
Sample records for non-transplanted thalassemia major

  1. Endocrinopathies in thalassemia major patient (United States)

    Lubis, D. A.; Yunir, E. M.


    Advanced in chelation therapy and regular blood transfusion have marked improvements in the life expectancy of patients with thalassemia major, however these patients still have to deal with several complications. We report a 19-year-old male, presented with multiple endocrine complication-related thalassemia; hypogonadism, short stature, osteoporosis with history of fracture, and subclinical hypothyroid.

  2. Psychosocial implications of Thalassemia Major. (United States)

    Aydinok, Yesim; Erermis, Serpil; Bukusoglu, Nagihan; Yilmaz, Deniz; Solak, Ufuk


    Many causes including the chronicity of disease, burden of treatment modalities, morbidities, and the expectation of early death resulting from the disease complications, may lead to psychosocial burden in Thalassemia Major (TM) patients. A total of 38 patients with TM and their mothers were recruited to evaluate the psychosocial burden as well as to disclose whether the psychological status of the patients contribute to the compliance with the therapy or to the contrary. Demographic and disease variables were obtained. Child Behavior Check-list (CBCL) was completed by the mothers of the patients. A detailed psychiatric interview based on the 4th edition of the Diagnostic and Statistical Manual diagnostic criteria was performed for each patient. Symptom Distress Checklist 90 (SCL-90) scale was given to all mothers for evaluating their psychopathology. Although CBCL scores remained between the normal ranges, desferrioxamine mesylate (DFO)-compliant patients and the patients with lower ferritin values had significantly higher scores. A total of 24% of the patients had a psychiatric diagnosis including major depression, anxiety disorder, tic disorder, and enuresis nocturnal. The psychiatric diagnosis was significantly higher in the patients who were compliant with desferrioxamine compared with the non-compliant group (P = 0.007). The SCL-90 scores indicated that the mothers who had a child with good adherence to DFO had higher scale scores than the mothers with a poor adherent child. The increase risk of psychosocial and behavioral problems in thalassemics and their parents indicated the importance of a lifelong psychosocial support for the prevention of mental health issues. The patients and their parents, who were more conscious of the illness, were more worried but more compliant with the therapy and need stronger psychiatric support.

  3. [Oromaxillofacial changes in thalassemia major]. (United States)

    De Mattia, D; Pettini, P L; Sabato, V; Rubini, G; Laforgia, A; Schettini, F


    Sixty patients (31 male and 29 female) with thalassemia major, aged between 6 and 26 years, 18 of which were splenectomized, were observed in this study evaluating the oro-maxillo-facial alterations and correlating them to transfusion indexes, serum ferritin levels, splenectomy and age. For each patient a haematologic and odontostomatologic card was filed with a view to report the medical and clinical history regarding: the haematologic picture, the prevention of caries and parodontal disease, the facies characteristics, the odonto-stomatologic examination, the orthodontic diagnosis, the skull X-rays and the orthopantomography. Poor oral hygiene as well as misknowledge of prevention were generally observed. All the patients showed carious lesions but most of them had never seen a dentist for therapy. The disharmonious growth of splanchnocranium, with the enlargement of the jaw and of its alveolar process, induced by the bone marrow hyperplasia, produced various and serious malocclusion stages (Angle's II class, deep bite, open bite), gnathologic alterations, hypodiaphanous paranasal sinuses and orbital hypertelorism, with a typical oriental-like facies. Malocclusion and the poor oral hygienic conditions determined the occurrence of marginal gingivitis, mainly localized at the level of the lower frontal teeth. In only 3 patients the oral mucous membrane was pale and atrophic. During this investigation agenesia and dental retention were reported in 30% and in 26% of the examined cases respectively, while no patients had supernumerary teeth. Tooth volume, position and shape abnormalities rarely occurred. Only in two patients was enamel hypoplasia described. The caries frequency greatly varied in number and in degree. Only five patients did not show any carious lesions. The caries index (DMF) for the permanent teeth calculated in all the 60 subjects was 5, 12 +/- 4.76. By utilizing Spearman's rank test the number of teeth with caries in the permanent dentition (DFM

  4. Thalassemias (United States)

    ... Intramural Research Home / Thalassemias Thalassemias Also known as What Is Thalassemias (thal-a- ... of thalassemia, go to "What Causes Thalassemias?" ) Alpha Thalassemias Alpha thalassemia silent carrier Alpha thalassemia minor, also ...

