2.0

    DEFF Research Database (Denmark)

    Hoof, Ilka; Vita, R; Zarebski, L

    2010-01-01

    The Immune Epitope Database (IEDB, www.iedb.org) provides a catalog of experimentally characterized B and T cell epitopes, as well as data on Major Histocompatibility Complex (MHC) binding and MHC ligand elution experiments. The database represents the molecular structures recognized by adaptive...... immune receptors and the experimental contexts in which these molecules were determined to be immune epitopes. Epitopes recognized in humans, nonhuman primates, rodents, pigs, cats and all other tested species are included. Both positive and negative experimental results are captured. Over the course...

  6. Innate immune recognition and activation during HIV infection

    Directory of Open Access Journals (Sweden)

    Larsen Carsten S

    2010-06-01

    Full Text Available Abstract The pathogenesis of HIV infection, and in particular the development of immunodeficiency, remains incompletely understood. Whichever intricate molecular mechanisms are at play between HIV and the host, it is evident that the organism is incapable of restricting and eradicating the invading pathogen. Both innate and adaptive immune responses are raised, but they appear to be insufficient or too late to eliminate the virus. Moreover, the picture is complicated by the fact that the very same cells and responses aimed at eliminating the virus seem to play deleterious roles by driving ongoing immune activation and progressive immunodeficiency. Whereas much knowledge exists on the role of adaptive immunity during HIV infection, it has only recently been appreciated that the innate immune response also plays an important part in HIV pathogenesis. In this review, we present current knowledge on innate immune recognition and activation during HIV infection based on studies in cell culture, non-human primates, and HIV-infected individuals, and discuss the implications for the understanding of HIV immunopathogenesis.

  7. Cheetahs have a stronger constitutive innate immunity than leopards.

    Science.gov (United States)

    Heinrich, Sonja K; Hofer, Heribert; Courtiol, Alexandre; Melzheimer, Jörg; Dehnhard, Martin; Czirják, Gábor Á; Wachter, Bettina

    2017-03-23

    As a textbook case for the importance of genetics in conservation, absence of genetic variability at the major histocompatibility complex (MHC) is thought to endanger species viability, since it is considered crucial for pathogen resistance. An alternative view of the immune system inspired by life history theory posits that a strong response should evolve in other components of the immune system if there is little variation in the MHC. In contrast to the leopard (Panthera pardus), the cheetah (Acinonyx jubatus) has a relatively low genetic variability at the MHC, yet free-ranging cheetahs are healthy. By comparing the functional competence of the humoral immune system of both species in sympatric populations in Namibia, we demonstrate that cheetahs have a higher constitutive innate but lower induced innate and adaptive immunity than leopards. We conclude (1) immunocompetence of cheetahs is higher than previously thought; (2) studying both innate and adaptive components of immune systems will enrich conservation science.

  8. The Scaffold Immune Microenvironment: Biomaterial-Mediated Immune Polarization in Traumatic and Nontraumatic Applications.

    Science.gov (United States)

    Sadtler, Kaitlyn; Allen, Brian W; Estrellas, Kenneth; Housseau, Franck; Pardoll, Drew M; Elisseeff, Jennifer H

    2017-10-01

    The immune system mediates tissue growth and homeostasis and is the first responder to injury or biomaterial implantation. Recently, it has been appreciated that immune cells play a critical role in wound healing and tissue repair and should thus be considered potentially beneficial, particularly in the context of scaffolds for regenerative medicine. In this study, we present a flow cytometric analysis of cellular recruitment to tissue-derived extracellular matrix scaffolds, where we quantitatively describe the infiltration and polarization of several immune subtypes, including macrophages, dendritic cells, neutrophils, monocytes, T cells, and B cells. We define a specific scaffold-associated macrophage (SAM) that expresses CD11b + F4/80 + CD11c +/- CD206 hi CD86 + MHCII + that are characteristic of an M2-like cell (CD206 hi ) with high antigen presentation capabilities (MHCII + ). Adaptive immune cells tightly regulate the phenotype of a mature SAM. These studies provide a foundation for detailed characterization of the scaffold immune microenvironment of a given biomaterial scaffold to determine the effect of scaffold changes on immune response and subsequent therapeutic outcome of that material.

  9. Evaluation of Traditional Medicines III: The Mechanism of Immune ...

    African Journals Online (AJOL)

    These results show that PHELA did not stimulate Th1 cytokines of a normal immune system but stimulated them when the immune system was suppressed by cyclosporine-A. In conclusion, PHELA is an immune-stimulant to a compromised immune system. Key words: PHELA, traditional medicine, cyclosporine-A, cytokines, ...

  10. Stromal infrastructure of the lymph node and coordination of immunity.

    Science.gov (United States)

    Chang, Jonathan E; Turley, Shannon J

    2015-01-01

    The initiation of adaptive immune responses depends upon the careful maneuvering of lymphocytes and antigen into and within strategically placed lymph nodes (LNs). Non-hematopoietic stromal cells form the cellular infrastructure that directs this process. Once regarded as merely structural features of lymphoid tissues, these cells are now appreciated as essential regulators of immune cell trafficking, fluid flow, and LN homeostasis. Recent advances in the identification and in vivo targeting of specific stromal populations have resulted in striking new insights to the function of stromal cells and reveal a level of complexity previously unrealized. We discuss here recent discoveries that highlight the pivotal role that stromal cells play in orchestrating immune cell homeostasis and adaptive immunity. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Dynamic Fungal Cell Wall Architecture in Stress Adaptation and Immune Evasion.

    Science.gov (United States)

    Hopke, Alex; Brown, Alistair J P; Hall, Rebecca A; Wheeler, Robert T

    2018-04-01

    Deadly infections from opportunistic fungi have risen in frequency, largely because of the at-risk immunocompromised population created by advances in modern medicine and the HIV/AIDS pandemic. This review focuses on dynamics of the fungal polysaccharide cell wall, which plays an outsized role in fungal pathogenesis and therapy because it acts as both an environmental barrier and as the major interface with the host immune system. Human fungal pathogens use architectural strategies to mask epitopes from the host and prevent immune surveillance, and recent work elucidates how biotic and abiotic stresses present during infection can either block or enhance masking. The signaling components implicated in regulating fungal immune recognition can teach us how cell wall dynamics are controlled, and represent potential targets for interventions designed to boost or dampen immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. NKT cell self-reactivity: evolutionary master key of immune homeostasis?

    DEFF Research Database (Denmark)

    Navikas, Shohreh

    2011-01-01

    Complex immune responses have evolved to protect multicellular organisms against the invasion of pathogens. This has exerted strong developmental pressure for specialized functions that can also limit damage to self-tissue. Two arms of immunity, the innate and adaptive immune system, have evolved...... through evolution by higher vertebrates could be related to their central function as master regulators of immune homeostasis that in part is shared with regulatory T cells. Hypothetical views on how self-reactive NKT cells secure such a central role will also be proposed.......Complex immune responses have evolved to protect multicellular organisms against the invasion of pathogens. This has exerted strong developmental pressure for specialized functions that can also limit damage to self-tissue. Two arms of immunity, the innate and adaptive immune system, have evolved....... The recent finding of self-peptide reactivity of NKT cells in the context of CD1d, with capacity to regulate multiple autoimmune and inflammatory conditions, motivates the current proposal that self-reactive NKT cells might be the ancestral link between present NK and T cells. Their parallel selection...

  13. CRISPR-Cas: Adapting to change.

    Science.gov (United States)

    Jackson, Simon A; McKenzie, Rebecca E; Fagerlund, Robert D; Kieper, Sebastian N; Fineran, Peter C; Brouns, Stan J J

    2017-04-07

    Bacteria and archaea are engaged in a constant arms race to defend against the ever-present threats of viruses and invasion by mobile genetic elements. The most flexible weapons in the prokaryotic defense arsenal are the CRISPR-Cas adaptive immune systems. These systems are capable of selective identification and neutralization of foreign DNA and/or RNA. CRISPR-Cas systems rely on stored genetic memories to facilitate target recognition. Thus, to keep pace with a changing pool of hostile invaders, the CRISPR memory banks must be regularly updated with new information through a process termed CRISPR adaptation. In this Review, we outline the recent advances in our understanding of the molecular mechanisms governing CRISPR adaptation. Specifically, the conserved protein machinery Cas1-Cas2 is the cornerstone of adaptive immunity in a range of diverse CRISPR-Cas systems. Copyright © 2017, American Association for the Advancement of Science.

  14. "The Impact of Mycobacterium tuberculosis Immune Evasion on Protective Immunity: Implications for TB Vaccine Design" - Meeting report.

    Science.gov (United States)

    Boggiano, Cesar; Eichelberg, Katrin; Ramachandra, Lakshmi; Shea, Jaqueline; Ramakrishnan, Lalita; Behar, Samuel; Ernst, Joel D; Porcelli, Steven A; Maeurer, Markus; Kornfeld, Hardy

    2017-06-14

    Tuberculosis (TB) is the major cause of death from infectious diseases around the world, particularly in HIV infected individuals. TB vaccine design and development have been focused on improving Bacille Calmette-Guérin (BCG) and evaluating recombinant and viral vector expressed Mycobacterium tuberculosis (Mtb) proteins, for boosting BCG-primed immunity, but these approaches have not yet yielded significant improvements over the modest effects of BCG in protecting against infection or disease. On March 7-8, 2016, the National Institute of Allergy and Infectious Diseases (NIAID) convened a workshop on "The Impact of Mtb Immune Evasion on Protective Immunity: Implications for TB Vaccine Design" with the goal of defining immune mechanisms that could be targeted through novel research approaches, to inform vaccine design and immune therapeutic interventions for prevention of TB. The workshop addressed early infection events, the impact of Mtb evolution on the development and maintenance of an adaptive immune response, and the factors that influence protection against and progression to active disease. Scientific gaps and areas of study to revitalize and accelerate TB vaccine design were discussed and prioritized. These included a comprehensive evaluation of innate and Mtb-specific adaptive immune responses in the lung at different stages of disease; determining the role of B cells and antibodies (Abs) during Mtb infection; development of better assays to measure Mtb burden following exposure, infection, during latency and after treatment, and approaches to improving current animal models to study Mtb immunogenicity, TB disease and transmission. Copyright © 2017.

  15. The innate and adaptive immune response induced by alveolar macrophages exposed to ambient particulate matter

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Ryohei; Eeden, Stephan F. van, E-mail: Stephan.vanEeden@hli.ubc.ca

    2011-12-15

    Emerging epidemiological evidence suggests that exposure to particulate matter (PM) air pollution increases the risk of cardiovascular events but the exact mechanism by which PM has adverse effects is still unclear. Alveolar macrophages (AM) play a major role in clearing and processing inhaled PM. This comprehensive review of research findings on immunological interactions between AM and PM provides potential pathophysiological pathways that interconnect PM exposure with adverse cardiovascular effects. Coarse particles (10 {mu}m or less, PM{sub 10}) induce innate immune responses via endotoxin-toll-like receptor (TLR) 4 pathway while fine (2.5 {mu}m or less, PM{sub 2.5}) and ultrafine particles (0.1 {mu}m or less, UFP) induce via reactive oxygen species generation by transition metals and/or polyaromatic hydrocarbons. The innate immune responses are characterized by activation of transcription factors [nuclear factor (NF)-{kappa}B and activator protein-1] and the downstream proinflammatory cytokine [interleukin (IL)-1{beta}, IL-6, and tumor necrosis factor-{alpha}] production. In addition to the conventional opsonin-dependent phagocytosis by AM, PM can also be endocytosed by an opsonin-independent pathway via scavenger receptors. Activation of scavenger receptors negatively regulates the TLR4-NF-{kappa}B pathway. Internalized particles are subsequently subjected to adaptive immunity involving major histocompatibility complex class II (MHC II) expression, recruitment of costimulatory molecules, and the modulation of the T helper (Th) responses. AM show atypical antigen presenting cell maturation in which phagocytic activity decreases while both MHC II and costimulatory molecules remain unaltered. PM drives AM towards a Th1 profile but secondary responses in a Th1- or Th-2 up-regulated milieu drive the response in favor of a Th2 profile.

  16. The microRNA miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by targeting interferon-γ.

    Science.gov (United States)

    Ma, Feng; Xu, Sheng; Liu, Xingguang; Zhang, Qian; Xu, Xiongfei; Liu, Mofang; Hua, Minmin; Li, Nan; Yao, Hangping; Cao, Xuetao

    2011-07-24

    Interferon-γ (IFN-γ) has a critical role in immune responses to intracellular bacterial infection. MicroRNAs (miRNAs) are important in the regulation of innate and adaptive immunity. However, whether miRNAs can directly target IFN-γ and regulate IFN-γ production post-transcriptionally remains unknown. Here we show that infection of mice with Listeria monocytogenes or Mycobacterium bovis bacillus Calmette-Guérin (BCG) downregulated miR-29 expression in IFN-γ-producing natural killer cells, CD4(+) T cells and CD8(+) T cells. Moreover, miR-29 suppressed IFN-γ production by directly targeting IFN-γ mRNA. We developed mice with transgenic expression of a 'sponge' target to compete with endogenous miR-29 targets (GS29 mice). We found higher serum concentrations of IFN-γ and lower L. monocytogenes burdens in L. monocytogenes-infected GS29 mice than in their littermates. GS29 mice had enhanced T helper type 1 (T(H)1) responses and greater resistance to infection with BCG or Mycobacterium tuberculosis. Therefore, miR-29 suppresses immune responses to intracellular pathogens by targeting IFN-γ.

  17. Innate immunity in vertebrates: an overview.

    Science.gov (United States)

    Riera Romo, Mario; Pérez-Martínez, Dayana; Castillo Ferrer, Camila

    2016-06-01

    Innate immunity is a semi-specific and widely distributed form of immunity, which represents the first line of defence against pathogens. This type of immunity is critical to maintain homeostasis and prevent microbe invasion, eliminating a great variety of pathogens and contributing with the activation of the adaptive immune response. The components of innate immunity include physical and chemical barriers, humoral and cell-mediated components, which are present in all jawed vertebrates. The understanding of innate defence mechanisms in non-mammalian vertebrates is the key to comprehend the general picture of vertebrate innate immunity and its evolutionary history. This is also essential for the identification of new molecules with applications in immunopharmacology and immunotherapy. In this review, we describe and discuss the main elements of vertebrate innate immunity, presenting core findings in this field and identifying areas that need further investigation. © 2016 John Wiley & Sons Ltd.

  18. Xanthomonas campestris lipooligosaccharides trigger innate immunity and oxidative burst in Arabidopsis

    NARCIS (Netherlands)

    Proietti, S; Giangrande, C; Amoresano, A; Pucci, P; Molinaro, A; Bertini, L; Caporale, C; Caruso, C

    2014-01-01

    Plants lack the adaptive immunity mechanisms of jawed vertebrates, so they rely on innate immune responses to defense themselves from pathogens. The plant immune system perceives the presence of pathogens by recognition of molecules known as pathogen-associated molecular patterns (PAMPs). PAMPs have

  19. Physical Activities, Exercises, and Their Effects to the Immune System

    OpenAIRE

    Nurmasitoh, Titis

    2015-01-01

    Every systems in human body correlate to maintain homeostasis. One of those systems which contribute to maintain homeostasis is the immune system. The immune system defends physiological functions against foreign substances and cancer cells through a complex and multilayered mechanism. The ability to defend against foreign substances and abnormal cells is done by two types of immune system, which are Innate immune system and adaptive/acquired immune system. There are also certain factors that...

  20. A specific primed immune response in Drosophila is dependent on phagocytes.

    Directory of Open Access Journals (Sweden)

    Linh N Pham

    2007-03-01

    Full Text Available Drosophila melanogaster, like other invertebrates, relies solely on its innate immune response to fight invading microbes; by definition, innate immunity lacks adaptive characteristics. However, we show here that priming Drosophila with a sublethal dose of Streptococcus pneumoniae protects against an otherwise-lethal second challenge of S. pneumoniae. This protective effect exhibits coarse specificity for S. pneumoniae and persists for the life of the fly. Although not all microbial challenges induced this specific primed response, we find that a similar specific protection can be elicited by Beauveria bassiana, a natural fly pathogen. To characterize this primed response, we focused on S. pneumoniae-induced protection. The mechanism underlying this protective effect requires phagocytes and the Toll pathway. However, activation of the Toll pathway is not sufficient for priming-induced protection. This work contradicts the paradigm that insect immune responses cannot adapt and will promote the search for similar responses overlooked in organisms with an adaptive immune response.

  1. Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.

    Science.gov (United States)

    Zhang, Jie; Liu, Huan; Wei, Bin

    Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.

  2. Immunity to intestinal pathogens: lessons learned from Salmonella

    Science.gov (United States)

    McSorley, Stephen J.

    2014-01-01

    Summary Salmonella are a common source of food or water-borne infection and cause a wide range of clinical disease in human and animal hosts. Salmonella are relatively easy to culture and manipulate in a laboratory setting, and the infection of laboratory animals induces robust innate and adaptive immune responses. Thus, immunologists have frequently turned to Salmonella infection models to expand understanding of immunity to intestinal pathogens. In this review, I summarize current knowledge of innate and adaptive immunity to Salmonella and highlight features of this response that have emerged from recent studies. These include the heterogeneity of the antigen-specific T-cell response to intestinal infection, the prominence of microbial mechanisms to impede T and B-cell responses, and the contribution of non-cognate pathways for elicitation of T-cell effector functions. Together, these different issues challenge an overly simplistic view of host-pathogen interaction during mucosal infection but also allow deeper insight into the real-world dynamic of protective immunity to intestinal pathogens. PMID:24942689

  3. Heavy metal pollution disturbs immune response in wild ant populations

    International Nuclear Information System (INIS)

    Sorvari, Jouni; Rantala, Liisa M.; Rantala, Markus J.; Hakkarainen, Harri; Eeva, Tapio

    2007-01-01

    Concern about the effects of environmental contaminants on immune function in both humans and wildlife is growing and practically nothing is known about this impact on terrestrial invertebrates, even though they are known to easily accumulate pollutants. We studied the effect of industrial heavy metal contamination on immune defense of a free-living wood ant (Formica aquilonia). To find out whether ants show an adapted immune function in a polluted environment, we compared encapsulation responses between local and translocated colonies. Local colonies showed higher heavy metal levels than the translocated ones but the encapsulation response was similar between the two groups, indicating that the immune system of local ants has not adapted to high contamination level. The encapsulation response was elevated in moderate whereas suppressed in high heavy metal levels suggesting higher risk for infections in heavily polluted areas. - Heavy metal pollution affects immune function in ants

  4. Fibroblast activation protein is dispensable in the anti-influenza immune response in mice.

    Directory of Open Access Journals (Sweden)

    Sioh-Yang Tan

    Full Text Available Fibroblast activation protein alpha (FAP is a unique dual peptidase of the S9B serine protease family, being capable of both dipeptidyl peptidase and endopeptidase activities. FAP is expressed at low level in healthy adult organs including the pancreas, cervix, uterus, submaxillary gland and the skin, and highly upregulated in embryogenesis, chronic inflammation and tissue remodelling. It is also expressed by cancer-associated stromal fibroblasts in more than 90% of epithelial tumours. FAP has enzymatic and non-enzymatic functions in the growth, immunosuppression, invasion and cell signalling of tumour cells. FAP deficient mice are fertile and viable with no gross abnormality, but little data exist on the role of FAP in the immune system. FAP is upregulated in association with microbial stimulation and chronic inflammation, but its function in infection remains unknown. We showed that major populations of immune cells including CD4+ and CD8+ T cells, B cells, dendritic cells and neutrophils are generated and maintained normally in FAP knockout mice. Upon intranasal challenge with influenza virus, FAP mRNA was increased in the lungs and lung-draining lymph nodes. Nonetheless, FAP deficient mice showed similar pathologic kinetics to wildtype controls, and were capable of supporting normal anti-influenza T and B cell responses. There was no evidence of compensatory upregulation of other DPP4 family members in influenza-infected FAP-deficient mice. FAP appears to be dispensable in anti-influenza adaptive immunity.

  5. Passive Immune-Protection of Litopenaeus vannamei against Vibrio harveyi and Vibrio parahaemolyticus Infections with Anti-Vibrio Egg Yolk (IgY-Encapsulated Feed

    Directory of Open Access Journals (Sweden)

    Xiaojian Gao

    2016-05-01

    Full Text Available Vibrio spp. are major causes of mortality in white shrimp (Litopenaeus vannamei which is lacking adaptive immunity. Passive immunization with a specific egg yolk antibody (IgY is a potential method for the protection of shrimp against vibriosis. In this study, immune effects of the specific egg yolk powders (IgY against both V. harveyi and V. parahaemolyticus on white shrimp were evaluated. The egg yolk powders against V. harveyi and V. parahaemolyticus for passive immunization of white shrimp were prepared, while a tube agglutination assay and an indirect enzyme-linked immunosorbent assay (ELISA were used for detection of IgY titer. Anti-Vibrio egg yolk was encapsulated by β-cyclodextrin, which could keep the activity of the antibody in the gastrointestinal tract of shrimp. The results showed that the anti-Vibrio egg powders had an inhibiting effect on V. harveyi and V. parahaemolyticus in vitro. Lower mortality of infected zoeae, mysis, and postlarva was observed in groups fed with anti-Vibrio egg powders, compared with those fed with normal egg powders. The bacterial load in postlarva fed with specific egg powders in seeding ponds was significantly lower than those fed with normal egg powders in seeding ponds. These results show that passive immunization by oral administration with specific egg yolk powders (IgY may provide a valuable protection of vibrio infections in white shrimp.

  6. Organ system view of the hepatic innate immunity in HCV infection.

    Science.gov (United States)

    Bang, Bo-Ram; Elmasry, Sandra; Saito, Takeshi

    2016-12-01

    An orchestration of innate and adaptive immunity determines the infection outcome and whether the host achieves clearance or allows the pathogen to establish persistent infection. The robust activation of the innate immune response plays the most critical role in both limiting viral replication and halting the spread of the pathogen immediately after infection. The magnitude of innate immune activation is coupled with the efficient mounting of the adaptive immunity. Although immunity against HCV infection is known to be inadequate as most cases transitions to chronicity, approximately 25% of acute infection cases result in spontaneous clearance. The exact immune mechanisms that govern the infection outcome remain largely unknown; recent discoveries suggest that the innate immune system facilitates this event. Both infected hepatocytes and local innate immune cells trigger the front line defense program of the liver as well as the recruitment of diverse adaptive immune cells to the site of infection. Although hepatocyte is the target of HCV infection, nearly all cell types that exist in the liver are involved in the innate defense and contribute to the pathophysiology of hepatic inflammation. The main focus of this comprehensive review is to discuss the current knowledge on how each hepatic cell type contributes to the organ system level innate immunity against HCV infection as well as interplays with the viral evasion program. Furthermore, this review article also aims to synchronize the observations from both molecular biological studies and clinical studies with the ultimate goal of improving our understanding of HCV mediated hepatitis. J. Med. Virol. 88:2025-2037, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  7. Opinion: Interactions of innate and adaptive lymphocytes

    Science.gov (United States)

    Gasteiger, Georg; Rudensky, Alexander Y.

    2015-01-01

    Innate lymphocytes, including natural killer (NK) cells and the recently discovered innate lymphoid cells (ILCs) have crucial roles during infection, tissue injury and inflammation. Innate signals regulate the activation and homeostasis of innate lymphocytes. Less well understood is the contribution of the adaptive immune system to the orchestration of innate lymphocyte responses. We review our current understanding of the interactions between adaptive and innate lymphocytes, and propose a model in which adaptive T cells function as antigen-specific sensors for the activation of innate lymphocytes to amplify and instruct local immune responses. We highlight the potential role of regulatory and helper T cells in these processes and discuss major questions in the emerging area of crosstalk between adaptive and innate lymphocytes. PMID:25132095

  8. Amelioration of murine passive immune thrombocytopenia by IVIg and a therapeutic monoclonal CD44 antibody does not require the Myd88 signaling pathway.

    Directory of Open Access Journals (Sweden)

    Andrew R Crow

    Full Text Available Immune thrombocytopenia (ITP is an autoimmune bleeding disorder characterized by a low platelet count and the production of anti-platelet antibodies. The majority of ITP patients have antibodies to platelet integrin α(IIbβ₃ (GPIIbIIIa which can direct platelet phagocytosis by macrophages. One effective treatment for patients with ITP is intravenous immunoglobulin (IVIg which rapidly reverses thrombocytopenia. The exact mechanism of IVIg action in human patients is unclear, although in mouse models of passive ITP, IVIg can rapidly increase platelet counts in the absence of adaptive immunity. Another antibody therapeutic that can similarly increase platelet counts independent of adaptive immunity are CD44 antibodies. Toll-like receptors (TLRs are pattern recognition receptors which play a central role in helping direct the innate immune system. Dendritic cells, which are notable for their expression of TLRs, have been directly implicated in IVIg function as an initiator cell, while CD44 can associate with TLR2 and TLR4. We therefore questioned whether IVIg, or the therapeutic CD44 antibody KM114, mediate their ameliorative effects in a manner dependent upon normal TLR function. Here, we demonstrate that the TLR4 agonist LPS does not inhibit IVIg or KM114 amelioration of antibody-induced thrombocytopenia, and that these therapeutics do not ameliorate LPS-induced thrombocytopenia. IVIg was able to significantly ameliorate murine ITP in C3H/HeJ mice which have defective TLR4. All known murine TLRs except TLR3 utilize the Myd88 adapter protein to drive TLR signaling. Employing Myd88 deficient mice, we found that both IVIg and KM114 ameliorate murine ITP in Myd88 deficient mice to the same extent as normal mice. Thus both IVIg and anti-CD44 antibody can mediate their ameliorative effects in murine passive ITP independent of the Myd88 signaling pathway. These data help shed light on the mechanism of action of IVIg and KM114 in the amelioration of

  9. Reinforcement Learning Based Artificial Immune Classifier

    Directory of Open Access Journals (Sweden)

    Mehmet Karakose

    2013-01-01

    Full Text Available One of the widely used methods for classification that is a decision-making process is artificial immune systems. Artificial immune systems based on natural immunity system can be successfully applied for classification, optimization, recognition, and learning in real-world problems. In this study, a reinforcement learning based artificial immune classifier is proposed as a new approach. This approach uses reinforcement learning to find better antibody with immune operators. The proposed new approach has many contributions according to other methods in the literature such as effectiveness, less memory cell, high accuracy, speed, and data adaptability. The performance of the proposed approach is demonstrated by simulation and experimental results using real data in Matlab and FPGA. Some benchmark data and remote image data are used for experimental results. The comparative results with supervised/unsupervised based artificial immune system, negative selection classifier, and resource limited artificial immune classifier are given to demonstrate the effectiveness of the proposed new method.

  10. Psychosocial adaptation and cellular immunity in breast cancer patients in the weeks after surgery: An exploratory study.

    Science.gov (United States)

    Blomberg, Bonnie B; Alvarez, Juan P; Diaz, Alain; Romero, Maria G; Lechner, Suzanne C; Carver, Charles S; Holley, Heather; Antoni, Michael H

    2009-11-01

    The period just after surgery for breast cancer requires psychosocial adaptation and is associated with elevated distress. Distress states have been associated with decreased cellular immune functioning in this population, which could have negative effects on physical recovery. However, little is known about relations between psychological status [negative and positive mood states and overall quality of life (QOL)] and cellular signaling cytokines that could account for these associations in women undergoing treatment for breast cancer. The present study examined associations between psychological adaptation indicators (mood, QOL) and T-helper cell type 1 (Th1) cytokine production from stimulated peripheral mononuclear cells in women who had recently undergone surgery for early-stage breast cancer but had not yet begun adjuvant therapy. These associations were evaluated while controlling for relevant disease/treatment, sociodemographic, and health behavior covariates. Lower anxiety related to greater production of the Th1 cytokine interleukin-2 (IL-2), while greater positive mood (affection) related to greater production of the Th1 cytokines IL-12 and interferon-gamma (IFN-gamma). Better QOL related to greater production of the Th1 cytokine, tumor necrosis factor-alpha (TNF-alpha). Individual differences in psychosocial adaptation in women with breast cancer during the period after surgery relate to biological parameters that may be relevant for health and well-being as they move through treatment.

  11. Intestinal dendritic cells in the regulation of mucosal immunity

    DEFF Research Database (Denmark)

    Bekiaris, Vasileios; Persson, Emma K.; Agace, William Winston

    2014-01-01

    immune cells within the mucosa must suitably respond to maintain intestinal integrity, while also providing the ability to mount effective immune responses to potential pathogens. Dendritic cells (DCs) are sentinel immune cells that play a central role in the initiation and differentiation of adaptive....... The recognition that dietary nutrients and microbial communities in the intestine influence both mucosal and systemic immune cell development and function as well as immune-mediated disease has led to an explosion of literature in mucosal immunology in recent years and a growing interest in the functionality...

  12. The body’s immune response in the induction and progression of cancer of the cervix uteri: possible mechanisms

    Directory of Open Access Journals (Sweden)

    O. V. Kurmyshkina

    2011-01-01

    Full Text Available Human papillomavirus (HPV that is a main cause of cancer of the cervix uteri (CCU has immunogenic properties, i.e. an abilityto activate antiviral immunity responses as adaptive HPV-specific and innate ones. For this reason, despite multiple mechanisms generated by HPV to avoid immunity responses, the human body can eliminate the infection in most cases. At the same time, CCU results from the combined influence of many factors of different nature, among which the factors that impair the normal course of an immune response are of vital importance.This review describes the major factors and mechanisms, which promote the establishment of persistent HPV infection and the progression of dysplasia to cancer, on the one hand, and allow the tumor cells in CCU to restrict the body’s immune reactions, on the other Immune disorders induced by the virus and/or tumor cells are considered at both local and systemic levels. Particular emphasis is placed on the molecular mechanisms that can change the population composition and functional activity of leukocytes and the cytokine profile of cells and can form the tumor suppressor microenvironment.

