WorldWideScience

Sample records for normal adaptive immunity

  1. Origins of adaptive immunity.

    Science.gov (United States)

    Liongue, Clifford; John, Liza B; Ward, Alister

    2011-01-01

    Adaptive immunity, involving distinctive antibody- and cell-mediated responses to specific antigens based on "memory" of previous exposure, is a hallmark of higher vertebrates. It has been argued that adaptive immunity arose rapidly, as articulated in the "big bang theory" surrounding its origins, which stresses the importance of coincident whole-genome duplications. Through a close examination of the key molecules and molecular processes underpinning adaptive immunity, this review suggests a less-extreme model, in which adaptive immunity emerged as part of longer evolutionary journey. Clearly, whole-genome duplications provided additional raw genetic materials that were vital to the emergence of adaptive immunity, but a variety of other genetic events were also required to generate some of the key molecules, whereas others were preexisting and simply co-opted into adaptive immunity.

  2. Alternative adaptive immunity in invertebrates

    DEFF Research Database (Denmark)

    Kurtz, Joachim; Armitage, Sophie Alice Octavia

    2006-01-01

    Vertebrate adaptive immunity is characterized by challenge-specific long-term protection. This specific memory is achieved through the vast diversity of somatically rearranged immunological receptors such as antibodies. Whether or not invertebrates are capable of a comparable phenotypic plasticity...

  3. A locally adaptive normal distribution

    DEFF Research Database (Denmark)

    Arvanitidis, Georgios; Hansen, Lars Kai; Hauberg, Søren

    2016-01-01

    entropy distribution under the given metric. The underlying metric is, however, non-parametric. We develop a maximum likelihood algorithm to infer the distribution parameters that relies on a combination of gradient descent and Monte Carlo integration. We further extend the LAND to mixture models......The multivariate normal density is a monotonic function of the distance to the mean, and its ellipsoidal shape is due to the underlying Euclidean metric. We suggest to replace this metric with a locally adaptive, smoothly changing (Riemannian) metric that favors regions of high local density...

  4. The Immune System: Basis of so much Health and Disease: 3. Adaptive Immunity.

    Science.gov (United States)

    Scully, Crispian; Georgakopoulou, Eleni A; Hassona, Yazan

    2017-04-01

    The immune system is the body’s primary defence mechanism against infections, and disturbances in the system can cause disease if the system fails in defence functions (in immunocompromised people), or if the activity is detrimental to the host (as in auto-immune and auto-inflammatory states). A healthy immune system is also essential to normal health of dental and oral tissues. This series presents the basics for the understanding of the immune system; this article covers adaptive immunity. Clinical relevance: Dental clinicians need a basic understanding of the immune system as it underlies health and disease.

  5. Adaptation in the innate immune system and heterologous innate immunity.

    Science.gov (United States)

    Martin, Stefan F

    2014-11-01

    The innate immune system recognizes deviation from homeostasis caused by infectious or non-infectious assaults. The threshold for its activation seems to be established by a calibration process that includes sensing of microbial molecular patterns from commensal bacteria and of endogenous signals. It is becoming increasingly clear that adaptive features, a hallmark of the adaptive immune system, can also be identified in the innate immune system. Such adaptations can result in the manifestation of a primed state of immune and tissue cells with a decreased activation threshold. This keeps the system poised to react quickly. Moreover, the fact that the innate immune system recognizes a wide variety of danger signals via pattern recognition receptors that often activate the same signaling pathways allows for heterologous innate immune stimulation. This implies that, for example, the innate immune response to an infection can be modified by co-infections or other innate stimuli. This "design feature" of the innate immune system has many implications for our understanding of individual susceptibility to diseases or responsiveness to therapies and vaccinations. In this article, adaptive features of the innate immune system as well as heterologous innate immunity and their implications are discussed.

  6. The Major Players in Adaptive Immunity-Cell-mediated Immunity

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 6. The Major Players in Adaptive Immunity - Cell-mediated Immunity. Asma Ahmed Banishree Saha Anand Patwardhan Shwetha Shivaprasad Dipankar Nandi. General Article Volume 14 Issue 6 June 2009 pp 610-621 ...

  7. Adaptive immunity in autoimmune hepatitis.

    Science.gov (United States)

    Longhi, Maria Serena; Ma, Yun; Mieli-Vergani, Giorgina; Vergani, Diego

    2010-01-01

    The histological lesion of interface hepatitis, with its dense portal cell infiltrate consisting of lymphocytes, monocytes/macrophages and plasma cells, was the first to suggest an autoaggressive cellular immune attack in the pathogenesis of autoimmune hepatitis (AIH). Immunohistochemical studies, focused on the phenotype of inflammatory cells infiltrating the liver parenchyma, have shown a predominance of alphabeta-T cells. Amongst these cells, the majority have been CD4 helper/inducers, while a sizeable minority have consisted of CD8 cytotoxic/suppressors. Lymphocytes on non-T cell lineage included natural killer cells, monocytes/macrophages and B lymphocytes. For autoimmunity to arise, the self-antigenic peptide, embraced by an human leukocyte antigen (HLA) class II molecule, must be presented to an uncommitted T helper (T(H)0) lymphocyte by professional antigen-presenting cells. Once activated and according to the presence in the milieu of interleukin 12 (IL-12) or IL-4, T(H)0 lymphocytes can differentiate into T(H)1 cells, which are pivotal to macrophage activation; enhance HLA class I expression, rendering liver cells vulnerable to CD8 T-cell attack; and induce HLA class II expression on hepatocytes; or they can differentiate into T(H)2 cells, which produce IL-4, IL-10 and IL-13, cytokines favouring autoantibody production by B lymphocytes. Autoantigen recognition is tightly controlled by regulatory mechanisms, such as those exerted by CD4+CD25(high) regulatory T cells. Numerical and functional regulatory T cell impairment characterises AIH and permits the perpetuation of effector immune responses with ensuing persistent liver destruction. Advances in the study of autoreactive T cells stem mostly from AIH type 2, where the main autoantigen, cytochrome P450IID6 (CYP2D6), is known to enable characterisation of antigen-specific immune responses. Copyright 2010 S. Karger AG, Basel.

  8. Adaptive Immunity to Cryptococcus neoformans Infections

    Directory of Open Access Journals (Sweden)

    Liliane Mukaremera

    2017-11-01

    Full Text Available The Cryptococcus neoformans/Cryptococcus gattii species complex is a group of fungal pathogens with different phenotypic and genotypic diversity that cause disease in immunocompromised patients as well as in healthy individuals. The immune response resulting from the interaction between Cryptococcus and the host immune system is a key determinant of the disease outcome. The species C. neoformans causes the majority of human infections, and therefore almost all immunological studies focused on C. neoformans infections. Thus, this review presents current understanding on the role of adaptive immunity during C. neoformans infections both in humans and in animal models of disease.

  9. Necroptotic signaling in adaptive and innate immunity.

    Science.gov (United States)

    Lu, Jennifer V; Chen, Helen C; Walsh, Craig M

    2014-11-01

    The vertebrate immune system is highly dependent on cell death for efficient responsiveness to microbial pathogens and oncogenically transformed cells. Cell death pathways are vital to the function of many immune cell types during innate, humoral and cellular immune responses. In addition, cell death regulation is imperative for proper adaptive immune self-tolerance and homeostasis. While apoptosis has been found to be involved in several of these roles in immunity, recent data demonstrate that alternative cell death pathways are required. Here, we describe the involvement of a programmed form of cellular necrosis called "necroptosis" in immunity. We consider the signaling pathways that promote necroptosis downstream of death receptors, type I transmembrane proteins of the tumor necrosis factor (TNF) receptor family. The involvement of necroptotic signaling through a "RIPoptosome" assembled in response to innate immune stimuli or genotoxic stress is described. We also characterize the induction of necroptosis following antigenic stimulation in T cells lacking caspase-8 or FADD function. While necroptotic signaling remains poorly understood, it is clear that this pathway is an essential component to effective vertebrate immunity. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Innate and Adaptive Immunity to Mucorales.

    Science.gov (United States)

    Ghuman, Harlene; Voelz, Kerstin

    2017-09-05

    Mucormycosis is an invasive fungal infection characterised by rapid filamentous growth, which leads to angioinvasion, thrombosis, and tissue necrosis. The high mortality rates (50-100%) associated with mucormycosis are reflective of not only the aggressive nature of the infection and the poor therapeutics currently employed, but also the failure of the human immune system to successfully clear the infection. Immune effector interaction with Mucorales is influenced by the developmental stage of the mucormycete spore. In a healthy immune environment, resting spores are resistant to phagocytic killing. Contrarily, swollen spores and hyphae are susceptible to damage and degradation by macrophages and neutrophils. Under the effects of immune suppression, the recruitment and efficacy of macrophage and neutrophil activity against mucormycetes is considerably reduced. Following penetration of the endothelial lining, Mucorales encounter platelets. Platelets adhere to both mucormycete spores and hyphae, and exhibit germination suppression and hyphal damage capacity in vitro. Dendritic cells are activated in response to Mucorales hyphae only, and induce adaptive immunity. It is crucial to further knowledge regarding our immune system's failure to eradicate resting spores under intact immunity and inhibit fungal growth under immunocompromised conditions, in order to understand mucormycosis pathogenicity and enhance therapeutic strategies for mucormycosis.

  11. Masturbation, sexuality, and adaptation: normalization in adolescence.

    Science.gov (United States)

    Shapiro, Theodore

    2008-03-01

    During adolescence the central masturbation fantasy that is formulated during childhood takes its final form and paradoxically must now be directed outward for appropriate object finding and pair matching in the service of procreative aims. This is a step in adaptation that requires a further developmental landmark that I have called normalization. The path toward airing these private fantasies is facilitated by chumship relationships as a step toward further exposure to the social surround. Hartmann's structuring application of adaptation within psychoanalysis is used as a framework for understanding the process that simultaneously serves intrapsychic and social demands and permits goals that follow evolutionary principles. Variations in the normalization process from masturbatory isolation to a variety of forms of sexual socialization are examined in sociological data concerning current adolescent sexual behavior and in case examples that indicate some routes to normalized experience and practice.

  12. A role of the adaptive immune system in glucose homeostasis.

    Science.gov (United States)

    Bronsart, Laura L; Contag, Christopher H

    2016-01-01

    The immune system, including the adaptive immune response, has recently been recognized as having a significant role in diet-induced insulin resistance. In this study, we aimed to determine if the adaptive immune system also functions in maintaining physiological glucose homeostasis in the absence of diet-induced disease. SCID mice and immunocompetent control animals were phenotypically assessed for variations in metabolic parameters and cytokine profiles. Additionally, the glucose tolerance of SCID and immunocompetent control animals was assessed following introduction of a high-fat diet. SCID mice on a normal chow diet were significantly insulin resistant relative to control animals despite having less fat mass. This was associated with a significant increase in the innate immunity-stimulating cytokines granulocyte colony-stimulating factor, monocyte chemoattractant protein 1 (MCP1), and MCP3. Additionally, the SCID mouse phenotype was exacerbated in response to a high-fat diet as evidenced by the further significant progression of glucose intolerance. These results support the notion that the adaptive immune system plays a fundamental biological role in glucose homeostasis, and that the absence of functional B and T cells results in disruption in the concentrations of various cytokines associated with macrophage proliferation and recruitment. Additionally, the absence of functional B and T cells is not protective against diet-induced pathology.

  13. Organization of an optimal adaptive immune system

    Science.gov (United States)

    Walczak, Aleksandra; Mayer, Andreas; Balasubramanian, Vijay; Mora, Thierry

    The repertoire of lymphocyte receptors in the adaptive immune system protects organisms from a diverse set of pathogens. A well-adapted repertoire should be tuned to the pathogenic environment to reduce the cost of infections. I will discuss a general framework for predicting the optimal repertoire that minimizes the cost of infections contracted from a given distribution of pathogens. The theory predicts that the immune system will have more receptors for rare antigens than expected from the frequency of encounters and individuals exposed to the same infections will have sparse repertoires that are largely different, but nevertheless exploit cross-reactivity to provide the same coverage of antigens. I will show that the optimal repertoires can be reached by dynamics that describes the competitive binding of antigens by receptors, and selective amplification of stimulated receptors.

  14. Parser Adaptation for Social Media by Integrating Normalization

    NARCIS (Netherlands)

    van der Goot, Rob; van Noord, Gerardus

    This work explores normalization for parser adaptation. Traditionally, normalization is used as separate pre-processing step. We show that integrating the normalization model into the parsing algorithm is beneficial. This way, multiple normalization candidates can be leveraged, which improves

  15. Suppression of adoptive antituberculosis immunity by normal recipient animals

    International Nuclear Information System (INIS)

    Lefford, M.J.

    1983-01-01

    Adoptive immunity is poorly expressed in normal syngeneic mice. This phenomenon was studied by using experimental antituberculosis immunity as a model system representing pure cell-mediated immunity. Expression of adoptive immunity was facilitated by pretreating recipients with sublethal ionizing radiation (500 rads) or high doses (200 mg/kg) of cyclophosphamide or by using adult thymectomized, lethally irradiated, bone-marrow-reconstituted (TXB) mice. Adult thymectomy was less effective, and a low dose of cyclophosphamide (20 mg/kg) was completely ineffective. The beneficial effect of sublethal irradiation was reduced over time; it persisted for 4 weeks and was absent after 8 weeks. Attempts to restore the suppressed state of normal mice to sublethally irradiated mice by using normal spleen or thymus cells did not succeed. Even in rats, which express adoptive antituberculosis immunity without immunosuppressive treatment, the use of sublethally irradiated or TXB recipients potentiated adoptive immunity. It was concluded that suppression of adoptive immunization in normal recipient mice is mediated predominantly, if not exclusively, by T lymphocytes that are sensitive to a number of immunosuppressive agents. The suppressor cells are long-lived and can be regenerated from precursors that are resistant to 500 but not to 900 rads of ionizing radiation

  16. Integration of the immune system: a complex adaptive supersystem

    Science.gov (United States)

    Crisman, Mark V.

    2001-10-01

    Immunity to pathogenic organisms is a complex process involving interacting factors within the immune system including circulating cells, tissues and soluble chemical mediators. Both the efficiency and adaptive responses of the immune system in a dynamic, often hostile, environment are essential for maintaining our health and homeostasis. This paper will present a brief review of one of nature's most elegant, complex adaptive systems.

  17. The Basic Immune Simulator: An agent-based model to study the interactions between innate and adaptive immunity

    Directory of Open Access Journals (Sweden)

    Orosz Charles G

    2007-09-01

    Full Text Available Abstract Background We introduce the Basic Immune Simulator (BIS, an agent-based model created to study the interactions between the cells of the innate and adaptive immune system. Innate immunity, the initial host response to a pathogen, generally precedes adaptive immunity, which generates immune memory for an antigen. The BIS simulates basic cell types, mediators and antibodies, and consists of three virtual spaces representing parenchymal tissue, secondary lymphoid tissue and the lymphatic/humoral circulation. The BIS includes a Graphical User Interface (GUI to facilitate its use as an educational and research tool. Results The BIS was used to qualitatively examine the innate and adaptive interactions of the immune response to a viral infection. Calibration was accomplished via a parameter sweep of initial agent population size, and comparison of simulation patterns to those reported in the basic science literature. The BIS demonstrated that the degree of the initial innate response was a crucial determinant for an appropriate adaptive response. Deficiency or excess in innate immunity resulted in excessive proliferation of adaptive immune cells. Deficiency in any of the immune system components increased the probability of failure to clear the simulated viral infection. Conclusion The behavior of the BIS matches both normal and pathological behavior patterns in a generic viral infection scenario. Thus, the BIS effectively translates mechanistic cellular and molecular knowledge regarding the innate and adaptive immune response and reproduces the immune system's complex behavioral patterns. The BIS can be used both as an educational tool to demonstrate the emergence of these patterns and as a research tool to systematically identify potential targets for more effective treatment strategies for diseases processes including hypersensitivity reactions (allergies, asthma, autoimmunity and cancer. We believe that the BIS can be a useful addition to

  18. Functional aspects of the adaptive immune system in arthritis

    NARCIS (Netherlands)

    Jansen, D.T.S.L.

    2017-01-01

    The adaptive immune system is the part of the immune system that is highly specific and generates memory resulting in a fast and specific immune response upon a second infection with the same pathogen. However, when this response is specific for a part of the body itself instead of a pathogen,

  19. Linear ubiquitination signals in adaptive immune responses.

    Science.gov (United States)

    Ikeda, Fumiyo

    2015-07-01

    Ubiquitin can form eight different linkage types of chains using the intrinsic Met 1 residue or one of the seven intrinsic Lys residues. Each linkage type of ubiquitin chain has a distinct three-dimensional topology, functioning as a tag to attract specific signaling molecules, which are so-called ubiquitin readers, and regulates various biological functions. Ubiquitin chains linked via Met 1 in a head-to-tail manner are called linear ubiquitin chains. Linear ubiquitination plays an important role in the regulation of cellular signaling, including the best-characterized tumor necrosis factor (TNF)-induced canonical nuclear factor-κB (NF-κB) pathway. Linear ubiquitin chains are specifically generated by an E3 ligase complex called the linear ubiquitin chain assembly complex (LUBAC) and hydrolyzed by a deubiquitinase (DUB) called ovarian tumor (OTU) DUB with linear linkage specificity (OTULIN). LUBAC linearly ubiquitinates critical molecules in the TNF pathway, such as NEMO and RIPK1. The linear ubiquitin chains are then recognized by the ubiquitin readers, including NEMO, which control the TNF pathway. Accumulating evidence indicates an importance of the LUBAC complex in the regulation of apoptosis, development, and inflammation in mice. In this article, I focus on the role of linear ubiquitin chains in adaptive immune responses with an emphasis on the TNF-induced signaling pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Frequent adaptive immune responses against arginase-1

    DEFF Research Database (Denmark)

    Martinenaite, Evelina; Mortensen, Rasmus Erik Johansson; Hansen, Morten

    2018-01-01

    The enzyme arginase-1 reduces the availability of arginine to tumor-infiltrating immune cells, thus reducing T-cell functionality in the tumor milieu. Arginase-1 is expressed by some cancer cells and by immune inhibitory cells, such as myeloid-derived suppressor cells (MDSCs) and tumor-associated...

  1. Immune regulation by pericytes: modulating innate and adaptive immunity

    DEFF Research Database (Denmark)

    Navarro, Rocio; Compte, Marta; Álvarez-Vallina, Luis

    2016-01-01

    Pericytes (PC) are mural cells that surround endothelial cells (EC) in small blood vessels. PC have traditionally been endowed with structural functions, being essential for vessel maturation and stabilization. However, accumulating evidence suggest that PC also display immune properties. They ca...

  2. Dynamic Nature of Noncoding RNA Regulation of Adaptive Immune Response

    Directory of Open Access Journals (Sweden)

    Franca Citarella

    2013-08-01

    Full Text Available Immune response plays a fundamental role in protecting the organism from infections; however, dysregulation often occurs and can be detrimental for the organism, leading to a variety of immune-mediated diseases. Recently our understanding of the molecular and cellular networks regulating the immune response, and, in particular, adaptive immunity, has improved dramatically. For many years, much of the focus has been on the study of protein regulators; nevertheless, recent evidence points to a fundamental role for specific classes of noncoding RNAs (ncRNAs in regulating development, activation and homeostasis of the immune system. Although microRNAs (miRNAs are the most comprehensive and well-studied, a number of reports suggest the exciting possibility that long ncRNAs (lncRNAs could mediate host response and immune function. Finally, evidence is also accumulating that suggests a role for miRNAs and other small ncRNAs in autocrine, paracrine and exocrine signaling events, thus highlighting an elaborate network of regulatory interactions mediated by different classes of ncRNAs during immune response. This review will explore the multifaceted roles of ncRNAs in the adaptive immune response. In particular, we will focus on the well-established role of miRNAs and on the emerging role of lncRNAs and circulating ncRNAs, which all make indispensable contributions to the understanding of the multilayered modulation of the adaptive immune response.

  3. The immune system, adaptation, and machine learning

    Science.gov (United States)

    Farmer, J. Doyne; Packard, Norman H.; Perelson, Alan S.

    1986-10-01

    The immune system is capable of learning, memory, and pattern recognition. By employing genetic operators on a time scale fast enough to observe experimentally, the immune system is able to recognize novel shapes without preprogramming. Here we describe a dynamical model for the immune system that is based on the network hypothesis of Jerne, and is simple enough to simulate on a computer. This model has a strong similarity to an approach to learning and artificial intelligence introduced by Holland, called the classifier system. We demonstrate that simple versions of the classifier system can be cast as a nonlinear dynamical system, and explore the analogy between the immune and classifier systems in detail. Through this comparison we hope to gain insight into the way they perform specific tasks, and to suggest new approaches that might be of value in learning systems.

  4. Phylogeny, longevity and evolution of adaptive immunity

    Czech Academy of Sciences Publication Activity Database

    Vinkler, Michal; Albrecht, Tomáš

    2011-01-01

    Roč. 60, č. 3 (2011), s. 277-282 ISSN 0139-7893 R&D Projects: GA ČR GA206/08/0640; GA ČR GA206/08/1281; GA ČR GAP505/10/1871 Institutional research plan: CEZ:AV0Z60930519 Keywords : acquired immunity * evolutionary immunology * immunological priming * innate immunity * invertebrates Subject RIV: EG - Zoology Impact factor: 0.554, year: 2011

  5. Adaptive immunity and histopathology in frog virus 3-infected Xenopus

    International Nuclear Information System (INIS)

    Robert, Jacques; Morales, Heidi; Buck, Wayne; Cohen, Nicholas; Marr, Shauna; Gantress, Jennifer

    2005-01-01

    Xenopus has been used as an experimental model to evaluate the contribution of adaptive cellular immunity in amphibian host susceptibility to the emerging ranavirus FV3. Conventional histology and immunohistochemistry reveal that FV3 has a strong tropism for the proximal tubular epithelium of the kidney and is rarely disseminated elsewhere in Xenopus hosts unless their immune defenses are impaired or developmentally immature as in larvae. In such cases, virus is found widespread in most tissues. Adults, immunocompromised by depletion of CD8 + T cells or by sub-lethal γ-irradiation, show increased susceptibility to FV3 infection. Larvae and irradiated (but not normal) adults can be cross-infected through water by infected adult conspecifics (irradiated or not). The natural MHC class I deficiency and the absence of effect of anti-CD8 treatment on both larval CD8 + T cells and larval susceptibility to FV3 are consistent with an inefficient CD8 + T cell effector function during this developmental period

  6. Regionalized Development and Maintenance of the Intestinal Adaptive Immune Landscape

    DEFF Research Database (Denmark)

    Agace, William Winston; McCoy, Kathy D.

    2017-01-01

    The intestinal immune system has the daunting task of protecting us from pathogenic insults while limiting inflammatory responses against the resident commensal microbiota and providing tolerance to food antigens. This role is particularly impressive when one considers the vast mucosal surface...... and changing landscape that the intestinal immune system must monitor. In this review, we highlight regional differences in the development and composition of the adaptive immune landscape of the intestine and the impact of local intrinsic and environmental factors that shape this process. To conclude, we...... review the evidence for a critical window of opportunity for early-life exposures that affect immune development and alter disease susceptibility later in life....

  7. Immune and stress responses in oysters with insights on adaptation.

    Science.gov (United States)

    Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude

    2015-09-01

    Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Immune genes undergo more adaptive evolution than non-immune system genes in Daphnia pulex

    Directory of Open Access Journals (Sweden)

    McTaggart Seanna J

    2012-05-01

    Full Text Available Abstract Background Understanding which parts of the genome have been most influenced by adaptive evolution remains an unsolved puzzle. Some evidence suggests that selection has the greatest impact on regions of the genome that interact with other evolving genomes, including loci that are involved in host-parasite co-evolutionary processes. In this study, we used a population genetic approach to test this hypothesis by comparing DNA sequences of 30 putative immune system genes in the crustacean Daphnia pulex with 24 non-immune system genes. Results In support of the hypothesis, results from a multilocus extension of the McDonald-Kreitman (MK test indicate that immune system genes as a class have experienced more adaptive evolution than non-immune system genes. However, not all immune system genes show evidence of adaptive evolution. Additionally, we apply single locus MK tests and calculate population genetic parameters at all loci in order to characterize the mode of selection (directional versus balancing in the genes that show the greatest deviation from neutral evolution. Conclusions Our data are consistent with the hypothesis that immune system genes undergo more adaptive evolution than non-immune system genes, possibly as a result of host-parasite arms races. The results of these analyses highlight several candidate loci undergoing adaptive evolution that could be targeted in future studies.

  9. PPARγ Agonists in Adaptive Immunity: What Do Immune Disorders and Their Models Have to Tell Us?

    Directory of Open Access Journals (Sweden)

    Laurindo Ferreira da Rocha Junior

    2013-01-01

    Full Text Available Adaptive immunity has evolved as a very powerful and highly specialized tool of host defense. Its classical protagonists are lymphocytes of the T- and B-cell lineage. Cytokines and chemokines play a key role as effector mechanisms of the adaptive immunity. Some autoimmune and inflammatory diseases are caused by disturbance of the adaptive immune system. Recent advances in understanding the pathogenesis of autoimmune diseases have led to research on new molecular and therapeutic targets. PPARγ are members of the nuclear receptor superfamily and are transcription factors involved in lipid metabolism as well as innate and adaptive immunity. PPARγ is activated by synthetic and endogenous ligands. Previous studies have shown that PPAR agonists regulate T-cell survival, activation and T helper cell differentiation into effector subsets: Th1, Th2, Th17, and Tregs. PPARγ has also been associated with B cells. The present review addresses these issues by placing PPARγ agonists in the context of adaptive immune responses and the relation of the activation of these receptors with the expression of cytokines involved in adaptive immunity.

  10. CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity

    Science.gov (United States)

    Barrangou, Rodolphe; Marraffini, Luciano A.

    2014-01-01

    Summary Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), and associated proteins (Cas) comprise the CRISPR-Cas system, which confers adaptive immunity against exogenic elements in many bacteria and most archaea. CRISPR-mediated immunization occurs through the uptake of DNA from invasive genetic elements such as plasmids and viruses, followed by its integration into CRISPR loci. These loci are subsequently transcribed and processed into small interfering RNAs that guide nucleases for specific cleavage of complementary sequences. Conceptually, CRISPR-Cas shares functional features with the mammalian adaptive immune system, while also exhibiting characteristics of Lamarckian evolution. Because immune markers spliced from exogenous agents are integrated iteratively in CRISPR loci, they constitute a genetic record of vaccination events and reflect environmental conditions and changes over time. Cas endonucleases, which can be reprogrammed by small guide RNAs have shown unprecedented potential and flexibility for genome editing, and can be repurposed for numerous DNA targeting applications including transcriptional control. PMID:24766887

  11. Quantifying adaptive evolution in the Drosophila immune system.

    Directory of Open Access Journals (Sweden)

    Darren J Obbard

    2009-10-01

    Full Text Available It is estimated that a large proportion of amino acid substitutions in Drosophila have been fixed by natural selection, and as organisms are faced with an ever-changing array of pathogens and parasites to which they must adapt, we have investigated the role of parasite-mediated selection as a likely cause. To quantify the effect, and to identify which genes and pathways are most likely to be involved in the host-parasite arms race, we have re-sequenced population samples of 136 immunity and 287 position-matched non-immunity genes in two species of Drosophila. Using these data, and a new extension of the McDonald-Kreitman approach, we estimate that natural selection fixes advantageous amino acid changes in immunity genes at nearly double the rate of other genes. We find the rate of adaptive evolution in immunity genes is also more variable than other genes, with a small subset of immune genes evolving under intense selection. These genes, which are likely to represent hotspots of host-parasite coevolution, tend to share similar functions or belong to the same pathways, such as the antiviral RNAi pathway and the IMD signalling pathway. These patterns appear to be general features of immune system evolution in both species, as rates of adaptive evolution are correlated between the D. melanogaster and D. simulans lineages. In summary, our data provide quantitative estimates of the elevated rate of adaptive evolution in immune system genes relative to the rest of the genome, and they suggest that adaptation to parasites is an important force driving molecular evolution.

  12. Heme oxygenase and the immune system in normal and pathological pregnancies

    Directory of Open Access Journals (Sweden)

    Maide eOzen

    2015-04-01

    Full Text Available Normal pregnancy is an immunotolerant state. Many factors, including environmental, socioeconomic, genetic, and immunologic changes by infection and/or other causes of inflammation, may contribute to inter-individual differences resulting in a normal or pathologic pregnancy. In particular, imbalances in the immune system can cause many pregnancy-related diseases, such as infertility, abortions, pre-eclampsia, and preterm labor, which result in maternal/fetal death, prematurity, or small-for-gestational age newborns. New findings imply that myeloid regulatory cells and regulatory T cells (Tregs may mediate immunotolerance during normal pregnancy. Effector T cells (Teffs have, in contrast, been implicated to cause adverse pregnancy outcomes. Furthermore, feto-maternal tolerance affects the developing fetus. It has been shown that the Treg/Teff balance affects litter size and adoptive transfer of pregnancy-induced Tregs can prevent fetal rejection in the mouse. Heme oxygenase-1 (HO-1 has a protective role in many conditions through its anti-inflammatory, anti-apoptotic, antioxidative, and anti-proliferative actions. HO-1 is highly expressed in the placenta and plays a role in angiogenesis and placental vascular development and in regulating vascular tone in pregnancy. In addition, HO-1 is a major regulator of immune homeostasis by mediating crosstalk between innate and adaptive immune systems. Moreover, HO-1 can inhibit inflammation-induced phenotypic maturation of immune effector cells and pro-inflammatory cytokine secretion and promote anti-inflammatory cytokine production. HO-1 may also be associated with T-cell activation and can limit immune-based tissue injury by promoting Treg suppression of effector responses. Thus, HO-1 and its byproducts may protect against pregnancy complications by its immunomodulatory effects, and the regulation of HO-1 or its downstream effects has the potential to prevent or treat pregnancy complications and

  13. An Immune-inspired Adaptive Automated Intrusion Response System Model

    Directory of Open Access Journals (Sweden)

    Ling-xi Peng

    2012-09-01

    Full Text Available An immune-inspired adaptive automated intrusion response system model, named as , is proposed. The descriptions of self, non-self, immunocyte, memory detector, mature detector and immature detector of the network transactions, and the realtime network danger evaluation equations are given. Then, the automated response polices are adaptively performed or adjusted according to the realtime network danger. Thus, not only accurately evaluates the network attacks, but also greatly reduces the response times and response costs.

  14. Genetic adaptation of the antibacterial human innate immunity network

    Directory of Open Access Journals (Sweden)

    Lazarus Ross

    2011-07-01

    Full Text Available Abstract Background Pathogens have represented an important selective force during the adaptation of modern human populations to changing social and other environmental conditions. The evolution of the immune system has therefore been influenced by these pressures. Genomic scans have revealed that immune system is one of the functions enriched with genes under adaptive selection. Results Here, we describe how the innate immune system has responded to these challenges, through the analysis of resequencing data for 132 innate immunity genes in two human populations. Results are interpreted in the context of the functional and interaction networks defined by these genes. Nucleotide diversity is lower in the adaptors and modulators functional classes, and is negatively correlated with the centrality of the proteins within the interaction network. We also produced a list of candidate genes under positive or balancing selection in each population detected by neutrality tests and showed that some functional classes are preferential targets for selection. Conclusions We found evidence that the role of each gene in the network conditions the capacity to evolve or their evolvability: genes at the core of the network are more constrained, while adaptation mostly occurred at particular positions at the network edges. Interestingly, the functional classes containing most of the genes with signatures of balancing selection are involved in autoinflammatory and autoimmune diseases, suggesting a counterbalance between the beneficial and deleterious effects of the immune response.

  15. Genetic adaptation of the antibacterial human innate immunity network.

    Science.gov (United States)

    Casals, Ferran; Sikora, Martin; Laayouni, Hafid; Montanucci, Ludovica; Muntasell, Aura; Lazarus, Ross; Calafell, Francesc; Awadalla, Philip; Netea, Mihai G; Bertranpetit, Jaume

    2011-07-11

    Pathogens have represented an important selective force during the adaptation of modern human populations to changing social and other environmental conditions. The evolution of the immune system has therefore been influenced by these pressures. Genomic scans have revealed that immune system is one of the functions enriched with genes under adaptive selection. Here, we describe how the innate immune system has responded to these challenges, through the analysis of resequencing data for 132 innate immunity genes in two human populations. Results are interpreted in the context of the functional and interaction networks defined by these genes. Nucleotide diversity is lower in the adaptors and modulators functional classes, and is negatively correlated with the centrality of the proteins within the interaction network. We also produced a list of candidate genes under positive or balancing selection in each population detected by neutrality tests and showed that some functional classes are preferential targets for selection. We found evidence that the role of each gene in the network conditions the capacity to evolve or their evolvability: genes at the core of the network are more constrained, while adaptation mostly occurred at particular positions at the network edges. Interestingly, the functional classes containing most of the genes with signatures of balancing selection are involved in autoinflammatory and autoimmune diseases, suggesting a counterbalance between the beneficial and deleterious effects of the immune response.

  16. Deficiency of adaptive immunity does not interfere with Wallerian degeneration.

    Directory of Open Access Journals (Sweden)

    Christopher R Cashman

    Full Text Available Following injury, distal axons undergo the process of Wallerian degeneration, and then cell debris is cleared to create a permissive environment for axon regeneration. The innate and adaptive immune systems are believed to be critical for facilitating the clearance of myelin and axonal debris during this process. However, immunodeficient animal models are regularly used in transplantation studies investigating cell therapies to modulate the degenerative/regenerative response. Given the importance of the immune system in preparing a permissive environment for regeneration by clearing debris, animals lacking, in part or in full, a functional immune system may have an impaired ability to regenerate due to poor myelin clearance, and may, thus, be poor hosts to study modulators of regeneration and degeneration. To study this hypothesis, three different mouse models with impaired adaptive immunity were compared to wild type animals in their ability to degenerate axons and clear myelin debris one week following sciatic nerve transection. Immunofluorescent staining for axons and quantitation of axon density with nerve histomorphometry of the distal stump showed no consistent discrepancy between immunodeficient and wild type animals, suggesting axons tended to degenerate equally between the two groups. Debris clearance was assessed by macrophage density and relative myelin basic protein expression within the denervated nerve stump, and no consistent impairment of debris clearance was found. These data suggested deficiency of the adaptive immune system does not have a substantial effect on axon degeneration one week following axonal injury.

  17. Adaptive immunity to rhinoviruses: sex and age matter

    Directory of Open Access Journals (Sweden)

    Pritchard Antonia L

    2010-12-01

    Full Text Available Abstract Background Rhinoviruses (RV are key triggers in acute asthma exacerbations. Previous studies suggest that men suffer from infectious diseases more frequently and with greater severity than women. Additionally, the immune response to most infections and vaccinations decreases with age. Most immune function studies do not account for such differences, therefore the aim of this study was to determine if the immune response to rhinovirus varies with sex or age. Methods Blood mononuclear cells were isolated from 63 healthy individuals and grouped by sex and age (≤50 years old and ≥52 years old. Cells were cultured with rhinovirus 16 at a multiplicity of infection of 1. The chemokine IP-10 was measured at 24 h as an index of innate immunity while IFNγ and IL-13 were measured at 5 days as an index of adaptive immunity. Results Rhinovirus induced IFNγ and IL-13 was significantly higher in ≤50 year old women than in age matched men (p 0.005. There was no sex or age based difference in rhinovirus induced IP-10 expression. Both IFNγ and IL-13 were negatively correlated with age in women but not in men. Conclusions This study suggests that pre-menopausal women have a stronger adaptive immune response to rhinovirus infection than men and older people, though the mechanisms responsible for these differences remain to be determined. Our findings highlight the importance of gender and age balance in clinical studies and in the development of new treatments and vaccines.

  18. Convergence of the innate and adaptive immunity during human aging

    Directory of Open Access Journals (Sweden)

    Branca Isabel Pereira

    2016-11-01

    Full Text Available Aging is associated with profound changes in the human immune system, a phenomenon referred to as immunosenescence. This complex immune remodeling affects the adaptive immune system and the CD8+ T cell compartment in particular, leading to the accumulation of terminally differentiated T cells, which can rapidly exert their effector functions at the expenses of a limited proliferative potential. In this review we will discuss evidence suggesting that senescent αβCD8+ T cells acquire the hallmarks of innate-like T cells and use recently acquired NK cell receptors as an alternative mechanism to mediate rapid effector functions. These cells concomitantly lose expression of co-stimulatory receptors and exhibit decreased TCR signaling suggesting a functional shift away from antigen specific activation. The convergence of innate and adaptive features in senescent T cells challenges the classic division between innate and adaptive immune systems. Innate-like T cells are particularly important for stress and tumor surveillance and we propose a new role for these cells in aging, where the acquisition of innate-like functions may represent a beneficial adaptation to an increased burden of malignancy with age, although it may also pose a higher risk of autoimmune disorders.

  19. Type 2 immunity and wound healing: evolutionary refinement of adaptive immunity by helminths

    Science.gov (United States)

    Gause, William C.; Wynn, Thomas A.; Allen, Judith E.

    2013-01-01

    Helminth-induced type 2 immune responses, which are characterized by the T helper 2 cell-associated cytokines interleukin-4 (IL-4) and IL-13, mediate host protection through enhanced tissue repair, the control of inflammation and worm expulsion. In this Opinion article, we consider type 2 immunity in the context of helminth-mediated tissue damage. We examine the relationship between the control of helminth infection and the mechanisms of wound repair, and we provide a new understanding of the adaptive type 2 immune response and its contribution to both host tolerance and resistance. PMID:23827958

  20. The Adaptive Immune System of Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Lisa-Katharina Maier

    2015-02-01

    Full Text Available To fight off invading genetic elements, prokaryotes have developed an elaborate defence system that is both adaptable and heritable—the CRISPR-Cas system (CRISPR is short for: clustered regularly interspaced short palindromic repeats and Cas: CRISPR associated. Comprised of proteins and multiple small RNAs, this prokaryotic defence system is present in 90% of archaeal and 40% of bacterial species, and enables foreign intruders to be eliminated in a sequence-specific manner. There are three major types (I–III and at least 14 subtypes of this system, with only some of the subtypes having been analysed in detail, and many aspects of the defence reaction remaining to be elucidated. Few archaeal examples have so far been analysed. Here we summarize the characteristics of the CRISPR-Cas system of Haloferax volcanii, an extremely halophilic archaeon originally isolated from the Dead Sea. It carries a single CRISPR-Cas system of type I-B, with a Cascade like complex composed of Cas proteins Cas5, Cas6b and Cas7. Cas6b is essential for CRISPR RNA (crRNA maturation but is otherwise not required for the defence reaction. A systematic search revealed that six protospacer adjacent motif (PAM sequences are recognised by the Haloferax defence system. For successful invader recognition, a non-contiguous seed sequence of 10 base-pairs between the crRNA and the invader is required.

  1. Staphylococcal Immune Evasion Proteins: Structure, Function, and Host Adaptation.

    Science.gov (United States)

    Koymans, Kirsten J; Vrieling, Manouk; Gorham, Ronald D; van Strijp, Jos A G

    2017-01-01

    Staphylococcus aureus is a successful human and animal pathogen. Its pathogenicity is linked to its ability to secrete a large amount of virulence factors. These secreted proteins interfere with many critical components of the immune system, both innate and adaptive, and hamper proper immune functioning. In recent years, numerous studies have been conducted in order to understand the molecular mechanism underlying the interaction of evasion molecules with the host immune system. Structural studies have fundamentally contributed to our understanding of the mechanisms of action of the individual factors. Furthermore, such studies revealed one of the most striking characteristics of the secreted immune evasion molecules: their conserved structure. Despite high-sequence variability, most immune evasion molecules belong to a small number of structural categories. Another remarkable characteristic is that S. aureus carries most of these virulence factors on mobile genetic elements (MGE) or ex-MGE in its accessory genome. Coevolution of pathogen and host has resulted in immune evasion molecules with a highly host-specific function and prevalence. In this review, we explore how these shared structures and genomic locations relate to function and host specificity. This is discussed in the context of therapeutic options for these immune evasion molecules in infectious as well as in inflammatory diseases.

  2. Regulation of intestinal homeostasis by innate and adaptive immunity.

    Science.gov (United States)

    Kayama, Hisako; Takeda, Kiyoshi

    2012-11-01

    The intestine is a unique tissue where an elaborate balance is maintained between tolerance and immune responses against a variety of environmental factors such as food and the microflora. In a healthy individual, the microflora stimulates innate and adaptive immune systems to maintain gut homeostasis. However, the interaction of environmental factors with particular genetic backgrounds can lead to dramatic changes in the composition of the microflora (i.e. dysbiosis). Many of the specific commensal-bacterial products and the signaling pathways they trigger have been characterized. The role of T(h)1, T(h)2 and T(h)17 cells in inflammatory bowel disease has been widely investigated, as has the contribution of epithelial cells and subsets of dendritic cells and macrophages. To date, multiple regulatory cells in adaptive immunity, such as regulatory T cells and regulatory B cells, have been shown to maintain gut homeostasis by preventing inappropriate innate and adaptive immune responses to commensal bacteria. Additionally, regulatory myeloid cells have recently been identified that prevent intestinal inflammation by inhibiting T-cell proliferation. An increasing body of evidence has shown that multiple regulatory mechanisms contribute to the maintenance of gut homeostasis.

  3. Diverse Roles of Inhibitor of Differentiation 2 in Adaptive Immunity

    Directory of Open Access Journals (Sweden)

    Lucille Rankin

    2011-01-01

    Full Text Available The helix-loop-helix (HLH transcription factor inhibitor of DNA binding 2 (Id2 has been implicated as a regulator of hematopoiesis and embryonic development. While its role in early lymphopoiesis has been well characterized, new roles in adaptive immune responses have recently been uncovered opening exciting new directions for investigation. In the innate immune system, Id2 is required for the development of mature natural killer (NK cells, lymphoid tissue-inducer (LTi cells, and the recently identified interleukin (IL-22 secreting nonconventional innate lymphocytes found in the gut. In addition, Id2 has been implicated in the development of specific dendritic cell (DC subsets, decisions determining the formation of αβ and γδ T-cell development, NK T-cell behaviour, and in the maintenance of effector and memory CD8+ T cells in peripheral tissues. Here, we review the current understanding of the role of Id2 in lymphopoiesis and in the development of the adaptive immune response required for maintaining immune homeostasis and immune protection.

  4. Adaptive nonlinear control using input normalized neural networks

    International Nuclear Information System (INIS)

    Leeghim, Henzeh; Seo, In Ho; Bang, Hyo Choong

    2008-01-01

    An adaptive feedback linearization technique combined with the neural network is addressed to control uncertain nonlinear systems. The neural network-based adaptive control theory has been widely studied. However, the stability analysis of the closed-loop system with the neural network is rather complicated and difficult to understand, and sometimes unnecessary assumptions are involved. As a result, unnecessary assumptions for stability analysis are avoided by using the neural network with input normalization technique. The ultimate boundedness of the tracking error is simply proved by the Lyapunov stability theory. A new simple update law as an adaptive nonlinear control is derived by the simplification of the input normalized neural network assuming the variation of the uncertain term is sufficiently small

  5. Viral Diversity Threshold for Adaptive Immunity in Prokaryotes

    Science.gov (United States)

    Weinberger, Ariel D.; Wolf, Yuri I.; Lobkovsky, Alexander E.; Gilmore, Michael S.; Koonin, Eugene V.

    2012-01-01

    ABSTRACT Bacteria and archaea face continual onslaughts of rapidly diversifying viruses and plasmids. Many prokaryotes maintain adaptive immune systems known as clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated genes (Cas). CRISPR-Cas systems are genomic sensors that serially acquire viral and plasmid DNA fragments (spacers) that are utilized to target and cleave matching viral and plasmid DNA in subsequent genomic invasions, offering critical immunological memory. Only 50% of sequenced bacteria possess CRISPR-Cas immunity, in contrast to over 90% of sequenced archaea. To probe why half of bacteria lack CRISPR-Cas immunity, we combined comparative genomics and mathematical modeling. Analysis of hundreds of diverse prokaryotic genomes shows that CRISPR-Cas systems are substantially more prevalent in thermophiles than in mesophiles. With sequenced bacteria disproportionately mesophilic and sequenced archaea mostly thermophilic, the presence of CRISPR-Cas appears to depend more on environmental temperature than on bacterial-archaeal taxonomy. Mutation rates are typically severalfold higher in mesophilic prokaryotes than in thermophilic prokaryotes. To quantitatively test whether accelerated viral mutation leads microbes to lose CRISPR-Cas systems, we developed a stochastic model of virus-CRISPR coevolution. The model competes CRISPR-Cas-positive (CRISPR-Cas+) prokaryotes against CRISPR-Cas-negative (CRISPR-Cas−) prokaryotes, continually weighing the antiviral benefits conferred by CRISPR-Cas immunity against its fitness costs. Tracking this cost-benefit analysis across parameter space reveals viral mutation rate thresholds beyond which CRISPR-Cas cannot provide sufficient immunity and is purged from host populations. These results offer a simple, testable viral diversity hypothesis to explain why mesophilic bacteria disproportionately lack CRISPR-Cas immunity. More generally, fundamental limits on the adaptability of biological

  6. CRISPR-Cas systems: Prokaryotes upgrade to adaptive immunity.

    Science.gov (United States)

    Barrangou, Rodolphe; Marraffini, Luciano A

    2014-04-24

    Clustered regularly interspaced short palindromic repeats (CRISPR), and associated proteins (Cas) comprise the CRISPR-Cas system, which confers adaptive immunity against exogenic elements in many bacteria and most archaea. CRISPR-mediated immunization occurs through the uptake of DNA from invasive genetic elements such as plasmids and viruses, followed by its integration into CRISPR loci. These loci are subsequently transcribed and processed into small interfering RNAs that guide nucleases for specific cleavage of complementary sequences. Conceptually, CRISPR-Cas shares functional features with the mammalian adaptive immune system, while also exhibiting characteristics of Lamarckian evolution. Because immune markers spliced from exogenous agents are integrated iteratively in CRISPR loci, they constitute a genetic record of vaccination events and reflect environmental conditions and changes over time. Cas endonucleases, which can be reprogrammed by small guide RNAs have shown unprecedented potential and flexibility for genome editing and can be repurposed for numerous DNA targeting applications including transcriptional control. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

    1987-01-01

    The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

  8. Mechanisms Underlying the Regulation of Innate and Adaptive Immunity by Vitamin D.

    Science.gov (United States)

    Wei, Ran; Christakos, Sylvia

    2015-09-24

    Non-classical actions of vitamin D were first suggested over 30 years ago when receptors for the active form of vitamin D, 1,25-dihydroxyvitamin D3 (1,25(OH)2D3), were detected in various tissues and cells that are not associated with the regulation of calcium homeostasis, including activated human inflammatory cells. The question that remained was the biological significance of the presence of vitamin D receptors in the different tissues and cells and, with regard to the immune system, whether or not vitamin D plays a role in the normal immune response and in modifying immune mediated diseases. In this article findings indicating that vitamin D is a key factor regulating both innate and adaptive immunity are reviewed with a focus on the molecular mechanisms involved. In addition, the physiological significance of vitamin D action, as suggested by in vivo studies in mouse models is discussed. Together, the findings indicate the importance of 1,25(OH)2D3 as a regulator of key components of the immune system. An understanding of the mechanisms involved will lead to potential therapeutic applications for the treatment of immune mediated diseases.

  9. Adaptive Immunity to Francisella tularensis and Considerations for Vaccine Development

    Directory of Open Access Journals (Sweden)

    Lydia M. Roberts

    2018-04-01

    Full Text Available Francisella tularensis is an intracellular bacterium that causes the disease tularemia. There are several subspecies of F. tularensis whose ability to cause disease varies in humans. The most virulent subspecies, tularensis, is a Tier One Select Agent and a potential bioweapon. Although considerable effort has made to generate efficacious tularemia vaccines, to date none have been licensed for use in the United States. Despite the lack of a tularemia vaccine, we have learned a great deal about the adaptive immune response the underlies protective immunity. Herein, we detail the animal models commonly used to study tularemia and their recapitulation of human disease, the field's current understanding of vaccine-mediated protection, and discuss the challenges associated with new vaccine development.

  10. Alterations in adaptive immunity persist during long-duration spaceflight

    Science.gov (United States)

    Crucian, Brian; Stowe, Raymond P; Mehta, Satish; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2015-01-01

    Background: It is currently unknown whether immune system alterations persist during long-duration spaceflight. In this study various adaptive immune parameters were assessed in astronauts at three intervals during 6-month spaceflight on board the International Space Station (ISS). AIMS: To assess phenotypic and functional immune system alterations in astronauts participating in 6-month orbital spaceflight. Methods: Blood was collected before, during, and after flight from 23 astronauts participating in 6-month ISS expeditions. In-flight samples were returned to Earth within 48 h of collection for immediate analysis. Assays included peripheral leukocyte distribution, T-cell function, virus-specific immunity, and mitogen-stimulated cytokine production profiles. Results: Redistribution of leukocyte subsets occurred during flight, including an elevated white blood cell (WBC) count and alterations in CD8+ T-cell maturation. A reduction in general T-cell function (both CD4+ and CD8+) persisted for the duration of the 6-month spaceflights, with differential responses between mitogens suggesting an activation threshold shift. The percentage of CD4+ T cells capable of producing IL-2 was depressed after landing. Significant reductions in mitogen-stimulated production of IFNγ, IL-10, IL-5, TNFα, and IL-6 persisted during spaceflight. Following lipopolysaccharide (LPS) stimulation, production of IL-10 was reduced, whereas IL-8 production was increased during flight. Conclusions: The data indicated that immune alterations persist during long-duration spaceflight. This phenomenon, in the absence of appropriate countermeasures, has the potential to increase specific clinical risks for crewmembers during exploration-class deep space missions. PMID:28725716

  11. TIPE2, a negative regulator of innate and adaptive immunity that maintains immune homeostasis.

    Science.gov (United States)

    Sun, Honghong; Gong, Shunyou; Carmody, Ruaidhri J; Hilliard, Anja; Li, Li; Sun, Jing; Kong, Li; Xu, Lingyun; Hilliard, Brendan; Hu, Shimin; Shen, Hao; Yang, Xiaolu; Chen, Youhai H

    2008-05-02

    Immune homeostasis is essential for the normal functioning of the immune system, and its breakdown leads to fatal inflammatory diseases. We report here the identification of a member of the tumor necrosis factor-alpha-induced protein-8 (TNFAIP8) family, designated TIPE2, that is required for maintaining immune homeostasis. TIPE2 is preferentially expressed in lymphoid tissues, and its deletion in mice leads to multiorgan inflammation, splenomegaly, and premature death. TIPE2-deficient animals are hypersensitive to septic shock, and TIPE2-deficient cells are hyper-responsive to Toll-like receptor (TLR) and T cell receptor (TCR) activation. Importantly, TIPE2 binds to caspase-8 and inhibits activating protein-1 and nuclear factor-kappaB activation while promoting Fas-induced apoptosis. Inhibiting caspase-8 significantly blocks the hyper-responsiveness of TIPE2-deficient cells. These results establish that TIPE2 is an essential negative regulator of TLR and TCR function, and its selective expression in the immune system prevents hyperresponsiveness and maintains immune homeostasis.

  12. Functional neuroimaging of normal aging: Declining brain, adapting brain.

    Science.gov (United States)

    Sugiura, Motoaki

    2016-09-01

    Early functional neuroimaging research on normal aging brain has been dominated by the interest in cognitive decline. In this framework the age-related compensatory recruitment of prefrontal cortex, in terms of executive system or reduced lateralization, has been established. Further details on these compensatory mechanisms and the findings reflecting cognitive decline, however, remain the matter of intensive investigations. Studies in another framework where age-related neural alteration is considered adaptation to the environmental change are recently burgeoning and appear largely categorized into three domains. The age-related increase in activation of the sensorimotor network may reflect the alteration of the peripheral sensorimotor systems. The increased susceptibility of the network for the mental-state inference to the socioemotional significance may be explained by the age-related motivational shift due to the altered social perception. The age-related change in activation of the self-referential network may be relevant to the focused positive self-concept of elderly driven by a similar motivational shift. Across the domains, the concept of the self and internal model may provide the theoretical bases of this adaptation framework. These two frameworks complement each other to provide a comprehensive view of the normal aging brain. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. The Hayflick Limit and Age-Related Adaptive Immune Deficiency.

    Science.gov (United States)

    Gill, Zoe; Nieuwoudt, Martin; Ndifon, Wilfred

    2018-01-01

    The adaptive immune system (AIS) acquires significant deficiency during chronological ageing, making older individuals more susceptible to infections and less responsive to vaccines compared to younger individuals. At the cellular level, one of the most striking features of this ageing-related immune deficiency is the dramatic loss of T-cell diversity that occurs in elderly humans. After the age of 70 years, there is a sharp decline in the diversity of naïve T cells, including a >10-fold decrease in the CD4+ compartment and a >100-fold decrease in the CD8+ compartment. Such changes are detrimental because the AIS relies on a diverse naïve T-cell pool to respond to novel pathogens. Recent work suggests that this collapse of naïve T-cell diversity results from T cells reaching the Hayflick limit and being eliminated through both antigen-dependent and -independent pathways. The progressive attrition of telomeres is the molecular mechanism that underlies this Hayflick limit. Therefore, we propose that by measuring the telomere lengths of T cells with high resolution, it is possible to develop a unique biomarker of immune deficiency, potentially much better correlated with individual susceptibility to diseases compared to chronological age alone. © 2017 S. Karger AG, Basel.

  14. The role of the adaptive immune system in regulation of gut microbiota.

    Science.gov (United States)

    Kato, Lucia M; Kawamoto, Shimpei; Maruya, Mikako; Fagarasan, Sidonia

    2014-07-01

    The gut nourishes rich bacterial communities that affect profoundly the functions of the immune system. The relationship between gut microbiota and the immune system is one of reciprocity. The microbiota contributes to nutrient processing and the development, maturation, and function of the immune system. Conversely, the immune system, particularly the adaptive immune system, plays a key role in shaping the repertoire of gut microbiota. The fitness of host immune system is reflected in the gut microbiota, and deficiencies in either innate or adaptive immunity impact on diversity and structures of bacterial communities in the gut. Here, we discuss the mechanisms that underlie this reciprocity and emphasize how the adaptive immune system via immunoglobulins (i.e. IgA) contributes to diversification and balance of gut microbiota required for immune homeostasis. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Targeting innate immunity to downmodulate adaptive immunity and reverse type 1 diabetes

    Directory of Open Access Journals (Sweden)

    Itoh A

    2017-05-01

    Full Text Available Arata Itoh, William M Ridgway Division of Immunology, Allergy and Rheumatology, University of Cincinnati College of Medicine, Cincinnati, OH, USA Abstract: Type 1 diabetes (T1D is characterized by specific destruction of pancreatic insulin-producing beta cells accompanied by evidence of beta-cell-directed autoimmunity such as autoreactive T cells and islet autoantibodies (IAAs. Currently, T1D cannot be prevented or reversed in humans. T1D is easy to prevent in the nonobese diabetic (NOD spontaneous mouse model but reversing new-onset T1D in mice is more difficult. Since the discovery of the T-cell receptor in the 1980s and the subsequent identification of autoreactive T cells directed toward beta-cell antigens (eg, insulin, glutamic acid decarboxylase, the dream of antigen-specific immunotherapy has dominated the field with its promise of specificity and limited side effects. While such approaches have worked in the NOD mouse, however, dozens of human trials have failed. Broader immunosuppressive approaches (originally cyclosporine, subsequently anti-CD3 antibody have shown partial successes (e.g., prolonged C peptide preservation but no major therapeutic efficacy or disease reversal. Human prevention trials have failed, despite the ease of such approaches in the NOD mouse. In the past 50 years, the incidence of T1D has increased dramatically, and one explanation is the “hygiene hypothesis”, which suggests that decreased exposure of the innate immune system to environmental immune stimulants (e.g., bacterial products such as Toll-like receptor (TLR 4-stimulating lipopolysaccharide [LPS] dramatically affects the adaptive immune system and increases subsequent autoimmunity. We have tested the role of innate immunity in autoimmune T1D by treating acute-onset T1D in NOD mice with anti-TLR4/MD-2 agonistic antibodies and have shown a high rate of disease reversal. The TLR4 antibodies do not directly stimulate T cells but induce tolerogenic

  16. BACH transcription factors in innate and adaptive immunity.

    Science.gov (United States)

    Igarashi, Kazuhiko; Kurosaki, Tomohiro; Roychoudhuri, Rahul

    2017-07-01

    BTB and CNC homology (BACH) proteins are transcriptional repressors of the basic region leucine zipper (bZIP) transcription factor family. Recent studies indicate widespread roles of BACH proteins in controlling the development and function of the innate and adaptive immune systems, including the differentiation of effector and memory cells of the B and T cell lineages, CD4 + regulatory T cells and macrophages. Here, we emphasize similarities at a molecular level in the cell-type-specific activities of BACH factors, proposing that competitive interactions of BACH proteins with transcriptional activators of the bZIP family form a common mechanistic theme underlying their diverse actions. The findings contribute to a general understanding of how transcriptional repressors shape lineage commitment and cell-type-specific functions through repression of alternative lineage programmes.

  17. Linking autoimmunity to the origin of the adaptive immune system.

    Science.gov (United States)

    Bayersdorf, Robert; Fruscalzo, Arrigo; Catania, Francesco

    2018-01-01

    In jawed vertebrates, the adaptive immune system (AIS) cooperates with the innate immune system (IIS) to protect hosts from infections. Although targeting non-self-components, the AIS also generates self-reactive antibodies which, when inadequately counter-selected, can give rise to autoimmune diseases (ADs). ADs are on the rise in western countries. Why haven't ADs been eliminated during the evolution of a ∼500 million-year old system? And why have they become more frequent in recent decades? Self-recognition is an attribute of the phylogenetically more ancient IIS and empirical data compellingly show that some self-reactive antibodies, which are classifiable as elements of the IIS rather then the AIS, may protect from (rather than cause) ADs. Here, we propose that the IIS's self-recognition system originally fathered the AIS and, as a consequence of this relationship, its activity is dampened in hygienic environments. Rather than a mere breakdown or failure of the mechanisms of self-tolerance, ADs might thus arise from architectural constraints.

  18. Evolution of vertebrate adaptive immunity: immune cells and tissues, and AID/APOBEC cytidine deaminases.

    Science.gov (United States)

    Hirano, Masayuki

    2015-08-01

    All surviving jawed vertebrate representatives achieve diversity in immunoglobulin-based B and T cell receptors for antigen recognition through recombinatorial rearrangement of V(D)J segments. However, the extant jawless vertebrates, lampreys and hagfish, instead generate three types of variable lymphocyte receptors (VLRs) through a template-mediated combinatorial assembly of different leucine-rich repeat (LRR) sequences. The clonally diverse VLRB receptors are expressed by B-like lymphocytes, while the VLRA and VLRC receptors are expressed by lymphocyte lineages that resemble αβ and γδ T lymphocytes, respectively. These findings suggest that three basic types of lymphocytes, one B-like and two T-like, are an essential feature of vertebrate adaptive immunity. Around 500 million years ago, a common ancestor of jawed and jawless vertebrates evolved a genetic program for the development of prototypic lymphoid cells as a foundation for an adaptive immune system. This acquisition preceded the convergent evolution of alternative types of clonally diverse receptors for antigens in all vertebrates, as reviewed in this article. © 2015 WILEY Periodicals, Inc.

  19. The Memories of NK Cells: Innate-Adaptive Immune Intrinsic Crosstalk.

    Science.gov (United States)

    Gabrielli, Sara; Ortolani, Claudio; Del Zotto, Genny; Luchetti, Francesca; Canonico, Barbara; Buccella, Flavia; Artico, Marco; Papa, Stefano; Zamai, Loris

    2016-01-01

    Although NK cells are considered part of the innate immune system, a series of evidences has demonstrated that they possess characteristics typical of the adaptive immune system. These NK adaptive features, in particular their memory-like functions, are discussed from an ontogenetic and evolutionary point of view.

  20. The Memories of NK Cells: Innate-Adaptive Immune Intrinsic Crosstalk

    Directory of Open Access Journals (Sweden)

    Sara Gabrielli

    2016-01-01

    Full Text Available Although NK cells are considered part of the innate immune system, a series of evidences has demonstrated that they possess characteristics typical of the adaptive immune system. These NK adaptive features, in particular their memory-like functions, are discussed from an ontogenetic and evolutionary point of view.

  1. Effect of Scoparia dulcis on noise stress induced adaptive immunity and cytokine response in immunized Wistar rats

    Directory of Open Access Journals (Sweden)

    Loganathan Sundareswaran

    2017-01-01

    Conclusion: S. dulcis (SD has normalized and prevented the noise induced changes in cell-mediated and humoral immunity and it could be the presence of anti-stressor and immuno stimulant activity of the plant.

  2. Optimal adaptive normalized matched filter for large antenna arrays

    KAUST Repository

    Kammoun, Abla

    2016-09-13

    This paper focuses on the problem of detecting a target in the presence of a compound Gaussian clutter with unknown statistics. To this end, we focus on the design of the adaptive normalized matched filter (ANMF) detector which uses the regularized Tyler estimator (RTE) built from N-dimensional observations x, · · ·, x in order to estimate the clutter covariance matrix. The choice for the RTE is motivated by its possessing two major attributes: first its resilience to the presence of outliers, and second its regularization parameter that makes it more suitable to handle the scarcity in observations. In order to facilitate the design of the ANMF detector, we consider the regime in which n and N are both large. This allows us to derive closed-form expressions for the asymptotic false alarm and detection probabilities. Based on these expressions, we propose an asymptotically optimal setting for the regularization parameter of the RTE that maximizes the asymptotic detection probability while keeping the asymptotic false alarm probability below a certain threshold. Numerical results are provided in order to illustrate the gain of the proposed detector over a recently proposed setting of the regularization parameter.

  3. Optimal adaptive normalized matched filter for large antenna arrays

    KAUST Repository

    Kammoun, Abla; Couillet, Romain; Pascal, Fré dé ric; Alouini, Mohamed-Slim

    2016-01-01

    This paper focuses on the problem of detecting a target in the presence of a compound Gaussian clutter with unknown statistics. To this end, we focus on the design of the adaptive normalized matched filter (ANMF) detector which uses the regularized Tyler estimator (RTE) built from N-dimensional observations x, · · ·, x in order to estimate the clutter covariance matrix. The choice for the RTE is motivated by its possessing two major attributes: first its resilience to the presence of outliers, and second its regularization parameter that makes it more suitable to handle the scarcity in observations. In order to facilitate the design of the ANMF detector, we consider the regime in which n and N are both large. This allows us to derive closed-form expressions for the asymptotic false alarm and detection probabilities. Based on these expressions, we propose an asymptotically optimal setting for the regularization parameter of the RTE that maximizes the asymptotic detection probability while keeping the asymptotic false alarm probability below a certain threshold. Numerical results are provided in order to illustrate the gain of the proposed detector over a recently proposed setting of the regularization parameter.

  4. Aberrant Pregnancy Adaptations in the Peripheral Immune Response in Type 1 Diabetes: A Rat Model.

    Directory of Open Access Journals (Sweden)

    Bart Groen

    Full Text Available Despite tight glycemic control, pregnancy complication rate in type 1 diabetes patients is higher than in normal pregnancy. Other etiological factors may be responsible for the development of adverse pregnancy outcome. Acceptance of the semi-allogeneic fetus is accompanied by adaptations in the maternal immune-response. Maladaptations of the immune-response has been shown to contribute to pregnancy complications. We hypothesized that type 1 diabetes, as an autoimmune disease, may be associated with maladaptations of the immune-response to pregnancy, possibly resulting in pregnancy complications.We studied pregnancy outcome and pregnancy-induced immunological adaptations in a normoglycemic rat-model of type 1 diabetes, i.e. biobreeding diabetes-prone rats (BBDP; 5 non-pregnant rats, 7 pregnant day 10 rats and 6 pregnant day 18 rats , versus non-diabetic control rats (i.e. congenic non-diabetic biobreeding diabetes-resistant (BBDR; 6 non-pregnant rats, 6 pregnant day 10 rats and 6 pregnant day 18 rats and Wistar-rats (6 non-pregnant, 6 pregnant day 10 rats and 5 pregnant day 18 rats.We observed reduced litter size, lower fetal weight of viable fetuses and increased numbers of resorptions versus control rats. These complications are accompanied by various differences in the immune-response between BBDP and control rats in both pregnant and non-pregnant animals. The immune-response in non-pregnant BBDP-rats was characterized by decreased percentages of lymphocytes, increased percentages of effector T-cells, regulatory T-cells and natural killer cells, an increased Th1/Th2-ratio and activated monocytes versus Wistar and BBDR-rats. Furthermore, pregnancy-induced adaptations in BBDP-rats coincided with an increased Th1/Th2-ratio, a decreased mean fluorescence intensity CD161a/NKR-P1b ratio and no further activation of monocytes versus non-diabetic control rats.This study suggests that even in the face of strict normoglycemia, pregnancy complications

  5. Evasion of adaptive and innate immune response mechanisms by γ-herpesviruses

    Science.gov (United States)

    Feng, Pinghui; Moses, Ashlee; Früh, Klaus

    2015-01-01

    γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies. PMID:23735334

  6. Evolution of Alternative Adaptive Immune Systems in Vertebrates.

    Science.gov (United States)

    Boehm, Thomas; Hirano, Masayuki; Holland, Stephen J; Das, Sabyasachi; Schorpp, Michael; Cooper, Max D

    2018-04-26

    Adaptive immunity in jawless fishes is based on antigen recognition by three types of variable lymphocyte receptors (VLRs) composed of variable leucine-rich repeats, which are differentially expressed by two T-like lymphocyte lineages and one B-like lymphocyte lineage. The T-like cells express either VLRAs or VLRCs of yet undefined antigen specificity, whereas the VLRB antibodies secreted by B-like cells bind proteinaceous and carbohydrate antigens. The incomplete VLR germline genes are assembled into functional units by a gene conversion-like mechanism that employs flanking variable leucine-rich repeat sequences as templates in association with lineage-specific expression of cytidine deaminases. B-like cells develop in the hematopoietic typhlosole and kidneys, whereas T-like cells develop in the thymoid, a thymus-equivalent region at the gill fold tips. Thus, the dichotomy between T-like and B-like cells and the presence of dedicated lymphopoietic tissues emerge as ancestral vertebrate features, whereas the somatic diversification of structurally distinct antigen receptor genes evolved independently in jawless and jawed vertebrates.

  7. Regulation of innate and adaptive immunity by the commensal microbiota

    OpenAIRE

    Jarchum, Irene; Pamer, Eric G.

    2011-01-01

    The microbial communities that inhabit the intestinal tract are essential for mammalian health. Communication between the microbiota and the host establishes and maintains immune homeostasis, enabling protective immune responses against pathogens while preventing adverse inflammatory responses to harmless commensal microbes. Specific bacteria, such as segmented filamentous bacteria, Clostridium species, and Bacteroides fragilis, are key contributors to immune homeostasis in the gut. The cellu...

  8. Triggering the adaptive immune system with commensal gut bacteria protects against insulin resistance and dysglycemia

    Directory of Open Access Journals (Sweden)

    Céline Pomié

    2016-06-01

    Full Text Available Objective: To demonstrate that glycemia and insulin resistance are controlled by a mechanism involving the adaptive immune system and gut microbiota crosstalk. Methods: We triggered the immune system with microbial extracts specifically from the intestinal ileum contents of HFD-diabetic mice by the process of immunization. 35 days later, immunized mice were fed a HFD for up to two months in order to challenge the development of metabolic features. The immune responses were quantified. Eventually, adoptive transfer of immune cells from the microbiota-immunized mice to naïve mice was performed to demonstrate the causality of the microbiota-stimulated adaptive immune system on the development of metabolic disease. The gut microbiota of the immunized HFD-fed mice was characterized in order to demonstrate whether the manipulation of the microbiota to immune system interaction reverses the causal deleterious effect of gut microbiota dysbiosis on metabolic disease. Results: Subcutaneous injection (immunization procedure of ileum microbial extracts prevented hyperglycemia and insulin resistance in a dose-dependent manner in response to a HFD. The immunization enhanced the proliferation of CD4 and CD8 T cells in lymphoid organs, also increased cytokine production and antibody secretion. As a mechanism explaining the metabolic improvement, the immunization procedure reversed gut microbiota dysbiosis. Finally, adoptive transfer of immune cells from immunized mice improved metabolic features in response to HFD. Conclusions: Glycemia and insulin sensitivity can be regulated by triggering the adaptive immunity to microbiota interaction. This reduces the gut microbiota dysbiosis induced by a fat-enriched diet. Keywords: Gut microbiota and metabolic diseases, Immunity, Insulin resistance

  9. Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response

    Directory of Open Access Journals (Sweden)

    Manns Michael P

    2007-06-01

    Full Text Available Abstract Spontaneous clearance of hepatitis C virus (HCV has frequently been associated with the presence of HCV-specific cellular immunity. However, there had been also reports in chimpanzees demonstrating clearance of HCV-viremia in the absence of significant levels of detectable HCV-specific cellular immune responses. We here report seven asymptomatic acute hepatitis C cases with peak HCV-RNA levels between 300 and 100.000 copies/ml who all cleared HCV-RNA spontaneously. Patients were identified by a systematic screening of 1176 consecutive new incoming offenders in a German young offender institution. Four of the seven patients never developed anti-HCV antibodies and had normal ALT levels throughout follow-up. Transient weak HCV-specific CD4+ T cell responses were detectable in five individuals which did not differ in strength and breadth from age- and sex-matched patients with chronic hepatitis C and long-term recovered patients. In contrast, HCV-specific MHC-class-I-tetramer-positive cells were found in 3 of 4 HLA-A2-positive patients. Thus, these cases highlight that clearance of low levels of HCV viremia is possible in the absence of a strong adaptive immune response which might explain the low seroconversion rate after occupational exposure to HCV.

  10. Computational Strategies for Dissecting the High-Dimensional Complexity of Adaptive Immune Repertoires

    Directory of Open Access Journals (Sweden)

    Enkelejda Miho

    2018-02-01

    Full Text Available The adaptive immune system recognizes antigens via an immense array of antigen-binding antibodies and T-cell receptors, the immune repertoire. The interrogation of immune repertoires is of high relevance for understanding the adaptive immune response in disease and infection (e.g., autoimmunity, cancer, HIV. Adaptive immune receptor repertoire sequencing (AIRR-seq has driven the quantitative and molecular-level profiling of immune repertoires, thereby revealing the high-dimensional complexity of the immune receptor sequence landscape. Several methods for the computational and statistical analysis of large-scale AIRR-seq data have been developed to resolve immune repertoire complexity and to understand the dynamics of adaptive immunity. Here, we review the current research on (i diversity, (ii clustering and network, (iii phylogenetic, and (iv machine learning methods applied to dissect, quantify, and compare the architecture, evolution, and specificity of immune repertoires. We summarize outstanding questions in computational immunology and propose future directions for systems immunology toward coupling AIRR-seq with the computational discovery of immunotherapeutics, vaccines, and immunodiagnostics.

  11. The role of adaptive immunity as an ecological filter on the gut microbiota in zebrafish.

    Science.gov (United States)

    Stagaman, Keaton; Burns, Adam R; Guillemin, Karen; Bohannan, Brendan Jm

    2017-07-01

    All animals live in intimate association with communities of microbes, collectively referred to as their microbiota. Certain host traits can influence which microbial taxa comprise the microbiota. One potentially important trait in vertebrate animals is the adaptive immune system, which has been hypothesized to act as an ecological filter, promoting the presence of some microbial taxa over others. Here we surveyed the intestinal microbiota of 68 wild-type zebrafish, with functional adaptive immunity, and 61 rag1 - zebrafish, lacking functional B- and T-cell receptors, to test the role of adaptive immunity as an ecological filter on the intestinal microbiota. In addition, we tested the robustness of adaptive immunity's filtering effects to host-host interaction by comparing the microbiota of fish populations segregated by genotype to those containing both genotypes. The presence of adaptive immunity individualized the gut microbiota and decreased the contributions of neutral processes to gut microbiota assembly. Although mixing genotypes led to increased phylogenetic diversity in each, there was no significant effect of adaptive immunity on gut microbiota composition in either housing condition. Interestingly, the most robust effect on microbiota composition was co-housing within a tank. In all, these results suggest that adaptive immunity has a role as an ecological filter of the zebrafish gut microbiota, but it can be overwhelmed by other factors, including transmission of microbes among hosts.