  5. Portal vein thrombosis after splenectomy for beta-thalassemia major

    International Nuclear Information System (INIS)

    Al-Hawsawi, Zakaria M.; Tarawah, Ahmed M.; Hassan, Ruhul Amin A.; Haouimi, Ammar S.


    Portal vein thrombosis is a recognized complication after splenectomy for beta-thalassemia major due to the chronic hypercoagulable state which has been recognized to exist in childhood thalassemia and contribute to thromboembolic events. We reporting one patient with beta-thalassemia major developed portal vein thrombosis following splenectomy. (author)

  6. Scintigraphic evaluation of bone involvement in beta thalassemia major

    International Nuclear Information System (INIS)

    Armijo, Soledad; Hidalgo, Pablo


    In this article, the authors describe a 19 year old man with beta-thalassemia major and back pain, who was studied with a Tc99m Metilendiphosphonate (Tc99m MDP) bone scan. This case shows many of the complications of beta-thalassemia major in the skeletal system. Also we can see some indirect signs of endocrinopathies associated (Au)

  7. A comparison of heart function and arrhythmia in clinically asymptomatic patients with beta thalassemia intermedia and beta thalassemia major. (United States)

    Amoozgar, Hamid; Zeighami, Samaneh; Haghpanah, Sezaneh; Karimi, Mehran


    The goal of this study was to compare heart function and arrhythmia in clinically asymptomatic patients with beta thalassemia intermedia and beta thalassemia major. In this cross-sectional study, 60 patients with beta thalassemia major and 60 patients with beta thalassemia intermedia who had clinically no symptoms of arrhythmia and clinically normal heart function were evaluated using 24-hour ambulatory electrocardiogram monitoring and echocardiography. For data analysis SPSS ver.20 software was used. A P-value of less than 0.05 was considered statistically significant. The mean age of the beta thalassemia intermedia patients was 24.18 ± 7.9 years and the mean age in beta thalassemia major was 24.38 ± 7.7 years (P>0.05). Premature atrial contractions (PACs) were observed in 14 (23.3%) patients with beta thalassemia intermedia and in 22 (36.6%) beta thalassemia major patients. Premature ventricular contractions (PVCs) were detected in 8 (13.3%) patients in the beta thalassemia intermediate group and 16 (26.6) patients in the beta thalassemia major group, respectively. The left ventricular diastolic dimension, end-diastolic volume, and stroke volume were significantly higher in beta thalassemia intermedia group (Pintermedia group. Both atrial and ventricular arrhythmias were more common in the beta thalassemia major group. Higher end-diastolic volume and stroke volume were detected in the beta thalassemia intermedia group. Pulmonary acceleration time was lower in the beta thalassemia intermedia group, which can be an indicator of higher pulmonary pressure.

  8. Thalassemia (United States)

    Mediterranean anemia; Cooley anemia; Beta thalassemia; Alpha thalassemia ... alpha globin protein are missing or changed (mutated). Beta thalassemia occurs when similar gene defects affect production of ...

  9. Parathyroid hormone in pediatric patients with β-thalassemia major ...

    African Journals Online (AJOL)

    The aim of the study is to estimate the level of serum parathyroid hormone and its relation to bone mineral density in transfusion dependent beta-thalassemia major children. Subjects and methods: We measured serum calcium, phosphorus and parathyroid hormone in a sample of pediatric patients with thalassemia, ...

  10. Mental health status in patients with Thalassemia major in Iran

    Directory of Open Access Journals (Sweden)

    Mahdieh Nasiri


    Full Text Available Thalassemia major is a genetic blood disorder that is detected by the symptoms of chronic and severe anemia, enlarged liver and spleen, failure to thrive and bone deformities in particular deformed face and bulging forehead. Due to changes in physical appearance, the disease can influence on other aspects of the patient's life, so the disease can have a strong impact on the mental health of these patients and their families. Previous studies showed that 80% of patients with thalassemia major have at least one psychiatric disorder. The aim of this paper was to review the mental health status of patients with Beta-thalassemia major in Iran.