  13. Manipulation of Innate and Adaptive Immunity by Staphylococcal Superantigens

    Directory of Open Access Journals (Sweden)

    Stephen W. Tuffs

    2018-05-01

    Full Text Available Staphylococcal superantigens (SAgs constitute a family of potent exotoxins secreted by Staphylococcus aureus and other select staphylococcal species. SAgs function to cross-link major histocompatibility complex (MHC class II molecules with T cell receptors (TCRs to stimulate the uncontrolled activation of T lymphocytes, potentially leading to severe human illnesses such as toxic shock syndrome. The ubiquity of SAgs in clinical S. aureus isolates suggests that they likely make an important contribution to the evolutionary fitness of S. aureus. Although the apparent redundancy of SAgs in S. aureus has not been explained, the high level of sequence diversity within this toxin family may allow for SAgs to recognize an assorted range of TCR and MHC class II molecules, as well as aid in the avoidance of humoral immunity. Herein, we outline the major diseases associated with the staphylococcal SAgs and how a dysregulated immune system may contribute to pathology. We then highlight recent research that considers the importance of SAgs in the pathogenesis of S. aureus infections, demonstrating that SAgs are more than simply an immunological diversion. We suggest that SAgs can act as targeted modulators that drive the immune response away from an effective response, and thus aid in S. aureus persistence.

  14. Analysis of adaptability of radioactive liquid effluent discharge under normal condition of inland nuclear power plant

    International Nuclear Information System (INIS)

    Xu Yueping; Zhang Bing; Chen Yang; Zhu Lingqing; Tao Yunliang; Shangguan Zhihong

    2011-01-01

    The discharge of radioactive liquid effluent from inland nuclear power plant under normal operation is an important part to be considered in environmental impact assessment. Requirements of newly revised and upcoming standards GB 6249 and GB 14587 are introduced in this paper. Through an example of an inland NPP siting in the preliminary feasibility study phase, the adaptability to the relevant regulations in the site selection is analyzed. Also, the concerned problems in the design of AP1000 units are addressed. (authors)

  15. Immune and genetic gardening of the intestinal microbiome

    Science.gov (United States)

    Jacobs, Jonathan P.; Braun, Jonathan

    2014-01-01

    The mucosal immune system – consisting of adaptive and innate immune cells as well as the epithelium – is profoundly influenced by its microbial environment. There is now growing evidence that the converse is also true, that the immune system shapes the composition of the intestinal microbiome. During conditions of health, this bidirectional interaction achieves a homeostasis in which inappropriate immune responses to nonpathogenic microbes are averted and immune activity suppresses blooms of potentially pathogenic microbes (pathobionts). Genetic alteration in immune/epithelial function can affect host gardening of the intestinal microbiome, contributing to the diversity of intestinal microbiota within a population and in some cases allowing for unfavorable microbial ecologies (dysbiosis) that confer disease susceptibility. PMID:24613921

  16. Imunidade na gestação normal e na paciente com lúpus eritematoso sistêmico (LES Immunity in the normal pregnancy and in the patient with systemic lupus erythematosus (SLE

    Directory of Open Access Journals (Sweden)

    Alessandra Cardoso Pereira

    2005-06-01

    Full Text Available A gravidez é uma condição fisiológica na qual ocorrem várias mudanças imunoendócrinas com a finalidade de facilitar a imunossupressão e a tolerância aos antígenos paternos e fetais. Na gravidez humana normal existe uma relativa supressão de citocinas tipo Th1 na resposta dos linfócitos, levando a uma prevalência na resposta do tipo Th2. No LES, onde prevalece a resposta imune do tipo Th2, a gravidez pode estar relacionada com a ativação da doença. Este artigo é uma revisão dessas alterações relacionadas com a resposta imune durante a gestação normal e na da paciente com LES.Pregnancy is a physiologic condition where several immuno-endocrine changes take place with the aim of facilitating immunosuppression and tolerance towards paternal and fetal antigens. In normal human pregnancy there is a relative suppression of Th1 type cytokines in response to lymphocytes, leading to a Th2 type response. In SLE, where a Th2 type response prevails, pregnancy may exacerbate the disease. This article reviews the alterations related to the immune response during normal pregnancy and in SLE patients.

  17. CRISPR-Cas: From the Bacterial Adaptive Immune System to a Versatile Tool for Genome Engineering.

    Science.gov (United States)

    Kirchner, Marion; Schneider, Sabine

    2015-11-09

    The field of biology has been revolutionized by the recent advancement of an adaptive bacterial immune system as a universal genome engineering tool. Bacteria and archaea use repetitive genomic elements termed clustered regularly interspaced short palindromic repeats (CRISPR) in combination with an RNA-guided nuclease (CRISPR-associated nuclease: Cas) to target and destroy invading DNA. By choosing the appropriate sequence of the guide RNA, this two-component system can be used to efficiently modify, target, and edit genomic loci of interest in plants, insects, fungi, mammalian cells, and whole organisms. This has opened up new frontiers in genome engineering, including the potential to treat or cure human genetic disorders. Now the potential risks as well as the ethical, social, and legal implications of this powerful new technique move into the limelight. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Regulation of intestinal homeostasis and immunity with probiotic lactobacilli

    NARCIS (Netherlands)

    Baarlen, van P.; Wells, J.; Kleerebezem, M.

    2013-01-01

    The gut microbiota provide important stimuli to the human innate and adaptive immune system and co-mediate metabolic and immune homeostasis. Probiotic bacteria can be regarded as part of the natural human microbiota, and have been associated with improving homeostasis, albeit with different levels

  19. Different faces of regulatory DCs in homeostasis and immunity

    NARCIS (Netherlands)

    Smits, Hermelijn H.; de Jong, Esther C.; Wierenga, Eddy A.; Kapsenberg, Martien L.

    2005-01-01

    Adaptive immunity protects against infection and cancer but is also a potential threat to the host because of the risk of excessive inflammation or the development of autoimmunity and allergy. Therefore, immune responses are subject to negative regulation. An important aspect of negative regulation

  20. The role of intestinal microbiota and the immune system.

    Science.gov (United States)

    Purchiaroni, F; Tortora, A; Gabrielli, M; Bertucci, F; Gigante, G; Ianiro, G; Ojetti, V; Scarpellini, E; Gasbarrini, A

    2013-02-01

    The human gut is an ecosystem consisting of a great number of commensal bacteria living in symbiosis with the host. Several data confirm that gut microbiota is engaged in a dynamic interaction with the intestinal innate and adaptive immune system, affecting different aspects of its development and function. To review the immunological functions of gut microbiota and improve knowledge of its therapeutic implications for several intestinal and extra-intestinal diseases associated to dysregulation of the immune system. Significant articles were identified by literature search and selected based on content, including atopic diseases, inflammatory bowel diseases and treatment of these conditions with probiotics. Accumulating evidence indicates that intestinal microflora has protective, metabolic, trophic and immunological functions and is able to establish a "cross-talk" with the immune component of mucosal immunity, comprising cellular and soluble elements. When one or more steps in this fine interaction fail, autoimmune or auto-inflammatory diseases may occur. Furthermore, it results from the data that probiotics, used for the treatment of the diseases caused by the dysregulation of the immune system, can have a beneficial effect by different mechanisms. Gut microbiota interacts with both innate and adaptive immune system, playing a pivotal role in maintenance and disruption of gut immune quiescence. A cross talk between the mucosal immune system and endogenous microflora favours a mutual growth, survival and inflammatory control of the intestinal ecosystem. Based on these evidences, probiotics can be used as an ecological therapy in the treatment of immune diseases.  

  1. Innate lymphoid cells: models of plasticity for immune homeostasis and rapid responsiveness in protection.

    Science.gov (United States)

    Almeida, F F; Belz, G T

    2016-09-01

    Innate lymphoid cells (ILCs) have stormed onto the immune landscape as "newly discovered" cell types. These tissue-resident sentinels are enriched at mucosal surfaces and engage in complex cross talk with elements of the adaptive immune system and microenvironment to orchestrate immune homeostasis. Many parallels exist between innate cells and T cells leading to the initial partitioning of ILCs into rather rigid subsets that reflect their "adaptive-like" effector cytokines profiles. ILCs themselves, however, have unique attributes that are only just beginning to be elucidated. These features result in complementarity with, rather than complete duplication of, functions of the adaptive immune system. Key transcription factors determine the pathway of differentiation of progenitors towards an ILC1, ILC2, or ILC3 subset. Once formed, flexibility in the responses of these subsets to stimuli unexpectedly allows transdifferentation between the different subsets and the acquisition of altered phenotypes and function. This provides a mechanism for rapid innate immune responsiveness. Here, we discuss the models of differentiation for maintenance and activation of tissue-resident ILCs in maintaining immune homeostasis and protection.

  2. Regulation of immune responses and tolerance: the microRNA perspective

    Science.gov (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

    2013-01-01

    Summary Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/ or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. PMID:23550642

  3. Regulation of immune responses and tolerance: the microRNA perspective.

    Science.gov (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

    2013-05-01

    Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. © 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  4. Immune Mechanisms in Myelodysplastic Syndrome

    Directory of Open Access Journals (Sweden)

    Andreas Glenthøj

    2016-06-01

    Full Text Available Myelodysplastic syndrome (MDS is a spectrum of diseases, characterized by debilitating cytopenias and a propensity of developing acute myeloid leukemia. Comprehensive sequencing efforts have revealed a range of mutations characteristic, but not specific, of MDS. Epidemiologically, autoimmune diseases are common in patients with MDS, fueling hypotheses of common etiological mechanisms. Both innate and adaptive immune pathways are overly active in the hematopoietic niche of MDS. Although supportive care, growth factors, and hypomethylating agents are the mainstay of MDS treatment, some patients—especially younger low-risk patients with HLA-DR15 tissue type—demonstrate impressive response rates after immunosuppressive therapy. This is in contrast to higher-risk MDS patients, where several immune activating treatments, such as immune checkpoint inhibitors, are in the pipeline. Thus, the dual role of immune mechanisms in MDS is challenging, and rigorous translational studies are needed to establish the value of immune manipulation as a treatment of MDS.

  5. Age-Dependent Differences in Systemic and Cell-Autonomous Immunity to L. monocytogenes

    Directory of Open Access Journals (Sweden)

    Ashley M. Sherrid

    2013-01-01

    Full Text Available Host defense against infection can broadly be categorized into systemic immunity and cell-autonomous immunity. Systemic immunity is crucial for all multicellular organisms, increasing in importance with increasing cellular complexity of the host. The systemic immune response to Listeria monocytogenes has been studied extensively in murine models; however, the clinical applicability of these findings to the human newborn remains incompletely understood. Furthermore, the ability to control infection at the level of an individual cell, known as “cell-autonomous immunity,” appears most relevant following infection with L. monocytogenes; as the main target, the monocyte is centrally important to innate as well as adaptive systemic immunity to listeriosis. We thus suggest that the overall increased risk to suffer and die from L. monocytogenes infection in the newborn period is a direct consequence of age-dependent differences in cell-autonomous immunity of the monocyte to L. monocytogenes. We here review what is known about age-dependent differences in systemic innate and adaptive as well as cell-autonomous immunity to infection with Listeria monocytogenes.

  6. Zinc Signals and Immunity.

    Science.gov (United States)

    Maywald, Martina; Wessels, Inga; Rink, Lothar

    2017-10-24

    Zinc homeostasis is crucial for an adequate function of the immune system. Zinc deficiency as well as zinc excess result in severe disturbances in immune cell numbers and activities, which can result in increased susceptibility to infections and development of especially inflammatory diseases. This review focuses on the role of zinc in regulating intracellular signaling pathways in innate as well as adaptive immune cells. Main underlying molecular mechanisms and targets affected by altered zinc homeostasis, including kinases, caspases, phosphatases, and phosphodiesterases, will be highlighted in this article. In addition, the interplay of zinc homeostasis and the redox metabolism in affecting intracellular signaling will be emphasized. Key signaling pathways will be described in detail for the different cell types of the immune system. In this, effects of fast zinc flux, taking place within a few seconds to minutes will be distinguish from slower types of zinc signals, also designated as "zinc waves", and late homeostatic zinc signals regarding prolonged changes in intracellular zinc.

  7. CRISPR-Cas adaptive immune systems of the sulfolobales

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Shah, Shiraz Ali; Erdmann, Susanne

    2015-01-01

    The Sulfolobales have provided good model organisms for studying CRISPR-Cas systems of the crenarchaeal kingdom of the archaea. These organisms are infected by a wide range of exceptional archaea-specific viruses and conjugative plasmids, and their CRISPR-Cas systems generally exhibit extensive...... structural and functional diversity. They carry large and multiple CRISPR loci and often multiple copies of diverse Type I and Type III interference modules as well as more homogeneous adaptation modules. These acidothermophilic organisms have recently provided seminal insights into both the adaptation...... process, the diverse modes of interference, and their modes of regulation. The functions of the adaptation and interference modules tend to be loosely coupled and the stringency of the crRNA-DNA sequence matching during DNA interference is relatively low, in contrast to some more streamlined CRISPR...

  8. The taktivine immune correction influence on the immune status of an irradiated organism

    International Nuclear Information System (INIS)

    Zhetpisbaev, B.A.; Mynzhanov, M.P.

    1996-01-01

    The taktivin immune correction action on irradiated organism immune system is studied. There were two series of experiments with 50 animals in each serial. The intacted and irradiated animals served as control ones. Irradiated animals have got the taktivin course 1,5-2,0 μg each 1 kg of mass intraperitoneally, during 3 days. Under tactivin action the immunity's T-sells quality and quantitative ability has been increased, and the lymphoid cells in the bone morrow and thymus have been normalized, and its quantity in spleen and small intestine's lymph nodes have been rise. The activation of energetic exchange within spleen has being carried out

  9. Immune phenotype in children with therapy-naïve remitted and relapsed Crohn’s disease

    Science.gov (United States)

    Cseh, Aron; Vasarhelyi, Barna; Molnar, Kriszta; Szalay, Balazs; Svec, Peter; Treszl, Andras; Dezsofi, Antal; Lakatos, Peter Laszlo; Arato, Andras; Tulassay, Tivadar; Veres, Gabor

    2010-01-01

    AIM: To characterize the prevalence of subpopulations of CD4+ cells along with that of major inhibitor or stimulator cell types in therapy-naïve childhood Crohn’s disease (CD) and to test whether abnormalities of immune phenotype are normalized with the improvement of clinical signs and symptoms of disease. METHODS: We enrolled 26 pediatric patients with CD. 14 therapy-naïve CD children; of those, 10 children remitted on conventional therapy and formed the remission group. We also tested another group of 12 children who relapsed with conventional therapy and were given infliximab; and 15 healthy children who served as controls. The prevalence of Th1 and Th2, naïve and memory, activated and regulatory T cells, along with the members of innate immunity such as natural killer (NK), NK-T, myeloid and plasmocytoid dendritic cells (DCs), monocytes and Toll-like receptor (TLR)-2 and TLR-4 expression were determined in peripheral blood samples. RESULTS: Children with therapy-naïve CD and those in relapse showed a decrease in Th1 cell prevalence. Simultaneously, an increased prevalence of memory and activated lymphocytes along with that of DCs and monocytes was observed. In addition, the ratio of myeloid /plasmocytoid DCs and the prevalence of TLR-2 or TLR-4 positive DCs and monocytes were also higher in therapy-naïve CD than in controls. The majority of alterations diminished in remitted CD irrespective of whether remission was obtained by conventional or biological therapy. CONCLUSION: The finding that immune phenotype is normalized in remission suggests a link between immune phenotype and disease activity in childhood CD. Our observations support the involvement of members of the adaptive and innate immune systems in childhood CD. PMID:21157977

  10. Intranasal immunization of baculovirus displayed hemagglutinin confers complete protection against mouse adapted highly pathogenic H7N7 reassortant influenza virus.

    Directory of Open Access Journals (Sweden)

    Subaschandrabose Rajesh Kumar

    Full Text Available BACKGROUND: Avian influenza A H7N7 virus poses a pandemic threat to human health because of its ability for direct transmission from domestic poultry to humans and from human to human. The wide zoonotic potential of H7N7 combined with an antiviral immunity inhibition similar to pandemic 1918 H1N1 and 2009 H1N1 influenza viruses is disconcerting and increases the risk of a putative H7N7 pandemic in the future, underlining the urgent need for vaccine development against this virus. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we developed a recombinant vaccine by expressing the H7N7-HA protein on the surface of baculovirus (Bac-HA. The protective efficacy of the live Bac-HA vaccine construct was evaluated in a mouse model by challenging mice immunized intranasally (i.n. or subcutaneously (s.c. with high pathogenic mouse adapted H7N7 reassorted strain. Although s.c. injection of live Bac-HA induced higher specific IgG than i.n. immunization, the later resulted in an elevated neutralization titer. Interestingly, 100% protection from the lethal viral challenge was only observed for the mice immunized intranasally with live Bac-HA, whereas no protection was achieved in any other s.c. or i.n. immunized mice groups. In addition, we also observed higher mucosal IgA as well as increased IFN-γ and IL-4 responses in the splenocytes of the surviving mice coupled with a reduced viral titer and diminished histopathological signs in the lungs. CONCLUSION: Our results indicated that protection from high pathogenic H7N7 (NL/219/03 virus requires both mucosal and systemic immune responses in mice. The balance between Th1 and Th2 cytokines is also required for the protection against the H7N7 pathogen. Intranasal administration of live Bac-HA induced all these immune responses and protected the mice from lethal viral challenge. Therefore, live Bac-HA is an effective vaccine candidate against H7N7 viral infections.

  11. Role of immune system in tumor progression and carcinogenesis.

    Science.gov (United States)

    Upadhyay, Shishir; Sharma, Nidhi; Gupta, Kunj Bihari; Dhiman, Monisha

    2018-01-12

    Tumor micro-environment has potential to customize the behavior of the immune cell according to their need. In immune-eliminating phase, immune cells eliminate transformed cells but after tumor establishment innate and adaptive immune cells synergistically provide shelter as well as fulfill their requirement that helps in progression. In between eliminating and establishment phase, equilibrium and escaping phase regulate the immune cells response. During immune-escaping, (1) the antigenic response generated is either inadequate, or focused entirely on tolerance, and (2) immune response generated is specific and effective, but the tumor skips immune recognition. In this review, we are discussing the critical role of immune cells and their cytokines before and after the establishment of tumor which might play a critical role during immunotherapy. © 2018 Wiley Periodicals, Inc.

  12. Gastrointestinal immune responses in HIV infected subjects

    Directory of Open Access Journals (Sweden)

    LRR Castello-Branco

    1996-06-01

    Full Text Available The gut associated lymphoid tissue is responsible for specific responses to intestinal antigens. During HIV infection, mucosal immune deficiency may account for the gastrointestinal infections. In this review we describe the humoral and cellular mucosal immune responses in normal and HIV-infected subjects.

  13. Complement System Part II: Role in Immunity

    Science.gov (United States)

    Merle, Nicolas S.; Noe, Remi; Halbwachs-Mecarelli, Lise; Fremeaux-Bacchi, Veronique; Roumenina, Lubka T.

    2015-01-01

    The complement system has been considered for a long time as a simple lytic cascade, aimed to kill bacteria infecting the host organism. Nowadays, this vision has changed and it is well accepted that complement is a complex innate immune surveillance system, playing a key role in host homeostasis, inflammation, and in the defense against pathogens. This review discusses recent advances in the understanding of the role of complement in physiology and pathology. It starts with a description of complement contribution to the normal physiology (homeostasis) of a healthy organism, including the silent clearance of apoptotic cells and maintenance of cell survival. In pathology, complement can be a friend or a foe. It acts as a friend in the defense against pathogens, by inducing opsonization and a direct killing by C5b–9 membrane attack complex and by triggering inflammatory responses with the anaphylatoxins C3a and C5a. Opsonization plays also a major role in the mounting of an adaptive immune response, involving antigen presenting cells, T-, and B-lymphocytes. Nevertheless, it can be also an enemy, when pathogens hijack complement regulators to protect themselves from the immune system. Inadequate complement activation becomes a disease cause, as in atypical hemolytic uremic syndrome, C3 glomerulopathies, and systemic lupus erythematosus. Age-related macular degeneration and cancer will be described as examples showing that complement contributes to a large variety of conditions, far exceeding the classical examples of diseases associated with complement deficiencies. Finally, we discuss complement as a therapeutic target. PMID:26074922

  14. The immune system vs. Pseudomonas aeruginosa biofilms

    DEFF Research Database (Denmark)

    Jensen, Peter Østrup; Givskov, Michael; Bjarnsholt, Thomas

    2010-01-01

    Ilya Metchnikoff and Paul Ehrlich were awarded the Nobel price in 1908. Since then, numerous studies have unraveled a multitude of mechanistically different immune responses to intruding microorganisms. However, in the vast majority of these studies, the underlying infectious agents have appeared...... in the planktonic state. Accordingly, much less is known about the immune responses to the presence of biofilm-based infections (which is probably also due to the relatively short period of time in which the immune response to biofilms has been studied). Nevertheless, more recent in vivo and in vitro studies have...... revealed both innate as well as adaptive immune responses to biofilms. On the other hand, measures launched by biofilm bacteria to achieve protection against the various immune responses have also been demonstrated. Whether particular immune responses to biofilm infections exist remains to be firmly...

  15. Review: The Necessity of Producing/Normalizing Adaptive Behavior Scales in Diagnosing Training Treatment Rehabilitation of Peop e and Assessment of the Programs

    Directory of Open Access Journals (Sweden)

    Seyyed Jalal Sadrosadat

    2000-10-01

    Full Text Available Adaptive behavior is defined as the manner in which people cope with the natural and social demands of their environments. Impairments in adaptive behavior are described as significant limitations in an individual's effectiveness in meeting the standards of maturation, learning, personal independence, and/or social responsibility that are expected for one's age level and cultural group, as determined by clinical assessment, and usually, standardized scales. The definitions of adaptive deficiencies imply an individual's ability to cope with demands of his or her environment. Some scholars support this notion when describing adaptive behavior's relationship to mental retardation. Despite the fact that adaptive behavior scales are the necessary tools in diagnosing training: treatment. Rehabilitation of people (Particularly with developmental disorders and the assessment of programs, those are not available to professionals. This article tries to explain the necessity of producing/normalizing such scales, and introduces one of the most famous scales named as "Adaptive Behavior Scale-Residential and Community".

  16. Innate, adaptive and regulatory responses in schistosomiasis: Relationship to allergy

    NARCIS (Netherlands)

    Hartgers, F.C.; Smits, H.H.; Kleij, D. van der; Yazdanbakhsh, M.

    2006-01-01

    Helminth infections have profound effects on the immune system. Here, recent insights in the molecular interactions between schistosomes and the host are described with respect to adaptive but also with respect to innate immune responses. Furthermore, the different mechanisms of immune

  17. The ontogeny of the porcine immune system

    Czech Academy of Sciences Publication Activity Database

    Šinkora, Marek; Butler, J. E.

    2009-01-01

    Roč. 33, č. 3 (2009), s. 273-283 ISSN 0145-305X R&D Projects: GA ČR GA524/07/0087; GA ČR GA523/07/0088 Institutional research plan: CEZ:AV0Z50200510 Keywords : ontogeny of the porcine immune system * swine adaptive immunity * development of alpha beta and gamma delta T cells Subject RIV: EC - Immunology Impact factor: 3.290, year: 2009

  18. Granulocyte-macrophage stimulating factor (GM-CSF increases circulating dendritic cells but does not abrogate suppression of adaptive cellular immunity in patients with metastatic colorectal cancer receiving chemotherapy

    Directory of Open Access Journals (Sweden)

    Martinez Micaela

    2012-01-01

    Full Text Available Abstract Background Advanced cancer and chemotherapy are both associated with immune system suppression. We initiated a clinical trial in patients receiving chemotherapy for metastatic colorectal cancer to determine if administration of GM-CSF in this setting was immunostimulatory. Methods Between June, 2003 and January, 2007, 20 patients were enrolled in a clinical trial (NCT00257322 in which they received 500 ug GM-CSF daily for 4 days starting 24 hours after each chemotherapy cycle. There were no toxicities or adverse events reported. Blood was obtained before chemotherapy/GM-CSF administration and 24 hours following the final dose of GM-CSF and evaluated for circulating dendritic cells and adaptive immune cellular subsets by flow cytometry. Peripheral blood mononuclear cell (PBMC expression of γ-interferon and T-bet transcription factor (Tbx21 by quantitative real-time PCR was performed as a measure of Th1 adaptive cellular immunity. Pre- and post-treatment (i.e., chemotherapy and GM-CSF samples were evaluable for 16 patients, ranging from 1 to 5 cycles (median 3 cycles, 6 biologic sample time points. Dendritic cells were defined as lineage (- and MHC class II high (+. Results 73% of patients had significant increases in circulating dendritic cells of ~3x for the overall group (5.8% to 13.6%, p = 0.02 and ~5x excluding non-responders (3.2% to 14.5%, p Tbx21 levels declined by 75% following each chemotherapy cycle despite administration of GM-CSF (p = 0.02. PBMC γ-interferon expression, however was unchanged. Conclusions This clinical trial confirms the suppressive effects of chemotherapy on Th1 cellular immunity in patients with metastatic colorectal cancer but demonstrates that mid-cycle administration of GM-CSF can significantly increase the proportion of circulating dendritic cells. As the role of dendritic cells in anti-tumor immunity becomes better defined, GM-CSF administration may provide a non-toxic intervention to augment this arm

  19. Leishmania Hijacks Myeloid Cells for Immune Escape

    Directory of Open Access Journals (Sweden)

    María Martínez-López

    2018-05-01

    Full Text Available Protozoan parasites of the Leishmania genus are the causative agents of leishmaniasis, a group of neglected tropical diseases whose clinical manifestations vary depending on the infectious Leishmania species but also on host factors. Recognition of the parasite by host myeloid immune cells is a key to trigger an effective Leishmania-specific immunity. However, the parasite is able to persist in host myeloid cells by evading, delaying and manipulating host immunity in order to escape host resistance and ensure its transmission. Neutrophils are first in infiltrating infection sites and could act either favoring or protecting against infection, depending on factors such as the genetic background of the host or the parasite species. Macrophages are the main host cells where the parasites grow and divide. However, macrophages are also the main effector population involved in parasite clearance. Parasite elimination by macrophages requires the priming and development of an effector Th1 adaptive immunity driven by specific subtypes of dendritic cells. Herein, we will provide a comprehensive outline of how myeloid cells regulate innate and adaptive immunity against Leishmania, and the mechanisms used by the parasites to promote their evasion and sabotage. Understanding the interactions between Leishmania and the host myeloid cells may lead to the development of new therapeutic approaches and improved vaccination to leishmaniases, an important worldwide health problem in which current therapeutic or preventive approaches are limited.

  20. ImmuneDB: a system for the analysis and exploration of high-throughput adaptive immune receptor sequencing data.

    Science.gov (United States)

    Rosenfeld, Aaron M; Meng, Wenzhao; Luning Prak, Eline T; Hershberg, Uri

    2017-01-15

    As high-throughput sequencing of B cells becomes more common, the need for tools to analyze the large quantity of data also increases. This article introduces ImmuneDB, a system for analyzing vast amounts of heavy chain variable region sequences and exploring the resulting data. It can take as input raw FASTA/FASTQ data, identify genes, determine clones, construct lineages, as well as provide information such as selection pressure and mutation analysis. It uses an industry leading database, MySQL, to provide fast analysis and avoid the complexities of using error prone flat-files. ImmuneDB is freely available at http://immunedb.comA demo of the ImmuneDB web interface is available at: http://immunedb.com/demo CONTACT: Uh25@drexel.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Sculpting humoral immunity through dengue vaccination to enhance protective immunity

    Directory of Open Access Journals (Sweden)

    Wayne eCrill

    2012-11-01

    Full Text Available Dengue viruses (DENV are the most important mosquito transmitted viral pathogens infecting humans. DENV infection produces a spectrum of disease, most commonly causing a self-limiting flu-like illness known as dengue fever; yet with increased frequency, manifesting as life-threatening dengue hemorrhagic fever (DHF. Waning cross-protective immunity from any of the four dengue serotypes may enhance subsequent infection with another heterologous serotype to increase the probability of DHF. Decades of effort to develop dengue vaccines are reaching the finishing line with multiple candidates in clinical trials. Nevertheless, concerns remain that imbalanced immunity, due to the prolonged prime-boost schedules currently used in clinical trials, could leave some vaccinees temporarily unprotected or with increased susceptibility to enhanced disease. Here we develop a DENV serotype 1 (DENV-1 DNA vaccine with the immunodominant cross-reactive B cell epitopes associated with immune enhancement removed. We compare wild-type (WT with this cross-reactivity reduced (CRR vaccine and demonstrate that both vaccines are equally protective against lethal homologous DENV-1 challenge. Under conditions mimicking natural exposure prior to acquiring protective immunity, WT vaccinated mice enhanced a normally sub-lethal heterologous DENV-2 infection resulting in DHF-like disease and 95% mortality in AG129 mice. However, CRR vaccinated mice exhibited redirected serotype-specific and protective immunity, and significantly reduced morbidity and mortality not differing from naïve mice. Thus, we demonstrate in an in vivo DENV disease model, that non-protective vaccine-induced immunity can prime vaccinees for enhanced DHF-like disease and that CRR DNA immunization significantly reduces this potential vaccine safety concern. The sculpting of immune memory by the modified vaccine and resulting redirection of humoral immunity provide insight into DENV vaccine induced immune

  2. Cutting Edge: Retinoic Acid Signaling in B Cells Is Essential for Oral Immunization and Microflora Composition.

    Science.gov (United States)

    Pantazi, Eirini; Marks, Ellen; Stolarczyk, Emilie; Lycke, Nils; Noelle, Randolph J; Elgueta, Raul

    2015-08-15

    Retinoic acid (RA) is a critical regulator of the intestinal adaptive immune response. However, the intrinsic impact of RA on B cell differentiation in the regulation of gut humoral immunity in vivo has never been directly shown. To address this issue, we have been able to generate a mouse model where B cells specifically express a dominant-negative receptor α for RA. In this study, we show that the silencing of RA signaling in B cells reduces the numbers of IgA(+) Ab-secreting cells both in vitro and in vivo, suggesting that RA has a direct effect on IgA plasma cell differentiation. Moreover, the lack of RA signaling in B cells abrogates Ag-specific IgA responses after oral immunization and affects the microbiota composition. In conclusion, these results suggest that RA signaling in B cells through the RA receptor α is important to generate an effective gut humoral response and to maintain a normal microbiota composition. Copyright © 2015 by The American Association of Immunologists, Inc.