  12. Multi-user cognitive radio network resource allocation based on the adaptive niche immune genetic algorithm

    International Nuclear Information System (INIS)

    Zu Yun-Xiao; Zhou Jie

    2012-01-01

    Multi-user cognitive radio network resource allocation based on the adaptive niche immune genetic algorithm is proposed, and a fitness function is provided. Simulations are conducted using the adaptive niche immune genetic algorithm, the simulated annealing algorithm, the quantum genetic algorithm and the simple genetic algorithm, respectively. The results show that the adaptive niche immune genetic algorithm performs better than the other three algorithms in terms of the multi-user cognitive radio network resource allocation, and has quick convergence speed and strong global searching capability, which effectively reduces the system power consumption and bit error rate. (geophysics, astronomy, and astrophysics)

  13. Increased innate and adaptive immune responses in induced sputum of young smokers

    Directory of Open Access Journals (Sweden)

    Agnese Kislina

    2015-01-01

    Conclusions: This study demonstrates that young smokers have early inflammatory changes in their airways that not only initiate nonspecific mechanisms recruiting neutrophils, but also involve specific immune mechanisms with recruitment of T regulatory lymphocytes. The lymphocyte response is probably adaptive.

  14. Genes of the major histocompatibility complex highlight interactions of the innate and adaptive immune system

    Directory of Open Access Journals (Sweden)

    Barbara Lukasch

    2017-08-01

    Full Text Available Background A well-functioning immune defence is crucial for fitness, but our knowledge about the immune system and its complex interactions is still limited. Major histocompatibility complex (MHC molecules are involved in T-cell mediated adaptive immune responses, but MHC is also highly upregulated during the initial innate immune response. The aim of our study was therefore to determine to what extent the highly polymorphic MHC is involved in interactions of the innate and adaptive immune defence and if specific functional MHC alleles (FA or heterozygosity at the MHC are more important. Methods To do this we used captive house sparrows (Passer domesticus to survey MHC diversity and immune function controlling for several environmental factors. MHC class I alleles were identified using parallel amplicon sequencing and to mirror immune function, several immunological tests that correspond to the innate and adaptive immunity were conducted. Results Our results reveal that MHC was linked to all immune tests, highlighting its importance for the immune defence. While all innate responses were associated with one single FA, adaptive responses (cell-mediated and humoral were associated with several different alleles. Discussion We found that repeated injections of an antibody in nestlings and adults were linked to different FA and hence might affect different areas of the immune system. Also, individuals with a higher number of different FA produced a smaller secondary response, indicating a disadvantage of having numerous MHC alleles. These results demonstrate the complexity of the immune system in relation to the MHC and lay the foundation for other studies to further investigate this topic.

  15. Genes of the major histocompatibility complex highlight interactions of the innate and adaptive immune system.

    Science.gov (United States)

    Lukasch, Barbara; Westerdahl, Helena; Strandh, Maria; Winkler, Hans; Moodley, Yoshan; Knauer, Felix; Hoi, Herbert

    2017-01-01

    A well-functioning immune defence is crucial for fitness, but our knowledge about the immune system and its complex interactions is still limited. Major histocompatibility complex (MHC) molecules are involved in T-cell mediated adaptive immune responses, but MHC is also highly upregulated during the initial innate immune response. The aim of our study was therefore to determine to what extent the highly polymorphic MHC is involved in interactions of the innate and adaptive immune defence and if specific functional MHC alleles (FA) or heterozygosity at the MHC are more important. To do this we used captive house sparrows ( Passer domesticus ) to survey MHC diversity and immune function controlling for several environmental factors. MHC class I alleles were identified using parallel amplicon sequencing and to mirror immune function, several immunological tests that correspond to the innate and adaptive immunity were conducted. Our results reveal that MHC was linked to all immune tests, highlighting its importance for the immune defence. While all innate responses were associated with one single FA, adaptive responses (cell-mediated and humoral) were associated with several different alleles. We found that repeated injections of an antibody in nestlings and adults were linked to different FA and hence might affect different areas of the immune system. Also, individuals with a higher number of different FA produced a smaller secondary response, indicating a disadvantage of having numerous MHC alleles. These results demonstrate the complexity of the immune system in relation to the MHC and lay the foundation for other studies to further investigate this topic.

  16. Biogenesis pathways of RNA guides in archaeal and bacterial CRISPR-Cas adaptive immunity

    NARCIS (Netherlands)

    Charpentier, Emmanuelle; Richter, Hagen; Oost, van der John; White, Malcolm F.

    2015-01-01

    CRISPR-Cas is an RNA-mediated adaptive immune system that defends bacteria and archaea against mobile genetic elements. Short mature CRISPR RNAs (crRNAs) are key elements in the interference step of the immune pathway. A CRISPR array composed of a series of repeats interspaced by spacer sequences

  17. Senescence of the adaptive immune system in health and aging-associated autoimmune disease

    NARCIS (Netherlands)

    van der Geest, Kornelis Stephan Mario

    2015-01-01

    Aging of the immune system may contribute to the development of aging-associated autoimmune diseases, such as giant cell arteritis, polymyalgia rheumatica and rheumatoid arthritis. The aim of this thesis was to identify aging-dependent changes of the adaptive immune system that promote autoimmunity

  18. Vascular thermal adaptation in tumors and normal tissue in rats

    International Nuclear Information System (INIS)

    Nah, Byung Sik; Choi, Ihl-Bohng; Oh, Won Young; Osborn, James L.; Song, Chang W.

    1996-01-01

    Purpose: The vascular thermal adaptation in the R3230 adenocarcinoma, skin and muscle in the legs of Fischer rats was studied. Methods and Materials: The legs of Fischer rats bearing the R3230 AC adenocarcinoma (subcutaneously) were heated once or twice with a water bath, and the blood flow in the tumor, skin and muscle of the legs was measured with the radioactive microsphere method. Results: The blood flow in control R3230 AC tumors was 23.9 ml/100 g/min. The tumor blood flow increased about 1.5 times in 30 min and then markedly decreased upon heating at 44.5 deg. C for 90 min. In the tumors preheated 16 h earlier at 42.5 deg. C for 60 min, reheating at 44.5 deg. C increased the tumor blood flow by 2.5-fold in 30 min. Contrary to the decline in blood flow following an initial increase during the 44.5 deg. C heating without preheating, the tumor blood flow remained elevated throughout the 90 min reheating at 44.5 deg. C. These results indicated that thermal adaptation or thermotolerance developed in the tumor vasculatures after the preheating at 42.5 deg. C for 60 min. The magnitude of vascular thermal adaptation in the tumors 24 h and 48 h after the preheating, as judged from the changes in blood flow, were smaller than that 16 h after the preheating. Heating at 42.5 deg. C for 60 min induced vascular thermal adaptation also in the skin and muscle, which peaked in 48 h and 24 h, respectively, after the heating. Conclusion: Heating at 42.5 deg. C for 1 h induced vascular thermal adaptation in the R3230 AC tumor, skin, and muscle of rats that peaked 16-48 h after the heating. When the tumor blood vessels were thermally adapted, the tumor blood flow increased upon heating at temperatures that would otherwise reduce the tumor blood flow. Such an increase in tumor blood flow may hinder raising the tumor temperature while it may increase tumor oxygenation.

  19. Ebola Virus Altered Innate and Adaptive Immune Response Signalling Pathways: Implications for Novel Therapeutic Approaches.

    Science.gov (United States)

    Kumar, Anoop

    2016-01-01

    Ebola virus (EBOV) arise attention for their impressive lethality by the poor immune response and high inflammatory reaction in the patients. It causes a severe hemorrhagic fever with case fatality rates of up to 90%. The mechanism underlying this lethal outcome is poorly understood. In 2014, a major outbreak of Ebola virus spread amongst several African countries, including Leone, Sierra, and Guinea. Although infections only occur frequently in Central Africa, but the virus has the potential to spread globally. Presently, there is no vaccine or treatment is available to counteract Ebola virus infections due to poor understanding of its interaction with the immune system. Accumulating evidence indicates that the virus actively alters both innate and adaptive immune responses and triggers harmful inflammatory responses. In the literature, some reports have shown that alteration of immune signaling pathways could be due to the ability of EBOV to interfere with dendritic cells (DCs), which link innate and adaptive immune responses. On the other hand, some reports have demonstrated that EBOV, VP35 proteins act as interferon antagonists. So, how the Ebola virus altered the innate and adaptive immune response signaling pathways is still an open question for the researcher to be explored. Thus, in this review, I try to summarize the mechanisms of the alteration of innate and adaptive immune response signaling pathways by Ebola virus which will be helpful for designing effective drugs or vaccines against this lethal infection. Further, potential targets, current treatment and novel therapeutic approaches have also been discussed.

  20. Metabolic and adaptive immune responses induced in mice infected ...

    African Journals Online (AJOL)

    This study investigated metabolic and immuno-inflammatory responses of mice infected with tissue-dwelling larvae of Trichinella zimbabwensis and explored the relationship between infection, metabolic parameters and Th1/Th17 immune responses. Sixty (60) female BALB/c mice aged between 6 to 8 weeks old were ...

  1. Functional demonstration of adaptive immunity in zebrafish using DNA vaccination

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    Due to the well characterized genome, overall highly synteny with the human genome and its suitability for functional genomics studies, the zebrafish is considered to be an ideal animal model for basic studies of mechanisms of diseases and immunity in vertebrates including humans. While several s...

  2. Standard of hygiene and immune adaptation in newborn infants

    NARCIS (Netherlands)

    Kallionpaa, Henna; Laajala, Essi; Oling, Viveka; Harkonen, Taina; Tillmann, Vallo; Dorshakova, Natalya V.; Ilonen, Jorma; Landesmaki, Harri; Knip, Mikael; Lahesmaa, Riitta; Koski, Katriina; Koski, Matti; Ryhanen, Samppa; Siljander, Heli; Hamalainen, Anu-Maaria; Ormisson, Anne; Peet, Aleksandr; Ulich, Valentina; Kuzmicheva, Elena; Mokurov, Sergei; Markova, Svettana; Pylova, Svetlana; Isakova, Marina; Shakurova, Elena; Petrov, Vladimir; Karapetyan, Tatyana; Varlamova, Tatyana; Ilonen, Jorma; Kiviniemi, Minna; Alnek, Kristi; Janson, Helis; Uibo, Raivo; Salum, Tiit; von Mutius, Erika; Weber, Juliane; Ahlfors, Helena; Moulder, Robert; Nieminen, Janne; Ruohtula, Terhi; Vaarala, Outi; Honkanen, Hanna; Hyoty, Heikki; Kondrashova, Anita; Oikarinen, Sami; Harmsen, Hermie J. M.; De Goffau, Marcus C.; Welling, Gjalt; Alahuhta, Kirsi; Korhonen, Tuuli; Virtanen, Suvi M.

    2014-01-01

    The prevalence of immune-mediated diseases, such as allergies and type 1 diabetes, is on the rise in the developed world. In order to explore differences in the gene expression patterns induced in utero in infants born in contrasting standards of living and hygiene, we collected umbilical cord blood

  3. Innate and adaptive immune traits are differentially affected by genetic and environmental factors

    Science.gov (United States)

    Mangino, Massimo; Roederer, Mario; Beddall, Margaret H.; Nestle, Frank O.; Spector, Tim D.

    2017-01-01

    The diversity and activity of leukocytes is controlled by genetic and environmental influences to maintain balanced immune responses. However, the relative contribution of environmental compared with genetic factors that affect variations in immune traits is unknown. Here we analyse 23,394 immune phenotypes in 497 adult female twins. 76% of these traits show a predominantly heritable influence, whereas 24% are mostly influenced by environment. These data highlight the importance of shared childhood environmental influences such as diet, infections or microbes in shaping immune homeostasis for monocytes, B1 cells, γδ T cells and NKT cells, whereas dendritic cells, B2 cells, CD4+ T and CD8+ T cells are more influenced by genetics. Although leukocyte subsets are influenced by genetics and environment, adaptive immune traits are more affected by genetics, whereas innate immune traits are more affected by environment. PMID:28054551

  4. Rationale for combination of therapeutic antibodies targeting tumor cells and immune checkpoint receptors: Harnessing innate and adaptive immunity through IgG1 isotype immune effector stimulation.

    Science.gov (United States)

    Ferris, Robert L; Lenz, Heinz-Josef; Trotta, Anna Maria; García-Foncillas, Jesús; Schulten, Jeltje; Audhuy, François; Merlano, Marco; Milano, Gerard

    2018-02-01

    Immunoglobulin (Ig) G1 antibodies stimulate antibody-dependent cell-mediated cytotoxicity (ADCC). Cetuximab, an IgG1 isotype monoclonal antibody, is a standard-of-care treatment for locally advanced and recurrent and/or metastatic squamous cell carcinoma of the head and neck (SCCHN) and metastatic colorectal cancer (CRC). Here we review evidence regarding the clinical relevance of cetuximab-mediated ADCC and other immune functions and provide a biological rationale concerning why this property positions cetuximab as an ideal partner for immune checkpoint inhibitors (ICIs) and other emerging immunotherapies. We performed a nonsystematic review of available preclinical and clinical data involving cetuximab-mediated immune activity and combination approaches of cetuximab with other immunotherapies, including ICIs, in SCCHN and CRC. Indeed, cetuximab mediates ADCC activity in the intratumoral space and primes adaptive and innate cellular immunity. However, counterregulatory mechanisms may lead to immunosuppressive feedback loops. Accordingly, there is a strong rationale for combining ICIs with cetuximab for the treatment of advanced tumors, as targeting CTLA-4, PD-1, and PD-L1 can ostensibly overcome these immunosuppressive counter-mechanisms in the tumor microenvironment. Moreover, combining ICIs (or other immunotherapies) with cetuximab is a promising strategy for boosting immune response and enhancing response rates and durability of response. Cetuximab immune activity-including, but not limited to, ADCC-provides a strong rationale for its combination with ICIs or other immunotherapies to synergistically and fully mobilize the adaptive and innate immunity against tumor cells. Ongoing prospective studies will evaluate the clinical effect of these combination regimens and their immune effect in CRC and SCCHN and in other indications. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. Manipulation of Innate and Adaptive Immunity by Staphylococcal Superantigens

    Directory of Open Access Journals (Sweden)

    Stephen W. Tuffs

    2018-05-01

    Full Text Available Staphylococcal superantigens (SAgs constitute a family of potent exotoxins secreted by Staphylococcus aureus and other select staphylococcal species. SAgs function to cross-link major histocompatibility complex (MHC class II molecules with T cell receptors (TCRs to stimulate the uncontrolled activation of T lymphocytes, potentially leading to severe human illnesses such as toxic shock syndrome. The ubiquity of SAgs in clinical S. aureus isolates suggests that they likely make an important contribution to the evolutionary fitness of S. aureus. Although the apparent redundancy of SAgs in S. aureus has not been explained, the high level of sequence diversity within this toxin family may allow for SAgs to recognize an assorted range of TCR and MHC class II molecules, as well as aid in the avoidance of humoral immunity. Herein, we outline the major diseases associated with the staphylococcal SAgs and how a dysregulated immune system may contribute to pathology. We then highlight recent research that considers the importance of SAgs in the pathogenesis of S. aureus infections, demonstrating that SAgs are more than simply an immunological diversion. We suggest that SAgs can act as targeted modulators that drive the immune response away from an effective response, and thus aid in S. aureus persistence.

  6. CRISPR-Cas adaptive immune systems of the sulfolobales

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Shah, Shiraz Ali; Erdmann, Susanne

    2015-01-01

    The Sulfolobales have provided good model organisms for studying CRISPR-Cas systems of the crenarchaeal kingdom of the archaea. These organisms are infected by a wide range of exceptional archaea-specific viruses and conjugative plasmids, and their CRISPR-Cas systems generally exhibit extensive...... structural and functional diversity. They carry large and multiple CRISPR loci and often multiple copies of diverse Type I and Type III interference modules as well as more homogeneous adaptation modules. These acidothermophilic organisms have recently provided seminal insights into both the adaptation...... process, the diverse modes of interference, and their modes of regulation. The functions of the adaptation and interference modules tend to be loosely coupled and the stringency of the crRNA-DNA sequence matching during DNA interference is relatively low, in contrast to some more streamlined CRISPR...

  7. Factors of Innate and Adaptive Local Immunity in Children with Primary Deficiencies of Antibody Formation

    Directory of Open Access Journals (Sweden)

    L.I. Chernyshova

    2013-10-01

    Full Text Available In 40 children with various types of primary immunodeficiencies (PID of antibody formation we examined factors of local immunity in saliva. It is found that in the saliva of children with PID of antibody formation in comparison with immunocompetent children the concentration of factors of adaptive immunity is significantly reduced. Lack of adaptive immunity in the PID of antibody formation to some extent is compensated by increased concentrations of innate immune factors on the mucous membranes — the free Sc, as well as lactoferrin in selective immunodeficiency of IgA. At PID of antibody formation we observed increased TNF-α level in the saliva, which may indicate the persistence of local inflammation on the membranes of the respiratory tract.

  8. Meta-Analysis of Maternal and Fetal Transcriptomic Data Elucidates the Role of Adaptive and Innate Immunity in Preterm Birth

    Science.gov (United States)

    Vora, Bianca; Wang, Aolin; Kosti, Idit; Huang, Hongtai; Paranjpe, Ishan; Woodruff, Tracey J.; MacKenzie, Tippi; Sirota, Marina

    2018-01-01

    Preterm birth (PTB) is the leading cause of newborn deaths around the world. Spontaneous preterm birth (sPTB) accounts for two-thirds of all PTBs; however, there remains an unmet need of detecting and preventing sPTB. Although the dysregulation of the immune system has been implicated in various studies, small sizes and irreproducibility of results have limited identification of its role. Here, we present a cross-study meta-analysis to evaluate genome-wide differential gene expression signals in sPTB. A comprehensive search of the NIH genomic database for studies related to sPTB with maternal whole blood samples resulted in data from three separate studies consisting of 339 samples. After aggregating and normalizing these transcriptomic datasets and performing a meta-analysis, we identified 210 genes that were differentially expressed in sPTB relative to term birth. These genes were enriched in immune-related pathways, showing upregulation of innate immunity and downregulation of adaptive immunity in women who delivered preterm. An additional analysis found several of these differentially expressed at mid-gestation, suggesting their potential to be clinically relevant biomarkers. Furthermore, a complementary analysis identified 473 genes differentially expressed in preterm cord blood samples. However, these genes demonstrated downregulation of the innate immune system, a stark contrast to findings using maternal blood samples. These immune-related findings were further confirmed by cell deconvolution as well as upstream transcription and cytokine regulation analyses. Overall, this study identified a strong immune signature related to sPTB as well as several potential biomarkers that could be translated to clinical use.

  9. Meta-Analysis of Maternal and Fetal Transcriptomic Data Elucidates the Role of Adaptive and Innate Immunity in Preterm Birth

    Directory of Open Access Journals (Sweden)

    Bianca Vora

    2018-05-01

    Full Text Available Preterm birth (PTB is the leading cause of newborn deaths around the world. Spontaneous preterm birth (sPTB accounts for two-thirds of all PTBs; however, there remains an unmet need of detecting and preventing sPTB. Although the dysregulation of the immune system has been implicated in various studies, small sizes and irreproducibility of results have limited identification of its role. Here, we present a cross-study meta-analysis to evaluate genome-wide differential gene expression signals in sPTB. A comprehensive search of the NIH genomic database for studies related to sPTB with maternal whole blood samples resulted in data from three separate studies consisting of 339 samples. After aggregating and normalizing these transcriptomic datasets and performing a meta-analysis, we identified 210 genes that were differentially expressed in sPTB relative to term birth. These genes were enriched in immune-related pathways, showing upregulation of innate immunity and downregulation of adaptive immunity in women who delivered preterm. An additional analysis found several of these differentially expressed at mid-gestation, suggesting their potential to be clinically relevant biomarkers. Furthermore, a complementary analysis identified 473 genes differentially expressed in preterm cord blood samples. However, these genes demonstrated downregulation of the innate immune system, a stark contrast to findings using maternal blood samples. These immune-related findings were further confirmed by cell deconvolution as well as upstream transcription and cytokine regulation analyses. Overall, this study identified a strong immune signature related to sPTB as well as several potential biomarkers that could be translated to clinical use.

  10. The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity

    Science.gov (United States)

    2006-07-06

    P.J. (1989) Effect of Streptococcus pneumoniae on human respiratory epithelium in vitro. Infect. Immun. 57: 2006-2013. Stoop, J.N., van der Molen ...antibiotics. Clin. Microbiol. Rev. 3: 171-196. Knapp, S., Wieland, C.W., van ’t Veer, C., Takeuchi, O., Akira, S., Florquin, S., and van der Poll...R.G., Baan, C.C., van der Laan, L.J., Kuipers, E.J., Kusters, J.G., and Janssen, H.L. (2005) Regulatory T cells contribute to the impaired immune

  11. Interactions between Innate Lymphoid Cells and Cells of the Innate and Adaptive Immune System.

    Science.gov (United States)

    Symowski, Cornelia; Voehringer, David

    2017-01-01

    Type 2 innate lymphoid cells (ILC2s) are a major source of cytokines, which are also produced by Th2 cells and several cell types of the innate immune system. Work over the past few years indicates that ILC2s play a central role in regulating type 2 immune responses against allergens and helminths. ILC2s can interact with a variety of cells types of the innate and adaptive immune system by cell-cell contacts or by communication via soluble factors. In this review, we provide an overview about recent advances in our understanding how ILC2s orchestrate type 2 immune responses with focus on direct interactions between ILC2s and other cells of the immune system.

  12. Endometrial immune markers are potential predictors of normal fertility and pregnancy after in vitro fertilization.

    Science.gov (United States)

    Kofod, Louise; Lindhard, Anette; Bzorek, Michael; Eriksen, Jens Ole; Larsen, Lise Grupe; Hviid, Thomas Vauvert F

    2017-09-01

    Elucidating immune mechanisms in the endometrium, which lead to the success of implantation and pregnancy, is important in reproductive medicine. Studies of immune cell abundance have shown conflicting results, and the expression and importance of HLA class Ib proteins in pre-implantation endometrium have not yet been investigated. The study population consisted of four subgroups: a hydrosalpinx, a salpingectomy, an unexplained infertility, and a fertile control group. Endometrial samples were collected during the implantation window. Immune markers (CD56 + and CD16 + cells, FoxP3 + Tregs, HLA-G, HLA-F) were quantified in the samples. The outcome of the subsequent IVF treatment was recorded. Increased CD56 + uNK cells and high HLA-G expression served as predictor for successful pregnancy outcome. HLA-F expression was positively correlated with uNK cells, being indirectly predictive for achieving pregnancy. Endometrial uNK cell abundance in the pre-implantation endometrium seems to be important for normal fertility and pregnancy success, and they may be used as clinical markers to predict implantation success in IVF. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Let's Tie the Knot: Marriage of Complement and Adaptive Immunity in Pathogen Evasion, for Better or Worse.

    Science.gov (United States)

    Bennett, Kaila M; Rooijakkers, Suzan H M; Gorham, Ronald D

    2017-01-01

    The complement system is typically regarded as an effector arm of innate immunity, leading to recognition and killing of microbial invaders in body fluids. Consequently, pathogens have engaged in an arms race, evolving molecules that can interfere with proper complement responses. However, complement is no longer viewed as an isolated system, and links with other immune mechanisms are continually being discovered. Complement forms an important bridge between innate and adaptive immunity. While its roles in innate immunity are well-documented, its function in adaptive immunity is less characterized. Therefore, it is no surprise that the field of pathogenic complement evasion has focused on blockade of innate effector functions, while potential inhibition of adaptive immune responses (via complement) has been overlooked to a certain extent. In this review, we highlight past and recent developments on the involvement of complement in the adaptive immune response. We discuss the mechanisms by which complement aids in lymphocyte stimulation and regulation, as well as in antigen presentation. In addition, we discuss microbial complement evasion strategies, and highlight specific examples in the context of adaptive immune responses. These emerging ties between complement and adaptive immunity provide a catalyst for future discovery in not only the field of adaptive immune evasion but in elucidating new roles of complement.

  14. Let’s Tie the Knot: Marriage of Complement and Adaptive Immunity in Pathogen Evasion, for Better or Worse

    Science.gov (United States)

    Bennett, Kaila M.; Rooijakkers, Suzan H. M.; Gorham, Ronald D.

    2017-01-01

    The complement system is typically regarded as an effector arm of innate immunity, leading to recognition and killing of microbial invaders in body fluids. Consequently, pathogens have engaged in an arms race, evolving molecules that can interfere with proper complement responses. However, complement is no longer viewed as an isolated system, and links with other immune mechanisms are continually being discovered. Complement forms an important bridge between innate and adaptive immunity. While its roles in innate immunity are well-documented, its function in adaptive immunity is less characterized. Therefore, it is no surprise that the field of pathogenic complement evasion has focused on blockade of innate effector functions, while potential inhibition of adaptive immune responses (via complement) has been overlooked to a certain extent. In this review, we highlight past and recent developments on the involvement of complement in the adaptive immune response. We discuss the mechanisms by which complement aids in lymphocyte stimulation and regulation, as well as in antigen presentation. In addition, we discuss microbial complement evasion strategies, and highlight specific examples in the context of adaptive immune responses. These emerging ties between complement and adaptive immunity provide a catalyst for future discovery in not only the field of adaptive immune evasion but in elucidating new roles of complement. PMID:28197139

  15. Suppression of Adaptive Immune Cell Activation Does Not Alter Innate Immune Adipose Inflammation or Insulin Resistance in Obesity.

    Directory of Open Access Journals (Sweden)

    Manikandan Subramanian

    Full Text Available Obesity-induced inflammation in visceral adipose tissue (VAT is a major contributor to insulin resistance and type 2 diabetes. Whereas innate immune cells, notably macrophages, contribute to visceral adipose tissue (VAT inflammation and insulin resistance, the role of adaptive immunity is less well defined. To address this critical gap, we used a model in which endogenous activation of T cells was suppressed in obese mice by blocking MyD88-mediated maturation of CD11c+ antigen-presenting cells. VAT CD11c+ cells from Cd11cCre+Myd88fl/fl vs. control Myd88fl/fl mice were defective in activating T cells in vitro, and VAT T and B cell activation was markedly reduced in Cd11cCre+Myd88fl/fl obese mice. However, neither macrophage-mediated VAT inflammation nor systemic inflammation were altered in Cd11cCre+Myd88fl/fl mice, thereby enabling a focused analysis on adaptive immunity. Unexpectedly, fasting blood glucose, plasma insulin, and the glucose response to glucose and insulin were completely unaltered in Cd11cCre+Myd88fl/fl vs. control obese mice. Thus, CD11c+ cells activate VAT T and B cells in obese mice, but suppression of this process does not have a discernible effect on macrophage-mediated VAT inflammation or systemic glucose homeostasis.

  16. Inactivated Influenza Vaccine That Provides Rapid, Innate-Immune-System-Mediated Protection and Subsequent Long-Term Adaptive Immunity.

    Science.gov (United States)

    Chua, Brendon Y; Wong, Chinn Yi; Mifsud, Edin J; Edenborough, Kathryn M; Sekiya, Toshiki; Tan, Amabel C L; Mercuri, Francesca; Rockman, Steve; Chen, Weisan; Turner, Stephen J; Doherty, Peter C; Kelso, Anne; Brown, Lorena E; Jackson, David C

    2015-10-27

    The continual threat to global health posed by influenza has led to increased efforts to improve the effectiveness of influenza vaccines for use in epidemics and pandemics. We show in this study that formulation of a low dose of inactivated detergent-split influenza vaccine with a Toll-like receptor 2 (TLR2) agonist-based lipopeptide adjuvant (R4Pam2Cys) provides (i) immediate, antigen-independent immunity mediated by the innate immune system and (ii) significant enhancement of antigen-dependent immunity which exhibits an increased breadth of effector function. Intranasal administration of mice with vaccine formulated with R4Pam2Cys but not vaccine alone provides protection against both homologous and serologically distinct (heterologous) viral strains within a day of administration. Vaccination in the presence of R4Pam2Cys subsequently also induces high levels of systemic IgM, IgG1, and IgG2b antibodies and pulmonary IgA antibodies that inhibit hemagglutination (HA) and neuraminidase (NA) activities of homologous but not heterologous virus. Improved primary virus nucleoprotein (NP)-specific CD8(+) T cell responses are also induced by the use of R4Pam2Cys and are associated with robust recall responses to provide heterologous protection. These protective effects are demonstrated in wild-type and antibody-deficient animals but not in those depleted of CD8(+) T cells. Using a contact-dependent virus transmission model, we also found that heterologous virus transmission from vaccinated mice to naive mice is significantly reduced. These results demonstrate the potential of adding a TLR2 agonist to an existing seasonal influenza vaccine to improve its utility by inducing immediate short-term nonspecific antiviral protection and also antigen-specific responses to provide homologous and heterologous immunity. The innate and adaptive immune systems differ in mechanisms, specificities, and times at which they take effect. The innate immune system responds within hours of

  17. Autologous Stem Cell Transplantation Disrupts Adaptive Immune Responses during Rebound Simian/Human Immunodeficiency Virus Viremia.

    Science.gov (United States)

    Reeves, Daniel B; Peterson, Christopher W; Kiem, Hans-Peter; Schiffer, Joshua T

    2017-07-01

    Primary HIV-1 infection induces a virus-specific adaptive/cytolytic immune response that impacts the plasma viral load set point and the rate of progression to AIDS. Combination antiretroviral therapy (cART) suppresses plasma viremia to undetectable levels that rebound upon cART treatment interruption. Following cART withdrawal, the memory component of the virus-specific adaptive immune response may improve viral control compared to primary infection. Here, using primary infection and treatment interruption data from macaques infected with simian/human immunodeficiency virus (SHIV), we observe a lower peak viral load but an unchanged viral set point during viral rebound. The addition of an autologous stem cell transplant before cART withdrawal alters viral dynamics: we found a higher rebound set point but similar peak viral loads compared to the primary infection. Mathematical modeling of the data that accounts for fundamental immune parameters achieves excellent fit to heterogeneous viral loads. Analysis of model output suggests that the rapid memory immune response following treatment interruption does not ultimately lead to better viral containment. Transplantation decreases the durability of the adaptive immune response following cART withdrawal and viral rebound. Our model's results highlight the impact of the endogenous adaptive immune response during primary SHIV infection. Moreover, because we capture adaptive immune memory and the impact of transplantation, this model will provide insight into further studies of cure strategies inspired by the Berlin patient. IMPORTANCE HIV patients who interrupt combination antiretroviral therapy (cART) eventually experience viral rebound, the return of viral loads to pretreatment levels. However, the "Berlin patient" remained free of HIV rebound over a decade after stopping cART. His cure is attributed to leukemia treatment that included an HIV-resistant stem cell transplant. Inspired by this case, we studied the impact

  18. Innate and adaptive immunity gene expression of human keratinocytes cultured of severe burn injury.

    Science.gov (United States)

    Noronha, Silvana Aparecida Alves Corrêa de; Noronha, Samuel Marcos Ribeiro de; Lanziani, Larissa Elias; Ferreira, Lydia Masako; Gragnani, Alfredo

    2014-01-01

    Evaluate the expression profile of genes related to Innate and Adaptive Immune System (IAIS) of human Primary Epidermal keratinocytes (hPEKP) of patients with severe burns. After obtaining viable fragments of skin with and without burning, culture hKEP was initiated by the enzymatic method using Dispase (Sigma-Aldrich). These cells were treated with Trizol(r) (Life Technologies) for extraction of total RNA. This was quantified and analyzed for purity for obtaining cDNA for the analysis of gene expression using specific IAIS PCR Arrays plates (SA Biosciences). After the analysis of gene expression we found that 63% of these genes were differentially expressed, of which 77% were repressed and 23% were hyper-regulated. Among these, the following genes (fold increase or decrease): IL8 (41), IL6 (32), TNF (-92), HLA-E (-86), LYS (-74), CCR6 (- 73), CD86 (-41) and HLA-A (-35). This study contributes to the understanding of the molecular mechanisms underlying wound infection caused by the burn. Furthermore, it may provide new strategies to restore normal expression of these genes and thereby change the healing process and improve clinical outcome.

  19. Long-term in vitro and in vivo effects of γ-irradiated BCG on innate and adaptive immunity

    DEFF Research Database (Denmark)

    Arts, Rob J W; Blok, Bastiaan A; Aaby, Peter

    2015-01-01

    were less strong than those induced by live BCG. γBCG vaccination in volunteers had only minimal effects on innate immunity, whereas a significant increase in heterologous Th1/Th17 immunity was observed. Our results indicate that γBCG induces long-term training of innate immunity in vitro. In vivo, γ......BCG vaccination is associated with a reduced mortality from nonmycobacterial infections. This is likely to be mediated by a combination of innate-immune memory ("trained immunity") and heterologous effects on adaptive immunity. As such, BCG could be used to boost host immunity...

  20. Effect of Scoparia dulcis on noise stress induced adaptive immunity and cytokine response in immunized Wistar rats.

    Science.gov (United States)

    Sundareswaran, Loganathan; Srinivasan, Sakthivel; Wankhar, Wankupar; Sheeladevi, Rathinasamy

    Noise acts as a stressor and is reported to have impact on individual health depending on nature, type, intensity and perception. Modern medicine has no effective drugs or cure to prevent its consequences. Being an environmental stressor noise cannot be avoided; instead minimizing its exposure or consuming anti-stressor and adaptogens from plants can be considered. The present study was carried out to evaluate the anti-stressor, adaptogen and immunostimulatory activity of Scoparia dulcis against noise-induced stress in Wistar rat models. Noise stress in rats was created by broadband white noise generator, 100 dB A/4 h daily/15 days and S. dulcis (200 mg/kg b.w.) was administered orally. 8 groups of rats were used consisting of 6 animals each; 4 groups for unimmunized and 4 groups for immunized. For immunization, sheep red blood cells (5 × 10 9  cells/ml) were injected intraperitoneally. Sub-acute noise exposed rats showed a significant increase in corticosterone and IL-4 levels in both immunized and unimmunized rats whereas lymphocytes, antibody titration, soluble immune complex, IL-4 showed a marked increase with a significant decrease in IL-2, TNF-α, IFN-γ cytokines only in unimmunized rats. Immunized noise exposed rats presented increased leukocyte migration index and decreased foot pad thickness, IL-2, TNF-α, IFN-γ with no changes in the lymphocytes. S. dulcis (SD) has normalized and prevented the noise induced changes in cell-mediated and humoral immunity and it could be the presence of anti-stressor and immuno stimulant activity of the plant. Copyright © 2016 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Published by Elsevier B.V. All rights reserved.

  1. Humoral Immunity to AAV-6, 8, and 9 in Normal and Dystrophic Dogs

    Science.gov (United States)

    Shin, Jin-Hong; Yue, Yongping; Smith, Bruce

    2012-01-01

    Abstract Adeno-associated virus (AAV)-6, 8, and 9 are promising gene-delivery vectors for testing novel Duchenne muscular dystrophy gene therapy in the canine model. Humoral immunity greatly influences in vivo AAV transduction. However, neutralizing antibodies to AAV-6, 8, and 9 have not been systemically examined in normal and dystrophic dogs. To gain information on the seroprevalence of antibodies to AAV-6, 8, and 9, we measured neutralizing antibody titers using an in vitro transduction inhibition assay. We examined 72 naive serum samples and 26 serum samples obtained from dogs that had received AAV gene transfer. Our data demonstrated that AAV-6 neutralizing antibody was the most prevalent antibody in dogs irrespective of age, gender, disease status (dystrophic or not), and prior parvovirus vaccination history. Surprisingly, high-level anti-AAV-6 antibody was detected at birth in newborn puppies. Further, a robust antibody response was induced in affected, but not normal newborn dogs following systemic AAV gene transfer. Taken together, our data have provided an important baseline on the seroprevalence of AAV-6, 8, and 9 neutralizing antibodies in normal and Duchenne muscular dystrophy dogs. These results will help guide translational AAV gene-therapy studies in dog models of muscular dystrophy. PMID:22040468

  2. Cutting edge: impairment of dendritic cells and adaptive immunity by Ebola and Lassa viruses.

    Science.gov (United States)

    Mahanty, Siddhartha; Hutchinson, Karen; Agarwal, Sudhanshu; McRae, Michael; Rollin, Pierre E; Pulendran, Bali

    2003-03-15

    Acute infection of humans with Ebola and Lassa viruses, two principal etiologic agents of hemorrhagic fevers, often results in a paradoxical pattern of immune responses: early infection, characterized by an outpouring of inflammatory mediators such as TNF-alpha, IL-1 beta, and IL-6, vs late stage infections, which are associated with poor immune responses. The mechanisms underlying these diverse outcomes are poorly understood. In particular, the role played by cells of the innate immune system, such as dendritic cells (DC), is not known. In this study, we show that Ebola and Lassa viruses infect human monocyte-derived DC and impair their function. Monocyte-derived DC exposed to either virus fail to secrete proinflammatory cytokines, do not up-regulate costimulatory molecules, and are poor stimulators of T cells. These data represent the first evidence for a mechanism by which Ebola and Lassa viruses target DC to impair adaptive immunity.

  3. Recognition of extracellular bacteria by NLRs and its role in the development of adaptive immunity

    Directory of Open Access Journals (Sweden)

    Jonathan eFerrand

    2013-10-01

    Full Text Available Innate immune recognition of bacteria is the first requirement for mounting an effective immune response able to control infection. Over the previous decade, the general paradigm was that extracellular bacteria were only sensed by cell surface-expressed Toll-like receptors (TLRs, whereas cytoplasmic sensors, including members of the Nod-like receptor (NLR family, were specific to pathogens capable of breaching the host cell membrane. It has become apparent, however, that intracellular innate immune molecules, such as the NLRs, play key roles in the sensing of not only intracellular, but also extracellular bacterial pathogens or their components. In this review, we will discuss the various mechanisms used by bacteria to activate NLR signaling in host cells. These mechanisms include bacterial secretion systems, pore-forming toxins and outer membrane vesicles. We will then focus on the influence of NLR activation on the development of adaptive immune responses in different cell types.

  4. Adaptive Convergence Rates of a Dirichlet Process Mixture of Multivariate Normals

    OpenAIRE

    Tokdar, Surya T.

    2011-01-01

    It is shown that a simple Dirichlet process mixture of multivariate normals offers Bayesian density estimation with adaptive posterior convergence rates. Toward this, a novel sieve for non-parametric mixture densities is explored, and its rate adaptability to various smoothness classes of densities in arbitrary dimension is demonstrated. This sieve construction is expected to offer a substantial technical advancement in studying Bayesian non-parametric mixture models based on stick-breaking p...

  5. Laser Therapy Inhibits Tumor Growth in Mice by Promoting Immune Surveillance and Vessel Normalization

    Directory of Open Access Journals (Sweden)

    Giulia Ottaviani

    2016-09-01

    Full Text Available Laser therapy, recently renamed as photobiomodulation, stands as a promising supportive treatment for oral mucositis induced by oncological therapies. However, its mechanisms of action and, more importantly, its safety in cancer patients, are still unclear. Here we explored the anti-cancer effect of 3 laser protocols, set at the most commonly used wavelengths, in B16F10 melanoma and oral carcinogenesis mouse models. While laser light increased cell metabolism in cultured cells, the in vivo outcome was reduced tumor progression. This striking, unexpected result, was paralleled by the recruitment of immune cells, in particular T lymphocytes and dendritic cells, which secreted type I interferons. Laser light also reduced the number of highly angiogenic macrophages within the tumor mass and promoted vessel normalization, an emerging strategy to control tumor progression. Collectively, these results set photobiomodulation as a safety procedure in oncological patients and open the way to its innovative use for cancer therapy.

  6. The 3 major types of innate and adaptive cell-mediated effector immunity.

    Science.gov (United States)

    Annunziato, Francesco; Romagnani, Chiara; Romagnani, Sergio

    2015-03-01

    The immune system has tailored its effector functions to optimally respond to distinct species of microbes. Based on emerging knowledge on the different effector T-cell and innate lymphoid cell (ILC) lineages, it is clear that the innate and adaptive immune systems converge into 3 major kinds of cell-mediated effector immunity, which we propose to categorize as type 1, type 2, and type 3. Type 1 immunity consists of T-bet(+) IFN-γ-producing group 1 ILCs (ILC1 and natural killer cells), CD8(+) cytotoxic T cells (TC1), and CD4(+) TH1 cells, which protect against intracellular microbes through activation of mononuclear phagocytes. Type 2 immunity consists of GATA-3(+) ILC2s, TC2 cells, and TH2 cells producing IL-4, IL-5, and IL-13, which induce mast cell, basophil, and eosinophil activation, as well as IgE antibody production, thus protecting against helminthes and venoms. Type 3 immunity is mediated by retinoic acid-related orphan receptor γt(+) ILC3s, TC17 cells, and TH17 cells producing IL-17, IL-22, or both, which activate mononuclear phagocytes but also recruit neutrophils and induce epithelial antimicrobial responses, thus protecting against extracellular bacteria and fungi. On the other hand, type 1 and 3 immunity mediate autoimmune diseases, whereas type 2 responses can cause allergic diseases. Copyright © 2014 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  7. The fungal quorum-sensing molecule farnesol activates innate immune cells but suppresses cellular adaptive immunity.

    Science.gov (United States)

    Leonhardt, Ines; Spielberg, Steffi; Weber, Michael; Albrecht-Eckardt, Daniela; Bläss, Markus; Claus, Ralf; Barz, Dagmar; Scherlach, Kirstin; Hertweck, Christian; Löffler, Jürgen; Hünniger, Kerstin; Kurzai, Oliver

    2015-03-17

    Farnesol, produced by the polymorphic fungus Candida albicans, is the first quorum-sensing molecule discovered in eukaryotes. Its main function is control of C. albicans filamentation, a process closely linked to pathogenesis. In this study, we analyzed the effects of farnesol on innate immune cells known to be important for fungal clearance and protective immunity. Farnesol enhanced the expression of activation markers on monocytes (CD86 and HLA-DR) and neutrophils (CD66b and CD11b) and promoted oxidative burst and the release of proinflammatory cytokines (tumor necrosis factor alpha [TNF-α] and macrophage inflammatory protein 1 alpha [MIP-1α]). However, this activation did not result in enhanced fungal uptake or killing. Furthermore, the differentiation of monocytes to immature dendritic cells (iDC) was significantly affected by farnesol. Several markers important for maturation and antigen presentation like CD1a, CD83, CD86, and CD80 were significantly reduced in the presence of farnesol. Furthermore, farnesol modulated migrational behavior and cytokine release and impaired the ability of DC to induce T cell proliferation. Of major importance was the absence of interleukin 12 (IL-12) induction in iDC generated in the presence of farnesol. Transcriptome analyses revealed a farnesol-induced shift in effector molecule expression and a down-regulation of the granulocyte-macrophage colony-stimulating factor (GM-CSF) receptor during monocytes to iDC differentiation. Taken together, our data unveil the ability of farnesol to act as a virulence factor of C. albicans by influencing innate immune cells to promote inflammation and mitigating the Th1 response, which is essential for fungal clearance. Farnesol is a quorum-sensing molecule which controls morphological plasticity of the pathogenic yeast Candida albicans. As such, it is a major mediator of intraspecies communication. Here, we investigated the impact of farnesol on human innate immune cells known to be

  8. Adaptive Value Normalization in the Prefrontal Cortex Is Reduced by Memory Load

    Science.gov (United States)

    Burke, C. J.; Seifritz, E.; Tobler, P. N.

    2017-01-01

    Abstract Adaptation facilitates neural representation of a wide range of diverse inputs, including reward values. Adaptive value coding typically relies on contextual information either obtained from the environment or retrieved from and maintained in memory. However, it is unknown whether having to retrieve and maintain context information modulates the brain’s capacity for value adaptation. To address this issue, we measured hemodynamic responses of the prefrontal cortex (PFC) in two studies on risky decision-making. In each trial, healthy human subjects chose between a risky and a safe alternative; half of the participants had to remember the risky alternatives, whereas for the other half they were presented visually. The value of safe alternatives varied across trials. PFC responses adapted to contextual risk information, with steeper coding of safe alternative value in lower-risk contexts. Importantly, this adaptation depended on working memory load, such that response functions relating PFC activity to safe values were steeper with presented versus remembered risk. An independent second study replicated the findings of the first study and showed that similar slope reductions also arose when memory maintenance demands were increased with a secondary working memory task. Formal model comparison showed that a divisive normalization model fitted effects of both risk context and working memory demands on PFC activity better than alternative models of value adaptation, and revealed that reduced suppression of background activity was the critical parameter impairing normalization with increased memory maintenance demand. Our findings suggest that mnemonic processes can constrain normalization of neural value representations. PMID:28462394

  9. Chronic grouped social restriction triggers long-lasting immune system adaptations.

    Science.gov (United States)

    Tian, Rui; Hou, Gonglin; Song, Liuwei; Zhang, Jianming; Yuan, Ti-Fei

    2017-05-16

    Chronic stress triggers rigorous psychological and physiological changes, including immunological system adaptations. However, the effects of long-term social restriction on human immune system have not been investigated. The present study is to investigate the effect of chronic stress on immune changes in human blood, with the stress stimuli controlled.10 male volunteers were group isolated from the modern society in a 50-meter-square room for 150 days, with enriched nutrition and good living conditions provided. Serum examination of immune system markers demonstrated numerous changes in different aspects of the immune functions. The changes were observed as early as 30 days and could last for another 150 days after the termination of the restriction period (300 days' time point). The results strongly argued for the adaptation of immunological system under chronic social restriction stress in adult human, preceding a clear change in psychological conditions. The changes of these immune system factors could as well act as the serum biomarkers in clinical early-diagnosis of stress-related disorders.

  10. Asymmetric T lymphocyte division in the initiation of adaptive immune responses.

    Science.gov (United States)

    Chang, John T; Palanivel, Vikram R; Kinjyo, Ichiko; Schambach, Felix; Intlekofer, Andrew M; Banerjee, Arnob; Longworth, Sarah A; Vinup, Kristine E; Mrass, Paul; Oliaro, Jane; Killeen, Nigel; Orange, Jordan S; Russell, Sarah M; Weninger, Wolfgang; Reiner, Steven L

    2007-03-23

    A hallmark of mammalian immunity is the heterogeneity of cell fate that exists among pathogen-experienced lymphocytes. We show that a dividing T lymphocyte initially responding to a microbe exhibits unequal partitioning of proteins that mediate signaling, cell fate specification, and asymmetric cell division. Asymmetric segregation of determinants appears to be coordinated by prolonged interaction between the T cell and its antigen-presenting cell before division. Additionally, the first two daughter T cells displayed phenotypic and functional indicators of being differentially fated toward effector and memory lineages. These results suggest a mechanism by which a single lymphocyte can apportion diverse cell fates necessary for adaptive immunity.

  11. Psychosocial Adaptation of Fathers of Children with Autism, Down Syndrome, and Normal Development.

    Science.gov (United States)

    Rodrigue, James R.; And Others

    1992-01-01

    This study compared fathers of 20 autistic, 20 Down's syndrome, and 20 developmentally normal children on measures of psychosocial adaptation. Groups differed on measures of intrapersonal and family functioning but not on social-ecological variables. There were few differences between fathers of children with autism and those of children with…

  12. A change in inflammatory footprint precedes plaque instability: a systematic evaluation of cellular aspects of the adaptive immune response in human atherosclerosis

    NARCIS (Netherlands)

    van Dijk, R. A.; Duinisveld, A. J. F.; Schaapherder, A. F.; Mulder-Stapel, A.; Hamming, J. F.; Kuiper, J.; de Boer, O. J.; van der Wal, A. C.; Kolodgie, F. D.; Virmani, R.; Lindeman, J. H. N.

    2015-01-01

    Experimental studies characterize adaptive immune response as a critical factor in the progression and complications of atherosclerosis. Yet, it is unclear whether these observations translate to the human situation. This study systematically evaluates cellular components of the adaptive immune

  13. Co-ordinating innate and adaptive immunity to viral infection: mobility is the key

    DEFF Research Database (Denmark)

    Wern, Jeanette Erbo; Thomsen, Allan Randrup

    2009-01-01

    The host counters a viral infection through a complex response made up of components belonging to both the innate and the adaptive immune system. In this report, we review the mechanisms underlying this response, how it is induced and how it is co-ordinated. As cell-cell communication represents...... the very essence of immune system physiology, a key to a rapid, efficient and optimally regulated immune response is the ability of the involved cells to rapidly shift between a stationary and a mobile state, combined with stringent regulation of cell migration during the mobile state. Through the co......-ordinated recruitment of different cell types intended to work in concert, cellular co-operation is optimized particularly under conditions that may involve rare cells. Consequently, a major focus is placed on presenting an overview of the co-operative events and the associated cell migration, which is essential...

  14. Modulatory Effects of Antibody Replacement Therapy to Innate and Adaptive Immune Cells

    Directory of Open Access Journals (Sweden)

    Isabella Quinti

    2017-06-01

    Full Text Available Intravenous immunoglobulin administered at replacement dosages modulates innate and adaptive immune cells in primary antibody deficiencies (PAD in a different manner to what observed when high dosages are used or when their effect is analyzed by in vitro experimental conditions. The effects seem to be beneficial on innate cells in that dendritic cells maturate, pro-inflammatory monocytes decrease, and neutrophil function is preserved. The effects are less clear on adaptive immune cells. IVIg induced a transient increase of Treg and a long-term increase of CD4 cells. More complex and less understood is the interplay of IVIg with defective B cells of PAD patients. The paucity of data underlies the need of more studies on patients with PAD before drawing conclusions on the in vivo mechanisms of action of IVIg based on in vitro investigations.

  15. A cascade reaction network mimicking the basic functional steps of adaptive immune response.

    Science.gov (United States)

    Han, Da; Wu, Cuichen; You, Mingxu; Zhang, Tao; Wan, Shuo; Chen, Tao; Qiu, Liping; Zheng, Zheng; Liang, Hao; Tan, Weihong

    2015-10-01

    Biological systems use complex 'information-processing cores' composed of molecular networks to coordinate their external environment and internal states. An example of this is the acquired, or adaptive, immune system (AIS), which is composed of both humoral and cell-mediated components. Here we report the step-by-step construction of a prototype mimic of the AIS that we call an adaptive immune response simulator (AIRS). DNA and enzymes are used as simple artificial analogues of the components of the AIS to create a system that responds to specific molecular stimuli in vitro. We show that this network of reactions can function in a manner that is superficially similar to the most basic responses of the vertebrate AIS, including reaction sequences that mimic both humoral and cellular responses. As such, AIRS provides guidelines for the design and engineering of artificial reaction networks and molecular devices.

  16. CRISPR-Cas: evolution of an RNA-based adaptive immunity system in prokaryotes.

    Science.gov (United States)

    Koonin, Eugene V; Makarova, Kira S

    2013-05-01

    The CRISPR-Cas (clustered regularly interspaced short palindromic repeats, CRISPR-associated genes) is an adaptive immunity system in bacteria and archaea that functions via a distinct self-non-self recognition mechanism that is partially analogous to the mechanism of eukaryotic RNA interference (RNAi). The CRISPR-Cas system incorporates fragments of virus or plasmid DNA into the CRISPR repeat cassettes and employs the processed transcripts of these spacers as guide RNAs to cleave the cognate foreign DNA or RNA. The Cas proteins, however, are not homologous to the proteins involved in RNAi and comprise numerous, highly diverged families. The majority of the Cas proteins contain diverse variants of the RNA recognition motif (RRM), a widespread RNA-binding domain. Despite the fast evolution that is typical of the cas genes, the presence of diverse versions of the RRM in most Cas proteins provides for a simple scenario for the evolution of the three distinct types of CRISPR-cas systems. In addition to several proteins that are directly implicated in the immune response, the cas genes encode a variety of proteins that are homologous to prokaryotic toxins that typically possess nuclease activity. The predicted toxins associated with CRISPR-Cas systems include the essential Cas2 protein, proteins of COG1517 that, in addition to a ligand-binding domain and a helix-turn-helix domain, typically contain different nuclease domains and several other predicted nucleases. The tight association of the CRISPR-Cas immunity systems with predicted toxins that, upon activation, would induce dormancy or cell death suggests that adaptive immunity and dormancy/suicide response are functionally coupled. Such coupling could manifest in the persistence state being induced and potentially providing conditions for more effective action of the immune system or in cell death being triggered when immunity fails.

  17. The M3 muscarinic receptor is required for optimal adaptive immunity to helminth and bacterial infection.

    Directory of Open Access Journals (Sweden)

    Matthew Darby

    2015-01-01

    Full Text Available Innate immunity is regulated by cholinergic signalling through nicotinic acetylcholine receptors. We show here that signalling through the M3 muscarinic acetylcholine receptor (M3R plays an important role in adaptive immunity to both Nippostrongylus brasiliensis and Salmonella enterica serovar Typhimurium, as M3R-/- mice were impaired in their ability to resolve infection with either pathogen. CD4 T cell activation and cytokine production were reduced in M3R-/- mice. Immunity to secondary infection with N. brasiliensis was severely impaired, with reduced cytokine responses in M3R-/- mice accompanied by lower numbers of mucus-producing goblet cells and alternatively activated macrophages in the lungs. Ex vivo lymphocyte stimulation of cells from intact BALB/c mice infected with N. brasiliensis and S. typhimurium with muscarinic agonists resulted in enhanced production of IL-13 and IFN-γ respectively, which was blocked by an M3R-selective antagonist. Our data therefore indicate that cholinergic signalling via the M3R is essential for optimal Th1 and Th2 adaptive immunity to infection.

  18. Quantitative proteomics and terminomics to elucidate the role of ubiquitination and proteolysis in adaptive immunity.

    Science.gov (United States)

    Klein, Theo; Viner, Rosa I; Overall, Christopher M

    2016-10-28

    Adaptive immunity is the specialized defence mechanism in vertebrates that evolved to eliminate pathogens. Specialized lymphocytes recognize specific protein epitopes through antigen receptors to mount potent immune responses, many of which are initiated by nuclear factor-kappa B activation and gene transcription. Most, if not all, pathways in adaptive immunity are further regulated by post-translational modification (PTM) of signalling proteins, e.g. phosphorylation, citrullination, ubiquitination and proteolytic processing. The importance of PTMs is reflected by genetic or acquired defects in these pathways that lead to a dysfunctional immune response. Here we discuss the state of the art in targeted proteomics and systems biology approaches to dissect the PTM landscape specifically regarding ubiquitination and proteolysis in B- and T-cell activation. Recent advances have occurred in methods for specific enrichment and targeted quantitation. Together with improved instrument sensitivity, these advances enable the accurate analysis of often rare PTM events that are opaque to conventional proteomics approaches, now rendering in-depth analysis and pathway dissection possible. We discuss published approaches, including as a case study the profiling of the N-terminome of lymphocytes of a rare patient with a genetic defect in the paracaspase protease MALT1, a key regulator protease in antigen-driven signalling, which was manifested by elevated linear ubiquitination.This article is part of the themed issue 'Quantitative mass spectrometry'. © 2016 The Authors.

  19. FORMATION OF INNATE AND ADAPTIVE IMMUNE RESPONSE UNDER THE INFLUENCE OF DIFFERENT FLAVIVIRUS VACCINES

    Directory of Open Access Journals (Sweden)

    N. V. Krylova

    2015-01-01

    Full Text Available The review examines in a comparative perspective the key moments of formation of innate and adaptive immune responses to different types of current flavivirus vaccines: live attenuated against yellow fever virus and inactivated whole virus against tick-borne encephalitis virus. Particular attention is paid to the ability of these different vaccines, containing exogenous pathogen-associated molecular structures, to stimulate innate immunity. Live attenuated vaccine by infecting several subtypes of dendritic cells activates them through various pattern-recognition receptors, such as Tolland RIG-I-like receptors, which leads to significant production of proinflammatory cytokines, including interferon-α primary mediator of innate antiviral immunity. By simulating natural viral infection, this vaccine quickly spreads over the vascular network, and the dendritic cells, activated by it, migrate to the draining lymph nodes and trigger multiple foci of Tand B-cell activation. Inactivated vaccine stimulates the innate immunity predominantly at the injection site, and for the sufficient activation requires the presence in its composition of an adjuvant (aluminum hydroxide, which effects the formation and activation of inflammasomes, ensuring the formation and secretion of IL-1β and IL-18 that, in turn, trigger a cascade of cellular and humoral innate immune responses. We demonstrated the possibility of involvement in the induction of innate immunity, mediated by the inactivated vaccine, endogenous pathogenassociated molecular patterns (uric acid and host cell DNA, forming at the vaccine injection site. We discuss the triggering of Band T-cell responses by flavivirus vaccines that determine various duration of protection against various pathogens. A single injection of the live vaccine against yellow fever virus induces polyvalent adaptive immune response, including the production of cytotoxic T-lymphocytes, Th1and Th2-cells and neutralizing antibodies

  20. The activation of the adaptive immune system: cross-talk between antigen-presenting cells, T cells and B cells.

    Science.gov (United States)

    den Haan, Joke M M; Arens, Ramon; van Zelm, Menno C

    2014-12-01

    The adaptive immune system consists of T and B cells that express clonally distributed antigen receptors. To achieve functional adaptive immune responses, antigen-specific T cell populations are stimulated by professional antigen-presenting cells like dendritic cells (DCs), which provide crucial stimulatory signals for efficient expansion and development of effector functions. Antigen-specific B cells receive costimulatory signals from helper T cells to stimulate affinity maturation and isotype switching. Here we elaborate on the interactions between DCs, T cells and B cells, and on the important signals for efficient induction of adaptive immune responses. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Physical model of the immune response of bacteria against bacteriophage through the adaptive CRISPR-Cas immune system

    Energy Technology Data Exchange (ETDEWEB)

    Han, Pu; Niestemski, Liang Ren; Deem, Michael W [Department of Physics and Astronomy, Rice University, Houston, TX 77005 (United States); Barrick, Jeffrey E, E-mail: mwdeem@rice.edu [Department of Chemistry and Biochemistry, The University of Texas at Austin, Austin, TX 78712 (United States)

    2013-04-15

    Bacteria and archaea have evolved an adaptive, heritable immune system that recognizes and protects against viruses or plasmids. This system, known as the CRISPR-Cas system, allows the host to recognize and incorporate short foreign DNA or RNA sequences, called 'spacers' into its CRISPR system. Spacers in the CRISPR system provide a record of the history of bacteria and phage coevolution. We use a physical model to study the dynamics of this coevolution as it evolves stochastically over time. We focus on the impact of mutation and recombination on bacteria and phage evolution and evasion. We discuss the effect of different spacer deletion mechanisms on the coevolutionary dynamics. We make predictions about bacteria and phage population growth, spacer diversity within the CRISPR locus, and spacer protection against the phage population. (paper)

  2. Physical model of the immune response of bacteria against bacteriophage through the adaptive CRISPR-Cas immune system

    Science.gov (United States)

    Han, Pu; Niestemski, Liang Ren; Barrick, Jeffrey E.; Deem, Michael W.

    2013-04-01

    Bacteria and archaea have evolved an adaptive, heritable immune system that recognizes and protects against viruses or plasmids. This system, known as the CRISPR-Cas system, allows the host to recognize and incorporate short foreign DNA or RNA sequences, called ‘spacers’ into its CRISPR system. Spacers in the CRISPR system provide a record of the history of bacteria and phage coevolution. We use a physical model to study the dynamics of this coevolution as it evolves stochastically over time. We focus on the impact of mutation and recombination on bacteria and phage evolution and evasion. We discuss the effect of different spacer deletion mechanisms on the coevolutionary dynamics. We make predictions about bacteria and phage population growth, spacer diversity within the CRISPR locus, and spacer protection against the phage population.

  3. Physical model of the immune response of bacteria against bacteriophage through the adaptive CRISPR-Cas immune system

    International Nuclear Information System (INIS)

    Han, Pu; Niestemski, Liang Ren; Deem, Michael W; Barrick, Jeffrey E

    2013-01-01

    Bacteria and archaea have evolved an adaptive, heritable immune system that recognizes and protects against viruses or plasmids. This system, known as the CRISPR-Cas system, allows the host to recognize and incorporate short foreign DNA or RNA sequences, called ‘spacers’ into its CRISPR system. Spacers in the CRISPR system provide a record of the history of bacteria and phage coevolution. We use a physical model to study the dynamics of this coevolution as it evolves stochastically over time. We focus on the impact of mutation and recombination on bacteria and phage evolution and evasion. We discuss the effect of different spacer deletion mechanisms on the coevolutionary dynamics. We make predictions about bacteria and phage population growth, spacer diversity within the CRISPR locus, and spacer protection against the phage population. (paper)

  4. Vitamin B5 Reduces Bacterial Growth via Regulating Innate Immunity and Adaptive Immunity in Mice Infected with Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Wenting He

    2018-02-01

    Full Text Available The mechanisms by which vitamins regulate immunity and their effect as an adjuvant treatment for tuberculosis have gradually become very important research topics. Studies have found that vitamin B5 (VB5 can promote epithelial cells to express inflammatory cytokines. We aimed to examine the proinflammatory and antibacterial effect of VB5 in macrophages infected with Mycobacterium tuberculosis (MTB strain H37Rv and the therapeutic potential of VB5 in vivo with tuberculosis. We investigated the activation of inflammatory signal molecules (NF-κB, AKT, JNK, ERK, and p38, the expression of two primary inflammatory cytokines (tumor necrosis factor and interleukin-6 and the bacterial burdens in H37Rv-infected macrophages stimulated with VB5 to explore the effect of VB5 on the inflammatory and antibacterial responses of macrophages. We further treated the H37Rv-infected mice with VB5 to explore VB5’s promotion of the clearance of H37Rv in the lungs and the effect of VB5 on regulating the percentage of inflammatory cells. Our data showed that VB5 enhanced the phagocytosis and inflammatory response in macrophages infected with H37Rv. Oral administration of VB5 decreased the number of colony-forming units of H37Rv in lungs of mice at 1, 2, and 4 weeks after infection. In addition, VB5 regulated the percentage of macrophages and promoted CD4+ T cells to express interferon-γ and interleukin-17; however, it had no effect on the percentage of polymorphonuclear neutrophils, CD4+ and CD8+ T cells. In conclusion, VB5 significantly inhibits the growth of MTB by regulating innate immunity and adaptive immunity.

  5. Angiogenesis for tumor vascular normalization of Endostar on hepatoma 22 tumor-bearing mice is involved in the immune response.

    Science.gov (United States)

    Xu, Qingyu; Gu, Junfei; Lv, You; Yuan, Jiarui; Yang, Nan; Chen, Juan; Wang, Chunfei; Hou, Xuefeng; Jia, Xiaobin; Feng, Liang; Yin, Guowen

    2018-03-01

    Tumor vascular normalization involved in immune response is beneficial to the chemotherapy of tumors. Recombinant human endostatin (Endostar), an angiogenesis inhibitor, has been demonstrated to be effective in hepatocellular cancer (HCC). However, its vascular normalization in HCC and the role of the immune response in angiogenesis were unclear. In the present study, effects of Endostar on tumor vascular normalization were evaluated in hepatoma 22 (H22) tumor-bearing mice. Endostar was able to inhibit the proliferation and infiltration of tumor cells and improve α-fetoprotein, tumor necrosis factor-α and cyclic adenosine 5'-phosphate levels in the serum of H22-bearing mice, as well as the protein expression levels of the immune factors interferon-γ and cluster of differentiation (CD)86 in liver tissue. Endostar also exhibited more marked downregulation of the levels of vascular endothelial growth factor, CD31, matrix metalloproteinase (MMP)-2, MMP-9 and interleukin-17 during day 3-9 treatment, resulting in short-term normalization of tumor blood vessels. The period of vascular normalization was 3-9 days. The results of the present study demonstrated that Endostar was able to induce the period of vascular normalization, contributing to a more efficacious means of HCC treatment combined with other chemotherapy, and this effect was associated with the immune response. It may be concluded that Endostar inhibited immunity-associated angiogenesis behaviors of vascular endothelial cells in response to HCC. The results of the present study provided more reasonable possibility for the combination therapy of Endostar for the treatment of HCC.

  6. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

    Science.gov (United States)

    Ruiz, Lorena; Espinosa-Martos, Irene; García-Carral, Cristina; Manzano, Susana; McGuire, Michelle K.; Meehan, Courtney L.; McGuire, Mark A.; Williams, Janet E.; Foster, James; Sellen, Daniel W.; Kamau-Mbuthia, Elizabeth W.; Kamundia, Egidioh W.; Mbugua, Samwel; Moore, Sophie E.; Kvist, Linda J.; Otoo, Gloria E.; Lackey, Kimberly A.; Flores, Katherine; Pareja, Rossina G.; Bode, Lars; Rodríguez, Juan M.

    2017-01-01

    Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα), acquired immunity factors (IL2, IL4, IL10, IL13, IL17), chemokines (IL8, Groα, MCP1, MIP1β), growth factors [IL5, IL7, epidermal growth factor (EGF), granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM), in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not) common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid. Clinical Trial Registration: www.ClinicalTrials.gov, identifier NCT02670278. PMID:28713365

  7. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

    Directory of Open Access Journals (Sweden)

    Lorena Ruiz

    2017-06-01

    Full Text Available Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα, acquired immunity factors (IL2, IL4, IL10, IL13, IL17, chemokines (IL8, Groα, MCP1, MIP1β, growth factors [IL5, IL7, epidermal growth factor (EGF, granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM, in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid.Clinical Trial Registration:www.ClinicalTrials.gov, identifier NCT02670278.

  8. Control Systems with Normalized and Covariance Adaptation by Optimal Control Modification

    Science.gov (United States)

    Nguyen, Nhan T. (Inventor); Burken, John J. (Inventor); Hanson, Curtis E. (Inventor)

    2016-01-01

    Disclosed is a novel adaptive control method and system called optimal control modification with normalization and covariance adjustment. The invention addresses specifically to current challenges with adaptive control in these areas: 1) persistent excitation, 2) complex nonlinear input-output mapping, 3) large inputs and persistent learning, and 4) the lack of stability analysis tools for certification. The invention has been subject to many simulations and flight testing. The results substantiate the effectiveness of the invention and demonstrate the technical feasibility for use in modern aircraft flight control systems.

  9. Interleukin-4 Receptor Alpha: From Innate to Adaptive Immunity in Murine Models of Cutaneous Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Ramona Hurdayal

    2017-11-01

    Full Text Available The interleukin (IL-4 receptor alpha (IL-4Rα, ubiquitously expressed on both innate and adaptive immune cells, controls the signaling of archetypal type 2 immune regulators; IL-4 and IL-13, which elicit their signaling action by the type 1 IL-4Rα/gamma common and/or the type 2 IL-4Rα/IL-13Rα complexes. Global gene-deficient mouse models targeting IL-4, IL-13, or the IL-4Rα chain, followed by the development of conditional mice and generation of important cell-type-specific IL-4Rα-deficient mouse models, were indeed critical to gaining in-depth understanding of detrimental T helper (Th 2 mechanisms in type 1-controlled diseases. A primary example being cutaneous leishmaniasis, which is caused by the protozoan parasite Leishmania major, among others. The disease is characterized by localized self-healing cutaneous lesions and necrosis for which, currently, not a single vaccine has made it to a stage that can be considered effective. The spectrum of human leishmaniasis belongs to the top 10 infectious diseases according to the World Health Organization. As such, 350 million humans are at risk of infection and disease, with an incidence of 1.5–2 million new cases being reported annually. A major aim of our research is to identify correlates of host protection and evasion, which may aid in vaccine design and therapeutic interventions. In this review, we focus on the immune-regulatory role of the IL-4Rα chain from innate immune responses to the development of beneficial type 1 and detrimental type 2 adaptive immune responses during cutaneous Leishmania infection. We discuss the cell-specific requirements of the IL-4Rα chain on crucial innate immune cells during L. major infection, including, IL-4Rα-responsive skin keratinocytes, macrophages, and neutrophils, as well as dendritic cells (DCs. The latter, contributing to one of the paradigm shifts with respect to the role of IL-4 instructing DCs in vivo, to promote Th1 responses against L

  10. Analysis and comparison of immune reactivity in guinea-pigs immunized with equivalent numbers of normal or radiation-attenuated cercariae of Schistosoma mansoni

    International Nuclear Information System (INIS)

    Rogers, M.V.; McLaren, D.J.

    1987-01-01

    Guinea-pigs immunized with equivalent numbers of normal or radiation-attenuated cercariae of Schistosoma mansoni develop close to complete resistance to reinfection at weeks 12 and 4.5 respectively. We here analyse and compare the immune responses induced by the two populations of cercariae. Both radiation-attenuated and normal parasites of S. mansoni elicited an extensive germinal centre response in guinea-pigs by week 4.5 post-immunization. The anti-parasite antibody titre and cytotoxic activity of serum from 4.5-week-vaccinated, or 4.5-week-infected guinea-pigs were approximately equal, but sera from 12-week-infected individuals had high titres of anti-parasite antibody, which promoted significant larvicidal activity in vitro. In all cases, larvicidal activity was mediated by the IgG 2 fraction of the immune serum. Lymphocyte transformation tests conducted on splenic lymphocytes from 4.5-week vaccinated guinea-pigs revealed maximal stimulation against cercarial, 2-week and 3-week worm antigens, whereas spleen cells from 4.5-week-infected guinea-pigs were maximally stimulated by cercarial and 6-week worm antigens. The splenic lymphocyte responses of 12-week infected animals were dramatic against antigens prepared from all life-stages of the parasite. (author)

  11. Genome complexity in the coelacanth is reflected in its adaptive immune system

    Science.gov (United States)

    Saha, Nil Ratan; Ota, Tatsuya; Litman, Gary W.; Hansen, John; Parra, Zuly; Hsu, Ellen; Buonocore, Francesco; Canapa, Adriana; Cheng, Jan-Fang; Amemiya, Chris T.

    2014-01-01

    We have analyzed the available genome and transcriptome resources from the coelacanth in order to characterize genes involved in adaptive immunity. Two highly distinctive IgW-encoding loci have been identified that exhibit a unique genomic organization, including a multiplicity of tandemly repeated constant region exons. The overall organization of the IgW loci precludes typical heavy chain class switching. A locus encoding IgM could not be identified either computationally or by using several different experimental strategies. Four distinct sets of genes encoding Ig light chains were identified. This includes a variant sigma-type Ig light chain previously identified only in cartilaginous fishes and which is now provisionally denoted sigma-2. Genes encoding α/β and γ/δ T-cell receptors, and CD3, CD4, and CD8 co-receptors also were characterized. Ig heavy chain variable region genes and TCR components are interspersed within the TCR α/δ locus; this organization previously was reported only in tetrapods and raises questions regarding evolution and functional cooption of genes encoding variable regions. The composition, organization and syntenic conservation of the major histocompatibility complex locus have been characterized. We also identified large numbers of genes encoding cytokines and their receptors, and other genes associated with adaptive immunity. In terms of sequence identity and organization, the adaptive immune genes of the coelacanth more closely resemble orthologous genes in tetrapods than those in teleost fishes, consistent with current phylogenomic interpretations. Overall, the work reported described herein highlights the complexity inherent in the coelacanth genome and provides a rich catalog of immune genes for future investigations.

  12. Adaptive Linear and Normalized Combination of Radial Basis Function Networks for Function Approximation and Regression

    Directory of Open Access Journals (Sweden)

    Yunfeng Wu

    2014-01-01

    Full Text Available This paper presents a novel adaptive linear and normalized combination (ALNC method that can be used to combine the component radial basis function networks (RBFNs to implement better function approximation and regression tasks. The optimization of the fusion weights is obtained by solving a constrained quadratic programming problem. According to the instantaneous errors generated by the component RBFNs, the ALNC is able to perform the selective ensemble of multiple leaners by adaptively adjusting the fusion weights from one instance to another. The results of the experiments on eight synthetic function approximation and six benchmark regression data sets show that the ALNC method can effectively help the ensemble system achieve a higher accuracy (measured in terms of mean-squared error and the better fidelity (characterized by normalized correlation coefficient of approximation, in relation to the popular simple average, weighted average, and the Bagging methods.