    Directory of Open Access Journals (Sweden)

    Amit Kumar Tiwari


    Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

  12. Thalassemia major and consanguinity in Shiraz city, Iran. (United States)

    Asadi-Pooya, Ali Akbar; Doroudchi, Mehrnoosh


    Beta-thalassemia is among the most common genetic disorders in the world and in Iran, with widespread occurrence. A cross-sectional study on 648 beta-thalassemia patients in Shiraz, Iran was carried out to determine the demography of beta-thalassemia major in Shiraz city, Fars province, Iran and also the rate of consanguinity and the significance of pre-marriage counseling in decreasing familial marriages and consequently preventing this autosomal recessive genetic disease. All interviewed patients had thalassemia major and their age, sex, and the consanguinity between parents were recorded. 40.6% of beta-thalassemia patients were outcomes of first-cousin marriages. Comparison of the percentages of familial marriages (consanguinity) between parents of beta-thalassemia patients and a sample of normal population, revealed a statistically significant difference (pmarriages among thalassemic families, however, more education and awareness of young women and men about the increased risk of beta-thalassemia after familial marriage through pre-marriage counseling is still necessary.

  13. Hepatic uptake of technetium-99m diphosphonate in thalassemia major

    International Nuclear Information System (INIS)

    Levy, H.M.; Smith, R.


    Two cases of thalassemia major are presented in which bone scintigraphy demonstrated diffuse hepatic uptake of Tc-99m diphosphonate. Although abnormal splenic and renal uptake of Tc-99m phosphates has been reported in patients with thalassemia major, hepatic uptake has not been reported previously. This scintigraphic finding is presumably due to increased iron deposition in the liver, resulting from increased iron turnover and retention in these patients and from multiple previous blood transfusions

  14. Diabetes mellitus in β-thalassemia major patients

    Directory of Open Access Journals (Sweden)

    Riadi Wirawan


    Full Text Available β-thalassemia major is a disease caused by β polypeptide chain synthesis disorder which is inherited as an autosomal recessive from both parents which is marked by little or no β globin chain synthesis. Medication for β thalassemia major patients is by repeated blood transfusions, which causes hemochromatosis. Hemochromatosis can occur in various organs including the pancreas. The aim of the study was to assess the alteration of plasma glucose concentration and the hemochromatosis prevalence. Fasting plasma glucose concentration and serum ferritin examination were measured in 115 β thalassemia major patients with ages between 10-23 years who were out-patients in the Thalassemia Centre, Department of Child Health, Medical School, University of Indonesia / Dr. Cipto Mangunkusumo General Hospital, Jakarta. The plasma glucose concentration examination was conducted by the GDH enzymatic method, with American Diabetes Association (ADA criteria in the evaluation, while the serum ferritin examination was conducted with the microparticle enzyme immuno assay (MEIA method. All patients had hemochromatosis, 14.8% of the patients had impaired fasting glucose level and 2.6% of the patients showed indications of diabetes mellitus. β thalassemia major patients who receive frequent transfusions will develop hemochromatosis that will in turn impair the pancreatic function. (Med J Indones 2003; 12: 87-93 Keywords : β thalassemia major, hemochromatosis, diabetes mellitus

  15. Knowledge, Attitude and Practice of Carrier Thalassemia Marriage Volunteer in Prevention of Major Thalassemia. (United States)

    Karimzaei, Tahmineh; Masoudi, Qolamreza; Shahrakipour, Mahnaz; Navidiyan, Ali; Jamalzae, Abd Al-Qaffar; Zoraqi Bamri, Ahmad