  3. The Role of Immune and Inflammatory Cells in Idiopathic Pulmonary Fibrosis.

    Science.gov (United States)

    Desai, Omkar; Winkler, Julia; Minasyan, Maksym; Herzog, Erica L

    2018-01-01

    The contribution of the immune system to idiopathic pulmonary fibrosis (IPF) remains poorly understood. While most sources agree that IPF does not result from a primary immunopathogenic mechanism, evidence gleaned from animal modeling and human studies suggests that innate and adaptive immune processes can orchestrate existing fibrotic responses. This review will synthesize the available data regarding the complex role of professional immune cells in IPF. The role of innate immune populations such as monocytes, macrophages, myeloid suppressor cells, and innate lymphoid cells will be discussed, as will the activation of these cells via pathogen-associated molecular patterns derived from invading or commensural microbes, and danger-associated molecular patterns derived from injured cells and tissues. The contribution of adaptive immune responses driven by T-helper cells and B cells will be reviewed as well. Each form of immune activation will be discussed in the context of its relationship to environmental and genetic factors, disease outcomes, and potential therapies. We conclude with discussion of unanswered questions and opportunities for future study in this area.

  4. The Role of Immune and Inflammatory Cells in Idiopathic Pulmonary Fibrosis

    Directory of Open Access Journals (Sweden)

    Omkar Desai

    2018-03-01

    Full Text Available The contribution of the immune system to idiopathic pulmonary fibrosis (IPF remains poorly understood. While most sources agree that IPF does not result from a primary immunopathogenic mechanism, evidence gleaned from animal modeling and human studies suggests that innate and adaptive immune processes can orchestrate existing fibrotic responses. This review will synthesize the available data regarding the complex role of professional immune cells in IPF. The role of innate immune populations such as monocytes, macrophages, myeloid suppressor cells, and innate lymphoid cells will be discussed, as will the activation of these cells via pathogen-associated molecular patterns derived from invading or commensural microbes, and danger-associated molecular patterns derived from injured cells and tissues. The contribution of adaptive immune responses driven by T-helper cells and B cells will be reviewed as well. Each form of immune activation will be discussed in the context of its relationship to environmental and genetic factors, disease outcomes, and potential therapies. We conclude with discussion of unanswered questions and opportunities for future study in this area.

  5. Immune Modulation by Vitamin D and Its Relevance to Food Allergy

    Directory of Open Access Journals (Sweden)

    Noor H. A. Suaini

    2015-07-01

    Full Text Available Apart from its classical function in bone and calcium metabolism, vitamin D is also involved in immune regulation and has been linked to various cancers, immune disorders and allergic diseases. Within the innate and adaptive immune systems, the vitamin D receptor and enzymes in monocytes, dendritic cells, epithelial cells, T lymphocytes and B lymphocytes mediate the immune modulatory actions of vitamin D. Vitamin D insufficiency/deficiency early in life has been identified as one of the risk factors for food allergy. Several studies have observed an association between increasing latitude and food allergy prevalence, plausibly linked to lower ultraviolet radiation (UVR exposure and vitamin D synthesis in the skin. Along with mounting epidemiological evidence of a link between vitamin D status and food allergy, mice and human studies have shed light on the modulatory properties of vitamin D on the innate and adaptive immune systems. This review will summarize the literature on the metabolism and immune modulatory properties of vitamin D, with particular reference to food allergy.

  6. The Role of Immune and Inflammatory Cells in Idiopathic Pulmonary Fibrosis

    Science.gov (United States)

    Desai, Omkar; Winkler, Julia; Minasyan, Maksym; Herzog, Erica L.

    2018-01-01

    The contribution of the immune system to idiopathic pulmonary fibrosis (IPF) remains poorly understood. While most sources agree that IPF does not result from a primary immunopathogenic mechanism, evidence gleaned from animal modeling and human studies suggests that innate and adaptive immune processes can orchestrate existing fibrotic responses. This review will synthesize the available data regarding the complex role of professional immune cells in IPF. The role of innate immune populations such as monocytes, macrophages, myeloid suppressor cells, and innate lymphoid cells will be discussed, as will the activation of these cells via pathogen-associated molecular patterns derived from invading or commensural microbes, and danger-associated molecular patterns derived from injured cells and tissues. The contribution of adaptive immune responses driven by T-helper cells and B cells will be reviewed as well. Each form of immune activation will be discussed in the context of its relationship to environmental and genetic factors, disease outcomes, and potential therapies. We conclude with discussion of unanswered questions and opportunities for future study in this area. PMID:29616220

  7. Immune-modulatory effects of syncytiotrophoblast extracellular vesicles in pregnancy and preeclampsia

    NARCIS (Netherlands)

    Göhner, Claudia; Plösch, Torsten; Faas, Marijke M

    2017-01-01

    Unique immunologic adaptations exist to successfully establish and maintain pregnancy and to avoid an immune attack against the semi allogenic fetus. These adaptations occur both locally at the maternofetal interface and in the peripheral circulation and affect the innate as well as the adaptive

  8. TAM receptor tyrosine kinases as emerging targets of innate immune checkpoint blockade for cancer therapy.

    Science.gov (United States)

    Akalu, Yemsratch T; Rothlin, Carla V; Ghosh, Sourav

    2017-03-01

    Cancer immunotherapy utilizing T-cell checkpoint inhibitors has shown tremendous clinical success. Yet, this mode of treatment is effective in only a subset of patients. Unresponsive patients tend to have non-T-cell-inflamed tumors that lack markers associated with the activation of adaptive anti-tumor immune responses. Notably, elimination of cancer cells by T cells is critically dependent on the optimal activity of innate immune cells. Therefore, identifying new targets that regulate innate immune cell function and promote the engagement of adaptive tumoricidal responses is likely to lead to the development of improved therapies against cancer. Here, we review the TAM receptor tyrosine kinases-TYRO3, AXL, and MERTK-as an emerging class of innate immune checkpoints that participate in key steps of anti-tumoral immunity. Namely, TAM-mediated efferocytosis, negative regulation of dendritic cell activity, and dysregulated production of chemokines collectively favor the escape of malignant cells. Hence, disabling TAM signaling may promote engagement of adaptive immunity and complement T-cell checkpoint blockade. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Optimal Design of the Adaptive Normalized Matched Filter Detector using Regularized Tyler Estimators

    KAUST Repository

    Kammoun, Abla; Couillet, Romain; Pascal, Frederic; Alouini, Mohamed-Slim

    2017-01-01

    This article addresses improvements on the design of the adaptive normalized matched filter (ANMF) for radar detection. It is well-acknowledged that the estimation of the noise-clutter covariance matrix is a fundamental step in adaptive radar detection. In this paper, we consider regularized estimation methods which force by construction the eigenvalues of the covariance estimates to be greater than a positive regularization parameter ρ. This makes them more suitable for high dimensional problems with a limited number of secondary data samples than traditional sample covariance estimates. The motivation behind this work is to understand the effect and properly set the value of ρthat improves estimate conditioning while maintaining a low estimation bias. More specifically, we consider the design of the ANMF detector for two kinds of regularized estimators, namely the regularized sample covariance matrix (RSCM), the regularized Tyler estimator (RTE). The rationale behind this choice is that the RTE is efficient in mitigating the degradation caused by the presence of impulsive noises while inducing little loss when the noise is Gaussian. Based on asymptotic results brought by recent tools from random matrix theory, we propose a design for the regularization parameter that maximizes the asymptotic detection probability under constant asymptotic false alarm rates. Provided Simulations support the efficiency of the proposed method, illustrating its gain over conventional settings of the regularization parameter.

  10. Optimal Design of the Adaptive Normalized Matched Filter Detector using Regularized Tyler Estimators

    KAUST Repository

    Kammoun, Abla

    2017-10-25

    This article addresses improvements on the design of the adaptive normalized matched filter (ANMF) for radar detection. It is well-acknowledged that the estimation of the noise-clutter covariance matrix is a fundamental step in adaptive radar detection. In this paper, we consider regularized estimation methods which force by construction the eigenvalues of the covariance estimates to be greater than a positive regularization parameter ρ. This makes them more suitable for high dimensional problems with a limited number of secondary data samples than traditional sample covariance estimates. The motivation behind this work is to understand the effect and properly set the value of ρthat improves estimate conditioning while maintaining a low estimation bias. More specifically, we consider the design of the ANMF detector for two kinds of regularized estimators, namely the regularized sample covariance matrix (RSCM), the regularized Tyler estimator (RTE). The rationale behind this choice is that the RTE is efficient in mitigating the degradation caused by the presence of impulsive noises while inducing little loss when the noise is Gaussian. Based on asymptotic results brought by recent tools from random matrix theory, we propose a design for the regularization parameter that maximizes the asymptotic detection probability under constant asymptotic false alarm rates. Provided Simulations support the efficiency of the proposed method, illustrating its gain over conventional settings of the regularization parameter.

  11. Immunity to fish rhabdoviruses

    Science.gov (United States)

    Purcell, Maureen K.; Laing, Kerry J.; Winton, James R.

    2012-01-01

    Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN) system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M) protein to mediate host-cell shutoff and the non-virion (NV) protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals.

  12. Immunity to fish rhabdoviruses.

    Science.gov (United States)

    Purcell, Maureen K; Laing, Kerry J; Winton, James R

    2012-01-01

    Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN) system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M) protein to mediate host-cell shutoff and the non‑virion (NV) protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals.

  13. Immunity to Fish Rhabdoviruses

    Directory of Open Access Journals (Sweden)

    Maureen K. Purcell

    2012-01-01

    Full Text Available Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M protein to mediate host-cell shutoff and the non‑virion (NV protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals.

  14. Is the scavenger receptor MARCO a new immune checkpoint?

    Science.gov (United States)

    Arredouani, Mohamed S

    2014-11-01

    Whereas macrophages use the scavenger receptor MARCO primarily in antimicrobial immunity by interacting with both exogenous and endogenous environments, in dendritic cells (DCs) MARCO is believed to pleiotropically link innate to adaptive immunity. MARCO exerts a significant modulatory effect on TLR-induced DC activation, thus offering novel avenues in cancer immunotherapy.

  15. Post-capture immune gene expression studies in the deep-sea hydrothermal vent mussel Bathymodiolus azoricus acclimatized to atmospheric pressure

    Digital Repository Service at National Institute of Oceanography (India)

    Barros, I.; Divya, B.; Martins, I.; Vandeperre, F.; Santos, R.S.; Bettencourt, R.

    -inflammatory cytokines such as interleukins, interferon, TNF, responsible for direct innate response and for triggering adaptive immune cells [43]. On the other hand, the pro-inflammatory cytokine TNF is considered as a multifunctional immune modulator that plays... the immune responses and host-adapted bacteria in- teractions. The study of innate immunity in B. azoricus has been mainly focused on the demonstration of the conservation of the immune system and its constituents [17,18], apparently homolo- gous...

  16. Regional specialization within the intestinal immune system

    DEFF Research Database (Denmark)

    Mowat, Allan M.; Agace, William Winston

    2014-01-01

    The intestine represents the largest compartment of the immune system. It is continually exposed to antigens and immunomodulatory agents from the diet and the commensal microbiota, and it is the port of entry for many clinically important pathogens. Intestinal immune processes are also increasingly...... implicated in controlling disease development elsewhere in the body. In this Review, we detail the anatomical and physiological distinctions that are observed in the small and large intestines, and we suggest how these may account for the diversity in the immune apparatus that is seen throughout...... the intestine. We describe how the distribution of innate, adaptive and innate-like immune cells varies in different segments of the intestine and discuss the environmental factors that may influence this. Finally, we consider the implications of regional immune specialization for inflammatory disease...

  17. CMV immune evasion and manipulation of the immune system with aging.

    Science.gov (United States)

    Jackson, Sarah E; Redeker, Anke; Arens, Ramon; van Baarle, Debbie; van den Berg, Sara P H; Benedict, Chris A; Čičin-Šain, Luka; Hill, Ann B; Wills, Mark R

    2017-06-01

    Human cytomegalovirus (HCMV) encodes numerous proteins and microRNAs that function to evade the immune response and allow the virus to replicate and disseminate in the face of a competent innate and acquired immune system. The establishment of a latent infection by CMV, which if completely quiescent at the level of viral gene expression would represent an ultimate in immune evasion strategies, is not sufficient for lifelong persistence and dissemination of the virus. CMV needs to reactivate and replicate in a lytic cycle of infection in order to disseminate further, which occurs in the face of a fully primed secondary immune response. Without reactivation, latency itself would be redundant for the virus. It is also becoming clear that latency is not a totally quiescent state, but is characterized by limited viral gene expression. Therefore, the virus also needs immune evasion strategies during latency. An effective immune response to CMV is required or viral replication will cause morbidity and ultimately mortality in the host. There is clearly a complex balance between virus immune evasion and host immune recognition over a lifetime. This poses the important question of whether long-term evasion or manipulation of the immune response driven by CMV is detrimental to health. In this meeting report, three groups used the murine model of CMV (MCMV) to examine if the contribution of the virus to immune senescence is set by the (i) initial viral inoculum, (ii) inflation of T cell responses, (iii) or the balance between functionally distinct effector CD4+ T cells. The work of other groups studying the CMV response in humans is discussed. Their work asks whether the ability to make immune responses to new antigens is compromised by (i) age and HCMV carriage, (ii) long-term exposure to HCMV giving rise to an overall immunosuppressive environment and increased levels of latent virus, or (iii) adapted virus mutants (used as potential vaccines) that have the capacity to

  18. Molecular mechanism and function of CD40/CD40L engagement in the immune system.

    Science.gov (United States)

    Elgueta, Raul; Benson, Micah J; de Vries, Victor C; Wasiuk, Anna; Guo, Yanxia; Noelle, Randolph J

    2009-05-01

    During the generation of a successful adaptive immune response, multiple molecular signals are required. A primary signal is the binding of cognate antigen to an antigen receptor expressed by T and B lymphocytes. Multiple secondary signals involve the engagement of costimulatory molecules expressed by T and B lymphocytes with their respective ligands. Because of its essential role in immunity, one of the best characterized of the costimulatory molecules is the receptor CD40. This receptor, a member of the tumor necrosis factor receptor family, is expressed by B cells, professional antigen-presenting cells, as well as non-immune cells and tumors. CD40 binds its ligand CD40L, which is transiently expressed on T cells and other non-immune cells under inflammatory conditions. A wide spectrum of molecular and cellular processes is regulated by CD40 engagement including the initiation and progression of cellular and humoral adaptive immunity. In this review, we describe the downstream signaling pathways initiated by CD40 and overview how CD40 engagement or antagonism modulates humoral and cellular immunity. Lastly, we discuss the role of CD40 as a target in harnessing anti-tumor immunity. This review underscores the essential role CD40 plays in adaptive immunity.

  19. Influence of diabetes mellitus on immunity to human tuberculosis.

    Science.gov (United States)

    Kumar Nathella, Pavan; Babu, Subash

    2017-09-01

    Type 2 diabetes mellitus(DM) is a major risk factor for the development of active pulmonary tuberculosis (TB), with development of DM pandemic in countries where TB is also endemic. Understanding the impact of DM on TB and the determinants of co-morbidity is essential in responding to this growing public health problem with improved therapeutic approaches. Despite the clinical and public health significance posed by the dual burden of TB and DM, little is known about the immunological and biochemical mechanisms of susceptibility. One possible mechanism is that an impaired immune response in patients with DM facilitates either primary infection with Mycobacterium tuberculosis or reactivation of latent TB. Diabetes is associated with immune dysfunction and alterations in the components of the immune system, including altered levels of specific cytokines and chemokines. Some effects of DM on adaptive immunity that are potentially relevant to TB defence have been identified in humans. In this review, we summarize current findings regarding the alterations in the innate and adaptive immune responses and immunological mechanisms of susceptibility of patients with DM to M. tuberculosis infection and disease. © 2017 John Wiley & Sons Ltd.

  20. Immunity, suicide or both? Ecological determinants for the combined evolution of anti-pathogen defense systems.

    Science.gov (United States)

    Iranzo, Jaime; Lobkovsky, Alexander E; Wolf, Yuri I; Koonin, Eugene V

    2015-03-13

    Parasite-host arms race is one of the key factors in the evolution of life. Most cellular life forms, in particular prokaryotes, possess diverse forms of defense against pathogens including innate immunity, adaptive immunity and programmed cell death (altruistic suicide). Coevolution of these different but interacting defense strategies yields complex evolutionary regimes. We develop and extensively analyze a computational model of coevolution of different defense strategies to show that suicide as a defense mechanism can evolve only in structured populations and when the attainable degree of immunity against pathogens is limited. The general principle of defense evolution seems to be that hosts do not evolve two costly defense mechanisms when one is sufficient. Thus, the evolutionary interplay of innate immunity, adaptive immunity and suicide, leads to an equilibrium state where the combination of all three defense strategies is limited to a distinct, small region of the parameter space. The three strategies can stably coexist only if none of them are highly effective. Coupled adaptive immunity-suicide systems, the existence of which is implied by the colocalization of genes for the two types of defense in prokaryotic genomes, can evolve either when immunity-associated suicide is more efficacious than other suicide systems or when adaptive immunity functionally depends on the associated suicide system. Computational modeling reveals a broad range of outcomes of coevolution of anti-pathogen defense strategies depending on the relative efficacy of different mechanisms and population structure. Some of the predictions of the model appear compatible with recent experimental evolution results and call for additional experiments.

  1. Pseudoachondroplasia with immune deficiency

    International Nuclear Information System (INIS)

    Kultursay, N.; Taneli, B.; Cavusoglu, A.

    1988-01-01

    A 5-year old boy was admitted to the hospital with failure to thrive since he was 2 years old, with weakness in his legs and a waddling gait. He has normal mental development. His parents are normal phenotypically and are unrelated. In analysing his pedigree only a grandfather is described to have waddling gait. He has a normal craniofacial appearance but a disproportionate body with normal trunk and short extremities with height below the 3rd percentile. The diagnosis of pseudoachondroplasia was made on clinical, radiological and laboratory findings. He also had immune deficiency characterised by low T-lymphocyte populations and a low level of serum immunoglobulin A. (orig.)

  2. The development of equine immunity: Current knowledge on immunology in the young horse.

    Science.gov (United States)

    Perkins, G A; Wagner, B

    2015-05-01

    The development of equine immunity from the fetus to adulthood is complex. The foal's immune response and the immune mechanisms that they are equipped with, along with changes over the first months of life until the immune system becomes adult-like, are only partially understood. While several innate immune responses seem to be fully functional from birth, the onset of adaptive immune response is delayed. For some adaptive immune parameters, such as immunoglobin (Ig)G1, IgG3, IgG5 and IgA antibodies, the immune response starts before or at birth and matures within 3 months of life. Other antibody responses, such as IgG4, IgG7 and IgE production, slowly develop within the first year of life until they reach adult levels. Similar differences have been observed for adaptive T cell responses. Interferon-gamma (IFN-γ) production by T helper 1 (Th1)-cells and cytotoxic T cells starts shortly after birth with low level production that gradually increases during the first year of life. In contrast, interleukin-4 (IL-4) produced by Th2-cells is almost undetectable in the first 3 months of life. These findings offer some explanation for the increased susceptibility of foals to certain pathogens such as Rhodococcus equi. The delay in Th-cell development and in particular Th2 immunity during the first months of life also provides an explanation for the reduced responsiveness of young horses to most traditional vaccines. In summary, all immune components of adult horses seem to exist in foals but the orchestrating and regulation of the immune response in immature horses is strikingly different. Young foals are fully competent and can perform certain immune responses but many mechanisms have yet to mature. Additional work is needed to improve our understanding of immunity and immune regulation in young horses, to identify the preferred immune pathways that they are using and ultimately provide new preventive strategies to protect against infectious disease. © 2015 EVJ Ltd.

  3. Degenerate target sites mediate rapid primed CRISPR adaptation

    NARCIS (Netherlands)

    Fineran, P.C.; Gerritzen, M.J.; Suarez-Diez, M.; Kunne, T.; Boekhorst, J.; Hijum, S.A.F.T. van; Staals, R.H.G.; Brouns, S.J.

    2014-01-01

    Prokaryotes encode adaptive immune systems, called CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR associated), to provide resistance against mobile invaders, such as viruses and plasmids. Host immunity is based on incorporation of invader DNA sequences in a memory locus

  4. Degenerate target sites mediate rapid primed CRISPR adaptation

    NARCIS (Netherlands)

    Fineran, P.C.; Gerritzen, M.J.H.; Suarez Diez, M.; Künne, T.A.; Boekhorst, J.; Hijum, van S.A.F.T.; Staals, R.H.J.; Brouns, S.J.J.

    2014-01-01

    Prokaryotes encode adaptive immune systems, called CRISPR-Cas (clustered regularly interspaced short palindromic repeats–CRISPR associated), to provide resistance against mobile invaders, such as viruses and plasmids. Host immunity is based on incorporation of invader DNA sequences in a memory locus

  5. Learning and Memory... and the Immune System

    Science.gov (United States)

    Marin, Ioana; Kipnis, Jonathan

    2013-01-01

    The nervous system and the immune system are two main regulators of homeostasis in the body. Communication between them ensures normal functioning of the organism. Immune cells and molecules are required for sculpting the circuitry and determining the activity of the nervous system. Within the parenchyma of the central nervous system (CNS),…

  6. The fungal quorum-sensing molecule farnesol activates innate immune cells but suppresses cellular adaptive immunity.

    Science.gov (United States)

    Leonhardt, Ines; Spielberg, Steffi; Weber, Michael; Albrecht-Eckardt, Daniela; Bläss, Markus; Claus, Ralf; Barz, Dagmar; Scherlach, Kirstin; Hertweck, Christian; Löffler, Jürgen; Hünniger, Kerstin; Kurzai, Oliver

    2015-03-17

    Farnesol, produced by the polymorphic fungus Candida albicans, is the first quorum-sensing molecule discovered in eukaryotes. Its main function is control of C. albicans filamentation, a process closely linked to pathogenesis. In this study, we analyzed the effects of farnesol on innate immune cells known to be important for fungal clearance and protective immunity. Farnesol enhanced the expression of activation markers on monocytes (CD86 and HLA-DR) and neutrophils (CD66b and CD11b) and promoted oxidative burst and the release of proinflammatory cytokines (tumor necrosis factor alpha [TNF-α] and macrophage inflammatory protein 1 alpha [MIP-1α]). However, this activation did not result in enhanced fungal uptake or killing. Furthermore, the differentiation of monocytes to immature dendritic cells (iDC) was significantly affected by farnesol. Several markers important for maturation and antigen presentation like CD1a, CD83, CD86, and CD80 were significantly reduced in the presence of farnesol. Furthermore, farnesol modulated migrational behavior and cytokine release and impaired the ability of DC to induce T cell proliferation. Of major importance was the absence of interleukin 12 (IL-12) induction in iDC generated in the presence of farnesol. Transcriptome analyses revealed a farnesol-induced shift in effector molecule expression and a down-regulation of the granulocyte-macrophage colony-stimulating factor (GM-CSF) receptor during monocytes to iDC differentiation. Taken together, our data unveil the ability of farnesol to act as a virulence factor of C. albicans by influencing innate immune cells to promote inflammation and mitigating the Th1 response, which is essential for fungal clearance. Farnesol is a quorum-sensing molecule which controls morphological plasticity of the pathogenic yeast Candida albicans. As such, it is a major mediator of intraspecies communication. Here, we investigated the impact of farnesol on human innate immune cells known to be

  7. Immune responses to influenza virus and its correlation to age and inherited factors

    Directory of Open Access Journals (Sweden)

    Azadeh Bahadoran

    2016-11-01

    Full Text Available Influenza viruses belong to the family Orthomyxoviridae of enveloped viruses and are an important cause of respiratory infections worldwide. The influenza virus is able to infect a wide variety species as diverse as poultry, marine, pigs, horses and humans. Upon infection with influenza virus the innate immunity plays a critical role in efficient and rapid control of viral infections as well as in adaptive immunity initiation. The humoral immune system produces antibodies against different influenza antigens, of which the HA-specific antibody is the most important for neutralization of the virus and thus prevention of illness. Cell mediated immunity including CD4+ helper T cells and CD8+ cytotoxic T cells are the other arms of adaptive immunity induced upon influenza virus infection. The complex inherited factors and age related changes are associated with the host immune responses. Here, we review the different components of immune responses against influenza virus. Additionally, the correlation of the immune response to age and inherited factors has been discussed. These determinations lead to a better understanding of the limitations of immune responses for developing improved vaccines to control influenza virus infection.

  8. Immune dysfunction in cirrhosis

    Science.gov (United States)

    Sipeki, Nora; Antal-Szalmas, Peter; Lakatos, Peter L; Papp, Maria

    2014-01-01

    Innate and adaptive immune dysfunction, also referred to as cirrhosis-associated immune dysfunction syndrome, is a major component of cirrhosis, and plays a pivotal role in the pathogenesis of both the acute and chronic worsening of liver function. During the evolution of the disease, acute decompensation events associated with organ failure(s), so-called acute-on chronic liver failure, and chronic decompensation with progression of liver fibrosis and also development of disease specific complications, comprise distinct clinical entities with different immunopathology mechanisms. Enhanced bacterial translocation associated with systemic endotoxemia and increased occurrence of systemic bacterial infections have substantial impacts on both clinical situations. Acute and chronic exposure to bacteria and/or their products, however, can result in variable clinical consequences. The immune status of patients is not constant during the illness; consequently, alterations of the balance between pro- and anti-inflammatory processes result in very different dynamic courses. In this review we give a detailed overview of acquired immune dysfunction and its consequences for cirrhosis. We demonstrate the substantial influence of inherited innate immune dysfunction on acute and chronic inflammatory processes in cirrhosis caused by the pre-existing acquired immune dysfunction with limited compensatory mechanisms. Moreover, we highlight the current facts and future perspectives of how the assessment of immune dysfunction can assist clinicians in everyday practical decision-making when establishing treatment and care strategies for the patients with end-stage liver disease. Early and efficient recognition of inappropriate performance of the immune system is essential for overcoming complications, delaying progression and reducing mortality. PMID:24627592

  9. Immune Reconstitution after Allogeneic Hematopoietic Stem Cell Transplantation

    Science.gov (United States)

    Ogonek, Justyna; Kralj Juric, Mateja; Ghimire, Sakhila; Varanasi, Pavankumar Reddy; Holler, Ernst; Greinix, Hildegard; Weissinger, Eva

    2016-01-01

    The timely reconstitution and regain of function of a donor-derived immune system is of utmost importance for the recovery and long-term survival of patients after allogeneic hematopoietic stem cell transplantation (HSCT). Of note, new developments such as umbilical cord blood or haploidentical grafts were associated with prolonged immunodeficiency due to delayed immune reconstitution, raising the need for better understanding and enhancing the process of immune reconstitution and finding strategies to further optimize these transplant procedures. Immune reconstitution post-HSCT occurs in several phases, innate immunity being the first to regain function. The slow T cell reconstitution is regarded as primarily responsible for deleterious infections with latent viruses or fungi, occurrence of graft-versus-host disease, and relapse. Here we aim to summarize the major steps of the adaptive immune reconstitution and will discuss the importance of immune balance in patients after HSCT. PMID:27909435

  10. T lymphocytes and normal tissue responses to radiation

    International Nuclear Information System (INIS)

    Schaue, Dörthe; McBride, William H.