  13. Analysis of adaptability of radioactive liquid effluent discharge under normal condition of inland nuclear power plant

    International Nuclear Information System (INIS)

    Xu Yueping; Zhang Bing; Chen Yang; Zhu Lingqing; Tao Yunliang; Shangguan Zhihong

    2011-01-01

    The discharge of radioactive liquid effluent from inland nuclear power plant under normal operation is an important part to be considered in environmental impact assessment. Requirements of newly revised and upcoming standards GB 6249 and GB 14587 are introduced in this paper. Through an example of an inland NPP siting in the preliminary feasibility study phase, the adaptability to the relevant regulations in the site selection is analyzed. Also, the concerned problems in the design of AP1000 units are addressed. (authors)

  14. Improved Discovery of Molecular Interactions in Genome-Scale Data with Adaptive Model-Based Normalization

    Science.gov (United States)

    Brown, Patrick O.

    2013-01-01

    Background High throughput molecular-interaction studies using immunoprecipitations (IP) or affinity purifications are powerful and widely used in biology research. One of many important applications of this method is to identify the set of RNAs that interact with a particular RNA-binding protein (RBP). Here, the unique statistical challenge presented is to delineate a specific set of RNAs that are enriched in one sample relative to another, typically a specific IP compared to a non-specific control to model background. The choice of normalization procedure critically impacts the number of RNAs that will be identified as interacting with an RBP at a given significance threshold – yet existing normalization methods make assumptions that are often fundamentally inaccurate when applied to IP enrichment data. Methods In this paper, we present a new normalization methodology that is specifically designed for identifying enriched RNA or DNA sequences in an IP. The normalization (called adaptive or AD normalization) uses a basic model of the IP experiment and is not a variant of mean, quantile, or other methodology previously proposed. The approach is evaluated statistically and tested with simulated and empirical data. Results and Conclusions The adaptive (AD) normalization method results in a greatly increased range in the number of enriched RNAs identified, fewer false positives, and overall better concordance with independent biological evidence, for the RBPs we analyzed, compared to median normalization. The approach is also applicable to the study of pairwise RNA, DNA and protein interactions such as the analysis of transcription factors via chromatin immunoprecipitation (ChIP) or any other experiments where samples from two conditions, one of which contains an enriched subset of the other, are studied. PMID:23349766

  15. Porphyromonas gingivalis suppresses adaptive immunity in periodontitis, atherosclerosis, and Alzheimer’s disease

    Directory of Open Access Journals (Sweden)

    Ingar Olsen

    2016-11-01

    Full Text Available Porphyromonas gingivalis, a keystone pathogen in chronic periodontitis, has been found to associate with remote body organ inflammatory pathologies, including atherosclerosis and Alzheimer’s disease (AD. Although P. gingivalis has a plethora of virulence factors, much of its pathogenicity is surprisingly related to the overall immunosuppression of the host. This review focuses on P. gingivalis aiding suppression of the host’s adaptive immune system involving manipulation of cellular immunological responses, specifically T cells and B cells in periodontitis and related conditions. In periodontitis, this bacterium inhibits the synthesis of IL-2 and increases humoral responses. This reduces the inflammatory responses related to T- and B-cell activation, and subsequent IFN-γ secretion by a subset of T cells. The T cells further suppress upregulation of programmed cell death-1 (PD-1-receptor on CD+cells and its ligand PD-L1 on CD11b+-subset of T cells. IL-2 downregulates genes regulated by immune response and induces a cytokine pattern in which the Th17 lineage is favored, thereby modulating the Th17/T-regulatory cell (Treg imbalance. The suppression of IFN-γ-stimulated release of interferon-inducible protein-10 (IP-10 chemokine ligands [ITAC (CXCL11 and Mig (CXCL9] by P. gingivalis capsular serotypes triggers distinct T cell responses and contributes to local immune evasion by release of its outer membrane vesicles. In atherosclerosis, P. gingivalis reduces Tregs, transforms growth factor beta-1 (TGFβ-1, and causes imbalance in the Th17 lineage of the Treg population. In AD, P. gingivalis may affect the blood–brain barrier permeability and inhibit local IFN-γ response by preventing entry of immune cells into the brain. The scarcity of adaptive immune cells in AD neuropathology implies P. gingivalis infection of the brain likely causing impaired clearance of insoluble amyloid and inducing immunosuppression. By the effective manipulation of

  16. Computational tool for immunotoxic assessment of pyrethroids toward adaptive immune cell receptors.

    Science.gov (United States)

    Kumar, Anoop; Behera, Padma Charan; Rangra, Naresh Kumar; Dey, Suddhasattya; Kant, Kamal

    2018-01-01

    Pyrethroids have prominently known for their insecticidal actions worldwide, but recent reports as anticancer and antiviral applications gained a lot of interest to further understand their safety and immunotoxicity. This encouraged us to carry out our present study to evaluate the interactions of pyrethroids toward adaptive immune cell receptors. Type 1 and Type 2 pyrethroids were tested on T (CD4 and CD8) and B (CD28 and CD45) immune cell receptors using Maestro 9.3 (Schrödinger, LLC, Cambridge, USA). In addition, top-ranked tested ligands were too explored for toxicity prediction in rodents using ProTOX tool. Pyrethroids (specifically type 2) such as fenvalerate (-5.534 kcal/mol: CD8), fluvalinate (-4.644 and - 4.431 kcal/mol: CD4 and CD45), and cypermethrin (-3.535 kcal/mol: CD28) have outcome in less energy or more affinity for B-cell and T-cell immune receptors which may later result in the immunosuppressive and hypersensitivity reactions. The current findings have uncovered that there is a further need to assess the Type 2 pyrethroids with wet laboratory experiments to understand the chemical nature of pyrethroid-induced immunotoxicity. Fenvalerate showed apex glide score toward CD8 immune receptor, while fluvalinate confirmed top-ranked binding with CD4 and CD45 immune proteinsIn addition, cypermethrin outcame in top glide score against CD28 immune receptorTop dock hits (Type 2) pyrethroids have shown probable toxicity targets toward AOFA: Amine oxidase (flavin-containing) A and PGH1: Prostaglandin G/H synthase 1, respectively. Abbreviations used: PDB: Protein Data Bank; AOFA: Amine oxidase (flavin-containing) A; PGH 1: Prostaglandin G/H synthase 1.

  17. Towards adapting a normal patient database for SPECT brain perfusion imaging

    International Nuclear Information System (INIS)

    Smith, N D; Soleimani, M; Mitchell, C N; Holmes, R B; Evans, M J; Cade, S C

    2012-01-01

    Single-photon emission computerized tomography (SPECT) is a tool which can be used to image perfusion in the brain. Clinicians can use such images to help diagnose dementias such as Alzheimer's disease. Due to the intrinsic stochasticity in the photon imaging system, some form of statistical comparison of an individual image with a 'normal' patient database gives a clinician additional confidence in interpreting the image. Due to the variations between SPECT camera systems, ideally a normal patient database is required for each individual system. However, cost or ethical considerations often prohibit the collection of such a database for each new camera system. Some method of adapting existing normal patient databases to new camera systems would be beneficial. This paper introduces a method which may be regarded as a 'first-pass' attempt based on 2-norm regularization and a codebook of discrete spatially stationary convolutional kernels. Some preliminary illustrative results are presented, together with discussion on limitations and possible improvements

  18. Normalized value coding explains dynamic adaptation in the human valuation process.

    Science.gov (United States)

    Khaw, Mel W; Glimcher, Paul W; Louie, Kenway

    2017-11-28

    The notion of subjective value is central to choice theories in ecology, economics, and psychology, serving as an integrated decision variable by which options are compared. Subjective value is often assumed to be an absolute quantity, determined in a static manner by the properties of an individual option. Recent neurobiological studies, however, have shown that neural value coding dynamically adapts to the statistics of the recent reward environment, introducing an intrinsic temporal context dependence into the neural representation of value. Whether valuation exhibits this kind of dynamic adaptation at the behavioral level is unknown. Here, we show that the valuation process in human subjects adapts to the history of previous values, with current valuations varying inversely with the average value of recently observed items. The dynamics of this adaptive valuation are captured by divisive normalization, linking these temporal context effects to spatial context effects in decision making as well as spatial and temporal context effects in perception. These findings suggest that adaptation is a universal feature of neural information processing and offer a unifying explanation for contextual phenomena in fields ranging from visual psychophysics to economic choice.

  19. Design of Immune-Algorithm-Based Adaptive Fuzzy Controllers for Active Suspension Systems

    Directory of Open Access Journals (Sweden)

    Ming-Yuan Shieh

    2014-04-01

    Full Text Available The aim of this paper is to integrate the artificial immune systems and adaptive fuzzy control for the automobile suspension system, which is regarded as a multiobjective optimization problem. Moreover, the fuzzy control rules and membership controls are then introduced for identification and memorization. It leads fast convergence in the search process. Afterwards, by using the diversity of the antibody group, trapping into local optimum can be avoided, and the system possesses a global search capacity and a faster local search for finding a global optimal solution. Experimental results show that the artificial immune system with the recognition and memory functions allows the system to rapidly converge and search for the global optimal approximate solutions.

  20. Peripheral dendritic cells are essential for both the innate and adaptive antiviral immune responses in the central nervous system

    International Nuclear Information System (INIS)

    Steel, Christina D.; Hahto, Suzanne M.; Ciavarra, Richard P.

    2009-01-01

    Intranasal application of vesicular stomatitis virus (VSV) causes acute infection of the central nervous system (CNS). However, VSV encephalitis is not invariably fatal, suggesting that the CNS may contain a professional antigen-presenting cell (APC) capable of inducing or propagating a protective antiviral immune response. To examine this possibility, we first characterized the cellular elements that infiltrate the brain as well as the activation status of resident microglia in the brains of normal and transgenic mice acutely ablated of peripheral dendritic cells (DCs) in vivo. VSV encephalitis was characterized by a pronounced infiltrate of myeloid cells (CD45 high CD11b + ) and CD8 + T cells containing a subset that was specific for the immunodominant VSV nuclear protein epitope. This T cell response correlated temporally with a rapid and sustained upregulation of MHC class I expression on microglia, whereas class II expression was markedly delayed. Ablation of peripheral DCs profoundly inhibited the inflammatory response as well as infiltration of virus-specific CD8 + T cells. Unexpectedly, the VSV-induced interferon-gamma (IFN-γ) response in the CNS remained intact in DC-deficient mice. Thus, both the inflammatory and certain components of the adaptive primary antiviral immune response in the CNS are dependent on peripheral DCs in vivo.

  1. Immunization

    Science.gov (United States)

    ... a lot worse. Some are even life-threatening. Immunization shots, or vaccinations, are essential. They protect against ... B, polio, tetanus, diphtheria, and pertussis (whooping cough). Immunizations are important for adults as well as children. ...

  2. Innate and adaptive immune interactions at the fetal-maternal interface in healthy human pregnancy and preeclampsia

    Directory of Open Access Journals (Sweden)

    Peter eHsu

    2014-03-01

    Full Text Available Maternal immune tolerance of the fetus is indispensible for a healthy pregnancy outcome. Nowhere is this immune tolerance more important than at the fetal-maternal interface – the decidua, the site of implantation and placentation. Indeed, many lines of evidence suggest an immunological origin to the common pregnancy-related disorder, preeclampsia. Within the innate immune system, decidual NK cells and antigen presenting cells (including dendritic cells and macrophages make up a large proportion of the decidual leukocyte population, and are thought to modulate vascular remodeling and trophoblast invasion. On the other hand, within the adaptive immune system, Foxp3+ regulatory T (Treg cells are crucial for ensuring immune tolerance towards the semi-allogeneic fetus. Additionally, another population of CD4+HLA-G+ suppressor T cells has also been identified as a potential player in the maintenance of immune tolerance. More recently, studies are beginning to unravel the potential interactions between the innate and the adaptive immune system within the decidua, that are required to maintain a healthy pregnancy. In this review, we discuss the recent advances exploring the complex crosstalk between the innate and the adaptive immune system during human pregnancy.

  3. Engineered Murine HSCs Reconstitute Multi-lineage Hematopoiesis and Adaptive Immunity

    Directory of Open Access Journals (Sweden)

    Yi-Fen Lu

    2016-12-01

    Full Text Available Hematopoietic stem cell (HSC transplantation is curative for malignant and genetic blood disorders, but is limited by donor availability and immune-mismatch. Deriving HSCs from patient-matched embryonic/induced-pluripotent stem cells (ESCs/iPSCs could address these limitations. Prior efforts in murine models exploited ectopic HoxB4 expression to drive self-renewal and enable multi-lineage reconstitution, yet fell short in delivering robust lymphoid engraftment. Here, by titrating exposure of HoxB4-ESC-HSC to Notch ligands, we report derivation of engineered HSCs that self-renew, repopulate multi-lineage hematopoiesis in primary and secondary engrafted mice, and endow adaptive immunity in immune-deficient recipients. Single-cell analysis shows that following engraftment in the bone marrow niche, these engineered HSCs further specify to a hybrid cell type, in which distinct gene regulatory networks of hematopoietic stem/progenitors and differentiated hematopoietic lineages are co-expressed. Our work demonstrates engineering of fully functional HSCs via modulation of genetic programs that govern self-renewal and lineage priming.

  4. Adaptive maternal immune deviations as a ground for autism spectrum disorders development in children.

    Science.gov (United States)

    Poletaev, Alexander B; Poletaeva, Alina A; Pukhalenko, Alexander I; Zamaleeva, Roza S; Cherepanova, Natalia A; Frizin, Dmitry V

    2014-01-01

    Autism is a vexed problem today. Overall, there is a high frequency of birth children (1:80 - 1:150) with late diagnosed autism spectrum disorders (ASD) and this trend is getting progressively stronger. The causes for the currently increased frequency of ASD and the pathogenesis of ASD are not fully understood yet. One of the most likely mechanisms inducing ASD may be a maternal immune imprinting. This phenomenon is based on transplacental translocation of maternal antibodies of IgG class and, as a consequence, on the epigenetic "tuning" of immune system of the fetus and child. This mechanism provides development of child's anti-infection resistance before meeting with microorganisms, but it can be also a cause of inborn pathology including the ASD appearance. The quantitative changes in maternal blood serum autoantibodies depend on a specific microbial population, or are induced by environmental chemical pollutants in association with some individual features of the maternal metabolism. These immune changes are adaptive in most cases for the maternal organism, but can be pathogenic for the fetus in some cases. We discuss in the present paper the possibilities to predict the risk from abnormal development of nervous system in fetus and early diagnosis of ASD in high-risk group of children.

  5. The influence of innate and adaptative immune responses on the differential clinical outcomes of leprosy.

    Science.gov (United States)

    Fonseca, Adriana Barbosa de Lima; Simon, Marise do Vale; Cazzaniga, Rodrigo Anselmo; de Moura, Tatiana Rodrigues; de Almeida, Roque Pacheco; Duthie, Malcolm S; Reed, Steven G; de Jesus, Amelia Ribeiro

    2017-02-06

    Leprosy is a chronic infectious disease caused by Mycobacterium leprae. According to official reports from 121 countries across five WHO regions, there were 213 899 newly diagnosed cases in 2014. Although leprosy affects the skin and peripheral nerves, it can present across a spectrum of clinical and histopathological forms that are strongly influenced by the immune response of the infected individuals. These forms comprise the extremes of tuberculoid leprosy (TT), with a M. leprae-specific Th1, but also a Th17, response that limits M. leprae multiplication, through to lepromatous leprosy (LL), with M. leprae-specific Th2 and T regulatory responses that do not control M. leprae replication but rather allow bacterial dissemination. The interpolar borderline clinical forms present with similar, but less extreme, immune biases. Acute inflammatory episodes, known as leprosy reactions, are complications that may occur before, during or after treatment, and cause further neurological damages that can cause irreversible chronic disabilities. This review discusses the innate and adaptive immune responses, and their interactions, that are known to affect pathogenesis and influence the clinical outcome of leprosy.

  6. Aircraft Abnormal Conditions Detection, Identification, and Evaluation Using Innate and Adaptive Immune Systems Interaction

    Science.gov (United States)

    Al Azzawi, Dia

    Abnormal flight conditions play a major role in aircraft accidents frequently causing loss of control. To ensure aircraft operation safety in all situations, intelligent system monitoring and adaptation must rely on accurately detecting the presence of abnormal conditions as soon as they take place, identifying their root cause(s), estimating their nature and severity, and predicting their impact on the flight envelope. Due to the complexity and multidimensionality of the aircraft system under abnormal conditions, these requirements are extremely difficult to satisfy using existing analytical and/or statistical approaches. Moreover, current methodologies have addressed only isolated classes of abnormal conditions and a reduced number of aircraft dynamic parameters within a limited region of the flight envelope. This research effort aims at developing an integrated and comprehensive framework for the aircraft abnormal conditions detection, identification, and evaluation based on the artificial immune systems paradigm, which has the capability to address the complexity and multidimensionality issues related to aircraft systems. Within the proposed framework, a novel algorithm was developed for the abnormal conditions detection problem and extended to the abnormal conditions identification and evaluation. The algorithm and its extensions were inspired from the functionality of the biological dendritic cells (an important part of the innate immune system) and their interaction with the different components of the adaptive immune system. Immunity-based methodologies for re-assessing the flight envelope at post-failure and predicting the impact of the abnormal conditions on the performance and handling qualities are also proposed and investigated in this study. The generality of the approach makes it applicable to any system. Data for artificial immune system development were collected from flight tests of a supersonic research aircraft within a motion-based flight

  7. Persistence and Adaptation in Immunity: T Cells Balance the Extent and Thoroughness of Search.

    Directory of Open Access Journals (Sweden)

    G Matthew Fricke

    2016-03-01

    Full Text Available Effective search strategies have evolved in many biological systems, including the immune system. T cells are key effectors of the immune response, required for clearance of pathogenic infection. T cell activation requires that T cells encounter antigen-bearing dendritic cells within lymph nodes, thus, T cell search patterns within lymph nodes may be a crucial determinant of how quickly a T cell immune response can be initiated. Previous work suggests that T cell motion in the lymph node is similar to a Brownian random walk, however, no detailed analysis has definitively shown whether T cell movement is consistent with Brownian motion. Here, we provide a precise description of T cell motility in lymph nodes and a computational model that demonstrates how motility impacts T cell search efficiency. We find that both Brownian and Lévy walks fail to capture the complexity of T cell motion. Instead, T cell movement is better described as a correlated random walk with a heavy-tailed distribution of step lengths. Using computer simulations, we identify three distinct factors that contribute to increasing T cell search efficiency: 1 a lognormal distribution of step lengths, 2 motion that is directionally persistent over short time scales, and 3 heterogeneity in movement patterns. Furthermore, we show that T cells move differently in specific frequently visited locations that we call "hotspots" within lymph nodes, suggesting that T cells change their movement in response to the lymph node environment. Our results show that like foraging animals, T cells adapt to environmental cues, suggesting that adaption is a fundamental feature of biological search.

  8. Persistence and Adaptation in Immunity: T Cells Balance the Extent and Thoroughness of Search

    Science.gov (United States)

    Fricke, G. Matthew; Letendre, Kenneth A.; Moses, Melanie E.; Cannon, Judy L.

    2016-01-01

    Effective search strategies have evolved in many biological systems, including the immune system. T cells are key effectors of the immune response, required for clearance of pathogenic infection. T cell activation requires that T cells encounter antigen-bearing dendritic cells within lymph nodes, thus, T cell search patterns within lymph nodes may be a crucial determinant of how quickly a T cell immune response can be initiated. Previous work suggests that T cell motion in the lymph node is similar to a Brownian random walk, however, no detailed analysis has definitively shown whether T cell movement is consistent with Brownian motion. Here, we provide a precise description of T cell motility in lymph nodes and a computational model that demonstrates how motility impacts T cell search efficiency. We find that both Brownian and Lévy walks fail to capture the complexity of T cell motion. Instead, T cell movement is better described as a correlated random walk with a heavy-tailed distribution of step lengths. Using computer simulations, we identify three distinct factors that contribute to increasing T cell search efficiency: 1) a lognormal distribution of step lengths, 2) motion that is directionally persistent over short time scales, and 3) heterogeneity in movement patterns. Furthermore, we show that T cells move differently in specific frequently visited locations that we call “hotspots” within lymph nodes, suggesting that T cells change their movement in response to the lymph node environment. Our results show that like foraging animals, T cells adapt to environmental cues, suggesting that adaption is a fundamental feature of biological search. PMID:26990103

  9. A Protocol for the Comprehensive Flow Cytometric Analysis of Immune Cells in Normal and Inflamed Murine Non-Lymphoid Tissues

    Science.gov (United States)

    Yu, Yen-Rei A.; O’Koren, Emily G.; Hotten, Danielle F.; Kan, Matthew J.; Kopin, David; Nelson, Erik R.; Que, Loretta; Gunn, Michael D.

    2016-01-01

    Flow cytometry is used extensively to examine immune cells in non-lymphoid tissues. However, a method of flow cytometric analysis that is both comprehensive and widely applicable has not been described. We developed a protocol for the flow cytometric analysis of non-lymphoid tissues, including methods of tissue preparation, a 10-fluorochrome panel for cell staining, and a standardized gating strategy, that allows the simultaneous identification and quantification of all major immune cell types in a variety of normal and inflamed non-lymphoid tissues. We demonstrate that our basic protocol minimizes cell loss, reliably distinguishes macrophages from dendritic cells (DC), and identifies all major granulocytic and mononuclear phagocytic cell types. This protocol is able to accurately quantify 11 distinct immune cell types, including T cells, B cells, NK cells, neutrophils, eosinophils, inflammatory monocytes, resident monocytes, alveolar macrophages, resident/interstitial macrophages, CD11b- DC, and CD11b+ DC, in normal lung, heart, liver, kidney, intestine, skin, eyes, and mammary gland. We also characterized the expression patterns of several commonly used myeloid and macrophage markers. This basic protocol can be expanded to identify additional cell types such as mast cells, basophils, and plasmacytoid DC, or perform detailed phenotyping of specific cell types. In examining models of primary and metastatic mammary tumors, this protocol allowed the identification of several distinct tumor associated macrophage phenotypes, the appearance of which was highly specific to individual tumor cell lines. This protocol provides a valuable tool to examine immune cell repertoires and follow immune responses in a wide variety of tissues and experimental conditions. PMID:26938654

  10. No evidence of local adaptation of immune responses to Gyrodactylus in three-spined stickleback (Gasterosteus aculeatus).

    Science.gov (United States)

    Robertson, Shaun; Bradley, Janette E; MacColl, Andrew D C

    2017-01-01

    Parasitism represents one of the most widespread lifestyles in the animal kingdom, with the potential to drive coevolutionary dynamics with their host population. Where hosts and parasites evolve together, we may find local adaptation. As one of the main host defences against infection, there is the potential for the immune response to be adapted to local parasites. In this study, we used the three-spined stickleback and its Gyrodactylus parasites to examine the extent of local adaptation of parasite infection dynamics and the immune response to infection. We took two geographically isolated host populations infected with two distinct Gyrodactylus species and performed a reciprocal cross-infection experiment in controlled laboratory conditions. Parasite burdens were monitored over the course of the infection, and individuals were sampled at multiple time points for immune gene expression analysis. We found large differences in virulence between parasite species, irrespective of host, and maladaptation of parasites to their sympatric host. The immune system responded to infection, with a decrease in expression of innate and Th1-type adaptive response genes in fish infected with the less virulent parasite, representing a marker of a possible resistance mechanism. There was no evidence of local adaptation in immune gene expression levels. Our results add to the growing understanding of the extent of host-parasite local adaptation, and demonstrate a systemic immune response during infection with a common ectoparasite. Further immunological studies using the stickleback-Gyrodactylus system can continue to contribute to our understanding of the function of the immune response in natural populations. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Paucity of PD-L1 expression in prostate cancer: innate and adaptive immune resistance.

    Science.gov (United States)

    Martin, A M; Nirschl, T R; Nirschl, C J; Francica, B J; Kochel, C M; van Bokhoven, A; Meeker, A K; Lucia, M S; Anders, R A; DeMarzo, A M; Drake, C G

    2015-12-01

    Primary prostate cancers are infiltrated with programmed death-1 (PD-1) expressing CD8+ T-cells. However, in early clinical trials, men with metastatic castrate-resistant prostate cancer did not respond to PD-1 blockade as a monotherapy. One explanation for this unresponsiveness could be that prostate tumors generally do not express programmed death ligand-1 (PD-L1), the primary ligand for PD-1. However, lack of PD-L1 expression in prostate cancer would be surprising, given that phosphatase and tensin homolog (PTEN) loss is relatively common in prostate cancer and several studies have shown that PTEN loss correlates with PD-L1 upregulation--constituting a mechanism of innate immune resistance. This study tested whether prostate cancer cells were capable of expressing PD-L1, and whether the rare PD-L1 expression that occurs in human specimens correlates with PTEN loss. Human prostate cancer cell lines were evaluated for PD-L1 expression and loss of PTEN by flow cytometry and western blotting, respectively. Immunohistochemical (IHC) staining for PTEN was correlated with PD-L1 IHC using a series of resected human prostate cancer samples. In vitro, many prostate cancer cell lines upregulated PD-L1 expression in response to inflammatory cytokines, consistent with adaptive immune resistance. In these cell lines, no association between PTEN loss and PD-L1 expression was apparent. In primary prostate tumors, PD-L1 expression was rare, and was not associated with PTEN loss. These studies show that some prostate cancer cell lines are capable of expressing PD-L1. However, in human prostate cancer, PTEN loss is not associated with PD-L1 expression, arguing against innate immune resistance as a mechanism that mitigates antitumor immune responses in this disease.

  12. CD47 Promotes Protective Innate and Adaptive Immunity in a Mouse Model of Disseminated Candidiasis

    Science.gov (United States)

    Navarathna, Dhammika H. M. L. P.; Stein, Erica V.; Lessey-Morillon, Elizabeth C.; Nayak, Debasis; Martin-Manso, Gema; Roberts, David D.

    2015-01-01

    CD47 is a widely expressed receptor that regulates immunity by engaging its counter-receptor SIRPα on phagocytes and its secreted ligand thrombospondin-1. Mice lacking CD47 can exhibit enhanced or impaired host responses to bacterial pathogens, but its role in fungal immunity has not been examined. cd47 -/- mice on a C57BL/6 background showed significantly increased morbidity and mortality following Candida albicans infection when compared with wild-type mice. Despite normal fungal colonization at earlier times, cd47 -/- mice at four days post-infection had increased colonization of brain and kidneys accompanied by stronger inflammatory reactions. Neutrophil and macrophage numbers were significantly elevated in kidneys and neutrophils in the brains of infected cd47 -/- mice. However, no defect in phagocytic activity towards C. albicans was observed in cd47 -/- bone-marrow-derived macrophages, and neutrophil and macrophage killing of C. albicans was not impaired. CD47-deficiency did not alter the early humoral immune response to C. albicans. Th1, Th2, and Th17 population of CD4+ T cells were expanded in the spleen, and gene expression profiles of spleen and kidney showed stronger pro-inflammatory signaling in infected cd47 -/- mice. The chemoattractant chemokines MIP-2α and MIP-2β were highly expressed in infected spleens of cd47 -/- mice. G-CSF, GM-CSF, and the inflammasome component NLRP3 were more highly expressed in infected cd47 -/- kidneys than in infected wild-type controls. Circulating pro- (TNF-α, IL-6) and anti-inflammatory cytokines (IL-10) were significantly elevated, but IL-17 was decreased. These data indicate that CD47 plays protective roles against disseminated candidiasis and alters pro-inflammatory and immunosuppressive pathways known to regulate innate and T cell immunity. PMID:26010544

  13. Host-adaptation of Francisella tularensis alters the bacterium's surface-carbohydrates to hinder effectors of innate and adaptive immunity.

    Directory of Open Access Journals (Sweden)

    Tiffany M Zarrella

    Full Text Available The gram-negative bacterium Francisella tularensis survives in arthropods, fresh water amoeba, and mammals with both intracellular and extracellular phases and could reasonably be expected to express distinct phenotypes in these environments. The presence of a capsule on this bacterium has been controversial with some groups finding such a structure while other groups report that no capsule could be identified. Previously we reported in vitro culture conditions for this bacterium which, in contrast to typical methods, yielded a bacterial phenotype that mimics that of the bacterium's mammalian, extracellular phase.SDS-PAGE and carbohydrate analysis of differentially-cultivated F. tularensis LVS revealed that bacteria displaying the host-adapted phenotype produce both longer polymers of LPS O-antigen (OAg and additional HMW carbohydrates/glycoproteins that are reduced/absent in non-host-adapted bacteria. Analysis of wildtype and OAg-mutant bacteria indicated that the induced changes in surface carbohydrates involved both OAg and non-OAg species. To assess the impact of these HMW carbohydrates on the access of outer membrane constituents to antibody we used differentially-cultivated bacteria in vitro to immunoprecipitate antibodies directed against outer membrane moieties. We observed that the surface-carbohydrates induced during host-adaptation shield many outer membrane antigens from binding by antibody. Similar assays with normal mouse serum indicate that the induced HMW carbohydrates also impede complement deposition. Using an in vitro macrophage infection assay, we find that the bacterial HMW carbohydrate impedes TLR2-dependent, pro-inflammatory cytokine production by macrophages. Lastly we show that upon host-adaptation, the human-virulent strain, F. tularensis SchuS4 also induces capsule production with the effect of reducing macrophage-activation and accelerating tularemia pathogenesis in mice.F. tularensis undergoes host-adaptation which

  14. Mitogen-stimulated phospholipid synthesis in normal and immune-deficient human B cells

    International Nuclear Information System (INIS)

    Chien, M.M.; Yokoyama, W.M.; Ashman, R.F.

    1986-01-01

    Eight patients with common variable panhypogammaglobulinemia were shown in the in vitro Ig biosynthesis assay to have defective B cell responses to pokeweed mitogen (PWM). Phospholipid synthesis was assessed in the B cell plus monocyte fraction (MB) and irradiated T cells (T*) of patients and paired normal controls. Cell populations were studied separately and in the four possible combinations (1:1), with and without PWM, to reveal the effect of cell interactions. At 16 to 20 hr the mean stimulation index (SI) +/- standard error for MB cells alone was 1.01 +/- 0.02 for eight patients and 0.99 +/- 0.02 for the paired normals; the T* cell SI was 1.25 +/- 0.04 for patients and 1.28 +/- 0.05 for normals. Combinations of normal MB cells with normal T* cells showed significantly higher SI when compared with the combinations of normal MB cells with patient T* cells (p less than 0.005). However, the combination of patient MB cells with patient T* cells and the combination of patient MB cells with normal T* cells were not significantly different in SI (0.05 less than p less than 0.1). Isolation of patient and normal B cells, T* cells, and monocytes after the choline pulse showed that patient B cells gave a higher SI with normal T* help than with patient T* help. Of greatest interest is the finding that patient B cells that were defective in PWM-stimulated Ig production nevertheless showed a phospholipid synthesis response to PWM in the normal range, suggesting that the maturation defect in these B cells occurs later than the phospholipid synthesis acceleration step, or on a different pathway

  15. Innate and adaptive immunity in the development of depression: An update on current knowledge and technological advances.

    Science.gov (United States)

    Haapakoski, Rita; Ebmeier, Klaus P; Alenius, Harri; Kivimäki, Mika

    2016-04-03

    The inflammation theory of depression, proposed over 20years ago, was influenced by early studies on T cell responses and since then has been a stimulus for numerous research projects aimed at understanding the relationship between immune function and depression. Observational studies have shown that indicators of immunity, especially C reactive protein and proinflammatory cytokines, such as interleukin 6, are associated with an increased risk of depressive disorders, although the evidence from randomized trials remains limited and only few studies have assessed the interplay between innate and adaptive immunity in depression. In this paper, we review current knowledge on the interactions between central and peripheral innate and adaptive immune molecules and the potential role of immune-related activation of microglia, inflammasomes and indoleamine-2,3-dioxygenase in the development of depressive symptoms. We highlight how combining basic immune methods with more advanced 'omics' technologies would help us to make progress in unravelling the complex associations between altered immune function and depressive disorders, in the identification of depression-specific biomarkers and in developing immunotherapeutic treatment strategies that take individual variability into account. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Children after Chernobyl: immune cells adaptive changes and stable alterations under low-dose irradiation

    International Nuclear Information System (INIS)

    Bazyka, D.A.; Chumak, A.A.; Bebeshko, V.G.; Beliaeva, N.V.

    1997-01-01

    Early changes of immune parameters in children evacuated from 30-km zone were characterized by E-rossette forming cells decrease and E-receptor non-stability in theophylline assay, surface Ig changes. Immunological follow-up of children inhabitants of territories contaminated with radionuclides after Chernobyl accident revealed TCR/CD3, CD4 and MHC CD3+, CD4+, CD57+ subsets, RIL-2, TrT expression and calcium channel activity. PMNC percentage with cortical thymocyte phenotype (CD1+, CD4+8+) was elevated during the first years after the accident and seemed to be of a compensatory origin. Combination of heterogenic activation and suppression subset reactions and changes in fine subset (Th1/Th2) organization were suggested. Adaptive and compensatory reactions were supposed and delayed hypersensitivity reactions increase as well. (author)

  17. CRISPR/Cas and Cmr modules, mobility and evolution of adaptive immune systems

    DEFF Research Database (Denmark)

    Shah, Shiraz Ali; Garrett, Roger Antony

    2011-01-01

    CRISPR/Cas and CRISPR/Cmr immune machineries of archaea and bacteria provide an adaptive and effective defence mechanism directed specifically against viruses and plasmids. Present data suggest that both CRISPR/Cas and Cmr modules can behave like integral genetic elements. They tend to be located...... in the more variable regions of chromosomes and are displaced by genome shuffling mechanisms including transposition. CRISPR loci may be broken up and dispersed in chromosomes by transposons with the potential for creating genetic novelty. Both CRISPR/Cas and Cmr modules appear to exchange readily between...... the significant barriers imposed by their differing conjugative, transcriptional and translational mechanisms. There are parallels between the CRISPR crRNAs and eukaryal siRNAs, most notably to germ cell piRNAs which are directed, with the help of effector proteins, to silence or destroy transposons...

  18. CRISPR-Cas: From the Bacterial Adaptive Immune System to a Versatile Tool for Genome Engineering.

    Science.gov (United States)

    Kirchner, Marion; Schneider, Sabine

    2015-11-09

    The field of biology has been revolutionized by the recent advancement of an adaptive bacterial immune system as a universal genome engineering tool. Bacteria and archaea use repetitive genomic elements termed clustered regularly interspaced short palindromic repeats (CRISPR) in combination with an RNA-guided nuclease (CRISPR-associated nuclease: Cas) to target and destroy invading DNA. By choosing the appropriate sequence of the guide RNA, this two-component system can be used to efficiently modify, target, and edit genomic loci of interest in plants, insects, fungi, mammalian cells, and whole organisms. This has opened up new frontiers in genome engineering, including the potential to treat or cure human genetic disorders. Now the potential risks as well as the ethical, social, and legal implications of this powerful new technique move into the limelight. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Maternal immune system adaptation to pregnancy - a potential influence on the course of diabetic retinopathy

    Directory of Open Access Journals (Sweden)

    Pavan Josip

    2010-10-01

    Full Text Available Abstract Background Progression of diabetic retinopathy occurs at least temporarily during pregnancy. Although the cause of this progression is not entirely understood, the immune phenomenon and chronic inflammation may play a significant role. During pregnancy in order to avoid fetus rejection, certain components of the immune system that are knowingly implicated in the pathogenesis of diabetic retinopathy are activated including generalized leukocyte activation and an increase in certain cytokine plasma levels. Activated leukocytes with up regulated adhesion molecules have an increased potential to bind to the endothelium cells of blood vessels. Leukocyte-endothelial interaction and the consequent leukostasis with capillary occlusion, ischemia and vascular leakage have a substantial role in the development of diabetic retinopathy. Furthermore, certain increased cytokines are known to cause blood-retinal-barrier breakdown whilst others promote angiogenic and fibrovascular proliferation and thereby can also be implicated in the pathogenesis of this diabetic complication. Presentation of the hypothesis We hypothesized that the activation of the immune system during gestation may have an influence on the course of retinopathy in pregnant diabetic women. Testing the hypothesis We suggest two prospective follow up studies conducted on women with type 1 diabetes mellitus. The first study would include a group of non-pregnant women and a group of diabetic women undergoing normal pregnancy matched for age and duration of diabetes. In the second study pregnant women would be divided into two groups: one with normal pregnancy and the other with preeclampsia. The procedure and data collection in both studies will be identical: a complete ophthalmological examination, glycaemic control, blood pressure measurement and venous blood samples for the determination of plasma levels of cytokines (TNF-alpha, IL-1beta, IL-6, IL-8 and adhesion molecules (ICAM-1

  20. The innate and adaptive immune response induced by alveolar macrophages exposed to ambient particulate matter

    International Nuclear Information System (INIS)

    Miyata, Ryohei; Eeden, Stephan F. van

    2011-01-01

    Emerging epidemiological evidence suggests that exposure to particulate matter (PM) air pollution increases the risk of cardiovascular events but the exact mechanism by which PM has adverse effects is still unclear. Alveolar macrophages (AM) play a major role in clearing and processing inhaled PM. This comprehensive review of research findings on immunological interactions between AM and PM provides potential pathophysiological pathways that interconnect PM exposure with adverse cardiovascular effects. Coarse particles (10 μm or less, PM 10 ) induce innate immune responses via endotoxin-toll-like receptor (TLR) 4 pathway while fine (2.5 μm or less, PM 2.5 ) and ultrafine particles (0.1 μm or less, UFP) induce via reactive oxygen species generation by transition metals and/or polyaromatic hydrocarbons. The innate immune responses are characterized by activation of transcription factors [nuclear factor (NF)-κB and activator protein-1] and the downstream proinflammatory cytokine [interleukin (IL)-1β, IL-6, and tumor necrosis factor-α] production. In addition to the conventional opsonin-dependent phagocytosis by AM, PM can also be endocytosed by an opsonin-independent pathway via scavenger receptors. Activation of scavenger receptors negatively regulates the TLR4-NF-κB pathway. Internalized particles are subsequently subjected to adaptive immunity involving major histocompatibility complex class II (MHC II) expression, recruitment of costimulatory molecules, and the modulation of the T helper (Th) responses. AM show atypical antigen presenting cell maturation in which phagocytic activity decreases while both MHC II and costimulatory molecules remain unaltered. PM drives AM towards a Th1 profile but secondary responses in a Th1- or Th-2 up-regulated milieu drive the response in favor of a Th2 profile.

  1. The innate and adaptive immune response induced by alveolar macrophages exposed to ambient particulate matter

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Ryohei; Eeden, Stephan F. van, E-mail: Stephan.vanEeden@hli.ubc.ca

    2011-12-15

    Emerging epidemiological evidence suggests that exposure to particulate matter (PM) air pollution increases the risk of cardiovascular events but the exact mechanism by which PM has adverse effects is still unclear. Alveolar macrophages (AM) play a major role in clearing and processing inhaled PM. This comprehensive review of research findings on immunological interactions between AM and PM provides potential pathophysiological pathways that interconnect PM exposure with adverse cardiovascular effects. Coarse particles (10 {mu}m or less, PM{sub 10}) induce innate immune responses via endotoxin-toll-like receptor (TLR) 4 pathway while fine (2.5 {mu}m or less, PM{sub 2.5}) and ultrafine particles (0.1 {mu}m or less, UFP) induce via reactive oxygen species generation by transition metals and/or polyaromatic hydrocarbons. The innate immune responses are characterized by activation of transcription factors [nuclear factor (NF)-{kappa}B and activator protein-1] and the downstream proinflammatory cytokine [interleukin (IL)-1{beta}, IL-6, and tumor necrosis factor-{alpha}] production. In addition to the conventional opsonin-dependent phagocytosis by AM, PM can also be endocytosed by an opsonin-independent pathway via scavenger receptors. Activation of scavenger receptors negatively regulates the TLR4-NF-{kappa}B pathway. Internalized particles are subsequently subjected to adaptive immunity involving major histocompatibility complex class II (MHC II) expression, recruitment of costimulatory molecules, and the modulation of the T helper (Th) responses. AM show atypical antigen presenting cell maturation in which phagocytic activity decreases while both MHC II and costimulatory molecules remain unaltered. PM drives AM towards a Th1 profile but secondary responses in a Th1- or Th-2 up-regulated milieu drive the response in favor of a Th2 profile.

  2. Characterization of an adaptive immune response in microsatellite-instable colorectal cancer

    Science.gov (United States)

    Boissière-Michot, Florence; Lazennec, Gwendal; Frugier, Hélène; Jarlier, Marta; Roca, Lise; Duffour, Jacqueline; Du Paty, Emilie; Laune, Daniel; Blanchard, France; Le Pessot, Florence; Sabourin, Jean-Christophe; Bibeau, Frédéric

    2014-01-01

    Sporadic or hereditary colorectal cancer (CRC) with microsatellite instability (MSI) is frequently characterized by inflammatory lymphocytic infiltration and tends to be associated with a better outcome than microsatellite stable (MSS) CRC, probably reflecting a more effective immune response. We investigated inflammatory mechanisms in 48 MSI CRCs and 62 MSS CRCs by analyzing: (1) the expression of 48 cytokines using Bio-Plex multiplex cytokine assays, and (2) the in situ immune response by immunohistochemical analysis with antibodies against CD3 (T lymphocytes), CD8 (cytotoxic T lymphocytes), CD45RO (memory T lymphocytes), T-bet (Th1 CD4 cells), and FoxP3 (regulatory T cells). MSI CRC exhibited significantly higher expression of CCL5 (RANTES), CXCL8 (IL-8), CXCL9 (MIG), IL-1β, CXCL10 (IP-10), IL-16, CXCL1 (GROα), and IL-1ra, and lower expression of MIF, compared with MSS CRC. Immunohistochemistry combined with image analysis indicated that the density of CD3+, CD8+, CD45RO+, and T-bet+ T lymphocytes was higher in MSI CRC than in MSS CRC, whereas the number of regulatory T cells (FoxP3+) was not statistically different between the groups. These results indicate that MSI CRC is associated with a specific cytokine expression profile that includes CCL5, CXCL10, and CXCL9, which are involved in the T helper type 1 (Th1) response and in the recruitment of memory CD45RO+ T cells. Our findings highlight the major role of adaptive immunity in MSI CRC and provide a possible explanation for the more favorable prognosis of this CRC subtype. PMID:25101223

  3. The role of idiotypic interactions in the adaptive immune system: a belief-propagation approach

    Science.gov (United States)

    Bartolucci, Silvia; Mozeika, Alexander; Annibale, Alessia

    2016-08-01

    In this work we use belief-propagation techniques to study the equilibrium behaviour of a minimal model for the immune system comprising interacting T and B clones. We investigate the effect of the so-called idiotypic interactions among complementary B clones on the system’s activation. Our results show that B-B interactions increase the system’s resilience to noise, making clonal activation more stable, while increasing the cross-talk between different clones. We derive analytically the noise level at which a B clone gets activated, in the absence of cross-talk, and find that this increases with the strength of idiotypic interactions and with the number of T cells sending signals to the B clones. We also derive, analytically and numerically, via population dynamics, the critical line where clonal cross-talk arises. Our approach allows us to derive the B clone size distribution, which can be experimentally measured and gives important information about the adaptive immune system response to antigens and vaccination.

  4. Influence of phthalates on in vitro innate and adaptive immune responses.

    Directory of Open Access Journals (Sweden)

    Juliana Frohnert Hansen

    Full Text Available Phthalates are a group of endocrine disrupting chemicals, suspected to influence the immune system. The aim of this study was to investigate the influence of phthalates on cytokine secretion from human peripheral blood mononuclear cells. Escherichia coli lipopolysaccharide and phytohemagglutinin-P were used for stimulation of monocytes/macrophages and T cells, respectively. Cells were exposed for 20 to 22 hours to either di-ethyl, di-n-butyl or mono-n-butyl phthalate at two different concentrations. Both diesters were metabolised to their respective monoester and influenced cytokine secretion from both monocytes/macrophages and T cells in a similar pattern: the secretion of interleukin (IL-6, IL-10 and the chemokine CXCL8 by monocytes/macrophages was enhanced, while tumour necrosis factor (TNF-α secretion by monocytes/macrophages was impaired, as was the secretion of IL-2 and IL-4, TNF-α and interferon-γ by T cells. The investigated phthalate monoester also influenced cytokine secretion from monocytes/macrophages similar to that of the diesters. In T cells, however, the effect of the monoester was different compared to the diesters. The influence of the phthalates on the cytokine secretion did not seem to be a result of cell death. Thus, results indicate that both human innate and adaptive immunity is influenced in vitro by phthalates, and that phthalates therefore may affect cell differentiation and regenerative and inflammatory processes in vivo.

  5. Optimal Design of the Adaptive Normalized Matched Filter Detector using Regularized Tyler Estimators

    KAUST Repository

    Kammoun, Abla; Couillet, Romain; Pascal, Frederic; Alouini, Mohamed-Slim

    2017-01-01

    This article addresses improvements on the design of the adaptive normalized matched filter (ANMF) for radar detection. It is well-acknowledged that the estimation of the noise-clutter covariance matrix is a fundamental step in adaptive radar detection. In this paper, we consider regularized estimation methods which force by construction the eigenvalues of the covariance estimates to be greater than a positive regularization parameter ρ. This makes them more suitable for high dimensional problems with a limited number of secondary data samples than traditional sample covariance estimates. The motivation behind this work is to understand the effect and properly set the value of ρthat improves estimate conditioning while maintaining a low estimation bias. More specifically, we consider the design of the ANMF detector for two kinds of regularized estimators, namely the regularized sample covariance matrix (RSCM), the regularized Tyler estimator (RTE). The rationale behind this choice is that the RTE is efficient in mitigating the degradation caused by the presence of impulsive noises while inducing little loss when the noise is Gaussian. Based on asymptotic results brought by recent tools from random matrix theory, we propose a design for the regularization parameter that maximizes the asymptotic detection probability under constant asymptotic false alarm rates. Provided Simulations support the efficiency of the proposed method, illustrating its gain over conventional settings of the regularization parameter.

  6. Optimal Design of the Adaptive Normalized Matched Filter Detector using Regularized Tyler Estimators

    KAUST Repository

    Kammoun, Abla

    2017-10-25

    This article addresses improvements on the design of the adaptive normalized matched filter (ANMF) for radar detection. It is well-acknowledged that the estimation of the noise-clutter covariance matrix is a fundamental step in adaptive radar detection. In this paper, we consider regularized estimation methods which force by construction the eigenvalues of the covariance estimates to be greater than a positive regularization parameter ρ. This makes them more suitable for high dimensional problems with a limited number of secondary data samples than traditional sample covariance estimates. The motivation behind this work is to understand the effect and properly set the value of ρthat improves estimate conditioning while maintaining a low estimation bias. More specifically, we consider the design of the ANMF detector for two kinds of regularized estimators, namely the regularized sample covariance matrix (RSCM), the regularized Tyler estimator (RTE). The rationale behind this choice is that the RTE is efficient in mitigating the degradation caused by the presence of impulsive noises while inducing little loss when the noise is Gaussian. Based on asymptotic results brought by recent tools from random matrix theory, we propose a design for the regularization parameter that maximizes the asymptotic detection probability under constant asymptotic false alarm rates. Provided Simulations support the efficiency of the proposed method, illustrating its gain over conventional settings of the regularization parameter.

  7. Strains of bacterial species induce a greatly varied acute adaptive immune response: The contribution of the accessory genome.

    Directory of Open Access Journals (Sweden)

    Uri Sela

    2018-01-01

    Full Text Available A fundamental question in human susceptibility to bacterial infections is to what extent variability is a function of differences in the pathogen species or in individual humans. To focus on the pathogen species, we compared in the same individual the human adaptive T and B cell immune response to multiple strains of two major human pathogens, Staphylococcus aureus and Streptococcus pyogenes. We found wide variability in the acute adaptive immune response induced by various strains of a species, with a unique combination of activation within the two arms of the adaptive response. Further, this was also accompanied by a dramatic difference in the intensity of the specific protective T helper (Th response. Importantly, the same immune response differences induced by the individual strains were maintained across multiple healthy human donors. A comparison of isogenic phage KO strains, demonstrated that of the pangenome, prophages were the major contributor to inter-strain immune heterogeneity, as the T cell response to the remaining "core genome" was noticeably blunted. Therefore, these findings extend and modify the notion of an adaptive response to a pathogenic bacterium, by implying that the adaptive immune response signature of a bacterial species should be defined either per strain or alternatively to the species' 'core genome', common to all of its strains. Further, our results demonstrate that the acquired immune response variation is as wide among different strains within a single pathogenic species as it is among different humans, and therefore may explain in part the clinical heterogeneity observed in patients infected with the same species.

  8. The adaptive immune system promotes initiation of prostate carcinogenesis in a human c-Myc transgenic mouse model.

    Science.gov (United States)

    Melis, Monique H M; Nevedomskaya, Ekaterina; van Burgsteden, Johan; Cioni, Bianca; van Zeeburg, Hester J T; Song, Ji-Ying; Zevenhoven, John; Hawinkels, Lukas J A C; de Visser, Karin E; Bergman, Andries M

    2017-11-07

    Increasing evidence from epidemiological and pathological studies suggests a role of the immune system in the initiation and progression of multiple cancers, including prostate cancer. Reports on the contribution of the adaptive immune system are contradictive, since both suppression and acceleration of disease development have been reported. This study addresses the functional role of lymphocytes in prostate cancer development using a genetically engineered mouse model (GEMM) of human c-Myc driven prostate cancer (Hi-Myc mice) combined with B and T cell deficiency (RAG1 -/- mice). From a pre-cancerous stage on, Hi-Myc mice showed higher accumulation of immune cells in their prostates then wild-type mice, of which macrophages were the most abundant. The onset of invasive adenocarcinoma was delayed in Hi-MycRAG1 -/- compared to Hi-Myc mice and associated with decreased infiltration of leukocytes into the prostate. In addition, lower levels of the cytokines CXCL2, CCL5 and TGF-β1 were detected in Hi-MycRAG1 -/- compared to Hi-Myc mouse prostates. These results from a GEMM of prostate cancer provide new insights into the promoting role of the adaptive immune system in prostate cancer development. Our findings indicate that the endogenous adaptive immune system does not protect against de novo prostate carcinogenesis in Hi-Myc transgenic mice, but rather accelerates the formation of invasive adenocarcinomas. This may have implications for the development of novel treatment strategies.

  9. Suppression of adaptive immunity to heterologous antigens during Plasmodium infection through hemozoin-induced failure of dendritic cell function

    Directory of Open Access Journals (Sweden)

    Phillips R

    2006-04-01

    Full Text Available Abstract Background Dendritic cells (DCs are central to the initiation and regulation of the adaptive immune response during infection. Modulation of DC function may therefore allow evasion of the immune system by pathogens. Significant depression of the host's systemic immune response to both concurrent infections and heterologous vaccines has been observed during malaria infection, but the mechanisms underlying this immune hyporesponsiveness are controversial. Results Here, we demonstrate that the blood stages of malaria infection induce a failure of DC function in vitro and in vivo, causing suboptimal activation of T cells involved in heterologous immune responses. This effect on T-cell activation can be transferred to uninfected recipients by DCs isolated from infected mice. Significantly, T cells activated by these DCs subsequently lack effector function, as demonstrated by a failure to migrate to lymphoid-organ follicles, resulting in an absence of B-cell responses to heterologous antigens. Fractionation studies show that hemozoin, rather than infected erythrocyte (red blood cell membranes, reproduces the effect of intact infected red blood cells on DCs. Furthermore, hemozoin-containing DCs could be identified in T-cell areas of the spleen in vivo. Conclusion Plasmodium infection inhibits the induction of adaptive immunity to heterologous antigens by modulating DC function, providing a potential explanation for epidemiological studies linking endemic malaria with secondary infections and reduced vaccine efficacy.

  10. Lithocholic acid controls adaptive immune responses by inhibition of Th1 activation through the Vitamin D receptor

    NARCIS (Netherlands)

    Pols, Thijs W. H.; Puchner, Teresa; Korkmaz, H. Inci; Vos, Mariska; Soeters, Maarten R.; de Vries, Carlie J. M.

    2017-01-01

    Bile acids are established signaling molecules next to their role in the intestinal emulsification and uptake of lipids. We here aimed to identify a potential interaction between bile acids and CD4+ Th cells, which are central in adaptive immune responses. We screened distinct bile acid species for

  11. Differences in innate and adaptive immune response traits of Pahari (Indian non-descript indigenous breed) and Jersey crossbred cattle.

    Science.gov (United States)

    Verma, Subhash; Thakur, Aneesh; Katoch, Shailja; Shekhar, Chander; Wani, Aasim Habib; Kumar, Sandeep; Dohroo, Shweta; Singh, Geetanjali; Sharma, Mandeep

    2017-10-01

    Cattle are an integral part of the largely agrarian economy of India. Indigenous breeds of cattle comprise about 80% of total cattle population of the country and contribute significantly to the overall milk production. There are 40 recognized indigenous breeds of cattle and a number of uncharacterized non-descript cattle. Pahari cattle of Himachal Pradesh in Northern India are one such non-descript indigenous breed. Here we describe a comprehensive evaluation of haematobiochemical parameters and innate and adaptive immune response traits of Pahari cattle and a comparison with Jersey crossbred cattle. The study shows demonstrable differences in the two breeds with respect to some innate and adaptive immunological traits. This is a first attempt to characterize immune response traits of Pahari cattle and the results of the study provide an understanding of breed differences in immune status of cattle which could be useful for their breeding and conservations programs. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. STSV2 as a Model Crenarchaeal Virus for Studying Virus-Host Interactions and CRISPR-Cas Adaptive Immunity

    DEFF Research Database (Denmark)

    León Sobrino, Carlos

    , the archaea harbour their own viruses, which constitute an extraordinarily diverse group with exotic morphologies and unique features. Prokaryotes possess a variety of defence mechanisms. The CRISPR-Cas adaptive immune system is of great importance for archaea –84% of them possess it, compared to 45...... generate immune memory by inserting in its own genome short invader-derived DNA fragments forming a database –the CRISPR locus. Little was known about this system until recent years, and the generation of immune memory has been the most elusive step. In this work, the interactions of the spindle......-shaped monocaudavirus STSV2 and its host Sulfolobus islandicus REY15A were studied. This interaction produced, after several days, de novo CRISPR adaptation – that is, without any previous memory that can act as a trigger. We employed transcriptome sequencing to characterise the long-term progression...

  13. A Comparison of Adaptive Behaviors among Mentally Retarded and Normal Individuals: A guide to Prevention and Treatment

    Directory of Open Access Journals (Sweden)

    Leyla Sadros

    2010-01-01

    Full Text Available Objectives: Because of the importance of adaptive behaviors in socialand domestic lives, this study aimed at a comparison of various domainsof adaptive behaviors, between mentally retarded and normalindividuals.Methods: A number of 246 normal and 74 mentally retarded individuals(7-18 years of age, mean: 12±3.5 years, participated this study inTehran, Iran. Their adaptive behaviors scores, were obtained using"Adaptive Behavioral Scale, Residential & Community" (ABS-RC: 2,consisting of 18 domains of behavior. The scale was first translatedinto Persian by the professionals and then retranslated into English byanother translator, to ensure content non-distortion.Results: The following domains were significantly lower in mentallyretarded than in normal individuals: independent functioning, economicactivity, language development, number & time, prevocational/vocational activity, self direction, responsibility, socialization,disturbing interpersonal behavior, domestic activity, social engagement,conformity and trustworthiness. No significant difference was documentedin the physical development, stereotype & hyperactive behaviors,sexual behavior as well as self abuse behavior domains, betweenthe two groups.Conclusions: As mentally deficient subjects did worse than normalones in terms of many adaptive behavioral domains, it implies that theadaptive behavioral issues in such people might need a great deal ofattention and intervention. For these retarded people to function betterin their social and residential environment, it would be necessary todevelop their adaptive behaviors. This study may shed light on theimportance of attention to the adaptive behavioral domains of mentallyretarded people and also indicates the necessity of preventive measures,even for normal individuals.

  14. Athletes and the Aorta: Normal Adaptations and the Diagnosis and Management of Pathology.

    Science.gov (United States)

    Stephen Hedley, J; Phelan, Dermot

    2017-10-09

    Over a hundred years ago, physicians first recognized that participation in regular, vigorous training resulted in enlargement of the heart. Since that time, the term "athlete's heart" has entered the medical lexicon as a global expression encompassing the electrical, functional, and morphological adaptations that develop in response to physical training. Exercise-induced adaptations of the aorta, which is also exposed to large hemodynamic stresses during prolonged endurance exercise or resistance training, are less well recognized. Young athletes tend to have slightly larger aortas than their sedentary counterparts; however, this rarely exceeds normal ranges for the general population. A systematic approach is advised when presented with an athlete with aortic enlargement. The size of the aorta needs to be first put in the context of the athlete's age, sex, size, and sporting endeavors; however, even in the largest young athletes, the aortic root rarely exceeds 4 cm in men or 3.4 cm in women. A comprehensive evaluation is advised which includes a detailed family history and a thorough physical examination evaluating for signs of any defined connective tissue disorder associated with aortopathy. Downstream testing is then tailored for the individual and may include further tomographic imaging, opthalmology review, and genetic testing. This should ideally be performed at a specialist center. Management of athletes with an aortopathy includes tailoring athletic activity, medical management with strict impulse control, and, in some cases, prophylactic surgery. The issue of sporting eligibility should be individualized and if disqualification is necessary, this should be undertaken by a sports cardiologist or an expert in aortic disease with experience in dealing with an athletic population.

  15. Localized Sympathectomy Reduces Mechanical Hypersensitivity by Restoring Normal Immune Homeostasis in Rat Models of Inflammatory Pain.

    Science.gov (United States)

    Xie, Wenrui; Chen, Sisi; Strong, Judith A; Li, Ai-Ling; Lewkowich, Ian P; Zhang, Jun-Ming

    2016-08-17

    Some forms of chronic pain are maintained or enhanced by activity in the sympathetic nervous system (SNS), but attempts to model this have yielded conflicting findings. The SNS has both pro- and anti-inflammatory effects on immunity, confounding the interpretation of experiments using global sympathectomy methods. We performed a "microsympathectomy" by cutting the ipsilateral gray rami where they entered the spinal nerves near the L4 and L5 DRG. This led to profound sustained reductions in pain behaviors induced by local DRG inflammation (a rat model of low back pain) and by a peripheral paw inflammation model. Effects of microsympathectomy were evident within one day, making it unlikely that blocking sympathetic sprouting in the local DRGs or hindpaw was the sole mechanism. Prior microsympathectomy greatly reduced hyperexcitability of sensory neurons induced by local DRG inflammation observed 4 d later. Microsympathectomy reduced local inflammation and macrophage density in the affected tissues (as indicated by paw swelling and histochemical staining). Cytokine profiling in locally inflamed DRG showed increases in pro-inflammatory Type 1 cytokines and decreases in the Type 2 cytokines present at baseline, changes that were mitigated by microsympathectomy. Microsympathectomy was also effective in reducing established pain behaviors in the local DRG inflammation model. We conclude that the effect of sympathetic fibers in the L4/L5 gray rami in these models is pro-inflammatory. This raises the possibility that therapeutic interventions targeting gray rami might be useful in some chronic inflammatory pain conditions. Sympathetic blockade is used for many pain conditions, but preclinical studies show both pro- and anti-nociceptive effects. The sympathetic nervous system also has both pro- and anti-inflammatory effects on immune tissues and cells. We examined effects of a very localized sympathectomy. By cutting the gray rami to the spinal nerves near the lumbar sensory

  16. The immune cell composition in Barrett's metaplastic tissue resembles that in normal duodenal tissue.

    Directory of Open Access Journals (Sweden)

    Alexandra Lind

    Full Text Available BACKGROUND AND OBJECTIVE: Barrett's esophagus (BE is characterized by the transition of squamous epithelium into columnar epithelium with intestinal metaplasia. The increased number and types of immune cells in BE have been indicated to be due to a Th2-type inflammatory process. We tested the alternative hypothesis that the abundance of T-cells in BE is caused by a homing mechanism that is found in the duodenum. PATIENTS AND METHODS: Biopsies from BE and duodenal tissue from 30 BE patients and duodenal tissue from 18 controls were characterized by immmunohistochemistry for the presence of T-cells and eosinophils(eos. Ex vivo expanded T-cells were further phenotyped by multicolor analysis using flowcytometry. RESULTS: The high percentage of CD4(+-T cells (69±3% (mean±SEM/n = 17, by flowcytometry, measured by flowcytometry and immunohistochemistry, and the presence of non-activated eosinophils found in BE by immunohistochemical staining, were not different from that found in duodenal tissue. Expanded lymphocytes from these tissues had a similar phenotype, characterized by a comparable but low percentage of αE(CD103 positive CD4(+cells (44±5% in BE, 43±4% in duodenum of BE and 34±7% in duodenum of controls and a similar percentage of granzyme-B(+CD8(+ cells(44±5% in BE, 33±6% in duodenum of BE and 36±7% in duodenum of controls. In addition, a similar percentage of α4β7(+ T-lymphocytes (63±5% in BE, 58±5% in duodenum of BE and 62±8% in duodenum of controls was found. Finally, mRNA expression of the ligand for α4β7, MAdCAM-1, was also similar in BE and duodenal tissue. No evidence for a Th2-response was found as almost no IL-4(+-T-cells were seen. CONCLUSION: The immune cell composition (lymphocytes and eosinophils and expression of intestinal adhesion molecule MAdCAM-1 is similar in BE and duodenum. This supports the hypothesis that homing of lymphocytes to BE tissue is mainly caused by intestinal homing signals rather than to an

  17. The Immune System Out of Shape? : Shaping of adaptive immunity by persistent viral infections in young children

    NARCIS (Netherlands)

    D. van den Heuvel (Diana)

    2015-01-01

    markdownabstractDuring pregnancy, a fetus is protected from a large part of the pathogens of the environment. As a result, a newborn’s immune system is immature and unexperienced, and mainly composed of innate leukocytes and naive lymphocytes. Immunological memory, and concomitant functional

  18. Immunity to current H5 highly pathogenic avian influenza viruses: From vaccines to adaptive immunity in wild birds

    Science.gov (United States)

    Following the 2014-2015 outbreaks of H5N2 and H5N8 highly pathogenic avian influenza (HPAI) in the U.S., studies were performed to assess the immunity required for protection against future outbreaks should they occur. We assessed the ability of vaccines to induce protection of chickens and turkeys...

  19. Structural basis of evasion of cellular adaptive immunity by HIV-1 Nef

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Xiaofei; Singh, Rajendra; Homann, Stefanie; Yang, Haitao; Guatelli, John; Xiong, Yong (Yale); (VA); (UCSD)

    2012-10-24

    The HIV-1 protein Nef inhibits antigen presentation by class I major histocompatibility complex (MHC-I). We determined the mechanism of this activity by solving the crystal structure of a protein complex comprising Nef, the MHC-I cytoplasmic domain (MHC-I CD) and the {mu}1 subunit of the clathrin adaptor protein complex 1. A ternary, cooperative interaction clamps the MHC-I CD into a narrow binding groove at the Nef-{mu}1 interface, which encompasses the cargo-recognition site of {mu}1 and the proline-rich strand of Nef. The Nef C terminus induces a previously unobserved conformational change in {mu}1, whereas the N terminus binds the Nef core to position it optimally for complex formation. Positively charged patches on {mu}1 recognize acidic clusters in Nef and MHC-I. The structure shows how Nef functions as a clathrin-associated sorting protein to alter the specificity of host membrane trafficking and enable viral evasion of adaptive immunity.

  20. Adaptive Immune Response Impairs the Efficacy of Autologous Transplantation of Engineered Stem Cells in Dystrophic Dogs

    Science.gov (United States)

    Sitzia, Clementina; Farini, Andrea; Jardim, Luciana; Razini, Paola; Belicchi, Marzia; Cassinelli, Letizia; Villa, Chiara; Erratico, Silvia; Parolini, Daniele; Bella, Pamela; da Silva Bizario, Joao Carlos; Garcia, Luis; Dias-Baruffi, Marcelo; Meregalli, Mirella; Torrente, Yvan

    2016-01-01

    Duchenne muscular dystrophy is the most common genetic muscular dystrophy. It is caused by mutations in the dystrophin gene, leading to absence of muscular dystrophin and to progressive degeneration of skeletal muscle. We have demonstrated that the exon skipping method safely and efficiently brings to the expression of a functional dystrophin in dystrophic CD133+ cells injected scid/mdx mice. Golden Retriever muscular dystrophic (GRMD) dogs represent the best preclinical model of Duchenne muscular dystrophy, mimicking the human pathology in genotypic and phenotypic aspects. Here, we assess the capacity of intra-arterial delivered autologous engineered canine CD133+ cells of restoring dystrophin expression in Golden Retriever muscular dystrophy. This is the first demonstration of five-year follow up study, showing initial clinical amelioration followed by stabilization in mild and severe affected Golden Retriever muscular dystrophy dogs. The occurrence of T-cell response in three Golden Retriever muscular dystrophy dogs, consistent with a memory response boosted by the exon skipped-dystrophin protein, suggests an adaptive immune response against dystrophin. PMID:27506452

  1. An adaptive immune optimization algorithm with dynamic lattice searching operation for fast optimization of atomic clusters

    International Nuclear Information System (INIS)

    Wu, Xia; Wu, Genhua

    2014-01-01

    Highlights: • A high efficient method for optimization of atomic clusters is developed. • Its performance is studied by optimizing Lennard-Jones clusters and Ag clusters. • The method is proved to be quite efficient. • A new Ag 61 cluster with stacking-fault face-centered cubic motif is found. - Abstract: Geometrical optimization of atomic clusters is performed by a development of adaptive immune optimization algorithm (AIOA) with dynamic lattice searching (DLS) operation (AIOA-DLS method). By a cycle of construction and searching of the dynamic lattice (DL), DLS algorithm rapidly makes the clusters more regular and greatly reduces the potential energy. DLS can thus be used as an operation acting on the new individuals after mutation operation in AIOA to improve the performance of the AIOA. The AIOA-DLS method combines the merit of evolutionary algorithm and idea of dynamic lattice. The performance of the proposed method is investigated in the optimization of Lennard-Jones clusters within 250 atoms and silver clusters described by many-body Gupta potential within 150 atoms. Results reported in the literature are reproduced, and the motif of Ag 61 cluster is found to be stacking-fault face-centered cubic, whose energy is lower than that of previously obtained icosahedron

  2. Mathematical modeling on T-cell mediated adaptive immunity in primary dengue infections.

    Science.gov (United States)

    Sasmal, Sourav Kumar; Dong, Yueping; Takeuchi, Yasuhiro

    2017-09-21

    At present, dengue is the most common mosquito-borne viral disease in the world, and the global dengue incidence is increasing day by day due to climate changing. Here, we present a mathematical model of dengue viruses (DENVs) dynamics in micro-environment (cellular level) consisting of healthy cells, infected cells, virus particles and T-cell mediated adaptive immunity. We have considered the explicit role of cytokines and antibody in our model. We find that the virus load goes down to zero within 6 days as it is common for DENV infection. From our analysis, we have identified the important model parameters and done the numerical simulation with respect to such important parameters. We have shown that the cytokine mediated virus clearance plays a very important role in dengue dynamics. It can change the dynamical behavior of the system and causes essential extinction of the virus. Finally, we have incorporated the antiviral treatment for dengue in our model and shown that the basic reproduction number is directly proportional to the antiviral treatment effects. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. ImmuneDB: a system for the analysis and exploration of high-throughput adaptive immune receptor sequencing data.

    Science.gov (United States)

    Rosenfeld, Aaron M; Meng, Wenzhao; Luning Prak, Eline T; Hershberg, Uri

    2017-01-15

    As high-throughput sequencing of B cells becomes more common, the need for tools to analyze the large quantity of data also increases. This article introduces ImmuneDB, a system for analyzing vast amounts of heavy chain variable region sequences and exploring the resulting data. It can take as input raw FASTA/FASTQ data, identify genes, determine clones, construct lineages, as well as provide information such as selection pressure and mutation analysis. It uses an industry leading database, MySQL, to provide fast analysis and avoid the complexities of using error prone flat-files. ImmuneDB is freely available at http://immunedb.comA demo of the ImmuneDB web interface is available at: http://immunedb.com/demo CONTACT: Uh25@drexel.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. Modulation of Host Immunity by Human Respiratory Syncytial Virus Virulence Factors: A Synergic Inhibition of Both Innate and Adaptive Immunity

    Directory of Open Access Journals (Sweden)

    Gisela Canedo-Marroquín

    2017-08-01

    Full Text Available The Human Respiratory Syncytial Virus (hRSV is a major cause of acute lower respiratory tract infections (ARTIs and high rates of hospitalizations in children and in the elderly worldwide. Symptoms of hRSV infection include bronchiolitis and pneumonia. The lung pathology observed during hRSV infection is due in part to an exacerbated host immune response, characterized by immune cell infiltration to the lungs. HRSV is an enveloped virus, a member of the Pneumoviridae family, with a non-segmented genome and negative polarity-single RNA that contains 10 genes encoding for 11 proteins. These include the Fusion protein (F, the Glycoprotein (G, and the Small Hydrophobic (SH protein, which are located on the virus surface. In addition, the Nucleoprotein (N, Phosphoprotein (P large polymerase protein (L part of the RNA-dependent RNA polymerase complex, the M2-1 protein as a transcription elongation factor, the M2-2 protein as a regulator of viral transcription and (M protein all of which locate inside the virion. Apart from the structural proteins, the hRSV genome encodes for the non-structural 1 and 2 proteins (NS1 and NS2. HRSV has developed different strategies to evade the host immunity by means of the function of some of these proteins that work as virulence factors to improve the infection in the lung tissue. Also, hRSV NS-1 and NS-2 proteins have been shown to inhibit the activation of the type I interferon response. Furthermore, the hRSV nucleoprotein has been shown to inhibit the immunological synapsis between the dendritic cells and T cells during infection, resulting in an inefficient T cell activation. Here, we discuss the hRSV virulence factors and the host immunological features raised during infection with this virus.

  5. HIV-1 Adaptation to Antigen Processing Results in Population-Level Immune Evasion and Affects Subtype Diversification

    DEFF Research Database (Denmark)

    Tenzer, Stefan; Crawford, Hayley; Pymm, Phillip

    2014-01-01

    these regions encode epitopes presented by ~30 more common HLA variants. By combining epitope processing and computational analyses of the two HIV subtypes responsible for ~60% of worldwide infections, we identified a hitherto unrecognized adaptation to the antigen-processing machinery through substitutions...... of intrapatient adaptations, is predictable, facilitates viral subtype diversification, and increases global HIV diversity. Because low epitope abundance is associated with infrequent and weak T cell responses, this most likely results in both population-level immune evasion and inadequate responses in most...

  6. Antitumor effect of malaria parasite infection in a murine Lewis lung cancer model through induction of innate and adaptive immunity.

    Science.gov (United States)

    Chen, Lili; He, Zhengxiang; Qin, Li; Li, Qinyan; Shi, Xibao; Zhao, Siting; Chen, Ling; Zhong, Nanshan; Chen, Xiaoping

    2011-01-01

    Lung cancer is the most common malignancy in humans and its high fatality means that no effective treatment is available. Developing new therapeutic strategies for lung cancer is urgently needed. Malaria has been reported to stimulate host immune responses, which are believed to be efficacious for combating some clinical cancers. This study is aimed to provide evidence that malaria parasite infection is therapeutic for lung cancer. Antitumor effect of malaria infection was examined in both subcutaneously and intravenously implanted murine Lewis lung cancer (LLC) model. The results showed that malaria infection inhibited LLC growth and metastasis and prolonged the survival of tumor-bearing mice. Histological analysis of tumors from mice infected with malaria revealed that angiogenesis was inhibited, which correlated with increased terminal deoxynucleotidyl transferase-mediated (TUNEL) staining and decreased Ki-67 expression in tumors. Through natural killer (NK) cell cytotoxicity activity, cytokine assays, enzyme-linked immunospot assay, lymphocyte proliferation, and flow cytometry, we demonstrated that malaria infection provided anti-tumor effects by inducing both a potent anti-tumor innate immune response, including the secretion of IFN-γ and TNF-α and the activation of NK cells as well as adaptive anti-tumor immunity with increasing tumor-specific T-cell proliferation and cytolytic activity of CD8(+) T cells. Notably, tumor-bearing mice infected with the parasite developed long-lasting and effective tumor-specific immunity. Consequently, we found that malaria parasite infection could enhance the immune response of lung cancer DNA vaccine pcDNA3.1-hMUC1 and the combination produced a synergistic antitumor effect. Malaria infection significantly suppresses LLC growth via induction of innate and adaptive antitumor responses in a mouse model. These data suggest that the malaria parasite may provide a novel strategy or therapeutic vaccine vector for anti-lung cancer

  7. Antitumor effect of malaria parasite infection in a murine Lewis lung cancer model through induction of innate and adaptive immunity.