    Thalassemia is the most common genetic disorder and rising in the world as a health problem. Due to the criticality of this disease, in our country thalassemia prevention programs are more importance. The aim of this study was investigation of knowledge, attitude and behavior of marrying partners who were thalassemia genetic carriers in prevention of the birth of the children with major thalassemia. This study was a descriptive-analytic study. Data collection tool was a self-administered questionnaire that included 43 items. The content validity of questionnaire was investigated under the supervision of physicians, experts of health education and promotion. Its reliability was confirmed by Cronbach's Alpha test. The subjects in the study consisted of 100 marrying partners who were genetic carriers of thalassemia who referred to Premarital Counseling Center in Iranshahr City. Iranshahr is a a large city of Sistan and Balouchestan Province that located in southeast of Iran. The subjects were selected by convenience non-probability sampling method. Data analyzed using descriptive and analytic statistical tests in SPSS 16.00 and level of significance considered on αpre-diploma. The research findings showed that 7% and 62% of the subjects had poor and mediocre levels of knowledge respectively. Also results showed that only 13% of them had a satisfactory behavior and educational status had a positive correlation with knowledge, behavior, perceived susceptibility and perceived severity (Pcounseling (33%) and premarital screening (27%) were the most important strategies for prevention of thalassemia. The perceived barriers were the strongest predictors for preventive behaviors of incidence of major thalassemia in marrying partners, therefor educational interventions should focused on perceived barriers removing in Volunteer marrying partners.

  16. Risk Factors to Growth Retardation in Major Thalassemia

    Directory of Open Access Journals (Sweden)

    Riva Uda


    Full Text Available The increasing in the life span of patients with major thalassemia should be followed by increased quality of life. There are factors which can affect growth retardation in these patients. The aim of this study was to find out the risk factors for growth retardation in patients with major thalassemia. An analytical study with cross-sectional design was conducted at Pediatric Thalassemia Clinics of Dr.Hasan Sadikin Hospital, Bandung, in June to July 2006. The subjects of this study were patients with major thalassemia. Inclusion criteria’s were age under 14 years old, had no chronic diseases like tuberculosis, cerebral palsy with complete medical records. Risk factors were the timing of diagnosis, initial and dose of deferoxamine, volume of transfused blood, mean pretransfusion hemoglobin level, family income, and age. Antropometric measurement indices were used to assess the growth which expressed in Z score. Growth evaluated based on height/age (H/A and growth retardation if H/A <-2 SD. Risk factors for growth retardation were analyzed separately using chi-square test and odds ratio (OR with 95% confidence interval (CI. Then they were analyzed simultaneously with logistic regression method. Subjects consisted of 152 patients with major thalassemia. Seventy three thalassemia patients were stunted. Analysis showed that age (OR: 5.42, 95% CI:2.32–12.65, p <0.001, dosage of deferoxamine (OR: 4.0, 95% CI: 1.29–12.41, p: 0.016, and family income (OR: 2.32, 95% CI: 1.06–5.06, p: 0.036 were risks factors for growth retardation. Conclusion, risk factors for growth retardation in major thalassemia are age, dosage of deferoxamine, and family income.

  17. Comparison of right and left side heart functions in patients with thalassemia major, patients with thalassemia intermedia, and control group. (United States)

    Noori, Noormohammad; Mohamadi, Mehdi; Keshavarz, Kambiz; Alavi, Seyed Mostafa; Mahjoubifard, Maziar; Mirmesdagh, Yalda


    Heart disease is the main cause of mortality and morbidity in patients with beta thalassemia, rendering its early diagnosis vital. We studied and compared echocardiographic findings in patients with beta thalassemia major, patients with beta thalassemia intermedia, and a control group. Eighty asymptomatic patients with thalassemia major and 22 asymptomatic cases with thalassemia intermedia (8-25 years old) were selected from those referred to Ali Asghar Hospital (Zahedan-Iran) between June 2008 and June 2009. Additionally, 80 healthy individuals within the same age and sex groups were used as controls. All the individuals underwent echocardiography, the data of which were analyzed with the Student t-test. The mean value of the pre-ejection period/ejection time ratio of the left ventricle during systole, the diameter of the posterior wall of the left ventricle during diastole, the left and right isovolumic relaxation times, and the right myocardial performance index in the patients with beta thalassemia major and intermedia increased significantly compared to those of the controls, but the other parameters were similar between the two patient groups. The mean values of the left and right pre-ejection periods, left ventricular end systolic dimension, and left isovolumic contraction time in the patients with thalassemia intermedia increased significantly compared to those of the controls. In the left side, myocardial performance index, left ventricular mass index, isovolumic contraction time, and deceleration time exhibited significant changes between the patients with thalassemia major and those with thalassemia intermedia, whereas all the echocardiographic parameters of the right side were similar between these two groups. The results showed that the systolic and diastolic functions of the right and left sides of the heart would be impaired in patients with thalassemia major and thalassemia intermedia. Consequently, serial echocardiography is suggested in

  18. Thalassemia (United States)

    ... Mediterranean (Greek, Italian and Middle Eastern), Asian, or African descent. Diagnosis & Tests How is thalassemia diagnosed? If your doctor thinks you or your child might have thalassemia, he’ll do a physical ...