    2012-01-01

    There is compelling evidence that lymphocytes are a recurring feature in radiation damaged normal tissues, but assessing their functional significance has proven difficult. Contradictory roles have been postulated in both tissue pathogenesis and protection, although these are not necessarily mutually exclusive as the immune system can display what may seem to be opposing faces at any one time. While the exact role of T lymphocytes in irradiated normal tissue responses may still be obscure, their accumulation after tissue damage suggests they may be critical targets for radiotherapeutic intervention and worthy of further study. This is accentuated by recent findings that pathologically damaged “self,” such as occurs after exposure to ionizing radiation, can generate danger signals with the ability to activate pathways similar to those that activate adoptive immunity to pathogens. In addition, the demonstration of T cell subsets with their recognition radars tuned to “self” moieties has revolutionized our ideas on how all immune responses are controlled and regulated. New concepts of autoimmunity have resulted based on the dissociation of immune functions between different subsets of immune cells. It is becoming axiomatic that the immune system has the power to regulate radiation-induced tissue damage, from failure of regeneration to fibrosis, to acute and chronic late effects, and even to carcinogenesis. Our understanding of the interplay between T lymphocytes and radiation-damaged tissue may still be rudimentary but this is a good time to re-examine their potential roles, their radiobiological and microenvironmental influences, and the possibilities for therapeutic manipulation. This review will discuss the yin and yang of T cell responses within the context of radiation exposures, how they might drive or protect against normal tissue side effects and what we may be able do about it.

  11. Poliovirus intrahost evolution is required to overcome tissue-specific innate immune responses.

    Science.gov (United States)

    Xiao, Yinghong; Dolan, Patrick Timothy; Goldstein, Elizabeth Faul; Li, Min; Farkov, Mikhail; Brodsky, Leonid; Andino, Raul

    2017-08-29

    RNA viruses, such as poliovirus, have a great evolutionary capacity, allowing them to quickly adapt and overcome challenges encountered during infection. Here we show that poliovirus infection in immune-competent mice requires adaptation to tissue-specific innate immune microenvironments. The ability of the virus to establish robust infection and virulence correlates with its evolutionary capacity. We further identify a region in the multi-functional poliovirus protein 2B as a hotspot for the accumulation of minor alleles that facilitate a more effective suppression of the interferon response. We propose that population genetic dynamics enables poliovirus spread between tissues through optimization of the genetic composition of low frequency variants, which together cooperate to circumvent tissue-specific challenges. Thus, intrahost virus evolution determines pathogenesis, allowing a dynamic regulation of viral functions required to overcome barriers to infection.RNA viruses, such as polioviruses, have a great evolutionary capacity and can adapt quickly during infection. Here, the authors show that poliovirus infection in mice requires adaptation to innate immune microenvironments encountered in different tissues.

  12. Pathogen recognition in the innate immune response.

    Science.gov (United States)

    Kumar, Himanshu; Kawai, Taro; Akira, Shizuo

    2009-04-28

    Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.

  13. Low-level radiation effects on immune cells

    International Nuclear Information System (INIS)

    Makinodan, T.

    1995-01-01

    The purpose of this study was to characterize the effects of chronic low-dose ionizing radiation (LDR) on murine immune cells. Previously, it had been reported that LDR enhances the proliferative activity of T cells in vitro and delays the growth of transplantable immunogenic tumors in vivo. This suggests that LDR eliminates immune suppressor cells, which downregulates immune response and/or adoptively upregulates the responsiveness of immune effector cells. It had also been reported that human lymphocytes become refractive to high dose radiation-induced chromosomal aberrations by pretreating mitotically active lymphocytes in vitro with very low doses of ionizing radiation, and the adaptive effect can be abrogated by cycloheximide. This suggests that protein synthesis is required for lymphocytes to respond adoptively to LDR

  14. The influence of pregnancy on systemic immunity.

    Science.gov (United States)

    Pazos, Michael; Sperling, Rhoda S; Moran, Thomas M; Kraus, Thomas A

    2012-12-01

    Adaptations in maternal systemic immunity are presumed to be responsible for observed alterations in disease susceptibility and severity as pregnancy progresses. Epidemiological evidence as well as animal studies have shown that influenza infections are more severe during the second and third trimesters of pregnancy, resulting in greater morbidity and mortality, although the reason for this is still unclear. Our laboratory has taken advantage of 20 years of experience studying the murine immune response to respiratory viruses to address questions of altered immunity during pregnancy. With clinical studies and unique animal model systems, we are working to define the mechanisms responsible for altered immune responses to influenza infection during pregnancy and what roles hormones such as estrogen or progesterone play in these alterations.

  15. New Players in Immunity to Tuberculosis: The Host Microbiome, Lung Epithelium, and Innate Immune Cells

    Science.gov (United States)

    Gupta, Nancy; Kumar, Rakesh; Agrawal, Babita

    2018-01-01

    Tuberculosis (TB) is a highly contagious infection and devastating chronic disease, causing 10.4 million new infections and 1.8 million deaths every year globally. Efforts to control and eradicate TB are hampered by the rapid emergence of drug resistance and limited efficacy of the only available vaccine, BCG. Immunological events in the airways and lungs are of major importance in determining whether exposure to Mycobacterium tuberculosis (Mtb) results in successful infection or protective immunity. Several studies have demonstrated that the host microbiota is in constant contact with the immune system, and thus continually directs the nature of immune responses occurring during new infections. However, little is known about its role in the eventual outcome of the mycobacterial infection. In this review, we highlight the changes in microbial composition in the respiratory tract and gut that have been linked to the alteration of immune responses, and to the risk, prevention, and treatment of TB. In addition, we summarize our current understanding of alveolar epithelial cells and the innate immune system, and their interaction with Mtb during early infection. Extensive studies are warranted to fully understand the all-inclusive role of the lung microbiota, its interaction with epithelium and innate immune responses and resulting adaptive immune responses, and in the pathogenesis and/or protection from Mtb infection. Novel interventions aimed at influencing the microbiota, the alveolar immune system and innate immunity will shape future strategies of prevention and treatment for TB. PMID:29692778

  16. The role of CD103+ Dendritic cells in the intestinal mucosal immune system.

    Directory of Open Access Journals (Sweden)

    Darren Thomas Ruane

    2011-07-01

    Full Text Available While dendritic cells (DC are central to the induction and regulation of adaptive immunity, these cells are very heterogenous and specific subsets can be characterized based on the expression of cell surface markers and functional properties. Intestinal CD103+ DCs are the subject of particular interest due to their role in regulating mucosal immunity. Since the epithelial surfaces are constantly exposed to a high antigenic load, tight regulation of innate and adaptive intestinal immune responses is vital as intestinal inflammation can have detrimental consequences for the host. Strategically positioned within the lamina propria, CD103+ DCs play an important role in maintaining intestinal immune homeostasis. These cells are required for the induction of tolerogenic immune responses and imprinting gut homing phenotypic changes on antigen-specific T cells. Recent insights into their development and regulatory properties have revealed additional immunoregulatory roles and further highlighted their importance for intestinal immunity. In this review we discuss the nature of the intestinal CD103+ DC population and the emerging roles of these cells in the regulation of mucosal immunity.

  17. Rorγt+ innate lymphoid cells in intestinal homeostasis and immunity.

    Science.gov (United States)

    Aparicio-Domingo, Patricia; Cupedo, Tom

    2011-01-01

    Innate lymphoid cells (ILC) combine innate and adaptive immune functions and are part of the first line of defense against mucosal infections. ILC are set apart from adaptive lymphocytes by their independence on RAG genes and the resulting absence of specific antigen receptors. In this review, we will discuss the biology and function of intestinal ILC that express the nuclear hormone receptor Rorγt (encoded by the Rorc gene) and highlight their role in intestinal homeostasis and immunity. Copyright © 2011 S. Karger AG, Basel.

  18. Impact of nest sanitation on the immune system of parents and nestlings in a passerine bird.

    Science.gov (United States)

    Evans, Jessica K; Griffith, Simon C; Klasing, Kirk C; Buchanan, Katherine L

    2016-07-01

    Bacterial communities are thought to have fundamental effects on the growth and development of nestling birds. The antigen exposure hypothesis suggests that, for both nestlings and adult birds, exposure to a diverse range of bacteria would select for stronger immune defences. However, there are relatively few studies that have tested the immune/bacterial relationships outside of domestic poultry. We therefore sought to examine indices of immunity (microbial killing ability in naive birds, which is a measure of innate immunity, and the antibody response to sheep red blood cells, which measures adaptive immunity) in both adult and nestling zebra finches (Taeniopygia guttata). We did this throughout breeding and between reproductive attempts in nests that were experimentally manipulated to change the intensity of bacterial exposure. Our results suggest that nest sanitation and bacterial load affected measures of the adaptive immune system, but not the innate immune parameters tested. Adult finches breeding in clean nests had a lower primary antibody response to sheep red blood cells, particularly males, and a greater difference between primary and secondary responses. Adult microbial killing of Escherichia coli decreased as parents moved from incubation to nestling rearing for both nest treatments; however, killing of Candida albicans remained consistent throughout. In nestlings, both innate microbial killing and the adaptive antibody response did not differ between nest environments. Together, these results suggest that exposure to microorganisms in the environment affects the adaptive immune system in nesting birds, with exposure upregulating the antibody response in adult birds. © 2016. Published by The Company of Biologists Ltd.

  19. Vitamin D signaling in intestinal innate immunity and homeostasis.

    Science.gov (United States)

    Dimitrov, Vassil; White, John H

    2017-09-15

    The lumen of the gut hosts a plethora of microorganisms that participate in food assimilation, inactivation of harmful particles and in vitamin synthesis. On the other hand, enteric flora, a number of food antigens, and toxins are capable of triggering immune responses causing inflammation, which, when unresolved, may lead to chronic conditions such as inflammatory bowel disease (IBD). It is important, therefore, to contain the gut bacteria within the lumen, control microbial load and composition, as well as ensure adequate innate and adaptive immune responses to pathogenic threats. There is growing evidence that vitamin D signaling has impacts on all these aspects of intestinal physiology, contributing to healthy enteric homeostasis. VD was first discovered as the curative agent for nutritional rickets, and its classical actions are associated with calcium absorption and bone health. However, vitamin D exhibits a number of extra-skeletal effects, particularly in innate immunity. Notably, it stimulates production of pattern recognition receptors, anti-microbial peptides, and cytokines, which are at the forefront of innate immune responses. They play a role in sensing the microbiota, in preventing excessive bacterial overgrowth, and complement the actions of vitamin D signaling in enhancing intestinal barrier function. Vitamin D also favours tolerogenic rather than inflammogenic T cell differentiation and function. Compromised innate immune function and overactive adaptive immunity, as well as defective intestinal barrier function, have been associated with IBD. Importantly, observational and intervention studies support a beneficial role of vitamin D supplementation in patients with Crohn's disease, a form of IBD. This review summarizes the effects of vitamin D signaling on barrier integrity and innate and adaptive immunity in the gut, as well as on microbial load and composition. Collectively, studies to date reveal that vitamin D signaling has widespread effects

  20. Adaptive immunity to leukemia is inhibited by cross-reactive induced regulatory T cells

    OpenAIRE

    Manlove, Luke S.; Berquam-Vrieze, Katherine E.; Pauken, Kristen E.; Williams, Richard T.; Jenkins, Marc K.; Farrar, Michael A.

    2015-01-01

    BCR-ABL+ acute lymphoblastic leukemia patients have transient responses to current therapies. However, the fusion of BCR to ABL generates a potential leukemia-specific antigen that could be a target for immunotherapy. We demonstrate that the immune system can limit BCR-ABL+ leukemia progression although ultimately this immune response fails. To address how BCR-ABL+ leukemia escapes immune surveillance, we developed a peptide: MHC-II tetramer that labels endogenous BCR-ABL-specific CD4+ T cell...

  1. Evolution of transgenerational immunity in invertebrates.

    Science.gov (United States)

    Pigeault, R; Garnier, R; Rivero, A; Gandon, S

    2016-09-28

    Over a decade ago, the discovery of transgenerational immunity in invertebrates shifted existing paradigms on the lack of sophistication of their immune system. Nonetheless, the prevalence of this trait and the ecological factors driving its evolution in invertebrates remain poorly understood. Here, we develop a theoretical host-parasite model and predict that long lifespan and low dispersal should promote the evolution of transgenerational immunity. We also predict that in species that produce both philopatric and dispersing individuals, it may pay to have a plastic allocation strategy with a higher transgenerational immunity investment in philopatric offspring because they are more likely to encounter locally adapted pathogens. We review all experimental studies published to date, comprising 21 invertebrate species in nine different orders, and we show that, as expected, longevity and dispersal correlate with the transfer of immunity to offspring. The validity of our prediction regarding the plasticity of investment in transgenerational immunity remains to be tested in invertebrates, but also in vertebrate species. We discuss the implications of our work for the study of the evolution of immunity, and we suggest further avenues of research to expand our knowledge of the impact of transgenerational immune protection in host-parasite interactions. © 2016 The Author(s).

  2. A pro-inflammatory effect of foot and mouth disease vírus on immune and non immune guinea pigs

    Directory of Open Access Journals (Sweden)

    Helio José Montassier

    1992-12-01

    Full Text Available The O1Campos strain of foot and mouth disease virus (FMDV used as inducing agent in the pleurisy model was able to trigger a pro-inflammatory effect on normal and immune guinea pigs. The proinflammatory activity which was detected at two times of the pleurisy (24 and 48 hours on normal guinea pigs was characterized only by mononuclear (MN cell influx, during the first interval of the reaction and by edematogenic effect, MN and polimorphonuclcar (PMN leucocyte migration, at the last time of the reaction. The inflammatory reaction profiles recorded on immune guinea pigs (vaccinated with anti-O1Campos oil adjuvanted vaccine, both after 7 and 30 days post vaccination (pv have showed, in both interval, lower intensities than that observed in normal guinea pigs, although in the 7 days PV guinea pigs the accumulations of total leucocytes and PMN were similar to that displayed by normal animals, after 48 hours of the reaction. Besides, on thirty days PV guinea pigs the FMDV induced a significant increase in volume of exudate and MN cell infiltration, after 24 hours, and all of the inflammatory parameters values dropped to normal levels, during the second interval of the reaction. It was found a negative association between the increase in serum neutralizing antibody titer, from 7 to 30 days PV and the intensities of pleural inflammatory parameters on the immune guinea pigs. The pleurisy test revealed itself feasible to evaluate the pro-inflammatory activity of FMDV.

  3. Metabolic and adaptive immune responses induced in mice infected ...

    African Journals Online (AJOL)

    This study investigated metabolic and immuno-inflammatory responses of mice infected with tissue-dwelling larvae of Trichinella zimbabwensis and explored the relationship between infection, metabolic parameters and Th1/Th17 immune responses. Sixty (60) female BALB/c mice aged between 6 to 8 weeks old were ...

  4. Standard of hygiene and immune adaptation in newborn infants

    NARCIS (Netherlands)

    Kallionpaa, Henna; Laajala, Essi; Oling, Viveka; Harkonen, Taina; Tillmann, Vallo; Dorshakova, Natalya V.; Ilonen, Jorma; Landesmaki, Harri; Knip, Mikael; Lahesmaa, Riitta; Koski, Katriina; Koski, Matti; Ryhanen, Samppa; Siljander, Heli; Hamalainen, Anu-Maaria; Ormisson, Anne; Peet, Aleksandr; Ulich, Valentina; Kuzmicheva, Elena; Mokurov, Sergei; Markova, Svettana; Pylova, Svetlana; Isakova, Marina; Shakurova, Elena; Petrov, Vladimir; Karapetyan, Tatyana; Varlamova, Tatyana; Ilonen, Jorma; Kiviniemi, Minna; Alnek, Kristi; Janson, Helis; Uibo, Raivo; Salum, Tiit; von Mutius, Erika; Weber, Juliane; Ahlfors, Helena; Moulder, Robert; Nieminen, Janne; Ruohtula, Terhi; Vaarala, Outi; Honkanen, Hanna; Hyoty, Heikki; Kondrashova, Anita; Oikarinen, Sami; Harmsen, Hermie J. M.; De Goffau, Marcus C.; Welling, Gjalt; Alahuhta, Kirsi; Korhonen, Tuuli; Virtanen, Suvi M.

    2014-01-01

    The prevalence of immune-mediated diseases, such as allergies and type 1 diabetes, is on the rise in the developed world. In order to explore differences in the gene expression patterns induced in utero in infants born in contrasting standards of living and hygiene, we collected umbilical cord blood

  5. The Immune System in Obesity: Developing Paradigms Amidst Inconvenient Truths.

    Science.gov (United States)

    Agrawal, Madhur; Kern, Philip A; Nikolajczyk, Barbara S

    2017-08-15

    Adipose tissue (AT) houses both innate and adaptive immune systems that are crucial for preserving AT function and metabolic homeostasis. In this review, we summarize recent information regarding progression of obesity-associated AT inflammation and insulin resistance. We additionally consider alterations in AT distribution and the immune system in males vs. females and among different racial populations. Innate and adaptive immune cell-derived inflammation drives insulin resistance both locally and systemically. However, new evidence also suggests that the immune system is equally vital for adipocyte differentiation and protection from ectopic lipid deposition. Furthermore, roles of anti-inflammatory immune cells such as regulatory T cells, "M2-like" macrophages, eosinophils, and mast cells are being explored, primarily due to promise of immunotherapeutic applications. Both immune responses and AT distribution are strongly influenced by factors like sex and race, which have been largely underappreciated in the field of metabolically-associated inflammation, or meta-flammation. More studies are required to recognize factors that switch inflammation from controlled to uncontrolled in obesity-associated pathogenesis and to integrate the combined effects of meta-flammation and immunometabolism. It is critical to recognize that the AT-associated immune system can be alternately beneficial and destructive; therefore, simply blocking immune responses early in obesity may not be the best clinical approach. The dearth of information on gender and race-associated disparities in metabolism, AT distribution, and the immune system suggest that a greater understanding of such differences will be critical to develop personalized treatments for obesity and the associated metabolic dysfunction.

  6. Modulation of immune homeostasis by commensal bacteria

    Science.gov (United States)

    Ivanov, Ivaylo I.; Littman, Dan R.

    2011-01-01

    Intestinal bacteria form a resident community that has co-evolved with the mammalian host. In addition to playing important roles in digestion and harvesting energy, commensal bacteria are crucial for the proper functioning of mucosal immune defenses. Most of these functions have been attributed to the presence of large numbers of “innocuous” resident bacteria that dilute or occupy niches for intestinal pathogens or induce innate immune responses that sequester bacteria in the lumen, thus quenching excessive activation of the mucosal immune system. However it has recently become obvious that commensal bacteria are not simply beneficial bystanders, but are important modulators of intestinal immune homeostasis and that the composition of the microbiota is a major factor in pre-determining the type and robustness of mucosal immune responses. Here we review specific examples of individual members of the microbiota that modify innate and adaptive immune responses, and we focus on potential mechanisms by which such species-specific signals are generated and transmitted to the host immune system. PMID:21215684

  7. Are innate immune signaling pathways in plants and animals conserved?

    Science.gov (United States)

    Ausubel, Frederick M

    2005-10-01

    Although adaptive immunity is unique to vertebrates, the innate immune response seems to have ancient origins. Common features of innate immunity in vertebrates, invertebrate animals and plants include defined receptors for microbe-associated molecules, conserved mitogen-associated protein kinase signaling cascades and the production of antimicrobial peptides. It is commonly reported that these similarities in innate immunity represent a process of divergent evolution from an ancient unicellular eukaryote that pre-dated the divergence of the plant and animal kingdoms. However, at present, data suggest that the seemingly analogous regulatory modules used in plant and animal innate immunity are a consequence of convergent evolution and reflect inherent constraints on how an innate immune system can be constructed.

  8. Innate Immune Cytokines, Fibroblast Phenotypes, and Regulation of Extracellular Matrix in Lung.

    Science.gov (United States)

    Richards, Carl D

    2017-02-01

    Chronic inflammation can be caused by adaptive immune responses in autoimmune and allergic conditions, driven by a T lymphocyte subset balance (TH1, TH2, Th17, Th22, and/or Treg) and skewed cellular profiles in an antigen-specific manner. However, several chronic inflammatory diseases have no clearly defined adaptive immune mechanisms that drive chronicity. These conditions include those that affect the lung such as nonatopic asthma or idiopathic pulmonary fibrosis comprising significant health problems. The remodeling of extracellular matrix (ECM) causes organ dysfunction, and it is largely generated by fibroblasts as the major cell controlling net ECM. As such, these are potential targets of treatment approaches in the context of ECM pathology. Fibroblast phenotypes contribute to ECM and inflammatory cell accumulation, and they are integrated into chronic disease mechanisms including cancer. Evidence suggests that innate cytokine responses may be critical in nonallergic/nonautoimmune disease, and they enable environmental agent exposure mechanisms that are independent of adaptive immunity. Innate immune cytokines derived from macrophage subsets (M1/M2) and innate lymphoid cell (ILC) subsets can directly regulate fibroblast function. We also suggest that STAT3-activating gp130 cytokines can sensitize fibroblasts to the innate cytokine milieu to drive phenotypes and exacerbate existing adaptive responses. Here, we review evidence exploring innate cytokine regulation of fibroblast behavior.

  9. Mucosal Herpes Immunity and Immunopathology to Ocular and Genital Herpes Simplex Virus Infections

    Science.gov (United States)

    Chentoufi, Aziz Alami; BenMohamed, Lbachir

    2012-01-01

    Herpes simplex viruses type 1 and type 2 (HSV-1 and HSV-2) are amongst the most common human infectious viral pathogens capable of causing serious clinical diseases at every stage of life, from fatal disseminated disease in newborns to cold sores genital ulcerations and blinding eye disease. Primary mucocutaneous infection with HSV-1 & HSV-2 is followed by a lifelong viral latency in the sensory ganglia. In the majority of cases, herpes infections are clinically asymptomatic. However, in symptomatic individuals, the latent HSV can spontaneously and frequently reactivate, reinfecting the muco-cutaneous surfaces and causing painful recurrent diseases. The innate and adaptive mucosal immunities to herpes infections and disease remain to be fully characterized. The understanding of innate and adaptive immune mechanisms operating at muco-cutaneous surfaces is fundamental to the design of next-generation herpes vaccines. In this paper, the phenotypic and functional properties of innate and adaptive mucosal immune cells, their role in antiherpes immunity, and immunopathology are reviewed. The progress and limitations in developing a safe and efficient mucosal herpes vaccine are discussed. PMID:23320014

  10. Mucosal Herpes Immunity and Immunopathology to Ocular and Genital Herpes Simplex Virus Infections

    Directory of Open Access Journals (Sweden)

    Aziz Alami Chentoufi

    2012-01-01

    Full Text Available Herpes simplex viruses type 1 and type 2 (HSV-1 and HSV-2 are amongst the most common human infectious viral pathogens capable of causing serious clinical diseases at every stage of life, from fatal disseminated disease in newborns to cold sores genital ulcerations and blinding eye disease. Primary mucocutaneous infection with HSV-1 & HSV-2 is followed by a lifelong viral latency in the sensory ganglia. In the majority of cases, herpes infections are clinically asymptomatic. However, in symptomatic individuals, the latent HSV can spontaneously and frequently reactivate, reinfecting the muco-cutaneous surfaces and causing painful recurrent diseases. The innate and adaptive mucosal immunities to herpes infections and disease remain to be fully characterized. The understanding of innate and adaptive immune mechanisms operating at muco-cutaneous surfaces is fundamental to the design of next-generation herpes vaccines. In this paper, the phenotypic and functional properties of innate and adaptive mucosal immune cells, their role in antiherpes immunity, and immunopathology are reviewed. The progress and limitations in developing a safe and efficient mucosal herpes vaccine are discussed.

  11. Transport modeling: An artificial immune system approach

    Directory of Open Access Journals (Sweden)

    Teodorović Dušan

    2006-01-01

    Full Text Available This paper describes an artificial immune system approach (AIS to modeling time-dependent (dynamic, real time transportation phenomenon characterized by uncertainty. The basic idea behind this research is to develop the Artificial Immune System, which generates a set of antibodies (decisions, control actions that altogether can successfully cover a wide range of potential situations. The proposed artificial immune system develops antibodies (the best control strategies for different antigens (different traffic "scenarios". This task is performed using some of the optimization or heuristics techniques. Then a set of antibodies is combined to create Artificial Immune System. The developed Artificial Immune transportation systems are able to generalize, adapt, and learn based on new knowledge and new information. Applications of the systems are considered for airline yield management, the stochastic vehicle routing, and real-time traffic control at the isolated intersection. The preliminary research results are very promising.

  12. Growth performance, innate immune responses and disease resistance of fingerling blunt snout bream, Megalobrama amblycephala adapted to different berberine-dietary feeding modes.

    Science.gov (United States)

    Xu, Wei-Na; Chen, Dan-Hong; Chen, Qing-Qing; Liu, Wen-Bin

    2017-09-01

    A 8-week feeding trial was conducted to evaluate the effect of different berberine-dietary feeding modes on growth, non-specific immune responses and disease resistance of blunt snout bream, Megalobrama amblycephala. Fish (average initial weight 4.70 ± 0.02 g) were fed two fat levels (5% and 10%) diets in three berberine-feeding modes (supplementing 50 mg/kg berberine continuously, two-week or four-week intervals) with four replicates, respectively. Then, fish were challenged by Aeromonas hydrophila and mortality was recorded for the next 96 h after feeding trial. The results showed that different feeding modes of berberine significantly influenced growth, innate immunity and antioxidant capability of fish. Fish fed normal diet with 50 mg/kg berberine at two-week interval mode reflected remarkably (P complement component 3 (C3) and complement component 4 (C4) concentrations were significantly (P feeding modes. Based on fish healthy improvement and feeding cost saving, blunt snout bream fed normal diet with 50 mg/kg berberine at two-week interval or fed high-fat diet with berberine at two-week or four-week intervals were optimal feeding mode, respectively. Copyright © 2017. Published by Elsevier Ltd.

  13. Auto-immune hepatitis following delivery.

    Science.gov (United States)

    Saini, Vandana; Gupta, Mamta; Mishra, S K

    2013-05-01

    Auto-immune hepatitis first presenting in the early postpartum period is rare. Immunosuppressive effects of pregnancy result in delayed manifestation of auto-immune hepatitis, and in established cases, the spontaneous improvements are there. Auto-immune hepatitis should be considered in the differential diagnosis of liver dysfunction first presenting in the early postpartum period. A case of postpartum hepatitis of auto-immune aetiology is being presented here. It is disease of unknown aetiology, characterised by inflammation of liver (as evidenced by raised serum transaminases, presence of interface hepatitis on histological examination), hypergammaglobulinaemia (> 1.5 times normal), presence of auto-antibodies [(antinuclear antibodies (ANA)], smooth muscle antibody (SMA) and antibody to liver-kidney microsome type 1 (LKM1) in the absence of viral markers ie, hepatitis B (HBsAg) and C (AntiHCV) and excellent response to corticosteroid therapy.

  14. Age and long-term protective immunity in dogs and cats.

    Science.gov (United States)

    Schultz, R D; Thiel, B; Mukhtar, E; Sharp, P; Larson, L J

    2010-01-01

    Vaccination can provide an immune response that is similar in duration to that following a natural infection. In general, adaptive immunity to viruses develops earliest and is highly effective. Such anti-viral immune responses often result in the development of sterile immunity and the duration of immunity (DOI) is often lifelong. In contrast, adaptive immunity to bacteria, fungi or parasites develops more slowly and the DOI is generally short compared with most systemic viral infections. Sterile immunity to these infectious agents is less commonly engendered. Old dogs and cats rarely die from vaccine-preventable infectious disease, especially when they have been vaccinated and immunized as young adults (i.e. between 16 weeks and 1 year of age). However, young animals do die, often because vaccines were either not given or not given at an appropriate age (e.g. too early in life in the presence of maternally derived antibody [MDA]). More animals need to be vaccinated to increase herd (population) immunity. The present study examines the DOI for core viral vaccines in dogs that had not been revaccinated for as long as 9 years. These animals had serum antibody to canine distemper virus (CDV), canine parvovirus type 2 (CPV-2) and canine adenovirus type-1 (CAV-1) at levels considered protective and when challenged with these viruses, the dogs resisted infection and/or disease. Thus, even a single dose of modified live virus (MLV) canine core vaccines (against CDV, cav-2 and cpv-2) or MLV feline core vaccines (against feline parvovirus [FPV], feline calicivirus [FCV] and feline herpesvirus [FHV]), when administered at 16 weeks or older, could provide long-term immunity in a very high percentage of animals, while also increasing herd immunity. Copyright 2009 Elsevier Ltd. All rights reserved.

  15. Nutrition, immune function and health of dairy cattle

    DEFF Research Database (Denmark)

    Ingvartsen, Klaus Lønne; Moyes, Kasey

    2013-01-01

    not seem to be improved. Earlier reviews have covered critical periods such as the transition period in the cow and its influence on health and immune function, the interplay between the endocrine system and the immune system and nutrition and immune function. Knowledge on these topics is crucial for our......) on immune function, and to give perspectives for prevention of diseases in the dairy cow through nutrition. To a large extent, the health problems during the periparturient period relate to cows having difficulty in adapting to the nutrient needs for lactation. This may result in PI, a situation where...... the regulatory mechanisms are insufficient for the animals to function optimally leading to a high risk of a complex of digestive, metabolic and infectious problems. The risk of infectious diseases will be increased if the immune competence is reduced. Nutrition plays a pivotal role in the immune response...

  16. MECHANISMS OF ANTIINFECTIOUS FUNCTIONS OF INNATE IMMUNITY: ROLE OF TOLL-LIKE RECEPTORS

    Directory of Open Access Journals (Sweden)

    S. I. Suskov

    2012-01-01

    Full Text Available This review describes the main role of toll-like receptors of innate immunity for pathogen recognition; signaling; production of inflammatory response. Also Interrelation of innate and adaptive Immunity in conditions of pathology and organ transplantation were considered. 