    Directory of Open Access Journals (Sweden)

    Lili Chen

    Full Text Available BACKGROUND: Lung cancer is the most common malignancy in humans and its high fatality means that no effective treatment is available. Developing new therapeutic strategies for lung cancer is urgently needed. Malaria has been reported to stimulate host immune responses, which are believed to be efficacious for combating some clinical cancers. This study is aimed to provide evidence that malaria parasite infection is therapeutic for lung cancer. METHODOLOGY/PRINCIPAL FINDINGS: Antitumor effect of malaria infection was examined in both subcutaneously and intravenously implanted murine Lewis lung cancer (LLC model. The results showed that malaria infection inhibited LLC growth and metastasis and prolonged the survival of tumor-bearing mice. Histological analysis of tumors from mice infected with malaria revealed that angiogenesis was inhibited, which correlated with increased terminal deoxynucleotidyl transferase-mediated (TUNEL staining and decreased Ki-67 expression in tumors. Through natural killer (NK cell cytotoxicity activity, cytokine assays, enzyme-linked immunospot assay, lymphocyte proliferation, and flow cytometry, we demonstrated that malaria infection provided anti-tumor effects by inducing both a potent anti-tumor innate immune response, including the secretion of IFN-γ and TNF-α and the activation of NK cells as well as adaptive anti-tumor immunity with increasing tumor-specific T-cell proliferation and cytolytic activity of CD8(+ T cells. Notably, tumor-bearing mice infected with the parasite developed long-lasting and effective tumor-specific immunity. Consequently, we found that malaria parasite infection could enhance the immune response of lung cancer DNA vaccine pcDNA3.1-hMUC1 and the combination produced a synergistic antitumor effect. CONCLUSIONS/SIGNIFICANCE: Malaria infection significantly suppresses LLC growth via induction of innate and adaptive antitumor responses in a mouse model. These data suggest that the malaria

  8. Dendritic Cell Migration to Skin-Draining Lymph Nodes Is Controlled by Dermatan Sulfate and Determines Adaptive Immunity Magnitude

    Directory of Open Access Journals (Sweden)

    Reza Nadafi

    2018-02-01

    Full Text Available For full activation of naïve adaptive lymphocytes in skin-draining lymph nodes (LNs, presentation of peptide:MHC complexes by LN-resident and skin-derived dendritic cells (DCs that encountered antigens (Ags is an absolute prerequisite. To get to the nearest draining LN upon intradermal immunization, DCs need to migrate from the infection site to the afferent lymphatics, which can only be reached by traversing a collagen-dense network located in the dermis of the skin through the activity of proteolytic enzymes. Here, we show that mice with altered collagen fibrillogenesis resulting in thicker collagen fibers in the skin display a reduced DC migration to the draining LN upon immune challenge. Consequently, the initiation of the cellular and humoral immune response was diminished. Ag-specific CD8+ and CD4+ T cells as well as Ag-specific germinal center B cells and serum immunoglobulin levels were significantly decreased. Hence, we postulate that alterations to the production of extracellular matrix, as seen in various connective tissue disorders, may in the end affect the qualitative outcome of adaptive immunity.

  9. Lithocholic acid controls adaptive immune responses by inhibition of Th1 activation through the Vitamin D receptor.

    Science.gov (United States)

    Pols, Thijs W H; Puchner, Teresa; Korkmaz, H Inci; Vos, Mariska; Soeters, Maarten R; de Vries, Carlie J M

    2017-01-01

    Bile acids are established signaling molecules next to their role in the intestinal emulsification and uptake of lipids. We here aimed to identify a potential interaction between bile acids and CD4+ Th cells, which are central in adaptive immune responses. We screened distinct bile acid species for their potency to affect T cell function. Primary human and mouse CD4+ Th cells as well as Jurkat T cells were used to gain insight into the mechanism underlying these effects. We found that unconjugated lithocholic acid (LCA) impedes Th1 activation as measured by i) decreased production of the Th1 cytokines IFNγ and TNFαα, ii) decreased expression of the Th1 genes T-box protein expressed in T cells (T-bet), Stat-1 and Stat4, and iii) decreased STAT1α/β phosphorylation. Importantly, we observed that LCA impairs Th1 activation at physiological relevant concentrations. Profiling of MAPK signaling pathways in Jurkat T cells uncovered an inhibition of ERK-1/2 phosphorylation upon LCA exposure, which could provide an explanation for the impaired Th1 activation. LCA induces these effects via Vitamin D receptor (VDR) signaling since VDR RNA silencing abrogated these effects. These data reveal for the first time that LCA controls adaptive immunity via inhibition of Th1 activation. Many factors influence LCA levels, including bile acid-based drugs and gut microbiota. Our data may suggest that these factors also impact on adaptive immunity via a yet unrecognized LCA-Th cell axis.

  10. Adaptive immunity to leukemia is inhibited by cross-reactive induced regulatory T cells

    OpenAIRE

    Manlove, Luke S.; Berquam-Vrieze, Katherine E.; Pauken, Kristen E.; Williams, Richard T.; Jenkins, Marc K.; Farrar, Michael A.

    2015-01-01

    BCR-ABL+ acute lymphoblastic leukemia patients have transient responses to current therapies. However, the fusion of BCR to ABL generates a potential leukemia-specific antigen that could be a target for immunotherapy. We demonstrate that the immune system can limit BCR-ABL+ leukemia progression although ultimately this immune response fails. To address how BCR-ABL+ leukemia escapes immune surveillance, we developed a peptide: MHC-II tetramer that labels endogenous BCR-ABL-specific CD4+ T cell...

  11. Parental Exposure to Dim Light at Night Prior to Mating Alters Offspring Adaptive Immunity

    OpenAIRE

    Ciss?, Yasmine M.; Russart, Kathryn L.G.; Nelson, Randy J.

    2017-01-01

    Exposure to dim light at night (dLAN) disrupts natural light/dark cycles and impairs endogenous circadian rhythms necessary to maintain optimal biological function, including the endocrine and immune systems. We have previously demonstrated that white dLAN compromises innate and cell mediated immune responses in adult Siberian hamsters (Phodopus sungorus). We hypothesized that dLAN has transgenerational influences on immune function. Adult male and female Siberian hamsters were exposed to eit...

  12. Immune cells in the normal ovary and spontaneous ovarian tumors in the laying hen (Gallus domesticus) model of human ovarian cancer.

    Science.gov (United States)

    Bradaric, Michael J; Penumatsa, Krishna; Barua, Animesh; Edassery, Seby L; Yu, Yi; Abramowicz, Jacques S; Bahr, Janice M; Luborsky, Judith L

    2013-01-01

    Spontaneous ovarian cancer in chickens resembles human tumors both histologically and biochemically. The goal was to determine if there are differences in lymphocyte content between normal ovaries and ovarian tumors in chickens as a basis for further studies to understand the role of immunity in human ovarian cancer progression. Hens were selected using grey scale and color Doppler ultrasound to determine if they had normal or tumor morphology. Cells were isolated from ovaries (n = 6 hens) and lymphocyte numbers were determined by flow cytometry using antibodies to avian CD4 and CD8 T and B (Bu1a) cells. Ovarian sections from another set of hens (n = 26) were assessed to verify tumor type and stage and to count CD4, CD8 and Bu1a immunostained cells by morphometric analysis. T and B cells were more numerous in ovarian tumors than in normal ovaries by flow cytometry and immunohistochemistry. There were less CD4+ cells than CD8+ and Bu1a+ cells in normal ovaries or ovarian tumors. CD8+ cells were the dominant T cell sub-type in both ovarian stroma and in ovarian follicles compared to CD4+ cells. Bu1a+ cells were consistently found in the stroma of normal ovaries and ovarian tumors but were not associated with follicles. The number of immune cells was highest in late stage serous tumors compared to endometrioid and mucinous tumors. The results suggest that similar to human ovarian cancer there are comparatively more immune cells in chicken ovarian tumors than in normal ovaries, and the highest immune cell content occurs in serous tumors. Thus, this study establishes a foundation for further study of tumor immune responses in a spontaneous model of ovarian cancer which will facilitate studies of the role of immunity in early ovarian cancer progression and use of the hen in pre-clinical vaccine trials.

  13. The Involvement of MicroRNAs in Modulation of Innate and Adaptive Immunity in Systemic Lupus Erythematosus and Lupus Nephritis

    Science.gov (United States)

    Köhler, Paulina; von Rauchhaupt, Ekaterina

    2018-01-01

    Noncoding RNAs (ncRNAs), including microRNAs (miRNAs), represent a family of RNA molecules that do not translate into protein. Nevertheless, they have the ability to regulate gene expression and play an essential role in immune cell differentiation and function. MicroRNAs were found to be differentially expressed in various tissues, and changes in their expression have been associated with several pathological processes. Yet, their roles in systemic lupus erythematosus (SLE) and lupus nephritis (LN) remain to be elucidated. Both SLE and LN are characterized by a complex dysfunction of the innate and adaptive immunity. Recently, significant findings have been made in understanding SLE through the use of genetic variant identification and expression pattern analysis and mouse models, as well as epigenetic analyses. Abnormalities in immune cell responses, cytokine and chemokine production, cell activation, and apoptosis have been linked to a unique expression pattern of a number of miRNAs that have been implicated in the immune pathogenesis of this autoimmune disease. The recent evidence that significantly increased the understanding of the pathogenesis of SLE drives a renewed interest in efficient therapy targets. This review aims at providing an overview of the current state of research on the expression and role of miRNAs in the immune pathogenesis of SLE and LN. PMID:29854836

  14. The Involvement of MicroRNAs in Modulation of Innate and Adaptive Immunity in Systemic Lupus Erythematosus and Lupus Nephritis.

    Science.gov (United States)

    Honarpisheh, Mohsen; Köhler, Paulina; von Rauchhaupt, Ekaterina; Lech, Maciej

    2018-01-01

    Noncoding RNAs (ncRNAs), including microRNAs (miRNAs), represent a family of RNA molecules that do not translate into protein. Nevertheless, they have the ability to regulate gene expression and play an essential role in immune cell differentiation and function. MicroRNAs were found to be differentially expressed in various tissues, and changes in their expression have been associated with several pathological processes. Yet, their roles in systemic lupus erythematosus (SLE) and lupus nephritis (LN) remain to be elucidated. Both SLE and LN are characterized by a complex dysfunction of the innate and adaptive immunity. Recently, significant findings have been made in understanding SLE through the use of genetic variant identification and expression pattern analysis and mouse models, as well as epigenetic analyses. Abnormalities in immune cell responses, cytokine and chemokine production, cell activation, and apoptosis have been linked to a unique expression pattern of a number of miRNAs that have been implicated in the immune pathogenesis of this autoimmune disease. The recent evidence that significantly increased the understanding of the pathogenesis of SLE drives a renewed interest in efficient therapy targets. This review aims at providing an overview of the current state of research on the expression and role of miRNAs in the immune pathogenesis of SLE and LN.

  15. A stressful microenvironment: opposing effects of the endoplasmic reticulum stress response in the suppression and enhancement of adaptive tumor immunity.

    Science.gov (United States)

    Rausch, Matthew P; Sertil, Aparna Ranganathan

    2015-03-01

    The recent clinical success of immunotherapy in the treatment of certain types of cancer has demonstrated the powerful ability of the immune system to control tumor growth, leading to significantly improved patient survival. However, despite these promising results current immunotherapeutic strategies are still limited and have not yet achieved broad acceptance outside the context of metastatic melanoma. The limitations of current immunotherapeutic approaches can be attributed in part to suppressive mechanisms present in the tumor microenvironment that hamper the generation of robust antitumor immune responses thus allowing tumor cells to escape immune-mediated destruction. The endoplasmic reticulum (ER) stress response has recently emerged as a potent regulator of tumor immunity. The ER stress response is an adaptive mechanism that allows tumor cells to survive in the harsh growth conditions inherent to the tumor milieu such as low oxygen (hypoxia), low pH and low levels of glucose. Activation of ER stress can also alter the cancer cell response to therapies. In addition, the ER stress response promotes tumor immune evasion by inducing the production of protumorigenic inflammatory cytokines and impairing tumor antigen presentation. However, the ER stress response can boost antitumor immunity in some situations by enhancing the processing and presentation of tumor antigens and by inducing the release of immunogenic factors from stressed tumor cells. Here, we discuss the dualistic role of the ER stress response in the modulation of tumor immunity and highlight how strategies to either induce or block ER stress can be employed to improve the clinical efficacy of tumor immunotherapy.

  16. Clinical Dosing Regimen of Selinexor Maintains Normal Immune Homeostasis and T-cell Effector Function in Mice: Implications for Combination with Immunotherapy.

    Science.gov (United States)

    Tyler, Paul M; Servos, Mariah M; de Vries, Romy C; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K

    2017-03-01

    Selinexor (KPT-330) is a first-in-class nuclear transport inhibitor currently in clinical trials as an anticancer agent. To determine how selinexor might affect antitumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T-cell development, a progressive loss of CD8 T cells, and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T-cell development and function. We determined the minimum concentration of selinexor required to block T-cell activation and showed that T-cell-inhibitory effects of selinexor occur at levels above 100 nmol/L, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 4-day drug holiday led to intratumoral IFNγ + , granzyme B + cytotoxic CD8 T cells that were comparable with vehicle-treated mice. Overall, selinexor treatment leads to transient inhibition of T-cell activation, but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T-cell functioning and development of antitumor immunity. Mol Cancer Ther; 16(3); 428-39. ©2017 AACR See related article by Farren et al., p. 417 . ©2017 American Association for Cancer Research.

  17. Clinical dosing regimen of selinexor maintains normal immune homeostasis and T cell effector function in mice: implications for combination with immunotherapy

    Science.gov (United States)

    Tyler, Paul M.; Servos, Mariah M.; de Vries, Romy C.; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K.

    2017-01-01

    Selinexor (KPT-330) is a first in class nuclear transport inhibitor currently in clinical trials as an anti-cancer agent. To determine how selinexor might impact anti-tumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T cell development, a progressive loss of CD8 T cells and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T cell development and function. We determined the minimum concentration of selinexor required to block T cell activation, and showed that T cell inhibitory effects of selinexor occur at levels above 100nM, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 5 day drug holiday led to intratumoral IFNγ+, granzyme B+ cytotoxic CD8 T cells that were comparable to vehicle treated mice. Overall, selinexor treatment leads to transient inhibition of T cell activation but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T cell functioning and development of anti-tumor immunity. PMID:28148714

  18. The role of the immune system in neurodegenerative disorders: Adaptive or maladaptive?

    Science.gov (United States)

    Doty, Kevin R; Guillot-Sestier, Marie-Victoire; Town, Terrence

    2015-08-18

    Neurodegenerative diseases share common features, including catastrophic neuronal loss that leads to cognitive or motor dysfunction. Neuronal injury occurs in an inflammatory milieu that is populated by resident and sometimes, infiltrating, immune cells - all of which participate in a complex interplay between secreted inflammatory modulators and activated immune cell surface receptors. The importance of these immunomodulators is highlighted by the number of immune factors that have been associated with increased risk of neurodegeneration in recent genome-wide association studies. One of the more difficult tasks for designing therapeutic strategies for immune modulation against neurodegenerative diseases is teasing apart beneficial from harmful signals. In this regard, learning more about the immune components of these diseases has yielded common themes. These unifying concepts should eventually enable immune-based therapeutics for treatment of Alzheimer׳s and Parkinson׳s diseases and amyotrophic lateral sclerosis. Targeted immune modulation should be possible to temper maladaptive factors, enabling beneficial immune responses in the context of neurodegenerative diseases. This article is part of a Special Issue entitled SI: Neuroimmunology in Health And Disease. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Transcriptomic and proteomic insights into innate immunity and adaptations to a symbiotic lifestyle in the gutless marine worm Olavius algarvensis.

    Science.gov (United States)

    Wippler, Juliane; Kleiner, Manuel; Lott, Christian; Gruhl, Alexander; Abraham, Paul E; Giannone, Richard J; Young, Jacque C; Hettich, Robert L; Dubilier, Nicole

    2016-11-21

    The gutless marine worm Olavius algarvensis has a completely reduced digestive and excretory system, and lives in an obligate nutritional symbiosis with bacterial symbionts. While considerable knowledge has been gained of the symbionts, the host has remained largely unstudied. Here, we generated transcriptomes and proteomes of O. algarvensis to better understand how this annelid worm gains nutrition from its symbionts, how it adapted physiologically to a symbiotic lifestyle, and how its innate immune system recognizes and responds to its symbiotic microbiota. Key adaptations to the symbiosis include (i) the expression of gut-specific digestive enzymes despite the absence of a gut, most likely for the digestion of symbionts in the host's epidermal cells; (ii) a modified hemoglobin that may bind hydrogen sulfide produced by two of the worm's symbionts; and (iii) the expression of a very abundant protein for oxygen storage, hemerythrin, that could provide oxygen to the symbionts and the host under anoxic conditions. Additionally, we identified a large repertoire of proteins involved in interactions between the worm's innate immune system and its symbiotic microbiota, such as peptidoglycan recognition proteins, lectins, fibrinogen-related proteins, Toll and scavenger receptors, and antimicrobial proteins. We show how this worm, over the course of evolutionary time, has modified widely-used proteins and changed their expression patterns in adaptation to its symbiotic lifestyle and describe expressed components of the innate immune system in a marine oligochaete. Our results provide further support for the recent realization that animals have evolved within the context of their associations with microbes and that their adaptive responses to symbiotic microbiota have led to biological innovations.

  20. Interferon alpha inhibits viral replication of a live-attenuated porcine reproductive and respiratory syndrome virus vaccine preventing development of an adaptive immune response in swine

    Science.gov (United States)

    Type I interferons, such as interferon alpha (IFNa), contribute to innate antiviral immunity by promoting production of antiviral mediators and are also involved in promoting an adaptive immune response. Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most devastating and c...

  1. MiR-155-regulated molecular network orchestrates cell fate in the innate and adaptive immune response to Mycobacterium tuberculosis.

    Science.gov (United States)

    Rothchild, Alissa C; Sissons, James R; Shafiani, Shahin; Plaisier, Christopher; Min, Deborah; Mai, Dat; Gilchrist, Mark; Peschon, Jacques; Larson, Ryan P; Bergthaler, Andreas; Baliga, Nitin S; Urdahl, Kevin B; Aderem, Alan

    2016-10-11

    The regulation of host-pathogen interactions during Mycobacterium tuberculosis (Mtb) infection remains unresolved. MicroRNAs (miRNAs) are important regulators of the immune system, and so we used a systems biology approach to construct an miRNA regulatory network activated in macrophages during Mtb infection. Our network comprises 77 putative miRNAs that are associated with temporal gene expression signatures in macrophages early after Mtb infection. In this study, we demonstrate a dual role for one of these regulators, miR-155. On the one hand, miR-155 maintains the survival of Mtb-infected macrophages, thereby providing a niche favoring bacterial replication; on the other hand, miR-155 promotes the survival and function of Mtb-specific T cells, enabling an effective adaptive immune response. MiR-155-induced cell survival is mediated through the SH2 domain-containing inositol 5-phosphatase 1 (SHIP1)/protein kinase B (Akt) pathway. Thus, dual regulation of the same cell survival pathway in innate and adaptive immune cells leads to vastly different outcomes with respect to bacterial containment.

  2. Dynamic Fungal Cell Wall Architecture in Stress Adaptation and Immune Evasion.

    Science.gov (United States)

    Hopke, Alex; Brown, Alistair J P; Hall, Rebecca A; Wheeler, Robert T

    2018-04-01

    Deadly infections from opportunistic fungi have risen in frequency, largely because of the at-risk immunocompromised population created by advances in modern medicine and the HIV/AIDS pandemic. This review focuses on dynamics of the fungal polysaccharide cell wall, which plays an outsized role in fungal pathogenesis and therapy because it acts as both an environmental barrier and as the major interface with the host immune system. Human fungal pathogens use architectural strategies to mask epitopes from the host and prevent immune surveillance, and recent work elucidates how biotic and abiotic stresses present during infection can either block or enhance masking. The signaling components implicated in regulating fungal immune recognition can teach us how cell wall dynamics are controlled, and represent potential targets for interventions designed to boost or dampen immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. Parental Exposure to Dim Light at Night Prior to Mating Alters Offspring Adaptive Immunity.

    Science.gov (United States)

    Cissé, Yasmine M; Russart, Kathryn L G; Nelson, Randy J

    2017-03-31

    Exposure to dim light at night (dLAN) disrupts natural light/dark cycles and impairs endogenous circadian rhythms necessary to maintain optimal biological function, including the endocrine and immune systems. We have previously demonstrated that white dLAN compromises innate and cell mediated immune responses in adult Siberian hamsters (Phodopus sungorus). We hypothesized that dLAN has transgenerational influences on immune function. Adult male and female Siberian hamsters were exposed to either dark nights (DARK) or dLAN (~5 lux) for 9 weeks, then paired in full factorial design, mated, and thereafter housed under dark nights. Offspring were gestated and reared in dark nights, then tested as adults for cell-mediated and humoral immunity. Maternal exposure to dLAN dampened delayed type hypersensitivity (DTH) responses in male offspring. Maternal and paternal exposure to dLAN reduced DTH responses in female offspring. IgG antibodies to a novel antigen were elevated in offspring of dams exposed to dLAN. Paternal exposure to dLAN decreased splenic endocrine receptor expression and global methylation in a parental sex-specific manner. Together, these data suggest that exposure to dLAN has transgenerational effects on endocrine-immune function that may be mediated by global alterations in the epigenetic landscape of immune tissues.

  4. CD8 apoptosis may be a predictor of T cell number normalization after immune reconstitution in HIV

    Directory of Open Access Journals (Sweden)

    Martinez Maria L

    2007-01-01

    Full Text Available Abstract Background As part of the Houston Vanguard study, a subset of 10 patients randomized to receive IL-2 therapy were compared to 4 patients randomized to not receive IL-2, for markers of T cell activation and death during the first three cycles of IL-2. All patients were treated with combination antiretroviral therapy (ART and were virally suppressed. The purpose of the study was to examine the role of CD8+ T cell death in responses to ART and IL-2 therapy. Methods Lymphocytes were examined at Day 0, 5 and 30 days during three cycles of IL-2 therapy. CD25, CD38, HLA-DR expression and annexin (cell death were examined on CD4 and CD8 subpopulations. Follow up studies examined CD4 levels and CD4:CD8 reconstitution after 6 years using both univariant and multivariate analyses. Results Human lymphocytes responded to IL-2 therapy by upregulation of CD25 on CD4+ T cells, leading to an increase in CD4 cell counts. CD8+ T cells did not increase CD25 expression, but upregulated activation antigens (CD38 and DR and had increased death. At baseline, 7 of the 14 patients had high CD8+ T cell apoptosis (mean 17.0% ± 6.0. We did an exploratory analysis of immune status after six years, and found that baseline CD8+ T cell apoptosis was correlated with CD4 cell count gain beginning two years post enrollment. Patients with low levels of CD8+ T cell apoptosis at baseline (mean 2.2% ± 2.1 had significantly higher CD4 cell counts and more normalized CD4:CD8 ratios than patients with high CD8+ T cell apoptosis (mean CD4 cell counts 1,209 ± 164 vs 754 ± 320 cells/mm3; CD4:CD8 ratios 1.55 vs. 0.70, respectively. Conclusion We postulate that CD8+ T cell apoptosis may reflect inherent activation status, which continues in some patients even though viral replication is suppressed which influences the ability of CD4+ T cells to rebound. Levels of CD8+ T cell apoptosis may therefore be an independent predictor of immune status, which should be shown in a

  5. CD8 apoptosis may be a predictor of T cell number normalization after immune reconstitution in HIV

    Science.gov (United States)

    Lewis, Dorothy E; Gross, Kimber L; Diez, Martine M; Martinez, Maria L; Lukefahr, Helen N; Kozinetz, Claudia A; Arduino, Roberto C

    2007-01-01

    Background As part of the Houston Vanguard study, a subset of 10 patients randomized to receive IL-2 therapy were compared to 4 patients randomized to not receive IL-2, for markers of T cell activation and death during the first three cycles of IL-2. All patients were treated with combination antiretroviral therapy (ART) and were virally suppressed. The purpose of the study was to examine the role of CD8+ T cell death in responses to ART and IL-2 therapy. Methods Lymphocytes were examined at Day 0, 5 and 30 days during three cycles of IL-2 therapy. CD25, CD38, HLA-DR expression and annexin (cell death) were examined on CD4 and CD8 subpopulations. Follow up studies examined CD4 levels and CD4:CD8 reconstitution after 6 years using both univariant and multivariate analyses. Results Human lymphocytes responded to IL-2 therapy by upregulation of CD25 on CD4+ T cells, leading to an increase in CD4 cell counts. CD8+ T cells did not increase CD25 expression, but upregulated activation antigens (CD38 and DR) and had increased death. At baseline, 7 of the 14 patients had high CD8+ T cell apoptosis (mean 17.0% ± 6.0). We did an exploratory analysis of immune status after six years, and found that baseline CD8+ T cell apoptosis was correlated with CD4 cell count gain beginning two years post enrollment. Patients with low levels of CD8+ T cell apoptosis at baseline (mean 2.2% ± 2.1) had significantly higher CD4 cell counts and more normalized CD4:CD8 ratios than patients with high CD8+ T cell apoptosis (mean CD4 cell counts 1,209 ± 164 vs 754 ± 320 cells/mm3; CD4:CD8 ratios 1.55 vs. 0.70, respectively). Conclusion We postulate that CD8+ T cell apoptosis may reflect inherent activation status, which continues in some patients even though viral replication is suppressed which influences the ability of CD4+ T cells to rebound. Levels of CD8+ T cell apoptosis may therefore be an independent predictor of immune status, which should be shown in a prospective study. PMID:17263884

  6. Periodontitis induced by Porphyromonas gingivalis drives periodontal microbiota dysbiosis and insulin resistance via an impaired adaptive immune response.

    Science.gov (United States)

    Blasco-Baque, Vincent; Garidou, Lucile; Pomié, Céline; Escoula, Quentin; Loubieres, Pascale; Le Gall-David, Sandrine; Lemaitre, Mathieu; Nicolas, Simon; Klopp, Pascale; Waget, Aurélie; Azalbert, Vincent; Colom, André; Bonnaure-Mallet, Martine; Kemoun, Philippe; Serino, Matteo; Burcelin, Rémy

    2017-05-01

    To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis ( Pg ), Fusobacterium nucleatum and Prevotella intermedia . The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  7. Adaptive immunity alters distinct host feeding pathways during nematode induced inflammation, a novel mechanism in parasite expulsion.

    Directory of Open Access Journals (Sweden)

    John J Worthington

    2013-01-01

    Full Text Available Gastrointestinal infection is often associated with hypophagia and weight loss; however, the precise mechanisms governing these responses remain poorly defined. Furthermore, the possibility that alterations in feeding during infection may be beneficial to the host requires further study. We used the nematode Trichinella spiralis, which transiently inhabits the small intestine before migrating to skeletal muscle, as a biphasic model of infection to determine the cellular and molecular pathways controlling feeding during enteric and peripheral inflammation. Through the infection of genetically modified mice lacking cholecystokinin, Tumor necrosis factor α receptors and T and B-cells, we observed a biphasic hypophagic response to infection resulting from two separate immune-driven mechanisms. The enteroendocrine I-cell derived hormone cholecystokinin is an essential mediator of initial hypophagia and is induced by CD4+ T-cells during enteritis. In contrast, the second hypophagic response is extra-intestinal and due to the anorectic effects of TNFα during peripheral infection of the muscle. Moreover, via maintaining naive levels of the adipose secreted hormone leptin throughout infection we demonstrate a novel feedback loop in the immunoendocrine axis. Immune driven I-cell hyperplasia and resultant weight loss leads to a reduction in the inflammatory adipokine leptin, which in turn heightens protective immunity during infection. These results characterize specific immune mediated mechanisms which reduce feeding during intestinal or peripheral inflammation. Importantly, the molecular mediators of each phase are entirely separate. The data also introduce the first evidence that I-cell hyperplasia is an adaptively driven immune response that directly impinges on the outcome to infection.

  8. Prostaglandin synthesis and catabolism in the gastric mucosa: studies in normal rabbits and rabbits immunized with prostaglandin E2

    International Nuclear Information System (INIS)

    Redfern, J.S.

    1988-01-01

    Antral and fundic mucosal homogenates obtained from prostaglandin E2-immunized rabbits converted 14C-arachidonic acid to prostaglandin E2, 6-keto prostaglandin F1 alpha, prostaglandin F2 alpha, and prostaglandin D2. Percentage conversion of 14C-arachidonic acid to these prostaglandin products was not significantly different in prostaglandin E2-immunized rabbits compared with control rabbits (thyroglobulin-immunized and unimmunized rabbits combined). Synthesis of 6-keto prostaglandin F1 alpha, prostaglandin E2 and 13,14-dihydro 15-keto prostaglandin E2 from endogenous arachidonic acid after vortex mixing fundic mucosal homogenates was similar in prostaglandin E2 immunized rabbits and control rabbits. Both in prostaglandin E2-immunized rabbits and controls, 3H-prostaglandin E2 was catabolized extensively by the fundic mucosa, whereas 3H-6-keto prostaglandin F1 alpha, 3H-prostaglandin F2 alpha, and 3H-prostaglandin D2 were not catabolized to any appreciable extent. The rate of catabolism of PGs was not significantly different in prostaglandin E2-immunized rabbits and control rabbits, with the exception of prostaglandin F2 alpha which was catabolized slightly more rapidly in prostaglandin E2-immunized rabbits. These results indicate that development of gastric ulcers in prostaglandin E2-immunized rabbits is not associated with an alteration in the capacity of the gastric mucosa to synthesize or catabolize prostaglandins

  9. Use of DNA vaccination for determination of onset of adaptive immunity in rainbow trout fry

    DEFF Research Database (Denmark)

    Rasmussen, Jesper Skou; Lorenzen, Ellen; Kjær, Torben Egil

    2013-01-01

    ). The fish were challenged by immersion at different times post vaccination. Protective immunity was induced in both sizes of fish, but whereas clear-cut specific protection was evident in the fish vaccinated at 0.5g, the results suggested that the protection in the fish vaccinated at 0.25 g was mainly due......Vaccine producers often recommend a minimum size of 5g for vaccination of rainbow trout, but implementation of prophylactic vaccination in smaller sized fish would be an advantage for several infectious diseases. To implement a cost efficient vaccination strategy, it is important to know...... the duration and nature of the protective immunity induced by the vaccines in the fish. The present work aimed at determination of the smallest size at which specific immunity could be induced in rainbow trout fry by DNA vaccination against viral haemorrhagic septicaemia (VHS). Earlier experiments revealed...

  10. The "new normal": Adapting doctoral trainee career preparation for broad career paths in science.

    Directory of Open Access Journals (Sweden)

    Rebekah St Clair

    Full Text Available Doctoral recipients in the biomedical sciences and STEM fields are showing increased interest in career opportunities beyond academic positions. While recent research has addressed the interests and preferences of doctoral trainees for non-academic careers, the strategies and resources that trainees use to prepare for a broad job market (non-academic are poorly understood. The recent adaptation of the Social Cognitive Career Theory to explicitly highlight the interplay of contextual support mechanisms, individual career search efficacy, and self-adaptation of job search processes underscores the value of attention to this explicit career phase. Our research addresses the factors that affect the career search confidence and job search strategies of doctoral trainees with non-academic career interests and is based on nearly 900 respondents from an NIH-funded survey of doctoral students and postdoctoral fellows in the biomedical sciences at two U.S. universities. Using structural equation modeling, we find that trainees pursuing non-academic careers, and/or with low perceived program support for career goals, have lower career development and search process efficacy (CDSE, and receive different levels of support from their advisors/supervisors. We also find evidence of trainee adaptation driven by their career search efficacy, and not by career interests.

  11. Adaptive Immunity to Leukemia Is Inhibited by Cross-Reactive Induced Regulatory T Cells.

    Science.gov (United States)

    Manlove, Luke S; Berquam-Vrieze, Katherine E; Pauken, Kristen E; Williams, Richard T; Jenkins, Marc K; Farrar, Michael A

    2015-10-15

    BCR-ABL(+) acute lymphoblastic leukemia patients have transient responses to current therapies. However, the fusion of BCR to ABL generates a potential leukemia-specific Ag that could be a target for immunotherapy. We demonstrate that the immune system can limit BCR-ABL(+) leukemia progression although ultimately this immune response fails. To address how BCR-ABL(+) leukemia escapes immune surveillance, we developed a peptide: MHC class II tetramer that labels endogenous BCR-ABL-specific CD4(+) T cells. Naive mice harbored a small population of BCR-ABL-specific T cells that proliferated modestly upon immunization. The small number of naive BCR-ABL-specific T cells was due to negative selection in the thymus, which depleted BCR-ABL-specific T cells. Consistent with this observation, we saw that BCR-ABL-specific T cells were cross-reactive with an endogenous peptide derived from ABL. Despite this cross-reactivity, the remaining population of BCR-ABL reactive T cells proliferated upon immunization with the BCR-ABL fusion peptide and adjuvant. In response to BCR-ABL(+) leukemia, BCR-ABL-specific T cells proliferated and converted into regulatory T (Treg) cells, a process that was dependent on cross-reactivity with self-antigen, TGF-β1, and MHC class II Ag presentation by leukemic cells. Treg cells were critical for leukemia progression in C57BL/6 mice, as transient Treg cell ablation led to extended survival of leukemic mice. Thus, BCR-ABL(+) leukemia actively suppresses antileukemia immune responses by converting cross-reactive leukemia-specific T cells into Treg cells. Copyright © 2015 by The American Association of Immunologists, Inc.

  12. Accelerated evolution of innate immunity proteins in social insects: adaptive evolution or relaxed constraint?

    Science.gov (United States)

    Harpur, Brock A; Zayed, Amro

    2013-07-01

    The genomes of eusocial insects have a reduced complement of immune genes-an unusual finding considering that sociality provides ideal conditions for disease transmission. The following three hypotheses have been invoked to explain this finding: 1) social insects are attacked by fewer pathogens, 2) social insects have effective behavioral or 3) novel molecular mechanisms for combating pathogens. At the molecular level, these hypotheses predict that canonical innate immune pathways experience a relaxation of selective constraint. A recent study of several innate immune genes in ants and bees showed a pattern of accelerated amino acid evolution, which is consistent with either positive selection or a relaxation of constraint. We studied the population genetics of innate immune genes in the honey bee Apis mellifera by partially sequencing 13 genes from the bee's Toll pathway (∼10.5 kb) and 20 randomly chosen genes (∼16.5 kb) sequenced in 43 diploid workers. Relative to the random gene set, Toll pathway genes had significantly higher levels of amino acid replacement mutations segregating within A. mellifera and fixed between A. mellifera and A. cerana. However, levels of diversity and divergence at synonymous sites did not differ between the two gene sets. Although we detect strong signs of balancing selection on the pathogen recognition gene pgrp-sa, many of the genes in the Toll pathway show signatures of relaxed selective constraint. These results are consistent with the reduced complement of innate immune genes found in social insects and support the hypothesis that some aspect of eusociality renders canonical innate immunity superfluous.

  13. Adaptive Bayesian inference on the mean of an infinite-dimensional normal distribution

    NARCIS (Netherlands)

    Belitser, E.; Ghosal, S.

    2003-01-01

    We consider the problem of estimating the mean of an infinite-break dimensional normal distribution from the Bayesian perspective. Under the assumption that the unknown true mean satisfies a "smoothness condition," we first derive the convergence rate of the posterior distribution for a prior that

  14. Pressure Induced Changes in Adaptive Immune Function in Belugas (Delphinapterus leucas; implications for dive physiology and health

    Directory of Open Access Journals (Sweden)

    Laura A Thompson

    2016-09-01

    Full Text Available Increased pressure, associated with diving, can alter cell function through several mechanisms and has been shown to impact immune functions performed by peripheral blood mononuclear cells (PBMC in humans. While marine mammals possess specific adaptations which protect them from dive related injury, it is unknown how their immune system is adapted to the challenges associated with diving. The purpose of this study was to measure PBMC activation (IL2R expression and Concanavalin A induced lymphocyte proliferation (BrdU incorporation in belugas following in vitro pressure exposures during baseline, Out of Water Examination (OWE and capture/release conditions. Beluga blood samples (n=4 were obtained from animals at the Mystic Aquarium and from free ranging animals in Alaska (n=9. Human blood samples (n=4 (Biological Specialty Corporation were run for comparison. In vivo catecholamines and cortisol were measured in belugas to characterize the neuroendocrine response. Comparison of cellular responses between controls and pressure exposed cells, between conditions in belugas, between belugas and humans as well as between dive profiles, were run using mixed generalized linear models (α=0.05. Cortisol was significantly higher in wild belugas and OWE samples as compared with baseline for aquarium animals. Both IL2R expression and proliferation displayed significant pressure induced changes, and these responses varied between conditions in belugas. Both belugas and humans displayed increased IL2R expression, while lymphocyte proliferation decreased for aquarium animals and increased for humans and wild belugas. Results suggest beluga PBMC function is altered during diving and changes may represent dive adaptation as the response differs from humans, a non-dive adapted mammal. In addition, characteristics of a dive (i.e., duration, depth as well as neuroendocrine activity can alter the response of beluga cells, potentially impacting the ability of animals

  15. Adaptive Filtering to Enhance Noise Immunity of Impedance and Admittance Spectroscopy: Comparison with Fourier Transformation

    Science.gov (United States)

    Stupin, Daniil D.; Koniakhin, Sergei V.; Verlov, Nikolay A.; Dubina, Michael V.

    2017-05-01

    The time-domain technique for impedance spectroscopy consists of computing the excitation voltage and current response Fourier images by fast or discrete Fourier transformation and calculating their relation. Here we propose an alternative method for excitation voltage and current response processing for deriving a system impedance spectrum based on a fast and flexible adaptive filtering method. We show the equivalence between the problem of adaptive filter learning and deriving the system impedance spectrum. To be specific, we express the impedance via the adaptive filter weight coefficients. The noise-canceling property of adaptive filtering is also justified. Using the RLC circuit as a model system, we experimentally show that adaptive filtering yields correct admittance spectra and elements ratings in the high-noise conditions when the Fourier-transform technique fails. Providing the additional sensitivity of impedance spectroscopy, adaptive filtering can be applied to otherwise impossible-to-interpret time-domain impedance data. The advantages of adaptive filtering are justified with practical living-cell impedance measurements.

  16. Adaptation of innate lymphoid cells to nutrient deprivation promotes type 2 barrier immunity

    Science.gov (United States)

    Survival of the host relies on the establishment of site-specific barrier defense tailored to constrain pressures imposed by commensal and parasitic exposures. The host is confronted with the additional challenge of maintaining barrier immunity in fluctuating states of dietary availability, yet how ...

  17. Differential Cortical Neurotrophin and Cytogenetic Adaptation after Voluntary Exercise in Normal and Amnestic Rats

    Science.gov (United States)

    Hall, Joseph M.; Vetreno, Ryan P.; Savage, Lisa M.

    2013-01-01

    Voluntary exercise (VEx) has profound effects on neural and behavioral plasticity, including recovery of CNS trauma and disease. However, the unique regional cortical adaption to VEx has not been elucidated. In a series of experiments, we first examined whether VEx would restore and retain neurotrophin levels in several cortical regions (frontal cortex [FC], retrosplenial cortex [RSC], occipital cortex [OC]) in an animal model (pyrithiamine-induced thiamine deficiency [PTD]) of the amnestic disorder Wernicke-Korsakoff syndrome. In addition, we assessed the time-dependent effect of VEx to rescue performance on a spontaneous alternation task. Following 2-weeks of VEx or stationary housing conditions (Stat), rats were behaviorally tested and brains were harvested either the day after VEx (24-h) or after an additional two-week period (2-wk). In both control pair-fed (PF) rats and PTD rats, all neurotrophin levels (brain-derived neurotrophic factor [BDNF], nerve growth factor [NGF], and vascular endothelial growth factor [VEGF]) increased at the 24-h period after VEx in the FC and RSC, but not OC. Two-weeks following VEx, BDNF remained elevated in both FC and RSC, whereas NGF remained elevated in only the FC. Interestingly, VEx only recovered cognitive performance in amnestic rats when there was an additional 2-wk adaptation period after VEx. Given this unique temporal profile, Experiment 2 examined the cortical cytogenetic responses in all three cortical regions following a 2-wk adaptation period after VEx. In healthy (PF) rats, VEx increased the survival of progenitor cells in both the FC and RSC, but only increased oligodendrocyte precursor cells in the FC. Furthermore, VEx had a selective effect of only recovering oligodendrocyte precursor cells in the FC in PTD rats. These data reveal the therapeutic potential of exercise to restore cortical plasticity in the amnestic brain, and that the FC is one of the most responsive cortical regions to VEx. PMID:24215977

  18. Genetic association analyses implicate aberrant regulation of innate and adaptive immunity genes in the pathogenesis of systemic lupus erythematosus

    Science.gov (United States)

    Graham, Deborah S Cunninghame; Pinder, Christopher L; Tombleson, Philip; Behrens, Timothy W; Martín, Javier; Fairfax, Benjamin P; Knight, Julian C; Chen, Lingyan; Replogle, Joseph; Syvänen, Ann-Christine; Rönnblom, Lars; Graham, Robert R; Wither, Joan E; Rioux, John D; Alarcón-Riquelme, Marta E; Vyse, Timothy J

    2015-01-01

    Systemic lupus erythematosus (SLE; OMIM 152700) is a genetically complex autoimmune disease characterized by loss of immune tolerance to nuclear and cell surface antigens. Previous genome-wide association studies (GWAS) had modest sample sizes, reducing their scope and reliability. Our study comprised 7,219 cases and 15,991 controls of European ancestry: a new GWAS, meta-analysis with a published GWAS and a replication study. We have mapped 43 susceptibility loci, including 10 novel associations. Assisted by dense genome coverage, imputation provided evidence for missense variants underpinning associations in eight genes. Other likely causal genes were established by examining associated alleles for cis-acting eQTL effects in a range of ex vivo immune cells. We found an over-representation (n=16) of transcription factors among SLE susceptibility genes. This supports the view that aberrantly regulated gene expression networks in multiple cell types in both the innate and adaptive immune response contribute to the risk of developing SLE. PMID:26502338

  19. Role and contribution of pulmonary CD103+ dendritic cells in the adaptive immune response to Mycobacterium tuberculosis.

    Science.gov (United States)

    Koh, Vanessa Hui Qi; Ng, See Liang; Ang, Michelle Lay Teng; Lin, Wenwei; Ruedl, Christiane; Alonso, Sylvie

    2017-01-01

    Despite international control programmes, the global burden of tuberculosis remains enormous. Efforts to discover novel drugs have largely focused on targeting the bacterium directly. Alternatively, manipulating the host immune response may represent a valuable approach to enhance immunological clearance of the bacilli, but necessitates a deeper understanding of the immune mechanisms associated with protection against Mycobacterium tuberculosis infection. Here, we examined the various dendritic cells (DC) subsets present in the lung and draining lymph nodes (LN) from mice intra-tracheally infected with M. tuberculosis. We showed that although limited in number, pulmonary CD103 + DCs appeared to be involved in the initial transport of mycobacteria to the draining mediastinal LN and subsequent activation of T cells. Using CLEC9A-DTR transgenic mice enabling the inducible depletion of CD103 + DCs, we established that this DC subset contributes to the control of mycobacterial burden and plays a role in the early activation of T cells, in particular CD8 + T cells. Our findings thus support a previously unidentified role for pulmonary CD103 + DCs in the rapid mobilization of mycobacteria from the lungs to the draining LN soon after exposure to M. tuberculosis, which is a critical step for the development of the host adaptive immune response. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. [Advances in molecular mechanisms of adaptive immunity mediated by type I-E CRISPR/Cas system--A review].

    Science.gov (United States)

    Sun, Dongchang; Qiu, Juanping

    2016-01-04

    To better adapt to the environment, prokaryocyte can take up exogenous genes (from bacteriophages, plasmids or genomes of other species) through horizontal gene transfer. Accompanied by the acquisition of exogenous genes, prokaryocyte is challenged by the invasion of 'selfish genes'. Therefore, to protect against the risk of gene transfer, prokaryocyte needs to establish mechanisms for selectively taking up or degrading exogenous DNA. In recent years, researchers discovered an adaptive immunity, which is mediated by the small RNA guided DNA degradation, prevents the invasion of exogenous genes in prokaryocyte. During the immune process, partial DNA fragments are firstly integrated.to the clustered regularly interspaced short palindromic repeats (CRISPR) located within the genome DNA, and then the mature CRISPR RNA transcript and the CRISPR associated proteins (Cas) form a complex CRISPR/Cas for degrading exogenous DNA. In this review, we will first briefly describe the CRISPR/Cas systems and then mainly focus on the recent advances of the function mechanism and the regulation mechanism of the type I-E CRISPR/Cas system in Escherichia coli.

  1. Nitric oxide and TNFα are critical regulators of reversible lymph node vascular remodeling and adaptive immune response.

    Directory of Open Access Journals (Sweden)

    Stephanie L Sellers

    Full Text Available Lymph node (LN vascular growth, at the level of the main arteriole, was recently characterized for the first time during infection. Arteriole diameter was shown to increase for at least seven days and to occur via a CD4(+ T cell dependent mechanism, with vascular expansion playing a critical role in regulating induction of adaptive immune response. Here, using intravital microscopy of the inguinal LN during herpes simplex type II (HSV-2 infection, the data provides the first studies that demonstrate arteriole expansion during infection is a reversible vascular event that occurs via eutrophic outward remodeling. Furthermore, using genetic ablation models, and pharmacological blockade, we reveal arteriole remodeling and LN hypertrophy to be dependent upon both endothelial nitric oxide synthase (eNOS and TNFα expression. Additionally, we reveal transient changes in nitric oxide (NO levels to be a notable feature of response to viral infection and LN vascular remodeling and provide evidence that mast cells are the critical source of TNFα required to drive arteriole remodeling. Overall, this study is the first to fully characterize LN arteriole vascular changes throughout the course of infection. It effectively reveals a novel role for NO and TNFα in LN cellularity and changes in LN vascularity, which represent key advances in understanding LN vascular physiology and adaptive immune response.

  2. The two sides of complement C3d: evolution of electrostatics in a link between innate and adaptive immunity.

    Science.gov (United States)

    Kieslich, Chris A; Morikis, Dimitrios

    2012-01-01

    The interaction between complement fragment C3d and complement receptor 2 (CR2) is a key aspect of complement immune system activation, and is a component in a link between innate and adaptive immunities. The complement immune system is an ancient mechanism for defense, and can be found in species that have been on Earth for the last 600 million years. However, the link between the complement system and adaptive immunity, which is formed through the association of the B-cell co-receptor complex, including the C3d-CR2 interaction, is a much more recent adaptation. Human C3d and CR2 have net charges of -1 and +7 respectively, and are believed to have evolved favoring the role of electrostatics in their functions. To investigate the role of electrostatics in the function and evolution of human C3d and CR2, we have applied electrostatic similarity methods to identify regions of evolutionarily conserved electrostatic potential based on 24 homologues of complement C3d and 4 homologues of CR2. We also examine the effects of structural perturbation, as introduced through molecular dynamics and mutations, on spatial distributions of electrostatic potential to identify perturbation resistant regions, generated by so-called electrostatic "hot-spots". Distributions of electrostatic similarity based on families of perturbed structures illustrate the presence of electrostatic "hot-spots" at the two functional sites of C3d, while the surface of CR2 lacks electrostatic "hot-spots" despite its excessively positive nature. We propose that the electrostatic "hot-spots" of C3d have evolved to optimize its dual-functionality (covalently attaching to pathogen surfaces and interaction with CR2), which are both necessary for the formation B-cell co-receptor complexes. Comparison of the perturbation resistance of the electrostatic character of the homologues of C3d suggests that there was an emergence of a new role of electrostatics, and a transition in the function of C3d, after the

  3. The two sides of complement C3d: evolution of electrostatics in a link between innate and adaptive immunity.

    Directory of Open Access Journals (Sweden)

    Chris A Kieslich

    Full Text Available The interaction between complement fragment C3d and complement receptor 2 (CR2 is a key aspect of complement immune system activation, and is a component in a link between innate and adaptive immunities. The complement immune system is an ancient mechanism for defense, and can be found in species that have been on Earth for the last 600 million years. However, the link between the complement system and adaptive immunity, which is formed through the association of the B-cell co-receptor complex, including the C3d-CR2 interaction, is a much more recent adaptation. Human C3d and CR2 have net charges of -1 and +7 respectively, and are believed to have evolved favoring the role of electrostatics in their functions. To investigate the role of electrostatics in the function and evolution of human C3d and CR2, we have applied electrostatic similarity methods to identify regions of evolutionarily conserved electrostatic potential based on 24 homologues of complement C3d and 4 homologues of CR2. We also examine the effects of structural perturbation, as introduced through molecular dynamics and mutations, on spatial distributions of electrostatic potential to identify perturbation resistant regions, generated by so-called electrostatic "hot-spots". Distributions of electrostatic similarity based on families of perturbed structures illustrate the presence of electrostatic "hot-spots" at the two functional sites of C3d, while the surface of CR2 lacks electrostatic "hot-spots" despite its excessively positive nature. We propose that the electrostatic "hot-spots" of C3d have evolved to optimize its dual-functionality (covalently attaching to pathogen surfaces and interaction with CR2, which are both necessary for the formation B-cell co-receptor complexes. Comparison of the perturbation resistance of the electrostatic character of the homologues of C3d suggests that there was an emergence of a new role of electrostatics, and a transition in the function of C3

  4. Differential effects of interleukin-17 receptor signaling on innate and adaptive immunity during central nervous system bacterial infection

    Directory of Open Access Journals (Sweden)

    Vidlak Debbie

    2012-06-01

    Full Text Available Abstract Although IL-17A (commonly referred to as IL-17 has been implicated in the pathogenesis of central nervous system (CNS autoimmune disease, its role during CNS bacterial infections remains unclear. To evaluate the broader impact of IL-17 family members in the context of CNS infection, we utilized IL-17 receptor (IL-17R knockout (KO mice that lack the ability to respond to IL-17, IL-17F and IL-17E (IL-25. In this article, we demonstrate that IL-17R signaling regulates bacterial clearance as well as natural killer T (NKT cell and gamma-delta (γδ T cell infiltrates during Staphylococcus aureus-induced brain abscess formation. Specifically, when compared with wild-type (WT animals, IL-17R KO mice exhibited elevated bacterial burdens at days 7 and 14 following S. aureus infection. Additionally, IL-17R KO animals displayed elevated neutrophil chemokine production, revealing the ability to compensate for the lack of IL-17R activity. Despite these differences, innate immune cell recruitment into brain abscesses was similar in IL-17R KO and WT mice, whereas IL-17R signaling exerted a greater influence on adaptive immune cell recruitment. In particular, γδ T cell influx was increased in IL-17R KO mice at day 7 post-infection. In addition, NK1.1high infiltrates were absent in brain abscesses of IL-17R KO animals and, surprisingly, were rarely detected in the livers of uninfected IL-17R KO mice. Although IL-17 is a key regulator of neutrophils in other infection models, our data implicate an important role for IL-17R signaling in regulating adaptive immunity during CNS bacterial infection.

  5. The relation of innate and adaptive immunity with viral-induced acute asthma attacks: Focusing on IP-10 and cathelicidin.

    Science.gov (United States)

    Arikoglu, T; Akyilmaz, E; Yildirim, D D; Batmaz, S B; Ulger, S T; Aslan, G; Kuyucu, S

    Despite growing evidence suggesting potential association between innate and adaptive immunity in viral-induced acute asthma, there is paucity of data in this area. This study aimed to investigate the association of innate and adaptive immunity with acute asthma attacks by analysing the role of IFN-γ-inducible protein 10 (IP-10), TLR2, cathelicidin, vitamin D and cytokines. This prospective study included 33 patients with viral-induced acute asthma and 30 children with controlled asthma. Nasopharyngeal swab samples were collected for virus identification and asthma attack scores assessed in acute asthma group. Blood sampling for IP-10, TLR2, cathelicidin, vitamin D levels, and spirometric indices were employed. Serum IP-10 and cathelicidin levels of acute asthma group were significantly higher and vitamin D levels were lower than controlled asthma group (IP-10; p=0.006, cathelicidin; p=0.002, vitamin D; pasthma attack severity (p=0.03) in acute asthma group. Higher cathelicidin values showed significant positive relation to IP-10 (beta coefficient: 33, p=0.02). Serum IP-10 levels higher than 38.9pg/ml (sensitivity: 85%, specificity: 47%, p=0.002) were predictive of virus-induced asthma. Serum IP-10 and vitamin D levels were found to be significantly related to viral-asthma attacks (IP-10; aOR: 8.93, p=0.03 and vitamin D; aOR: 0.82, p=0.001). Innate immunity biomarkers such as serum IP-10 and cathelicidin can be used to predict viral-induced acute asthma. These biomarkers may provide potential new treatment targets for acute asthma. Copyright © 2016 SEICAP. Published by Elsevier España, S.L.U. All rights reserved.

  6. Activation/modulation of adaptive immunity emerges simultaneously after 17DD yellow fever first-time vaccination: is this the key to prevent severe adverse reactions following immunization?

    Science.gov (United States)

    Martins, M A; Silva, M L; Marciano, A P V; Peruhype-Magalhães, V; Eloi-Santos, S M; Ribeiro, j G L; Correa-Oliveira, R; Homma, A; Kroon, E G; Teixeira-Carvalho, A; Martins-Filho, O A

    2007-04-01

    Over past decades the 17DD yellow fever vaccine has proved to be effective in controlling yellow fever and promises to be a vaccine vector for other diseases, but the cellular and molecular mechanisms by which it elicits such broad-based immunity are still unclear. In this study we describe a detailed phenotypic investigation of major and minor peripheral blood lymphocyte subpopulations aimed at characterizing the kinetics of the adaptive immune response following primary 17DD vaccination. Our major finding is a decreased frequency of circulating CD19+ cells at day 7 followed by emerging activation/modulation phenotypic features (CD19+interleukin(IL)10R+/CD19+CD32+) at day 15. Increased frequency of CD4+human leucocyte antigen D-related(HLA-DR+) at day 7 and CD8+HLA-DR+ at day 30 suggest distinct kinetics of T cell activation, with CD4+ T cells being activated early and CD8+ T cells representing a later event following 17DD vaccination. Up-regulation of modulatory features on CD4+ and CD8+ cells at day 15 seems to be the key event leading to lower frequency of CD38+ T cells at day 30. Taken together, our findings demonstrate the co-existence of phenotypic features associated with activation events and modulatory pathways. Positive correlations between CD4+HLA-DR+ cells and CD4+CD25high regulatory T cells and the association between the type 0 chemokine receptor CCR2 and the activation status of CD4+ and CD8+ cells further support this hypothesis. We hypothesize that this controlled microenviroment seems to be the key to prevent the development of serious adverse events, and even deaths, associated with the 17DD vaccine reported in the literature.

  7. The p36 Isoform of Murine Cytomegalovirus m152 Protein Suffices for Mediating Innate and Adaptive Immune Evasion

    Science.gov (United States)

    Fink, Annette; Renzaho, Angeliqué; Reddehase, Matthias J.; Lemmermann, Niels A. W.

    2013-01-01

    The MHC-class I (MHC-I)-like viral (MHC-Iv) m152 gene product of murine cytomegalovirus (mCMV) was the first immune evasion molecule described for a member of the β-subfamily of herpesviruses as a paradigm for analogous functions of human cytomegalovirus proteins. Notably, by interacting with classical MHC-I molecules and with MHC-I-like RAE1 family ligands of the activatory natural killer (NK) cell receptor NKG2D, it inhibits presentation of antigenic peptides to CD8 T cells and the NKG2D-dependent activation of NK cells, respectively, thus simultaneously interfering with adaptive and innate immune recognition of infected cells. Although the m152 gene product exists in differentially glycosylated isoforms whose individual contributions to immune evasion are unknown, it has entered the scientific literature as m152/gp40, based on the quantitatively most prominent isoform but with no functional justification. By construction of a recombinant mCMV in which all three N-glycosylation sites are mutated (N61Q, N208Q, and N241Q), we show here that N-linked glycosylation is not essential for functional interaction of the m152 immune evasion protein with either MHC-I or RAE1. These data add an important functional detail to recent structural analysis of the m152/RAE1γ complex that has revealed N-glycosylations at positions Asn61 and Asn208 of m152 distant from the m152/RAE1γ interface. PMID:24351798

  8. The p36 Isoform of Murine Cytomegalovirus m152 Protein Suffices for Mediating Innate and Adaptive Immune Evasion

    Directory of Open Access Journals (Sweden)

    Annette Fink

    2013-12-01

    Full Text Available The MHC-class I (MHC-I-like viral (MHC-Iv m152 gene product of murine cytomegalovirus (mCMV was the first immune evasion molecule described for a member of the β-subfamily of herpesviruses as a paradigm for analogous functions of human cytomegalovirus proteins. Notably, by interacting with classical MHC-I molecules and with MHC-I-like RAE1 family ligands of the activatory natural killer (NK cell receptor NKG2D, it inhibits presentation of antigenic peptides to CD8 T cells and the NKG2D-dependent activation of NK cells, respectively, thus simultaneously interfering with adaptive and innate immune recognition of infected cells. Although the m152 gene product exists in differentially glycosylated isoforms whose individual contributions to immune evasion are unknown, it has entered the scientific literature as m152/gp40, based on the quantitatively most prominent isoform but with no functional justification. By construction of a recombinant mCMV in which all three N-glycosylation sites are mutated (N61Q, N208Q, and N241Q, we show here that N-linked glycosylation is not essential for functional interaction of the m152 immune evasion protein with either MHC-I or RAE1. These data add an important functional detail to recent structural analysis of the m152/RAE1g complex that has revealed N-glycosylations at positions Asn61 and Asn208 of m152 distant from the m152/RAE1g interface.

  9. Normal tissue sparing in a phase II trial on daily adaptive plan selection in radiotherapy for urinary bladder cancer.

    Science.gov (United States)

    Vestergaard, Anne; Muren, Ludvig P; Lindberg, Henriette; Jakobsen, Kirsten L; Petersen, Jørgen B B; Elstrøm, Ulrik V; Agerbæk, Mads; Høyer, Morten

    2014-08-01

    Background: Patients with urinary bladder cancer often display large changes in the shape and size of their bladder target during a course of radiotherapy (RT), making adaptive RT (ART) appealing for this tumour site. We are conducting a clinical phase II trial of daily plan selection-based ART for bladder cancer and here report dose-volume data from the first 20 patients treated in the trial. All patients received 60 Gy in 30 fractions to the bladder; in 13 of the patients the pelvic lymph nodes were simultaneously treated to 48 Gy. Daily patient set-up was by use of cone beam computed tomography (CBCT) guidance. The first 5 fractions were delivered with large, population-based (non-adaptive) margins. The bladder contours from the CBCTs acquired in the first 4 fractions were used to create a patient-specific library of three plans, corresponding to a small, medium and large size bladder. From fraction 6, daily online plan selection was performed, where the smallest plan covering the bladder was selected prior to each treatment delivery. A total of 600 treatment fractions in the 20 patients were evaluated. Small, medium and large size plans were used almost equally often, with an average of 10, 9 and 11 fractions, respectively. The median volume ratio of the course-averaged PTV (PTV-ART) relative to the non-adaptive PTV was 0.70 (range: 0.46-0.89). A linear regression analysis showed a 183 cm(3) (CI 143-223 cm(3)) reduction in PTV-ART compared to the non-adaptive PTV (R(2) = 0.94). Daily adaptive plan selection in RT of bladder cancer results in a considerable normal tissue sparing, of a magnitude that we expect will translate into a clinically significant reduction of the treatment-related morbidity.

  10. Estrogen mediates innate and adaptive immune alterations to influenza infection in pregnant mice.

    Directory of Open Access Journals (Sweden)

    Michael A Pazos

    Full Text Available Pregnancy is a leading risk factor for severe complications during an influenza virus infection. Women infected during their second and third trimesters are at increased risk for severe cardiopulmonary complications, premature delivery, and death. Here, we establish a murine model of aerosolized influenza infection during pregnancy. We find significantly altered innate antiviral responses in pregnant mice, including decreased levels of IFN-β, IL-1α, and IFN-γ at early time points of infection. We also find reduced cytotoxic T cell activity and delayed viral clearance. We further demonstrate that pregnancy levels of the estrogen 17-β-estradiol are able to induce key anti-inflammatory phenotypes in immune responses to the virus independently of other hormones or pregnancy-related stressors. We conclude that elevated estrogen levels result in an attenuated anti-viral immune response, and that pregnancy-associated morbidities occur in the context of this anti-inflammatory phenotype.

  11. Estrogen mediates innate and adaptive immune alterations to influenza infection in pregnant mice.

    Science.gov (United States)

    Pazos, Michael A; Kraus, Thomas A; Muñoz-Fontela, César; Moran, Thomas M

    2012-01-01

    Pregnancy is a leading risk factor for severe complications during an influenza virus infection. Women infected during their second and third trimesters are at increased risk for severe cardiopulmonary complications, premature delivery, and death. Here, we establish a murine model of aerosolized influenza infection during pregnancy. We find significantly altered innate antiviral responses in pregnant mice, including decreased levels of IFN-β, IL-1α, and IFN-γ at early time points of infection. We also find reduced cytotoxic T cell activity and delayed viral clearance. We further demonstrate that pregnancy levels of the estrogen 17-β-estradiol are able to induce key anti-inflammatory phenotypes in immune responses to the virus independently of other hormones or pregnancy-related stressors. We conclude that elevated estrogen levels result in an attenuated anti-viral immune response, and that pregnancy-associated morbidities occur in the context of this anti-inflammatory phenotype.

  12. The isolator piglet: a model for studying the development of adaptive immunity

    Czech Academy of Sciences Publication Activity Database

    Butler, J. E.; Šinkora, Marek

    2007-01-01

    Roč. 39, 1-3 (2007), s. 33-51 ISSN 0257-277X R&D Projects: GA ČR GA524/07/0087; GA ČR GA523/07/0088; GA AV ČR IAA5020303 Institutional research plan: CEZ:AV0Z50200510 Keywords : neonatal development * colonization * immune homeostasis Subject RIV: EE - Microbiology, Virology Impact factor: 2.364, year: 2007

  13. Short communication: Association of disease incidence and adaptive immune response in Holstein dairy cows.

    Science.gov (United States)

    Thompson-Crispi, K A; Hine, B; Quinton, M; Miglior, F; Mallard, B A

    2012-07-01

    The objective of this study was to use previously calculated estimated breeding values for cell- (CMIR) and antibody-mediated immune responses (AMIR) to determine associations between immune response (IR) and economically important diseases of dairy cattle. In total, 699 Holsteins were classified as high, average, or low for CMIR, AMIR, and overall IR (combined CMIR and AMIR), and associations with mastitis, metritis, ketosis, displaced abomasums, and retained fetal membranes were determined. The incidence of mastitis was higher among average cows as compared with cows classified as high AMIR [odds ratio (OR)=2.5], high CMIR (OR=1.8), or high IR (OR=1.8). Low-CMIR cows had a higher incidence of metritis (OR=11.3) and low-IR cows had a higher incidence of displaced abomasum (OR=4.1) and retained fetal membrane (OR=2.8) than did average responders. Results of this study show that cows classified as high immune responders have lower occurrence of disease, suggesting that breeding cattle for enhanced IR may be a feasible approach to decrease the incidence of infectious and metabolic diseases in the dairy industry. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. Psychosocial adaptation and cellular immunity in breast cancer patients in the weeks after surgery: An exploratory study.

    Science.gov (United States)

    Blomberg, Bonnie B; Alvarez, Juan P; Diaz, Alain; Romero, Maria G; Lechner, Suzanne C; Carver, Charles S; Holley, Heather; Antoni, Michael H

    2009-11-01

    The period just after surgery for breast cancer requires psychosocial adaptation and is associated with elevated distress. Distress states have been associated with decreased cellular immune functioning in this population, which could have negative effects on physical recovery. However, little is known about relations between psychological status [negative and positive mood states and overall quality of life (QOL)] and cellular signaling cytokines that could account for these associations in women undergoing treatment for breast cancer. The present study examined associations between psychological adaptation indicators (mood, QOL) and T-helper cell type 1 (Th1) cytokine production from stimulated peripheral mononuclear cells in women who had recently undergone surgery for early-stage breast cancer but had not yet begun adjuvant therapy. These associations were evaluated while controlling for relevant disease/treatment, sociodemographic, and health behavior covariates. Lower anxiety related to greater production of the Th1 cytokine interleukin-2 (IL-2), while greater positive mood (affection) related to greater production of the Th1 cytokines IL-12 and interferon-gamma (IFN-gamma). Better QOL related to greater production of the Th1 cytokine, tumor necrosis factor-alpha (TNF-alpha). Individual differences in psychosocial adaptation in women with breast cancer during the period after surgery relate to biological parameters that may be relevant for health and well-being as they move through treatment.

  15. The role of the adaptive immune system in burn-induced heterotopic ossification and mesenchymal cell osteogenic differentiation.

    Science.gov (United States)

    Ranganathan, Kavitha; Agarwal, Shailesh; Cholok, David; Loder, Shawn; Li, Jonathan; Sung Hsieh, Hsiao Hsin; Wang, Stewart C; Buchman, Steven R; Levi, Benjamin

    2016-11-01

    Heterotopic ossification (HO) is the pathologic process of extraskeletal bone formation. Although the exact etiology remains unknown, inflammation appears to catalyze disease progression. The goal of this study is to determine the impact of the adaptive immune system on HO. HO was induced in 8-wk-old control C57BL/6 and immunocompromised Rag1tm1Mom (Rag1 KO) male mice deficient in B- and T-lymphocytes via combined Achilles tenotomy and burn injury. Microcomputed tomography quantified the extent of HO formation at the tenotomy site. Adipose-derived mesenchymal stem cells were harvested to evaluate osteogenic differentiation potential. Areas of developing HO demonstrated substantial enrichment of CD45 + leukocytes at 3 wk after injury. HO from Rag1 KO mice was substantially less mature with foci of cartilage and disorganized trabecular bone present 12 wk after injury. Rag1 KO mice formed 60% less bone compared to immunocompetent controls (4.67 ± 1.5 mm versus 7.76 ± 0.65 mm; P = 0.001). Tartrate-resistant acid phosphatase staining and immunofluorescent analysis of osteoprotegerin and nuclear factor kappa-light-chain-enhancer of activated B cells demonstrated no appreciable difference in osteoclast number or activation. Alizarin red staining in vitro demonstrated a significant decrease in osteogenic potential in immunocompromised mice compared to controls (29.1 ± 0.54 mm versus 12.1 ± 0.14 mm; P role for the adaptive immune system in the development of HO. In the absence of mature B- and T-lymphocytes, HO growth and development are attenuated. Furthermore, we demonstrate that mesenchymal populations from B- and T-cell deficient mice are inherently less osteogenic. This study identifies a potential therapeutic role for modulation of the adaptive immune system in the treatment of HO. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Microbial Warfare: Illuminating CRISPR adaptive immunity using single-molecule fluorescence

    NARCIS (Netherlands)

    Loeff, L.

    2017-01-01

    Bacteria and archaea are constantly threatened by a large array of viruses and other genetic elements. Driven by evolution, these organisms have acquired a wide arsenal of defense mechanisms that allow the host organism to fight off the invaders. Among these defense mechanisms is an adaptive and

  17. A microplate adaptation of the solid-phase C1q immune complex assay

    International Nuclear Information System (INIS)

    Hunt, J.S.; Kennedy, M.P.; Barber, K.E.; McGiven, A.R.

    1980-01-01

    A method has been developed for the detection of C1q binding immune complexes in serum in which microculture plates are used as the solid-phase matrix for adsorption of C1q. This micromethod used only one-tenth of the amount of both C1q and [ 125 I]antihuman immunoglobulin per test and enabled 7 times as many samples to be tested in triplicate in comparison with the number performed in duplicate by the standard tube assay. (Auth.)

  18. Human Milk Oligosaccharide 2′-Fucosyllactose Improves Innate and Adaptive Immunity in an Influenza-Specific Murine Vaccination Model

    Directory of Open Access Journals (Sweden)

    Ling Xiao

    2018-03-01

    Full Text Available BackgroundHuman milk is uniquely suited to provide optimal nutrition and immune protection to infants. Human milk oligosaccharides are structural complex and diverse consisting of short chain and long chain oligosaccharides typically present in a 9:1 ratio. 2′-Fucosyllactose (2′FL is one of the most prominent short chain oligosaccharides and is associated with anti-infective capacity of human milk.AimTo determine the effect of 2′FL on vaccination responsiveness (both innate and adaptive in a murine influenza vaccination model and elucidate mechanisms involved.MethodsA dose range of 0.25–5% (w/w dietary 2′FL was provided to 6-week-old female C57Bl/6JOlaHsd mice 2 weeks prior primary and booster vaccination until the end of the experiment. Intradermal (i.d. challenge was performed to measure the vaccine-specific delayed-type hypersensitivity (DTH. Antigen-specific antibody levels in serum as well as immune cell populations within several organs were evaluated using ELISA and flow cytometry, respectively. In an ex vivo restimulation assay, spleen cells were cocultured with influenza-loaded bone marrow-derived dendritic cells (BMDCs to study the effects of 2′FL on vaccine-specific CD4+ and CD8+ T-cell proliferation and cytokine secretions. Furthermore, the direct immune regulatory effects of 2′FL were confirmed using in vitro BMDCs T-cell cocultures.ResultsDietary 2′FL significantly (p < 0.05 enhanced vaccine specific DTH responses accompanied by increased serum levels of vaccine-specific immunoglobulin (Ig G1 and IgG2a in a dose-dependent manner. Consistently, increased activation marker (CD27 expression on splenic B-cells was detected in mice receiving 2′FL as compared to control mice. Moreover, proliferation of vaccine-specific CD4+ and CD8+ T-cells, as well as interferon-γ production after ex vivo restimulation were significantly increased in spleen cells of mice receiving 2′FL as compared to control mice, which were

  19. Complementary roles for lipid and protein allergens in triggering innate and adaptive immune systems.

    Science.gov (United States)

    Russano, A M; Agea, E; Casciari, C; de Benedictis, F M; Spinozzi, F

    2008-11-01

    Recent advances in allergy research mostly focussed on two major headings: improving protein allergen purification, which is aimed towards a better characterization of IgE- and T-cell reactive epitopes, and the potential new role for unconventional innate and regulatory T cells in controlling airway inflammation. These advancements could appear to be in conflict each other, as innate T cells have a poorly-defined antigen specificity that is often directed toward nonprotein substances, such as lipids. To reconcile these contrasting findings, the model of cypress pollinosis as paradigmatic for studying allergic diseases in adults is suggested. The biochemical characterization of major native protein allergens from undenatured pollen grain demonstrated that the most relevant substance with IgE-binding activity is a glycohydrolase enzyme, which easily denaturizes in stored grains. Moreover, lipids from the pollen membrane are implicated in early pollen grain capture and recognition by CD1(+) dendritic cells (DC) and CD1-restricted T lymphocytes. These T cells display Th0/Th2 functional activity and are also able to produce regulatory cytokines, such as IL-10 and TGF-beta. CD1(+) immature DCs expand in the respiratory mucosa of allergic subjects and are able to process both proteins and lipids. A final scenario may suggest that expansion and functional activation of CD1(+) DCs is a key step for mounting a Th0/Th2-deviated immune response, and that such innate response does not confer long-lasting protective immunity.