  17. Evasion of host immune defenses by human papillomavirus.

    Science.gov (United States)

    Westrich, Joseph A; Warren, Cody J; Pyeon, Dohun

    2017-03-02

    A majority of human papillomavirus (HPV) infections are asymptomatic and self-resolving in the absence of medical interventions. Various innate and adaptive immune responses, as well as physical barriers, have been implicated in controlling early HPV infections. However, if HPV overcomes these host immune defenses and establishes persistence in basal keratinocytes, it becomes very difficult for the host to eliminate the infection. The HPV oncoproteins E5, E6, and E7 are important in regulating host immune responses. These oncoproteins dysregulate gene expression, protein-protein interactions, posttranslational modifications, and cellular trafficking of critical host immune modulators. In addition to the HPV oncoproteins, sequence variation and dinucleotide depletion in papillomavirus genomes has been suggested as an alternative strategy for evasion of host immune defenses. Since anti-HPV host immune responses are also considered to be important for antitumor immunity, immune dysregulation by HPV during virus persistence may contribute to immune suppression essential for HPV-associated cancer progression. Here, we discuss cellular pathways dysregulated by HPV that allow the virus to evade various host immune defenses. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  18. The Carbomer-Lecithin Adjuvant Adjuplex Has Potent Immunoactivating Properties and Elicits Protective Adaptive Immunity against Influenza Virus Challenge in Mice

    Science.gov (United States)

    Wegmann, Frank; Moghaddam, Amin E.; Schiffner, Torben; Gartlan, Kate H.; Powell, Timothy J.; Russell, Rebecca A.; Baart, Matthijs; Carrow, Emily W.

    2015-01-01

    The continued discovery and development of adjuvants for vaccine formulation are important to safely increase potency and/or reduce the antigen doses of existing vaccines and tailor the adaptive immune response to newly developed vaccines. Adjuplex is a novel adjuvant platform based on a purified lecithin and carbomer homopolymer. Here, we analyzed the adjuvant activity of Adjuplex in mice for the soluble hemagglutinin (HA) glycoprotein of influenza A virus. The titration of Adjuplex revealed an optimal dose of 1% for immunogenicity, eliciting high titers of HA-specific IgG but inducing no significant weight loss. At this dose, Adjuplex completely protected mice from an otherwise lethal influenza virus challenge and was at least as effective as the adjuvants monophosphoryl lipid A (MPL) and alum in preventing disease. Adjuplex elicited balanced Th1-/Th2-type immune responses with accompanying cytokines and triggered antigen-specific CD8+ T-cell proliferation. The use of the peritoneal inflammation model revealed that Adjuplex recruited dendritic cells (DCs), monocytes, and neutrophils in the context of innate cytokine and chemokine secretion. Adjuplex neither triggered classical maturation of DCs nor activated a pathogen recognition receptor (PRR)-expressing NF-κB reporter cell line, suggesting a mechanism of action different from that reported for classical pathogen-associated molecular pattern (PAMP)-activated innate immunity. Taken together, these data reveal Adjuplex to be a potent and well-tolerated adjuvant with application for subunit vaccines. PMID:26135973

  19. Human Milk Oligosaccharide 2′-Fucosyllactose Improves Innate and Adaptive Immunity in an Influenza-Specific Murine Vaccination Model

    Directory of Open Access Journals (Sweden)

    Ling Xiao

    2018-03-01

    Full Text Available BackgroundHuman milk is uniquely suited to provide optimal nutrition and immune protection to infants. Human milk oligosaccharides are structural complex and diverse consisting of short chain and long chain oligosaccharides typically present in a 9:1 ratio. 2′-Fucosyllactose (2′FL is one of the most prominent short chain oligosaccharides and is associated with anti-infective capacity of human milk.AimTo determine the effect of 2′FL on vaccination responsiveness (both innate and adaptive in a murine influenza vaccination model and elucidate mechanisms involved.MethodsA dose range of 0.25–5% (w/w dietary 2′FL was provided to 6-week-old female C57Bl/6JOlaHsd mice 2 weeks prior primary and booster vaccination until the end of the experiment. Intradermal (i.d. challenge was performed to measure the vaccine-specific delayed-type hypersensitivity (DTH. Antigen-specific antibody levels in serum as well as immune cell populations within several organs were evaluated using ELISA and flow cytometry, respectively. In an ex vivo restimulation assay, spleen cells were cocultured with influenza-loaded bone marrow-derived dendritic cells (BMDCs to study the effects of 2′FL on vaccine-specific CD4+ and CD8+ T-cell proliferation and cytokine secretions. Furthermore, the direct immune regulatory effects of 2′FL were confirmed using in vitro BMDCs T-cell cocultures.ResultsDietary 2′FL significantly (p < 0.05 enhanced vaccine specific DTH responses accompanied by increased serum levels of vaccine-specific immunoglobulin (Ig G1 and IgG2a in a dose-dependent manner. Consistently, increased activation marker (CD27 expression on splenic B-cells was detected in mice receiving 2′FL as compared to control mice. Moreover, proliferation of vaccine-specific CD4+ and CD8+ T-cells, as well as interferon-γ production after ex vivo restimulation were significantly increased in spleen cells of mice receiving 2′FL as compared to control mice, which were

  20. Hibernation : the immune system at rest?

    NARCIS (Netherlands)

    Bouma, Hjalmar R.; Carey, Hannah V.; Kroese, Frans G. M.

    2010-01-01

    Mammalian hibernation consists of torpor phases when metabolism is severely depressed, and T can reach as low as approximately -2 degrees C, interrupted by euthermic arousal phases. Hibernation affects the function of the innate and the adaptive immune systems. Torpor drastically reduces numbers of

  1. Socio-cultural adaptation and standardization of Dubois' five words testing in a population of normal subject in Mali, West Africa.

    Science.gov (United States)

    Guinto, Cheick O; Coulibaly, Toumany; Koné, Zeinab; Coulibaly, Souleymane; Maiga, Boubacar; Dembélé, Kekouta; Cissé, Lassana; Konaté, Mamadou; Coulibaly, Thomas; Sissoko, Adama S; Karambé, Mamadou; Burnett, Barrington; Landouré, Guida; Traoré, Moussa

    2016-06-01

    Dubois' five words testing (5WT) is a verbal memory test that depends on many parameters. The aim of this study is to adapt Dubois' 5WT to the Malian socio-cultural conditions to (i) determine performances of normal subjects to the 5WT and (ii) provide reference scores of the 5WT. A sample of 276 normal subjects aged ≥ 50 years (154 males and 122 females; 144 literates and 132 illiterates) were enrolled from February 2008 to January 2009. Subjects with a history of symptoms likely to modify cognitive functions and those who were found disabled under Lawton's four simplified item test were excluded. The learning score in illiterates was 1.51 in Dubois' 5WT and 4.90 in the modified 5WT. The mean value of the modified 5WT total score was 9.71. Majority (90.22%) of the subjects scored the maximum (10). The modified 5WT reduced with both the age (p culture and the socio-educative level in French. Its adaptation to the socio-cultural context could prove useful and efficient in countries with a low literacy rate and a diverse cultural background.

  2. The role of retinoic acid in tolerance and immunity.

    Science.gov (United States)

    Hall, Jason A; Grainger, John R; Spencer, Sean P; Belkaid, Yasmine

    2011-07-22

    Vitamin A elicits a broad array of immune responses through its metabolite, retinoic acid (RA). Recent evidence indicates that loss of RA leads to impaired immunity, whereas excess RA can potentially promote inflammatory disorders. In this review, we discuss recent advances showcasing the crucial contributions of RA to both immunological tolerance and the elicitation of adaptive immune responses. Further, we provide a comprehensive overview of the cell types and factors that control the production of RA and discuss how host perturbations may affect the ability of this metabolite to control tolerance and immunity or to instigate pathology. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Regulation of intestinal homeostasis and immunity with probiotic lactobacilli.

    Science.gov (United States)

    van Baarlen, Peter; Wells, Jerry M; Kleerebezem, Michiel

    2013-05-01

    The gut microbiota provide important stimuli to the human innate and adaptive immune system and co-mediate metabolic and immune homeostasis. Probiotic bacteria can be regarded as part of the natural human microbiota, and have been associated with improving homeostasis, albeit with different levels of success. Composition of microbiota, probiotic strain identity, and host genetic differences may account for differential modulation of immune responses by probiotics. Here, we review the mechanisms of immunomodulating capacities of specific probiotic strains, the responses they can induce in the host, and how microbiota and genetic differences between individuals may co-influence host responses and immune homeostasis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. [Evasion of anti-infectious immunity by Brucella - A review].

    Science.gov (United States)

    Quan, Wurong; Yang, Yongjie

    2016-05-04

    Brucellosis, caused by Brucella species, is a worldwide zoonosis. As facultative intracellular pathogens, Brucella possess non-classical virulence factor, but its virulence is very powerful and can elicit chronic infections of both animals and humans. Evasion of host anti-infectious immunity is a prerequisite for chronic infections, this ability appears increasingly crucial for Brucella virulence. As successful pathogens, Brucella can escape or suppress innate immunity and modulate adaptive immunity to establish long lasting infections in host cells. In this review, we address the molecular mechanisms of Brucella to evade anti-infectious immunity. This will shed new insights on Brucella virulence and will, potentially, open new prophylactic avenues.

  5. Retrieving infinite numbers of patterns in a spin-glass model of immune networks

    Science.gov (United States)

    Agliari, E.; Annibale, A.; Barra, A.; Coolen, A. C. C.; Tantari, D.

    2017-01-01

    The similarity between neural and (adaptive) immune networks has been known for decades, but so far we did not understand the mechanism that allows the immune system, unlike associative neural networks, to recall and execute a large number of memorized defense strategies in parallel. The explanation turns out to lie in the network topology. Neurons interact typically with a large number of other neurons, whereas interactions among lymphocytes in immune networks are very specific, and described by graphs with finite connectivity. In this paper we use replica techniques to solve a statistical mechanical immune network model with “coordinator branches” (T-cells) and “effector branches” (B-cells), and show how the finite connectivity enables the coordinators to manage an extensive number of effectors simultaneously, even above the percolation threshold (where clonal cross-talk is not negligible). A consequence of its underlying topological sparsity is that the adaptive immune system exhibits only weak ergodicity breaking, so that also spontaneous switch-like effects as bi-stabilities are present: the latter may play a significant role in the maintenance of immune homeostasis.

  6. Hepatitis C, innate immunity and alcohol: friends or foes?

    Science.gov (United States)

    Osna, Natalia A; Ganesan, Murali; Kharbanda, Kusum K

    2015-02-05

    Hepatitis C and alcohol are the most widespread causes of liver disease worldwide. Approximately 80% of patients with a history of hepatitis C and alcohol abuse develop chronic liver injury. Alcohol consumption in hepatitis C virus (HCV)-infected patients exacerbates liver disease leading to rapid progression of fibrosis, cirrhosis and even hepatocellular carcinoma. Hepatocytes are the main sites of HCV-infection and ethanol metabolism, both of which generate oxidative stress. Oxidative stress levels affect HCV replication and innate immunity, resulting in a greater susceptibility for HCV-infection and virus spread in the alcoholic patients. In this review paper, we analyze the effects of ethanol metabolism and other factors on HCV replication. In addition, we illustrate the mechanisms of how HCV hijacks innate immunity and how ethanol exposure regulates this process. We also clarify the effects of HCV and ethanol metabolism on interferon signaling-a crucial point for activation of anti-viral genes to protect cells from virus-and the role that HCV- and ethanol-induced impairments play in adaptive immunity which is necessary for recognition of virally-infected hepatocytes. In conclusion, ethanol exposure potentiates the suppressive effects of HCV on innate immunity, which activates viral spread in the liver and finally, leads to impairments in adaptive immunity. The dysregulation of immune response results in impaired elimination of HCV-infected cells, viral persistence, progressive liver damage and establishment of chronic infection that worsens the outcomes of chronic hepatitis C in alcoholic patients.

  7. Hepatitis C, Innate Immunity and Alcohol: Friends or Foes?

    Directory of Open Access Journals (Sweden)

    Natalia A. Osna

    2015-02-01

    Full Text Available Hepatitis C and alcohol are the most widespread causes of liver disease worldwide. Approximately 80% of patients with a history of hepatitis C and alcohol abuse develop chronic liver injury. Alcohol consumption in hepatitis C virus (HCV-infected patients exacerbates liver disease leading to rapid progression of fibrosis, cirrhosis and even hepatocellular carcinoma. Hepatocytes are the main sites of HCV-infection and ethanol metabolism, both of which generate oxidative stress. Oxidative stress levels affect HCV replication and innate immunity, resulting in a greater susceptibility for HCV-infection and virus spread in the alcoholic patients. In this review paper, we analyze the effects of ethanol metabolism and other factors on HCV replication. In addition, we illustrate the mechanisms of how HCV hijacks innate immunity and how ethanol exposure regulates this process. We also clarify the effects of HCV and ethanol metabolism on interferon signaling—a crucial point for activation of anti-viral genes to protect cells from virus—and the role that HCV- and ethanol-induced impairments play in adaptive immunity which is necessary for recognition of virally-infected hepatocytes. In conclusion, ethanol exposure potentiates the suppressive effects of HCV on innate immunity, which activates viral spread in the liver and finally, leads to impairments in adaptive immunity. The dysregulation of immune response results in impaired elimination of HCV-infected cells, viral persistence, progressive liver damage and establishment of chronic infection that worsens the outcomes of chronic hepatitis C in alcoholic patients.

  8. Adaptive Immunity to Leukemia Is Inhibited by Cross-Reactive Induced Regulatory T Cells.

    Science.gov (United States)

    Manlove, Luke S; Berquam-Vrieze, Katherine E; Pauken, Kristen E; Williams, Richard T; Jenkins, Marc K; Farrar, Michael A

    2015-10-15

    BCR-ABL(+) acute lymphoblastic leukemia patients have transient responses to current therapies. However, the fusion of BCR to ABL generates a potential leukemia-specific Ag that could be a target for immunotherapy. We demonstrate that the immune system can limit BCR-ABL(+) leukemia progression although ultimately this immune response fails. To address how BCR-ABL(+) leukemia escapes immune surveillance, we developed a peptide: MHC class II tetramer that labels endogenous BCR-ABL-specific CD4(+) T cells. Naive mice harbored a small population of BCR-ABL-specific T cells that proliferated modestly upon immunization. The small number of naive BCR-ABL-specific T cells was due to negative selection in the thymus, which depleted BCR-ABL-specific T cells. Consistent with this observation, we saw that BCR-ABL-specific T cells were cross-reactive with an endogenous peptide derived from ABL. Despite this cross-reactivity, the remaining population of BCR-ABL reactive T cells proliferated upon immunization with the BCR-ABL fusion peptide and adjuvant. In response to BCR-ABL(+) leukemia, BCR-ABL-specific T cells proliferated and converted into regulatory T (Treg) cells, a process that was dependent on cross-reactivity with self-antigen, TGF-β1, and MHC class II Ag presentation by leukemic cells. Treg cells were critical for leukemia progression in C57BL/6 mice, as transient Treg cell ablation led to extended survival of leukemic mice. Thus, BCR-ABL(+) leukemia actively suppresses antileukemia immune responses by converting cross-reactive leukemia-specific T cells into Treg cells. Copyright © 2015 by The American Association of Immunologists, Inc.

  9. Aggravating Impact of Nanoparticles on Immune-Mediated Pulmonary Inflammation

    Directory of Open Access Journals (Sweden)

    Ken-Ichiro Inoue

    2011-01-01

    Full Text Available Although the adverse health effects of nanoparticles have been proposed and are being clarified, their aggravating effects on pre-existing pathological conditions have not been fully investigated. In this review, we provide insights into the immunotoxicity of both airborne and engineered nanoparticles as an exacerbating factor on hypersusceptible subjects, especially those with immune-mediated pulmonary inflammation, using our in vivo experimental model. First, we exhibit the effects of nanoparticles on pulmonary inflammation induced by bacterial endotoxin (lipopolysaccharide: LPS as a disease model in innate immunity, and demonstrate that nanoparticles instilled through both an intratracheal tube and an inhalation system can exacerbate the lung inflammation. Second, we introduce the effects of nanoparticles on allergic pulmonary inflammation as a disease model in adaptive immunity, and show that repetitive pulmonary exposure to nanoparticles has aggravating effects on allergic inflammation, including adjuvant effects on Th2-milieu. Third, we show that very small nanoparticle exposure exacerbates emphysematous pulmonary inflammation, which is concomitant with enhanced lung expression of proinflammatory molecules (including those that are innate immunity related. Taken together, nanoparticle exposure may synergistically facilitate pathological pulmonary inflammation via both innate and adaptive immunological impairment.

  10. Mecanismos adaptativos do sistema imunológico em resposta ao treinamento físico Adaptative mechanisms of the immune system in response to physical training

    Directory of Open Access Journals (Sweden)

    Carol Góis Leandro

    2007-10-01

    Full Text Available O treinamento físico, de intensidade moderada, melhora os sistemas de defesa, enquanto que o treinamento intenso causa imunossupressão. Os mecanismos subjacentes estão associados à comunicação entre os sistemas nervoso, endócrino e imunológico, sugerindo vias autonômicas e modulação da resposta imune. Células do sistema imune, quando expostas a pequenas cargas de estresse, desenvolvem mecanismo de tolerância. Em muitos tecidos tem-se demonstrado que a resposta a situações agressivas parece ser atenuada pelo treinamento físico aplicado previamente, isto é, o treinamento induz tolerância para situações agressivas/estressantes. Nesta revisão são relatados estudos sugerindo os mecanismos adaptativos do sistema imunológico em resposta ao treinamento físico.Moderate physical training enhances the defense mechanisms, while intense physical training induces to immune suppression. The underlying mechanisms are associated with the link between nervous, endocrine, and immune systems. It suggests autonomic patterns and modulation of immune response. Immune cells, when exposed to regular bouts of stress, develop a mechanism of tolerance. In many tissues, it has been demonstrated that the response to aggressive conditions is attenuated by moderate physical training. Thus, training can induce tolerance to aggressive/stressful situations. In this review, studies suggesting the adaptation mechanisms of the immune system in response to physical training will be reported.

  11. Placental immune editing switch (PIES): learning about immunomodulatory pathways from a unique case report

    Science.gov (United States)

    Bronchud, Miguel H.; Tresserra, Francesc; Xu, Wenjie; Warren, Sarah; Cusido, Maite; Zantop, Bernat; Zenclussen, Ana Claudia; Cesano, Alessandra

    2016-01-01

    The hypothesis of this work is that, in order to escape the natural immune surveillance mechanisms, cancer cells and the surrounding microenvironment might express ectopically genes that are physiologically present in the placenta to mediate fetal immune-tolerance. These natural “placental immune-editing switch” mechanisms (PIES) may represent the result of millions of years of mammalian evolution developed to allow materno-fetal tolerance. Here, we introduce genes of the immune regulatory pathways that are either similarly over- or under-expressed in tumor vs normal tissue. Our analysis was carried out in primary breast cancer with metastatic homolateral axillary lymph nodes as well as placenta tissue (both uterine decidual tissue and term placenta tissue) from a pregnant woman. Gene expression profiling of paired non-self and self tissues (i.e. placenta/uterus; breast cancer/normal breast tissue; metastatic lymphnode/normal lymphnode tissue) was performed using the PanCancer Immune gene panel, a 770 Nanostring gene expression panel. Our findings reveal overlapping in specific immune gene expression in placenta and cancer tissue, suggesting that these genes might play an important role in maintaining immune tolerance both physiologically (in the placenta) and pathologically (in the cancer setting). PMID:27852037

  12. Advances of Immune Checkpoint Inhibitors in Tumor Immunotherapy

    Science.gov (United States)

    Guo, Qiao

    2018-01-01

    Immune checkpoints are cell surface molecules that can fine-tune the immune responses, they are crucial for modulating the duration and amplitude of immune reactions while maintaining self-tolerance in order to minimize autoimmune responses. Numerous studies have demonstrated that tumors cells can directly express immune-checkpoint molecules, or induce many inhibitory molecules expression in the tumor microenvironment to inhibit the anti-tumor immunity. Releasing these brakes has emerged as an exciting strategy to cure cancer. In the past few years, clinical trials with therapeutic antibodies targeting to the checkpoint molecules CTLA-4 and PD-1 have rekindled the hope for cancer immunotherapy. In contrast to the conventional treatment, checkpoint inhibitors induce broad and durable antitumor responses. In the future, treatment may involve combination therapy to target different checkpoint molecules and stages of the adaptive immune responses. In this review, we summarized the recent advances of the study and development of other checkpoint molecules in tumor immunotherapy.

  13. Senescence in immune priming and attractiveness in a beetle.

    Science.gov (United States)

    Daukšte, J; Kivleniece, I; Krama, T; Rantala, M J; Krams, I

    2012-07-01

    Age-related decline in immune activity is referred to as immunosenescence and has been observed for both the adaptive immune response of vertebrates and the innate immune system of invertebrates. Because maintaining a basic level of immune defence and mounting an immune response is costly, optimal investment in immune function should vary over a wide range of individual states such as the individual's age. In this study, we tested whether the immune response and immunological priming within individuals become less efficient with age using mealworm beetles, Tenebrio molitor, as a model organism. We also tested whether ageing and immunological priming affected the odours produced by males. We found that young males of T. molitor were capable of mounting an immune response a sterile nylon monofilament implant with the potential to exhibit a simple form of immune memory through mechanisms of immune priming. Older males did not increase their immune response to a second immune challenge, which negatively affected their sexual attractiveness and remaining life span. Our results indicate that the immune system of older males in T. molitor is less effective, suggesting complex evolutionary trade-offs between ageing, immune response and sexual attractiveness. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

  14. Characterization of main cytokine sources from the innate and adaptive immune responses following primary 17DD yellow fever vaccination in adults.

    Science.gov (United States)

    Silva, Maria Luiza; Martins, Marina Angela; Espírito-Santo, Luçandra Ramos; Campi-Azevedo, Ana Carolina; Silveira-Lemos, Denise; Ribeiro, José Geraldo Leite; Homma, Akira; Kroon, Erna Geessien; Teixeira-Carvalho, Andréa; Elói-Santos, Silvana Maria; Martins-Filho, Olindo Assis

    2011-01-10

    The mechanisms of immune response following yellow fever (YF-17DD) vaccination are still poorly understood. In this study, we have performed a longitudinal investigation (days 0, 7, 15 and 30) to characterize the cytokine profile of innate and adaptive immunity following YF-17DD first-time vaccination. Data from non-stimulated cultures demonstrated a prominent participation of the innate immunity with increased frequency of TNF-α(+) neutrophils and IFN-γ(+) NK-cells at day 7 besides TNF-α(+) monocytes at day 7, day 15 and day 30. Increased frequency of IL-10(+) monocytes was observed at day 15 and day 30, and decreased percentage of IL-4(+) NK-cells were detected at day 7, day 15 and day 30. Time-dependent and oscillating cytokine pattern was observed in CD4(+) T-cells, with low percentage of IL-12(+), IL-4(+) and IL-10(+) cells at day 7 and increased frequency of TNF-α(+) cells at day 15 besides IFN-γ(+) and IL-5(+) cells at day 15 and day 30. Later changes with increased percentage of IL-12(+) and IL-5(+)CD8(+) T-cells were observed at day 30. Increased frequency of IL-10(+) B-cells was observed at day 15, when seroconversion was detected in all vaccinees. The overall cytokine analysis of non-stimulated leukocytes showed a transient shift towards a pro-inflammatory profile at day 7, mainly due to changes in the innate immunity, which draws back toward a mixed/regulatory pattern at day 15 and day 30. The changes induced by the in vitro YF-17DD vaccine-stimulation were mainly observed at day 0 and day 7 (before seroconversion) with minor changes at day 15 and day 30 (after seroconversion). These data support the hypothesis that a complex network with mixed pro/anti-inflammatory cytokine profile is associated with the establishment of the protective immunity following YF-17DD primo-vaccination, free of adverse events. Copyright © 2010 Elsevier Ltd. All rights reserved.

  15. Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response

    Science.gov (United States)

    Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J.; Repasky, Elizabeth A.; Hylander, Bonnie L.

    2018-01-01

    An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were

  16. Parental Exposure to Dim Light at Night Prior to Mating Alters Offspring Adaptive Immunity.

    Science.gov (United States)

    Cissé, Yasmine M; Russart, Kathryn L G; Nelson, Randy J

    2017-03-31

    Exposure to dim light at night (dLAN) disrupts natural light/dark cycles and impairs endogenous circadian rhythms necessary to maintain optimal biological function, including the endocrine and immune systems. We have previously demonstrated that white dLAN compromises innate and cell mediated immune responses in adult Siberian hamsters (Phodopus sungorus). We hypothesized that dLAN has transgenerational influences on immune function. Adult male and female Siberian hamsters were exposed to either dark nights (DARK) or dLAN (~5 lux) for 9 weeks, then paired in full factorial design, mated, and thereafter housed under dark nights. Offspring were gestated and reared in dark nights, then tested as adults for cell-mediated and humoral immunity. Maternal exposure to dLAN dampened delayed type hypersensitivity (DTH) responses in male offspring. Maternal and paternal exposure to dLAN reduced DTH responses in female offspring. IgG antibodies to a novel antigen were elevated in offspring of dams exposed to dLAN. Paternal exposure to dLAN decreased splenic endocrine receptor expression and global methylation in a parental sex-specific manner. Together, these data suggest that exposure to dLAN has transgenerational effects on endocrine-immune function that may be mediated by global alterations in the epigenetic landscape of immune tissues.

  17. Immune Response to Lipoproteins in Atherosclerosis

    Directory of Open Access Journals (Sweden)

    Sonia Samson

    2012-01-01

    Full Text Available Atherosclerosis, the underlying cause of cardiovascular disease, is characterized by chronic inflammation and altered immune response. Cholesterol is a well-known risk factor associated with the development of cardiovascular diseases. Elevated serum cholesterol is unique because it can lead to development of atherosclerosis in animals and humans even in the absence of other risk factors. Modifications of low-density lipoproteins mediated by oxidation, enzymatic degradation, and aggregation result in changes in their function and activate both innate and adaptive immune system. Oxidized low-density lipoprotein (LDL has been identified as one of the most important autoantigens in atherosclerosis. This escape from self-tolerance is dependent on the formation of oxidized phospholipids. The emerging understanding of the importance of immune responses against oxidized LDL in atherosclerosis has focused attention on the possibility of development of novel therapy for atherosclerosis. This review provides an overview of immune response to lipoproteins and the fascinating possibility of developing an immunomodulatory therapy for atherosclerosis.

  18. Immune barriers of Ebola virus infection.

    Science.gov (United States)

    McElroy, Anita K; Mühlberger, Elke; Muñoz-Fontela, César

    2018-02-01

    Since its initial emergence in 1976 in northern Democratic Republic of Congo (DRC), Ebola virus (EBOV) has been a global health concern due to its virulence in humans, the mystery surrounding the identity of its host reservoir and the unpredictable nature of Ebola virus disease (EVD) outbreaks. Early after the first clinical descriptions of a disease resembling a 'septic-shock-like syndrome', with coagulation abnormalities and multi-system organ failure, researchers began to evaluate the role of the host immune response in EVD pathophysiology. In this review, we summarize how data gathered during the last 40 years in the laboratory as well as in the field have provided insight into EBOV immunity. From molecular mechanisms involved in EBOV recognition in infected cells, to antigen processing and adaptive immune responses, we discuss current knowledge on the main immune barriers of infection as well as outstanding research questions. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Ageing and the immune system: focus on macrophages.

    Science.gov (United States)

    Linehan, E; Fitzgerald, D C

    2015-03-01

    A fully functioning immune system is essential in order to maintain good health. However, the immune system deteriorates with advancing age, and this contributes to increased susceptibility to infection, autoimmunity, and cancer in the older population. Progress has been made in identifying age-related defects in the adaptive immune system. In contrast, relatively little research has been carried out on the impact of ageing on the innate immune response. This area requires further research as the innate immune system plays a crucial role in protection against infection and represents a first line of defence. Macrophages are central effector cells of the innate immune system and have many diverse functions. As a result, age-related impairments in macrophage function are likely to have important consequences for the health of the older population. It has been reported that ageing in macrophages impacts on many processes including toll-like receptor signalling, polarisation, phagocytosis, and wound repair. A detailed understanding of the impact of ageing on macrophages is required in order to develop therapeutics that will boost immune responses in the older population.

  20. Alternatives to conventional vaccines--mediators of innate immunity.

    Science.gov (United States)

    Eisen, D P; Liley, H G; Minchinton, R M

    2004-01-01

    Vaccines have been described as "weapons of mass protection". The eradication of many diseases is testament to their utility and effectiveness. Nevertheless, many vaccine preventable diseases remain prevalent because of political and economic barriers. Additionally, the effects of immaturity and old age, therapies that incapacitate the adaptive immune system and the multitude of strategies evolved by pathogens to evade immediate or sustained recognition by the mammalian immune system are barriers to the effectiveness of existing vaccines or development of new vaccines. In the front line of defence against the pervasiness of infection are the elements of the innate immune system. Innate immunity is under studied and poorly appreciated. However, in the first days after entry of a pathogen into the body, our entire protective response is dependant upon the various elements of our innate immune repertoire. In spite of its place as our initial defence against infection, attention is only now turning to strategies which enhance or supplement innate immunity. This review examines the need for and potential of innate immune therapies.

  1. Vascular thermal adaptation in tumors and normal tissue in rats

    International Nuclear Information System (INIS)

    Nah, Byung Sik; Choi, Ihl-Bohng; Oh, Won Young; Osborn, James L.; Song, Chang W.

    1996-01-01

    Purpose: The vascular thermal adaptation in the R3230 adenocarcinoma, skin and muscle in the legs of Fischer rats was studied. Methods and Materials: The legs of Fischer rats bearing the R3230 AC adenocarcinoma (subcutaneously) were heated once or twice with a water bath, and the blood flow in the tumor, skin and muscle of the legs was measured with the radioactive microsphere method. Results: The blood flow in control R3230 AC tumors was 23.9 ml/100 g/min. The tumor blood flow increased about 1.5 times in 30 min and then markedly decreased upon heating at 44.5 deg. C for 90 min. In the tumors preheated 16 h earlier at 42.5 deg. C for 60 min, reheating at 44.5 deg. C increased the tumor blood flow by 2.5-fold in 30 min. Contrary to the decline in blood flow following an initial increase during the 44.5 deg. C heating without preheating, the tumor blood flow remained elevated throughout the 90 min reheating at 44.5 deg. C. These results indicated that thermal adaptation or thermotolerance developed in the tumor vasculatures after the preheating at 42.5 deg. C for 60 min. The magnitude of vascular thermal adaptation in the tumors 24 h and 48 h after the preheating, as judged from the changes in blood flow, were smaller than that 16 h after the preheating. Heating at 42.5 deg. C for 60 min induced vascular thermal adaptation also in the skin and muscle, which peaked in 48 h and 24 h, respectively, after the heating. Conclusion: Heating at 42.5 deg. C for 1 h induced vascular thermal adaptation in the R3230 AC tumor, skin, and muscle of rats that peaked 16-48 h after the heating. When the tumor blood vessels were thermally adapted, the tumor blood flow increased upon heating at temperatures that would otherwise reduce the tumor blood flow. Such an increase in tumor blood flow may hinder raising the tumor temperature while it may increase tumor oxygenation.

  2. Parental Exposure to Dim Light at Night Prior to Mating Alters Offspring Adaptive Immunity

    OpenAIRE

    Ciss?, Yasmine M.; Russart, Kathryn L.G.; Nelson, Randy J.

    2017-01-01

    Exposure to dim light at night (dLAN) disrupts natural light/dark cycles and impairs endogenous circadian rhythms necessary to maintain optimal biological function, including the endocrine and immune systems. We have previously demonstrated that white dLAN compromises innate and cell mediated immune responses in adult Siberian hamsters (Phodopus sungorus). We hypothesized that dLAN has transgenerational influences on immune function. Adult male and female Siberian hamsters were exposed to eit...

  3. Divergent Roles of Interferon-γ and Innate Lymphoid Cells in Innate and Adaptive Immune Cell-Mediated Intestinal Inflammation.

    Science.gov (United States)

    Brasseit, Jennifer; Kwong Chung, Cheong K C; Noti, Mario; Zysset, Daniel; Hoheisel-Dickgreber, Nina; Genitsch, Vera; Corazza, Nadia; Mueller, Christoph

    2018-01-01

    Aberrant interferon gamma (IFNγ) expression is associated with the pathogenesis of numerous autoimmune- and inflammatory disorders, including inflammatory bowel diseases (IBD). However, the requirement of IFNγ for the pathogenesis of chronic intestinal inflammation remains controversial. The aim of this study was thus to investigate the role of IFNγ in experimental mouse models of innate and adaptive immune cell-mediated intestinal inflammation using genetically and microbiota-stabilized hosts. While we find that IFNγ drives acute intestinal inflammation in the anti-CD40 colitis model in an innate lymphoid cell (ILC)-dependent manner, IFNγ secreted by both transferred CD4 T cells and/or cells of the lymphopenic Rag1 -/- recipient mice was dispensable for CD4 T cell-mediated colitis. In the absence of IFNγ, intestinal inflammation in CD4 T cell recipient mice was associated with enhanced IL17 responses; consequently, targeting IL17 signaling in IFNγ-deficient mice reduced T cell-mediated colitis. Intriguingly, in contrast to the anti-CD40 model of colitis, depletion of ILC in the Rag1 -/- recipients of colitogenic CD4 T cells did not prevent induction of colonic inflammation. Together, our findings demonstrate that IFNγ represents an essential, or a redundant, pro-inflammatory cytokine for the induction of intestinal inflammation, depending on the experimental mouse model used and on the nature of the critical disease inducing immune cell populations involved.

  4. The effects of stress hormones on immune function may be vital for the adaptive reconfiguration of the immune system during fight-or-flight behavior.

    Science.gov (United States)

    Adamo, Shelley A

    2014-09-01

    Intense, short-term stress (i.e., robust activation of the fight-or-flight response) typically produces a transient decline in resistance to disease in animals across phyla. Chemical mediators of the stress response (e.g., stress hormones) help induce this decline, suggesting that this transient immunosuppression is an evolved response. However, determining the function of stress hormones on immune function is difficult because of their complexity. Nevertheless, evidence suggests that stress hormones help maintain maximal resistance to disease during the physiological changes needed to optimize the body for intense physical activity. Work on insects demonstrates that stress hormones both shunt resources away from the immune system during fight-or-flight responses as well as reconfigure the immune system. Reconfiguring the immune system minimizes the impact of the loss of these resources and reduces the increased costs of some immune functions due to the physiological changes demanded by the fight-or-flight response. For example, during the stress response of the cricket Gryllus texensis, some molecular resources are shunted away from the immune system and toward lipid transport, resulting in a reduction in resistance to disease. However, insects' immune cells (hemocytes) have receptors for octopamine (the insect stress neurohormone). Octopamine increases many hemocyte functions, such as phagocytosis, and these changes would tend to mitigate the decline in immunity due to the loss of molecular resources. Moreover, because the stress response generates oxidative stress, some immune responses are probably more costly when activated during a stress response (e.g., those that produce reactive molecules). Some of these immune responses are depressed during stress in crickets, while others, whose costs are probably not increased during a stress response, are enhanced. Some effects of stress hormones on immune systems may be better understood as examples of reconfiguration

  5. MicroRNA regulation of immune events at conception.

    Science.gov (United States)

    Robertson, Sarah A; Zhang, Bihong; Chan, Honyueng; Sharkey, David J; Barry, Simon C; Fullston, Tod; Schjenken, John E

    2017-09-01

    The reproductive tract environment at conception programs the developmental trajectory of the embryo, sets the course of pregnancy, and impacts offspring phenotype and health. Despite the fundamental importance of this stage of reproduction, the rate-limiting regulatory mechanisms operating locally to control fertility and fecundity are incompletely understood. Emerging studies highlight roles for microRNAs (miRNAs) in regulating reproductive and developmental processes and in modulating the quality and strength of the female immune response. Since endometrial receptivity and robust placentation require specific adaptation of the immune response, we hypothesize that miRNAs participate in establishing pregnancy through effects on key gene networks in immune cells. Our recent studies investigated miRNAs that are induced in the peri-conception environment, focusing on miRNAs that have immune-regulatory roles-particularly miR-223, miR-155, and miR-146a. Genetic mouse models deficient in individual miRNAs are proving informative in defining roles for these miRNAs in the generation and stabilization of regulatory T cells (Treg cells) that confer adaptive immune tolerance. Overlapping and redundant functions between miRNAs that target multiple genes, combined with multiple miRNAs targeting individual genes, indicate complex and sensitive regulatory networks. Although to date most data on miRNA regulation of reproductive events are from mice, conserved functions of miRNAs across species imply similar biological pathways operate in all mammals. Understanding the regulation and roles of miRNAs in the peri-conception immune response will advance our knowledge of how environmental determinants act at conception, and could have practical applications for animal breeding as well as human fertility. © 2017 Wiley Periodicals, Inc.

  6. Immune System Dysregulation and Herpesvirus Reactivation Persist During Long-Duration Spaceflight

    Science.gov (United States)

    Crucian, B. E.; Mehta, S.; Stowe, R. P.; Uchakin, P.; Quiriarte, H.; Pierson, D.; Sams, C. F.

    2011-01-01

    This poster presentation reviews a study that is designed to address immune system dysregulation and the risk to crewmembers in long duration exploration class missions. This study will address these objectives: (1) Determine the status of adaptive immunity physiological stress, viral immunity, latent herpesvirus reactivation in astronauts during 6 month missions to the International Space Station; (2) determine the clinical risk related to immune dysregulation for exploration class spaceflight; and (3) determine an appropriate monitoring strategy for spaceflight-associated immune dysfunction that could be used for the evaluation of countermeasures. The study anticipates 17 subjects, and for this presentation, (midpoint study data) 10 subjects are reviewed.

  7. Phospholipase C-β in immune cells.

    Science.gov (United States)

    Kawakami, Toshiaki; Xiao, Wenbin

    2013-09-01

    Great progress has recently been made in structural and functional research of phospholipase C (PLC)-β. We now understand how PLC-β isoforms (β1-β4) are activated by GTP-bound Gαq downstream of G protein-coupled receptors. Numerous studies indicate that PLC-βs participate in the differentiation and activation of immune cells that control both the innate and adaptive immune systems. The PLC-β3 isoform also interplays with tyrosine kinase-based signaling pathways, to inhibit Stat5 activation by recruiting the protein-tyrosine phosphatase SHP-1, with which PLC-β3 and Stat5 form a multi-molecular signaling platform, named SPS complex. The SPS complex has important regulatory roles in tumorigenesis and immune cell activation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Codevelopment of Microbiota and Innate Immunity and the Risk for Group B Streptococcal Disease

    Directory of Open Access Journals (Sweden)

    Julia Kolter

    2017-11-01

    Full Text Available The pathogenesis of neonatal late-onset sepsis (LOD, which manifests between the third day and the third month of life, remains poorly understood. Group B Streptococcus (GBS is the most important cause of LOD in infants without underlying diseases or prematurity and the third most frequent cause of meningitis in the Western world. On the other hand, GBS is a common intestinal colonizer in infants. Accordingly, despite its adaption to the human lower gastrointestinal tract, GBS has retained its potential virulence and its transition from a commensal to a dangerous pathogen is unpredictable in the individual. Several cellular innate immune mechanisms, in particular Toll-like receptors, the inflammasome and the cGAS pathway, are engaged by GBS effectors like nucleic acids. These are likely to impact on the GBS-specific host resistance. Given the long evolution of streptococci as a normal constituent of the human microbiota, the emergence of GBS as the dominant neonatal sepsis cause just about 50 years ago is remarkable. It appears that intensive usage of tetracycline starting in the 1940s has been a selection advantage for the currently dominant GBS clones with superior adhesive and invasive properties. The historical replacement of Group A by Group B streptococci as a leading neonatal pathogen and the higher frequency of other β-hemolytic streptococci in areas with low GBS prevalence suggests the existence of a confined streptococcal niche, where locally competing streptococcal species are subject to environmental and immunological selection pressure. Thus, it seems pivotal to resolve neonatal innate immunity at mucous surfaces and its impact on microbiome composition and quality, i.e., genetic heterogeneity and metabolism, at the microanatomical level. Then, designer pro- and prebiotics, such as attenuated strains of GBS, and oligonucleotide priming of mucosal immunity may unfold their potential and facilitate adaptation of potentially

  9. Codevelopment of Microbiota and Innate Immunity and the Risk for Group B Streptococcal Disease.

    Science.gov (United States)

    Kolter, Julia; Henneke, Philipp

    2017-01-01

    The pathogenesis of neonatal late-onset sepsis (LOD), which manifests between the third day and the third month of life, remains poorly understood. Group B Streptococcus (GBS) is the most important cause of LOD in infants without underlying diseases or prematurity and the third most frequent cause of meningitis in the Western world. On the other hand, GBS is a common intestinal colonizer in infants. Accordingly, despite its adaption to the human lower gastrointestinal tract, GBS has retained its potential virulence and its transition from a commensal to a dangerous pathogen is unpredictable in the individual. Several cellular innate immune mechanisms, in particular Toll-like receptors, the inflammasome and the cGAS pathway, are engaged by GBS effectors like nucleic acids. These are likely to impact on the GBS-specific host resistance. Given the long evolution of streptococci as a normal constituent of the human microbiota, the emergence of GBS as the dominant neonatal sepsis cause just about 50 years ago is remarkable. It appears that intensive usage of tetracycline starting in the 1940s has been a selection advantage for the currently dominant GBS clones with superior adhesive and invasive properties. The historical replacement of Group A by Group B streptococci as a leading neonatal pathogen and the higher frequency of other β-hemolytic streptococci in areas with low GBS prevalence suggests the existence of a confined streptococcal niche, where locally competing streptococcal species are subject to environmental and immunological selection pressure. Thus, it seems pivotal to resolve neonatal innate immunity at mucous surfaces and its impact on microbiome composition and quality, i.e., genetic heterogeneity and metabolism, at the microanatomical level. Then, designer pro- and prebiotics, such as attenuated strains of GBS, and oligonucleotide priming of mucosal immunity may unfold their potential and facilitate adaptation of potentially hazardous streptococci as

  10. Characterization of host immune responses in Ebola virus infections.

    Science.gov (United States)

    Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo

    2014-06-01

    Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.

  11. Innate immune system and preeclampsia

    Directory of Open Access Journals (Sweden)

    Alejandra ePerez-Sepulveda

    2014-05-01

    Full Text Available Normal pregnancy is considered as a Th2 type immunological state that favors an immune-tolerance environment in order to prevent fetal rejection. PE has been classically described as a Th1/Th2 imbalance; however, the Th1/Th2 paradigm has proven insufficient to fully explain the functional and molecular changes observed during normal/pathological pregnancies. Recent studies have expanded the Th1/Th2 into a Th1⁄Th2⁄Th17 and regulatory T (Treg cells paradigm and where dendritic cells could have a crucial role. Recently, some evidence has emerged supporting the idea that mesenchymal stem cells might be part of the feto-maternal tolerance environment. This review will discuss the involvement of the innate immune system in the establishment of a physiological environment that favors pregnancy and possible alterations related to the development of preeclampsia.

  12. Modulation of Immune Functions by Foods

    Directory of Open Access Journals (Sweden)

    Shuichi Kaminogawa

    2004-01-01

    Full Text Available Evidence is rapidly accumulating as to the beneficial effects of foods. However, it is not always clear whether the information is based on data evaluated impartially in a scientific fashion. Human research into whether foods modulate immune functions in either intervention studies or randomized controlled trials can be classified into three categories according to the physical state of subjects enrolled for investigation: (i studies examining the effect of foods in healthy individuals; (ii studies analyzing the effect of foods on patients with hypersensitivity; and (iii studies checking the effect of foods on immunocompromized subjects, including patients who had undergone surgical resection of cancer and newborns. The systematization of reported studies has made it reasonable to conclude that foods are able to modulate immune functions manifesting as either innate immunity (phagocytic activity, NK cell activity or acquired immunity (T cell response, antibody production. Moreover, improvement of immune functions by foods can normalize the physical state of allergic patients or cancer patients, and may reduce the risk of diseases in healthy individuals. Therefore, it is valuable to assess the immune-modulating abilities of foods by measuring at least one parameter of either innate or acquired immunity.

  13. Anthrax Lethal Toxin Impairs Innate Immune Functions of Alveolar Macrophages and Facilitates Bacillus anthracis Survival

    National Research Council Canada - National Science Library

    Ribot, Wilson J; Panchal, Rekha G; Brittingham, Katherine C; Ruthel, Gordon; Kenny, Tara A; Lane, Douglas; Curry, Bob; Hoover, Timothy A; Friedlander, Arthur M; Bavari, Sina

    2006-01-01

    Alveolar macrophages (AM) are very important for pulmonary innate immune responses against invading inhaled pathogens because they directly kill the organisms and initiate a cascade of innate and adaptive immune responses...

  14. Psychological Stress and the Human Immune System: A Meta-Analytic Study of 30 Years of Inquiry

    OpenAIRE

    Segerstrom, Suzanne C.; Miller, Gregory E.

    2004-01-01

    The present report meta-analyzes more than 300 empirical articles describing a relationship between psychological stress and parameters of the immune system in human participants. Acute stressors (lasting minutes) were associated with potentially adaptive upregulation of some parameters of natural immunity and downregulation of some functions of specific immunity. Brief naturalistic stressors (such as exams) tended to suppress cellular immunity while preserving humoral immunity. Chronic stres...

  15. Focusing on Ciona intestinalis (Tunicata) innate immune system. Evolutionary implications

    OpenAIRE

    N Parrinello

    2009-01-01

    Phylogenetic analyses based on molecular data provide compelling evidence that ascidians are of critical importance for studying chordate immune system evolution. The Ciona intestinalis draft genome sequence allows searches for phylogenetic relationships, gene cloning and expression of immunorelevant molecules. Acidians lack of the pivotal components of the vertebrate recombinatory adaptive immunity, i.e., MHC, TCRs and dimeric immunoglobulins. However, bioinformatic sequence analyses recogni...

  16. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  17. Role of the immune system in cardiac tissue damage and repair following myocardial infarction.

    Science.gov (United States)

    Saparov, Arman; Ogay, Vyacheslav; Nurgozhin, Talgat; Chen, William C W; Mansurov, Nurlan; Issabekova, Assel; Zhakupova, Jamilya

    2017-09-01

    The immune system plays a crucial role in the initiation, development, and resolution of inflammation following myocardial infarction (MI). The lack of oxygen and nutrients causes the death of cardiomyocytes and leads to the exposure of danger-associated molecular patterns that are recognized by the immune system to initiate inflammation. At the initial stage of post-MI inflammation, the immune system further damages cardiac tissue to clear cell debris. The excessive production of reactive oxygen species (ROS) by immune cells and the inability of the anti-oxidant system to neutralize ROS cause oxidative stress that further aggravates inflammation. On the other hand, the cells of both innate and adaptive immune system and their secreted factors are critically instrumental in the very dynamic and complex processes of regulating inflammation and mediating cardiac repair. It is important to decipher the balance between detrimental and beneficial effects of the immune system in MI. This enables us to identify better therapeutic targets for reducing the infarct size, sustaining the cardiac function, and minimizing the likelihood of heart failure. This review discusses the role of both innate and adaptive immune systems in cardiac tissue damage and repair in experimental models of MI.

  18. Immune Response to Dengue and Zika.

    Science.gov (United States)

    Ngono, Annie Elong; Shresta, Sujan

    2018-04-26

    Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.

  19. Adaptive Immune Responses in a Multiple Sclerosis Patient with Acute Varicella-Zoster Virus Reactivation during Treatment with Fingolimod

    Directory of Open Access Journals (Sweden)

    Andrea Harrer

    2015-09-01

    Full Text Available Fingolimod, an oral sphingosine 1-phosphate (S1P receptor modulator, is approved for the treatment of relapsing forms of multiple sclerosis (MS. The interference with S1P signaling leads to retention particularly of chemokine receptor-7 (CCR7 expressing T cells in lymph nodes. The immunological basis of varicella zoster virus (VZV infections during fingolimod treatment is unclear. Here, we studied the dynamics of systemic and intrathecal immune responses associated with symptomatic VZV reactivation including cessation of fingolimod and initiation of antiviral therapy. Key features in peripheral blood were an about two-fold increase of VZV-specific IgG at diagnosis of VZV reactivation as compared to the previous months, a relative enrichment of effector CD4+ T cells (36% versus mean 12% in controls, and an accelerated reconstitution of absolute lymphocytes counts including a normalized CD4+/CD8+ ratio and reappearance of CCR7+ T cells. In cerebrospinal fluid (CSF the lymphocytic pleocytosis and CD4+/CD8+ ratios at diagnosis of reactivation and after nine days of fingolimod discontinuation remained unchanged. During this time CCR7+ T cells were not observed in CSF. Further research into fingolimod-associated VZV reactivation and immune reconstitution is mandatory to prevent morbidity and mortality associated with this potentially life-threatening condition.

  20. Distinctive cellular immunity in genetically susceptible BALB/c mice recovered from Leishmania major infection or after subcutaneous immunization with killed parasites

    International Nuclear Information System (INIS)

    Liew, F.Y.; Dhaliwal, J.S.

    1987-01-01

    Genetically susceptible BALB/c mice are refractory to further infection after recovery from Leishmania major infection after a sublethal dose of gamma-irradiation. In contrast, mice immunized with killed promastigotes s.c. develop exacerbated lesions after infection. Both groups of mice produce only a low level of specific antibody and no detectable cytotoxic T cells, but do have a strong antigen-specific DTH, which is adoptively transferable with Lyt-1+2-, L3T4+ T cells. Kinetic and histological studies revealed that mice immunized s.c. developed Jones-Mote hypersensitivity, peaking at 15 hr. with little mononuclear cell infiltration at the site of antigen administration; whereas mice that had recovered from infection developed tuberculin-type of reactivity, peaking at 24 to 48 hr, with intense mononuclear cell infiltration. Splenic T cells from recovered mice, when injected into the footpads of normal recipients together with live promastigotes, were able to retard lesion development; whereas T cells from s.c. immunized mice, when similarly transferred, accelerated disease progression. Antigen-specific culture supernatant of spleen cells from recovered mice also activated normal resident peritoneal macrophages to kill intracellular L. major amastigotes and tumor cells. Culture supernatants of spleen cells from s.c. immunized or normal mice were devoid of such activities. Part of the macrophage-activating potential can be inhibited by antibody specific for IFN-gamma. These results therefore demonstrate that whereas the Jones-Mote reaction is correlated with disease exacerbation, the tuberculin-type of DTH may be protective. Furthermore, in vivo immunity is directly related to the capacity of T cells to produce macrophage-activating factor

  1. Impaired B cell immunity in acute myeloid leukemia patients after chemotherapy.

    Science.gov (United States)

    Goswami, Meghali; Prince, Gabrielle; Biancotto, Angelique; Moir, Susan; Kardava, Lela; Santich, Brian H; Cheung, Foo; Kotliarov, Yuri; Chen, Jinguo; Shi, Rongye; Zhou, Huizhi; Golding, Hana; Manischewitz, Jody; King, Lisa; Kunz, Lauren M; Noonan, Kimberly; Borrello, Ivan M; Smith, B Douglas; Hourigan, Christopher S

    2017-07-10

    Changes in adaptive immune cells after chemotherapy in adult acute myeloid leukemia (AML) may have implications for the success of immunotherapy. This study was designed to determine the functional capacity of the immune system in adult patients with AML who have completed chemotherapy and are potential candidates for immunotherapy. We used the response to seasonal influenza vaccination as a surrogate for the robustness of the immune system in 10 AML patients in a complete remission post-chemotherapy and performed genetic, phenotypic, and functional characterization of adaptive immune cell subsets. Only 2 patients generated protective titers in response to vaccination, and a majority of patients had abnormal frequencies of transitional and memory B-cells. B-cell receptor sequencing showed a B-cell repertoire with little evidence of somatic hypermutation in most patients. Conversely, frequencies of T-cell populations were similar to those seen in healthy controls, and cytotoxic T-cells demonstrated antigen-specific activity after vaccination. Effector T-cells had increased PD-1 expression in AML patients least removed from chemotherapy. Our results suggest that while some aspects of cellular immunity recover quickly, humoral immunity is incompletely reconstituted in the year following intensive cytotoxic chemotherapy for AML. The observed B-cell abnormalities may explain the poor response to vaccination often seen in AML patients after chemotherapy. Furthermore, the uncoupled recovery of B-cell and T-cell immunity and increased PD-1 expression shortly after chemotherapy might have implications for the success of several modalities of immunotherapy.

  2. Three-Dimensional Normal Human Neural Progenitor Tissue-Like Assemblies: A Model for Persistent Varicell-Zoster Virus Infection and Platform to Study Viral Infectivity and Oxidative Stress and Damage

    Science.gov (United States)

    Goodwin, T. J.; McCarthy, M.; Osterrieder, N.; Cohrs, R. J.; Kaufer, B. B.

    2014-01-01

    The environment of space results in a multitude of challenges to the human physiology that present barriers to extended habitation and exploration. Over 40 years of investigation to define countermeasures to address space flight adaptation has left gaps in our knowledge regarding mitigation strategies partly due to the lack of investigative tools, monitoring strategies, and real time diagnostics to understand the central causative agent(s) responsible for physiologic adaptation and maintaining homeostasis. Spaceflight-adaptation syndrome is the combination of space environmental conditions and the synergistic reaction of the human physiology. Our work addresses the role of oxidative stress and damage (OSaD) as a negative and contributing Risk Factor (RF) in the following areas of combined spaceflight related dysregulation: i) radiation induced cellular damage [1], [2] ii) immune impacts and the inflammatory response [3], [4] and iii) varicella zoster virus (VZV) reactivation [5]. Varicella-zoster (VZV)/Chicken Pox virus is a neurotropic human alphaherpesvirus resulting in varicella upon primary infection, suppressed by the immune system becomes latent in ganglionic neurons, and reactivates under stress events to re-express in zoster and possibly shingles. Our laboratory has developed a complex threedimensional (3D) normal human neural tissue model that emulates several characteristics of the human trigeminal ganglia (TG) and allows the study of combinatorial experimentation which addresses, simultaneously, OSaD associated with Spaceflight adaptation and habitation [6].

  3. Immune system development during early childhood in tropical Latin America: evidence for the age-dependent down regulation of the innate immune response.

    Science.gov (United States)

    Teran, Rommy; Mitre, Edward; Vaca, Maritza; Erazo, Silvia; Oviedo, Gisela; Hübner, Marc P; Chico, Martha E; Mattapallil, Joseph J; Bickle, Quentin; Rodrigues, Laura C; Cooper, Philip J

    2011-03-01

    The immune response that develops in early childhood underlies the development of inflammatory diseases such as asthma and there are few data from tropical Latin America (LA). This study investigated the effects of age on the development of immunity during the first 5 years of life by comparing innate and adaptive immune responses in Ecuadorian children aged 6-9 months, 22-26 months, and 48-60 months. Percentages of naïve CD4+ T cells declined with age while those of memory CD4(+) and CD8(+) T cells increased indicating active development of the immune system throughout the first five years. Young infants had greater innate immune responses to TLR agonists compared to older children while regulatory responses including SEB-induced IL-10 and percentages of FoxP3(+) T-regulatory cells decreased with age. Enhanced innate immunity in early life may be important for host defense against pathogens but may increase the risk of immunopathology. Copyright © 2010 Elsevier Inc. All rights reserved.

  4. The role of radiotherapy for the induction of antitumor immune responses

    International Nuclear Information System (INIS)

    Multhoff, G.; Helmholtz-Zentrum Muenchen; Gaipl, U.S.; Niedermann, G.

    2012-01-01

    Effective radiotherapy is aimed to control the growth of the primary carcinoma and to induce a long-term specific antitumor immune response against the primary tumor, recurrence and metastases. The contribution covers the following issues: T cells and tumor specific immune responses, dendritic cells (DCs) start adaptive immune responses, NK (natural killer) cells for HLA independent tumor control, abscopal effects of radiotherapy, combination of radiotherapy and immune therapy, radiotherapy contribution to the induction of immunogenic cell death, combinability of radiotherapy and DC activation, combinability of radiotherapy and NK cell therapy. It turns out that the combination of radio-chemotherapy and immune therapy can change the microenvironment initiating antitumor immune reactions that inhibit the recurrence risk and the development of metastases.

  5. Is immune system-related hypertension associated with ovarian hormone deficiency?

    Science.gov (United States)

    Sandberg, Kathryn; Ji, Hong; Einstein, Gillian; Au, April; Hay, Meredith

    2016-03-01

    What is the topic of this review? This review summarizes recent data on the role of ovarian hormones and sex in inflammation-related hypertension. What advances does it highlight? The adaptive immune system has recently been implicated in the development of hypertension in males but not in females. The role of the immune system in the development of hypertension in women and its relationship to ovarian hormone production are highlighted. The immune system is known to contribute to the development of high blood pressure in males. However, the role of the immune system in the development of high blood pressure in females and the role of ovarian hormones has only recently begun to be studied. In animal studies, both the sex of the host and the T cell are critical biological determinants of susceptibility and resistance to hypertension induced by angiotensin II. In women, natural menopause is known to result in significant changes in the expression of genes regulating the immune system. Likewise, in animal models, ovariectomy results in hypertension and an upregulation in T-cell tumour necrosis factor-α-related genes. Oestrogen replacement results in decreases in inflammatory genes in the brain regions involved in blood pressure regulation. Together, these studies suggest that the response of the adaptive immune system to ovarian hormone deficiency is a significant contributor to hypertension in women. © 2015 The Authors. Experimental Physiology © 2015 The Physiological Society.

  6. The nature of immune responses to urinary tract infections

    Science.gov (United States)

    Abraham, Soman N.; Miao, Yuxuan

    2016-01-01

    The urinary tract is constantly exposed to microorganisms that inhabit the gastrointestinal tract, but generally the urinary tract resists infection by gut microorganisms. This resistance to infection is mainly ascribed to the versatility of the innate immune defences in the urinary tract as the adaptive immune responses are limited, particularly when only the lower urinary tract is infected. In recent years, as the strengths and weaknesses of the immune system of the urinary tract have emerged and as the virulence attributes of uropathogens are recognized, several potentially effective and unconventional strategies to contain or prevent urinary tract infections have emerged. PMID:26388331

  7. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  8. Athletes and the Aorta: Normal Adaptations and the Diagnosis and Management of Pathology.