  20. Sildenafil Can Affect Innate and Adaptive Immune System in Both Experimental Animals and Patients.

    Science.gov (United States)

    Kniotek, Monika; Boguska, Agnieszka

    2017-01-01

    Sildenafil, a type 5 phosphodiesterase inhibitor (PDE5-I), is primarily used for treating erectile dysfunction. Sildenafil inhibits the degradation of cyclic guanosine monophosphate (cGMP) by competing with cGMP for binding site of PDE5. cGMP is a secondary messenger activating protein kinases and a common regulator of ion channel conductance, glycogenolysis, and cellular apoptosis. PDE5 inhibitors (PDE-Is) found application in cardiology, nephrology, urology, dermatology, oncology, and gynecology. Positive result of sildenafil treatment is closely connected with its immunomodulatory effects. Sildenafil influences angiogenesis, platelet activation, proliferation of regulatory T cells, and production of proinflammatory cytokines and autoantibodies. Sildenafil action in humans and animals appears to be different. Surprisingly, it also acts differently in males and females organisms. Although the immunomodulatory effects of PDE5 inhibitors appear to be promising, none of them reached the point of being tested in clinical trials. Data on the influence of selective PDE5-Is on the human immune system are limited. The main objective of this review is to discuss the immunomodulatory effects of sildenafil in both patients and experimental animals. This is the first review of the current state of knowledge about the effects of sildenafil on the immune system.

  1. Uncomplicated Diverticular Disease: Innate and Adaptive Immunity in Human Gut Mucosa before and after Rifaximin

    Directory of Open Access Journals (Sweden)

    Rossella Cianci

    2014-01-01

    Full Text Available Background/Aim. Uncomplicated diverticular disease (UDD is a frequent condition in adults. The pathogenesis of symptoms remains unknown. Bacteria are able to interact with Toll-like receptors (TLRs and to induce inflammation through both innate immunity and T-cell recruitment. We investigated the pattern of TLRs 2 and 4 and the intestinal homing in patients with UDD before and after a course of Rifaximin. Methods. Forty consecutive patients with UDD and 20 healthy asymptomatic subjects were enrolled. Among UDD patients, 20 were assigned to a 2-month course of treatment with Rifaximin 1.2 g/day for 15 days/month and 20 received placebo. Blood sample and colonic biopsies were obtained from patients and controls. The samples were collected and analyzed at baseline and at the end of treatment. Flow cytometry was performed using monoclonal antibodies (CD3, CD4, CD8, CD103, TCR-gamma/delta, CD14, TLR2, and TLR4. Results. In UDD, TLR2 and TLR4 expression on immune cell subpopulations from blood and mucosa of the affected colon are altered as compared with controls. Rifaximin treatment induced significant modifications of altered conditions. Conclusions. Our data show the role of TLRs in the development of inflammation in UDD. TLRs distribution is altered in UDD and these alterations are reversed after antibiotic treatment. This trial is registered with ClinicalTrials.gov: NCT02068482.

  2. CRISPR-Cas systems exploit viral DNA injection to establish and maintain adaptive immunity.

    Science.gov (United States)

    Modell, Joshua W; Jiang, Wenyan; Marraffini, Luciano A

    2017-04-06

    Clustered regularly interspaced short palindromic repeats (CRISPR)-Cas systems provide protection against viral and plasmid infection by capturing short DNA sequences from these invaders and integrating them into the CRISPR locus of the prokaryotic host. These sequences, known as spacers, are transcribed into short CRISPR RNA guides that specify the cleavage site of Cas nucleases in the genome of the invader. It is not known when spacer sequences are acquired during viral infection. Here, to investigate this, we tracked spacer acquisition in Staphylococcus aureus cells harbouring a type II CRISPR-Cas9 system after infection with the staphylococcal bacteriophage ϕ12. We found that new spacers were acquired immediately after infection preferentially from the cos site, the viral free DNA end that is first injected into the cell. Analysis of spacer acquisition after infection with mutant phages demonstrated that most spacers are acquired during DNA injection, but not during other stages of the viral cycle that produce free DNA ends, such as DNA replication or packaging. Finally, we showed that spacers acquired from early-injected genomic regions, which direct Cas9 cleavage of the viral DNA immediately after infection, provide better immunity than spacers acquired from late-injected regions. Our results reveal that CRISPR-Cas systems exploit the phage life cycle to generate a pattern of spacer acquisition that ensures a successful CRISPR immune response.

  3. Enhancing Artificial Bee Colony Algorithm with Self-Adaptive Searching Strategy and Artificial Immune Network Operators for Global Optimization

    Directory of Open Access Journals (Sweden)

    Tinggui Chen

    2014-01-01

    Full Text Available Artificial bee colony (ABC algorithm, inspired by the intelligent foraging behavior of honey bees, was proposed by Karaboga. It has been shown to be superior to some conventional intelligent algorithms such as genetic algorithm (GA, artificial colony optimization (ACO, and particle swarm optimization (PSO. However, the ABC still has some limitations. For example, ABC can easily get trapped in the local optimum when handing in functions that have a narrow curving valley, a high eccentric ellipse, or complex multimodal functions. As a result, we proposed an enhanced ABC algorithm called EABC by introducing self-adaptive searching strategy and artificial immune network operators to improve the exploitation and exploration. The simulation results tested on a suite of unimodal or multimodal benchmark functions illustrate that the EABC algorithm outperforms ACO, PSO, and the basic ABC in most of the experiments.

  4. Divergent Roles of Interferon-γ and Innate Lymphoid Cells in Innate and Adaptive Immune Cell-Mediated Intestinal Inflammation.

    Science.gov (United States)

    Brasseit, Jennifer; Kwong Chung, Cheong K C; Noti, Mario; Zysset, Daniel; Hoheisel-Dickgreber, Nina; Genitsch, Vera; Corazza, Nadia; Mueller, Christoph

    2018-01-01

    Aberrant interferon gamma (IFNγ) expression is associated with the pathogenesis of numerous autoimmune- and inflammatory disorders, including inflammatory bowel diseases (IBD). However, the requirement of IFNγ for the pathogenesis of chronic intestinal inflammation remains controversial. The aim of this study was thus to investigate the role of IFNγ in experimental mouse models of innate and adaptive immune cell-mediated intestinal inflammation using genetically and microbiota-stabilized hosts. While we find that IFNγ drives acute intestinal inflammation in the anti-CD40 colitis model in an innate lymphoid cell (ILC)-dependent manner, IFNγ secreted by both transferred CD4 T cells and/or cells of the lymphopenic Rag1 -/- recipient mice was dispensable for CD4 T cell-mediated colitis. In the absence of IFNγ, intestinal inflammation in CD4 T cell recipient mice was associated with enhanced IL17 responses; consequently, targeting IL17 signaling in IFNγ-deficient mice reduced T cell-mediated colitis. Intriguingly, in contrast to the anti-CD40 model of colitis, depletion of ILC in the Rag1 -/- recipients of colitogenic CD4 T cells did not prevent induction of colonic inflammation. Together, our findings demonstrate that IFNγ represents an essential, or a redundant, pro-inflammatory cytokine for the induction of intestinal inflammation, depending on the experimental mouse model used and on the nature of the critical disease inducing immune cell populations involved.

  5. Aberrant Pregnancy Adaptations in the Peripheral Immune Response in Type 1 Diabetes : A Rat Model

    NARCIS (Netherlands)

    Groen, Bart; Links, Thera P; Lefrandt, Joop D; van den Berg, Paul P; de Vos, Paul; Faas, Marijke M

    2013-01-01

    Introduction: Despite tight glycemic control, pregnancy complication rate in type 1 diabetes patients is higher than in normal pregnancy. Other etiological factors may be responsible for the development of adverse pregnancy outcome. Acceptance of the semi-allogeneic fetus is accompanied by

  6. Immunomodulatory effects and adaptive immune response to daratumumab in multiple myeloma

    DEFF Research Database (Denmark)

    Krejcik, Jakub; Casneuf, T.; Nijhof, I.

    2015-01-01

    (range) was 64 (31-84) years and median time from diagnosis was 5.12 (0.77-23.77) years. Seventy-six percent of patients had received >3 prior therapies and 91% were refractory to their last treatment. Clinical response was evaluated using IMWG consensus recommendations. Peripheral blood (PB) samples...... assays. T-cell subpopulation counts were modelled over time with linear mixed modelling. Two group comparisons were performed using non-parametric Wilcoxon rank sum tests. Results: Data from 148 patients receiving 16 mg/kg DARA in GEN501 (n = 42) and Sirius (n = 106) were analyzed for changes in immune...... response. In PB, robust mean increases in CD3+ (44%), CD4+ (32%) and CD8+ (62%) T-cell counts per 100 days were seen with DARA treatment. However, responding evaluable patients (n = 45) showed significantly greater increases from baseline than nonresponders (n = 93) in CD3+ (P = 0.00012), CD4+ (P = 0...

  7. Influence of Phthalates on in vitro Innate and Adaptive Immune Responses

    DEFF Research Database (Denmark)

    Hansen, Juliana Frohnert; Nielsen, Claus Henrik; Brorson, Marianne Møller

    2015-01-01

    Phthalates are a group of endocrine disrupting chemicals, suspected to influence the immune system. The aim of this study was to investigate the influence of phthalates on cytokine secretion from human peripheral blood mononuclear cells. Escherichia coli lipopolysaccharide and phytohemagglutinin......-P were used for stimulation of monocytes/macrophages and T cells, respectively. Cells were exposed for 20 to 22 hours to either di-ethyl, di-n-butyl or mono-n-butyl phthalate at two different concentrations. Both diesters were metabolised to their respective monoester and influenced cytokine secretion......-α and interferon-γ by T cells. The investigated phthalate monoester also influenced cytokine secretion from monocytes/macrophages similar to that of the diesters. In T cells, however, the effect of the monoester was different compared to the diesters. The influence of the phthalates on the cytokine secretion did...

  8. Induction of Regulatory T Cells by Intravenous Immunoglobulin: A Bridge between Adaptive and Innate Immunity.

    Science.gov (United States)

    Kaufman, Gabriel N; Massoud, Amir H; Dembele, Marieme; Yona, Madelaine; Piccirillo, Ciriaco A; Mazer, Bruce D

    2015-01-01

    Intravenous immunoglobulin (IVIg) is a polyclonal immunoglobulin G preparation with potent immunomodulatory properties. The mode of action of IVIg has been investigated in multiple disease states, with various mechanisms described to account for its benefits. Recent data indicate that IVIg increases both the number and the suppressive capacity of regulatory T cells, a subpopulation of T cells that are essential for immune homeostasis. IVIg alters dendritic cell function, cytokine and chemokine networks, and T lymphocytes, leading to development of regulatory T cells. The ability of IVIg to influence Treg induction has been shown both in animal models and in human diseases. In this review, we discuss data on the potential mechanisms contributing to the interaction between IVIg and the regulatory T-cell compartment.

  9. CRISPR-Cas Adaptive Immune Systems of the Sulfolobales: Unravelling Their Complexity and Diversity

    Directory of Open Access Journals (Sweden)

    Roger A. Garrett

    2015-03-01

    Full Text Available The Sulfolobales have provided good model organisms for studying CRISPR-Cas systems of the crenarchaeal kingdom of the archaea. These organisms are infected by a wide range of exceptional archaea-specific viruses and conjugative plasmids, and their CRISPR-Cas systems generally exhibit extensive structural and functional diversity. They carry large and multiple CRISPR loci and often multiple copies of diverse Type I and Type III interference modules as well as more homogeneous adaptation modules. These acidothermophilic organisms have recently provided seminal insights into both the adaptation process, the diverse modes of interference, and their modes of regulation. The functions of the adaptation and interference modules tend to be loosely coupled and the stringency of the crRNA-DNA sequence matching during DNA interference is relatively low, in contrast to some more streamlined CRISPR-Cas systems of bacteria. Despite this, there is evidence for a complex and differential regulation of expression of the diverse functional modules in response to viral infection. Recent work also supports critical roles for non-core Cas proteins, especially during Type III-directed interference, and this is consistent with these proteins tending to coevolve with core Cas proteins. Various novel aspects of CRISPR-Cas systems of the Sulfolobales are considered including an alternative spacer acquisition mechanism, reversible spacer acquisition, the formation and significance of antisense CRISPR RNAs, and a novel mechanism for avoidance of CRISPR-Cas defense. Finally, questions regarding the basis for the complexity, diversity, and apparent redundancy, of the intracellular CRISPR-Cas systems are discussed.

  10. Centriole polarisation to the immunological synapse directs secretion from cytolytic cells of both the innate and adaptive immune systems

    Directory of Open Access Journals (Sweden)

    Arico Maurizo

    2011-06-01

    Full Text Available Abstract Background Cytolytic cells of the immune system destroy pathogen-infected cells by polarised exocytosis of secretory lysosomes containing the pore-forming protein perforin. Precise delivery of this lethal hit is essential to ensuring that only the target cell is destroyed. In cytotoxic T lymphocytes (CTLs, this is accomplished by an unusual movement of the centrosome to contact the plasma membrane at the centre of the immunological synapse formed between killer and target cells. Secretory lysosomes are directed towards the centrosome along microtubules and delivered precisely to the point of target cell recognition within the immunological synapse, identified by the centrosome. We asked whether this mechanism of directing secretory lysosome release is unique to CTL or whether natural killer (NK and invariant NKT (iNKT cytolytic cells of the innate immune system use a similar mechanism to focus perforin-bearing lysosome release. Results NK cells were conjugated with B-cell targets lacking major histocompatibility complex class I 721.221 cells, and iNKT cells were conjugated with glycolipid-pulsed CD1-bearing targets, then prepared for thin-section electron microscopy. High-resolution electron micrographs of the immunological synapse formed between NK and iNKT cytolytic cells with their targets revealed that in both NK and iNKT cells, the centrioles could be found associated (or 'docked' with the plasma membrane within the immunological synapse. Secretory clefts were visible within the synapses formed by both NK and iNKT cells, and secretory lysosomes were polarised along microtubules leading towards the docked centrosome. The Golgi apparatus and recycling endosomes were also polarised towards the centrosome at the plasma membrane within the synapse. Conclusions These results reveal that, like CTLs of the adaptive immune system, the centrosomes of NK and iNKT cells (cytolytic cells of the innate immune system direct secretory lysosomes to

  11. Centriole polarisation to the immunological synapse directs secretion from cytolytic cells of both the innate and adaptive immune systems.

    Science.gov (United States)

    Stinchcombe, Jane C; Salio, Mariolina; Cerundolo, Vincenzo; Pende, Daniela; Arico, Maurizo; Griffiths, Gillian M

    2011-06-28

    Cytolytic cells of the immune system destroy pathogen-infected cells by polarised exocytosis of secretory lysosomes containing the pore-forming protein perforin. Precise delivery of this lethal hit is essential to ensuring that only the target cell is destroyed. In cytotoxic T lymphocytes (CTLs), this is accomplished by an unusual movement of the centrosome to contact the plasma membrane at the centre of the immunological synapse formed between killer and target cells. Secretory lysosomes are directed towards the centrosome along microtubules and delivered precisely to the point of target cell recognition within the immunological synapse, identified by the centrosome. We asked whether this mechanism of directing secretory lysosome release is unique to CTL or whether natural killer (NK) and invariant NKT (iNKT) cytolytic cells of the innate immune system use a similar mechanism to focus perforin-bearing lysosome release. NK cells were conjugated with B-cell targets lacking major histocompatibility complex class I 721.221 cells, and iNKT cells were conjugated with glycolipid-pulsed CD1-bearing targets, then prepared for thin-section electron microscopy. High-resolution electron micrographs of the immunological synapse formed between NK and iNKT cytolytic cells with their targets revealed that in both NK and iNKT cells, the centrioles could be found associated (or 'docked') with the plasma membrane within the immunological synapse. Secretory clefts were visible within the synapses formed by both NK and iNKT cells, and secretory lysosomes were polarised along microtubules leading towards the docked centrosome. The Golgi apparatus and recycling endosomes were also polarised towards the centrosome at the plasma membrane within the synapse. These results reveal that, like CTLs of the adaptive immune system, the centrosomes of NK and iNKT cells (cytolytic cells of the innate immune system) direct secretory lysosomes to the immunological synapse. Morphologically, the

  12. Adaptive Immune Responses in a Multiple Sclerosis Patient with Acute Varicella-Zoster Virus Reactivation during Treatment with Fingolimod

    Directory of Open Access Journals (Sweden)

    Andrea Harrer

    2015-09-01

    Full Text Available Fingolimod, an oral sphingosine 1-phosphate (S1P receptor modulator, is approved for the treatment of relapsing forms of multiple sclerosis (MS. The interference with S1P signaling leads to retention particularly of chemokine receptor-7 (CCR7 expressing T cells in lymph nodes. The immunological basis of varicella zoster virus (VZV infections during fingolimod treatment is unclear. Here, we studied the dynamics of systemic and intrathecal immune responses associated with symptomatic VZV reactivation including cessation of fingolimod and initiation of antiviral therapy. Key features in peripheral blood were an about two-fold increase of VZV-specific IgG at diagnosis of VZV reactivation as compared to the previous months, a relative enrichment of effector CD4+ T cells (36% versus mean 12% in controls, and an accelerated reconstitution of absolute lymphocytes counts including a normalized CD4+/CD8+ ratio and reappearance of CCR7+ T cells. In cerebrospinal fluid (CSF the lymphocytic pleocytosis and CD4+/CD8+ ratios at diagnosis of reactivation and after nine days of fingolimod discontinuation remained unchanged. During this time CCR7+ T cells were not observed in CSF. Further research into fingolimod-associated VZV reactivation and immune reconstitution is mandatory to prevent morbidity and mortality associated with this potentially life-threatening condition.

  13. Dynamics of immune system vulnerabilities

    Science.gov (United States)

    Stromberg, Sean P.

    The adaptive immune system can be viewed as a complex system, which adapts, over time, to reflect the history of infections experienced by the organism. Understanding its operation requires viewing it in terms of tradeoffs under constraints and evolutionary history. It typically displays "robust, yet fragile" behavior, meaning common tasks are robust to small changes but novel threats or changes in environment can have dire consequences. In this dissertation we use mechanistic models to study several biological processes: the immune response, the homeostasis of cells in the lymphatic system, and the process that normally prevents autoreactive cells from entering the lymphatic system. Using these models we then study the effects of these processes interacting. We show that the mechanisms that regulate the numbers of cells in the immune system, in conjunction with the immune response, can act to suppress autoreactive cells from proliferating, thus showing quantitatively how pathogenic infections can suppress autoimmune disease. We also show that over long periods of time this same effect can thin the repertoire of cells that defend against novel threats, leading to an age correlated vulnerability. This vulnerability is shown to be a consequence of system dynamics, not due to degradation of immune system components with age. Finally, modeling a specific tolerance mechanism that normally prevents autoimmune disease, in conjunction with models of the immune response and homeostasis we look at the consequences of the immune system mistakenly incorporating pathogenic molecules into its tolerizing mechanisms. The signature of this dynamic matches closely that of the dengue virus system.

  14. Acute adaptive immune response correlates with late radiation-induced pulmonary fibrosis in mice

    International Nuclear Information System (INIS)

    Paun, Alexandra; Kunwar, Amit; Haston, Christina K

    2015-01-01

    The lung response to radiation exposure can involve an immediate or early reaction to the radiation challenge, including cell death and an initial immune reaction, and can be followed by a tissue injury response, of pneumonitis or fibrosis, to this acute reaction. Herein, we aimed to determine whether markers of the initial immune response, measured within days of radiation exposure, are correlated with the lung tissue injury responses occurring weeks later. Inbred strains of mice known to be susceptible (KK/HIJ, C57BL/6J, 129S1/SvImJ) or resistant (C3H/HeJ, A/J, AKR/J) to radiation-induced pulmonary fibrosis and to vary in time to onset of respiratory distress post thoracic irradiation (from 10–23 weeks) were studied. Mice were untreated (controls) or received 18 Gy whole thorax irradiation and were euthanized at 6 h, 1d or 7 d after radiation treatment. Pulmonary CD4+ lymphocytes, bronchoalveolar cell profile & cytokine level, and serum cytokine levels were assayed. Thoracic irradiation and inbred strain background significantly affected the numbers of CD4+ cells in the lungs and the bronchoalveolar lavage cell differential of exposed mice. At the 7 day timepoint greater numbers of pulmonary Th1 and Th17 lymphocytes and reduced lavage interleukin17 and interferonγ levels were significant predictors of late stage fibrosis. Lavage levels of interleukin-10, measured at the 7 day timepoint, were inversely correlated with fibrosis score (R = −0.80, p = 0.05), while serum levels of interleukin-17 in control mice significantly correlated with post irradiation survival time (R = 0.81, p = 0.04). Lavage macrophage, lymphocyte or neutrophil counts were not significantly correlated with either of fibrosis score or time to respiratory distress in the six mouse strains. Specific cytokine and lymphocyte levels, but not strain dependent lavage cell profiles, were predictive of later radiation-induced lung injury in this panel of inbred strains. The online version of this

  15. Interferon alpha inhibits replication of a live-attenuated porcine reproductive and respiratory syndrome virus vaccine preventing development of an adaptive immune response in swine.

    Science.gov (United States)

    Brockmeier, Susan L; Loving, Crystal L; Eberle, Kirsten C; Hau, Samantha J; Buckley, Alexandra; Van Geelen, Albert; Montiel, Nestor A; Nicholson, Tracy; Lager, Kelly M

    2017-12-01

    Type I interferons, such as interferon alpha (IFN-α), contribute to innate antiviral immunity by promoting production of antiviral mediators and are also involved in promoting an adaptive immune response. Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most devastating and costly viruses to the swine industry world-wide and has been shown to induce a meager IFN-α response. Previously we administered porcine IFN-α using a replication-defective adenovirus vector (Ad5-IFN-α) at the time of challenge with virulent PRRSV and demonstrated an increase in the number of virus-specific IFNγ secreting cells, indicating that the presence of IFN-α at the time of infection can alter the adaptive immune responses to PRRSV. In the current experiment, we explored the use of IFN-α as an adjuvant administered with live-attenuated PRRSV vaccine as a method to enhance immune response to the vaccine. Unlike the previous studies with fully virulent virus, one injection of the Ad5-IFN-α abolished replication of the vaccine virus and as a result there was no detectible adaptive immune response. Although IFN-α did not have the desired adjuvant effect, the results further highlight the use of IFN-α as a treatment for PRRSV infection. Published by Elsevier B.V.

  16. A feasibility study in adapting Shamos Bickel and Hodges Lehman estimator into T-Method for normalization

    Science.gov (United States)

    Harudin, N.; Jamaludin, K. R.; Muhtazaruddin, M. Nabil; Ramlie, F.; Muhamad, Wan Zuki Azman Wan

    2018-03-01

    T-Method is one of the techniques governed under Mahalanobis Taguchi System that developed specifically for multivariate data predictions. Prediction using T-Method is always possible even with very limited sample size. The user of T-Method required to clearly understanding the population data trend since this method is not considering the effect of outliers within it. Outliers may cause apparent non-normality and the entire classical methods breakdown. There exist robust parameter estimate that provide satisfactory results when the data contain outliers, as well as when the data are free of them. The robust parameter estimates of location and scale measure called Shamos Bickel (SB) and Hodges Lehman (HL) which are used as a comparable method to calculate the mean and standard deviation of classical statistic is part of it. Embedding these into T-Method normalize stage feasibly help in enhancing the accuracy of the T-Method as well as analysing the robustness of T-method itself. However, the result of higher sample size case study shows that T-method is having lowest average error percentages (3.09%) on data with extreme outliers. HL and SB is having lowest error percentages (4.67%) for data without extreme outliers with minimum error differences compared to T-Method. The error percentages prediction trend is vice versa for lower sample size case study. The result shows that with minimum sample size, which outliers always be at low risk, T-Method is much better on that, while higher sample size with extreme outliers, T-Method as well show better prediction compared to others. For the case studies conducted in this research, it shows that normalization of T-Method is showing satisfactory results and it is not feasible to adapt HL and SB or normal mean and standard deviation into it since it’s only provide minimum effect of percentages errors. Normalization using T-method is still considered having lower risk towards outlier’s effect.

  17. Polyphenols from red wine are potent modulators of innate and adaptive immune responsiveness.

    Science.gov (United States)

    Magrone, Thea; Jirillo, Emilio

    2010-08-01

    It is well known that the consumption of dietary polyphenols leads to beneficial effects for human health as in the case of prevention and/or attenuation of cardiovascular, inflammatory, neurodegenerative and neoplastic diseases. This review summarizes the role of polyphenols from red wine in the immune function. In particular, using healthy human peripheral blood mononuclear cells, we have demonstrated the in vitro ability of Negroamaro, an Italian red wine, to induce the release of nitric oxide and both pro-inflammatory and anti-inflammatory cytokines, thus leading to the maintenance of the immmune homeostasis in the host. All these effects were abrogated by deprivation of polyphenols from red wine samples. We have also provided evidence that Negromaro polyphenols are able to activate extracellular regulated kinase and p38 kinase and switch off the NF-kappaB pathway via an increased expression with time of the IkappaBalpha phosphorylated form. These mechanisms may represent key molecular events leading to inhibition of the pro-inflammatory cascade and atherogenesis. In conclusion, according to the current literature and our own data, moderate consumption of red wine seems to be protective for the host in the prevention of several diseases, even including aged-related diseases by virtue of its immunomodulating properties.

  18. Enhancement of human adaptive immune responses by administration of a high-molecular-weight polysaccharide extract from the cyanobacterium Arthrospira platensis

    DEFF Research Database (Denmark)

    Pedersen, Morten Løbner; Walsted, Anette; Larsen, Rune

    2008-01-01

    The effect of consumption of Immulina, a high-molecular-weight polysaccharide extract from the cyanobacterium Arthrospira platensis, on adaptive immune responses was investigated by evaluation of changes in leukocyte responsiveness to two foreign recall antigens, Candida albicans (CA) and tetanus...

  19. Review: The Necessity of Producing/Normalizing Adaptive Behavior Scales in Diagnosing Training Treatment Rehabilitation of Peop e and Assessment of the Programs

    Directory of Open Access Journals (Sweden)

    Seyyed Jalal Sadrosadat

    2000-10-01

    Full Text Available Adaptive behavior is defined as the manner in which people cope with the natural and social demands of their environments. Impairments in adaptive behavior are described as significant limitations in an individual's effectiveness in meeting the standards of maturation, learning, personal independence, and/or social responsibility that are expected for one's age level and cultural group, as determined by clinical assessment, and usually, standardized scales. The definitions of adaptive deficiencies imply an individual's ability to cope with demands of his or her environment. Some scholars support this notion when describing adaptive behavior's relationship to mental retardation. Despite the fact that adaptive behavior scales are the necessary tools in diagnosing training: treatment. Rehabilitation of people (Particularly with developmental disorders and the assessment of programs, those are not available to professionals. This article tries to explain the necessity of producing/normalizing such scales, and introduces one of the most famous scales named as "Adaptive Behavior Scale-Residential and Community".

  20. Imunidade na gestação normal e na paciente com lúpus eritematoso sistêmico (LES Immunity in the normal pregnancy and in the patient with systemic lupus erythematosus (SLE

    Directory of Open Access Journals (Sweden)

    Alessandra Cardoso Pereira

    2005-06-01

    Full Text Available A gravidez é uma condição fisiológica na qual ocorrem várias mudanças imunoendócrinas com a finalidade de facilitar a imunossupressão e a tolerância aos antígenos paternos e fetais. Na gravidez humana normal existe uma relativa supressão de citocinas tipo Th1 na resposta dos linfócitos, levando a uma prevalência na resposta do tipo Th2. No LES, onde prevalece a resposta imune do tipo Th2, a gravidez pode estar relacionada com a ativação da doença. Este artigo é uma revisão dessas alterações relacionadas com a resposta imune durante a gestação normal e na da paciente com LES.Pregnancy is a physiologic condition where several immuno-endocrine changes take place with the aim of facilitating immunosuppression and tolerance towards paternal and fetal antigens. In normal human pregnancy there is a relative suppression of Th1 type cytokines in response to lymphocytes, leading to a Th2 type response. In SLE, where a Th2 type response prevails, pregnancy may exacerbate the disease. This article reviews the alterations related to the immune response during normal pregnancy and in SLE patients.

  1. Immune Regulation by Self-Recognition

    DEFF Research Database (Denmark)

    Andersen, Mads Hald

    2015-01-01

    Circulating T cells that specifically target normal self-proteins expressed by regulatory immune cells were first described in patients with cancer, but can also be detected in healthy individuals. The adaptive immune system is distinguished for its ability to differentiate between self......-antigens and foreign antigens. Thus, it was remarkable to discover T cells that apparently lacked tolerance to important self-proteins, eg, IDO, PD-L1, and FoxP3, expressed in regulatory immune cells. The ability of self-reactive T cells to react to and eliminate regulatory immune cells can influence general immune...... reactions. This suggests that they may be involved in immune homeostasis. It is here proposed that these T cells should be termed antiregulatory T cells (anti-Tregs). The role of anti-Tregs in immune-regulatory networks may be diverse. For example, pro-inflammatory self-reactive T cells that react...

  2. Immune Modulation in Normal Human Peripheral Blood Mononuclear Cells (PBMCs) (Lymphocytes) in Response to Benzofuran-2-Carboxylic Acid Derivative KMEG during Spaceflight

    Science.gov (United States)

    Okoro, Elvis; Mann, Vivek; Ellis, Ivory; Mansoor, Elvedina; Olamigoke, Loretta; Marriott, Karla Sue; Denkins, Pamela; Williams, Willie; Sundaresan, Alamelu

    2017-08-01

    Microgravity and radiation exposure during space flight have been widely reported to induce the suppression of normal immune system function, and increase the risk of cancer development in humans. These findings pose a serious risk to manned space missions. Interestingly, recent studies have shown that benzofuran-2-carboxylic acid derivatives can inhibit the progression of some of these devastating effects on earth and in modeled microgravity. However, these studies had not assessed the impacts of benzofuran-2- carboxylic acid and its derivatives on global gene expression under spaceflight conditions. In this study, the ability of a specific benzofuran-2-carboxylic acid derivative (KMEG) to confer protection from radiation and restore normal immune function was investigated following exposure to space flight conditions on the ISS. Normal human peripheral blood mononuclear cells (lymphocytes) treated with 10 µ g/ml of KMEG together with untreated control samples were flown on Nanoracks hardware on Spacex-3 flight. The Samples were returned one month later and gene expression was analyzed. A 1g-ground control experiment was performed in parallel at the Kennedy spaceflight center. The first overall subtractive unrestricted analysis revealed 78 genes, which were differentially expressed in space flight KMEG, untreated lymphocytes as compared to the corresponding ground controls. However, in KMEG-treated space flight lymphocytes, there was an increased expression of a group of genes that mediate increased transcription, translation and innate immune system mediating functions of lymphocytes as compared to KMEG-untreated samples. Analysis of genes related to T cell proliferation in spaceflight KMEG-treated lymphocytes compared to 1g-ground KMEG- treated lymphocytes revealed six T cell proliferation and signaling genes to be significantly upregulated (p trafficking, promote early response, mediating C-myc related proliferation, promote antiapoptotic activity and protects

  3. High-resolution imaging of the retinal nerve fiber layer in normal eyes using adaptive optics scanning laser ophthalmoscopy.

    Science.gov (United States)

    Takayama, Kohei; Ooto, Sotaro; Hangai, Masanori; Arakawa, Naoko; Oshima, Susumu; Shibata, Naohisa; Hanebuchi, Masaaki; Inoue, Takashi; Yoshimura, Nagahisa

    2012-01-01

    To conduct high-resolution imaging of the retinal nerve fiber layer (RNFL) in normal eyes using adaptive optics scanning laser ophthalmoscopy (AO-SLO). AO-SLO images were obtained in 20 normal eyes at multiple locations in the posterior polar area and a circular path with a 3-4-mm diameter around the optic disc. For each eye, images focused on the RNFL were recorded and a montage of AO-SLO images was created. AO-SLO images for all eyes showed many hyperreflective bundles in the RNFL. Hyperreflective bundles above or below the fovea were seen in an arch from the temporal periphery on either side of a horizontal dividing line to the optic disc. The dark lines among the hyperreflective bundles were narrower around the optic disc compared with those in the temporal raphe. The hyperreflective bundles corresponded with the direction of the striations on SLO red-free images. The resolution and contrast of the bundles were much higher in AO-SLO images than in red-free fundus photography or SLO red-free images. The mean hyperreflective bundle width around the optic disc had a double-humped shape; the bundles at the temporal and nasal sides of the optic disc were narrower than those above and below the optic disc (Poptical coherence tomography correlated with the hyperreflective bundle widths on AO-SLO (Pfiber bundles and Müller cell septa. The widths of the nerve fiber bundles appear to be proportional to the RNFL thickness at equivalent distances from the optic disc.

  4. Experimental studies on possible regulatory role of nitric oxide on the differential effects of chronic predictable and unpredictable stress on adaptive immune responses.

    Science.gov (United States)

    Thakur, Tarun; Gulati, Kavita; Rai, Nishant; Ray, Arunabha

    2017-09-01

    The present study was designed to investigate the effects of chronic predictable stress (CPS) and chronic unpredictable stress (CUS) on immunological responses in KLH-sensitized rats and involvement of NOergic signaling pathways mediating such responses. Male Wistar rats (200-250g) were exposed to either CPS or CUS for 14days and IgG antibody levels and delayed type hypersensitivity (DTH) response was determined to assess changes in adaptive immunity. To evaluate the role of nitric oxide during such immunomodulation, biochemical estimation of stable metabolite of nitric oxide (NOx) and 3-nitrotyrosine (3-NT, a marker of peroxynitrite formation) were done in both blood and brain. Chronic stress exposure resulted in suppression of IgG and DTH response and elevated NOx and 3-NT levels, with a difference in magnitude of response in CPS vs CUS. Pretreatment with aminoguanidine (iNOS inhibitor) caused further reduction of adaptive immune responses and attenuated the increased NOx and 3-NT levels in CPS or CUS exposed rats. On the other hand 7-NI (nNOS inhibitor) did not significantly affect these estimated parameters. The results suggest involvement of iNOS and lesser/no role of nNOS during modulation of adaptive immunity to stress. Thus, the result showed that predictability of stressors results in differential degree of modulation of immune responses and complex NO-mediated signaling mechanisms may be involved during responses. Copyright © 2017. Published by Elsevier B.V.

  5. Periconception onset diabetes is associated with embryopathy and fetal growth retardation, reproductive tract hyperglycosylation and impaired immune adaptation to pregnancy.

    Science.gov (United States)

    Brown, Hannah M; Green, Ella S; Tan, Tiffany C Y; Gonzalez, Macarena B; Rumbold, Alice R; Hull, M Louise; Norman, Robert J; Packer, Nicolle H; Robertson, Sarah A; Thompson, Jeremy G

    2018-02-01

    Diabetes has been linked with impaired fertility but the underlying mechanisms are not well defined. Here we use a streptozotocin-induced diabetes mouse model to investigate the cellular and biochemical changes in conceptus and maternal tissues that accompany hyperglycaemia. We report that streptozotocin treatment before conception induces profound intra-cellular protein β-O-glycosylation (O-GlcNAc) in the oviduct and uterine epithelium, prominent in early pregnancy. Diabetic mice have impaired blastocyst development and reduced embryo implantation rates, and delayed mid-gestation growth and development. Peri-conception changes are accompanied by increased expression of pro-inflammatory cytokine Trail, and a trend towards increased Il1a, Tnf and Ifng in the uterus, and changes in local T-cell dynamics that skew the adaptive immune response to pregnancy, resulting in 60% fewer anti-inflammatory regulatory T-cells within the uterus-draining lymph nodes. Activation of the heat shock chaperones, a mechanism for stress deflection, was evident in the reproductive tract. Additionally, we show that the embryo exhibits elevated hyper-O-GlcNAcylation of both cytoplasmic and nuclear proteins, associated with activation of DNA damage (ɣH2AX) pathways. These results advance understanding of the impact of peri-conception diabetes, and provide a foundation for designing interventions to support healthy conception without propagation of disease legacy to offspring.

  6. Mathematical modeling of malaria infection with innate and adaptive immunity in individuals and agent-based communities.

    Science.gov (United States)

    Gurarie, David; Karl, Stephan; Zimmerman, Peter A; King, Charles H; St Pierre, Timothy G; Davis, Timothy M E

    2012-01-01

    Agent-based modeling of Plasmodium falciparum infection offers an attractive alternative to the conventional Ross-Macdonald methodology, as it allows simulation of heterogeneous communities subjected to realistic transmission (inoculation patterns). We developed a new, agent based model that accounts for the essential in-host processes: parasite replication and its regulation by innate and adaptive immunity. The model also incorporates a simplified version of antigenic variation by Plasmodium falciparum. We calibrated the model using data from malaria-therapy (MT) studies, and developed a novel calibration procedure that accounts for a deterministic and a pseudo-random component in the observed parasite density patterns. Using the parasite density patterns of 122 MT patients, we generated a large number of calibrated parameters. The resulting data set served as a basis for constructing and simulating heterogeneous agent-based (AB) communities of MT-like hosts. We conducted several numerical experiments subjecting AB communities to realistic inoculation patterns reported from previous field studies, and compared the model output to the observed malaria prevalence in the field. There was overall consistency, supporting the potential of this agent-based methodology to represent transmission in realistic communities. Our approach represents a novel, convenient and versatile method to model Plasmodium falciparum infection.

  7. Mathematical modeling of malaria infection with innate and adaptive immunity in individuals and agent-based communities.

    Directory of Open Access Journals (Sweden)

    David Gurarie

    Full Text Available BACKGROUND: Agent-based modeling of Plasmodium falciparum infection offers an attractive alternative to the conventional Ross-Macdonald methodology, as it allows simulation of heterogeneous communities subjected to realistic transmission (inoculation patterns. METHODOLOGY/PRINCIPAL FINDINGS: We developed a new, agent based model that accounts for the essential in-host processes: parasite replication and its regulation by innate and adaptive immunity. The model also incorporates a simplified version of antigenic variation by Plasmodium falciparum. We calibrated the model using data from malaria-therapy (MT studies, and developed a novel calibration procedure that accounts for a deterministic and a pseudo-random component in the observed parasite density patterns. Using the parasite density patterns of 122 MT patients, we generated a large number of calibrated parameters. The resulting data set served as a basis for constructing and simulating heterogeneous agent-based (AB communities of MT-like hosts. We conducted several numerical experiments subjecting AB communities to realistic inoculation patterns reported from previous field studies, and compared the model output to the observed malaria prevalence in the field. There was overall consistency, supporting the potential of this agent-based methodology to represent transmission in realistic communities. CONCLUSIONS/SIGNIFICANCE: Our approach represents a novel, convenient and versatile method to model Plasmodium falciparum infection.

  8. Omics Approaches for the Study of Adaptive Immunity to Staphylococcus aureus and the Selection of Vaccine Candidates

    Directory of Open Access Journals (Sweden)

    Silva Holtfreter

    2016-03-01

    Full Text Available Staphylococcus aureus is a dangerous pathogen both in hospitals and in the community. Due to the crisis of antibiotic resistance, there is an urgent need for new strategies to combat S. aureus infections, such as vaccination. Increasing our knowledge about the mechanisms of protection will be key for the successful prevention or treatment of S. aureus invasion. Omics technologies generate a comprehensive picture of the physiological and pathophysiological processes within cells, tissues, organs, organisms and even populations. This review provides an overview of the contribution of genomics, transcriptomics, proteomics, metabolomics and immunoproteomics to the current understanding of S. aureus‑host interaction, with a focus on the adaptive immune response to the microorganism. While antibody responses during colonization and infection have been analyzed in detail using immunoproteomics, the full potential of omics technologies has not been tapped yet in terms of T-cells. Omics technologies promise to speed up vaccine development by enabling reverse vaccinology approaches. In consequence, omics technologies are powerful tools for deepening our understanding of the “superbug” S. aureus and for improving its control.

  9. Omics Approaches for the Study of Adaptive Immunity to Staphylococcus aureus and the Selection of Vaccine Candidates

    Science.gov (United States)

    Holtfreter, Silva; Kolata, Julia; Stentzel, Sebastian; Bauerfeind, Stephanie; Schmidt, Frank; Sundaramoorthy, Nandakumar; Bröker, Barbara M.

    2016-01-01

    Staphylococcus aureus is a dangerous pathogen both in hospitals and in the community. Due to the crisis of antibiotic resistance, there is an urgent need for new strategies to combat S. aureus infections, such as vaccination. Increasing our knowledge about the mechanisms of protection will be key for the successful prevention or treatment of S. aureus invasion. Omics technologies generate a comprehensive picture of the physiological and pathophysiological processes within cells, tissues, organs, organisms and even populations. This review provides an overview of the contribution of genomics, transcriptomics, proteomics, metabolomics and immunoproteomics to the current understanding of S. aureus‑host interaction, with a focus on the adaptive immune response to the microorganism. While antibody responses during colonization and infection have been analyzed in detail using immunoproteomics, the full potential of omics technologies has not been tapped yet in terms of T-cells. Omics technologies promise to speed up vaccine development by enabling reverse vaccinology approaches. In consequence, omics technologies are powerful tools for deepening our understanding of the “superbug” S. aureus and for improving its control. PMID:28248221

  10. The effects of stress hormones on immune function may be vital for the adaptive reconfiguration of the immune system during fight-or-flight behavior.

    Science.gov (United States)

    Adamo, Shelley A

    2014-09-01

    Intense, short-term stress (i.e., robust activation of the fight-or-flight response) typically produces a transient decline in resistance to disease in animals across phyla. Chemical mediators of the stress response (e.g., stress hormones) help induce this decline, suggesting that this transient immunosuppression is an evolved response. However, determining the function of stress hormones on immune function is difficult because of their complexity. Nevertheless, evidence suggests that stress hormones help maintain maximal resistance to disease during the physiological changes needed to optimize the body for intense physical activity. Work on insects demonstrates that stress hormones both shunt resources away from the immune system during fight-or-flight responses as well as reconfigure the immune system. Reconfiguring the immune system minimizes the impact of the loss of these resources and reduces the increased costs of some immune functions due to the physiological changes demanded by the fight-or-flight response. For example, during the stress response of the cricket Gryllus texensis, some molecular resources are shunted away from the immune system and toward lipid transport, resulting in a reduction in resistance to disease. However, insects' immune cells (hemocytes) have receptors for octopamine (the insect stress neurohormone). Octopamine increases many hemocyte functions, such as phagocytosis, and these changes would tend to mitigate the decline in immunity due to the loss of molecular resources. Moreover, because the stress response generates oxidative stress, some immune responses are probably more costly when activated during a stress response (e.g., those that produce reactive molecules). Some of these immune responses are depressed during stress in crickets, while others, whose costs are probably not increased during a stress response, are enhanced. Some effects of stress hormones on immune systems may be better understood as examples of reconfiguration

  11. Effect of endotoxin preparations (LPS) with irradiation decreased toxicity on the immune response of normal and irradiated rats

    Energy Technology Data Exchange (ETDEWEB)

    Elekes, E; Bertok, L [Orszagos Frederic Joliot-Curie Sugarbiologiai es Sugaregeszsegugyi Kutato Intezet, Budapest (Hungary)

    1979-03-01

    A comparison of the immunostimulating effect of parent and radiodetoxified with 50, 100, 150 and 200 kGy (5, 10, 15 and 20 Mrad) /sup 60/Co ..gamma..-rays endotoxin preparations in normal and irradiated rats is given. By increasing the dose of irradiation the immunostimulating effect decreased. The preparations detoxified even with the highest (200 kGy) dose is characterized by a pronounced adjuvant effect in irradiated animals.

  12. Adaptation.

    Science.gov (United States)

    Broom, Donald M

    2006-01-01

    The term adaptation is used in biology in three different ways. It may refer to changes which occur at the cell and organ level, or at the individual level, or at the level of gene action and evolutionary processes. Adaptation by cells, especially nerve cells helps in: communication within the body, the distinguishing of stimuli, the avoidance of overload and the conservation of energy. The time course and complexity of these mechanisms varies. Adaptive characters of organisms, including adaptive behaviours, increase fitness so this adaptation is evolutionary. The major part of this paper concerns adaptation by individuals and its relationships to welfare. In complex animals, feed forward control is widely used. Individuals predict problems and adapt by acting before the environmental effect is substantial. Much of adaptation involves brain control and animals have a set of needs, located in the brain and acting largely via motivational mechanisms, to regulate life. Needs may be for resources but are also for actions and stimuli which are part of the mechanism which has evolved to obtain the resources. Hence pigs do not just need food but need to be able to carry out actions like rooting in earth or manipulating materials which are part of foraging behaviour. The welfare of an individual is its state as regards its attempts to cope with its environment. This state includes various adaptive mechanisms including feelings and those which cope with disease. The part of welfare which is concerned with coping with pathology is health. Disease, which implies some significant effect of pathology, always results in poor welfare. Welfare varies over a range from very good, when adaptation is effective and there are feelings of pleasure or contentment, to very poor. A key point concerning the concept of individual adaptation in relation to welfare is that welfare may be good or poor while adaptation is occurring. Some adaptation is very easy and energetically cheap and

  13. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  14. Adaptation

    International Development Research Centre (IDRC) Digital Library (Canada)

    building skills, knowledge or networks on adaptation, ... the African partners leading the AfricaAdapt network, together with the UK-based Institute of Development Studies; and ... UNCCD Secretariat, Regional Coordination Unit for Africa, Tunis, Tunisia .... 26 Rural–urban Cooperation on Water Management in the Context of.

  15. RhIL-11 treatment normalized Th1/Th2 and T-bet/GATA-3 imbalance in in human immune thrombocytopenic purpura (ITP).

    Science.gov (United States)

    Lin, Ying; Zhou, Xieming; Guo, Wenjian; Li, Qianqian; Pan, Xiahui; Bao, Yunhua; He, Muqing; Zhu, Baoling; Lin, Xiaoji; Jin, Limin; Yao, Rongxin

    2016-09-01

    Immune thrombocytopenia (ITP) is an autoimmune hemorrhagic disorder characterized by reduction in platelet counts. T helper 1 (Th1) cells polarization with an increased shift of Th1/Th2 ratio has been reported in ITP. This shift is associated with transcription factor T-box expressed in T cells (T-bet) upregulation and GATA-binding protein 3 (GATA-3) downregulation, leading to an increased T-bet/GATA-3 ratio. Our previous in vitro study showed that recombinant human interleukin-11 (rhIL-11) could normalize Th1/Th2 imbalance in the peripheral blood mononuclear cells (PBMCs) isolated from adult ITP patients, which co-occurred with T-bet/GATA-3 ratio restoration. In this report, we investigated whether rhIL-11 had therapeutic effect in clinical ITP patients and whether rhIL-11 treatment could normalize Th1/Th2 and T-bet/GATA-3 levels in vivo. We found rhIL-11 treatment had a response rate of 67.7% and significantly decreased Th1 and T-bet levels but increased Th2 and GATA-3 levels in ITP patients who showed good response, normalizing Th1/Th2 and T-bet/GATA-3 ratios similar to that in healthy controls. Thus our study suggested rhIL-11 was effective with tolerable adverse effects in ITP. The treatment strategy warrants further clinical investigation. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Dynamics of adaptive and innate immunity in patients treated during primary human immunodeficiency virus infection: results from Maraviroc in HIV Acute Infection (MAIN) randomized clinical trial.

    Science.gov (United States)

    Ripa, M; Pogliaghi, M; Chiappetta, S; Galli, L; Pensieroso, S; Cavarelli, M; Scarlatti, G; De Biasi, S; Cossarizza, A; De Battista, D; Malnati, M; Lazzarin, A; Nozza, S; Tambussi, G

    2015-09-01

    We evaluated the dynamics of innate and adaptive immunity in patients treated with combined antiretroviral therapy (cART) during primary human immunodeficiency virus infection (PHI), enrolled in a prospective randomized trial (MAIN, EUDRACT 2008-007004-29). After 48 weeks of cART, we documented a reduction in activated B cells and CD8(+) T cells. Natural killer cell and dendritic cell frequencies were measured and a decrease in CD16(+) CD56(dim) with a reciprocal rise in CD56(high) natural killer cells and an increase in myeloid and plasmacytoid dendritic cells were recorded. In conclusion, 48 weeks of cART during PHI showed significant benefits for both innate and adaptive immunity. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  17. The interaction between regulatory T cells and NKT cells in the liver: a CD1d bridge links innate and adaptive immunity.

    Science.gov (United States)

    Hua, Jing; Liang, Shuwen; Ma, Xiong; Webb, Tonya J; Potter, James P; Li, Zhiping

    2011-01-01

    Regulatory T cells (Tregs) and natural killer T (NKT) cells are two distinct lymphocyte subsets that independently regulate hepatic adaptive and innate immunity, respectively. In the current study, we examine the interaction between Tregs and NKT cells to understand the mechanisms of cross immune regulation by these cells. The frequency and function of Tregs were evaluated in wild type and NKT cell deficient (CD1dko) mice. In vitro lymphocyte proliferation and apoptosis assays were performed with NKT cells co-cultured with Tregs. The ability of Tregs to inhibit NKT cells in vivo was examined by adoptive transfer of Tregs in a model of NKT cell mediated hepatitis. CD1dko mice have a significant reduction in hepatic Tregs. Although, the Tregs from CD1dko mice remain functional and can suppress conventional T cells, their ability to suppress activation induced NKT cell proliferation and to promote NKT cell apoptosis is greatly diminished. These effects are CD1d dependent and require cell to cell contact. Adoptive transfer of Tregs inhibits NKT cell-mediated liver injury. NKT cells promote Tregs, and Tregs inhibit NKT cells in a CD1d dependent manner requiring cell to cell contact. These cross-talk immune regulations provide a linkage between innate and adaptive immunity.

  18. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  19. Nano-Pulse Stimulation induces immunogenic cell death in human papillomavirus-transformed tumors and initiates an adaptive immune response.

    Directory of Open Access Journals (Sweden)

    Joseph G Skeate

    Full Text Available Nano-Pulse Stimulation (NPS is a non-thermal pulsed electric field modality that has been shown to have cancer therapeutic effects. Here we applied NPS treatment to the human papillomavirus type 16 (HPV 16-transformed C3.43 mouse tumor cell model and showed that it is effective at eliminating primary tumors through the induction of immunogenic cell death while subsequently increasing the number of tumor-infiltrating lymphocytes within the tumor microenvironment. In vitro NPS treatment of C3.43 cells resulted in a doubling of activated caspase 3/7 along with the translocation of phosphatidylserine (PS to the outer leaflet of the plasma membrane, indicating programmed cell death activity. Tumor-bearing mice receiving standard NPS treatment showed an initial decrease in tumor volume followed by clearing of tumors in most mice, and a significant increase in overall survival. Intra-tumor analysis of mice that were unable to clear tumors showed an inverse correlation between the number of tumor infiltrating lymphocytes and the size of the tumor. Approximately half of the mice that cleared established tumors were protected against tumor re-challenge on the opposite flank. Selective depletion of CD8+ T cells eliminated this protection, suggesting that NPS treatment induces an adaptive immune response generating CD8+ T cells that recognize tumor antigen(s associated with the C3.43 tumor model. This method may be utilized in the future to not only ablate primary tumors, but also to induce an anti-tumor response driven by effector CD8+ T cells capable of protecting individuals from disease recurrence.

  20. Nano-Pulse Stimulation induces immunogenic cell death in human papillomavirus-transformed tumors and initiates an adaptive immune response.

    Science.gov (United States)

    Skeate, Joseph G; Da Silva, Diane M; Chavez-Juan, Elena; Anand, Snjezana; Nuccitelli, Richard; Kast, W Martin

    2018-01-01

    Nano-Pulse Stimulation (NPS) is a non-thermal pulsed electric field modality that has been shown to have cancer therapeutic effects. Here we applied NPS treatment to the human papillomavirus type 16 (HPV 16)-transformed C3.43 mouse tumor cell model and showed that it is effective at eliminating primary tumors through the induction of immunogenic cell death while subsequently increasing the number of tumor-infiltrating lymphocytes within the tumor microenvironment. In vitro NPS treatment of C3.43 cells resulted in a doubling of activated caspase 3/7 along with the translocation of phosphatidylserine (PS) to the outer leaflet of the plasma membrane, indicating programmed cell death activity. Tumor-bearing mice receiving standard NPS treatment showed an initial decrease in tumor volume followed by clearing of tumors in most mice, and a significant increase in overall survival. Intra-tumor analysis of mice that were unable to clear tumors showed an inverse correlation between the number of tumor infiltrating lymphocytes and the size of the tumor. Approximately half of the mice that cleared established tumors were protected against tumor re-challenge on the opposite flank. Selective depletion of CD8+ T cells eliminated this protection, suggesting that NPS treatment induces an adaptive immune response generating CD8+ T cells that recognize tumor antigen(s) associated with the C3.43 tumor model. This method may be utilized in the future to not only ablate primary tumors, but also to induce an anti-tumor response driven by effector CD8+ T cells capable of protecting individuals from disease recurrence.

  1. Adapt

    Science.gov (United States)

    Bargatze, L. F.

    2015-12-01

    Active Data Archive Product Tracking (ADAPT) is a collection of software routines that permits one to generate XML metadata files to describe and register data products in support of the NASA Heliophysics Virtual Observatory VxO effort. ADAPT is also a philosophy. The ADAPT concept is to use any and all available metadata associated with scientific data to produce XML metadata descriptions in a consistent, uniform, and organized fashion to provide blanket access to the full complement of data stored on a targeted data server. In this poster, we present an application of ADAPT to describe all of the data products that are stored by using the Common Data File (CDF) format served out by the CDAWEB and SPDF data servers hosted at the NASA Goddard Space Flight Center. These data servers are the primary repositories for NASA Heliophysics data. For this purpose, the ADAPT routines have been used to generate data resource descriptions by using an XML schema named Space Physics Archive, Search, and Extract (SPASE). SPASE is the designated standard for documenting Heliophysics data products, as adopted by the Heliophysics Data and Model Consortium. The set of SPASE XML resource descriptions produced by ADAPT includes high-level descriptions of numerical data products, display data products, or catalogs and also includes low-level "Granule" descriptions. A SPASE Granule is effectively a universal access metadata resource; a Granule associates an individual data file (e.g. a CDF file) with a "parent" high-level data resource description, assigns a resource identifier to the file, and lists the corresponding assess URL(s). The CDAWEB and SPDF file systems were queried to provide the input required by the ADAPT software to create an initial set of SPASE metadata resource descriptions. Then, the CDAWEB and SPDF data repositories were queried subsequently on a nightly basis and the CDF file lists were checked for any changes such as the occurrence of new, modified, or deleted

  2. Blood coagulation factor XII drives adaptive immunity during neuroinflammation via CD87-mediated modulation of dendritic cells

    Science.gov (United States)

    Göbel, Kerstin; Pankratz, Susann; Asaridou, Chloi-Magdalini; Herrmann, Alexander M.; Bittner, Stefan; Merker, Monika; Ruck, Tobias; Glumm, Sarah; Langhauser, Friederike; Kraft, Peter; Krug, Thorsten F.; Breuer, Johanna; Herold, Martin; Gross, Catharina C.; Beckmann, Denise; Korb-Pap, Adelheid; Schuhmann, Michael K.; Kuerten, Stefanie; Mitroulis, Ioannis; Ruppert, Clemens; Nolte, Marc W.; Panousis, Con; Klotz, Luisa; Kehrel, Beate; Korn, Thomas; Langer, Harald F.; Pap, Thomas; Nieswandt, Bernhard; Wiendl, Heinz; Chavakis, Triantafyllos; Kleinschnitz, Christoph; Meuth, Sven G.

    2016-01-01

    Aberrant immune responses represent the underlying cause of central nervous system (CNS) autoimmunity, including multiple sclerosis (MS). Recent evidence implicated the crosstalk between coagulation and immunity in CNS autoimmunity. Here we identify coagulation factor XII (FXII), the initiator of the intrinsic coagulation cascade and the kallikrein–kinin system, as a specific immune cell modulator. High levels of FXII activity are present in the plasma of MS patients during relapse. Deficiency or pharmacologic blockade of FXII renders mice less susceptible to experimental autoimmune encephalomyelitis (a model of MS) and is accompanied by reduced numbers of interleukin-17A-producing T cells. Immune activation by FXII is mediated by dendritic cells in a CD87-dependent manner and involves alterations in intracellular cyclic AMP formation. Our study demonstrates that a member of the plasmatic coagulation cascade is a key mediator of autoimmunity. FXII inhibition may provide a strategy to combat MS and other immune-related disorders. PMID:27188843

  3. Early IFN-gamma production after YF 17D vaccine virus immunization in mice and its association with adaptive immune responses.

    Directory of Open Access Journals (Sweden)

    Patrícia C C Neves

    Full Text Available Yellow Fever vaccine is one of the most efficacious human vaccines ever made. The vaccine (YF 17D virus induces polyvalent immune responses, with a mixed TH1/TH2 CD4(+ cell profile, which results in robust T CD8(+ responses and high titers of neutralizing antibody. In recent years, it has been suggested that early events after yellow fever vaccination are crucial to the development of adequate acquired immunity. We have previously shown that primary immunization of humans and monkeys with YF 17D virus vaccine resulted in the early synthesis of IFN-γ. Herein we have demonstrated, for the first time that early IFN-γ production after yellow fever vaccination is a feature also of murine infection and is much more pronounced in the C57BL/6 strain compared to the BALB/c strain. Likewise, in C57BL/6 strain, we have observed the highest CD8(+ T cells responses as well as higher titers of neutralizing antibodies and total anti-YF IgG. Regardless of this intense IFN-γ response in mice, it was not possible to see higher titers of IgG2a in relation to IgG1 in both mice lineages. However, IgG2a titers were positively correlated to neutralizing antibodies levels, pointing to an important role of IFN-γ in eliciting high quality responses against YF 17D, therefore influencing the immunogenicity of this vaccine.

  4. Ganzfeld stimulation or sleep enhance long term motor memory consolidation compared to normal viewing in saccadic adaptation paradigm.

    Directory of Open Access Journals (Sweden)

    Caroline Voges

    Full Text Available Adaptation of saccade amplitude in response to intra-saccadic target displacement is a type of implicit motor learning which is required to compensate for physiological changes in saccade performance. Once established trials without intra-saccadic target displacement lead to de-adaptation or extinction, which has been attributed either to extra-retinal mechanisms of spatial constancy or to the influence of the stable visual surroundings. Therefore we investigated whether visual deprivation ("Ganzfeld"-stimulation or sleep can partially maintain this motor learning compared to free viewing of the natural surroundings. Thirty-five healthy volunteers performed two adaptation blocks of 100 inward adaptation trials - interspersed by an extinction block - which were followed by a two-hour break with or without visual deprivation (VD. Using additional adaptation and extinction blocks short and long (4 weeks term memory of this implicit motor learning were tested. In the short term, motor memory tested immediately after free viewing was superior to adaptation performance after VD. In the long run, however, effects were opposite: motor memory and relearning of adaptation was superior in the VD conditions. This could imply independent mechanisms that underlie the short-term ability of retrieving learned saccadic gain and its long term consolidation. We suggest that subjects mainly rely on visual cues (i.e., retinal error in the free viewing condition which makes them prone to changes of the visual stimulus in the extinction block. This indicates the role of a stable visual array for resetting adapted saccade amplitudes. In contrast, visual deprivation (GS and sleep, might train subjects to rely on extra-retinal cues, e.g., efference copy or prediction to remap their internal representations of saccade targets, thus leading to better consolidation of saccadic adaptation.

  5. Immunity's ancient arms

    OpenAIRE

    Litman, Gary W.; Cannon, John P.

    2009-01-01

    Diverse receptors on two types of cell mediate adaptive immunity in jawed vertebrates. In the lamprey, a jawless vertebrate, immunity is likewise compartmentalized but the molecular mechanics are very different.

  6. Gel-trapped lymphorganogenic chemokines trigger artificial tertiary lymphoid organs and mount adaptive immune responses in vivo

    Directory of Open Access Journals (Sweden)

    Takeshi Watanabe

    2016-08-01

    Full Text Available We previously generated artificial lymph node-like tertiary lymphoid organs (artTLOs in mice using lymphotoxin α-expressing stromal cells. Here, we show the construction of transplantable and functional artTLOs by applying soluble factors trapped in slow-releasing gels in the absence of lymphoid tissue organizer- (LTo stromal cells. The resultant artTLOs were easily removable, transplantable, and were capable of attracting memory B and T cells. Importantly, artTLOs induced a powerful antigen-specific secondary immune response, which was particularly pronounced in immune-compromised hosts. Synthesis of functionally stable immune tissues/organs like those described here may be a first step to eventually develop immune system-based therapeutics. Although much needs to be learned from the precise mechanisms of action, they may offer ways in the future to reestablish immune functions to overcome hitherto untreatable diseases including severe infection, cancer, autoimmune diseases, and various forms of immune deficiencies including immune-senescence during aging.

  7. Gel-Trapped Lymphorganogenic Chemokines Trigger Artificial Tertiary Lymphoid Organs and Mount Adaptive Immune Responses In Vivo.

    Science.gov (United States)

    Kobayashi, Yuka; Watanabe, Takeshi

    2016-01-01

    We previously generated artificial lymph node-like tertiary lymphoid organs (artTLOs) in mice using lymphotoxin α-expressing stromal cells. Here, we show the construction of transplantable and functional artTLOs by applying soluble factors trapped in slow-releasing gels in the absence of lymphoid tissue organizer stromal cells. The resultant artTLOs were easily removable, transplantable, and were capable of attracting memory B and T cells. Importantly, artTLOs induced a powerful antigen-specific secondary immune response, which was particularly pronounced in immune-compromised hosts. Synthesis of functionally stable immune tissues/organs like those described here may be a first step to eventually develop immune system-based therapeutics. Although much needs to be learned from the precise mechanisms of action, they may offer ways in the future to reestablish immune functions to overcome hitherto untreatable diseases, including severe infection, cancer, autoimmune diseases, and various forms of immune deficiencies, including immune-senescence during aging.

  8. Multi-metal contamination with uranium trend impact on aquatic environment and consequences for fish immune system and adaptive responses

    Energy Technology Data Exchange (ETDEWEB)

    Le Guernic, A.; Gagnaire, B. [IRSN/PRP-ENV/SERIS/LECO (France); Sanchez, W. [Institut national de l' environnement industriel et des risques - INERIS (France); Betoulle, S. [Champagne Ardenne University (France)

    2014-07-01

    Human activities have conducted to an increase of concentrations of various metals in aquatic ecosystems, including uranium. Its extraction and use have been rapidly magnified because of its role in the nuclear fuel cycle. These activities have led to high concentrations of uranium in the aquatic environment and thus a potential risk to exposed organisms, including fish. Consequences can be observed through metabolic and physiological responses, called biomarkers. Some biomarkers are interesting in order to evaluate the effects of metal contamination, among other immunotoxicity markers, antioxidant defenses and genotoxicity. The aims of this study are: i) to investigate the effects of a multi-metal contamination on a fish, the three-spined stickleback, Gasterosteus aculeatus, and ii) to observe the adaptive capacity of fish due to a combination of stress (chemical stress and biological stress). To meet the first objective, six water bodies (ponds and lakes) located in two departments (Cantal and Haute-Vienne, France) were chosen according to their proximity to old uranium mines and to their levels of metal contamination related to chemical processes appeared during extraction. 240 three-spined sticklebacks were caged for 28 days in the six selected sites. A battery of biomarkers was measured in fish sampled after 14 and 28 of caging. The results for the Haute-Vienne department showed that caged fish in the pond with the highest uranium concentration (20 μg.L{sup -1}) presented the most DNA damage after 14 days of caging. Leukocyte phagocytosis (marker of immunotoxicity) of caged fish in this pond was lower at 14 days and greater at 28 days compared to other ponds without uranium. The multi-metal contamination negatively affected other parameters such as the condition index, oxidative activity, viability of lysosomal membrane and leukocytes distribution. In order to study the response of fish to a combined stress (chemical + biological) (objective ii), a second

  9. Common chromosomal fragile sites (CFS) may be involved in normal and traumatic cognitive stress memory consolidation and altered nervous system immunity.

    Science.gov (United States)

    Gericke, G S

    2010-05-01

    Previous reports of specific patterns of increased fragility at common chromosomal fragile sites (CFS) found in association with certain neurobehavioural disorders did not attract attention at the time due to a shift towards molecular approaches to delineate neuropsychiatric disorder candidate genes. Links with miRNA, altered methylation and the origin of copy number variation indicate that CFS region characteristics may be part of chromatinomic mechanisms that are increasingly linked with neuroplasticity and memory. Current reports of large-scale double-stranded DNA breaks in differentiating neurons and evidence of ongoing DNA demethylation of specific gene promoters in adult hippocampus may shed new light on the dynamic epigenetic changes that are increasingly appreciated as contributing to long-term memory consolidation. The expression of immune recombination activating genes in key stress-induced memory regions suggests the adoption by the brain of this ancient pattern recognition and memory system to establish a structural basis for long-term memory through controlled chromosomal breakage at highly specific genomic regions. It is furthermore considered that these mechanisms for management of epigenetic information related to stress memory could be linked, in some instances, with the transfer of the somatically acquired information to the germline. Here, rearranged sequences can be subjected to further selection and possible eventual retrotranscription to become part of the more stable coding machinery if proven to be crucial for survival and reproduction. While linkage of cognitive memory with stress and fear circuitry and memory establishment through structural DNA modification is proposed as a normal process, inappropriate activation of immune-like genomic rearrangement processes through traumatic stress memory may have the potential to lead to undesirable activation of neuro-inflammatory processes. These theories could have a significant impact on the

  10. Mansonella perstans microfilaremic individuals are characterized by enhanced type 2 helper T and regulatory T and B cell subsets and dampened systemic innate and adaptive immune responses.

    Directory of Open Access Journals (Sweden)

    Manuel Ritter

    2018-01-01

    Full Text Available The filarial nematode Mansonella perstans is endemic throughout Africa, northern South America and the Caribbean. Interestingly, M. perstans-infected individuals present no distinct clinical picture associated with certain pathology. Due to its relatively silent nature, research on this tropical disease has been neglected, especially M. perstans-driven immune responses. A hindrance in obtaining data on M. perstans-specific responses has been the inability to obtain adult worms since their habitats in serous cavities are difficult to access. Thus, in this study, for the first time, we used Mansonella perstans worm antigen extract as stimulant to obtain filarial-specific recall and immunoglobulin responses from M. perstans microfilaremic individuals (Mp MF+ from Cameroon. Moreover, systemic immune profiles in sera and immune cell composition in peripheral blood from Mp MF+ and amicrofilaremic individuals (Mp MF- were obtained. Our data reveal that Mp MF+ individuals showed significantly reduced cytokine (IL-4, IL-6 and IL-12p70 and chemokine levels (IL-8 and RANTES, but significantly higher MIP-1β as well as increased M. perstans-specific IgG4 levels compared to Mp MF- individuals. In contrast, upon re-stimulation with worm antigen extract, IFN-γ, IL-13, IL-10 and IL-17A secretion was enhanced in cell cultures from Mp MF+ individuals when compared to those from cultures of healthy European individuals. Moreover, analysis of immune cell composition in peripheral blood from Mp MF+ individuals revealed increased type 2 helper T (Th2, natural killer (NK, regulatory B and T cell (Breg and Treg subsets but decreased type 1 regulatory T (Tr1 cells. In summary, this study deciphers for the first time, M. perstans-specific immune responses using worm antigen extract and shows that patent M. perstans infections have distinct Th2, Breg and Treg subsets accompanied with reduced systemic innate and adaptive immune responses and dominant filarial-specific Ig

  11. MiR-155–regulated molecular network orchestrates cell fate in the innate and adaptive immune response to Mycobacterium tuberculosis

    Science.gov (United States)

    Rothchild, Alissa C.; Sissons, James R.; Shafiani, Shahin; Plaisier, Christopher; Min, Deborah; Mai, Dat; Gilchrist, Mark; Peschon, Jacques; Larson, Ryan P.; Bergthaler, Andreas; Baliga, Nitin S.; Urdahl, Kevin B.; Aderem, Alan

    2016-01-01

    The regulation of host–pathogen interactions during Mycobacterium tuberculosis (Mtb) infection remains unresolved. MicroRNAs (miRNAs) are important regulators of the immune system, and so we used a systems biology approach to construct an miRNA regulatory network activated in macrophages during Mtb infection. Our network comprises 77 putative miRNAs that are associated with temporal gene expression signatures in macrophages early after Mtb infection. In this study, we demonstrate a dual role for one of these regulators, miR-155. On the one hand, miR-155 maintains the survival of Mtb-infected macrophages, thereby providing a niche favoring bacterial replication; on the other hand, miR-155 promotes the survival and function of Mtb-specific T cells, enabling an effective adaptive immune response. MiR-155–induced cell survival is mediated through the SH2 domain-containing inositol 5-phosphatase 1 (SHIP1)/protein kinase B (Akt) pathway. Thus, dual regulation of the same cell survival pathway in innate and adaptive immune cells leads to vastly different outcomes with respect to bacterial containment. PMID:27681624

  12. Cold-Adapted Influenza and Recombinant Adenovirus Vaccines Induce Cross-Protective Immunity against pH1N1 Challenge in Mice

    Science.gov (United States)

    Soboleski, Mark R.; Gabbard, Jon D.; Price, Graeme E.; Misplon, Julia A.; Lo, Chia-Yun; Perez, Daniel R.; Ye, Jianqiang; Tompkins, S. Mark; Epstein, Suzanne L.

    2011-01-01

    Background The rapid spread of the 2009 H1N1 pandemic influenza virus (pH1N1) highlighted problems associated with relying on strain-matched vaccines. A lengthy process of strain identification, manufacture, and testing is required for current strain-matched vaccines and delays vaccine availability. Vaccines inducing immunity to conserved viral proteins could be manufactured and tested in advance and provide cross-protection against novel influenza viruses until strain-matched vaccines became available. Here we test two prototype vaccines for cross-protection against the recent pandemic virus. Methodology/Principal Findings BALB/c and C57BL/6 mice were intranasally immunized with a single dose of cold-adapted (ca) influenza viruses from 1977 or recombinant adenoviruses (rAd) expressing 1934 nucleoprotein (NP) and consensus matrix 2 (M2) (NP+M2-rAd). Antibodies against the M2 ectodomain (M2e) were seen in NP+M2-rAd immunized BALB/c but not C57BL/6 mice, and cross-reacted with pH1N1 M2e. The ca-immunized mice did not develop antibodies against M2e. Despite sequence differences between vaccine and challenge virus NP and M2e epitopes, extensive cross-reactivity of lung T cells with pH1N1 peptides was detected following immunization. Both ca and NP+M2-rAd immunization protected BALB/c and C57BL/6 mice against challenge with a mouse-adapted pH1N1 virus. Conclusion/Significance Cross-protective vaccines such as NP+M2-rAd and ca virus are effective against pH1N1 challenge within 3 weeks of immunization. Protection was not dependent on recognition of the highly variable external viral proteins and could be achieved with a single vaccine dose. The rAd vaccine was superior to the ca vaccine by certain measures, justifying continued investigation of this experimental vaccine even though ca vaccine is already available. This study highlights the potential for cross-protective vaccines as a public health option early in an influenza pandemic. PMID:21789196

  13. Cold-adapted influenza and recombinant adenovirus vaccines induce cross-protective immunity against pH1N1 challenge in mice.

    Directory of Open Access Journals (Sweden)

    Mark R Soboleski

    Full Text Available The rapid spread of the 2009 H1N1 pandemic influenza virus (pH1N1 highlighted problems associated with relying on strain-matched vaccines. A lengthy process of strain identification, manufacture, and testing is required for current strain-matched vaccines and delays vaccine availability. Vaccines inducing immunity to conserved viral proteins could be manufactured and tested in advance and provide cross-protection against novel influenza viruses until strain-matched vaccines became available. Here we test two prototype vaccines for cross-protection against the recent pandemic virus.BALB/c and C57BL/6 mice were intranasally immunized with a single dose of cold-adapted (ca influenza viruses from 1977 or recombinant adenoviruses (rAd expressing 1934 nucleoprotein (NP and consensus matrix 2 (M2 (NP+M2-rAd. Antibodies against the M2 ectodomain (M2e were seen in NP+M2-rAd immunized BALB/c but not C57BL/6 mice, and cross-reacted with pH1N1 M2e. The ca-immunized mice did not develop antibodies against M2e. Despite sequence differences between vaccine and challenge virus NP and M2e epitopes, extensive cross-reactivity of lung T cells with pH1N1 peptides was detected following immunization. Both ca and NP+M2-rAd immunization protected BALB/c and C57BL/6 mice against challenge with a mouse-adapted pH1N1 virus.Cross-protective vaccines such as NP+M2-rAd and ca virus are effective against pH1N1 challenge within 3 weeks of immunization. Protection was not dependent on recognition of the highly variable external viral proteins and could be achieved with a single vaccine dose. The rAd vaccine was superior to the ca vaccine by certain measures, justifying continued investigation of this experimental vaccine even though ca vaccine is already available. This study highlights the potential for cross-protective vaccines as a public health option early in an influenza pandemic.

  14. From blood coagulation to innate and adaptive immunity: the role of platelets in the physiology and pathology of autoimmune disorders.

    Science.gov (United States)

    Łukasik, Zuzanna Małgorzata; Makowski, Marcin; Makowska, Joanna Samanta

    2018-02-28

    Thrombosis and cardiovascular complications are common manifestations of a variety of pathological conditions, including infections and chronic inflammatory diseases. Hence, there is great interest in determining the hitherto unforeseen immune role of the main blood coagulation executor-the platelet. Platelets store and release a plethora of immunoactive molecules, generate microparticles, and interact with cells classically belonging to the immune system. The observed effects of platelet involvement in immune processes, especially in autoimmune diseases, are conflicting-from inciting inflammation to mediating its resolution. An in-depth understanding of the role of platelets in inflammation and immunity could open new therapeutic pathways for patients with autoimmune disorders. This review aims to summarize the current knowledge on the role of platelets in the patomechanisms of autoimmune disorders and suggests directions for future research.

  15. Molecular adjuvants based on nonpyrogenic lipophilic derivatives of norAbuMDP/GMDP formulated in nanoliposomes: stimulation of innate and adaptive immunity.

    Science.gov (United States)

    Knotigová, Pavlína Turánek; Zyka, Daniel; Mašek, Josef; Kovalová, Anna; Křupka, Michal; Bartheldyová, Eliška; Kulich, Pavel; Koudelka, Štěpán; Lukáč, Róbert; Kauerová, Zuzana; Vacek, Antonín; Horynová, Milada Stuchlová; Kozubík, Alois; Miller, Andrew D; Fekete, Ladislav; Kratochvílová, Irena; Ježek, Jan; Ledvina, Miroslav; Raška, Milan; Turánek, Jaroslav

    2015-04-01

    The aim of this work was to demonstrate an immunostimulatory and adjuvant effect of new apyrogenic lipophilic derivatives of norAbuMDP and norAbuGMDP formulated in nanoliposomes. Nanoliposomes and metallochelating nanoliposomes were prepared by lipid film hydration and extrusion methods. The structure of the liposomal formulation was studied by electron microscopy, AF microscopy, and dynamic light scattering. Sublethal and lethal γ-irradiation mice models were used to demonstrate stimulation of innate immune system. Recombinant Hsp90 antigen (Candida albicans) bound onto metallochelating nanoliposomes was used for immunisation of mice to demonstrate adjuvant activities of tested compounds. Safety and stimulation of innate and adaptive immunity were demonstrated on rabbits and mice. The liposomal formulation of norAbuMDP/GMDP was apyrogenic in rabbit test and lacking any side effect in vivo. Recovery of bone marrow after sublethal γ-irradiation as well as increased survival of mice after lethal irradiation was demonstrated. Enhancement of specific immune response was demonstrated for some derivatives incorporated in metallochelating nanoliposomes with recombinant Hsp90 protein antigen. Liposomal formulations of new lipophilic derivatives of norAbuMDP/GMDP proved themselves as promising adjuvants for recombinant vaccines as well as immunomodulators for stimulation of innate immunity and bone-marrow recovery after chemo/radio therapy of cancer.

  16. Future targets for immune therapy in colitis?

    DEFF Research Database (Denmark)

    Kristensen, Nanna Ny; Claesson, M H

    2008-01-01

    Crohn's disease and Ulcerative Colitis, collectively termed inflammatory bowel disease (IBD), are chronic inflammatory disorders of the bowel. It is generally accepted that the pathology associated with IBD is characterized by a hyper-reactive immune response in the gut wall directed against...... the commensal intestinal bacterial flora, and that the CD4+ T cells dominate the adaptive immune response. Chemokines are small proteins involved in the guidance of migration of immune cells during normal homeostasis and inflammation. Chemokines have been shown to play a central role in recruiting inflammatory...... cells from congenic normal mice are transplanted into immune deficient mice, which in turn develop a chronic lethal colitis within 1-2 months. By simultaneous transplantation of CD4+CD25+ regulatory T cells (Tregs) it is possible to hinder development of colitis. Thus the model is well suited...

  17. Mecanismos adaptativos do sistema imunológico em resposta ao treinamento físico Adaptative mechanisms of the immune system in response to physical training

    Directory of Open Access Journals (Sweden)

    Carol Góis Leandro

    2007-10-01

    Full Text Available O treinamento físico, de intensidade moderada, melhora os sistemas de defesa, enquanto que o treinamento intenso causa imunossupressão. Os mecanismos subjacentes estão associados à comunicação entre os sistemas nervoso, endócrino e imunológico, sugerindo vias autonômicas e modulação da resposta imune. Células do sistema imune, quando expostas a pequenas cargas de estresse, desenvolvem mecanismo de tolerância. Em muitos tecidos tem-se demonstrado que a resposta a situações agressivas parece ser atenuada pelo treinamento físico aplicado previamente, isto é, o treinamento induz tolerância para situações agressivas/estressantes. Nesta revisão são relatados estudos sugerindo os mecanismos adaptativos do sistema imunológico em resposta ao treinamento físico.Moderate physical training enhances the defense mechanisms, while intense physical training induces to immune suppression. The underlying mechanisms are associated with the link between nervous, endocrine, and immune systems. It suggests autonomic patterns and modulation of immune response. Immune cells, when exposed to regular bouts of stress, develop a mechanism of tolerance. In many tissues, it has been demonstrated that the response to aggressive conditions is attenuated by moderate physical training. Thus, training can induce tolerance to aggressive/stressful situations. In this review, studies suggesting the adaptation mechanisms of the immune system in response to physical training will be reported.

  18. Infusion of Sibling Marrow in a Patient with Purine Nucleoside Phosphorylase Deficiency Leads to Split Mixed Donor Chimerism and Normal Immunity

    Directory of Open Access Journals (Sweden)

    Laura Yeates

    2017-06-01

    Full Text Available Purine nucleoside phosphorylase (PNP deficiency, a rare autosomal recessive metabolic disease causes combined immunodeficiency and developmental delay, hypotonia, and spasticity. Patients present with recurrent infections associated with T-lymphocytopenia, characteristically presenting later than patients with classical severe combined immunodeficiency (SCID. PNP, with adenosine deaminase (ADA, is part of the purine salvage pathway. The only curative therapy is hematopoietic stem cell transplantation. Myeloablative conditioning is recommended to prevent rejection caused by residual immune function. However, HLA-identical sibling stem cell infusions in ADA-SCID result in some donor stem cell engraftment and long-term thymopoiesis. We report a patient with PNP deficiency, who received HLA-identical sibling marrow without chemotherapy because of disseminated cytomegalovirus (CMV infection. The patient presented at 14 months of age following recurrent infections, from early infancy, with persistent irritability, developmental delay, and hypotonia. She had neutropenia, pan-lymphocytopenia, and hypogammaglobulinemia with low plasma urate and erythrocyte PNP activity. Diagnosis was confirmed with a homozygous mutation in PNP. The patient was viremic with CMV detected in blood and CSF by PCR. Dual antiviral therapy improved the clinical condition and reduced the viral load. In view of the disseminated CMV infection, the decision was made to infuse stem cells without any pre-conditioning chemotherapy. She received a matched sibling donor unconditioned stem cell infusion at 16 months of age. The post-transplant course was uneventful. Blood PCR became negative for CMV. Global hypotonia persisted, although with significant improvement in irritability. At 4 years of age and 29 months post-transplant, the patient demonstrated normal T-lymphocyte and natural killer cell numbers. Recent thymic emigrants represented 12% of the total T

  19. Adaptive immune responses to booster vaccination against yellow fever virus are much reduced compared to those after primary vaccination

    DEFF Research Database (Denmark)

    Kongsgaard, Michael; Bassi, Maria Rosaria; Rasmussen, Michael

    2017-01-01

    Outbreaks of Yellow Fever occur regularly in endemic areas of Africa and South America frequently leading to mass vaccination campaigns straining the availability of the attenuated Yellow Fever vaccine, YF-17D. The WHO has recently decided to discontinue regular booster-vaccinations since a single...... vaccination is deemed to confer life-long immune protection. Here, we have examined humoral (neutralizing antibody) and cellular (CD8 and CD4 T cell) immune responses in primary and booster vaccinees (the latter spanning 8 to 36 years after primary vaccination). After primary vaccination, we observed strong...... cellular immune responses with T cell activation peaking ≈2 weeks and subsiding to background levels ≈ 4 weeks post-vaccination. The number of antigen-specific CD8+ T cells declined over the following years. In >90% of vaccinees, in vitro expandable T cells could still be detected >10 years post-vaccination...

  20. Intranasal immunization of baculovirus displayed hemagglutinin confers complete protection against mouse adapted highly pathogenic H7N7 reassortant influenza virus.

    Directory of Open Access Journals (Sweden)

    Subaschandrabose Rajesh Kumar

    Full Text Available BACKGROUND: Avian influenza A H7N7 virus poses a pandemic threat to human health because of its ability for direct transmission from domestic poultry to humans and from human to human. The wide zoonotic potential of H7N7 combined with an antiviral immunity inhibition similar to pandemic 1918 H1N1 and 2009 H1N1 influenza viruses is disconcerting and increases the risk of a putative H7N7 pandemic in the future, underlining the urgent need for vaccine development against this virus. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we developed a recombinant vaccine by expressing the H7N7-HA protein on the surface of baculovirus (Bac-HA. The protective efficacy of the live Bac-HA vaccine construct was evaluated in a mouse model by challenging mice immunized intranasally (i.n. or subcutaneously (s.c. with high pathogenic mouse adapted H7N7 reassorted strain. Although s.c. injection of live Bac-HA induced higher specific IgG than i.n. immunization, the later resulted in an elevated neutralization titer. Interestingly, 100% protection from the lethal viral challenge was only observed for the mice immunized intranasally with live Bac-HA, whereas no protection was achieved in any other s.c. or i.n. immunized mice groups. In addition, we also observed higher mucosal IgA as well as increased IFN-γ and IL-4 responses in the splenocytes of the surviving mice coupled with a reduced viral titer and diminished histopathological signs in the lungs. CONCLUSION: Our results indicated that protection from high pathogenic H7N7 (NL/219/03 virus requires both mucosal and systemic immune responses in mice. The balance between Th1 and Th2 cytokines is also required for the protection against the H7N7 pathogen. Intranasal administration of live Bac-HA induced all these immune responses and protected the mice from lethal viral challenge. Therefore, live Bac-HA is an effective vaccine candidate against H7N7 viral infections.

  1. Effect of psychological intervention in the form of relaxation and guided imagery on cellular immune function in normal healthy subjects. An overview

    DEFF Research Database (Denmark)

    Zachariae, R; Kristensen, J S; Hokland, P

    1991-01-01

    The present study measured the effects of relaxation and guided imagery on cellular immune function. During a period of 10 days 10 healthy subjects were given one 1-hour relaxation procedure and one combined relaxation and guided imagery procedure, instructing the subjects to imagine their immune...... on the immune defense and could form the basis of further studies on psychological intervention and immunological status. Udgivelsesdato: 1990-null...

  2. EFSA NDA Panel (EFSA Panel on Dietetic Products, Nutrition and Allergies), 2014 . Scientific Opinion on the substantiation of a health claim related to zinc and normal function of the immune system pursuant to Article 14 of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    substantiation of a health claim related to zinc and normal function of the immune system. The food constituent, zinc, which is the subject of the health claim is sufficiently characterised. Normal function of the immune system is a beneficial physiological effect for infants and young children. A claim on zinc...... and function of the immune system in the general population has already been assessed with a favourable outcome. The Panel considers that the role of zinc in normal function of the immune system applies to all ages, including infants and young children (from birth to three years). The Panel concludes...... that a cause and effect relationship has been established between the dietary intake of zinc and normal function of the immune system. The following wording reflects the scientific evidence: “zinc contributes to normal function of the immune system”....

  3. Metabolic Symbiosis and Immunomodulation: How Tumor Cell-Derived Lactate May Disturb Innate and Adaptive Immune Responses

    Directory of Open Access Journals (Sweden)

    Alexandre Morrot

    2018-03-01

    Full Text Available The tumor microenvironment (TME is composed by cellular and non-cellular components. Examples include the following: (i bone marrow-derived inflammatory cells, (ii fibroblasts, (iii blood vessels, (iv immune cells, and (v extracellular matrix components. In most cases, this combination of components may result in an inhospitable environment, in which a significant retrenchment in nutrients and oxygen considerably disturbs cell metabolism. Cancer cells are characterized by an enhanced uptake and utilization of glucose, a phenomenon described by Otto Warburg over 90 years ago. One of the main products of this reprogrammed cell metabolism is lactate. “Lactagenic” or lactate-producing cancer cells are characterized by their immunomodulatory properties, since lactate, the end product of the aerobic glycolysis, besides acting as an inducer of cellular signaling phenomena to influence cellular fate, might also play a role as an immunosuppressive metabolite. Over the last 10 years, it has been well accepted that in the TME, the lactate secreted by transformed cells is able to compromise the function and/or assembly of an effective immune response against tumors. Herein, we will discuss recent advances regarding the deleterious effect of high concentrations of lactate on the tumor-infiltrating immune cells, which might characterize an innovative way of understanding the tumor-immune privilege.

  4. Let's tie the knot : Marriage of complement and adaptive immunity in pathogen evasion, for better or worse

    NARCIS (Netherlands)

    Bennett, Kaila M.; Rooijakkers, Suzan H.M.; Gorham, Ronald D.

    2017-01-01

    The complement system is typically regarded as an effector arm of innate immunity, leading to recognition and killing of microbial invaders in body fluids. Consequently, pathogens have engaged in an arms race, evolving molecules that can interfere with proper complement responses. However,

  5. Splenectomy inhibits non-small cell lung cancer growth by modulating anti-tumor adaptive and innate immune response

    Science.gov (United States)

    Levy, Liran; Mishalian, Inbal; Bayuch, Rachel; Zolotarov, Lida; Michaeli, Janna; Fridlender, Zvi G

    2015-01-01

    It has been shown that inhibitors of the immune system reside in the spleen and inhibit the endogenous antitumor effects of the immune system. We hypothesized that splenectomy would inhibit the growth of relatively large non-small lung cancer (NSCLC) tumors by modulating the systemic inhibition of the immune system, and in particular Myeloid Derived Suppressor Cells (MDSC). The effect of splenectomy was evaluated in several murine lung cancer models. We found that splenectomy reduces tumor growth and the development of lung metastases, but only in advanced tumors. In immune-deficient NOD-SCID mice the effect of splenectomy on tumor growth and metastatic spread disappeared. Splenectomy significantly reduced the presence of MDSC, and especially monocytic-MDSC in the circulation and inside the tumor. Specific reduction of the CCR2+ subset of monocytic MDSC was demonstrated, and the importance of the CCL2-CCR2 axis was further shown by a marked reduction in CCL2 following splenectomy. These changes were followed by changes in the macrophages contents of the tumors to become more antitumorigenic, and by increased activation of CD8+ Cytotoxic T-cells (CTL). By MDSC depletion, and adoptive transfer of MDSCs, we demonstrated that the effect of splenectomy on tumor growth was substantially mediated by MDSC cells. We conclude that the spleen is an important contributor to tumor growth and metastases, and that splenectomy can blunt this effect by depletion of MDSC, changing the amount and characteristics of myeloid cells and enhancing activation of CTL. PMID:26137413

  6. The Carbomer-Lecithin Adjuvant Adjuplex Has Potent Immunoactivating Properties and Elicits Protective Adaptive Immunity against Influenza Virus Challenge in Mice

    Science.gov (United States)

    Wegmann, Frank; Moghaddam, Amin E.; Schiffner, Torben; Gartlan, Kate H.; Powell, Timothy J.; Russell, Rebecca A.; Baart, Matthijs; Carrow, Emily W.

    2015-01-01

    The continued discovery and development of adjuvants for vaccine formulation are important to safely increase potency and/or reduce the antigen doses of existing vaccines and tailor the adaptive immune response to newly developed vaccines. Adjuplex is a novel adjuvant platform based on a purified lecithin and carbomer homopolymer. Here, we analyzed the adjuvant activity of Adjuplex in mice for the soluble hemagglutinin (HA) glycoprotein of influenza A virus. The titration of Adjuplex revealed an optimal dose of 1% for immunogenicity, eliciting high titers of HA-specific IgG but inducing no significant weight loss. At this dose, Adjuplex completely protected mice from an otherwise lethal influenza virus challenge and was at least as effective as the adjuvants monophosphoryl lipid A (MPL) and alum in preventing disease. Adjuplex elicited balanced Th1-/Th2-type immune responses with accompanying cytokines and triggered antigen-specific CD8+ T-cell proliferation. The use of the peritoneal inflammation model revealed that Adjuplex recruited dendritic cells (DCs), monocytes, and neutrophils in the context of innate cytokine and chemokine secretion. Adjuplex neither triggered classical maturation of DCs nor activated a pathogen recognition receptor (PRR)-expressing NF-κB reporter cell line, suggesting a mechanism of action different from that reported for classical pathogen-associated molecular pattern (PAMP)-activated innate immunity. Taken together, these data reveal Adjuplex to be a potent and well-tolerated adjuvant with application for subunit vaccines. PMID:26135973

  7. The microRNA miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by targeting interferon-γ.

    Science.gov (United States)

    Ma, Feng; Xu, Sheng; Liu, Xingguang; Zhang, Qian; Xu, Xiongfei; Liu, Mofang; Hua, Minmin; Li, Nan; Yao, Hangping; Cao, Xuetao

    2011-07-24

    Interferon-γ (IFN-γ) has a critical role in immune responses to intracellular bacterial infection. MicroRNAs (miRNAs) are important in the regulation of innate and adaptive immunity. However, whether miRNAs can directly target IFN-γ and regulate IFN-γ production post-transcriptionally remains unknown. Here we show that infection of mice with Listeria monocytogenes or Mycobacterium bovis bacillus Calmette-Guérin (BCG) downregulated miR-29 expression in IFN-γ-producing natural killer cells, CD4(+) T cells and CD8(+) T cells. Moreover, miR-29 suppressed IFN-γ production by directly targeting IFN-γ mRNA. We developed mice with transgenic expression of a 'sponge' target to compete with endogenous miR-29 targets (GS29 mice). We found higher serum concentrations of IFN-γ and lower L. monocytogenes burdens in L. monocytogenes-infected GS29 mice than in their littermates. GS29 mice had enhanced T helper type 1 (T(H)1) responses and greater resistance to infection with BCG or Mycobacterium tuberculosis. Therefore, miR-29 suppresses immune responses to intracellular pathogens by targeting IFN-γ.

  8. Adaptive Immunity against Streptococcus pyogenes in Adults Involves Increased IFN-gamma and IgG3 Responses Compared with Children

    DEFF Research Database (Denmark)

    Mortensen, Rasmus; Nissen, Thomas Norrelykke; Blauenfeldt, Thomas

    2015-01-01

    Each year, millions of people are infected with Streptococcus pyogenes, leading to an estimated 500,000 annual deaths worldwide. For unknown reasons, school-aged children have substantially higher infection rates than adults. The goal for this study was to provide, to our knowledge, the first det...... cellular memory response in combination with IgG1/IgG3-dominated humoral immunity that increase with age. The significance of these data regarding both the increased GAS infection rate in children and the development of protective GAS vaccines is discussed.......Each year, millions of people are infected with Streptococcus pyogenes, leading to an estimated 500,000 annual deaths worldwide. For unknown reasons, school-aged children have substantially higher infection rates than adults. The goal for this study was to provide, to our knowledge, the first...... detailed characterization of the human adaptive immune response against S. pyogenes in both children and adults. We report that all adults in our study, as well as most children, showed immunity against the two conserved group A streptococci (GAS) Ags, streptococcal C5a peptidase and immunogenic secreted...

  9. Patient-dependent count-rate adaptive normalization for PET detector efficiency with delayed-window coincidence events

    International Nuclear Information System (INIS)

    Niu, Xiaofeng; Ye, Hongwei; Xia, Ting; Asma, Evren; Gagnon, Daniel; Wang, Wenli; Winkler, Mark

    2015-01-01

    Quantitative PET imaging is widely used in clinical diagnosis in oncology and neuroimaging. Accurate normalization correction for the efficiency of each line-of- response is essential for accurate quantitative PET image reconstruction. In this paper, we propose a normalization calibration method by using the delayed-window coincidence events from the scanning phantom or patient. The proposed method could dramatically reduce the ‘ring’ artifacts caused by mismatched system count-rates between the calibration and phantom/patient datasets. Moreover, a modified algorithm for mean detector efficiency estimation is proposed, which could generate crystal efficiency maps with more uniform variance. Both phantom and real patient datasets are used for evaluation. The results show that the proposed method could lead to better uniformity in reconstructed images by removing ring artifacts, and more uniform axial variance profiles, especially around the axial edge slices of the scanner. The proposed method also has the potential benefit to simplify the normalization calibration procedure, since the calibration can be performed using the on-the-fly acquired delayed-window dataset. (paper)

  10. A lower dose threshold for the in vivo protective adaptive response to radiation. Tumorigenesis in chronically exposed normal and Trp53 heterozygous C57BL/6 mice

    International Nuclear Information System (INIS)

    Mitchel, R.E.J.; Burchart, P.; Wyatt, H.

    2008-01-01

    Low doses of ionizing radiation to cells and animals may induce adaptive responses that reduce the risk of cancer. However, there are upper dose thresholds above which these protective adaptive responses do not occur. We have now tested the hypothesis that there are similar lower dose thresholds that must be exceeded in order to induce protective effects in vivo. We examined the effects of low dose/low dose rate fractionated exposures on cancer formation in Trp53 normal or cancer-prone Trp53 heterozygous female C57BL/6 mice. Beginning at 6 weeks of age, mice were exposed 5 days/week to single daily doses (0.33 mGy, 0.7 mGy/h) totaling 48, 97 or 146 mGy over 30, 60 or 90 weeks. The exposures for shorter times (up to 60 weeks) appeared to be below the level necessary to induce overall protective adaptive responses in Trp53 normal mice, and detrimental effects (shortened lifespan, increased frequency) evident for only specific tumor types (B- and T-cell lymphomas), were produced. Only when the exposures were continued for 90 weeks did the dose become sufficient to induce protective adaptive responses, balancing the detrimental effects for these specific cancers, and reducing the risk level back to that of the unexposed animals. Detrimental effects were not seen for other tumor types, and a protective effect was seen for sarcomas after 60 weeks of exposure, which was then lost when the exposure continued for 90 weeks. As previously shown for the upper dose threshold for protection by low doses, the lower dose boundary between protection and harm was influenced by Trp53 functionality. Neither protection nor harm was observed in exposed Trp53 heterozygous mice, indicating that reduced Trp53 function raises the lower dose/dose rate threshold for both detrimental and protective tumorigenic effects. (author)

  11. Time-course investigation of infection with a low virulent Pasteurella multocida strain in normal and immune-suppressed 12-week-old free-range chickens

    DEFF Research Database (Denmark)

    Mbuthia, P.G.; Njagi, L.W.; Nyaga, P.N.

    2011-01-01

    Twelve-week-old indigenous chickens, either immune-suppressed using dexamethasone (IS) or non-immune-suppressed (NIS), were challenged with a low virulent strain, Pasteurella multocida strain NCTC 10322(T), and developed clinical signs and pathological lesions typical of chronic fowl cholera. NIS...

  12. Alternative Immune Systems

    Directory of Open Access Journals (Sweden)

    Luis Fernando Cadavid Gutierrez

    2011-09-01

    Full Text Available The immune system in animals is a complex network of molecules, cells and tissues that coordinately maintain the physiological and genetic integrity of the organism. Traditionally, two classes of immunity have been considered, the innate immunity and the adaptive immunity. The former is ancestral, with limited variability and low discrimination. The latter is highly variable, specific and limited to jawed vertebrates. Adaptive immunity is based on antigen receptors that rearrange somatically to generate a nearly unlimited diversity of molecules. Likely, this mechanism of somatic recombination arose as a consequence of a horizontal transfer of transposons and transposases from bacterial genomes in the ancestor of jawed vertebrates. The recent discovery in jawless vertebrates and invertebrates of alternative adaptive immune mechanisms, suggests during evolution different animal groups have found alternative solutions to the problem of immune recognition.

  13. EFSA NDA Panel (EFSA Panel on Dietetic Products, Nutrition and Allergies), 2015. Scientific Opinion on the substantiation of a health claim related to vitamin D and contribution to the normal function of the immune system pursuant to Article 14 of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    2015-01-01

    on the scientific substantiation of a health claim related to vitamin D and contribution to the normal function of the immune system. The Panel considers that vitamin D is sufficiently characterised. Contribution to the normal function of the immune system is a beneficial physiological effect for children....... The Panel had previously assessed a claim on vitamin D and contribution to the normal function of the immune system with a favourable outcome. The target population was the general population. The Panel considered that vitamin D plays a regulatory role in the functioning of the immune system. The Panel...... considers that the role of vitamin D in the functioning of the immune system applies to all ages, including children. The Panel concludes that a cause and effect relationship has been established between the dietary intake of vitamin D and contribution to the normal function of the immune system...

  14. Growth performance, innate immune responses and disease resistance of fingerling blunt snout bream, Megalobrama amblycephala adapted to different berberine-dietary feeding modes.

    Science.gov (United States)

    Xu, Wei-Na; Chen, Dan-Hong; Chen, Qing-Qing; Liu, Wen-Bin

    2017-09-01

    A 8-week feeding trial was conducted to evaluate the effect of different berberine-dietary feeding modes on growth, non-specific immune responses and disease resistance of blunt snout bream, Megalobrama amblycephala. Fish (average initial weight 4.70 ± 0.02 g) were fed two fat levels (5% and 10%) diets in three berberine-feeding modes (supplementing 50 mg/kg berberine continuously, two-week or four-week intervals) with four replicates, respectively. Then, fish were challenged by Aeromonas hydrophila and mortality was recorded for the next 96 h after feeding trial. The results showed that different feeding modes of berberine significantly influenced growth, innate immunity and antioxidant capability of fish. Fish fed normal diet with 50 mg/kg berberine at two-week interval mode reflected remarkably (P complement component 3 (C3) and complement component 4 (C4) concentrations were significantly (P feeding modes. Based on fish healthy improvement and feeding cost saving, blunt snout bream fed normal diet with 50 mg/kg berberine at two-week interval or fed high-fat diet with berberine at two-week or four-week intervals were optimal feeding mode, respectively. Copyright © 2017. Published by Elsevier Ltd.

  15. Socio-cultural adaptation and standardization of Dubois' five words testing in a population of normal subject in Mali, West Africa.

    Science.gov (United States)

    Guinto, Cheick O; Coulibaly, Toumany; Koné, Zeinab; Coulibaly, Souleymane; Maiga, Boubacar; Dembélé, Kekouta; Cissé, Lassana; Konaté, Mamadou; Coulibaly, Thomas; Sissoko, Adama S; Karambé, Mamadou; Burnett, Barrington; Landouré, Guida; Traoré, Moussa

    2016-06-01

    Dubois' five words testing (5WT) is a verbal memory test that depends on many parameters. The aim of this study is to adapt Dubois' 5WT to the Malian socio-cultural conditions to (i) determine performances of normal subjects to the 5WT and (ii) provide reference scores of the 5WT. A sample of 276 normal subjects aged ≥ 50 years (154 males and 122 females; 144 literates and 132 illiterates) were enrolled from February 2008 to January 2009. Subjects with a history of symptoms likely to modify cognitive functions and those who were found disabled under Lawton's four simplified item test were excluded. The learning score in illiterates was 1.51 in Dubois' 5WT and 4.90 in the modified 5WT. The mean value of the modified 5WT total score was 9.71. Majority (90.22%) of the subjects scored the maximum (10). The modified 5WT reduced with both the age (p culture and the socio-educative level in French. Its adaptation to the socio-cultural context could prove useful and efficient in countries with a low literacy rate and a diverse cultural background.

  16. Innate and Adaptive Immune Response to Pneumonia Virus of Mice in a Resistant and a Susceptible Mouse Strain

    Directory of Open Access Journals (Sweden)

    Ellen R. T. Watkiss

    2013-01-01

    Full Text Available Respiratory syncytial virus (RSV is the leading cause of infant bronchiolitis. The closely related pneumonia virus of mice (PVM causes a similar immune-mediated disease in mice, which allows an analysis of host factors that lead to severe illness. This project was designed to compare the immune responses to lethal and sublethal doses of PVM strain 15 in Balb/c and C57Bl/6 mice. Balb/c mice responded to PVM infection with an earlier and stronger innate response that failed to control viral replication. Production of inflammatory cyto- and chemokines, as well as infiltration of neutrophils and IFN-γ secreting natural killer cells into the lungs, was more predominant in Balb/c mice. In contrast, C57Bl/6 mice were capable of suppressing both viral replication and innate inflammatory responses. After a sublethal infection, PVM-induced IFN-γ production by splenocytes was stronger early during infection and weaker at late time points in C57Bl/6 mice when compared to Balb/c mice. Furthermore, although the IgG levels were similar and the mucosal IgA titres lower, the virus neutralizing antibody titres were higher in C57Bl/6 mice than in Balb/c mice. Overall, the difference in susceptibility of these two strains appeared to be related not to an inherent T helper bias, but to the capacity of the C57Bl/6 mice to control both viral replication and the immune response elicited by PVM.

  17. Innate-like CD4 T cells selected by thymocytes suppress adaptive immune responses against bacterial infections

    OpenAIRE

    Qiao, Yu; Gray, Brian M.; Sofi, Mohammed H.; Bauler, Laura D.; Eaton, Kathryn A.; O'Riordan, Mary X. D.; Chang, Cheong-Hee

    2011-01-01

    We have reported a new innate-like CD4 T cell population that expresses cell surface makers of effector/memory cells and produce Th1 and Th2 cytokines immediately upon activation. Unlike conventional CD4 T cells that are selected by thymic epithelial cells, these CD4 T cells, named T-CD4 T cells, are selected by MHC class II expressing thymocytes. Previously, we showed that the presence of T-CD4 T cells protected mice from airway inflammation suggesting an immune regulatory role of T-CD4 T ce...

  18. Radiation dose response of normal lung assessed by Cone Beam CT - A potential tool for biologically adaptive radiation therapy

    International Nuclear Information System (INIS)

    Bertelsen, Anders; Schytte, Tine; Bentzen, Soren M.; Hansen, Olfred; Nielsen, Morten; Brink, Carsten

    2011-01-01

    Background: Density changes of healthy lung tissue during radiotherapy as observed by Cone Beam CT (CBCT) might be an early indicator of patient specific lung toxicity. This study investigates the time course of CBCT density changes and tests for a possible correlation with locally delivered dose. Methods: A total of 665 CBCTs in 65 lung cancer patients treated with IMRT/VMAT to 60 or 66 Gy in 2 Gy fractions were analyzed. For each patient, CBCT lung density changes during the treatment course were related to the locally delivered dose. Results: A dose response is observed for the patient population at the end of the treatment course. However, the observed dose response is highly variable among patients. Density changes at 10th and 20th fraction are clearly correlated to those observed at the end of the treatment course. Conclusions: CBCT density changes in healthy lung tissue during radiotherapy correlate with the locally delivered dose and can be detected relatively early during the treatment. If these density changes are correlated to subsequent clinical toxicity this assay could form the basis for biological adaptive radiotherapy.

  19. Characterization of main cytokine sources from the innate and adaptive immune responses following primary 17DD yellow fever vaccination in adults.

    Science.gov (United States)

    Silva, Maria Luiza; Martins, Marina Angela; Espírito-Santo, Luçandra Ramos; Campi-Azevedo, Ana Carolina; Silveira-Lemos, Denise; Ribeiro, José Geraldo Leite; Homma, Akira; Kroon, Erna Geessien; Teixeira-Carvalho, Andréa; Elói-Santos, Silvana Maria; Martins-Filho, Olindo Assis

    2011-01-10

    The mechanisms of immune response following yellow fever (YF-17DD) vaccination are still poorly understood. In this study, we have performed a longitudinal investigation (days 0, 7, 15 and 30) to characterize the cytokine profile of innate and adaptive immunity following YF-17DD first-time vaccination. Data from non-stimulated cultures demonstrated a prominent participation of the innate immunity with increased frequency of TNF-α(+) neutrophils and IFN-γ(+) NK-cells at day 7 besides TNF-α(+) monocytes at day 7, day 15 and day 30. Increased frequency of IL-10(+) monocytes was observed at day 15 and day 30, and decreased percentage of IL-4(+) NK-cells were detected at day 7, day 15 and day 30. Time-dependent and oscillating cytokine pattern was observed in CD4(+) T-cells, with low percentage of IL-12(+), IL-4(+) and IL-10(+) cells at day 7 and increased frequency of TNF-α(+) cells at day 15 besides IFN-γ(+) and IL-5(+) cells at day 15 and day 30. Later changes with increased percentage of IL-12(+) and IL-5(+)CD8(+) T-cells were observed at day 30. Increased frequency of IL-10(+) B-cells was observed at day 15, when seroconversion was detected in all vaccinees. The overall cytokine analysis of non-stimulated leukocytes showed a transient shift towards a pro-inflammatory profile at day 7, mainly due to changes in the innate immunity, which draws back toward a mixed/regulatory pattern at day 15 and day 30. The changes induced by the in vitro YF-17DD vaccine-stimulation were mainly observed at day 0 and day 7 (before seroconversion) with minor changes at day 15 and day 30 (after seroconversion). These data support the hypothesis that a complex network with mixed pro/anti-inflammatory cytokine profile is associated with the establishment of the protective immunity following YF-17DD primo-vaccination, free of adverse events. Copyright © 2010 Elsevier Ltd. All rights reserved.

  20. GYF-21, an Epoxide 2-(2-Phenethyl-Chromone Derivative, Suppresses Innate and Adaptive Immunity via Inhibiting STAT1/3 and NF-κB Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Ran Guo

    2017-05-01

    Full Text Available Multiple sclerosis is a chronic inflammatory autoimmune disease of the central nervous system characterized by demyelinating plaques and axonal loss. Inhibition on over activation of innate and adaptive immunity provides a rationale strategy for treatment of multiple sclerosis. In the present study, we investigated the inhibitory effects of GYF-21, an epoxide 2-(2-phenethyl-chromone derivative isolated from Chinese agarwood, on innate and adaptive immunity for revealing its potential to treat multiple sclerosis. The results showed that GYF-21 markedly inhibited the activation of microglia, and dendritic cells as well as neutrophils, all of which play important roles in innate immunity. Furthermore, GYF-21 significantly suppressed adaptive immunity via inhibiting the differentiation of naive CD4+ T cells into T helper 1 (Th1 and T helper 17 (Th17 cells, and suppressing the activation, proliferation, and IFN-γ secretion of CD8+ T cells. The mechanism study showed that GYF-21 evidently inhibited the activation of STAT1/3 and NF-κB signaling pathways in microglia. In conclusion, we demonstrated that GYF-21 can significantly inhibit innate and adaptive immunity via suppressing STAT1/3 and NF-κB signaling pathways, and has potential to be developed into therapeutic drug for multiple sclerosis.

  1. Less-than-expected weight loss in normal-weight women undergoing caloric restriction and exercise is accompanied by preservation of fat-free mass and metabolic adaptations.

    Science.gov (United States)

    Koehler, K; De Souza, M J; Williams, N I

    2017-03-01

    Normal-weight women frequently restrict their caloric intake and exercise, but little is known about the effects on body weight, body composition and metabolic adaptations in this population. We conducted a secondary analysis of data from a randomized controlled trial in sedentary normal-weight women. Women were assigned to a severe energy deficit (SEV: -1062±80 kcal per day; n=9), a moderate energy deficit (MOD: -633±71 kcal per day; n=7) or energy balance (BAL; n=9) while exercising five times per week for 3 months. Outcome variables included changes in body weight, body composition, resting metabolic rate (RMR) and metabolic hormones associated with energy conservation. Weight loss occurred in SEV (-3.7±0.9 kg, P0.33). RMR decreased by -6±2% in MOD (P=0.020). In SEV, RMR did not change on a group level (P=0.66), but participants whose RMR declined lost more weight (P=0.020) and had a higher baseline RMR (P=0.026) than those whose RMR did not decrease. Characteristic changes in leptin (P=0.003), tri-iodothyronine (P=0.013), insulin-like growth factor-1 (P=0.016) and ghrelin (P=0.049) occurred only in SEV. The energy deficit and adaptive changes in RMR explained 54% of the observed weight loss. In normal-weight women, caloric restriction and exercise resulted in less-than-predicted weight loss. In contrast to previous literature, weight loss consisted almost exclusively of fat mass, whereas fat-free mass was preserved.

  2. Maternal Adaptive Immune Cells in Decidua Parietalis Display a More Activated and Coinhibitory Phenotype Compared to Decidua Basalis

    Directory of Open Access Journals (Sweden)

    Martin Solders

    2017-01-01

    Full Text Available The maternal part of the placenta, the decidua, consists of maternal immune cells, decidual stromal cells, and extravillous fetal trophoblasts. In a successful pregnancy, these cell compartments interact to provide an intricate balance between fetal tolerance and antimicrobial defense. These processes are still poorly characterized in the two anatomically different decidual tissues, basalis and parietalis. We examined immune cells from decidua basalis and parietalis from term placentas (n=15 with flow cytometry. By using multivariate discriminant analysis, we found a clear separation between the two decidual compartments based on the 81 investigated parameters. Decidua parietalis lymphocytes displayed a more activated phenotype with a higher expression of coinhibitory markers than those isolated from basalis and contained higher frequencies of T regulatory cells. Decidua basalis contained higher proportions of monocytes, B cells, and mucosal-associated invariant T (MAIT cells. The basalis B cells were more immature, and parietalis MAIT cells showed a more activated phenotype. Conventional T cells, NK cells, and MAIT cells from both compartments potently responded with the production of interferon-γ and/or cytotoxic molecules in response to stimulation. To conclude, leukocytes in decidua basalis and parietalis displayed remarkable phenotypic disparities, indicating that the corresponding stromal microenvironments provide different immunoregulatory signals.

  3. Adaptation of Candida albicans to environmental pH induces cell wall remodelling and enhances innate immune recognition.

    Directory of Open Access Journals (Sweden)

    Sarah L Sherrington

    2017-05-01

    Full Text Available Candida albicans is able to proliferate in environments that vary dramatically in ambient pH, a trait required for colonising niches such as the stomach, vaginal mucosal and the GI tract. Here we show that growth in acidic environments involves cell wall remodelling which results in enhanced chitin and β-glucan exposure at the cell wall periphery. Unmasking of the underlying immuno-stimulatory β-glucan in acidic environments enhanced innate immune recognition of C. albicans by macrophages and neutrophils, and induced a stronger proinflammatory cytokine response, driven through the C-type lectin-like receptor, Dectin-1. This enhanced inflammatory response resulted in significant recruitment of neutrophils in an intraperitoneal model of infection, a hallmark of symptomatic vaginal colonisation. Enhanced chitin exposure resulted from reduced expression of the cell wall chitinase Cht2, via a Bcr1-Rim101 dependent signalling cascade, while increased β-glucan exposure was regulated via a non-canonical signalling pathway. We propose that this "unmasking" of the cell wall may induce non-protective hyper activation of the immune system during growth in acidic niches, and may attribute to symptomatic vaginal infection.

  4. Adaptation of Candida albicans to environmental pH induces cell wall remodelling and enhances innate immune recognition

    Science.gov (United States)

    Sorsby, Eleanor; Mahtey, Nabeel; Brown, Ian

    2017-01-01

    Candida albicans is able to proliferate in environments that vary dramatically in ambient pH, a trait required for colonising niches such as the stomach, vaginal mucosal and the GI tract. Here we show that growth in acidic environments involves cell wall remodelling which results in enhanced chitin and β-glucan exposure at the cell wall periphery. Unmasking of the underlying immuno-stimulatory β-glucan in acidic environments enhanced innate immune recognition of C. albicans by macrophages and neutrophils, and induced a stronger proinflammatory cytokine response, driven through the C-type lectin-like receptor, Dectin-1. This enhanced inflammatory response resulted in significant recruitment of neutrophils in an intraperitoneal model of infection, a hallmark of symptomatic vaginal colonisation. Enhanced chitin exposure resulted from reduced expression of the cell wall chitinase Cht2, via a Bcr1-Rim101 dependent signalling cascade, while increased β-glucan exposure was regulated via a non-canonical signalling pathway. We propose that this “unmasking” of the cell wall may induce non-protective hyper activation of the immune system during growth in acidic niches, and may attribute to symptomatic vaginal infection. PMID:28542528

  5. Segmentation of Planar Surfaces from Laser Scanning Data Using the Magnitude of Normal Position Vector for Adaptive Neighborhoods.

    Science.gov (United States)

    Kim, Changjae; Habib, Ayman; Pyeon, Muwook; Kwon, Goo-rak; Jung, Jaehoon; Heo, Joon

    2016-01-22

    Diverse approaches to laser point segmentation have been proposed since the emergence of the laser scanning system. Most of these segmentation techniques, however, suffer from limitations such as sensitivity to the choice of seed points, lack of consideration of the spatial relationships among points, and inefficient performance. In an effort to overcome these drawbacks, this paper proposes a segmentation methodology that: (1) reduces the dimensions of the attribute space; (2) considers the attribute similarity and the proximity of the laser point simultaneously; and (3) works well with both airborne and terrestrial laser scanning data. A neighborhood definition based on the shape of the surface increases the homogeneity of the laser point attributes. The magnitude of the normal position vector is used as an attribute for reducing the dimension of the accumulator array. The experimental results demonstrate, through both qualitative and quantitative evaluations, the outcomes' high level of reliability. The proposed segmentation algorithm provided 96.89% overall correctness, 95.84% completeness, a 0.25 m overall mean value of centroid difference, and less than 1° of angle difference. The performance of the proposed approach was also verified with a large dataset and compared with other approaches. Additionally, the evaluation of the sensitivity of the thresholds was carried out. In summary, this paper proposes a robust and efficient segmentation methodology for abstraction of an enormous number of laser points into plane information.

  6. Segmentation of Planar Surfaces from Laser Scanning Data Using the Magnitude of Normal Position Vector for Adaptive Neighborhoods

    Directory of Open Access Journals (Sweden)

    Changjae Kim

    2016-01-01

    Full Text Available Diverse approaches to laser point segmentation have been proposed since the emergence of the laser scanning system. Most of these segmentation techniques, however, suffer from limitations such as sensitivity to the choice of seed points, lack of consideration of the spatial relationships among points, and inefficient performance. In an effort to overcome these drawbacks, this paper proposes a segmentation methodology that: (1 reduces the dimensions of the attribute space; (2 considers the attribute similarity and the proximity of the laser point simultaneously; and (3 works well with both airborne and terrestrial laser scanning data. A neighborhood definition based on the shape of the surface increases the homogeneity of the laser point attributes. The magnitude of the normal position vector is used as an attribute for reducing the dimension of the accumulator array. The experimental results demonstrate, through both qualitative and quantitative evaluations, the outcomes’ high level of reliability. The proposed segmentation algorithm provided 96.89% overall correctness, 95.84% completeness, a 0.25 m overall mean value of centroid difference, and less than 1° of angle difference. The performance of the proposed approach was also verified with a large dataset and compared with other approaches. Additionally, the evaluation of the sensitivity of the thresholds was carried out. In summary, this paper proposes a robust and efficient segmentation methodology for abstraction of an enormous number of laser points into plane information.

  7. Host transcriptomic responses to pneumonic plague reveal that Yersinia pestis inhibits both the initial adaptive and innate immune responses in mice.

    Science.gov (United States)

    Yang, Huiying; Wang, Tong; Tian, Guang; Zhang, Qingwen; Wu, Xiaohong; Xin, Youqian; Yan, Yanfeng; Tan, Yafang; Cao, Shiyang; Liu, Wanbing; Cui, Yujun; Yang, Ruifu; Du, Zongmin

    2017-01-01

    Pneumonic plague is the most deadly form of infection caused by Yersinia pestis and can progress extremely fast. However, our understanding on the host transcriptomic response to pneumonic plague is insufficient. Here, we used RNA-sequencing technology to analyze transcriptomic responses in mice infected with fully virulent strain 201 or EV76, a live attenuated vaccine strain lacking the pigmentation locus. Approximately 600 differentially expressed genes (DEGs) were detected in lungs from both 201- and EV76-infected mice at 12h post-infection (hpi). DEGs in lungs of 201-infected mice exceeded 2000 at 48hpi, accompanied by sustained large numbers of DEGs in the liver and spleen; however, limited numbers of DEGs were detected in those organs of EV-infected mice. Remarkably, DEGs in lungs were significantly enriched in critical immune responses pathways in EV76-infected but not 201-infected mice, including antigen processing and presentation, T cell receptor signaling among others. Pathological and bacterial load analyses confirmed the rapid systemic dissemination of 201-infection and the confined EV76-infection in lungs. Our results suggest that fully virulent Y. pestis inhibits both the innate and adaptive immune responses that are substantially stimulated in a self-limited infection, which update our holistic views on the transcriptomic response to pneumonic plague. Copyright © 2016 Elsevier GmbH. All rights reserved.

  8. Yersinia enterocolitica targets cells of the innate and adaptive immune system by injection of Yops in a mouse infection model.

    Directory of Open Access Journals (Sweden)

    Martin Köberle

    2009-08-01

    Full Text Available Yersinia enterocolitica (Ye evades the immune system of the host by injection of Yersinia outer proteins (Yops via a type three secretion system into host cells. In this study, a reporter system comprising a YopE-beta-lactamase hybrid protein and a fluorescent staining sensitive to beta-lactamase cleavage was used to track Yop injection in cell culture and in an experimental Ye mouse infection model. Experiments with GD25, GD25-beta1A, and HeLa cells demonstrated that beta1-integrins and RhoGTPases play a role for Yop injection. As demonstrated by infection of splenocyte suspensions in vitro, injection of Yops appears to occur randomly into all types of leukocytes. In contrast, upon infection of mice, Yop injection was detected in 13% of F4/80(+, 11% of CD11c(+, 7% of CD49b(+, 5% of Gr1(+ cells, 2.3% of CD19(+, and 2.6% of CD3(+ cells. Taking the different abundance of these cell types in the spleen into account, the highest total number of Yop-injected cells represents B cells, particularly CD19(+CD21(+CD23(+ follicular B cells, followed by neutrophils, dendritic cells, and macrophages, suggesting a distinct cellular tropism of Ye. Yop-injected B cells displayed a significantly increased expression of CD69 compared to non-Yop-injected B cells, indicating activation of these cells by Ye. Infection of IFN-gammaR (receptor- and TNFRp55-deficient mice resulted in increased numbers of Yop-injected spleen cells for yet unknown reasons. The YopE-beta-lactamase hybrid protein reporter system provides new insights into the modulation of host cell and immune responses by Ye Yops.

  9. Major Histocompatibilty Complex-Restricted Adaptive Immune Responses to CT26 Colon Cancer Cell Line in Mixed Allogeneic Chimera.

    Science.gov (United States)

    Lee, K W; Choi, B; Kim, Y M; Cho, C W; Park, H; Moon, J I; Choi, G-S; Park, J B; Kim, S J

    2017-06-01

    Although the induction of mixed allogeneic chimera shows promising clinical tolerance results in organ transplantation, its clinical relevance as an anti-cancer therapy is yet unknown. We introduced a mixed allogenic chimera setting with the use of a murine colon cancer cell line, CT26, by performing double bone marrow transplantation. We analyzed donor- and recipient-restricted anti-cancer T-cell responses, and phenotypes of subpopulations of T cells. The protocol involves challenging 1 × 10 5 cells of CT26 cells intra-hepatically on day 50 after bone marrow transplantation, and, by use of CT26 lysates and an H-2L d -restricted AH1 pentamer, flow cytometric analysis was performed to detect the generation of cancer-specific CD4 + and CD8 + T cells at various time points. We found that immunocompetence against tumors depends heavily on cancer-specific CD8 + T-cell responses in a major histocompatibility complex-restricted manner; the evidence was further supported by the increase of interferon-γ-secreting CD4 + T cells. Moreover, we demonstrated that during the effector immune response to CT26 cancer challenge, there was a presence of central memory cells (CD62L hi CCR7 + ) as well as effector memory cells (CD62L lo CCR7 - ). Moreover, mixed allogeneic chimeras (BALB/c to C56BL/6 or vice versa) showed similar or heightened immune responses to CT26 cells compared with that of wild-type mice. Our results suggest that the responses of primary immunocompetency and of pre-existing memory T cells against allogeneic cancer are sustained and preserved long-term in a mixed allogeneic chimeric environment. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Innate and adaptive immune response to chronic pulmonary infection of hyphae of Aspergillus fumigatus in a new murine model.

    Science.gov (United States)

    Wang, Fengyuan; Zhang, Caiyun; Jiang, Yuan; Kou, Caixia; Kong, Qingtao; Long, Nanbiao; Lu, Ling; Sang, Hong

    2017-10-01

    The pathogenesis of chronic pulmonary aspergillosis (CPA) has seldom been studied due partly to a lack of animal models. Since hypha is the main morphology colonizing the airway in CPA, it's critical to study the immune reaction to chronic pulmonary infection of hyphae of Aspergillus fumigatus, which also has seldom been studied in vivo before. We established a novel murine model of chronic pulmonary infection of hyphae by challenging immunocompetent mice with tightly-structured hyphae balls intratracheally, and described the ensuing immunoreaction to hyphae and conidia, and the pathogenesis of CPA. Our experiment proved that the hyphae balls could induce a chronic pulmonary infection for 28 days with a considerable recrudescence at day 28 post-infection. Lungs infected with hyphae balls were remarkable for the many neutrophils and macrophages that flooded into airway lumens, with peribronchiolar infiltration of leukocytes. There was a transient increase of Th2 cells and Th17 cells at day 7 post-infection in the lung tissue. In contrast, lungs infected with conidia showed no peribronchiolar infiltration of leukocytes, but an influx of a great number of macrophages, and a much less number of neutrophils in the lumen. Besides, conidia activated the co-response of Th1, Th2 and Th17 cells with an increase of Treg cells in the lung tissue (quite different from most previous studies). We established a new murine model of chronic infection of hyphae to mimic the formation of CPA, and provide a new marker for different immune responses to hyphae and conidia.

  11. Thiol dependent NF-κB suppression and inhibition of T-cell mediated adaptive immune responses by a naturally occurring steroidal lactone Withaferin A

    Energy Technology Data Exchange (ETDEWEB)

    Gambhir, Lokesh; Checker, Rahul; Sharma, Deepak; Thoh, M. [Radiation Biology & Health Sciences Division, Bio-science Group, Bhabha Atomic Research Centre, Mumbai (India); Patil, Anand [Advanced Centre for Treatment Research and Education in Cancer, Kharghar, Navi Mumbai (India); Degani, M. [Institute of Chemical Technology, Matunga, Mumbai (India); Gota, Vikram [Advanced Centre for Treatment Research and Education in Cancer, Kharghar, Navi Mumbai (India); Sandur, Santosh K., E-mail: sskumar@barc.gov.in [Radiation Biology & Health Sciences Division, Bio-science Group, Bhabha Atomic Research Centre, Mumbai (India)

    2015-12-01

    Withaferin A (WA), a steroidal lactone isolated from ayurvedic medicinal plant Withania somnifera, was shown to inhibit tumor growth by inducing oxidative stress and suppressing NF-κB pathway. However, its effect on T-cell mediated adaptive immune responses and the underlying mechanism has not been investigated. Since both T-cell responses and NF-κB pathway are known to be redox sensitive, the present study was undertaken to elucidate the effect of WA on adaptive immune responses in vitro and in vivo. WA inhibited mitogen induced T-cell and B-cell proliferation in vitro without inducing any cell death. It inhibited upregulation of T-cell (CD25, CD69, CD71 and CD54) and B-cell (CD80, CD86 and MHC-II) activation markers and secretion of Th1 and Th2 cytokines. WA induced oxidative stress by increasing the basal ROS levels and the immunosuppressive effects of WA were abrogated only by thiol anti-oxidants. The redox modulatory effects of WA in T-cells were attributed to its ability to directly interact with free thiols. WA inhibited NF-κB nuclear translocation in lymphocytes and prevented the direct binding of nuclear NF-κB to its consensus sequence. MALDI-TOF analysis using a synthetic NF-κB-p50 peptide containing Cys-62 residue suggested that WA can modify the cysteine residue of NF-κB. The pharmacokinetic studies for WA were also carried out and in vivo efficacy of WA was studied using mouse model of Graft-versus-host disease. In conclusion, WA is a potent inhibitor of T-cell responses and acts via a novel thiol dependent mechanism and inhibition of NF-κB pathway. - Highlights:: • Withaferin A (WA) inhibited T-cell and B-cell mediated immune responses. • WA increased basal ROS levels in lymphocytes. • WA directly interacted with GSH as studied using spectrophotometry and HPLC. • WA inhibited NF-κB nuclear translocation and binding of nuclear NF-κB to DNA. • WA inhibited induction of the graft-versus-host disease in mice.

  12. A pox on thee! Manipulation of the host immune system by myxoma virus and implications for viral-host co-adaptation.

    Science.gov (United States)

    Zúñiga, Martha C

    2002-09-01

    The poxviruses have evolved a diverse array of proteins which serve to subvert innate and adaptive host responses that abort or at least limit viral infections. Myxoma virus and its rabbit host are considered to represent an ideal poxvirus-host system in which to study the effects of these immunomodulatory proteins. Studies of laboratory rabbits (Oryctolagus cuniculus) infected with gene knockout variants of myxoma virus have provided compelling evidence that several myxoma virus gene products contribute to the pathogenic condition known as myxomatosis. However, myxomatosis, which is characterized by skin lesions, systemic immunosuppression, and a high mortality rate, does not occur in the virus' natural South American host, Sylvilogus brasiliensis. Moreover, in Australia where myxoma virus was willfully introduced to control populations of O. cuniculus, myxomatosis-resistant rabbits emerged within a year of myxoma virus introduction into the field. In this review I discuss the characterized immunomodulatory proteins of myxoma virus, their biochemical properties, their pathogenic effects in laboratory rabbits, the role of the host immune system in the susceptibility or resistance to myxomatosis, and the evidence that immunomodulatory genes may have been attenuated during the co-adaptation of myxoma virus and O. cuniculus in Australia.

  13. Effects of helium and air inhalation on the innate and early adaptive immune system in healthy volunteers ex vivo

    Directory of Open Access Journals (Sweden)

    Oei Gezina TML

    2012-09-01

    Full Text Available Abstract Background Helium inhalation protects myocardium, brain and endothelium against ischemia/reperfusion injury in animals and humans, when applied according to specific “conditioning” protocols. Before widespread use of this “conditioning” agent in clinical practice, negative side effects have to be ruled out. We investigated the effect of prolonged helium inhalation on the responsiveness of the human immune response in whole blood ex vivo. Methods Male healthy volunteers inhaled 30 minutes heliox (79%He/21%O2 or air in a cross over design, with two weeks between measurements. Blood was withdrawn at T0 (baseline, T1 (25 min inhalation and T2-T5 (1, 2, 6, 24 h after inhalation and incubated with lipopolysaccharide (LPS, lipoteichoic acid (LTA, T-cell stimuli anti-CD3/ anti-CD28 (TCS or RPMI (as control for 2, 4 and 24 hours or not incubated (0 h. An additional group of six volunteers inhaled 60 minutes of heliox or air, followed by blood incubation with LPS and RPMI. Tumor necrosis factor-α (TNF-α, interleukin-1β (IL-1β, interleukin-6 (IL-6, interleukin-8 (IL-8, interferon-γ (IFN-γ and interleukin-2 (IL-2 was analyzed by cytometric bead array. Statistical analysis was performed by the Wilcoxon test for matched samples. Results Incubation with LPS, LTA or TCS significantly increased TNF-α, IL-1β, IL-6, IL-8, IFN-γ and IL-2 in comparison to incubation with RPMI alone. Thirty min of helium inhalation did not influence the amounts of TNF-α, IL-1β, IL-6, IL-8, IFN-γ and IL-2 in comparison to air. Sixty min of helium inhalation did not affect cytokine production after LPS stimulation. Conclusions We conclude that 79% helium inhalation does not affect the responsiveness of the human immune system in healthy volunteers. Trial registration Dutch Trial Register: http://www.trialregister.nl/ NTR2152

  14. Administration of Rhodiola kirilowii Extracts during Mouse Pregnancy and Lactation Stimulates Innate but Not Adaptive Immunity of the Offspring

    Directory of Open Access Journals (Sweden)

    Sławomir Lewicki

    2017-01-01

    Full Text Available The use of antibiotics during pregnancy and lactation is associated with an increased risk of developmental disorders. One of the natural medicinal plants—Rhodiola kirilowii, widely used as an immunostimulant in adults—might be a good alternative to antibiotic treatment. The aim of present study was to assess whether daily oral administration of 20 mg/kg of Rhodiola kirilowii aqueous (RKW or 50% hydroalcoholic (RKW-A extracts affected hematological and immunological parameters of 6-week-old mouse progeny. There was no significant change in hematological parameters of blood with the exception of hemoglobin, which was significantly higher (about 4% in RKW group. Offspring of mothers fed Rhodiola kirilowii extracts had increased percentage of granulocytes and decreased percentage of lymphocytes. These changes correlated with decreased percentage of CD3+/CD4+ T-cells (RKW and RKW-A, decrease of CD8+ cells, and increase percentage of NK cells in RKW group. In addition, both types of Rhodiola kirilowii extracts stimulated granulocyte phagocytosis and increased level of respiratory burst. In conclusion, the long-term supplementation of mouse mothers during pregnancy and lactation with RKW or RKW-A extracts affects the immune system of their progeny. These results should be taken into consideration before administration of Rhodiola kirilowii to pregnant and lactating women.

  15. CD11c-positive cells from brain, spleen, lung, and liver exhibit site-specific immune phenotypes and plastically adapt to new environments.

    Science.gov (United States)

    Immig, Kerstin; Gericke, Martin; Menzel, Franziska; Merz, Felicitas; Krueger, Martin; Schiefenhövel, Fridtjof; Lösche, Andreas; Jäger, Kathrin; Hanisch, Uwe-Karsten; Biber, Knut; Bechmann, Ingo

    2015-04-01

    The brain's immune privilege has been also attributed to the lack of dendritic cells (DC) within its parenchyma and the adjacent meninges, an assumption, which implies maintenance of antigens rather than their presentation in lymphoid organs. Using mice transcribing the green fluorescent protein under the promoter of the DC marker CD11c (itgax), we identified a juxtavascular population of cells expressing this DC marker and demonstrated their origin from bone marrow and local microglia. We now phenotypically compared this population with CD11c/CD45 double-positive cells from lung, liver, and spleen in healthy mice using seven-color flow cytometry. We identified unique, site-specific expression patterns of F4/80, CD80, CD86, CX3CR1, CCR2, FLT3, CD103, and MHC-II. Furthermore, we observed the two known CD45-positive populations (CD45(high) and CD45(int) ) in the brain, whereas liver, lung, and spleen exhibited a homogeneous CD45(high) population. CD11c-positive microglia lacked MHC-II expression and CD45(high) /CD11c-positive cells from the brain have a lower percentage of MHC-II-positive cells. To test whether phenotypical differences are fixed by origin or specifically develop due to environmental factors, we transplanted brain and spleen mononuclear cells on organotypic slice cultures from brain (OHSC) and spleen (OSSC). We demonstrate that adaption and ramification of MHC-II-positive splenocytes is paralleled by down-regulation of MHC-II, whereas brain-derived mononuclear cells neither ramified nor up-regulated MHC-II in OSSCs. Thus, brain-derived mononuclear cells maintain their MHC-II-negative phenotype within the environment of an immune organ. Intraparenchymal CD11c-positive cells share immunophenotypical characteristics of DCs from other organs but remain unique for their low MHC-II expression. © 2014 Wiley Periodicals, Inc.

  16. CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

    Science.gov (United States)

    Jung, Myung-Hwa; Jung, Sung-Ju

    2017-10-01

    Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. The Integrated Impact of Diet on Human Immune Response, the Gut Microbiota, and Nutritional Status During Adaptation to a Spaceflight Analog

    Science.gov (United States)

    Douglas, G. L.; Zwart, S. R.; Young, M.; Kloeris, V.; Crucian, B.; Smith, S. M.; Lorenzi, H.

    2018-01-01

    Spaceflight impacts human physiology, including well documented immune system dysregulation. Diet, immune function, and the microbiome are interlinked, but diet is the only one of these factors that we have the ability to easily, and significantly, alter on Earth or during flight. As we understand dietary impacts on physiology more thoroughly, we may then improve the spaceflight diet to improve crew health and potentially reduce spaceflight-associated physiological alterations. It is expected that increasing the consumption of fruits and vegetables and bioactive compounds (e.g., omega-3 fatty acids, lycopene, flavonoids) and therefore enhancing overall nutritional intake from the nominal shelf-stable, fully-processed space food system could serve as a countermeasure to improve human immunological profiles, the taxonomic profile of the gut microbiota, and nutritional status, especially where currently dysregulated during spaceflight. This interdisciplinary study will determine the effect of the current shelf-stable spaceflight diet compared to an "enhanced" shelf-stable spaceflight diet (25% more foods rich in omega-3 fatty acids, lycopene, flavonoids, and more fruits, and vegetables in general). The NASA Human Exploration Research Analog (HERA) 2017 missions, consisting of four 45-day missions with closed chamber confinement and realistic mission simulation in a high-fidelity mock space vehicle, will serve as a platform to replicate mission stressors and the effects on crew biochemistry, immunology, and the gut microbiome. Bio sampling of crewmembers is scheduled for selected intervals pre- and in-mission. Data collection also includes dietary intake recording. Outcome measures will include immune markers (e.g., peripheral leukocyte distribution, inflammatory cytokine profiles, T cell function), the taxonomic and metatranscriptomic profile of the gut microbiome, and nutritional status biomarkers and metabolites. Statistical evaluations will determine physiological

  18. Roles of Zinc Signaling in the Immune System.

    Science.gov (United States)

    Hojyo, Shintaro; Fukada, Toshiyuki

    2016-01-01

    Zinc (Zn) is an essential micronutrient for basic cell activities such as cell growth, differentiation, and survival. Zn deficiency depresses both innate and adaptive immune responses. However, the precise physiological mechanisms of the Zn-mediated regulation of the immune system have been largely unclear. Zn homeostasis is tightly controlled by the coordinated activity of Zn transporters and metallothioneins, which regulate the transport, distribution, and storage of Zn. There is growing evidence that Zn behaves like a signaling molecule, facilitating the transduction of a variety of signaling cascades in response to extracellular stimuli. In this review, we highlight the emerging functional roles of Zn and Zn transporters in immunity, focusing on how crosstalk between Zn and immune-related signaling guides the normal development and function of immune cells.

  19. De novo assembly of the Indo-Pacific humpback dolphin leucocyte transcriptome to identify putative genes involved in the aquatic adaptation and immune response.

    Directory of Open Access Journals (Sweden)

    Duan Gui

    Full Text Available BACKGROUND: The Indo-Pacific humpback dolphin (Sousa chinensis, a marine mammal species inhabited in the waters of Southeast Asia, South Africa and Australia, has attracted much attention because of the dramatic decline in population size in the past decades, which raises the concern of extinction. So far, this species is poorly characterized at molecular level due to little sequence information available in public databases. Recent advances in large-scale RNA sequencing provide an efficient approach to generate abundant sequences for functional genomic analyses in the species with un-sequenced genomes. PRINCIPAL FINDINGS: We performed a de novo assembly of the Indo-Pacific humpback dolphin leucocyte transcriptome by Illumina sequencing. 108,751 high quality sequences from 47,840,388 paired-end reads were generated, and 48,868 and 46,587 unigenes were functionally annotated by BLAST search against the NCBI non-redundant and Swiss-Prot protein databases (E-value<10(-5, respectively. In total, 16,467 unigenes were clustered into 25 functional categories by searching against the COG database, and BLAST2GO search assigned 37,976 unigenes to 61 GO terms. In addition, 36,345 unigenes were grouped into 258 KEGG pathways. We also identified 9,906 simple sequence repeats and 3,681 putative single nucleotide polymorphisms as potential molecular markers in our assembled sequences. A large number of unigenes were predicted to be involved in immune response, and many genes were predicted to be relevant to adaptive evolution and cetacean-specific traits. CONCLUSION: This study represented the first transcriptome analysis of the Indo-Pacific humpback dolphin, an endangered species. The de novo transcriptome analysis of the unique transcripts will provide valuable sequence information for discovery of new genes, characterization of gene expression, investigation of various pathways and adaptive evolution, as well as identification of genetic markers.

  20. Variants at multiple loci implicated in both innate and adaptive immune responses are associated with Sjögren’s syndrome

    Science.gov (United States)

    Lessard, Christopher J.; Li, He; Adrianto, Indra; Ice, John A.; Rasmussen, Astrid; Grundahl, Kiely M.; Kelly, Jennifer A.; Dozmorov, Mikhail G.; Miceli-Richard, Corinne; Bowman, Simon; Lester, Sue; Eriksson, Per; Eloranta, Maija-Leena; Brun, Johan G.; Gøransson, Lasse G.; Harboe, Erna; Guthridge, Joel M.; Kaufman, Kenneth M.; Kvarnström, Marika; Jazebi, Helmi; Graham, Deborah S. Cunninghame; Grandits, Martha E.; Nazmul-Hossain, Abu N. M.; Patel, Ketan; Adler, Adam J.; Maier-Moore, Jacen S.; Farris, A. Darise; Brennan, Michael T.; Lessard, James A.; Chodosh, James; Gopalakrishnan, Rajaram; Hefner, Kimberly S.; Houston, Glen D.; Huang, Andrew J.W.; Hughes, Pamela J.; Lewis, David M.; Radfar, Lida; Rohrer, Michael D.; Stone, Donald U.; Wren, Jonathan D.; Vyse, Timothy J.; Gaffney, Patrick M.; James, Judith A.; Omdal, Roald; Wahren-Herlenius, Marie; Illei, Gabor G.; Witte, Torsten; Jonsson, Roland; Rischmueller, Maureen; Rönnblom, Lars; Nordmark, Gunnel; Ng, Wan-Fai; Mariette, Xavier; Anaya, Juan-Manuel; Rhodus, Nelson L.; Segal, Barbara M.; Scofield, R. Hal; Montgomery, Courtney G.; Harley, John B.; Sivils, Kathy L. Moser

    2013-01-01

    Sjögren’s syndrome is a common autoimmune disease (~0.7% of European Americans) typically presenting as keratoconjunctivitis sicca and xerostomia. In addition to strong association within the HLA region at 6p21 (Pmeta=7.65×10−114), we establish associations with IRF5-TNPO3 (Pmeta=2.73×10−19), STAT4 (Pmeta=6.80×10−15), IL12A (Pmeta =1.17×10−10), FAM167A-BLK (Pmeta=4.97×10−10), DDX6-CXCR5 (Pmeta=1.10×10−8), and TNIP1 (Pmeta=3.30×10−8). Suggestive associations with Pmeta<5×10−5 were observed with 29 regions including TNFAIP3, PTTG1, PRDM1, DGKQ, FCGR2A, IRAK1BP1, ITSN2, and PHIP amongst others. These results highlight the importance of genes involved in both innate and adaptive immunity in Sjögren’s syndrome. PMID:24097067

  1. EFSA NDA Panel (EFSA Panel on Dietetic Product s, Nutrition and Allergies), 2013 . Scientific Opinion on the substantiation of a health claim related to vitamin A and contribution to normal development and function of the immune system pursuant to Article 14 of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    of infants and young children (from birth to three years). The Panel concludes that a cause and effect relationship has been established between dietary intake of vitamin A and contribution to normal development and function of the immune system. The following wording reflects the scientific evidence......: “Vitamin A contributes to the normal function of the immune system”. The target population is infants and children up to three years. © European Food Safety Authority, 2013...

  2. Next-generation sequencing identifies deregulation of microRNAs involved in both innate and adaptive immune response in ALK+ ALCL.

    Directory of Open Access Journals (Sweden)

    Julia Steinhilber

    Full Text Available Anaplastic large cell lymphoma (ALCL is divided into two systemic diseases according to the expression of the anaplastic lymphoma kinase (ALK. We investigated the differential expression of miRNAs between ALK+ ALCL, ALK- ALCL cells and normal T-cells using next generation sequencing (NGS. In addition, a C/EBPβ-dependent miRNA profile was generated. The data were validated in primary ALCL cases. NGS identified 106 miRNAs significantly differentially expressed between ALK+ and ALK- ALCL and 228 between ALK+ ALCL and normal T-cells. We identified a signature of 56 miRNAs distinguishing ALK+ ALCL, ALK- ALCL and T-cells. The top candidates significant differentially expressed between ALK+ and ALK- ALCL included 5 upregulated miRNAs: miR-340, miR-203, miR-135b, miR-182, miR-183; and 7 downregulated: miR-196b, miR-155, miR-146a, miR-424, miR-503, miR-424*, miR-542-3p. The miR-17-92 cluster was also upregulated in ALK+ cells. Additionally, we identified a signature of 3 miRNAs significantly regulated by the transcription factor C/EBPβ, which is specifically overexpressed in ALK+ ALCL, including the miR-181 family. Of interest, miR-181a, which regulates T-cell differentiation and modulates TCR signalling strength, was significantly downregulated in ALK+ ALCL cases. In summary, our data reveal a miRNA signature linking ALK+ ALCL to a deregulated immune response and may reflect the abnormal TCR antigen expression known in ALK+ ALCL.

  3. Fermentation of non-sterilized fish biomass with a mixed culture of film-forming yeasts and lactobacilli and its effect on innate and adaptive immunity in mice.

    Science.gov (United States)

    Inoue, Shigeaki; Suzuki-Utsunomiya, Kyoko; Komori, Yukako; Kamijo, Akemi; Yumura, Isao; Tanabe, Koudai; Miyawaki, Ayumi; Koga, Kunimasa

    2013-12-01

    Non-sterilized fish waste containing fish bones was fermented using combined starter cultures of film-forming yeast (Candida ethanolica) and lactic acid bacteria (LAB; Lactobacillus casei and Lactobacillus rhamnosus) in order to obtain a liquefied fermented broth without spoiling. During the entire fermentation, the number of LAB cells was maintained at a high level (6 × 10(8)-5 × 10(7) cells/ml). Although the number of general bacteria was 10(6)cell/ml after adding non-sterilized fish biomass, its growth was suppressed to be 1-3 × 10(4) cells/ml. The entire biomass had completely liquefied and the fermented broth contained all 20 α-amino acids composed of protein and also various kinds of minerals in abundance. The weight of mice group fed the fermented broth content feed (sample feed) for 31 days significantly increased compared with that fed no broth feed (control feed) (21.37 g vs 20.76 g (p < 0.05). No abnormal behavior and appearance were observed. All internal organs (the heart, the liver, the lung, the intestines, and the spleen) of both groups were confirmed to be normal by visual observation. In peripheral blood, the percentages of NK cells and CD8+ T cells of the mice in the sample feed group increased significantly relative to those in the control feed group (NK cells: 19% vs 11%, CD8+ T cells: 9% vs 5%, p < 0.05). In the spleen, the percentage of NK cells in the sample feed group also increased significantly compared to that in the control feed group (p < 0.05). The fermented fish biomass is expected to be effective for innate and adaptive immunity and thus fit for animal feed. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  4. Distribution of intrahepatic T, NK and CD3(+)CD56(+)NKT cells alters after liver transplantation: Shift from innate to adaptive immunity?