    Science.gov (United States)

    Stephen Hedley, J; Phelan, Dermot

    2017-10-09

    Over a hundred years ago, physicians first recognized that participation in regular, vigorous training resulted in enlargement of the heart. Since that time, the term "athlete's heart" has entered the medical lexicon as a global expression encompassing the electrical, functional, and morphological adaptations that develop in response to physical training. Exercise-induced adaptations of the aorta, which is also exposed to large hemodynamic stresses during prolonged endurance exercise or resistance training, are less well recognized. Young athletes tend to have slightly larger aortas than their sedentary counterparts; however, this rarely exceeds normal ranges for the general population. A systematic approach is advised when presented with an athlete with aortic enlargement. The size of the aorta needs to be first put in the context of the athlete's age, sex, size, and sporting endeavors; however, even in the largest young athletes, the aortic root rarely exceeds 4 cm in men or 3.4 cm in women. A comprehensive evaluation is advised which includes a detailed family history and a thorough physical examination evaluating for signs of any defined connective tissue disorder associated with aortopathy. Downstream testing is then tailored for the individual and may include further tomographic imaging, opthalmology review, and genetic testing. This should ideally be performed at a specialist center. Management of athletes with an aortopathy includes tailoring athletic activity, medical management with strict impulse control, and, in some cases, prophylactic surgery. The issue of sporting eligibility should be individualized and if disqualification is necessary, this should be undertaken by a sports cardiologist or an expert in aortic disease with experience in dealing with an athletic population.

  9. The Neonatal Window of Opportunity: Setting the Stage for Life-Long Host-Microbial Interaction and Immune Homeostasis.

    Science.gov (United States)

    Torow, Natalia; Hornef, Mathias W

    2017-01-15

    The existence of a neonatal window was first highlighted by epidemiological studies that revealed the particular importance of this early time in life for the susceptibility to immune-mediated diseases in humans. Recently, the first animal studies emerged that present examples of early-life exposure-triggered persisting immune events, allowing a detailed analysis of the factors that define this particular time period. The enteric microbiota and the innate and adaptive immune system represent prime candidates that impact on the pathogenesis of immune-mediated diseases and are known to reach a lasting homeostatic equilibrium following a dynamic priming period after birth. In this review, we outline the postnatal establishment of the microbiota and maturation of the innate and adaptive immune system and discuss examples of early-life exposure-triggered immune-mediated diseases that start to shed light on the critical importance of the early postnatal period for life-long immune homeostasis. Copyright © 2017 by The American Association of Immunologists, Inc.

  10. Beyond the reproductive effect of sex steroids: their role during immunity to helminth parasite infections.

    Science.gov (United States)

    Hernández-Bello, R; Nava-Castro, K; Muñiz-Hernández, S; Nava-Luna, P; Trejo-Sánchez, Itztli; Tiempos-Guzmán, N; Mendoza-Rodríguez, Y; Morales-Montor, J

    2012-10-01

    During the helminth infections, the immune system tends to be modulated by host's sex hormones. Actually, many studies show the reciprocal relationship between sex steroids, the immune system and the elimination or establishment of helminth parasites. Is well known that innate immune response determines the type of adaptive immune response, so the effects in the innate immune response by hormones may affect subsequent adaptive immunity. The sex steroids as estrogens, progesterone and testosterone regulate growth, differentiation, survival and function of many cell types that could be involved in process like homeostasis and immunity, but also have a direct effect on the helminthes, that may probably be mediated by specific receptors on these parasites. Sex steroids, parasites and immunity are closely connected, and their interconnection is involved in the maintenance of elimination or establishment of helminthes in an immunocompetent host. For that reason, understanding the action's mechanisms of sex steroids on immune cells and its direct effect on helminth parasites is important for further progress in the development of novel therapies for chronic helminth diseases associated to immune dysregulation. In this review, we will describe the effects of sex steroids on the immune response during helminth infections as well as the direct effect in these parasites, and the possible implications of these effects on the incidence of several helminth infections.

  11. Functional demonstration of adaptive immunity in zebrafish using DNA vaccination

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    Due to the well characterized genome, overall highly synteny with the human genome and its suitability for functional genomics studies, the zebrafish is considered to be an ideal animal model for basic studies of mechanisms of diseases and immunity in vertebrates including humans. While several s...

  12. Molecular Interactions of Autophagy with the Immune System and Cancer

    Directory of Open Access Journals (Sweden)

    Yunho Jin

    2017-08-01

    Full Text Available Autophagy is a highly conserved catabolic mechanism that mediates the degradation of damaged cellular components by inducing their fusion with lysosomes. This process provides cells with an alternative source of energy for the synthesis of new proteins and the maintenance of metabolic homeostasis in stressful environments. Autophagy protects against cancer by mediating both innate and adaptive immune responses. Innate immune receptors and lymphocytes (T and B are modulated by autophagy, which represent innate and adaptive immune responses, respectively. Numerous studies have demonstrated beneficial roles for autophagy induction as well as its suppression of cancer cells. Autophagy may induce either survival or death depending on the cell/tissue type. Radiation therapy is commonly used to treat cancer by inducing autophagy in human cancer cell lines. Additionally, melatonin appears to affect cancer cell death by regulating programmed cell death. In this review, we summarize the current understanding of autophagy and its regulation in cancer.

  13. Enhancing Artificial Bee Colony Algorithm with Self-Adaptive Searching Strategy and Artificial Immune Network Operators for Global Optimization

    Directory of Open Access Journals (Sweden)

    Tinggui Chen

    2014-01-01

    Full Text Available Artificial bee colony (ABC algorithm, inspired by the intelligent foraging behavior of honey bees, was proposed by Karaboga. It has been shown to be superior to some conventional intelligent algorithms such as genetic algorithm (GA, artificial colony optimization (ACO, and particle swarm optimization (PSO. However, the ABC still has some limitations. For example, ABC can easily get trapped in the local optimum when handing in functions that have a narrow curving valley, a high eccentric ellipse, or complex multimodal functions. As a result, we proposed an enhanced ABC algorithm called EABC by introducing self-adaptive searching strategy and artificial immune network operators to improve the exploitation and exploration. The simulation results tested on a suite of unimodal or multimodal benchmark functions illustrate that the EABC algorithm outperforms ACO, PSO, and the basic ABC in most of the experiments.

  14. Gel-Trapped Lymphorganogenic Chemokines Trigger Artificial Tertiary Lymphoid Organs and Mount Adaptive Immune Responses In Vivo.

    Science.gov (United States)

    Kobayashi, Yuka; Watanabe, Takeshi

    2016-01-01

    We previously generated artificial lymph node-like tertiary lymphoid organs (artTLOs) in mice using lymphotoxin α-expressing stromal cells. Here, we show the construction of transplantable and functional artTLOs by applying soluble factors trapped in slow-releasing gels in the absence of lymphoid tissue organizer stromal cells. The resultant artTLOs were easily removable, transplantable, and were capable of attracting memory B and T cells. Importantly, artTLOs induced a powerful antigen-specific secondary immune response, which was particularly pronounced in immune-compromised hosts. Synthesis of functionally stable immune tissues/organs like those described here may be a first step to eventually develop immune system-based therapeutics. Although much needs to be learned from the precise mechanisms of action, they may offer ways in the future to reestablish immune functions to overcome hitherto untreatable diseases, including severe infection, cancer, autoimmune diseases, and various forms of immune deficiencies, including immune-senescence during aging.

  15. Gel-trapped lymphorganogenic chemokines trigger artificial tertiary lymphoid organs and mount adaptive immune responses in vivo

    Directory of Open Access Journals (Sweden)

    Takeshi Watanabe

    2016-08-01

    Full Text Available We previously generated artificial lymph node-like tertiary lymphoid organs (artTLOs in mice using lymphotoxin α-expressing stromal cells. Here, we show the construction of transplantable and functional artTLOs by applying soluble factors trapped in slow-releasing gels in the absence of lymphoid tissue organizer- (LTo stromal cells. The resultant artTLOs were easily removable, transplantable, and were capable of attracting memory B and T cells. Importantly, artTLOs induced a powerful antigen-specific secondary immune response, which was particularly pronounced in immune-compromised hosts. Synthesis of functionally stable immune tissues/organs like those described here may be a first step to eventually develop immune system-based therapeutics. Although much needs to be learned from the precise mechanisms of action, they may offer ways in the future to reestablish immune functions to overcome hitherto untreatable diseases including severe infection, cancer, autoimmune diseases, and various forms of immune deficiencies including immune-senescence during aging.

  16. Mitogen-stimulated phospholipid synthesis in normal and immune-deficient human B cells

    International Nuclear Information System (INIS)

    Chien, M.M.; Yokoyama, W.M.; Ashman, R.F.

    1986-01-01

    Eight patients with common variable panhypogammaglobulinemia were shown in the in vitro Ig biosynthesis assay to have defective B cell responses to pokeweed mitogen (PWM). Phospholipid synthesis was assessed in the B cell plus monocyte fraction (MB) and irradiated T cells (T*) of patients and paired normal controls. Cell populations were studied separately and in the four possible combinations (1:1), with and without PWM, to reveal the effect of cell interactions. At 16 to 20 hr the mean stimulation index (SI) +/- standard error for MB cells alone was 1.01 +/- 0.02 for eight patients and 0.99 +/- 0.02 for the paired normals; the T* cell SI was 1.25 +/- 0.04 for patients and 1.28 +/- 0.05 for normals. Combinations of normal MB cells with normal T* cells showed significantly higher SI when compared with the combinations of normal MB cells with patient T* cells (p less than 0.005). However, the combination of patient MB cells with patient T* cells and the combination of patient MB cells with normal T* cells were not significantly different in SI (0.05 less than p less than 0.1). Isolation of patient and normal B cells, T* cells, and monocytes after the choline pulse showed that patient B cells gave a higher SI with normal T* help than with patient T* help. Of greatest interest is the finding that patient B cells that were defective in PWM-stimulated Ig production nevertheless showed a phospholipid synthesis response to PWM in the normal range, suggesting that the maturation defect in these B cells occurs later than the phospholipid synthesis acceleration step, or on a different pathway

  17. Regulation of TGFβ in the immune system: An emerging role for integrins and dendritic cells

    OpenAIRE

    Worthington, John J.; Fenton, Thomas M.; Czajkowska, Beata I.; Klementowicz, Joanna E.; Travis, Mark A.

    2012-01-01

    Regulation of an immune response requires complex crosstalk between cells of the innate and adaptive immune systems, via both cell?cell contact and secretion of cytokines. An important cytokine with a broad regulatory role in the immune system is transforming growth factor-? (TGF-?). TGF-? is produced by and has effects on many different cells of the immune system, and plays fundamental roles in the regulation of immune responses during homeostasis, infection and disease. Although many cells ...

  18. Diffuse endocrine system, neuroendocrine tumors and immunity: what's new?

    Science.gov (United States)

    Ameri, Pietro; Ferone, Diego

    2012-01-01

    During the last two decades, research into the modulation of immunity by the neuroendocrine system has flourished, unravelling significant effects of several neuropeptides, including somatostatin (SRIH), and especially cortistatin (CST), on immune cells. Scientists have learnt that the diffuse neuroendocrine system can regulate the immune system at all its levels: innate immunity, adaptive immunity, and maintenance of immune tolerance. Compelling studies with animal models have demonstrated that some neuropeptides may be effective in treating inflammatory disorders, such as sepsis, and T helper 1-driven autoimmune diseases, like Crohn's disease and rheumatoid arthritis. Here, the latest findings concerning the neuroendocrine control of the immune system are discussed, with emphasis on SRIH and CST. The second part of the review deals with the immune response to neuroendocrine tumors (NETs). The anti-NET immune response has been described in the last years and it is still being characterized, similarly to what is happening for several other types of cancer. In parallel with investigations addressing the mechanisms by which the immune system contrasts NET growth and spreading, ground-breaking clinical trials of dendritic cell vaccination as immunotherapy for metastatic NETs have shown in principle that the immune reaction to NETs can be exploited for treatment. Copyright © 2012 S. Karger AG, Basel.

  19. Regulation of T cell immunity in atopic dermatitis by microbes: The Yin and Yang of cutaneous inflammation

    Directory of Open Access Journals (Sweden)

    Tilo eBiedermann

    2015-07-01

    Full Text Available Atopic dermatitis (AD is a chronic inflammatory skin disease predominantly mediated by T helper cells. While numerous adaptive immune mechanisms in AD pathophysiology have been elucidated in detail, deciphering the impact of innate immunity in AD pathogenesis has made substantial progress in recent years and is currently a fast evolving field. As innate and adaptive immunity are intimately linked cross-talks between these two branches of the immune system are critically influencing the resulting immune response and disease. Innate immune recognition of the cutaneous microbiota was identified to substantially contribute to immune homeostasis and shaping of protective adaptive immunity in the absence of inflammation. Disturbances in the composition of the skin microbiome with reduced microbial diversity and overabundance of Staphylococcus spp. have been shown to be associated with AD inflammation. Distinct S. aureus associated microbial associated molecular patterns (MAMPs binding to TLR2 heterodimers could be identified to initiate long lasting cutaneous inflammation driven by T helper cells and consecutively local immune suppression by induction of myeloid derived suppressor cells (MDSC further favoring secondary skin infections as often seen in AD patients. Moreover dissecting cellular and molecular mechanisms in cutaneous innate immune sensing in AD pathogenesis paved the way for exploiting regulatory and anti-inflammatory pathways to attenuate skin inflammation. Activation of the innate immune system by MAMPs of non-pathogenic bacteria on AD skin alleviated cutaneous inflammation. The induction of tolerogenic dendritic cells, Interleukin-10 expression and regulatory Tr1 cells were shown to mediate this beneficial effect. Thus, activation of innate immunity by MAMPs of non-pathogenic bacteria for induction of regulatory T cell phenotypes seems to be a promising strategy for treatment of inflammatory skin disorders as atopic dermatitis. These

  20. Impacts of Low Temperature on the Teleost Immune System

    Directory of Open Access Journals (Sweden)

    Quinn H. Abram

    2017-11-01

    Full Text Available As poikilothermic vertebrates, fish can experience changes in water temperature, and hence body temperature, as a result of seasonal changes, migration, or efflux of large quantities of effluent into a body of water. Temperature shifts outside of the optimal temperature range for an individual fish species can have negative impacts on the physiology of the animal, including the immune system. As a result, acute or chronic exposure to suboptimal temperatures can impair an organisms’ ability to defend against pathogens and thus compromise the overall health of the animal. This review focuses on the advances made towards understanding the impacts of suboptimal temperature on the soluble and cellular mediators of the innate and adaptive immune systems of fishes. Although cold stress can result in varying effects in different fish species, acute and chronic suboptimal temperature exposure generally yield suppressive effects, particularly on adaptive immunity. Knowledge of the effects of environmental temperature on fish species is critical for both the optimal management of wild species and the best management practices for aquaculture species.

  1. Viruses are a dominant driver of protein adaptation in mammals.

    Science.gov (United States)

    Enard, David; Cai, Le; Gwennap, Carina; Petrov, Dmitri A

    2016-05-17

    Viruses interact with hundreds to thousands of proteins in mammals, yet adaptation against viruses has only been studied in a few proteins specialized in antiviral defense. Whether adaptation to viruses typically involves only specialized antiviral proteins or affects a broad array of virus-interacting proteins is unknown. Here, we analyze adaptation in ~1300 virus-interacting proteins manually curated from a set of 9900 proteins conserved in all sequenced mammalian genomes. We show that viruses (i) use the more evolutionarily constrained proteins within the cellular functions they interact with and that (ii) despite this high constraint, virus-interacting proteins account for a high proportion of all protein adaptation in humans and other mammals. Adaptation is elevated in virus-interacting proteins across all functional categories, including both immune and non-immune functions. We conservatively estimate that viruses have driven close to 30% of all adaptive amino acid changes in the part of the human proteome conserved within mammals. Our results suggest that viruses are one of the most dominant drivers of evolutionary change across mammalian and human proteomes.

  2. Genome-wide analysis of differential transcriptional and epigenetic variability across human immune cell types

    DEFF Research Database (Denmark)

    Ecker, Simone; Chen, Lu; Pancaldi, Vera

    2017-01-01

    Background: A healthy immune system requires immune cells that adapt rapidly to environmental challenges. This phenotypic plasticity can be mediated by transcriptional and epigenetic variability. Results: We apply a novel analytical approach to measure and compare transcriptional and epigenetic v...

  3. A feasibility study in adapting Shamos Bickel and Hodges Lehman estimator into T-Method for normalization

    Science.gov (United States)

    Harudin, N.; Jamaludin, K. R.; Muhtazaruddin, M. Nabil; Ramlie, F.; Muhamad, Wan Zuki Azman Wan

    2018-03-01

    T-Method is one of the techniques governed under Mahalanobis Taguchi System that developed specifically for multivariate data predictions. Prediction using T-Method is always possible even with very limited sample size. The user of T-Method required to clearly understanding the population data trend since this method is not considering the effect of outliers within it. Outliers may cause apparent non-normality and the entire classical methods breakdown. There exist robust parameter estimate that provide satisfactory results when the data contain outliers, as well as when the data are free of them. The robust parameter estimates of location and scale measure called Shamos Bickel (SB) and Hodges Lehman (HL) which are used as a comparable method to calculate the mean and standard deviation of classical statistic is part of it. Embedding these into T-Method normalize stage feasibly help in enhancing the accuracy of the T-Method as well as analysing the robustness of T-method itself. However, the result of higher sample size case study shows that T-method is having lowest average error percentages (3.09%) on data with extreme outliers. HL and SB is having lowest error percentages (4.67%) for data without extreme outliers with minimum error differences compared to T-Method. The error percentages prediction trend is vice versa for lower sample size case study. The result shows that with minimum sample size, which outliers always be at low risk, T-Method is much better on that, while higher sample size with extreme outliers, T-Method as well show better prediction compared to others. For the case studies conducted in this research, it shows that normalization of T-Method is showing satisfactory results and it is not feasible to adapt HL and SB or normal mean and standard deviation into it since it’s only provide minimum effect of percentages errors. Normalization using T-method is still considered having lower risk towards outlier’s effect.

  4. Acne: a new model of immune-mediated chronic inflammatory skin disease.

    Science.gov (United States)

    Antiga, E; Verdelli, A; Bonciani, D; Bonciolini, V; Caproni, M; Fabbri, P

    2015-04-01

    Acne is a chronic inflammatory disease of the sebaceous-pilosebaceous unit. Interestingly, inflammation can be detected by histopathological examination and immuohistochemical analysis even in the apparently non-inflammatory acneic lesions, such as comedones. In the last years, it has been clearly demonstrated that acne development is linked to the combination of predisposing genetic factors and environmental triggers, among which a prominent role is played by the follicular colonization by Propionibacterium acnes (P. acnes). P. acnes displays several activities able to promote the development of acne skin lesions, including the promotion of follicular hyperkeratinisation, the induction of sebogenesis, and the stimulation of an inflammatory response by the secretion of proinflammatory molecules and by the activation of innate immunity, that is followed by a P. acnes-specific adaptive immune response. In addition, P. acnes-independent inflammation mediated by androgens or by a neurogenic activation, followed by the secretion in the skin of pro-inflammatory neuropeptides, can occur in acne lesions. In conclusion, acne can be considered as a model of immune-mediated chronic inflammatory skin disease, characterized by an innate immune response that is not able to control P. acnes followed by a Th1-mediated adaptive immune response, that becomes self-maintaining independently from P. acnes itself.

  5. The Immune System Out of Shape? : Shaping of adaptive immunity by persistent viral infections in young children

    NARCIS (Netherlands)

    D. van den Heuvel (Diana)

    2015-01-01

    markdownabstractDuring pregnancy, a fetus is protected from a large part of the pathogens of the environment. As a result, a newborn’s immune system is immature and unexperienced, and mainly composed of innate leukocytes and naive lymphocytes. Immunological memory, and concomitant functional

  6. Recent progress in host immunity to avian coccidiosis: IL-17 family cytokines as sentinels of the intestinal mucosa.

    Science.gov (United States)

    Min, Wongi; Kim, Woo H; Lillehoj, Erik P; Lillehoj, Hyun S

    2013-11-01

    The molecular and cellular mechanisms leading to immune protection against coccidiosis are complex and include multiple aspects of innate and adaptive immunities. Innate immunity is mediated by various subpopulations of immune cells that recognize pathogen associated molecular patterns (PAMPs) through their pattern recognition receptors (PRRs) leading to the secretion of soluble factors with diverse functions. Adaptive immunity, which is important in conferring protection against subsequent reinfections, involves subtypes of T and B lymphocytes that mediate antigen-specific immune responses. Recently, global gene expression microarray analysis has been used in an attempt to dissect this complex network of immune cells and molecules during avian coccidiosis. These new studies emphasized the uniqueness of the innate immune response to Eimeria infection, and directly led to the discovery of previously uncharacterized host genes and proteins whose expression levels were modulated following parasite infection. Among these is the IL-17 family of cytokines. This review highlights recent progress in IL-17 research in the context of host immunity to avian coccidiosis. Copyright © 2013. Published by Elsevier Ltd.

  7. COMPARATIVE STUDY OF TUMORIGENESIS AND TUMOR IMMUNITY IN INVERTEBRATES AND NONMAMMALIAN VERTEBRATES

    Science.gov (United States)

    Robert, Jacques

    2010-01-01

    Despite intense study in mammals, the different roles played by the immune system in detecting (immunosurveillance), controlling and remodeling (immunoediting) neoplasia, and perhaps in metastasis are not fully understood. In this review, I will present evidence of neoplasia and invasive malignancy, as well as tumor immunity in invertebrates and nonmammalian vertebrates. I will also present a comparative and evolutionary view of the complex interactions between neoplasia and the host immune system. Overall, I wish to go beyond the too simplistic dichotomy between invertebrates with innate immunity that are only affected with benign neoplasia and vertebrates with adaptive immunity that are affected by metastatic malignancies or cancer. PMID:20553753

  8. Immunological considerations regarding parental concerns on pediatric immunizations.

    Science.gov (United States)

    Nicoli, Francesco; Appay, Victor

    2017-05-25

    Despite the fundamental role of vaccines in the decline of infant mortality, parents may decide to decline vaccination for their own children. Many factors may influence this decision, such as the belief that the infant immune system is weakened by vaccines, and concerns have been raised about the number of vaccines and the early age at which they are administered. Studies focused on the infant immune system and its reaction to immunizations, summarized in this review, show that vaccines can overcome those suboptimal features of infant immune system that render them more at risk of infections and of their severe manifestations. In addition, many vaccines have been shown to improve heterologous innate and adaptive immunity resulting in lower mortality rates for fully vaccinated children. Thus, multiple vaccinations are necessary and not dangerous, as infants can respond to several antigens as well as when responding to single stimuli. Current immunization schedules have been developed and tested to avoid vaccine interference, improve benefits and reduce side effects compared to single administrations. The infant immune system is therefore capable, early after birth, of managing several antigenic challenges and exploits them to prompt its development. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Hormesis of Low Doses of Ionizing Radiation Exposure on Immune System

    International Nuclear Information System (INIS)

    Ragab, M.H.; Abbas, M.O.; El-Asady, R.S.; Amer, H.A.; El-Khouly, W.A.; Shabon, M.H.

    2015-01-01

    The effect of low doses of ionizing radiation on the immune system has been a controversial subject. To evaluate the effect of low-doses γ-irradiation exposure on immune system. An animal model, using Rattus Rattus rats was used. The rats were divided into groups exposed to either continuous or fractionated 100, 200, 300, 400 and 500 mSv of radiation and compared to control rats that did not receive radiation. All groups were exposed to a total white blood count (Wcs), lymphocyte count and serum IgG level measurement, as indicators of the function of the cell-mediated (T lymphocytes) and the humoral (B lymphocytes) immune system. The results of the current study revealed that the counts of total leukocytes (WBCs) and lymphocytes, as well as the serum level of IgG were increased significantly in rats receiving low dose radiation, indicating enhancement of immune system. The data suggests that low-dose gamma-radiation improved hematological parameters and significantly enhances immune response indices of the exposed rats. These findings are similar to the radiation adaptive responses in which a small dose of pre irradiation would induce certain radiation resistance and enhances the cell response after exposure to further irradiation doses The applied low doses used in the present study may appear effective inducing the radio adaptive response. Farooqi and Kesavan (1993) and Bravard et al. (1999) reported that the adaptive response to ionizing radiation refers to the phenomenon by which cells irradiated with low (cGy) or sublethal doses (conditioning doses) become less susceptible to genotoxic effects of a subsequent high dose (challenge dose, several Gy).

  10. A pox on thee! Manipulation of the host immune system by myxoma virus and implications for viral-host co-adaptation.

    Science.gov (United States)

    Zúñiga, Martha C

    2002-09-01

    The poxviruses have evolved a diverse array of proteins which serve to subvert innate and adaptive host responses that abort or at least limit viral infections. Myxoma virus and its rabbit host are considered to represent an ideal poxvirus-host system in which to study the effects of these immunomodulatory proteins. Studies of laboratory rabbits (Oryctolagus cuniculus) infected with gene knockout variants of myxoma virus have provided compelling evidence that several myxoma virus gene products contribute to the pathogenic condition known as myxomatosis. However, myxomatosis, which is characterized by skin lesions, systemic immunosuppression, and a high mortality rate, does not occur in the virus' natural South American host, Sylvilogus brasiliensis. Moreover, in Australia where myxoma virus was willfully introduced to control populations of O. cuniculus, myxomatosis-resistant rabbits emerged within a year of myxoma virus introduction into the field. In this review I discuss the characterized immunomodulatory proteins of myxoma virus, their biochemical properties, their pathogenic effects in laboratory rabbits, the role of the host immune system in the susceptibility or resistance to myxomatosis, and the evidence that immunomodulatory genes may have been attenuated during the co-adaptation of myxoma virus and O. cuniculus in Australia.

  11. EFSA NDA Panel (EFSA Panel on Dietetic Product s, Nutrition and Allergies), 2013 . Scientific Opinion on the substantiation of a health claim related to vitamin A and contribution to normal development and function of the immune system pursuant to Article 14 of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    of infants and young children (from birth to three years). The Panel concludes that a cause and effect relationship has been established between dietary intake of vitamin A and contribution to normal development and function of the immune system. The following wording reflects the scientific evidence......: “Vitamin A contributes to the normal function of the immune system”. The target population is infants and children up to three years. © European Food Safety Authority, 2013...

  12. Accelerated evolution of innate immunity proteins in social insects: adaptive evolution or relaxed constraint?

    Science.gov (United States)

    Harpur, Brock A; Zayed, Amro

    2013-07-01

    The genomes of eusocial insects have a reduced complement of immune genes-an unusual finding considering that sociality provides ideal conditions for disease transmission. The following three hypotheses have been invoked to explain this finding: 1) social insects are attacked by fewer pathogens, 2) social insects have effective behavioral or 3) novel molecular mechanisms for combating pathogens. At the molecular level, these hypotheses predict that canonical innate immune pathways experience a relaxation of selective constraint. A recent study of several innate immune genes in ants and bees showed a pattern of accelerated amino acid evolution, which is consistent with either positive selection or a relaxation of constraint. We studied the population genetics of innate immune genes in the honey bee Apis mellifera by partially sequencing 13 genes from the bee's Toll pathway (∼10.5 kb) and 20 randomly chosen genes (∼16.5 kb) sequenced in 43 diploid workers. Relative to the random gene set, Toll pathway genes had significantly higher levels of amino acid replacement mutations segregating within A. mellifera and fixed between A. mellifera and A. cerana. However, levels of diversity and divergence at synonymous sites did not differ between the two gene sets. Although we detect strong signs of balancing selection on the pathogen recognition gene pgrp-sa, many of the genes in the Toll pathway show signatures of relaxed selective constraint. These results are consistent with the reduced complement of innate immune genes found in social insects and support the hypothesis that some aspect of eusociality renders canonical innate immunity superfluous.

  13. The role of rare innate immune cells in Type 2 immune activation against parasitic helminths.

    Science.gov (United States)

    Webb, Lauren M; Tait Wojno, Elia D

    2017-09-01

    The complexity of helminth macroparasites is reflected in the intricate network of host cell types that participate in the Type 2 immune response needed to battle these organisms. In this context, adaptive T helper 2 cells and the Type 2 cytokines interleukin (IL)-4, IL-5, IL-9 and IL-13 have been the focus of research for years, but recent work has demonstrated that the innate immune system plays an essential role. Some innate immune cells that promote Type 2 immunity are relatively abundant, such as macrophages and eosinophils. However, we now appreciate that more rare cell types including group 2 innate lymphoid cells, basophils, mast cells and dendritic cells make significant contributions to these responses. These cells are found at low frequency but they are specialized to their roles - located at sites such as the skin, lung and gut, where the host combats helminth parasites. These cells respond rapidly and robustly to worm antigens and worm-induced damage to produce essential cytokines, chemokines, eicosanoids and histamine to activate damaged epithelium and to recruit other effectors. Thus, a greater understanding of how these cells operate is essential to understand how the host protects itself during helminth infection.

  14. Immunity to VHS virus in rainbow trout

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Olesen, Niels Jørgen; Koch, C.

    1999-01-01

    Viral hemorrhagic septicemia virus (VHSV) is the rhabdovirus that causes most disease problems in farmed rainbow trout in Europe. Survivors of infection are usually immune to reinfection but as with other fish viruses, development of a modern recombinant vaccine has been complicated by the limited...... knowledge of the immune mechanisms and antigens involved in induction of immunity. Neutralizing and protective monoclonal antibodies recognize the envelope glycoprotein (G protein) which is the only viral protein known to be present on the surface of the virus particle. Immunoblotting analyses...... with monoclonal antibodies as well as with sera from immunized trout have indicated that protein conformation plays an important role in neutralization epitopes. The virus neutralizing activity often found in sera from convalescent trout is highly dependent on a poorly defined complementing activity in normal...