    Science.gov (United States)

    Werner, Jens M; Lang, Corinna; Scherer, Marcus N; Farkas, Stefan A; Geissler, Edward K; Schlitt, Hans J; Hornung, Matthias

    2011-07-01

    The liver is an immunological organ containing a large number of T, NK and NKT cells, but little is known about intrahepatic immunity after LTx. Here, we investigated whether the distribution of T, NK and CD3(+)CD56(+)NKT cells is altered in transplanted livers under different circumstances. Core biopsies of transplanted livers were stained with antibodies against CD3 and CD56. Several cell populations including T (CD3(+)CD56(-)), NK (CD3(-)CD56(+)) and NKT cells (CD3(+)CD56(+)) were studied by fluorescence microscopy. Cell numbers were analyzed in relation to the time interval after LTx, immunosuppressive therapy and stage of acute graft rejection (measured with the rejection activity index: RAI) compared to tumor free liver tissue from patients after liver resection due to metastatic disease as control. Recruitment of CD3(+)CD56(+)NKT cells revealed a significant decrease during high RAI scores in comparison to low and middle RAI scores (RAI 7-9: 0.03±0.01/HPF vs. RAI 4-6: 0.1±0.005/HPF). CD3(+)CD56(+)NKT cells were also lower during immunosuppressive therapy with tacrolimus (0.03±0.01/HPF) than with cyclosporine (0.1±0.003/HPF), cyclosporine/MMF (0.1±0.003/HPF) or sirolimus (0.1±0.01/HPF) treatment. Intrahepatic T cell numbers increased significantly 50days after LTx compared to control liver tissue (4.5±0.2/HPF vs. 1.9±0.1/HPF). In contrast, NK cells (0.3±0.004/HPF) were significantly fewer in all biopsies after LTx compared to the control (0.7±0.04/HPF). These data indicate significant alterations in the hepatic recruitment of T, NK and CD3(+)CD56(+)NKT cells after LTx. The increase in T cells and the decrease in NK and CD3(+)CD56(+)NKT cells suggest a shift from innate to adaptive hepatic immunity in the liver graft. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Imbalanced immune homeostasis in immune thrombocytopenia.

    Science.gov (United States)

    Yazdanbakhsh, Karina

    2016-04-01

    Immune thrombocytopenia (ITP) is an autoimmune bleeding disorder resulting from low platelet counts caused by inadequate production as well as increased destruction by autoimmune mechanisms. As with other autoimmune disorders, chronic ITP is characterized by perturbations of immune homeostasis with hyperactivated effector cells as well as defective regulatory arm of the adaptive immune system, which will be reviewed here. Interestingly, some ITP treatments are associated with restoring the regulatory imbalance, although it remains unclear whether the immune system is redirected to a state of tolerance once treatment is discontinued. Understanding the mechanisms that result in breakdown of immune homeostasis in ITP will help to identify novel pathways for restoring tolerance and inhibiting effector cell responses. This information can then be translated into developing therapies for averting autoimmunity not only in ITP but also many autoimmune disorders. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Review: The Necessity of Producing/Normalizing Adaptive Behavior Scales in Diagnosing Training Treatment Rehabilitation of Peop e and Assessment of the Programs

    OpenAIRE

    Seyyed Jalal Sadrosadat; Leila Sadrosadat

    2000-01-01

    Adaptive behavior is defined as the manner in which people cope with the natural and social demands of their environments. Impairments in adaptive behavior are described as significant limitations in an individual's effectiveness in meeting the standards of maturation, learning, personal independence, and/or social responsibility that are expected for one's age level and cultural group, as determined by clinical assessment, and usually, standardized scales. The definitions of adaptive deficie...

  7. Pro-inflammatory cytokine/chemokine production by reovirus treated melanoma cells is PKR/NF-κB mediated and supports innate and adaptive anti-tumour immune priming

    Directory of Open Access Journals (Sweden)

    Coffey Matt

    2011-02-01

    Full Text Available Abstract Background As well as inducing direct oncolysis, reovirus treatment of melanoma is associated with activation of innate and adaptive anti-tumour immune responses. Results Here we characterise the effects of conditioned media from reovirus-infected, dying human melanoma cells (reoTCM, in the absence of live virus, to address the immune bystander potential of reovirus therapy. In addition to RANTES, IL-8, MIP-1α and MIP-1β, reovirus-infected melanoma cells secreted eotaxin, IP-10 and the type 1 interferon IFN-β. To address the mechanisms responsible for the inflammatory composition of reoTCM, we show that IL-8 and IFN-β secretion by reovirus-infected melanoma cells was associated with activation of NF-κB and decreased by pre-treatment with small molecule inhibitors of NF-κB and PKR; specific siRNA-mediated knockdown further confirmed a role for PKR. This pro-inflammatory milieu induced a chemotactic response in isolated natural killer (NK cells, dendritic cells (DC and anti-melanoma cytotoxic T cells (CTL. Following culture in reoTCM, NK cells upregulated CD69 expression and acquired greater lytic potential against tumour targets. Furthermore, melanoma cell-loaded DC cultured in reoTCM were more effective at priming adaptive anti-tumour immunity. Conclusions These data demonstrate that the PKR- and NF-κB-dependent induction of pro-inflammatory molecules that accompanies reovirus-mediated killing can recruit and activate innate and adaptive effector cells, thus potentially altering the tumour microenvironment to support bystander immune-mediated therapy as well as direct viral oncolysis.

  8. Modulation of immune cells and Th1/Th2 cytokines in insulin-treated ...

    African Journals Online (AJOL)

    and Th2 cytokines and the frequencies of innate and adaptive immunity cells .... As inclusion criteria, all participants were non- .... Ranges of normal values: Fasting glucose: 3.88-6.10 mM (0.7-1.10 g/L); .... of HbA1c, reflecting a poor control of diabetes37 and a .... rophage recruitment and adipose tissue inflammation in.

  9. Vitamin E, immunity, and infection

    Science.gov (United States)

    A normally functioning immune system is critical for the body to fight and eliminate invading pathogens from the environment. On the other hand, the immune system also protects the body from internal risks such as neoplasia growing within and autoimmune responses that attack self. The immune system ...

  10. Oral immune therapy: targeting the systemic immune system via the gut immune system for the treatment of inflammatory bowel disease.

    Science.gov (United States)

    Ilan, Yaron

    2016-01-01

    Inflammatory bowel diseases (IBD) are associated with an altered systemic immune response leading to inflammation-mediated damage to the gut and other organs. Oral immune therapy is a method of systemic immune modulation via alteration of the gut immune system. It uses the inherit ability of the innate system of the gut to redirect the systemic innate and adaptive immune responses. Oral immune therapy is an attractive clinical approach to treat autoimmune and inflammatory disorders. It can induce immune modulation without immune suppression, has minimal toxicity and is easily administered. Targeting the systemic immune system via the gut immune system can serve as an attractive novel therapeutic method for IBD. This review summarizes the current data and discusses several examples of oral immune therapeutic methods for using the gut immune system to generate signals to reset systemic immunity as a treatment for IBD.

  11. Characterization of recombinant B. abortus strain RB51SOD towards understanding the uncorrelated innate and adaptive immune responses induced by RB51SOD compared to its parent vaccine strain RB51

    Directory of Open Access Journals (Sweden)

    Jianguo eZhu

    2011-11-01

    Full Text Available Brucella abortus is a Gram-negative, facultative intracellular pathogen for several mammals, including humans. Live attenuated B. abortus strain RB51 is currently the official vaccine used against bovine brucellosis in the United States and several other countries. Overexpression of protective B. abortus antigen Cu/Zn superoxide dismutase (SOD in a recombinant strain of RB51 (strain RB51SOD significantly increases its vaccine efficacy against virulent B. abortus challenge in a mouse model. An attempt has been made to better understand the mechanism of the enhanced protective immunity of RB51SOD compared to its parent strain RB51. We previously reported that RB51SOD stimulated enhanced Th1 immune response. In this study, we further found that T effector cells derived from RB51SOD-immunized mice exhibited significantly higher cytotoxic T lymphocyte (CTL activity than T effector cells derived from RB51-immunized mice against virulent B. abortus-infected target cells. Meanwhile, the macrophage responses to these two strains were also studied. Compared to RB51, RB51SOD cells had a lower survival rate in macrophages and induced lower levels of macrophage apoptosis and necrosis. The decreased survival of RB51SOD cells correlates with the higher sensitivity of RB51SOD, compared to RB51, to the bactericidal action of either Polymyxin B or sodium dodecyl sulfate (SDS. Furthermore, a physical damage to the outer membrane of RB51SOD was observed by electron microscopy. Possibly due to the physical damage, overexpressed Cu/Zn SOD in RB51SOD was found to be released into the bacterial cell culture medium. Therefore, the stronger adaptive immunity induced by RB51SOD did not correlate with the low level of innate immunity induced by RB51SOD compared to RB51. This unique and apparently contradictory profile is likely associated with the differences in outer membrane integrity and Cu/Zn SOD release.

  12. Oncolytic Viral Therapy and the Immune System: A Double-Edged Sword Against Cancer.

    Science.gov (United States)

    Marelli, Giulia; Howells, Anwen; Lemoine, Nicholas R; Wang, Yaohe

    2018-01-01

    Oncolytic viral therapy is a new promising strategy against cancer. Oncolytic viruses (OVs) can replicate in cancer cells but not in normal cells, leading to lysis of the tumor mass. Beside this primary effect, OVs can also stimulate the immune system. Tumors are an immuno-suppressive environment in which the immune system is silenced in order to avoid the immune response against cancer cells. The delivery of OVs into the tumor wakes up the immune system so that it can facilitate a strong and durable response against the tumor itself. Both innate and adaptive immune responses contribute to this process, producing an immune response against tumor antigens and facilitating immunological memory. However, viruses are recognized by the immune system as pathogens and the consequent anti-viral response could represent a big hurdle for OVs. Finding a balance between anti-tumor and anti-viral immunity is, under this new light, a priority for researchers. In this review, we provide an overview of the various ways in which different components of the immune system can be allied with OVs. We have analyzed the different immune responses in order to highlight the new and promising perspectives leading to increased anti-tumor response and decreased immune reaction to the OVs.

  13. Immunity to Fish Rhabdoviruses

    OpenAIRE

    Purcell, Maureen K.; Laing, Kerry J.; Winton, James R.

    2012-01-01

    Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabd...

  14. Innate immune functions of microglia isolated from human glioma patients

    Directory of Open Access Journals (Sweden)

    Grimm Elizabeth

    2006-03-01

    Full Text Available Abstract Background Innate immunity is considered the first line of host defense and microglia presumably play a critical role in mediating potent innate immune responses to traumatic and infectious challenges in the human brain. Fundamental impairments of the adaptive immune system in glioma patients have been investigated; however, it is unknown whether microglia are capable of innate immunity and subsequent adaptive anti-tumor immune responses within the immunosuppressive tumor micro-environment of human glioma patients. We therefore undertook a novel characterization of the innate immune phenotype and function of freshly isolated human glioma-infiltrating microglia (GIM. Methods GIM were isolated by sequential Percoll purification from patient tumors immediately after surgical resection. Flow cytometry, phagocytosis and tumor cytotoxicity assays were used to analyze the phenotype and function of these cells. Results GIM expressed significant levels of Toll-like receptors (TLRs, however they do not secrete any of the cytokines (IL-1β, IL-6, TNF-α critical in developing effective innate immune responses. Similar to innate macrophage functions, GIM can mediate phagocytosis and non-MHC restricted cytotoxicity. However, they were statistically less able to mediate tumor cytotoxicity compared to microglia isolated from normal brain. In addition, the expression of Fas ligand (FasL was low to absent, indicating that apoptosis of the incoming lymphocyte population may not be a predominant mode of immunosuppression by microglia. Conclusion We show for the first time that despite the immunosuppressive environment of human gliomas, GIM are capable of innate immune responses such as phagocytosis, cytotoxicity and TLR expression but yet are not competent in secreting key cytokines. Further understanding of these innate immune functions could play a critical role in understanding and developing effective immunotherapies to malignant human gliomas.

  15. Relative Contribution of Th1 and Th17 Cells in Adaptive Immunity to Bordetella pertussis: Towards the Rational Design of an Improved Acellular Pertussis Vaccine

    Science.gov (United States)

    Ross, Pádraig J.; Allen, Aideen C.; Walsh, Kevin; Misiak, Alicja; Lavelle, Ed C.; McLoughlin, Rachel M.; Mills, Kingston H. G.

    2013-01-01

    Whooping cough caused by Bordetella pertussis is a re-emerging infectious disease despite the introduction of safer acellular pertussis vaccines (Pa). One explanation for this is that Pa are less protective than the more reactogenic whole cell pertussis vaccines (Pw) that they replaced. Although Pa induce potent antibody responses, and protection has been found to be associated with high concentrations of circulating IgG against vaccine antigens, it has not been firmly established that host protection induced with this vaccine is mediated solely by humoral immunity. The aim of this study was to examine the relative contribution of Th1 and Th17 cells in host immunity to infection with B. pertussis and in immunity induced by immunization with Pw and Pa and to use this information to help rationally design a more effective Pa. Our findings demonstrate that Th1 and Th17 both function in protective immunity induced by infection with B. pertussis or immunization with Pw. In contrast, a current licensed Pa, administered with alum as the adjuvant, induced Th2 and Th17 cells, but weak Th1 responses. We found that IL-1 signalling played a central role in protective immunity induced with alum-adsorbed Pa and this was associated with the induction of Th17 cells. Pa generated strong antibody and Th2 responses, but was fully protective in IL-4-defective mice, suggesting that Th2 cells were dispensable. In contrast, Pa failed to confer protective immunity in IL-17A-defective mice. Bacterial clearance mediated by Pa-induced Th17 cells was associated with cell recruitment to the lungs after challenge. Finally, protective immunity induced by an experimental Pa could be enhanced by substituting alum with a TLR agonist that induces Th1 cells. Our findings demonstrate that alum promotes protective immunity through IL-1β-induced IL-17A production, but also reveal that optimum protection against B. pertussis requires induction of Th1, but not Th2 cells. PMID:23592988

  16. Granulocyte-macrophage stimulating factor (GM-CSF increases circulating dendritic cells but does not abrogate suppression of adaptive cellular immunity in patients with metastatic colorectal cancer receiving chemotherapy

    Directory of Open Access Journals (Sweden)

    Martinez Micaela

    2012-01-01

    Full Text Available Abstract Background Advanced cancer and chemotherapy are both associated with immune system suppression. We initiated a clinical trial in patients receiving chemotherapy for metastatic colorectal cancer to determine if administration of GM-CSF in this setting was immunostimulatory. Methods Between June, 2003 and January, 2007, 20 patients were enrolled in a clinical trial (NCT00257322 in which they received 500 ug GM-CSF daily for 4 days starting 24 hours after each chemotherapy cycle. There were no toxicities or adverse events reported. Blood was obtained before chemotherapy/GM-CSF administration and 24 hours following the final dose of GM-CSF and evaluated for circulating dendritic cells and adaptive immune cellular subsets by flow cytometry. Peripheral blood mononuclear cell (PBMC expression of γ-interferon and T-bet transcription factor (Tbx21 by quantitative real-time PCR was performed as a measure of Th1 adaptive cellular immunity. Pre- and post-treatment (i.e., chemotherapy and GM-CSF samples were evaluable for 16 patients, ranging from 1 to 5 cycles (median 3 cycles, 6 biologic sample time points. Dendritic cells were defined as lineage (- and MHC class II high (+. Results 73% of patients had significant increases in circulating dendritic cells of ~3x for the overall group (5.8% to 13.6%, p = 0.02 and ~5x excluding non-responders (3.2% to 14.5%, p Tbx21 levels declined by 75% following each chemotherapy cycle despite administration of GM-CSF (p = 0.02. PBMC γ-interferon expression, however was unchanged. Conclusions This clinical trial confirms the suppressive effects of chemotherapy on Th1 cellular immunity in patients with metastatic colorectal cancer but demonstrates that mid-cycle administration of GM-CSF can significantly increase the proportion of circulating dendritic cells. As the role of dendritic cells in anti-tumor immunity becomes better defined, GM-CSF administration may provide a non-toxic intervention to augment this arm

  17. Genome-to-genome analysis highlights the impact of the human innate and adaptive immune systems on the hepatitis C virus

    Science.gov (United States)

    Ip, Camilla; Magri, Andrea; Von Delft, Annette; Bonsall, David; Chaturvedi, Nimisha; Bartha, Istvan; Smith, David; Nicholson, George; McVean, Gilean; Trebes, Amy; Piazza, Paolo; Fellay, Jacques; Cooke, Graham; Foster, Graham R; Hudson, Emma; McLauchlan, John; Simmonds, Peter; Bowden, Rory; Klenerman, Paul; Barnes, Eleanor; Spencer, Chris C. A.

    2018-01-01

    Outcomes of hepatitis C virus (HCV) infection and treatment depend on viral and host genetic factors. We use human genome-wide genotyping arrays and new whole-genome HCV viral sequencing technologies to perform a systematic genome-to-genome study of 542 individuals chronically infected with HCV, predominately genotype 3. We show that both HLA alleles and interferon lambda innate immune system genes drive viral genome polymorphism, and that IFNL4 genotypes determine HCV viral load through a mechanism that is dependent on a specific polymorphism in the HCV polyprotein. We highlight the interplay between innate immune responses and the viral genome in HCV control. PMID:28394351

  18. DMPD: Translational mini-review series on Toll-like receptors: networks regulated byToll-like receptors mediate innate and adaptive immunity. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17223959 Translational mini-review series on Toll-like receptors: networks regulate...ol. 2007 Feb;147(2):199-207. (.png) (.svg) (.html) (.csml) Show Translational mini-review series on Toll-lik... immunity. PubmedID 17223959 Title Translational mini-review series on Toll-like receptors: networks regulat

  19. Gene-environment interactions in multiple sclerosis: innate and adaptive immune responses to human endogenous retrovirus and herpesvirus antigens and the lectin complement activation pathway

    DEFF Research Database (Denmark)

    Christensen, Tove; Petersen, Thor; Thiel, Steffen

    2006-01-01

    -associated molecular pattern recognition: mannan-binding lectin (MBL), and MASP-2 and MASP-3. For representative MS families, we also determined herpesvirus serology for HSV-1, VZV, and EBV; and tissue typed for HLA-B, and HLA DR and DQ. In MS, a significant correlation between elevated immune reactivity to HERV-H Env...

  20. Gene-environment interactions in multiple sclerosis: Innate and adaptive immune responses to human endogenous retrovirus and herpesvirus antigens and the lectin complement activation pathway

    DEFF Research Database (Denmark)

    Christensen, Tove; Petersen, Thor; Thiel, Steffen

    2007-01-01

    -associated molecular pattern recognition: mannan-binding lectin (MBL), and MASP-2 and MASP-3. For representative MS families, we also determined herpesvirus serology for HSV-1, VZV, and EBV; and tissue typed for HLA-B, and HLA DR and DQ. In MS, a significant correlation between elevated immune reactivity to HERV-H Env...

  1. M2e-displaying virus-like particles with associated RNA promote T helper 1 type adaptive immunity against influenza A.

    Directory of Open Access Journals (Sweden)

    Lorena Itatí Ibañez

    Full Text Available The ectodomain of influenza A matrix protein 2 (M2e is a candidate for a universal influenza A vaccine. We used recombinant Hepatitis B core antigen to produce virus-like particles presenting M2e (M2e-VLPs. We produced the VLPs with and without entrapped nucleic acids and compared their immunogenicity and protective efficacy. Immunization of BALB/c mice with M2e-VLPs containing nucleic acids induced a stronger, Th1-biased antibody response compared to particles lacking nucleic acids. The former also induced a stronger M2e-specific CD4(+ T cell response, as determined by ELISPOT. Mice vaccinated with alum-adjuvanted M2e-VLPs containing the nucleic acid-binding domain were better protected against influenza A virus challenge than mice vaccinated with similar particles lacking this domain, as deduced from the loss in body weight following challenge with X47 (H3N2 or PR/8 virus. Challenge of mice that had been immunized with M2e-VLPs with or without nucleic acids displayed significantly lower mortality, morbidity and lung virus titers than control-immunized groups. We conclude that nucleic acids present in M2e-VLPs correlate with improved immune protection.

  2. Immune System Dysfunction in the Elderly.

    Science.gov (United States)

    Fuentes, Eduardo; Fuentes, Manuel; Alarcón, Marcelo; Palomo, Iván

    2017-01-01

    Human aging is characterized by both physical and physiological frailty that profoundly affects the immune system. In this context aging is associated with declines in adaptive and innate immunity established as immunosenescence. Immunosenescence is a new concept that reflects the age-associated restructuring changes of innate and adaptive immune functions. Thus elderly individuals usually present chronic low-level inflammation, higher infection rates and chronic diseases. A study of alterations in the immune system during aging could provide a potentially useful biomarker for the evaluation of immune senescence treatment. The immune system is the result of the interplay between innate and adaptive immunity, yet the impact of aging on this function is unclear. In this article the function of the immune system during aging is explored.

  3. Mammalian Gut Immunity

    Science.gov (United States)

    Chassaing, Benoit; Kumar, Manish; Baker, Mark T.; Singh, Vishal; Vijay-Kumar, Matam

    2016-01-01

    The mammalian intestinal tract is the largest immune organ in the body and comprises cells from non-hemopoietic (epithelia, Paneth cells, goblet cells) and hemopoietic (macrophages, dendritic cells, T-cells) origin, and is also a dwelling for trillions of microbes collectively known as the microbiota. The homeostasis of this large microbial biomass is prerequisite to maintain host health by maximizing beneficial symbiotic relationships and minimizing the risks of living in such close proximity. Both microbiota and host immune system communicate with each other to mutually maintain homeostasis in what could be called a “love–hate relationship.” Further, the host innate and adaptive immune arms of the immune system cooperate and compensate each other to maintain the equilibrium of a highly complex gut ecosystem in a stable and stringent fashion. Any imbalance due to innate or adaptive immune deficiency or aberrant immune response may lead to dysbiosis and low-grade to robust gut inflammation, finally resulting in metabolic diseases. PMID:25163502

  4. Immunity: Insect Immune Memory Goes Viral.

    Science.gov (United States)

    Ligoxygakis, Petros

    2017-11-20

    Adaptive memory in insect immunity has been controversial. In this issue, Andino and co-workers propose that acquisition of viral sequences in the host genome gives rise to anti-sense, anti-viral piRNAs. Such sequences can be regarded as both a genomic archive of past infections and as an armour of potential heritable memory. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Zinc Signals and Immunity.

    Science.gov (United States)

    Maywald, Martina; Wessels, Inga; Rink, Lothar

    2017-10-24

    Zinc homeostasis is crucial for an adequate function of the immune system. Zinc deficiency as well as zinc excess result in severe disturbances in immune cell numbers and activities, which can result in increased susceptibility to infections and development of especially inflammatory diseases. This review focuses on the role of zinc in regulating intracellular signaling pathways in innate as well as adaptive immune cells. Main underlying molecular mechanisms and targets affected by altered zinc homeostasis, including kinases, caspases, phosphatases, and phosphodiesterases, will be highlighted in this article. In addition, the interplay of zinc homeostasis and the redox metabolism in affecting intracellular signaling will be emphasized. Key signaling pathways will be described in detail for the different cell types of the immune system. In this, effects of fast zinc flux, taking place within a few seconds to minutes will be distinguish from slower types of zinc signals, also designated as "zinc waves", and late homeostatic zinc signals regarding prolonged changes in intracellular zinc.

  6. Increased Expression of Cytotoxic T-Lymphocyte-Associated Protein 4 by T Cells, Induced by B7 in Sera, Reduces Adaptive Immunity in Patients With Acute Liver Failure

    DEFF Research Database (Denmark)

    Khamri, Wafa; Abeles, Robin D; Hou, Tie Zheng

    2017-01-01

    , hepatic sinusoidal endothelial cells, and biliary epithelial cells from healthy or diseased liver tissues. We also measured levels of soluble B7 serum samples from patients and controls, and mice with acetaminophen-induced liver injury using enzyme-linked immunosorbent assays. RESULTS: Peripheral blood...... mice with acetaminophen-induced liver injury contained high levels of soluble B7 compared to sera from mice without liver injury. Plasma exchange reduced circulating levels of soluble B7 in patients with ALF and expression of CTLA4 on T cells. CONCLUSIONS: Peripheral CD4+ T cells from patients with ALF......BACKGROUND & AIMS: Patients with acute liver failure (ALF) have defects in innate immune responses to microbes (immune paresis) and are susceptible to sepsis. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4), which interacts with the membrane receptor B7 (also called CD80 and CD86...

  7. Genome-to-genome analysis highlights the effect of the human innate and adaptive immune systems on the hepatitis C virus.

    Science.gov (United States)

    Ansari, M Azim; Pedergnana, Vincent; L C Ip, Camilla; Magri, Andrea; Von Delft, Annette; Bonsall, David; Chaturvedi, Nimisha; Bartha, Istvan; Smith, David; Nicholson, George; McVean, Gilean; Trebes, Amy; Piazza, Paolo; Fellay, Jacques; Cooke, Graham; Foster, Graham R; Hudson, Emma; McLauchlan, John; Simmonds, Peter; Bowden, Rory; Klenerman, Paul; Barnes, Eleanor; Spencer, Chris C A

    2017-05-01

    Outcomes of hepatitis C virus (HCV) infection and treatment depend on viral and host genetic factors. Here we use human genome-wide genotyping arrays and new whole-genome HCV viral sequencing technologies to perform a systematic genome-to-genome study of 542 individuals who were chronically infected with HCV, predominantly genotype 3. We show that both alleles of genes encoding human leukocyte antigen molecules and genes encoding components of the interferon lambda innate immune system drive viral polymorphism. Additionally, we show that IFNL4 genotypes determine HCV viral load through a mechanism dependent on a specific amino acid residue in the HCV NS5A protein. These findings highlight the interplay between the innate immune system and the viral genome in HCV control.

  8. Predicting the Role of IL-10 in the Regulation of the Adaptive Immune Responses in Mycobacterium avium Subsp. paratuberculosis Infections Using Mathematical Models

    Science.gov (United States)

    Magombedze, Gesham; Eda, Shigetoshi; Stabel, Judy

    2015-01-01

    Mycobacterium avium subsp. paratuberculosis (MAP) is an intracellular bacterial pathogen that causes Johne’s disease (JD) in cattle and other animals. The hallmark of MAP infection in the early stages is a strong protective cell-mediated immune response (Th1-type), characterized by antigen-specific γ-interferon (IFN-γ). The Th1 response wanes with disease progression and is supplanted by a non-protective humoral immune response (Th2-type). Interleukin-10 (IL-10) is believed to play a critical role in the regulation of host immune responses to MAP infection and potentially orchestrate the reversal of Th1/Th2 immune dominance during disease progression. However, how its role correlates with MAP infection remains to be completely deciphered. We developed mathematical models to explain probable mechanisms for IL-10 involvement in MAP infection. We tested our models with IL-4, IL-10, IFN-γ, and MAP fecal shedding data collected from calves that were experimentally infected and followed over a period of 360 days in the study of Stabel and Robbe-Austerman (2011). Our models predicted that IL-10 can have different roles during MAP infection, (i) it can suppress the Th1 expression, (ii) can enhance Th2 (IL-4) expression, and (iii) can suppress the Th1 expression in synergy with IL-4. In these predicted roles, suppression of Th1 responses was correlated with increased number of MAP. We also predicted that Th1-mediated responses (IFN-γ) can lead to high expression of IL-10 and that infection burden regulates Th2 suppression by the Th1 response. Our models highlight areas where more experimental data is required to refine our model assumptions, and further test and investigate the role of IL-10 in MAP infection. PMID:26619346

  9. Predicting the Role of IL-10 in the Regulation of the Adaptive Immune Responses in Mycobacterium avium Subsp. paratuberculosis Infections Using Mathematical Models.

    Directory of Open Access Journals (Sweden)

    Gesham Magombedze

    Full Text Available Mycobacterium avium subsp. paratuberculosis (MAP is an intracellular bacterial pathogen that causes Johne's disease (JD in cattle and other animals. The hallmark of MAP infection in the early stages is a strong protective cell-mediated immune response (Th1-type, characterized by antigen-specific γ-interferon (IFN-γ. The Th1 response wanes with disease progression and is supplanted by a non-protective humoral immune response (Th2-type. Interleukin-10 (IL-10 is believed to play a critical role in the regulation of host immune responses to MAP infection and potentially orchestrate the reversal of Th1/Th2 immune dominance during disease progression. However, how its role correlates with MAP infection remains to be completely deciphered. We developed mathematical models to explain probable mechanisms for IL-10 involvement in MAP infection. We tested our models with IL-4, IL-10, IFN-γ, and MAP fecal shedding data collected from calves that were experimentally infected and followed over a period of 360 days in the study of Stabel and Robbe-Austerman (2011. Our models predicted that IL-10 can have different roles during MAP infection, (i it can suppress the Th1 expression, (ii can enhance Th2 (IL-4 expression, and (iii can suppress the Th1 expression in synergy with IL-4. In these predicted roles, suppression of Th1 responses was correlated with increased number of MAP. We also predicted that Th1-mediated responses (IFN-γ can lead to high expression of IL-10 and that infection burden regulates Th2 suppression by the Th1 response. Our models highlight areas where more experimental data is required to refine our model assumptions, and further test and investigate the role of IL-10 in MAP infection.

  10. Pseudoachondroplasia with immune deficiency

    International Nuclear Information System (INIS)

    Kultursay, N.; Taneli, B.; Cavusoglu, A.

    1988-01-01

    A 5-year old boy was admitted to the hospital with failure to thrive since he was 2 years old, with weakness in his legs and a waddling gait. He has normal mental development. His parents are normal phenotypically and are unrelated. In analysing his pedigree only a grandfather is described to have waddling gait. He has a normal craniofacial appearance but a disproportionate body with normal trunk and short extremities with height below the 3rd percentile. The diagnosis of pseudoachondroplasia was made on clinical, radiological and laboratory findings. He also had immune deficiency characterised by low T-lymphocyte populations and a low level of serum immunoglobulin A. (orig.)

  11. Cathelicidin-like helminth defence molecules (HDMs: absence of cytotoxic, anti-microbial and anti-protozoan activities imply a specific adaptation to immune modulation.

    Directory of Open Access Journals (Sweden)

    Karine Thivierge

    Full Text Available Host defence peptides (HDPs are expressed throughout the animal and plant kingdoms. They have multifunctional roles in the defence against infectious agents of mammals, possessing both bactericidal and immune-modulatory activities. We have identified a novel family of molecules secreted by helminth parasites (helminth defence molecules; HDMs that exhibit similar structural and biochemical characteristics to the HDPs. Here, we have analyzed the functional activities of four HDMs derived from Schistosoma mansoni and Fasciola hepatica and compared them to human, mouse, bovine and sheep HDPs. Unlike the mammalian HDPs the helminth-derived HDMs show no antimicrobial activity and are non-cytotoxic to mammalian cells (macrophages and red blood cells. However, both the mammalian- and helminth-derived peptides suppress the activation of macrophages by microbial stimuli and alter the response of B cells to cytokine stimulation. Therefore, we hypothesise that HDMs represent a novel family of HDPs that evolved to regulate the immune responses of their mammalian hosts by retaining potent immune modulatory properties without causing deleterious cytotoxic effects.

  12. Childhood Immunization

    Science.gov (United States)

    ... lowest levels in history, thanks to years of immunization. Children must get at least some vaccines before ... child provide protection for many years, adults need immunizations too. Centers for Disease Control and Prevention

  13. Immunizations - diabetes

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000331.htm Immunizations - diabetes To use the sharing features on this page, please enable JavaScript. Immunizations (vaccines or vaccinations) help protect you from some ...

  14. Immunization Coverage

    Science.gov (United States)

    ... room/fact-sheets/detail/immunization-coverage","@context":"http://schema.org","@type":"Article"}; العربية 中文 français русский español ... Plan Global Health Observatory (GHO) data - Immunization More information on vaccines and immunization News 1 in 10 ...

  15. Cellular immune responses to respiratory viruses

    NARCIS (Netherlands)

    van Helden, M.J.G.

    2011-01-01

    When a respiratory virus successfully infects the lungs, cascades of immune responses are initiated aimed to remove the pathogen. Immediate non-specific protection is provided by the innate immune system and this reduces the viral load during the first days of infection. The adaptive immune response

  16. Effects of ultraviolet radiation on the immune system in humans

    International Nuclear Information System (INIS)

    Morison, W.L.

    1989-01-01

    In experimental animals, exposure to UV-B radiation produces selective alterations of immune function which are mainly in the form of suppression of normal immune responses. This immune suppression is important in the development of nonmelanoma skin cancer, may influence the development and course of infectious disease and possibly protects against autoimmune reactions. The evidence that this form of immune suppression occurs in humans is less compelling and very incomplete. The wavelengths of radiation most affected by a depletion of the stratospheric ozone layer are those known to be most immunosuppressive in animals and it is likely that such depletion will increase any suppressive effect of sunlight on immunity in humans. In addition to establishing whether or not UV-B radiation can cause suppression of immune function in humans, studies are required to determine if melanin can provide protection against such suppression, the role of this suppression in the pathogenesis of skin cancer, the development of infectious disease and vaccine effectiveness, and the capacity for humans to develop adaptive, protective mechanisms which may limit damage from continued exposure to UV-B radiation. (author)

  17. Filoviral Immune Evasion Mechanisms

    Directory of Open Access Journals (Sweden)

    Christopher F. Basler

    2011-09-01

    Full Text Available The Filoviridae family of viruses, which includes the genera Ebolavirus (EBOV and Marburgvirus (MARV, causes severe and often times lethal hemorrhagic fever in humans. Filoviral infections are associated with ineffective innate antiviral responses as a result of virally encoded immune antagonists, which render the host incapable of mounting effective innate or adaptive immune responses. The Type I interferon (IFN response is critical for establishing an antiviral state in the host cell and subsequent activation of the adaptive immune responses. Several filoviral encoded components target Type I IFN responses, and this innate immune suppression is important for viral replication and pathogenesis. For example, EBOV VP35 inhibits the phosphorylation of IRF-3/7 by the TBK-1/IKKε kinases in addition to sequestering viral RNA from detection by RIG-I like receptors. MARV VP40 inhibits STAT1/2 phosphorylation by inhibiting the JAK family kinases. EBOV VP24 inhibits nuclear translocation of activated STAT1 by karyopherin-α. The examples also represent distinct mechanisms utilized by filoviral proteins in order to counter immune responses, which results in limited IFN-α/β production and downstream signaling.

  18. Immunizing Children

    Directory of Open Access Journals (Sweden)

    Geraldine Jody Macdonald

    2014-11-01

    Full Text Available This article addresses the complex contexts within which Canadian health professionals engage in immunizing children and focuses on the Canadian practice guidelines and current scientific evidence that direct Canadian health professional competencies. The article begins by presenting two current global vaccine initiatives and links these to immunization in Canada. A selected literature review identifies current best immunization practices. With the purpose of promoting quality improvement, three key Canadian immunization competencies for health professional are highlighted: communication with parents, including those who are experiencing vaccine hesitancy; administration of immunizing agents; and documentation of immunizations. Health professionals are encouraged to reflect on immunization competencies and ensure evidence-based practices underpin vaccine delivery in their primary care settings.

  19. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  20. A targeted and adjuvanted nanocarrier lowers the effective dose of liposomal amphotericin B and enhances adaptive immunity in murine cutaneous leishmaniasis.

    Science.gov (United States)

    Daftarian, Pirouz M; Stone, Geoffrey W; Kovalski, Leticia; Kumar, Manoj; Vosoughi, Aram; Urbieta, Maitee; Blackwelder, Pat; Dikici, Emre; Serafini, Paolo; Duffort, Stephanie; Boodoo, Richard; Rodríguez-Cortés, Alhelí; Lemmon, Vance; Deo, Sapna; Alberola, Jordi; Perez, Victor L; Daunert, Sylvia; Ager, Arba L

    2013-12-01

    Amphotericin B (AmB), the most effective drug against leishmaniasis, has serious toxicity. As Leishmania species are obligate intracellular parasites of antigen presenting cells (APC), an immunopotentiating APC-specific AmB nanocarrier would be ideally suited to reduce the drug dosage and regimen requirements in leishmaniasis treatment. Here, we report a nanocarrier that results in effective treatment shortening of cutaneous leishmaniasis in a mouse model, while also enhancing L. major specific T-cell immune responses in the infected host. We used a Pan-DR-binding epitope (PADRE)-derivatized-dendrimer (PDD), complexed with liposomal amphotericin B (LAmB) in an L. major mouse model and analyzed the therapeutic efficacy of low-dose PDD/LAmB vs full dose LAmB. PDD was shown to escort LAmB to APCs in vivo, enhanced the drug efficacy by 83% and drug APC targeting by 10-fold and significantly reduced parasite burden and toxicity. Fortuitously, the PDD immunopotentiating effect significantly enhanced parasite-specific T-cell responses in immunocompetent infected mice. PDD reduced the effective dose and toxicity of LAmB and resulted in elicitation of strong parasite specific T-cell responses. A reduced effective therapeutic dose was achieved by selective LAmB delivery to APC, bypassing bystander cells, reducing toxicity and inducing antiparasite immunity.

  1. Nubbin isoform antagonism governs Drosophila intestinal immune homeostasis.

    Directory of Open Access Journals (Sweden)

    Bo G Lindberg

    2018-03-01

    Full Text Available Gut immunity is regulated by intricate and dynamic mechanisms to ensure homeostasis despite a constantly changing microbial environment. Several regulatory factors have been described to participate in feedback responses to prevent aberrant immune activity. Little is, however, known about how transcriptional programs are directly tuned to efficiently adapt host gut tissues to the current microbiome. Here we show that the POU/Oct gene nubbin (nub encodes two transcription factor isoforms, Nub-PB and Nub-PD, which antagonistically regulate immune gene expression in Drosophila. Global transcriptional profiling of adult flies overexpressing Nub-PB in immunocompetent tissues revealed that this form is a strong transcriptional activator of a large set of immune genes. Further genetic analyses showed that Nub-PB is sufficient to drive expression both independently and in conjunction with nuclear factor kappa B (NF-κB, JNK and JAK/STAT pathways. Similar overexpression of Nub-PD did, conversely, repress expression of the same targets. Strikingly, isoform co-overexpression normalized immune gene transcription, suggesting antagonistic activities. RNAi-mediated knockdown of individual nub transcripts in enterocytes confirmed antagonistic regulation by the two isoforms and that both are necessary for normal immune gene transcription in the midgut. Furthermore, enterocyte-specific Nub-PB expression levels had a strong impact on gut bacterial load as well as host lifespan. Overexpression of Nub-PB enhanced bacterial clearance of ingested Erwinia carotovora carotovora 15. Nevertheless, flies quickly succumbed to the infection, suggesting a deleterious immune response. In line with this, prolonged overexpression promoted a proinflammatory signature in the gut with induction of JNK and JAK/STAT pathways, increased apoptosis and stem cell proliferation. These findings highlight a novel regulatory mechanism of host-microbe interactions mediated by antagonistic

  2. Immune mediated liver failure.

    Science.gov (United States)

    Wang, Xiaojing; Ning, Qin

    2014-01-01

    Liver failure is a clinical syndrome of various etiologies, manifesting as jaundice, encephalopathy, coagulopathy and circulatory dysfunction, which result in subsequent multiorgan failure. Clinically, liver failure is classified into four categories: acute, subacute, acute-on-chronic and chronic liver failure. Massive hepatocyte death is considered to be the core event in the development of liver failure, which occurs when the extent of hepatocyte death is beyond the liver regenerative capacity. Direct damage and immune-mediated liver injury are two major factors involved in this process. Increasing evidence has suggested the essential role of immune-mediated liver injury in the pathogenesis of liver failure. Here, we review the evolved concepts concerning the mechanisms of immune-mediated liver injury in liver failure from human and animal studies. Both innate and adaptive immunity, especially the interaction of various immune cells and molecules as well as death receptor signaling system are discussed. In addition, we highlight the concept of "immune coagulation", which has been shown to be related to the disease progression and liver injury exacerbation in HBV related acute-on-chronic liver failure.

  3. Immune-Neuroendocrine Interactions and Autoimmune Diseases

    Directory of Open Access Journals (Sweden)

    Luis J. Jara

    2006-01-01

    Full Text Available The relationship between immune-neuroendocrine system is firmly established. The messengers of this connection are hormones, neuropeptides, neurotransmitters and cytokines. The immune-neuroendocrine system have the capacity to synthesize and release these molecules, which, in turn, can stimulate or suppress the activity of immune or neuroendocrine cells by binding to receptors. In fact, hormones, neuropeptides and neurotransmitters participate in innate and adaptive immune response.

  4. Glatiramer Acetate in Treatment of Multiple Sclerosis: A Toolbox of Random Co-Polymers for Targeting Inflammatory Mechanisms of both the Innate and Adaptive Immune System?

    Directory of Open Access Journals (Sweden)

    Thomas Vorup-Jensen

    2012-11-01

    Full Text Available Multiple sclerosis is a disease of the central nervous system, resulting in the demyelination of neurons, causing mild to severe symptoms. Several anti-inflammatory treatments now play a significant role in ameliorating the disease. Glatiramer acetate (GA is a formulation of random polypeptide copolymers for the treatment of relapsing-remitting MS by limiting the frequency of attacks. While evidence suggests the influence of GA on inflammatory responses, the targeted molecular mechanisms remain poorly understood. Here, we review the multiple pharmacological modes-of-actions of glatiramer acetate in treatment of multiple sclerosis. We discuss in particular a newly discovered interaction between the leukocyte-expressed integrin αMβ2 (also called Mac-1, complement receptor 3, or CD11b/CD18 and perspectives on the GA co-polymers as an influence on the function of the innate immune system.

  5. Manganese-superoxide dismutase (MnSOD), a role player in seahorse (Hippocampus abdominalis) antioxidant defense system and adaptive immune system.

    Science.gov (United States)

    Perera, N C N; Godahewa, G I; Lee, Seongdo; Kim, Myoung-Jin; Hwang, Jee Youn; Kwon, Mun Gyeong; Hwang, Seong Don; Lee, Jehee

    2017-09-01

    Manganese superoxide dismutase (MnSOD) is a metaloenzyme that catalyzes dismutation of the hazardous superoxide radicals into less hazardous H 2 O 2 and H 2 O. Here, we identified a homolog of MnSOD from big belly seahorse (Hippocampus abdominalis; HaMnSOD) and characterized its structural and functional features. HaMnSOD transcript possessed an open reading frame (ORF) of 672 bp which codes for a peptide of 223 amino acids. Pairwise alignment showed that HaMnSOD shared highest identity with rock bream MnSOD. Results of the phylogenetic analysis of HaMnSOD revealed a close proximity with rock bream MnSOD which was consistent with the result of homology alignment. The intense expression of HaMnSOD was observed in the ovary, followed by the heart and the brain. Further, immune related responses of HaMnSOD towards pathogenic stimulation were observed through bacterial and viral challenges. Highest HaMnSOD expression in response to stimulants Edwardsiella tarda, Streptococcus iniae, lipopolysaccharide (LPS), and polyinosinic-polycytidylic acid (Poly I:C) was observed in the late stage in the blood tissue. Xanthine/xanthine oxidase assay (XOD assay) indicated the ROS-scavenging ability of purified recombinant HaMnSOD (rHaMnSOD). The optimum conditions for the SOD activity of rHaMnSOD were pH 9 and the 25 °C. Collectively, the results obtained through the expressional analysis profiles and the functional assays provide insights into potential immune related and antioxidant roles of HaMnSOD in the big belly seahorse. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Complimentary mechanisms of dual checkpoint blockade expand unique T-cell repertoires and activate adaptive anti-tumor immunity in triple-negative breast tumors

    Science.gov (United States)

    Wei, Junping; Yang, Xiao Yi; Lei, Gangjun; Wang, Tao; Liu, Cong-Xiao; Morse, Michael A.; Gouin, Kenneth; Knott, Simon R. V.; Hartman, Zachary C.

    2018-01-01

    ABSTRACT Triple-negative breast cancer (TNBC) is an aggressive and molecularly diverse breast cancer subtype typified by the presence of p53 mutations (∼80%), elevated immune gene signatures and neoantigen expression, as well as the presence of tumor infiltrating lymphocytes (TILs). As these factors are hypothesized to be strong immunologic prerequisites for the use of immune checkpoint blockade (ICB) antibodies, multiple clinical trials testing single ICBs have advanced to Phase III, with early indications of heterogeneous response rates of <20% to anti-PD1 and anti-PDL1 ICB. While promising, these modest response rates highlight the need for mechanistic studies to understand how different ICBs function, how their combination impacts functionality and efficacy, as well as what immunologic parameters predict efficacy to different ICBs regimens in TNBC. To address these issues, we tested anti-PD1 and anti-CTLA4 in multiple models of TNBC and found that their combination profoundly enhanced the efficacy of either treatment alone. We demonstrate that this efficacy is due to anti-CTLA4-driven expansion of an individually unique T-cell receptor (TCR) repertoire whose functionality is enhanced by both intratumoral Treg suppression and anti-PD1 blockade of tumor expressed PDL1. Notably, the individuality of the TCR repertoire was observed regardless of whether the tumor cells expressed a nonself antigen (ovalbumin) or if tumor-specific transgenic T-cells were transferred prior to sequencing. However, responsiveness was strongly correlated with systemic measures of tumor-specific T-cell and B-cell responses, which along with systemic assessment of TCR expansion, may serve as the most useful predictors for clinical responsiveness in future clinical trials of TNBC utilizing anti-PD1/anti-CTLA4 ICB. PMID:29721371

  7. Complimentary mechanisms of dual checkpoint blockade expand unique T-cell repertoires and activate adaptive anti-tumor immunity in triple-negative breast tumors.

    Science.gov (United States)

    Crosby, Erika J; Wei, Junping; Yang, Xiao Yi; Lei, Gangjun; Wang, Tao; Liu, Cong-Xiao; Agarwal, Pankaj; Korman, Alan J; Morse, Michael A; Gouin, Kenneth; Knott, Simon R V; Lyerly, H Kim; Hartman, Zachary C

    2018-01-01

    Triple-negative breast cancer (TNBC) is an aggressive and molecularly diverse breast cancer subtype typified by the presence of p53 mutations (∼80%), elevated immune gene signatures and neoantigen expression, as well as the presence of tumor infiltrating lymphocytes (TILs). As these factors are hypothesized to be strong immunologic prerequisites for the use of immune checkpoint blockade (ICB) antibodies, multiple clinical trials testing single ICBs have advanced to Phase III, with early indications of heterogeneous response rates of <20% to anti-PD1 and anti-PDL1 ICB. While promising, these modest response rates highlight the need for mechanistic studies to understand how different ICBs function, how their combination impacts functionality and efficacy, as well as what immunologic parameters predict efficacy to different ICBs regimens in TNBC. To address these issues, we tested anti-PD1 and anti-CTLA4 in multiple models of TNBC and found that their combination profoundly enhanced the efficacy of either treatment alone. We demonstrate that this efficacy is due to anti-CTLA4-driven expansion of an individually unique T-cell receptor (TCR) repertoire whose functionality is enhanced by both intratumoral Treg suppression and anti-PD1 blockade of tumor expressed PDL1. Notably, the individuality of the TCR repertoire was observed regardless of whether the tumor cells expressed a nonself antigen (ovalbumin) or if tumor-specific transgenic T-cells were transferred prior to sequencing. However, responsiveness was strongly correlated with systemic measures of tumor-specific T-cell and B-cell responses, which along with systemic assessment of TCR expansion, may serve as the most useful predictors for clinical responsiveness in future clinical trials of TNBC utilizing anti-PD1/anti-CTLA4 ICB.

  8. Prenatal arsenic exposure and the epigenome: altered microRNAs associated with innate and adaptive immune signaling in newborn cord blood.

    Science.gov (United States)

    Rager, Julia E; Bailey, Kathryn A; Smeester, Lisa; Miller, Sloane K; Parker, Joel S; Laine, Jessica E; Drobná, Zuzana; Currier, Jenna; Douillet, Christelle; Olshan, Andrew F; Rubio-Andrade, Marisela; Stýblo, Miroslav; García-Vargas, Gonzalo; Fry, Rebecca C

    2014-04-01

    The Biomarkers of Exposure to ARsenic (BEAR) pregnancy cohort in Gómez Palacio, Mexico was recently established to better understand the impacts of prenatal exposure to inorganic arsenic (iAs). In this study, we examined a subset (n = 40) of newborn cord blood samples for microRNA (miRNA) expression changes associated with in utero arsenic exposure. Levels of iAs in maternal drinking water (DW-iAs) and maternal urine were assessed. Levels of DW-iAs ranged from below detectable values to 236 µg/L (mean = 51.7 µg/L). Total arsenic in maternal urine (U-tAs) was defined as the sum of iAs and its monomethylated and dimethylated metabolites (MMAs and DMAs, respectively) and ranged from 6.2 to 319.7 µg/L (mean = 64.5 µg/L). Genome-wide miRNA expression analysis of cord blood revealed 12 miRNAs with increasing expression associated with U-tAs. Transcriptional targets of the miRNAs were computationally predicted and subsequently assessed using transcriptional profiling. Pathway analysis demonstrated that the U-tAs-associated miRNAs are involved in signaling pathways related to known health outcomes of iAs exposure including cancer and diabetes mellitus. Immune response-related mRNAs were also identified with decreased expression levels associated with U-tAs, and predicted to be mediated in part by the arsenic-responsive miRNAs. Results of this study highlight miRNAs as novel responders to prenatal arsenic exposure that may contribute to associated immune response perturbations. Copyright © 2013 Wiley Periodicals, Inc.

  9. Immunity peculiarities of neonates in case of perinatal pathology

    Directory of Open Access Journals (Sweden)

    О. S. Godovanets

    2018-02-01

    of the evidences of immune system components participation in perinatal pathology pathogenesis is detected correlation between immune disorders severity and clinical manifestation of diseases, as well as immune indices normalization in a long-term organism adaptation formation. Conclusions. Based on the data obtained it has been concluded that immune system status determination is reasonable for diagnostics of disadaptation syndrome severity in early neonatal period.

  10. In vivo immunoprotective role of Indigofera tinctoria and Scoparia dulcis aqueous extracts against chronic noise stress induced immune abnormalities in Wistar albino rats.

    Science.gov (United States)

    Madakkannu, Boothapandi; Ravichandran, Ramanibai

    2017-01-01

    Indigofera tinctoria and Scoparia dulcis are being widely used in Indian folk medicine for the treatment of various disorders. Environmental noise pollution is thought to be an important factor for many health problems and it causes immune abnormalities. In the present study immune-regulating potential of I. tinctoria and S. dulcis aqueous extracts on innate and adaptive immune system of wistar albino rats was evaluated during normal and chronic noise induced stress conditions. The results demonstrated that both I. tinctoria and S. dulcis aqueous extracts (200 mg/kg b.w) showed immunostimulant effect on both innate and adaptive immune response of wistar albino rat compared to control group under normal condition. The noise stress (100 dB for 1 h, 20 days) induced animals showed suppressive effects on immune response by decreasing macrophage phagocytosis, antibody secretion by spleen cells, humoral immune response, proliferation of lymphocytes, cytotoxicity, TNF α expression, granzyme B and perforin expression in splenic NK cells. Similarly, noise stress also caused DNA damage in tissues. However, the suppressed effects induced by noise stress on rat immune system were significantly prevented by oral administration of both I. tinctoria and S. dulcis aqueous extracts. Considering all these results it is suggested that the selected medicinal plant's aqueous extracts have the potential to prevent the effects of noise stress induced rat immune system and explore a strong immunostimulant potential applicable to clinical practices.

  11. Immune dysfunction in cirrhosis

    Science.gov (United States)

    Sipeki, Nora; Antal-Szalmas, Peter; Lakatos, Peter L; Papp, Maria

    2014-01-01

    Innate and adaptive immune dysfunction, also referred to as cirrhosis-associated immune dysfunction syndrome, is a major component of cirrhosis, and plays a pivotal role in the pathogenesis of both the acute and chronic worsening of liver function. During the evolution of the disease, acute decompensation events associated with organ failure(s), so-called acute-on chronic liver failure, and chronic decompensation with progression of liver fibrosis and also development of disease specific complications, comprise distinct clinical entities with different immunopathology mechanisms. Enhanced bacterial translocation associated with systemic endotoxemia and increased occurrence of systemic bacterial infections have substantial impacts on both clinical situations. Acute and chronic exposure to bacteria and/or their products, however, can result in variable clinical consequences. The immune status of patients is not constant during the illness; consequently, alterations of the balance between pro- and anti-inflammatory processes result in very different dynamic courses. In this review we give a detailed overview of acquired immune dysfunction and its consequences for cirrhosis. We demonstrate the substantial influence of inherited innate immune dysfunction on acute and chronic inflammatory processes in cirrhosis caused by the pre-existing acquired immune dysfunction with limited compensatory mechanisms. Moreover, we highlight the current facts and future perspectives of how the assessment of immune dysfunction can assist clinicians in everyday practical decision-making when establishing treatment and care strategies for the patients with end-stage liver disease. Early and efficient recognition of inappropriate performance of the immune system is essential for overcoming complications, delaying progression and reducing mortality. PMID:24627592

  12. PERINATAL MALNUTRITION AND THE PROTECTIVE ROLE OF THE PHYSICAL TRAINING ON THE IMMUNE SYSTEM.

    Science.gov (United States)

    Moreno Senna, Sueli; Ferraz, José Cândido; Leandro, Carol Góis

    2015-09-01

    Developing organisms have the ability to cope with environmental demands through physiologic and morphologic adaptations. Early life malnutrition has been recognized as an environmental stimulus that is related with down-regulation of immune responses. Some of these effects are explained by the epigenetics and the programming of hormones and cytokines impairing the modulation of the immune cells in response to environmental stimuli. Recently, it has been demonstrated that these effects are not deterministic and current environment, such as physical activity, can positively influence the immune system. Here, we discuss the effects of perinatal malnutrition on the immune system and how it can be modulated by physical training. The mechanism includes the normalization of some hormones concentrations related to growth and metabolism such as leptin, IGF-1 and glucocorticoids. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  13. Prenatal vitamin A deficiency impairs adaptive immune responses to pentavalent rotavirus vaccine (RotaTeq®) in a neonatal gnotobiotic pig model.

    Science.gov (United States)

    Kandasamy, Sukumar; Chattha, Kuldeep S; Vlasova, Anastasia N; Saif, Linda J

    2014-02-07

    Vitamin A deficiency (VAD) is associated with increased childhood mortality and morbidity in impoverished Asian and African countries, but the impact of VAD on rotavirus (RV) vaccine or infection is poorly understood. We assessed effects of gestational and dietary induced pre- and post-natal VAD and vitamin A supplementation on immune responses to a pentavalent rotavirus vaccine, RotaTeq(®) in a neonatal gnotobiotic pig model. Vaccine efficacy was assessed against virulent G1P[8] human rotavirus (HRV) challenge. VAD and vitamin A sufficient (VAS) piglets were derived from dietary VAD and VAS sows, respectively. VAD piglets had significantly lower levels of hepatic vitamin A compared to that of VAS piglets. RotaTeq(®)-vaccinated VAD piglets had 350-fold higher fecal virus shedding titers compared to vaccinated VAS piglets post-challenge. Only 25% of vaccinated non-vitamin A supplemented VAD piglets were protected against diarrhea compared with 100% protection rate in vaccinated non-supplemented VAS piglets post-challenge. Intestinal HRV specific immune responses were compromised in VAD piglets. Vaccinated VAD piglets had significantly lower ileal HRV IgG antibody secreting cell (ASC) responses (pre-challenge) and duodenal HRV IgA ASC responses (post-challenge) compared to vaccinated VAS piglets. Also, intestinal HRV IgA antibody titers were 11-fold lower in vaccinated VAD compared to vaccinated VAS piglets post-challenge. Persistently elevated levels of IL-8, a pro-inflammatory mediator, and lower IL-10 responses (anti-inflammatory) in vaccinated VAD compared to VAS piglets suggest more severe inflammatory responses in VAD piglets post-challenge. Moreover higher IFN-γ responses pre-challenge were observed in VAD compared to VAS piglets. The impaired vaccine-specific intestinal antibody responses and decreased immunoregulatory cytokine responses coincided with reduced protective efficacy of the RV vaccine against virulent HRV challenge in VAD piglets. In

  14. Alcohol, aging, and innate immunity.

    Science.gov (United States)

    Boule, Lisbeth A; Kovacs, Elizabeth J

    2017-07-01

    The global population is aging: in 2010, 8% of the population was older than 65 y, and that is expected to double to 16% by 2050. With advanced age comes a heightened prevalence of chronic diseases. Moreover, elderly humans fair worse after acute diseases, namely infection, leading to higher rates of infection-mediated mortality. Advanced age alters many aspects of both the innate and adaptive immune systems, leading to impaired responses to primary infection and poor development of immunologic memory. An often overlooked, yet increasingly common, behavior in older individuals is alcohol consumption. In fact, it has been estimated that >40% of older adults consume alcohol, and evidence reveals that >10% of this group is drinking more than the recommended limit by the National Institute on Alcohol Abuse and Alcoholism. Alcohol consumption, at any level, alters host immune responses, including changes in the number, phenotype, and function of innate and adaptive immune cells. Thus, understanding the effect of alcohol ingestion on the immune system of older individuals, who are already less capable of combating infection, merits further study. However, there is currently almost nothing known about how drinking alters innate immunity in older subjects, despite innate immune cells being critical for host defense, resolution of inflammation, and maintenance of immune homeostasis. Here, we review the effects of aging and alcohol consumption on innate immune cells independently and highlight the few studies that have examined the effects of alcohol ingestion in aged individuals. © Society for Leukocyte Biology.

  15. Innate immunity in the pathogenesis of psoriasis.

    LENUS (Irish Health Repository)

    Sweeney, Cheryl M

    2011-12-01

    Psoriasis is a common, immune-mediated inflammatory skin disorder. T helper(h)1 and Th17 lymphocytes contribute to the pathogenesis of psoriasis through the release of inflammatory cytokines that promote further recruitment of immune cells, keratinocyte proliferation and sustained inflammation. The innate immune system is the first line of defence against infection and plays a crucial role in the initiation of the adaptive immune response. The presence of innate immune cells and their products in psoriatic skin plaques suggests a role for innate immunity in this disease. In addition, the innate immune system can direct the development of pathogenic Th cells in psoriasis. In this article, we will summarise the role of the innate immune system in psoriasis with particular emphasis on the role of cytokines, signalling pathways and cells of the innate immune system.

  16. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for

  17. Immune surveillance properties of human NK cell-derived exosomes.

    Science.gov (United States)

    Lugini, Luana; Cecchetti, Serena; Huber, Veronica; Luciani, Francesca; Macchia, Gianfranco; Spadaro, Francesca; Paris, Luisa; Abalsamo, Laura; Colone, Marisa; Molinari, Agnese; Podo, Franca; Rivoltini, Licia; Ramoni, Carlo; Fais, Stefano

    2012-09-15

    Exosomes are nanovesicles released by normal and tumor cells, which are detectable in cell culture supernatant and human biological fluids, such as plasma. Functions of exosomes released by "normal" cells are not well understood. In fact, several studies have been carried out on exosomes derived from hematopoietic cells, but very little is known about NK cell exosomes, despite the importance of these cells in innate and adaptive immunity. In this paper, we report that resting and activated NK cells, freshly isolated from blood of healthy donors, release exosomes expressing typical protein markers of NK cells and containing killer proteins (i.e., Fas ligand and perforin molecules). These nanovesicles display cytotoxic activity against several tumor cell lines and activated, but not resting, immune cells. We also show that NK-derived exosomes undergo uptake by tumor target cells but not by resting PBMC. Exosomes purified from plasma of healthy donors express NK cell markers, including CD56+ and perforin, and exert cytotoxic activity against different human tumor target cells and activated immune cells as well. The results of this study propose an important role of NK cell-derived exosomes in immune surveillance and homeostasis. Moreover, this study supports the use of exosomes as an almost perfect example of biomimetic nanovesicles possibly useful in future therapeutic approaches against various diseases, including tumors.

  18. Immune System

    Science.gov (United States)

    A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

  19. Immunity to fish rhabdoviruses

    Science.gov (United States)

    Purcell, Maureen K.; Laing, Kerry J.; Winton, James R.

    2012-01-01

    Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN) system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M) protein to mediate host-cell shutoff and the non-virion (NV) protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals.

  20. Immunity to fish rhabdoviruses.

    Science.gov (United States)

    Purcell, Maureen K; Laing, Kerry J; Winton, James R

    2012-01-01

    Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN) system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M) protein to mediate host-cell shutoff and the non‑virion (NV) protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals.

  1. Immunity to Fish Rhabdoviruses

    Directory of Open Access Journals (Sweden)

    Maureen K. Purcell

    2012-01-01

    Full Text Available Members of the family Rhabdoviridae are single-stranded RNA viruses and globally important pathogens of wild and cultured fish and thus relatively well studied in their respective hosts or other model systems. Here, we review the protective immune mechanisms that fish mount in response to rhabdovirus infections. Teleost fish possess the principal components of innate and adaptive immunity found in other vertebrates. Neutralizing antibodies are critical for long-term protection from fish rhabdoviruses, but several studies also indicate a role for cell-mediated immunity. Survival of acute rhabdoviral infection is also dependent on innate immunity, particularly the interferon (IFN system that is rapidly induced in response to infection. Paradoxically, rhabdoviruses are sensitive to the effects of IFN but virulent rhabdoviruses can continue to replicate owing to the abilities of the matrix (M protein to mediate host-cell shutoff and the non‑virion (NV protein to subvert programmed cell death and suppress functional IFN. While many basic features of the fish immune response to rhabdovirus infections are becoming better understood, much less is known about how factors in the environment affect the ecology of rhabdovirus infections in natural populations of aquatic animals.

  2. Key cytokines of adaptive immunity are differentially induced in rainbow trout kidney by a group of structurally related geranyl aromatic derivatives.

    Science.gov (United States)

    Valenzuela, Beatriz; Obreque, Javiera; Soto-Aguilera, Sarita; Maisey, Kevin; Imarai, Mónica; Modak, Brenda

    2016-02-01

    Filifolinone is a semi-synthetic terpenoid derivative obtained from Heliotropium filifolium that increases the expression level of pro-inflammatory and anti-inflammatory cytokines in kidney cells of salmon. Because cytokines are produced in response to a foreign organism and by distinct other signals modulating immune responses, we further studied the potential immunomodulatory effects of a group of structural related terpenoid derivatives from H. filifolium on salmonids to determine the relationship between the chemical structure of the derivatives and their ability to modify cytokine expression and the lymphoid content. The resin and four 3H-spiro 1-benzofuran-2,1'-cyclohexane derivatives were tested in vivo in rainbow trout (Oncorhynchus mykiss) by quantifying the transcript levels of antiviral and T helper-type cytokines and T and B cells in the kidney. Three of the four terpenoids differ only in the C-7'substituent of the cyclohexane and the presence of the ketone group at this position in Filifolinone appeared responsible of an important up-regulation of IFN-α1, IFN-γ, IL-4/13A and IL-17D in the kidney of the treated trout. In addition, the absence of a methoxy group in carbon 7 of the benzene ring, found in all compounds but not in Folifolinoic acid, produced a significant reduction of IFN-γ, IL-12 and IL-4/13A transcripts. B cells were not affected by the compound treatment but Filifolinoic acid and the resin induced a significant reduction of T cells. Altogether, results showed that immunomodulating responses observed in the trout by effect of 3H-spiro 1-benzofuran-2,1'-cyclohexane derivatives is related to the presence of the ketone group in the carbon 7' and the methoxy group in carbon 7 of the benzene ring, being Filifolinone the most active immunostimulatory compound identified. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Effects of flunixin and florfenicol combined with vitamins E and/or C on selected immune mechanisms in cattle under conditions of adaptive stress

    Directory of Open Access Journals (Sweden)

    Urban-Chmiel Renata

    2015-06-01

    Full Text Available The aim of the study was to evaluate the effect of flunixin and florfenicol administered in combination with vitamin E or C on selected leukocyte immune mechanisms and on the inflammatory process during the first few weeks in the feedlot. Fifty calves divided into 5 groups (n = 10 received florfenicol and flunixin with vitamin E or C. Blood was collected on the 1st, 3rd, 7th, 14th, 21st, and 28th d of the experiment. Intracellular metabolism (NBT, apoptosis, chemotaxis, susceptibility to M. haemolytica leukotoxin, and expression of β2-integrins were determined in leukocytes. The symptoms of respiratory tract infection were observed in 40% of calves in control group, while in the other groups the morbidity rate ranged from 10% to 20%. Leukocytes showed decreased NBT, and the mean values for apoptosis ranged from 14% to 24%. The lowest percentage of apoptotic cells was observed in the calves that received florfenicol with flunixin and vitamins E and C. The chemotactic activity confirmed the significant inhibitory effect of the preparations on migration of the cells. A significant decrease (P ≤ 0.05 in the susceptibility of leukocytes to leukotoxin was noted in the group that received florfenicol and flunixin with vitamin E. Expression of β2-integrin receptors was the lowest in calves receiving florfenicol with flunixin and vitamin E or C. The application of an antibiotic and a non-steroidal anti-inflammatory drug with antioxidants protected the leukocytes involved in defence against M. haemolytica virulence factors and effectively limited oxidative stress in the calves.

  4. Reversibility of alcohol-induced immune depression

    DEFF Research Database (Denmark)

    Tønnesen, H; Kaiser, A H; Nielsen, B B

    1992-01-01

    Alcohol abusers have suppressed cellular immune function. The aim of the study was to investigate the time of sobriety required to normalize immune function. Delayed hypersensitivity was investigated during disulfiram controlled abstinence in ten heavy alcoholics and in seven moderate drinkers...... months of abstinence. The results suggest that while 2 weeks of abstinence from alcohol will improve the depressed cellular immunity, 2 months of sobriety is necessary to normalize it....

  5. In vivo immunoprotective role of Indigofera tinctoria and Scoparia dulcis aqueous extracts against chronic noise stress induced immune abnormalities in Wistar albino rats

    Directory of Open Access Journals (Sweden)

    Boothapandi Madakkannu

    Full Text Available Indigofera tinctoria and Scoparia dulcis are being widely used in Indian folk medicine for the treatment of various disorders. Environmental noise pollution is thought to be an important factor for many health problems and it causes immune abnormalities. In the present study immune-regulating potential of I. tinctoria and S. dulcis aqueous extracts on innate and adaptive immune system of wistar albino rats was evaluated during normal and chronic noise induced stress conditions. The results demonstrated that both I. tinctoria and S. dulcis aqueous extracts (200 mg/kg b.w showed immunostimulant effect on both innate and adaptive immune response of wistar albino rat compared to control group under normal condition. The noise stress (100 dB for 1 h, 20 days induced animals showed suppressive effects on immune response by decreasing macrophage phagocytosis, antibody secretion by spleen cells, humoral immune response, proliferation of lymphocytes, cytotoxicity, TNF α expression, granzyme B and perforin expression in splenic NK cells. Similarly, noise stress also caused DNA damage in tissues. However, the suppressed effects induced by noise stress on rat immune system were significantly prevented by oral administration of both I. tinctoria and S. dulcis aqueous extracts. Considering all these results it is suggested that the selected medicinal plant’s aqueous extracts have the potential to prevent the effects of noise stress induced rat immune system and explore a strong immunostimulant potential applicable to clinical practices. Keywords: Indigofera tinctoria, Scoparia dulcis, Chronic noise stress, Immunomodulatory, Innate immunity, Adaptive immunity

  6. The CD47-SIRPα signaling axis as an innate immune checkpoint in cancer.

    Science.gov (United States)

    Matlung, Hanke L; Szilagyi, Katka; Barclay, Neil A; van den Berg, Timo K

    2017-03-01

    Immune checkpoint inhibitors, including those targeting CTLA-4/B7 and the PD-1/PD-L1 inhibitory pathways, are now available for clinical use in cancer patients, with other interesting checkpoint inhibitors being currently in development. Most of these have the purpose to promote adaptive T cell-mediated immunity against cancer. Here, we review another checkpoint acting to potentiate the activity of innate immune cells towards cancer. This innate immune checkpoint is composed of what has become known as the 'don't-eat me' signal CD47, which is a protein broadly expressed on normal cells and often overexpressed on cancer cells, and its counter-receptor, the myeloid inhibitory immunoreceptor SIRPα. Blocking CD47-SIRPα interactions has been shown to promote the destruction of cancer cells by phagocytes, including macrophages and neutrophils. Furthermore, there is growing evidence that targeting of the CD47-SIRPα axis may also promote antigen-presenting cell function and thereby stimulate adaptive T cell-mediated anti-cancer immunity. The development of CD47-SIRPα checkpoint inhibitors and the potential side effects that these may have are discussed. Collectively, this identifies the CD47-SIRPα axis as a promising innate immune checkpoint in cancer, and with data of the first clinical studies with CD47-SIRPα checkpoint inhibitors expected within the coming years, this is an exciting and rapidly developing field. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. In immune defense: redefining the role of the immune system in chronic disease.

    Science.gov (United States)

    Rubinow, Katya B; Rubinow, David R

    2017-03-01

    The recognition of altered immune system function in many chronic disease states has proven to be a pivotal advance in biomedical research over the past decade. For many metabolic and mood disorders, this altered immune activity has been characterized as inflammation, with the attendant assumption that the immune response is aberrant. However, accumulating evidence challenges this assumption and suggests that the immune system may be mounting adaptive responses to chronic stressors. Further, the inordinate complexity of immune function renders a simplistic, binary model incapable of capturing critical mechanistic insights. In this perspective article, we propose alternative paradigms for understanding the role of the immune system in chronic disease. By invoking allostasis or systems biology rather than inflammation, we can ascribe greater functional significance to immune mediators, gain newfound appreciation of the adaptive facets of altered immune activity, and better avoid the potentially disastrous effects of translating erroneous assumptions into novel therapeutic strategies.

  8. Differential impact of respiratory syncytial virus and parainfluenza virus on the frequency of acute otitis media is explained by lower adaptive and innate immune responses in otitis-prone children.

    Science.gov (United States)

    Verhoeven, David; Xu, Qingfu; Pichichero, Michael E

    2014-08-01

    Acute otitis media (AOM) is a leading cause of bacterial pediatric infections associated with viral upper respiratory infections (URIs). We examined the differential impact of respiratory syncytial virus (RSV) and parainfluenza virus URIs on the frequency of AOM caused by Streptococcus pneumoniae (Spn) and nontypeable Haemophilus influenzae (NTHi) in stringently defined otitis-prone (sOP) and non-otitis-prone (NOP) children as a potential mechanism to explain increased susceptibility to AOM. Peripheral blood and nasal washes were obtained from sOP and NOP children (n = 309). Colonization events and antiviral responses consisting of total specific immunoglobulin G (IgG) responses, neutralizing antibody responses, and T-cell responses were determined. Isolated neutrophils were infected with varying multiplicities of infection of both viruses, and opsonophagocytosis potential was measured. A significant increase was found in frequency of AOM events caused by Spn and NTHi, with a concurrent RSV infection in sOP children. These results correlated with diminished total RSV-specific IgG, higher viral nasal burdens, and lower IgG neutralizing capacity. The sOP children had diminished T-cell responses to RSV that correlated with lower Toll-like receptor 3/7 transcript and decreased expression of HLA-DR on antigen-presenting cells. RSV interfered with the Spn phagocytic capacity of neutrophils in a dose-dependent manner. Parainfluenza virus infections did not differentially affect AOM events in sOP and NOP children. Lower innate and adaptive immune responses to RSV in sOP children may slow the kinetics of viral clearance from the nasopharynx and allow for viral interference with antibacterial immune responses, thus contributing to increased frequency of AOMs. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  9. Effects of Feeding Milk Replacer Ad Libitum or in Restricted Amounts for the First Five Weeks of Life on the Growth, Metabolic Adaptation, and Immune Status of Newborn Calves

    Science.gov (United States)

    Schäff, Christine T.; Gruse, Jeannine; Maciej, Josefine; Mielenz, Manfred; Wirthgen, Elisa; Hoeflich, Andreas; Schmicke, Marion; Pfuhl, Ralf; Jawor, Paulina; Stefaniak, Tadeusz

    2016-01-01

    The pre-weaning period is critical for calf health and growth, and intensive milk feeding programs may assist postnatal development by improving body growth and organ maturation. The aim of the present work was to study the effects of ad libitum milk replacer (MR) feeding on the growth, metabolic adaptation, health, and immune status of newborn calves. Twenty-eight newborn Holstein and Holstein x Charolais crossbred calves were fed ad libitum (ADLIB) or in restricted amounts (6 liters per day; RES) during the first five weeks of life. The MR intake in the ADLIB treatment was gradually reduced at weeks 6 and 7, and all calves then received 6 liters of MR per day until day 60. Blood samples were collected to measure the plasma concentrations of metabolites, insulin, insulin-like growth factor (IGF)-I and IGF binding proteins (IGFBP), immunoglobulins, and acute phase proteins. The expression of mRNA associated with both the somatotropic axis and gluconeogenic enzymes was measured in the liver on day 60. Intensive feeding improved MR intake and growth in ADLIB without influencing concentrate intake. Carcass weight, perirenal fat, and muscle mass were greater in ADLIB. Plasma concentrations of glucose, triglycerides, insulin, and IGF-I were greater, whereas plasma concentrations of β-hydroxybutyrate, total protein, albumin, urea, IGFBP-2 and -4, and fibrinogen were lower at distinct time points in ADLIB. The hepatic mRNA expression of cytosolic phosphoenolpyruvate carboxykinase was greater in ADLIB. Most metabolic and endocrine differences occurred during the MR feeding period, but a slightly greater concentrate intake was associated with increased plasma IGF-I and insulin at the end of the study. The immune and health status of the calves were not affected by MR feeding. However, increased plasma fibrinogen in the RES group suggested differences in the acute phase response. PMID:28036351

  10. Immunity booster

    International Nuclear Information System (INIS)

    Stefanescu, Ioan; Titescu, Gheorghe; Tamaian, Radu; Haulica, Ion; Bild, Walther

    2002-01-01

    The immunity booster is, according to its patent description, microbiologically pure water with an D/(D+H) isotopic concentration of 100 ppm, with physical-chemical characteristics similar to those of distilled water. It is obtained by sterilization of a mixture of deuterium depleted water, with a 25 ppm isotopic concentration, with distilled water in a volume ratio of 4:6. Unlike natural immunity boosters (bacterial agents as Bacillus Chalmette-Guerin, Corynebacterium parvum; lipopolysaccharides; human immunoglobulin) or synthetical products (levamysol; isoprinosyne with immunostimulating action), which cause hypersensitivity and shocks, thrill, fever, sickness and the immunity complex disease, the water of 100 ppm D/(D + H) isotopic concentration is a toxicity free product. The testing for immune reaction of the immunity booster led to the following results: - an increase of cell action capacity in the first immunity shielding stage (macrophages), as evidenced by stimulation of a number of essential characterizing parameters, as well as of the phagocytosis capacity, bactericide capacity, and opsonic capacity of serum; - an increase of the number of leucocyte particularly of the granulocyte in peripheral blood, produced especially when medullar toxic agents like caryolysine are used; - it hinders the effect of lowering the number of erythrocytes in peripheral blood produced by experimentally induced chronic inflammation; - an increase of nonspecific immunity defence capacity against specific bacterial aggression of both Gram-positive bacteria (Streptococcus pneumoniae 558 ) and of the Gram-negative ones (Klebsiella pneumoniae 507 ); - an increase of immunity - stimulating activity (proinflamatory), like that of levamisole as evidenced by the test of stimulation of experimentally induced inflammation by means of carrageenan. The following advantages of the immunity booster are stressed: - it is toxicity free and side effect free; - can be orally administrated as

  11. De novo assembly of the Indo-Pacific humpback dolphin leucocyte transcriptome to identify putative genes involved in the aquatic adaptation and immune response.

    Science.gov (United States)

    Gui, Duan; Jia, Kuntong; Xia, Jia; Yang, Lili; Chen, Jialin; Wu, Yuping; Yi, Meisheng

    2013-01-01

    The Indo-Pacific humpback dolphin (Sousa chinensis), a marine mammal species inhabited in the waters of Southeast Asia, South Africa and Australia, has attracted much attention because of the dramatic decline in population size in the past decades, which raises the concern of extinction. So far, this species is poorly characterized at molecular level due to little sequence information available in public databases. Recent advances in large-scale RNA sequencing provide an efficient approach to generate abundant sequences for functional genomic analyses in the species with un-sequenced genomes. We performed a de novo assembly of the Indo-Pacific humpback dolphin leucocyte transcriptome by Illumina sequencing. 108,751 high quality sequences from 47,840,388 paired-end reads were generated, and 48,868 and 46,587 unigenes were functionally annotated by BLAST search against the NCBI non-redundant and Swiss-Prot protein databases (E-valueIndo-Pacific humpback dolphin, an endangered species. The de novo transcriptome analysis of the unique transcripts will provide valuable sequence information for discovery of new genes, characterization of gene expression, investigation of various pathways and adaptive evolution, as well as identification of genetic markers.

  12. HLA-Driven Convergence of HIV-1 Viral Subtypes B and F Toward the Adaptation to Immune Responses in Human Populations

    Science.gov (United States)

    Dilernia, Dario Alberto; Jones, Leandro; Rodriguez, Sabrina; Turk, Gabriela; Rubio, Andrea E.; Pampuro, Sandra; Gomez-Carrillo, Manuel; Bautista, Christian; Deluchi, Gabriel; Benetucci, Jorge; Lasala, María Beatriz; Lourtau, Leonardo; Losso, Marcelo Horacio; Perez, Héctor; Cahn, Pedro; Salomón, Horacio

    2008-01-01

    Background Cytotoxic T-Lymphocyte (CTL) response drives the evolution of HIV-1 at a host-level by selecting HLA-restricted escape mutations. Dissecting the dynamics of these escape mutations at a population-level would help to understand how HLA-mediated selection drives the evolution of HIV-1. Methodology/Principal Findings We undertook a study of the dynamics of HIV-1 CTL-escape mutations by analyzing through statistical approaches and phylogenetic methods the viral gene gag sequenced in plasma samples collected between the years 1987 and 2006 from 302 drug-naïve HIV-positive patients. By applying logistic regression models and after performing correction for multiple test, we identified 22 potential CTL-escape mutations (p-value<0.05; q-value<0.2); 10 of these associations were confirmed in samples biologically independent by a Bayesian Markov Chain Monte-Carlo method. Analyzing their prevalence back in time we found that escape mutations that are the consensus residue in samples collected after 2003 have actually significantly increased in time in one of either B or F subtype until becoming the most frequent residue, while dominating the other viral subtype. Their estimated prevalence in the viral subtype they did not dominate was lower than 30% for the majority of samples collected at the end of the 80's. In addition, when screening the entire viral region, we found that the 75% of positions significantly changing in time (p<0.05) were located within known CTL epitopes. Conclusions Across HIV Gag protein, the rise of polymorphisms from independent origin during the last twenty years of epidemic in our setting was related to an association with an HLA allele. The fact that these mutations accumulated in one of either B or F subtypes have also dominated the other subtype shows how this selection might be causing a convergence of viral subtypes to variants which are more likely to evade the immune response of the population where they circulate. PMID:18941505

  13. Immune Mechanisms in Myelodysplastic Syndrome

    Directory of Open Access Journals (Sweden)

    Andreas Glenthøj

    2016-06-01

    Full Text Available Myelodysplastic syndrome (MDS is a spectrum of diseases, characterized by debilitating cytopenias and a propensity of developing acute myeloid leukemia. Comprehensive sequencing efforts have revealed a range of mutations characteristic, but not specific, of MDS. Epidemiologically, autoimmune diseases are common in patients with MDS, fueling hypotheses of common etiological mechanisms. Both innate and adaptive immune pathways are overly active in the hematopoietic niche of MDS. Although supportive care, growth factors, and hypomethylating agents are the mainstay of MDS treatment, some patients—especially younger low-risk patients with HLA-DR15 tissue type—demonstrate impressive response rates after immunosuppressive therapy. This is in contrast to higher-risk MDS patients, where several immune activating treatments, such as immune checkpoint inhibitors, are in the pipeline. Thus, the dual role of immune mechanisms in MDS is challenging, and rigorous translational studies are needed to establish the value of immune manipulation as a treatment of MDS.

  14. Immune Mechanisms in Myelodysplastic Syndrome

    DEFF Research Database (Denmark)

    Glenthøj, Andreas; Ørskov, Andreas Due; Hansen, Jakob Werner

    2016-01-01

    diseases are common in patients with MDS, fueling hypotheses of common etiological mechanisms. Both innate and adaptive immune pathways are overly active in the hematopoietic niche of MDS. Although supportive care, growth factors, and hypomethylating agents are the mainstay of MDS treatment, some patients......-especially younger low-risk patients with HLA-DR15 tissue type-demonstrate impressive response rates after immunosuppressive therapy. This is in contrast to higher-risk MDS patients, where several immune activating treatments, such as immune checkpoint inhibitors, are in the pipeline. Thus, the dual role of immune...... mechanisms in MDS is challenging, and rigorous translational studies are needed to establish the value of immune manipulation as a treatment of MDS....

  15. Spirochetal Lipoproteins and Immune Evasion

    Science.gov (United States)

    Christodoulides, Alexei; Boyadjian, Ani; Kelesidis, Theodoros

    2017-01-01

    Spirochetes are a major threat to public health. However, the exact pathogenesis of spirochetal diseases remains unclear. Spirochetes express lipoproteins that often determine the cross talk between the host and spirochetes. Lipoproteins are pro-inflammatory, modulatory of immune responses, and enable the spirochetes to evade the immune system. In this article, we review the modulatory effects of spirochetal lipoproteins related to immune evasion. Understanding lipoprotein-induced immunomodulation will aid in elucidating innate pathogenesis processes and subsequent adaptive mechanisms potentially relevant to spirochetal disease vaccine development and treatment. PMID:28424696

  16. Effects of recombinant bovine somatotropin during the periparturient period on innate and adaptive immune responses, systemic inflammation, and metabolism of dairy cows.

    Science.gov (United States)

    Silva, P R B; Machado, K S; Da Silva, D N Lobão; Moraes, J G N; Keisler, D H; Chebel, R C

    2015-07-01

    The aim of this experiment was to determine effects of treating peripartum dairy cows with body condition score ≥3.75 with recombinant bovine somatotropin (rbST) on immune, inflammatory, and metabolic responses. Holstein cows (253±1d of gestation) were assigned randomly to 1 of 3 treatments: untreated control (n=53), rbST87.5 (n=56; 87.5mg of rbST), and rbST125 (n=57; 125mg of rbST). Cows in the rbST87.5 and rbST125 treatments received rbST weekly from -21 to 28d relative to calving. Growth hormone, insulin-like growth factor 1, haptoglobin, tumor necrosis factor α, nonesterified fatty acids, β-hydroxybutyrate, glucose, and cortisol concentrations were determined weekly from -21 to 21d relative to calving. Blood sampled weekly from -14 to 21d relative to calving was used for hemogram and polymorphonuclear leukocyte (PMNL) expression of adhesion molecules, phagocytosis, and oxidative burst. Cows were vaccinated with ovalbumin at -21, -7, and 7d relative to calving, and blood was collected weekly from -21 to 21d relative to calving to determine IgG anti-ovalbumin concentrations. A subsample of cows had liver biopsied -21, -7, and 7d relative to calving to determine total lipids, triglycerides, and glycogen content. Growth hormone concentrations prepartum (control=11.0±1.2, rbST87.5=14.1±1.2, rbST125=15.1±1.3ng/mL) and postpartum (control=14.4±1.1, rbST87.5=17.8±1.2, rbST125=21.8±1.1ng/mL) were highest for rbST125 cows. Cows treated with rbST had higher insulin-like growth factor 1 concentrations than control cows (control=110.5±4.5, rbST87.5=126.2±4.5, rbST125=127.2±4.5ng/mL) only prepartum. Intensity of L-selectin expression was higher for rbST125 than for control and rbST87.5 cows [control=3,590±270, rbST87.5=3,279±271, rbST125=4,371±279 geometric mean fluorescence intensity (GMFI)] in the prepartum period. The PMNL intensities of phagocytosis (control=3,131±130, rbST87.5=3,391±133, rbST125=3,673±137 GMFI) and oxidative burst (control=9,588±746

  17. Immune cells in term and preterm labor

    Science.gov (United States)

    Gomez-Lopez, Nardhy; StLouis, Derek; Lehr, Marcus A; Sanchez-Rodriguez, Elly N; Arenas-Hernandez, Marcia

    2014-01-01

    Labor resembles an inflammatory response that includes secretion of cytokines/chemokines by resident and infiltrating immune cells into reproductive tissues and the maternal/fetal interface. Untimely activation of these inflammatory pathways leads to preterm labor, which can result in preterm birth. Preterm birth is a major determinant of neonatal mortality and morbidity; therefore, the elucidation of the process of labor at a cellular and molecular level is essential for understanding the pathophysiology of preterm labor. Here, we summarize the role of innate and adaptive immune cells in the physiological or pathological activation of labor. We review published literature regarding the role of innate and adaptive immune cells in the cervix, myometrium, fetal membranes, decidua and the fetus in late pregnancy and labor at term and preterm. Accumulating evidence suggests that innate immune cells (neutrophils, macrophages and mast cells) mediate the process of labor by releasing pro-inflammatory factors such as cytokines, chemokines and matrix metalloproteinases. Adaptive immune cells (T-cell subsets and B cells) participate in the maintenance of fetomaternal tolerance during pregnancy, and an alteration in their function or abundance may lead to labor at term or preterm. Also, immune cells that bridge the innate and adaptive immune systems (natural killer T (NKT) cells and dendritic cells (DCs)) seem to participate in the pathophysiology of preterm labor. In conclusion, a balance between innate and adaptive immune cells is required in order to sustain pregnancy; an alteration of this balance will lead to labor at term or preterm. PMID:24954221

  18. Innate immunity

    African Journals Online (AJOL)

    Ronnie Anderson is Director of the Medical Research Council Unit for Inflammation and Immunity. ... field have included macrophage, T cell, cytokine and cytokine activated killer cell interactions .... monocytes, mast cells, lymphocytes, eccrine.

  19. Childhood immunization

    Science.gov (United States)

    Romain, Sandra; Schillaci, Michael A.

    2009-01-01

    ABSTRACT OBJECTIVE To examine childhood immunization levels relative to the number of family physicians, pediatricians, and public health nurses in Ontario. DESIGN Retrospective comparative analysis of publicly available data on immunization coverage levels and the relative number of family physicians, pediatricians, and public health nurses. SETTING Ontario. PARTICIPANTS Seven-year-old children, family physicians, pediatricians, and public health nurses in Ontario. MAIN OUTCOME MEASURES The association between immunization coverage levels and the relative number of family physicians, pediatricians, and public health nurses. RESULTS We found correlations between immunization coverage levels and the relative number (ie, per 1000 Ontario residents) of family physicians (ρ = 0.60) and pediatricians (ρ = 0.70) and a lower correlation with the relative number of public health nurses (ρ = 0.40), although none of these correlations was significant. A comparison of temporal trends illustrated that variation in the relative number of family physicians and pediatricians in Ontario was associated with similar variation in immunization coverage levels. CONCLUSION Increasing the number of family physicians and pediatricians might help to boost access to immunizations and perhaps other components of cost-saving childhood preventive care. PMID:19910599

  20. Regulation of intestinal homeostasis by innate immune cells.

    Science.gov (United States)

    Kayama, Hisako; Nishimura, Junichi; Takeda, Kiyoshi

    2013-12-01

    The intestinal immune system has an ability to distinguish between the microbiota and pathogenic bacteria, and then activate pro-inflammatory pathways against pathogens for host defense while remaining unresponsive to the microbiota and dietary antigens. In the intestine, abnormal activation of innate immunity causes development of several inflammatory disorders such as inflammatory bowel diseases (IBD). Thus, activity of innate immunity is finely regulated in the intestine. To date, multiple innate immune cells have been shown to maintain gut homeostasis by preventing inadequate adaptive immune responses in the murine intestine. Additionally, several innate immune subsets, which promote Th1 and Th17 responses and are implicated in the pathogenesis of IBD, have recently been identified in the human intestinal mucosa. The demonstration of both murine and human intestinal innate immune subsets contributing to regulation of adaptive immunity emphasizes the conserved innate immune functions across species and might promote development of the intestinal innate immunity-based clinical therapy.

  1. Evaluation of Traditional Medicines III: The Mechanism of Immune ...

    African Journals Online (AJOL)

    These results show that PHELA did not stimulate Th1 cytokines of a normal immune system but stimulated them when the immune system was suppressed by cyclosporine-A. In conclusion, PHELA is an immune-stimulant to a compromised immune system. Key words: PHELA, traditional medicine, cyclosporine-A, cytokines, ...

  2. Pregnancy immunology: decidual immune cells.

    Science.gov (United States)

    Sanguansermsri, Donruedee; Pongcharoen, Sutatip

    2008-01-01

    Human pregnancy is a complex process. Placental development depends on the function of secretory molecules produced by placental trophoblast cells as well as by maternal uterine immune cells within the decidua. These decidual immune cells are T cells, natural killer cells, macrophages and dendritic cells. The interactions between the trophoblast cells and the maternal immune cells have an impact on the outcome of the pregnancy. Knowledge about the phenotypes and functions of the maternal immune cells in normal and pathological pregnancies including recurrent spontaneous abortions, preeclampsia and hydatidiform moles may improve our understanding of the immunobiology of the normal pregnancy as a whole and may provide approaches for improving the treatment of pathological pregnancies.

  3. The first whole genome and transcriptome of the cinereous vulture reveals adaptation in the gastric and immune defense systems and possible convergent evolution between the Old and New World vultures.

    Science.gov (United States)

    Chung, Oksung; Jin, Seondeok; Cho, Yun Sung; Lim, Jeongheui; Kim, Hyunho; Jho, Sungwoong; Kim, Hak-Min; Jun, JeHoon; Lee, HyeJin; Chon, Alvin; Ko, Junsu; Edwards, Jeremy; Weber, Jessica A; Han, Kyudong; O'Brien, Stephen J; Manica, Andrea; Bhak, Jong; Paek, Woon Kee

    2015-10-21

    The cinereous vulture, Aegypius monachus, is the largest bird of prey and plays a key role in the ecosystem by removing carcasses, thus preventing the spread of diseases. Its feeding habits force it to cope with constant exposure to pathogens, making this species an interesting target for discovering functionally selected genetic variants. Furthermore, the presence of two independently evolved vulture groups, Old World and New World vultures, provides a natural experiment in which to investigate convergent evolution due to obligate scavenging. We sequenced the genome of a cinereous vulture, and mapped it to the bald eagle reference genome, a close relative with a divergence time of 18 million years. By comparing the cinereous vulture to other avian genomes, we find positively selected genetic variations in this species associated with respiration, likely linked to their ability of immune defense responses and gastric acid secretion, consistent with their ability to digest carcasses. Comparisons between the Old World and New World vulture groups suggest convergent gene evolution. We assemble the cinereous vulture blood transcriptome from a second individual, and annotate genes. Finally, we infer the demographic history of the cinereous vulture which shows marked fluctuations in effective population size during the late Pleistocene. We present the first genome and transcriptome analyses of the cinereous vulture compared to other avian genomes and transcriptomes, revealing genetic signatures of dietary and environmental adaptations accompanied by possible convergent evolution between the Old World and New World vultures.

  4. Search Strategy of Focused Crawler Based on Adaptive Immune Evolutionary Algorithm%基于自适应免疫进化算法的聚焦爬虫搜索策略

    Institute of Scientific and Technical Information of China (English)

    刘丽杰; 许楠; 李盼池

    2012-01-01

    聚焦爬虫是主题搜索引擎的核心部件。针对目前聚焦爬虫搜索策略的不足,提出基于主题相关度和页面重要性相结合的综合相关度来判别页面主题相关性,并采用自适应免疫进化算法这种搜索策略指导聚焦爬虫的爬行,实验结果证明,该算法下载的主题相关网页数所占比例明显高于最佳搜索和广度优先搜索算法的比例,具有更高的搜索效率。%Focused crawler was a core component of the topic search engine.To overcome the deficiency of focused crawler search strategy,a comprehensive value based on theme relevance and importance of page was proposed to determine the topic relevant of the page,and the adaptive immune evolutionary algorithm of this search strategy was used to guide the crawling strategy of focused crawler.The experiment results showed that the algorithm download the proportion to the number of webpage related to the themes was higher significantly than the best search and breadth first search algorithm and had higher searching efficiency.

  5. Physical Activities, Exercises, and Their Effects to the Immune System

    OpenAIRE

    Nurmasitoh, Titis

    2015-01-01

    Every systems in human body correlate to maintain homeostasis. One of those systems which contribute to maintain homeostasis is the immune system. The immune system defends physiological functions against foreign substances and cancer cells through a complex and multilayered mechanism. The ability to defend against foreign substances and abnormal cells is done by two types of immune system, which are Innate immune system and adaptive/acquired immune system. There are also certain factors that...

  6. Active and passive immunity, vaccine types, excipients and licensing.

    Science.gov (United States)

    Baxter, David

    2007-12-01

    Abstract Immunity is the state of protection against infectious disease conferred either through an immune response generated by immunization or previous infection or by other non-immunological factors. This article reviews active and passive immunity and the differences between them: it also describes the four different commercially available vaccine types (live attenuated, killed/inactivated, subunit and toxoid): it also looks at how these different vaccines generate an adaptive immune response.

  7. Assessment of Adaptive Rate Response Provided by Accelerometer, Minute Ventilation and Dual Sensor Compared with Normal Sinus Rhythm During Exercise: A Self-controlled Study in Chronotropically Competent Subjects

    Directory of Open Access Journals (Sweden)

    Yuanyuan Cao

    2015-01-01

    Full Text Available Background: Dual sensor (DS for rate adaption was supposed to be more physiological. To evaluate its superiority, the DS (accelerometer [ACC] and minute ventilation [MV] and normal sinus rate response were compared in a self-controlled way during exercise treadmill testing. Methods: This self-controlled study was performed in atrioventricular block patients with normal sinus function who met the indications of pacemaker implant. Twenty-one patients came to the 1-month follow-up visit. Patients performed a treadmill test 1-month post implant while programmed in DDDR and sensor passive mode. For these patients, sensor response factors were left at default settings (ACC = 8, MV = 3 and sensor indicated rates (SIRs for DS, ACC and MV sensor were retrieved from the pacemaker memories, along with measured sinus node (SN rates from the beginning to 1-minute after the end of the treadmill test, and compared among study groups. Repeated measures analysis of variance and profile analysis, as well as variance analysis of randomized block designs, were used for statistical analysis. Results: Fifteen patients (15/21 were determined to be chronotropically competent. The mean differences between DS SIRs and intrinsic sinus rates during treadmill testing were smaller than those for ACC and MV sensor (mean difference between SIR and SN rate: ACC vs. SN, MV vs. SN, DS vs. SN, respectively, 34.84, 17.60, 16.15 beats/min, though no sensors could mimic sinus rates under the default settings for sensor response factor (ACC vs. SN P-adjusted < 0.001; MV vs. SN P-adjusted = 0.002; DS vs. SN P-adjusted = 0.005. However, both in the range of 1 st minute and first 3 minutes of exercise, only the DS SIR profile did not differ from sinus rates (P-adjusted = 0.09, 0.90, respectively. Conclusions: The DS under default settings provides more physiological rate response during physical activity than the corresponding single sensors (ACC or MV sensor. Further study is needed to

  8. Cardiac allograft immune activation: current perspectives

    Directory of Open Access Journals (Sweden)

    Chang D

    2014-12-01

    Full Text Available David Chang, Jon Kobashigawa Cedars-Sinai Heart Institute, Los Angeles, CA, USA Abstract: Heart transplant remains the most durable option for end-stage heart disease. Cardiac allograft immune activation and heart transplant rejection remain among the main complications limiting graft and recipient survival. Mediators of the immune system can cause different forms of rejection post-heart transplant. Types of heart transplant rejection include hyperacute rejection, cellular rejection, antibody-mediated rejection, and chronic rejection. In this review, we will summarize the innate and adaptive immune responses which influence the post-heart transplant recipient. Different forms of rejection and their clinical presentation, detection, and immune monitoring will be discussed. Treatment of heart transplant rejection will be examined. We will discuss potential treatment strategies for preventing rejection post-transplant in immunologically high-risk patients with antibody sensitization. Keywords: heart transplant, innate immunity, adaptive immunity, rejection, immunosuppression

  9. Malware Normalization

    OpenAIRE

    Christodorescu, Mihai; Kinder, Johannes; Jha, Somesh; Katzenbeisser, Stefan; Veith, Helmut

    2005-01-01

    Malware is code designed for a malicious purpose, such as obtaining root privilege on a host. A malware detector identifies malware and thus prevents it from adversely affecting a host. In order to evade detection by malware detectors, malware writers use various obfuscation techniques to transform their malware. There is strong evidence that commercial malware detectors are susceptible to these evasion tactics. In this paper, we describe the design and implementation of a malware normalizer ...

  10. Modulation of host immunity by tick saliva

    Czech Academy of Sciences Publication Activity Database

    Kotál, Jan; Langhansová, H.; Lieskovská, J.; Andersen, J. F.; Francischetti, I.M.B.; Chavakis, T.; Kopecký, J.; Pedra, J. H. F.; Kotsyfakis, Michalis; Chmelař, J.

    2015-01-01

    Roč. 128, OCT 14 2015 (2015), s. 58-68 ISSN 1874-3919 R&D Projects: GA ČR GAP502/12/2409 Institutional support: RVO:60077344 Keywords : Adaptive immunity * Innate immunity * Saliva * Salivary glands * Tick Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.867, year: 2015

  11. Immune Evasion by Epstein-Barr Virus

    NARCIS (Netherlands)

    Ressing, Maaike E; van Gent, Michiel; Gram, Anna M; Hooykaas, Marjolein J G; Piersma, Sytse J; Wiertz, EJHJ

    2015-01-01

    Epstein-Bar virus (EBV) is widespread within the human population with over 90% of adults being infected. In response to primary EBV infection, the host mounts an antiviral immune response comprising both innate and adaptive effector functions. Although the immune system can control EBV infection to

  12. Leptin as immune mediator: Interaction between neuroendocrine and immune system.

    Science.gov (United States)

    Procaccini, Claudio; La Rocca, Claudia; Carbone, Fortunata; De Rosa, Veronica; Galgani, Mario; Matarese, Giuseppe

    2017-01-01

    Leptin is an adipocyte-derived hormone/cytokine that links nutritional status with neuroendocrine and immune functions. Initially described as an anti-obesity hormone, leptin has subsequently been shown to exert pleiotropic effects, being also able to influence haematopoiesis, thermogenesis, reproduction, angiogenesis, and more importantly immune homeostasis. As a cytokine, leptin can affect both innate and adaptive immunity, by inducing a pro-inflammatory response and thus playing a key role in the regulation of the pathogenesis of several autoimmune/inflammatory diseases. In this review, we discuss the most recent advances on the role of leptin as immune-modulator in mammals and we also provide an overview on its main functions in non-mammalian vertebrates. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Postnatal Innate Immune Development: From Birth to Adulthood

    Directory of Open Access Journals (Sweden)

    Anastasia Georgountzou

    2017-08-01

    Full Text Available It is well established that adaptive immune responses are deficient in early life, contributing to increased mortality and morbidity. The developmental trajectories of different components of innate immunity are only recently being explored. Individual molecules, cells, or pathways of innate recognition and signaling, within different compartments/anatomical sites, demonstrate variable maturation patterns. Despite some discrepancies among published data, valuable information is emerging, showing that the developmental pattern of cytokine responses during early life is age and toll-like receptor specific, and may be modified by genetic and environmental factors. Interestingly, specific environmental exposures have been linked both to innate function modifications and the occurrence of chronic inflammatory disorders, such as respiratory allergies. As these conditions are on the rise, our knowledge on innate immune development and its modulating factors needs to be expanded. Improved understanding of the sequence of events associated with disease onset and persistence will lead toward meaningful interventions. This review describes the state-of-the-art on normal postnatal innate immune ontogeny and highlights research areas that are currently explored or should be further addressed.

  14. Normal accidents

    International Nuclear Information System (INIS)

    Perrow, C.

    1989-01-01

    The author has chosen numerous concrete examples to illustrate the hazardousness inherent in high-risk technologies. Starting with the TMI reactor accident in 1979, he shows that it is not only the nuclear energy sector that bears the risk of 'normal accidents', but also quite a number of other technologies and industrial sectors, or research fields. The author refers to the petrochemical industry, shipping, air traffic, large dams, mining activities, and genetic engineering, showing that due to the complexity of the systems and their manifold, rapidly interacting processes, accidents happen that cannot be thoroughly calculated, and hence are unavoidable. (orig./HP) [de

  15. Immune System

    Science.gov (United States)

    ... of the Immune System Print en español El sistema inmunitario Whether you're stomping through the showers ... of Use Notice of Nondiscrimination Visit the Nemours Web site. Note: All information on TeensHealth® is for ...

  16. Immunizing Adults

    Centers for Disease Control (CDC) Podcasts

    Vaccines aren’t just for kids; adults also need to get immunized. Overall, far too many people 19 years and older aren’t getting the vaccines they need and remain unprotected. In this podcast, Dr. Walter Williams discuss the importance of adults being fully vaccinated.

  17. Innate immunity in vertebrates: an overview.

    Science.gov (United States)

    Riera Romo, Mario; Pérez-Martínez, Dayana; Castillo Ferrer, Camila

    2016-06-01

    Innate immunity is a semi-specific and widely distributed form of immunity, which represents the first line of defence against pathogens. This type of immunity is critical to maintain homeostasis and prevent microbe invasion, eliminating a great variety of pathogens and contributing with the activation of the adaptive immune response. The components of innate immunity include physical and chemical barriers, humoral and cell-mediated components, which are present in all jawed vertebrates. The understanding of innate defence mechanisms in non-mammalian vertebrates is the key to comprehend the general picture of vertebrate innate immunity and its evolutionary history. This is also essential for the identification of new molecules with applications in immunopharmacology and immunotherapy. In this review, we describe and discuss the main elements of vertebrate innate immunity, presenting core findings in this field and identifying areas that need further investigation. © 2016 John Wiley & Sons Ltd.

  18. Reinforcement Learning Based Artificial Immune Classifier

    Directory of Open Access Journals (Sweden)

    Mehmet Karakose

    2013-01-01

    Full Text Available One of the widely used methods for classification that is a decision-making process is artificial immune systems. Artificial immune systems based on natural immunity system can be successfully applied for classification, optimization, recognition, and learning in real-world problems. In this study, a reinforcement learning based artificial immune classifier is proposed as a new approach. This approach uses reinforcement learning to find better antibody with immune operators. The proposed new approach has many contributions according to other methods in the literature such as effectiveness, less memory cell, high accuracy, speed, and data adaptability. The performance of the proposed approach is demonstrated by simulation and experimental results using real data in Matlab and FPGA. Some benchmark data and remote image data are used for experimental results. The comparative results with supervised/unsupervised based artificial immune system, negative selection classifier, and resource limited artificial immune classifier are given to demonstrate the effectiveness of the proposed new method.

  19. Vaccines (immunizations) - overview

    Science.gov (United States)

    Vaccinations; Immunizations; Immunize; Vaccine shots; Prevention - vaccine ... of the vaccine. VACCINE SCHEDULE The recommended vaccination (immunization) schedule is updated every 12 months by the ...

  20. The twilight of immunity: emerging concepts in aging of the immune system.

    Science.gov (United States)

    Nikolich-Žugich, Janko

    2018-01-01

    Immunosenescence is a series of age-related changes that affect the immune system and, with time, lead to increased vulnerability to infectious diseases. This Review addresses recent developments in the understanding of age-related changes that affect key components of immunity, including the effect of aging on cells of the (mostly adaptive) immune system, on soluble molecules that guide the maintenance and function of the immune system and on lymphoid organs that coordinate both the maintenance of lymphocytes and the initiation of immune responses. I further address the effect of the metagenome and exposome as key modifiers of immune-system aging and discuss a conceptual framework in which age-related changes in immunity might also affect the basic rules by which the immune system operates.

  1. Sculpting humoral immunity through dengue vaccination to enhance protective immunity

    Directory of Open Access Journals (Sweden)

    Wayne eCrill

    2012-11-01

    Full Text Available Dengue viruses (DENV are the most important mosquito transmitted viral pathogens infecting humans. DENV infection produces a spectrum of disease, most commonly causing a self-limiting flu-like illness known as dengue fever; yet with increased frequency, manifesting as life-threatening dengue hemorrhagic fever (DHF. Waning cross-protective immunity from any of the four dengue serotypes may enhance subsequent infection with another heterologous serotype to increase the probability of DHF. Decades of effort to develop dengue vaccines are reaching the finishing line with multiple candidates in clinical trials. Nevertheless, concerns remain that imbalanced immunity, due to the prolonged prime-boost schedules currently used in clinical trials, could leave some vaccinees temporarily unprotected or with increased susceptibility to enhanced disease. Here we develop a DENV serotype 1 (DENV-1 DNA vaccine with the immunodominant cross-reactive B cell epitopes associated with immune enhancement removed. We compare wild-type (WT with this cross-reactivity reduced (CRR vaccine and demonstrate that both vaccines are equally protective against lethal homologous DENV-1 challenge. Under conditions mimicking natural exposure prior to acquiring protective immunity, WT vaccinated mice enhanced a normally sub-lethal heterologous DENV-2 infection resulting in DHF-like disease and 95% mortality in AG129 mice. However, CRR vaccinated mice exhibited redirected serotype-specific and protective immunity, and significantly reduced morbidity and mortality not differing from naïve mice. Thus, we demonstrate in an in vivo DENV disease model, that non-protective vaccine-induced immunity can prime vaccinees for enhanced DHF-like disease and that CRR DNA immunization significantly reduces this potential vaccine safety concern. The sculpting of immune memory by the modified vaccine and resulting redirection of humoral immunity provide insight into DENV vaccine induced immune

  2. Reconstructing Normality

    DEFF Research Database (Denmark)

    Gildberg, Frederik Alkier; Bradley, Stephen K.; Fristed, Peter Billeskov

    2012-01-01

    Forensic psychiatry is an area of priority for the Danish Government. As the field expands, this calls for increased knowledge about mental health nursing practice, as this is part of the forensic psychiatry treatment offered. However, only sparse research exists in this area. The aim of this study...... was to investigate the characteristics of forensic mental health nursing staff interaction with forensic mental health inpatients and to explore how staff give meaning to these interactions. The project included 32 forensic mental health staff members, with over 307 hours of participant observations, 48 informal....... The intention is to establish a trusting relationship to form behaviour and perceptual-corrective care, which is characterized by staff's endeavours to change, halt, or support the patient's behaviour or perception in relation to staff's perception of normality. The intention is to support and teach the patient...

  3. Pursuing Normality

    DEFF Research Database (Denmark)

    Madsen, Louise Sofia; Handberg, Charlotte

    2018-01-01

    implying an influence on whether to participate in cancer survivorship care programs. Because of "pursuing normality," 8 of 9 participants opted out of cancer survivorship care programming due to prospects of "being cured" and perceptions of cancer survivorship care as "a continuation of the disease......BACKGROUND: The present study explored the reflections on cancer survivorship care of lymphoma survivors in active treatment. Lymphoma survivors have survivorship care needs, yet their participation in cancer survivorship care programs is still reported as low. OBJECTIVE: The aim of this study...... was to understand the reflections on cancer survivorship care of lymphoma survivors to aid the future planning of cancer survivorship care and overcome barriers to participation. METHODS: Data were generated in a hematological ward during 4 months of ethnographic fieldwork, including participant observation and 46...

  4. Statistical Models of Adaptive Immune populations

    Science.gov (United States)

    Sethna, Zachary; Callan, Curtis; Walczak, Aleksandra; Mora, Thierry

    The availability of large (104-106 sequences) datasets of B or T cell populations from a single individual allows reliable fitting of complex statistical models for naïve generation, somatic selection, and hypermutation. It is crucial to utilize a probabilistic/informational approach when modeling these populations. The inferred probability distributions allow for population characterization, calculation of probability distributions of various hidden variables (e.g. number of insertions), as well as statistical properties of the distribution itself (e.g. entropy). In particular, the differences between the T cell populations of embryonic and mature mice will be examined as a case study. Comparing these populations, as well as proposed mixed populations, provides a concrete exercise in model creation, comparison, choice, and validation.

  5. Starvation stress affects the interplay among shrimp gut microbiota, digestion and immune activities.

    Science.gov (United States)

    Dai, Wen-Fang; Zhang, Jin-Jie; Qiu, Qiong-Fen; Chen, Jiong; Yang, Wen; Ni, Sui; Xiong, Jin-Bo

    2018-05-24

    Aquatic animals are frequently suffered from starvation due to restricted food availability or deprivation. It is currently known that gut microbiota assists host in nutrient acquisition. Thus, exploring the gut microbiota responses would improve our understanding on physiological adaptation to starvation. To achieve this, we investigated how the gut microbiota and shrimp digestion and immune activities were affected under starvation stress. The results showed that the measured digestion activities in starved shrimp were significantly lower than in normal cohorts; while the measured immune activities exhibited an opposite trend. A structural equation modeling (SEM) revealed that changes in the gut bacterial community were directly related to digestive and immune enzyme activities, which in turn markedly affected shrimp growth traits. Notably, several gut bacterial indicators that characterized the shrimp nutrient status were identified, with more abundant opportunistic pathogens in starved shrimp, although there were no statistical differences in the overall diversity and the structures of gut bacterial communities between starved and normal shrimp. Starved shrimp exhibited less connected and cooperative interspecies interaction as compared with normal cohorts. Additionally, the functional pathways involved in carbohydrate and protein digestion, glycan biosynthesis, lipid and enzyme metabolism remarkably decreased in starved shrimp. These attenuations could increase the susceptibility of starved shrimp to pathogens infection. In summary, this study provides novel insights into the interplay among shrimp digestion, immune activities and gut microbiota in response to starvation stress. Copyright © 2018. Published by Elsevier Ltd.

  6. Liver X receptor and peroxisome proliferator-activated receptor as integrators of lipid homeostasis and immunity.

    Science.gov (United States)

    Kidani, Yoko; Bensinger, Steven J

    2012-09-01

    Lipid metabolism has emerged as an important modulator of innate and adaptive immune cell fate and function. The lipid-activated transcription factors peroxisome proliferator-activated receptor (PPAR) α, β/δ, γ and liver X receptor (LXR) are members of the nuclear receptor superfamily that have a well-defined role in regulating lipid homeostasis and metabolic diseases. Accumulated evidence over the last decade indicates that PPAR and LXR signaling also influence multiple facets of inflammation and immunity, thereby providing important crosstalk between metabolism and immune system. Herein, we provide a brief introduction to LXR and PPAR biology and review recent discoveries highlighting the importance of PPAR and LXR signaling in the modulation of normal and pathologic states of immunity. We also examine advances in our mechanistic understanding of how nuclear receptors impact immune system function and homeostasis. Finally, we discuss whether LXRs and PPARs could be pharmacologically manipulated to provide novel therapeutic approaches for modulation of the immune system under pathologic inflammation or in the context of allergic and autoimmune disease. © 2012 John Wiley & Sons A/S.

  7. Adult Immunization

    Directory of Open Access Journals (Sweden)

    Omer Coskun

    2008-04-01

    Full Text Available Despite the many advances in modern medicine, each year thousands of people in the world die from diseases that are easily prevented by safe and effective vaccines. Few measures in preventive medicine are of such proven value and as easy to implement as routine immunization against infectious diseases. Prevention of infection by immunization is a lifelong process. There are a number of vaccines that all adults (¡I18 years require. There are also other vaccines that need to be tailored to meet individual variations in risk resulting from occupation, foreign travel, underlying illness, lifestyle and age. In this study, we tried to review this important subject. [TAF Prev Med Bull 2008; 7(2.000: 159-166

  8. Linear ubiquitination in immunity.

    Science.gov (United States)

    Shimizu, Yutaka; Taraborrelli, Lucia; Walczak, Henning

    2015-07-01

    Linear ubiquitination is a post-translational protein modification recently discovered to be crucial for innate and adaptive immune signaling. The function of linear ubiquitin chains is regulated at multiple levels: generation, recognition, and removal. These chains are generated by the linear ubiquitin chain assembly complex (LUBAC), the only known ubiquitin E3 capable of forming the linear ubiquitin linkage de novo. LUBAC is not only relevant for activation of nuclear factor-κB (NF-κB) and mitogen-activated protein kinases (MAPKs) in various signaling pathways, but importantly, it also regulates cell death downstream of immune receptors capable of inducing this response. Recognition of the linear ubiquitin linkage is specifically mediated by certain ubiquitin receptors, which is crucial for translation into the intended signaling outputs. LUBAC deficiency results in attenuated gene activation and increased cell death, causing pathologic conditions in both, mice, and humans. Removal of ubiquitin chains is mediated by deubiquitinases (DUBs). Two of them, OTULIN and CYLD, are constitutively associated with LUBAC. Here, we review the current knowledge on linear ubiquitination in immune signaling pathways and the biochemical mechanisms as to how linear polyubiquitin exerts its functions distinctly from those of other ubiquitin linkage types. © 2015 The Authors. Immunological Reviews Published by John Wiley & Sons Ltd.

  9. Learning and Memory... and the Immune System

    Science.gov (United States)

    Marin, Ioana; Kipnis, Jonathan

    2013-01-01

    The nervous system and the immune system are two main regulators of homeostasis in the body. Communication between them ensures normal functioning of the organism. Immune cells and molecules are required for sculpting the circuitry and determining the activity of the nervous system. Within the parenchyma of the central nervous system (CNS),…

  10. Gastrointestinal immune responses in HIV infected subjects

    Directory of Open Access Journals (Sweden)

    LRR Castello-Branco

    1996-06-01

    Full Text Available The gut associated lymphoid tissue is responsible for specific responses to intestinal antigens. During HIV infection, mucosal immune deficiency may account for the gastrointestinal infections. In this review we describe the humoral and cellular mucosal immune responses in normal and HIV-infected subjects.

  11. Complement System Part II: Role in Immunity

    Science.gov (United States)

    Merle, Nicolas S.; Noe, Remi; Halbwachs-Mecarelli, Lise; Fremeaux-Bacchi, Veronique; Roumenina, Lubka T.

    2015-01-01

    The complement system has been considered for a long time as a simple lytic cascade, aimed to kill bacteria infecting the host organism. Nowadays, this vision has changed and it is well accepted that complement is a complex innate immune surveillance system, playing a key role in host homeostasis, inflammation, and in the defense against pathogens. This review discusses recent advances in the understanding of the role of complement in physiology and pathology. It starts with a description of complement contribution to the normal physiology (homeostasis) of a healthy organism, including the silent clearance of apoptotic cells and maintenance of cell survival. In pathology, complement can be a friend or a foe. It acts as a friend in the defense against pathogens, by inducing opsonization and a direct killing by C5b–9 membrane attack complex and by triggering inflammatory responses with the anaphylatoxins C3a and C5a. Opsonization plays also a major role in the mounting of an adaptive immune response, involving antigen presenting cells, T-, and B-lymphocytes. Nevertheless, it can be also an enemy, when pathogens hijack complement regulators to protect themselves from the immune system. Inadequate complement activation becomes a disease cause, as in atypical hemolytic uremic syndrome, C3 glomerulopathies, and systemic lupus erythematosus. Age-related macular degeneration and cancer will be described as examples showing that complement contributes to a large variety of conditions, far exceeding the classical examples of diseases associated with complement deficiencies. Finally, we discuss complement as a therapeutic target. PMID:26074922

  12. Immunizations for Preterm Babies

    Science.gov (United States)

    ... Issues Health Issues Health Issues Conditions Injuries & Emergencies Vaccine Preventable Diseases ... Children > Safety & Prevention > Immunizations > Immunizations For Preterm Babies Safety & ...

  13. Weakened Immune Systems

    Science.gov (United States)

    ... Issues Health Issues Health Issues Conditions Injuries & Emergencies Vaccine Preventable Diseases ... Children > Safety & Prevention > Immunizations > Weakened Immune Systems Safety & Prevention ...

  14. Immunizations: Active vs. Passive

    Science.gov (United States)

    ... Issues Health Issues Health Issues Conditions Injuries & Emergencies Vaccine Preventable Diseases ... Children > Safety & Prevention > Immunizations > Immunizations: Active vs. Passive Safety & ...

  15. Role of Activin A in Immune Response to Breast Cancer

    Science.gov (United States)

    2014-12-01

    Innate and adaptive immune cells in the tumor microenvironment. Nat Immunol 14:1014-1022, 2013 10. Ji R-R, Chasalow SD, Wang L, et al: An immune... cells also generate reactive oxygen and nitrogen species that modify the chemokine and antigen receptors on CTLs both in the lymphoid organs and in the... cells . endogenous, evolutionarily conserved intracellular molecules that are released upon necrotic cell death. By linking the innate and adaptive immune

  16. [The role of the innate immune system in atopic dermatitis].

    Science.gov (United States)

    Volz, T; Kaesler, S; Skabytska, Y; Biedermann, T

    2015-02-01

    The mechanisms how the innate immune system detects microbes and mounts a rapid immune response have been more and more elucidated in the past years. Subsequently it has been shown that innate immunity also shapes adaptive immune responses and determines their quality that can be either inflammatory or tolerogenic. As atopic dermatitis is characterized by disturbances of innate and adaptive immune responses, colonization with pathogens and defects in skin barrier function, insight into mechanisms of innate immunity has helped to understand the vicious circle of ongoing skin inflammation seen in atopic dermatitis patients. Elucidating general mechanisms of the innate immune system and its functions in atopic dermatitis paves the way for developing new therapies. Especially the novel insights into the human microbiome and potential functional consequences make the innate immune system a very fundamental and promising target. As a result atopic dermatitis manifestations can be attenuated or even resolved. These currently developed strategies will be introduced in the current review.

  17. Efficient community-based control strategies in adaptive networks

    International Nuclear Information System (INIS)

    Yang Hui; Tang Ming; Zhang Haifeng

    2012-01-01

    Most studies on adaptive networks concentrate on the properties of steady state, but neglect transient dynamics. In this study, we pay attention to the emergence of community structure in the transient process and the effects of community-based control strategies on epidemic spreading. First, by normalizing the modularity, we investigate the evolution of community structure during the transient process, and find that a strong community structure is induced by the rewiring mechanism in the early stage of epidemic dynamics, which, remarkably, delays the outbreak of disease. We then study the effects of control strategies started at different stages on the prevalence. Both immunization and quarantine strategies indicate that it is not ‘the earlier, the better’ for the implementation of control measures. And the optimal control effect is obtained if control measures can be efficiently implemented in the period of a strong community structure. For the immunization strategy, immunizing the susceptible nodes on susceptible–infected links and immunizing susceptible nodes randomly have similar control effects. However, for the quarantine strategy, quarantining the infected nodes on susceptible–infected links can yield a far better result than quarantining infected nodes randomly. More significantly, the community-based quarantine strategy performs better than the community-based immunization strategy. This study may shed new light on the forecast and the prevention of epidemics among humans. (paper)

  18. Zinc and immunity: An essential interrelation.

    Science.gov (United States)

    Maares, Maria; Haase, Hajo

    2016-12-01

    The significance of the essential trace element zinc for immune function has been known for several decades. Zinc deficiency affects immune cells, resulting in altered host defense, increased risk of inflammation, and even death. The micronutrient zinc is important for maintenance and development of immune cells of both the innate and adaptive immune system. A disrupted zinc homeostasis affects these cells, leading to impaired formation, activation, and maturation of lymphocytes, disturbed intercellular communication via cytokines, and weakened innate host defense via phagocytosis and oxidative burst. This review outlines the connection between zinc and immunity by giving a survey on the major roles of zinc in immune cell function, and their potential consequences in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Mucosal immunity to pathogenic intestinal bacteria.

    Science.gov (United States)

    Perez-Lopez, Araceli; Behnsen, Judith; Nuccio, Sean-Paul; Raffatellu, Manuela

    2016-03-01

    The intestinal mucosa is a particularly dynamic environment in which the host constantly interacts with trillions of commensal microorganisms, known as the microbiota, and periodically interacts with pathogens of diverse nature. In this Review, we discuss how mucosal immunity is controlled in response to enteric bacterial pathogens, with a focus on the species that cause morbidity and mortality in humans. We explain how the microbiota can shape the immune response to pathogenic bacteria, and we detail innate and adaptive immune mechanisms that drive protective immunity against these pathogens. The vast diversity of the microbiota, pathogens and immune responses encountered in the intestines precludes discussion of all of the relevant players in this Review. Instead, we aim to provide a representative overview of how the intestinal immune system responds to pathogenic bacteria.

  20. The immune system vs. Pseudomonas aeruginosa biofilms

    DEFF Research Database (Denmark)

    Jensen, Peter Østrup; Givskov, Michael; Bjarnsholt, Thomas

    2010-01-01

    Ilya Metchnikoff and Paul Ehrlich were awarded the Nobel price in 1908. Since then, numerous studies have unraveled a multitude of mechanistically different immune responses to intruding microorganisms. However, in the vast majority of these studies, the underlying infectious agents have appeared...... in the planktonic state. Accordingly, much less is known about the immune responses to the presence of biofilm-based infections (which is probably also due to the relatively short period of time in which the immune response to biofilms has been studied). Nevertheless, more recent in vivo and in vitro studies have...... revealed both innate as well as adaptive immune responses to biofilms. On the other hand, measures launched by biofilm bacteria to achieve protection against the various immune responses have also been demonstrated. Whether particular immune responses to biofilm infections exist remains to be firmly...

  1. Immune disorders in anorexia

    Directory of Open Access Journals (Sweden)

    Sylwia Małgorzata Słotwińska

    2017-10-01

    Full Text Available Anorexia nervosa is a disease involving eating disorders. It mainly affects young people, especially teenage women. The disease is often latent and occurs in many sub-clinical and partial forms. Approximately from 0.3% to 1% of the population suffers from anorexia. It has been shown that patients with anorexia develop neurotransmitter-related disorders, leading to uncontrolled changes in the immune and endocrine systems. Interactions between cytokines, neuropeptides, and neurotransmitters play an important role in disease development. Significant malnutrition induces disorders and alterations in T-cell populations. The cellular response in patients with anorexia nervosa has been shown to be normal, although opinions on this issue are controversial. Laboratory studies on neutrophils in anorexia patients showed decreased adhesion and reduced bactericidal and cell activities. Despite such unfavourable results, patients with anorexia are resistant to infections, which are very rare in this group. Glutamine improves the performance of the human immune system. The administration of glutamine to anorexia patients, as a supplement to parenteral nutrition, has resulted in significant improvements in immune system parameters. The results of previous studies on the causes and risk factors in the development of anorexia nervosa are still ambiguous. One can hope that the differences and similarities between patients with anorexia nervosa and those with other forms of protein-calorie malnutrition may be helpful in determining the relationship between nutritional status and body defences and susceptibility to infection, and can help to broaden the knowledge about the aetiopathogenesis of anorexia nervosa.

  2. Immune disorders in anorexia.

    Science.gov (United States)

    Słotwińska, Sylwia Małgorzata; Słotwiński, Robert

    2017-01-01

    Anorexia nervosa is a disease involving eating disorders. It mainly affects young people, especially teenage women. The disease is often latent and occurs in many sub-clinical and partial forms. Approximately from 0.3% to 1% of the population suffers from anorexia. It has been shown that patients with anorexia develop neurotransmitter-related disorders, leading to uncontrolled changes in the immune and endocrine systems. Interactions between cytokines, neuropeptides, and neurotransmitters play an important role in disease development. Significant malnutrition induces disorders and alterations in T-cell populations. The cellular response in patients with anorexia nervosa has been shown to be normal, although opinions on this issue are controversial. Laboratory studies on neutrophils in anorexia patients showed decreased adhesion and reduced bactericidal and cell activities. Despite such unfavourable results, patients with anorexia are resistant to infections, which are very rare in this group. Glutamine improves the performance of the human immune system. The administration of glutamine to anorexia patients, as a supplement to parenteral nutrition, has resulted in significant improvements in immune system parameters. The results of previous studies on the causes and risk factors in the development of anorexia nervosa are still ambiguous. One can hope that the differences and similarities between patients with anorexia nervosa and those with other forms of protein-calorie malnutrition may be helpful in determining the relationship between nutritional status and body defences and susceptibility to infection, and can help to broaden the knowledge about the aetiopathogenesis of anorexia nervosa.

  3. Integrated Circuit Immunity

    Science.gov (United States)

    Sketoe, J. G.; Clark, Anthony

    2000-01-01

    This paper presents a DOD E3 program overview on integrated circuit immunity. The topics include: 1) EMI Immunity Testing; 2) Threshold Definition; 3) Bias Tee Function; 4) Bias Tee Calibration Set-Up; 5) EDM Test Figure; 6) EMI Immunity Levels; 7) NAND vs. and Gate Immunity; 8) TTL vs. LS Immunity Levels; 9) TP vs. OC Immunity Levels; 10) 7805 Volt Reg Immunity; and 11) Seventies Chip Set. This paper is presented in viewgraph form.

  4. Role of immune system in tumor progression and carcinogenesis.

    Science.gov (United States)

    Upadhyay, Shishir; Sharma, Nidhi; Gupta, Kunj Bihari; Dhiman, Monisha

    2018-01-12

    Tumor micro-environment has potential to customize the behavior of the immune cell according to their need. In immune-eliminating phase, immune cells eliminate transformed cells but after tumor establishment innate and adaptive immune cells synergistically provide shelter as well as fulfill their requirement that helps in progression. In between eliminating and establishment phase, equilibrium and escaping phase regulate the immune cells response. During immune-escaping, (1) the antigenic response generated is either inadequate, or focused entirely on tolerance, and (2) immune response generated is specific and effective, but the tumor skips immune recognition. In this review, we are discussing the critical role of immune cells and their cytokines before and after the establishment of tumor which might play a critical role during immunotherapy. © 2018 Wiley Periodicals, Inc.

  5. Genomic prediction accounting for genotype by environment interaction offers an effective framework for breeding simultaneously for adaptation to an abiotic stress and performance under normal cropping conditions in rice

    OpenAIRE

    Ahmadi, Nourollah; Cao, Tuong-Vi; Valé, Giampiero; Bartholomé, Jérôme; Hassen, Manel

    2018-01-01

    Developing rice varieties adapted to alternate wetting and drying water management is crucial for the sustainability of irrigated rice cropping systems. Here we report the first study exploring the feasibility of breeding rice for adaptation to alternate wetting and drying using genomic prediction methods that account for genotype by environment interactions. Two breeding populations (a reference panel of 284 accessions and a progeny population of 97 advanced lines) were evaluated under alter...

  6. Environmental exposure to lead induces oxidative stress and modulates the function of the antioxidant defense system and the immune system in the semen of males with normal semen profile

    Energy Technology Data Exchange (ETDEWEB)

    Kasperczyk, Aleksandra; Dobrakowski, Michał [Dept. of Biochemistry, School of Medicine with the Division of Dentistry, Medical University of Silesia, Katowice, Jordana 19, 41-808 Zabrze (Poland); Czuba, Zenon P. [Dept. of Microbiology and Immunology, School of Medicine with the Division of Dentistry, Medical University of Silesia, Katowice, Jordana 19, 41-808 Zabrze (Poland); Horak, Stanisław [I-st Chair and Clin. Dept. of Gynecology, Obstetrics and Gynecological Oncology, School of Medicine with the Division of Dentistry, Medical University of Silesia, Katowice, Batorego 15, 41-902 Bytom (Poland); Kasperczyk, Sławomir, E-mail: kaslav@mp.pl [Dept. of Biochemistry, School of Medicine with the Division of Dentistry, Medical University of Silesia, Katowice, Jordana 19, 41-808 Zabrze (Poland)

    2015-05-01

    We investigated the associations between environmental exposure to lead and a repertoire of cytokines in seminal plasma of males with normal semen profile according to the WHO criteria. Based on the median lead concentration in seminal plasma, 65 samples were divided into two groups: low (LE) and high exposure to lead (HE). Differences in semen volume and the pH, count, motility and morphology of sperm cells were not observed between the examined groups. The total oxidant status value and the level of protein sulfhydryl groups as well as the activities of manganese superoxide dismutase and catalase were significantly higher in the HE group, whereas the total antioxidant capacity value and the activities of glutathione reductase and glutathione-S-transferase were depressed. IL-7, IL-10, IL-12, and TNF-α levels were significantly higher in the HE group compared with the LE group. Environmental exposure to lead is sufficient to induce oxidative stress in seminal plasma and to modulate antioxidant defense system. - Highlights: • Lead induces oxidative stress in seminal plasma in human. • Lead modulates antioxidant defense system in seminal plasma in human. • Lead does not change a Th1/Th2 imbalance in seminal plasma in human.

  7. Cholinergic Modulation of Type 2 Immune Responses

    Directory of Open Access Journals (Sweden)

    Goele Bosmans

    2017-12-01

    Full Text Available In recent years, the bidirectional relationship between the nervous and immune system has become increasingly clear, and its role in both homeostasis and inflammation has been well documented over the years. Since the introduction of the cholinergic anti-inflammatory pathway, there has been an increased interest in parasympathetic regulation of both innate and adaptive immune responses, including T helper 2 responses. Increasing evidence has been emerging suggesting a role for the parasympathetic nervous system in the pathophysiology of allergic diseases, including allergic rhinitis, asthma, food allergy, and atopic dermatitis. In this review, we will highlight the role of cholinergic modulation by both nicotinic and muscarinic receptors in several key aspects of the allergic inflammatory response, including barrier function, innate and adaptive immune responses, and effector cells responses. A better understanding of these cholinergic processes mediating key aspects of type 2 immune disorders might lead to novel therapeutic approaches to treat allergic diseases.

  8. Mast cell activators as novel immune regulators.

    Science.gov (United States)

    Johnson-Weaver, Brandi; Choi, Hae Woong; Abraham, Soman N; Staats, Herman F

    2018-05-26

    Mast cells are an important cell type of the innate immune system that when activated, play a crucial role in generating protective innate host responses after bacterial and viral infection. Additionally, activated mast cells influence lymph node composition to regulate the induction of adaptive immune responses. The recognition that mast cells play a beneficial role in host responses to microbial infection and induction of adaptive immunity has provided the rationale to evaluate mast cell activators for use as antimicrobials or vaccine adjuvants. This review summarizes the role of mast cell activators in antimicrobial responses while also discussing the use of different classes of mast cell activators as potent vaccine adjuvants that enhance the induction of protective immune responses. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. The ontogeny of the porcine immune system

    Czech Academy of Sciences Publication Activity Database

    Šinkora, Marek; Butler, J. E.

    2009-01-01

    Roč. 33, č. 3 (2009), s. 273-283 ISSN 0145-305X R&D Projects: GA ČR GA524/07/0087; GA ČR GA523/07/0088 Institutional research plan: CEZ:AV0Z50200510 Keywords : ontogeny of the porcine immune system * swine adaptive immunity * development of alpha beta and gamma delta T cells Subject RIV: EC - Immunology Impact factor: 3.290, year: 2009

  10. Anthrax Lethal Toxin Impairs Innate Immune Functions of Alveolar Macrophages and Facilitates Bacillus anthracis Survival

    National Research Council Canada - National Science Library

    Ribot, Wilson J; Panchal, Rekha G; Brittingham, Katherine C; Ruthel, Gordon; Kenny, Tara A; Lane, Douglas; Curry, Bob; Hoover, Timothy A; Friedlander, Arthur M; Bavari, Sina

    2006-01-01

    Alveolar macrophages (AM) are very important for pulmonary innate immune responses against invading inhaled pathogens because they directly kill the organisms and initiate a cascade of innate and adaptive immune responses...

  11. Genome-wide analysis of differential transcriptional and epigenetic variability across human immune cell types

    DEFF Research Database (Denmark)

    Ecker, Simone; Chen, Lu; Pancaldi, Vera

    2017-01-01

    Background: A healthy immune system requires immune cells that adapt rapidly to environmental challenges. This phenotypic plasticity can be mediated by transcriptional and epigenetic variability. Results: We apply a novel analytical approach to measure and compare transcriptional and epigenetic v...

  12. Immune System Quiz

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Quiz: Immune System KidsHealth / For Kids / Quiz: Immune System Print How much do you know about your immune system? Find out by taking this quiz! About Us ...

  13. Immunization Schedules for Adults

    Science.gov (United States)

    ... ACIP Vaccination Recommendations Why Immunize? Vaccines: The Basics Immunization Schedule for Adults (19 Years of Age and ... diseases that can be prevented by vaccines . 2018 Immunization Schedule Recommended Vaccinations for Adults by Age and ...

  14. Immunizations and African Americans

    Science.gov (United States)

    ... Data > Minority Population Profiles > Black/African American > Immunizations Immunizations and African Americans African American adults are less ... 19 to 35 months had comparable rates of immunization. African American women are as likely to have ...

  15. Instant Childhood Immunization Schedule

    Science.gov (United States)

    ... Recommendations Why Immunize? Vaccines: The Basics Instant Childhood Immunization Schedule Recommend on Facebook Tweet Share Compartir Get ... date. See Disclaimer for additional details. Based on Immunization Schedule for Children 0 through 6 Years of ...

  16. Microbial-immune cross-talk and regulation of the immune system.

    Science.gov (United States)

    Cahenzli, Julia; Balmer, Maria L; McCoy, Kathy D

    2013-01-01

    We are all born germ-free. Following birth we enter into a lifelong relationship with microbes residing on our body's surfaces. The lower intestine is home to the highest microbial density in our body, which is also the highest microbial density known on Earth (up to 10(12) /g of luminal contents). With our indigenous microbial cells outnumbering our human cells by an order of magnitude our body is more microbial than human. Numerous immune adaptations confine these microbes within the mucosa, enabling most of us to live in peaceful homeostasis with our intestinal symbionts. Intestinal epithelial cells not only form a physical barrier between the bacteria-laden lumen and the rest of the body but also function as multi-tasking immune cells that sense the prevailing microbial (apical) and immune (basolateral) milieus, instruct the underlying immune cells, and adapt functionally. In the constant effort to ensure intestinal homeostasis, the immune system becomes educated to respond appropriately and in turn immune status can shape the microbial consortia. Here we review how the dynamic immune-microbial dialogue underlies maturation and regulation of the immune system and discuss recent findings on the impact of diet on both microbial ecology and immune function. © 2012 The Authors. Immunology © 2012 Blackwell Publishing Ltd.

  17. T cell immunity

    OpenAIRE

    Emel Bülbül Başkan

    2013-01-01

    Since birth, our immune system is constantly bombarded with self-antigens and foreign pathogens. To stay healthy, complex immune strategies have evolved in our immune system to maintain self-tolerance and to defend against foreign pathogens. Effector T cells are the key players in steering the immune responses to execute immune functions. While effector T cells were initially identified to be immune promoting, recent studies unraveled negative regulatory functions of effector T cells...

  18. Immune Evasion by Epstein-Barr Virus.

    Science.gov (United States)

    Ressing, Maaike E; van Gent, Michiel; Gram, Anna M; Hooykaas, Marjolein J G; Piersma, Sytse J; Wiertz, Emmanuel J H J

    2015-01-01

    Epstein-Bar virus (EBV) is widespread within the human population with over 90% of adults being infected. In response to primary EBV infection, the host mounts an antiviral immune response comprising both innate and adaptive effector functions. Although the immune system can control EBV infection to a large extent, the virus is not cleared. Instead, EBV establishes a latent infection in B lymphocytes characterized by limited viral gene expression. For the production of new viral progeny, EBV reactivates from these latently infected cells. During the productive phase of infection, a repertoire of over 80 EBV gene products is expressed, presenting a vast number of viral antigens to the primed immune system. In particular the EBV-specific CD4+ and CD8+ memory T lymphocytes can respond within hours, potentially destroying the virus-producing cells before viral replication is completed and viral particles have been released. Preceding the adaptive immune response, potent innate immune mechanisms provide a first line of defense during primary and recurrent infections. In spite of this broad range of antiviral immune effector mechanisms, EBV persists for life and continues to replicate. Studies performed over the past decades have revealed a wide array of viral gene products interfering with both innate and adaptive immunity. These include EBV-encoded proteins as well as small noncoding RNAs with immune-evasive properties. The current review presents an overview of the evasion strategies that are employed by EBV to facilitate immune escape during latency and productive infection. These evasion mechanisms may also compromise the elimination of EBV-transformed cells, and thus contribute to malignancies associated with EBV infection.

  19. Effects of dietary Lactobacillus plantarum in different treatments on growth performance and immune gene expression of white shrimp Litopenaeus vannamei under normal condition and stress of acute low salinity.

    Science.gov (United States)

    Zheng, Xiaoting; Duan, Yafei; Dong, Hongbiao; Zhang, Jiasong

    2017-03-01

    A 45-day feeding trial followed by an acute stress test of low salinity was done to evaluate effects of Lactobacillus plantarum on growth performance and anti-stress capability of white shrimp (Litopenaeus vannamei). Shrimp were randomly allocated in 15 tanks (100 shrimp per tank) and divided into 5 treatments with 3 replicates. Triplicate tanks were fed with a control diet or diets containing different treatments of L. plantarum (fermentation supernatant (FS), live bacteria (LB), dead bacteria (DB) and cell-free extract (CE) of L. plantarum) as treatment groups. Growth performance including weight gain (WGR), feed conversion ratio (FCR) and specific growth rate (SGR) were determined after feeding 45 days. Anti-stress capacity was evaluated by determining the gene expression of ProPO, SOD and Lys in gut of shrimp at the end of feeding trial and again at 96 h post-stress test. Results indicated that supplementation of L. plantarum into diet had significantly improved growth performance of L. vannamei. On the other hand, L. plantarum supplementation had no significant effects on the gene expression of SOD and Lys in gut of shrimp cultured under normal condition for 45 days. Supplementation of L. plantarum had increased survivability of L. vannamei having higher survival rates compared to the control group. However, statistical analysis showed no significant difference between the control group and treatments. Compared with the control group, supplementation of L. plantarum significantly improved the resistance of L. vannamei against the stress of acute low salinity, as indicated by higher survival rate as well as higher transcript levels of ProPo, SOD and Lys gene. Our findings suggested that L. plantarum, especially cell-free extract of L. plantarum has improved the anti-stress capacity of L. vannamei and could serve as a potential feed additive that helps shrimp to overcome environmental stresses. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Functions of innate immune cells and commensal bacteria in gut homeostasis.

    Science.gov (United States)

    Kayama, Hisako; Takeda, Kiyoshi

    2016-02-01

    The intestinal immune system remains unresponsive to beneficial microbes and dietary antigens while activating pro-inflammatory responses against pathogens for host defence. In intestinal mucosa, abnormal activation of innate immunity, which directs adaptive immune responses, causes the onset and/or progression of inflammatory bowel diseases. Thus, innate immunity is finely regulated in the gut. Multiple innate immune cell subsets have been identified in both murine and human intestinal lamina propria. Some innate immune cells play a key role in the maintenance of gut homeostasis by preventing inappropriate adaptive immune responses while others are associated with the pathogenesis of intestinal inflammation through development of Th1 and Th17 cells. In addition, intestinal microbiota and their metabolites contribute to the regulation of innate/adaptive immune responses. Accordingly, perturbation of microbiota composition can trigger intestinal inflammation by driving inappropriate immune responses. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  1. The role of extracellular vesicles when innate meets adaptive.

    Science.gov (United States)

    Groot Kormelink, Tom; Mol, Sanne; de Jong, Esther C; Wauben, Marca H M

    2018-04-03

    Innate immune cells are recognized for their rapid and critical contribution to the body's first line of defense against invading pathogens and harmful agents. These actions can be further amplified by specific adaptive immune responses adapted to the activating stimulus. Recently, the awareness has grown that virtually all innate immune cells, i.e., mast cells, neutrophils, macrophages, eosinophils, basophils, and NK cells, are able to communicate with dendritic cells (DCs) and/or T and B cells, and thereby significantly contribute to the orchestration of adaptive immune responses. The means of communication that are thus far primarily associated with this function are cell-cell contacts and the release of a broad range of soluble mediators. Moreover, the possible contribution of innate immune cell-derived extracellular vesicles (EVs) to the modulation of adaptive immunity will be outlined in this review. EVs are submicron particles composed of a lipid bilayer, proteins, and nucleic acids released by cells in a regulated fashion. EVs are involved in intercellular communication between multiple cell types, including those of the immune system. A good understanding of the mechanisms by which innate immune cell-derived EVs influence adaptive immune responses, or vice versa, may reveal novel insights in the regulation of the immune system and can open up new possibilities for EVs (or their components) in controlling immune responses, either as a therapy, target, or as an adjuvant in future immune modulating treatments.

  2. Immunization Action Coalition

    Science.gov (United States)

    ... IAC | Contact | A-Z Index | Donate | Shop | SUBSCRIBE Immunization Action Coalition Favorites ACIP Recommendations Package Inserts Additional Immunization Resources Photos Adult Vaccination Screening Checklists Ask the ...

  3. Regional specialization within the intestinal immune system

    DEFF Research Database (Denmark)

    Mowat, Allan M.; Agace, William Winston

    2014-01-01

    The intestine represents the largest compartment of the immune system. It is continually exposed to antigens and immunomodulatory agents from the diet and the commensal microbiota, and it is the port of entry for many clinically important pathogens. Intestinal immune processes are also increasingly...... implicated in controlling disease development elsewhere in the body. In this Review, we detail the anatomical and physiological distinctions that are observed in the small and large intestines, and we suggest how these may account for the diversity in the immune apparatus that is seen throughout...... the intestine. We describe how the distribution of innate, adaptive and innate-like immune cells varies in different segments of the intestine and discuss the environmental factors that may influence this. Finally, we consider the implications of regional immune specialization for inflammatory disease...

  4. Transport modeling: An artificial immune system approach

    Directory of Open Access Journals (Sweden)

    Teodorović Dušan

    2006-01-01

    Full Text Available This paper describes an artificial immune system approach (AIS to modeling time-dependent (dynamic, real time transportation phenomenon characterized by uncertainty. The basic idea behind this research is to develop the Artificial Immune System, which generates a set of antibodies (decisions, control actions that altogether can successfully cover a wide range of potential situations. The proposed artificial immune system develops antibodies (the best control strategies for different antigens (different traffic "scenarios". This task is performed using some of the optimization or heuristics techniques. Then a set of antibodies is combined to create Artificial Immune System. The developed Artificial Immune transportation systems are able to generalize, adapt, and learn based on new knowledge and new information. Applications of the systems are considered for airline yield management, the stochastic vehicle routing, and real-time traffic control at the isolated intersection. The preliminary research results are very promising.

  5. The Immune Epitope Database 2.0

    DEFF Research Database (Denmark)

    Hoof, Ilka; Vita, R; Zarebski, L

    2010-01-01

    The Immune Epitope Database (IEDB, www.iedb.org) provides a catalog of experimentally characterized B and T cell epitopes, as well as data on Major Histocompatibility Complex (MHC) binding and MHC ligand elution experiments. The database represents the molecular structures recognized by adaptive...... immune receptors and the experimental contexts in which these molecules were determined to be immune epitopes. Epitopes recognized in humans, nonhuman primates, rodents, pigs, cats and all other tested species are included. Both positive and negative experimental results are captured. Over the course...

  6. Innate immune system and preeclampsia

    Directory of Open Access Journals (Sweden)

    Alejandra ePerez-Sepulveda

    2014-05-01

    Full Text Available Normal pregnancy is considered as a Th2 type immunological state that favors an immune-tolerance environment in order to prevent fetal rejection. PE has been classically described as a Th1/Th2 imbalance; however, the Th1/Th2 paradigm has proven insufficient to fully explain the functional and molecular changes observed during normal/pathological pregnancies. Recent studies have expanded the Th1/Th2 into a Th1⁄Th2⁄Th17 and regulatory T (Treg cells paradigm and where dendritic cells could have a crucial role. Recently, some evidence has emerged supporting the idea that mesenchymal stem cells might be part of the feto-maternal tolerance environment. This review will discuss the involvement of the innate immune system in the establishment of a physiological environment that favors pregnancy and possible alterations related to the development of preeclampsia.

  7. Senescence in immune priming and attractiveness in a beetle.

    Science.gov (United States)

    Daukšte, J; Kivleniece, I; Krama, T; Rantala, M J; Krams, I

    2012-07-01

    Age-related decline in immune activity is referred to as immunosenescence and has been observed for both the adaptive immune response of vertebrates and the innate immune system of invertebrates. Because maintaining a basic level of immune defence and mounting an immune response is costly, optimal investment in immune function should vary over a wide range of individual states such as the individual's age. In this study, we tested whether the immune response and immunological priming within individuals become less efficient with age using mealworm beetles, Tenebrio molitor, as a model organism. We also tested whether ageing and immunological priming affected the odours produced by males. We found that young males of T. molitor were capable of mounting an immune response a sterile nylon monofilament implant with the potential to exhibit a simple form of immune memory through mechanisms of immune priming. Older males did not increase their immune response to a second immune challenge, which negatively affected their sexual attractiveness and remaining life span. Our results indicate that the immune system of older males in T. molitor is less effective, suggesting complex evolutionary trade-offs between ageing, immune response and sexual attractiveness. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

  8. Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response

    Science.gov (United States)

    Qiao, Guanxi; Chen, Minhui; Bucsek,