  15. Adaptive evolution of relish, a Drosophila NF-kappaB/IkappaB protein.

    OpenAIRE

    Begun, D J; Whitley, P

    2000-01-01

    NF-kappaB and IkappaB proteins have central roles in regulation of inflammation and innate immunity in mammals. Homologues of these proteins also play an important role in regulation of the Drosophila immune response. Here we present a molecular population genetic analysis of Relish, a Drosophila NF-kappaB/IkappaB protein, in Drosophila simulans and D. melanogaster. We find strong evidence for adaptive protein evolution in D. simulans, but not in D. melanogaster. The adaptive evolution appear...

  16. In vitro adaptation of Plasmodium falciparum reveal variations in cultivability

    OpenAIRE

    White, John; Mascarenhas, Anjali; Pereira, Ligia; Dash, Rashmi; Walke, Jayashri T.; Gawas, Pooja; Sharma, Ambika; Manoharan, Suresh Kumar; Guler, Jennifer L.; Maki, Jennifer N.; Kumar, Ashwani; Mahanta, Jagadish; Valecha, Neena; Dubhashi, Nagesh; Vaz, Marina

    2016-01-01

    Background Culture-adapted Plasmodium falciparum parasites can offer deeper understanding of geographic variations in drug resistance, pathogenesis and immune evasion. To help ground population-based calculations and inferences from culture-adapted parasites, the complete range of parasites from a study area must be well represented in any collection. To this end, standardized adaptation methods and determinants of successful in vitro adaption were sought. Methods Venous blood was collected f...

  17. Immune Privilege and Eye-Derived T-Regulatory Cells

    Directory of Open Access Journals (Sweden)

    Hiroshi Keino

    2018-01-01

    Full Text Available Certain cellular components of the eye, such as neural retina, are unable to regenerate and replicate after destructive inflammation. Ocular immune privilege provides the eye with immune protection against intraocular inflammation in order to minimize the risk to vision integrity. The eye and immune system use strategies to maintain the ocular immune privilege by regulating the innate and adaptive immune response, which includes immunological ignorance, peripheral tolerance to eye-derived antigens, and intraocular immunosuppressive microenvironment. In this review, we summarize current knowledge regarding the molecular mechanism responsible for the development and maintenance of ocular immune privilege via regulatory T cells (Tregs, which are generated by the anterior chamber-associated immune deviation (ACAID, and ocular resident cells including corneal endothelial (CE cells, ocular pigment epithelial (PE cells, and aqueous humor. Furthermore, we examined the therapeutic potential of Tregs generated by RPE cells that express transforming growth factor beta (TGF-β, cytotoxic T lymphocyte-associated antigen-2 alpha (CTLA-2α, and retinoic acid for autoimmune uveoretinitis and evaluated a new strategy using human RPE-induced Tregs for clinical application in inflammatory ocular disease. We believe that a better understanding of the ocular immune privilege associated with Tregs might offer a new approach with regard to therapeutic interventions for ocular autoimmunity.

  18. Immune Privilege and Eye-Derived T-Regulatory Cells.

    Science.gov (United States)

    Keino, Hiroshi; Horie, Shintaro; Sugita, Sunao

    2018-01-01

    Certain cellular components of the eye, such as neural retina, are unable to regenerate and replicate after destructive inflammation. Ocular immune privilege provides the eye with immune protection against intraocular inflammation in order to minimize the risk to vision integrity. The eye and immune system use strategies to maintain the ocular immune privilege by regulating the innate and adaptive immune response, which includes immunological ignorance, peripheral tolerance to eye-derived antigens, and intraocular immunosuppressive microenvironment. In this review, we summarize current knowledge regarding the molecular mechanism responsible for the development and maintenance of ocular immune privilege via regulatory T cells (Tregs), which are generated by the anterior chamber-associated immune deviation (ACAID), and ocular resident cells including corneal endothelial (CE) cells, ocular pigment epithelial (PE) cells, and aqueous humor. Furthermore, we examined the therapeutic potential of Tregs generated by RPE cells that express transforming growth factor beta (TGF- β ), cytotoxic T lymphocyte-associated antigen-2 alpha (CTLA-2 α ), and retinoic acid for autoimmune uveoretinitis and evaluated a new strategy using human RPE-induced Tregs for clinical application in inflammatory ocular disease. We believe that a better understanding of the ocular immune privilege associated with Tregs might offer a new approach with regard to therapeutic interventions for ocular autoimmunity.

  19. Regulatory T cells and immunity to pathogens.

    Science.gov (United States)

    Rouse, Barry T; Suvas, Susmit

    2007-09-01

    Immune responses to pathogens are modulated by one or more types of cells that perform a regulatory function. Some cells with this function, such as CD4+ Foxp3+ natural regulatory T cells (nTreg), pre-exist prior to infections whereas others may be induced as a consequence of infection (adaptive Treg). With pathogens that have a complex pathogenesis, multiple types of regulatory cells could influence the outcome. One major property of Treg is to help minimize collateral tissue damage that can occur during immune reactions to a chronic infection. The consequence is less damage to the host but in such situations the pathogen is likely to establish persistence. In some cases, a fine balance is established between Treg responses, effector components of immunity and the pathogen. Treg responses to pathogens may also act to hamper the efficacy of immune control. This review discusses these issues as well as the likely mechanisms by which various pathogens can signal the participation of Treg during infection.

  20. Adaptive Immune Response Impairs the Efficacy of Autologous Transplantation of Engineered Stem Cells in Dystrophic Dogs

    Science.gov (United States)

    Sitzia, Clementina; Farini, Andrea; Jardim, Luciana; Razini, Paola; Belicchi, Marzia; Cassinelli, Letizia; Villa, Chiara; Erratico, Silvia; Parolini, Daniele; Bella, Pamela; da Silva Bizario, Joao Carlos; Garcia, Luis; Dias-Baruffi, Marcelo; Meregalli, Mirella; Torrente, Yvan

    2016-01-01

    Duchenne muscular dystrophy is the most common genetic muscular dystrophy. It is caused by mutations in the dystrophin gene, leading to absence of muscular dystrophin and to progressive degeneration of skeletal muscle. We have demonstrated that the exon skipping method safely and efficiently brings to the expression of a functional dystrophin in dystrophic CD133+ cells injected scid/mdx mice. Golden Retriever muscular dystrophic (GRMD) dogs represent the best preclinical model of Duchenne muscular dystrophy, mimicking the human pathology in genotypic and phenotypic aspects. Here, we assess the capacity of intra-arterial delivered autologous engineered canine CD133+ cells of restoring dystrophin expression in Golden Retriever muscular dystrophy. This is the first demonstration of five-year follow up study, showing initial clinical amelioration followed by stabilization in mild and severe affected Golden Retriever muscular dystrophy dogs. The occurrence of T-cell response in three Golden Retriever muscular dystrophy dogs, consistent with a memory response boosted by the exon skipped-dystrophin protein, suggests an adaptive immune response against dystrophin. PMID:27506452

  1. Synthetic mast-cell granules as adjuvants to promote and polarize immunity in lymph nodes

    Science.gov (United States)

    St. John, Ashley L.; Chan, Cheryl Y.; Staats, Herman F.; Leong, Kam W.; Abraham, Soman N.

    2012-03-01

    Granules of mast cells (MCs) enhance adaptive immunity when, on activation, they are released as stable particles. Here we show that submicrometre particles modelled after MC granules augment immunity when used as adjuvants in vaccines. The synthetic particles, which consist of a carbohydrate backbone with encapsulated inflammatory mediators such as tumour necrosis factor, replicate attributes of MCs in vivo including the targeting of draining lymph nodes and the timed release of the encapsulated mediators. When used as an adjuvant during vaccination of mice with haemagglutinin from the influenza virus, the particles enhanced adaptive immune responses and increased survival of mice on lethal challenge. Furthermore, differential loading of the particles with the cytokine IL-12 directed the character of the response towards Th1 lymphocytes. The synthetic MC adjuvants replicate and enhance the functions of MCs during vaccination, and can be extended to polarize the resulting immunity.

  2. Tweaking Innate Immunity: The Promise of Innate Immunologicals as Anti-Infectives

    Directory of Open Access Journals (Sweden)

    Kenneth L Rosenthal

    2006-01-01

    Full Text Available New and exciting insights into the importance of the innate immune system are revolutionizing our understanding of immune defense against infections, pathogenesis, and the treatment and prevention of infectious diseases. The innate immune system uses multiple families of germline-encoded pattern recognition receptors (PRRs to detect infection and trigger a variety of antimicrobial defense mechanisms. PRRs are evolutionarily highly conserved and serve to detect infection by recognizing pathogen-associated molecular patterns that are unique to microorganisms and essential for their survival. Toll-like receptors (TLRs are transmembrane signalling receptors that activate gene expression programs that result in the production of proinflammatory cytokines and chemokines, type I interferons and antimicrobial factors. Furthermore, TLR activation facilitates and guides activation of adaptive immune responses through the activation of dendritic cells. TLRs are localized on the cell surface and in endosomal/lysosomal compartments, where they detect bacterial and viral infections. In contrast, nucleotide-binding oligomerization domain proteins and RNA helicases are located in the cell cytoplasm, where they serve as intracellular PRRs to detect cytoplasmic infections, particularly viruses. Due to their ability to enhance innate immune responses, novel strategies to use ligands, synthetic agonists or antagonists of PRRs (also known as 'innate immunologicals' can be used as stand-alone agents to provide immediate protection or treatment against bacterial, viral or parasitic infections. Furthermore, the newly appreciated importance of innate immunity in initiating and shaping adaptive immune responses is contributing to our understanding of vaccine adjuvants and promises to lead to improved next-generation vaccines.

  3. Retinoic Acid and Its Role in Modulating Intestinal Innate Immunity

    Directory of Open Access Journals (Sweden)

    Paulo Czarnewski

    2017-01-01

    Full Text Available Vitamin A (VA is amongst the most well characterized food-derived nutrients with diverse immune modulatory roles. Deficiency in dietary VA has not only been associated with immune dysfunctions in the gut, but also with several systemic immune disorders. In particular, VA metabolite all-trans retinoic acid (atRA has been shown to be crucial in inducing gut tropism in lymphocytes and modulating T helper differentiation. In addition to the widely recognized role in adaptive immunity, increasing evidence identifies atRA as an important modulator of innate immune cells, such as tolerogenic dendritic cells (DCs and innate lymphoid cells (ILCs. Here, we focus on the role of retinoic acid in differentiation, trafficking and the functions of innate immune cells in health and inflammation associated disorders. Lastly, we discuss the potential involvement of atRA during the plausible crosstalk between DCs and ILCs.

  4. The Unfolded Protein Response in Homeostasis and Modulation of Mammalian Immune Cells.

    Science.gov (United States)

    Martins, Ana Sofia; Alves, Inês; Helguero, Luisa; Domingues, Maria Rosário; Neves, Bruno Miguel

    2016-11-01

    The endoplasmic reticulum (ER) plays important roles in eukaryotic protein folding and lipid biosynthesis. Several exogenous and endogenous cellular sources of stress can perturb ER homeostasis leading to the accumulation of unfolded proteins in the lumen. Unfolded protein accumulation triggers a signal-transduction cascade known as the unfolded protein response (UPR), an adaptive mechanism which aims to protect cells from protein aggregates and to restore ER functions. Further to this protective mechanism, in immune cells, UPR molecular effectors have been shown to participate in a wide range of biological processes such as cell differentiation, survival and immunoglobulin and cytokine production. Recent findings also highlight the involvement of the UPR machinery in the maturational program and antigen presentation capacities of dendritic cells. UPR is therefore a key element in immune system homeostasis with direct implications on both adaptive and innate immune responses. The present review summarizes the knowledge on the emerging roles of UPR signaling cascades in mammalian immune cells as well as the consequences of their dysregulation in relation to the pathogenesis of several diseases.

  5. Innate immunity and effector and regulatory mechanisms involved in allergic contact dermatitis.

    Science.gov (United States)

    Silvestre, Marilene Chaves; Sato, Maria Notomi; Reis, Vitor Manoel Silva Dos

    2018-03-01

    Skin's innate immunity is the initial activator of immune response mechanisms, influencing the development of adaptive immunity. Some contact allergens are detected by Toll-like receptors (TLRs) and inflammasome NLR3. Keratinocytes participate in innate immunity and, in addition to functioning as an anatomical barrier, secrete cytokines, such as TNF, IL-1β, and IL-18, contributing to the development of Allergic Contact Dermatitis. Dendritic cells recognize and process antigenic peptides into T cells. Neutrophils cause pro-inflammatory reactions, mast cells induce migration/maturation of skin DCs, the natural killer cells have natural cytotoxic capacity, the γδ T cells favor contact with hapten during the sensitization phase, and the innate lymphoid cells act in the early stages by secreting cytokines, as well as act in inflammation and tissue homeostasis. The antigen-specific inflammation is mediated by T cells, and each subtype of T cells (Th1/Tc1, Th2/Tc2, and Th17/Tc17) activates resident skin cells, thus contributing to inflammation. Skin's regulatory T cells have a strong ability to inhibit the proliferation of hapten-specific T cells, acting at the end of the Allergic Contact Dermatitis response and in the control of systemic immune responses. In this review, we report how cutaneous innate immunity is the first line of defense and focus its role in the activation of the adaptive immune response, with effector response induction and its regulation.

  6. Innate immunity and effector and regulatory mechanisms involved in allergic contact dermatitis*

    Science.gov (United States)

    Silvestre, Marilene Chaves; Sato, Maria Notomi; dos Reis, Vitor Manoel Silva

    2018-01-01

    Skin's innate immunity is the initial activator of immune response mechanisms, influencing the development of adaptive immunity. Some contact allergens are detected by Toll-like receptors (TLRs) and inflammasome NLR3. Keratinocytes participate in innate immunity and, in addition to functioning as an anatomical barrier, secrete cytokines, such as TNF, IL-1β, and IL-18, contributing to the development of Allergic Contact Dermatitis. Dendritic cells recognize and process antigenic peptides into T cells. Neutrophils cause pro-inflammatory reactions, mast cells induce migration/maturation of skin DCs, the natural killer cells have natural cytotoxic capacity, the γδ T cells favor contact with hapten during the sensitization phase, and the innate lymphoid cells act in the early stages by secreting cytokines, as well as act in inflammation and tissue homeostasis. The antigen-specific inflammation is mediated by T cells, and each subtype of T cells (Th1/Tc1, Th2/Tc2, and Th17/Tc17) activates resident skin cells, thus contributing to inflammation. Skin's regulatory T cells have a strong ability to inhibit the proliferation of hapten-specific T cells, acting at the end of the Allergic Contact Dermatitis response and in the control of systemic immune responses. In this review, we report how cutaneous innate immunity is the first line of defense and focus its role in the activation of the adaptive immune response, with effector response induction and its regulation. PMID:29723367

  7. Immune algorithm based active PID control for structure systems

    International Nuclear Information System (INIS)

    Lee, Young Jin; Cho, Hyun Cheol; Lee, Kwon Soon

    2006-01-01

    An immune algorithm is a kind of evolutional computation strategies, which is developed in the basis of a real immune mechanism in the human body. Recently, scientific or engineering applications using this scheme are remarkably increased due to its significant ability in terms of adaptation and robustness for external disturbances. Particularly, this algorithm is efficient to search optimal parameters against complicated dynamic systems with uncertainty and perturbation. In this paper, we investigate an immune algorithm embedded Proportional Integral Derivate (called I P ID) control, in which an optimal parameter vector of the controller is determined offline by using a cell-mediated immune response of the immunized mechanism. For evaluation, we apply the proposed control to mitigation of vibrations for nonlinear structural systems, cased by external environment load such as winds and earthquakes. Comparing to traditional controls under same simulation scenarios, we demonstrate the innovation control is superior especially in robustness aspect

  8. Obesity, Fat Mass and Immune System: Role for Leptin

    Directory of Open Access Journals (Sweden)

    Vera Francisco

    2018-06-01

    Full Text Available Obesity is an epidemic disease characterized by chronic low-grade inflammation associated with a dysfunctional fat mass. Adipose tissue is now considered an extremely active endocrine organ that secretes cytokine-like hormones, called adipokines, either pro- or anti-inflammatory factors bridging metabolism to the immune system. Leptin is historically one of most relevant adipokines, with important physiological roles in the central control of energy metabolism and in the regulation of metabolism-immune system interplay, being a cornerstone of the emerging field of immunometabolism. Indeed, leptin receptor is expressed throughout the immune system and leptin has been shown to regulate both innate and adaptive immune responses. This review discusses the latest data regarding the role of leptin as a mediator of immune system and metabolism, with particular emphasis on its effects on obesity-associated metabolic disorders and autoimmune and/or inflammatory rheumatic diseases.

  9. Long noncoding RNA in hematopoiesis and immunity.

    Science.gov (United States)

    Satpathy, Ansuman T; Chang, Howard Y

    2015-05-19

    Dynamic gene expression during cellular differentiation is tightly coordinated by transcriptional and post-transcriptional mechanisms. An emerging theme is the central role of long noncoding RNAs (lncRNAs) in the regulation of this specificity. Recent advances demonstrate that lncRNAs are expressed in a lineage-specific manner and control the development of several cell types in the hematopoietic system. Moreover, specific lncRNAs are induced to modulate innate and adaptive immune responses. lncRNAs can function via RNA-DNA, RNA-RNA, and RNA-protein target interactions. As a result, they affect several stages of gene regulation, including chromatin modification, mRNA biogenesis, and protein signaling. We discuss recent advances, future prospects, and challenges in understanding the roles of lncRNAs in immunity and immune-mediated diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. The Immune Response and the Pathogenesis of Idiopathic Inflammatory Myositis: a Critical Review.

    Science.gov (United States)

    Ceribelli, Angela; De Santis, Maria; Isailovic, Natasa; Gershwin, M Eric; Selmi, Carlo

    2017-02-01

    The pathogenesis of idiopathic inflammatory myositis (IIMs, including polymyositis and dermatomyositis) remains largely enigmatic, despite advances in the study of the role played by innate immunity, adaptive immunity, genetic predisposition, and environmental factors in an orchestrated response. Several factors are involved in the inflammatory state that characterizes the different forms of IIMs which share features and mechanisms but are clearly different with respect to the involved sites and characteristics of the inflammation. Cellular and non-cellular mechanisms of both the immune and non-immune systems have been identified as key regulators of inflammation in polymyositis/dermatomyositis, particularly at different stages of disease, leading to the fibrotic state that characterizes the end stage. Among these, a special role is played by an interferon signature and complement cascade with different mechanisms in polymyositis and dermatomyositis; these differences can be identified also histologically in muscle biopsies. Numerous cellular components of the adaptive and innate immune response are present in the site of tissue inflammation, and the complexity of idiopathic inflammatory myositis is further supported by the involvement of non-immune mechanisms such as hypoxia and autophagy. The aim of this comprehensive review is to describe the major pathogenic mechanisms involved in the onset of idiopathic inflammatory myositis and to report on the major working hypothesis with therapeutic implications.

  11. The Immune System: Basis of so much Health and Disease: 4. Immunocytes.

    Science.gov (United States)

    Scully, Crispian; Georgakopoulou, Eleni A; Hassona, Yazan

    2017-05-01

    The immune system is the body’s primary defence mechanism against infections, and disturbances in the system can cause disease if the system fails in defence functions (in immunocompromised people), or if the activity is detrimental to the host (as in auto-immune and auto-inflammatory states). A healthy immune system is also essential to normal health of dental and oral tissues. This series presents the basics for the understanding of the immune system, this article covers cells of the immune system (immunocytes). Clinical relevance: Modern dental clinicians need a basic understanding of the immune system as it underlies health and disease.

  12. The middle ear immune defense changes with age

    DEFF Research Database (Denmark)

    Nielsen, Michelle Christine; Friis, Morten; Martin-Bertelsen, Tomas

    2016-01-01

    of this study was to analyze the relationship between age and the mucosal immune system in the middle ear. It is hypothesized that genes involved in the middle ear immune system will change with age. A comprehensive assessment of these genetic differences using the techniques of complementary DNA has not been...... performed. Complementary DNA microarray technology was used to identify immune-related genes differentially expressed between the normal middle ear mucosa of young (10 days old) and adult rats (80 days old). Data were analyzed using tools of bioinformatics. A total of 260 age-related genes were identified...

  13. Cell-mediated immunity during syphilis. A review

    Science.gov (United States)

    Pavia, Charles S.; Folds, James D.; Baseman, Joel B.

    1978-01-01

    Evidence is presented which reinforces the complexity of the host-parasite interaction during the course of syphilis. Infection with Treponema pallidum evokes a complicated antibody response and an assortment of cell-mediated immune reactions in the host. It appears that humoral immunity plays a minor role towards the complete elimination of syphilitic infection while the cellular limb of the immune response may be an important host defence mechanism. Information now available indicates that a state of anergy, or immunosuppression, exists in the early stages of human and experimental rabbit syphilis based upon negative skin reactions to T. pallidum antigen(s), the abnormal histological appearance of lymphoid organs, and impaired in vitro lymphocyte reactivity. It is also evident that in the later stages of the disease cellular immunity becomes activated as delayed type skin reactions can normally be elicited in tertiary syphilitics and lymphocyte behaviour in cell culture appears normal. Several mechanisms have been invoked to explain the delay in an effective immune response against syphilitic infection and the duration of the disease: (1) a capsule-like substance on the outer surface of virulant T. pallidum may act as a barrier against treponemicidal antibody; (2) this material and other biological properties of virulent treponemes could enable spirochaetes to escape being engulfed by macrophages and other phagocytic cells; (3) antigenic competition among different treponemal antigens causing partial tolerance; (4) T. pallidum infection may bring about the elaboration of immunosuppressive substances of host or treponemal origin which inhibit the proper function of lymphocytes, macrophages, and other cell types. PMID:350348

  14. Mechanisms and pathways of innate immune activation and regulation in health and cancer.

    Science.gov (United States)

    Cui, Jun; Chen, Yongjun; Wang, Helen Y; Wang, Rong-Fu

    2014-01-01

    Research on innate immune signaling and regulation has recently focused on pathogen recognition receptors (PRRs) and their signaling pathways. Members of PRRs sense diverse microbial invasions or danger signals, and initiate innate immune signaling pathways, leading to proinflammatory cytokines production, which, in turn, instructs adaptive immune response development. Despite the diverse functions employed by innate immune signaling to respond to a variety of different pathogens, the innate immune response must be tightly regulated. Otherwise, aberrant, uncontrolled immune responses will lead to harmful, or even fatal, consequences. Therefore, it is essential to better discern innate immune signaling and many regulators, controlling various signaling pathways, have been identified. In this review, we focus on the recent advances in our understanding of the activation and regulation of innate immune signaling in the host response to pathogens and cancer.

  15. Molecular signaling networks in regulation of immunity and disease

    DEFF Research Database (Denmark)

    Laursen, Janne Marie; Jensen, Stina Rikke; Sørensen, Morten

    and dynamic microbial communities with the immune cell compartment in the gut, and therefore the interaction between components from different gut bacteria can efficiently shape the phenotype of the immune response. A specialized antigenpresenting cell present at mucosal surfaces, the dendritic cell (DC......), plays a crucial role in shaping the nature of the adaptive/memorybased immune response after encountering inflammatory compounds. In the gut, the DC is continuously exposed to microbial and dietary components that are recognized by its innate pattern recognition receptors, and the phenotype developed...... in the DC during activation is of profound importance for the state of immune response and thereby also affects the inflammatory and metabolic status in tissues. We have shown that specific fermentation products from gut bacteria have distinct immunoregulatory effects that effectively inhibit...

  16. Novel "Elements" of Immune Suppression within the Tumor Microenvironment.

    Science.gov (United States)

    Gurusamy, Devikala; Clever, David; Eil, Robert; Restifo, Nicholas P

    2017-06-01

    Adaptive evolution has prompted immune cells to use a wide variety of inhibitory signals, many of which are usurped by tumor cells to evade immune surveillance. Although tumor immunologists often focus on genes and proteins as mediators of immune function, here we highlight two elements from the periodic table-oxygen and potassium-that suppress the immune system in previously unappreciated ways. While both are key to the maintenance of T-cell function and tissue homeostasis, they are exploited by tumors to suppress immuno-surveillance and promote metastatic spread. We discuss the temporal and spatial roles of these elements within the tumor microenvironment and explore possible therapeutic interventions for effective and promising anticancer therapies. Cancer Immunol Res; 5(6); 426-33. ©2017 AACR . ©2017 American Association for Cancer Research.

  17. Biological Immune System Applications on Mobile Robot for Disabled People

    Directory of Open Access Journals (Sweden)

    Songmin Jia

    2014-01-01

    Full Text Available To improve the service quality of service robots for the disabled, immune system is applied on robot for its advantages such as diversity, dynamic, parallel management, self-organization, and self-adaptation. According to the immune system theory, local environment condition sensed by robot is considered an antigen while robot is regarded as B-cell and possible node as antibody, respectively. Antibody-antigen affinity is employed to choose the optimal possible node to ensure the service robot can pass through the optimal path. The paper details the immune system applications on service robot and gives experimental results.

  18. Hyperthyroidism caused by acquired immune deficiency syndrome.

    Science.gov (United States)

    Wang, J-J; Zhou, J-J; Yuan, X-L; Li, C-Y; Sheng, H; Su, B; Sheng, C-J; Qu, S; Li, H

    2014-01-01

    Acquired immune deficiency syndrome (AIDS) is an immune deficiency disease. The etiology of hyperthyroidism, which can also be immune-related, is usually divided into six classical categories, including hypophyseal, hypothalamic, thyroid, neoplastic, autoimmune and inflammatory hyperthyroidism. Hyperthyroidism is a rare complication of highly active antimicrobial therapy (HAART) for human immunodeficiency virus (HIV). Hyperthyroidism caused directly by AIDS has not been previously reported. A 29-year-old man who complained of dyspnea and asthenia for 1 month, recurrent fever for more than 20 days, and breathlessness for 1 week was admitted to our hospital. The thyroid function test showed that the level of free thyroxine (FT4) was higher than normal and that the level of thyroid-stimulating hormone (TSH) was below normal. He was diagnosed with hyperthyroidism. Additional investigations revealed a low serum albumin level and chest infection, along with diffuse lung fibrosis. Within 1 month, he experienced significant weight loss, no hand tremors, intolerance of heat, and perspiration proneness. We recommended an HIV examination; subsequently, AIDS was diagnosed based on the laboratory parameters. This is the first reported case of hyperthyroidism caused by AIDS. AIDS may cause hyperthyroidism by immunization regulation with complex, atypical, and easily ignored symptoms. Although hyperthyroidism is rare in patients with AIDS, clinicians should be aware of this potential interaction and should carefully monitor thyroid function in HIV-positive patients.

  19. Facilitating Effects of Nanoparticles/Materials on Sensitive Immune-Related Lung Disorders

    International Nuclear Information System (INIS)

    Inoue, K.I.; Takano, H.

    2011-01-01

    Although the adverse health effects of nanoparticles/materials have been proposed and are being clarified, their facilitating effects on preexisting pathological conditions have not been fully examined. In this paper, we provide insights into the immunotoxicity of nanoparticles/materials as an aggravating factor in hyper susceptible subjects, especially those with immune-related respiratory disorders using our in vivo experimental model. We first exhibit the effects of nanoparticles/materials on lung inflammation induced by bacterial endotoxin (lipopolysaccharide: LPS) in vivo as a disease model in innate immunity, and demonstrated that nanoparticles instilled through both an intratracheal tube and an inhalation system can exacerbate the lung inflammation. Secondly, we introduce the effects of nanoparticles/materials on allergic asthma in vivo as a disease model in adaptive immunity, and showed that repetitive pulmonary exposure to nanoparticles has aggravating effects on allergic airway inflammation, including adjuvant effects on Th2-milieu. Taken together, nanoparticle exposure may synergistically facilitate pathological inflammatory conditions in the lung via both innate and adaptive immunological abnormalities.

  20. [Immune dysfunction and cognitive deficit in stress and physiological aging (Part I): Pathogenesis and risk factors].

    Science.gov (United States)

    Pukhal'skiĭ, A L; Shmarina, G V; Aleshkin, V A

    2014-01-01

    The concept of stressful cognitive dysfunction, which is under consideration in this review, allows picking out several therapeutic targets. The brain, immune and endocrine systems being the principal adaptive systems in the body permanently share information both in the form of neural impulses and soluble mediators. The CNS differs from other organs due to several peculiarities that affect local immune surveillance. The brain cells secluded from the blood flow by a specialized blood-brain-barrier (BBB) can endogenously express pro- and anti-inflammatory cytokines without the intervention of the immune system. In normal brain the cytokine signaling rather contributes to exclusive brain function (e.g. long-term potentiation, synaptic plasticity, adult neurogenesis) than serves as immune communicator. The stress of different origin increases the serum cytokine levels and disrupts BBB. As a result peripheral cytokines penetrate into the brain where they begin to perform new functions. Mass intrusion of biologically active peptides having a lot of specific targets alters the brain work that we can observe both in humans and in animal experiments. In addition owing to BBB disruption dendritic cells and T cells also penetrate into the brain where they take up a perivascular position. The changes observed in stressed subject may accumulate during repeated episodes of stress forming a picture typical of the aging brain. Moreover long-term stress as well as physiological aging result in hormonal and immunological disturbances including hypothalamic-pituitary-adrenal axis depletion, regulatory T-cell accumulation and dehydroepiandrosterone decrease.