  19. Thalassemia (United States)

    Thalassemias are inherited blood disorders. If you have one, your body makes fewer healthy red blood cells ... oxygen to the body. That leads to anemia. Thalassemias occur most often among people of Italian, Greek, ...

  20. Improving adherence with deferoxamine regimen in thalassemia major using education

    Directory of Open Access Journals (Sweden)

    Gholamreza Pouladfar


    Full Text Available Background: Subcutaneous deferoxamine is the first line for management of iron overload in thalassemia major. There is a wide deferoxamine adherence variation in patients with thalassemia major. In order to assess the effect of education on patients and their parents, a cognitive approach was used. Methods: In a randomized control trial, 78 consecutive patients with thalassemia major were randomly divided into educational (38 cases, 50% male and 50% female and control (40 cases, 65% male and 35% female groups. Oral and practical education sessions for deferoxamine injection were planned. Deferoxamine usage, pump function, side effects, knowledge levels of the patients and their parents, and ferritin serum levels were assessed before and after the trail. The knowledge was also evaluated promptly after educational sessions. Results: the mean age of experimental and control groups were 14.6 and 13.0 years, respectively. There was no significant difference in age, sex and weight (P>0.05 at the end of the study, there was no significant change in the level of knowledge in both groups however, the patients who used deferoxamine at least 5 times a week were increased in the experimental group (P0.001. Conclusion: A cognitive approach had relatively significant effect on deferoxamine adherence. However, educational sessions had not dramatic change in knowledge levels of the patients and their parents, but oral and practical education produced a significant change in decreasing local side effects of subcutaneous deferoxamine in thalassemia major.

  1. Frequency of short stature in - thalassemia major patients

    International Nuclear Information System (INIS)

    Aslam, M.S.; Roshan, E.; Shahid, M.


    Objective: To determine the frequency of short stature in children with - thalassemia major receiving multiple transfusions at Military Hospital Rawalpindi. Study Design: Descriptive cross sectional study. Place and Duration of Study: Study was conducted at Military Hospital from 1st January 2010 to 30th June 2010. Subjects and Methods: Total 100 multi-transfused cases of - thalassemia major were included in the study. The height of every child was measured in centimeters using the same free-standing standard stadiometer, and the same technique by a single pediatrician. Results: Out of 100 patients of - thalassemia major 57.0% (n=57) were male while 43% (n=43) were female. Mean age was 9.94 years (SD +- 2.93) with range of 6 to 14 years. Mean height was 115.77 cm (SD +- 13.79) with range of 72.00 to 148.00 cm. 57.0% (n=57) were found to be short statured while 43.0% (n=43) were with normal height. Mean age of short statured patients was 11.61 +- 2.34 years and mean age of patients with normal height was 7.73 +- 2.05 years. Conclusion: The frequency of short stature in our patients with - thalassemia major receiving multiple transfusions is high. There is need to monitor the height of thalassemic children regularly and to improve the quality of care being provided to them so as to improve their quality of life. (author)

  2. Neurotic manifestations in adolescents with thalassemia major. (United States)

    Moorjani, J D; Issac, Chithira


    To study the neurotic manifestations in thalassemic adolescents as a consequence of long-term illness. From July 2003, thirty six thalassemic adolescents and forty normal adolescents were selected with age ranging from 13 to 18 and with same socio economic status and family background. Middlesex Hospital Questionnaire by Crown and Crisp [1966] was administered and Mann Whiteny 'U' test was employed to measure free-floating anxiety, phobia, somatic anxiety, obsession, depression, hysteria and total neuroticism score. An interview was conducted along with the questionnaire to detect the problems in depth. Parents of thalassemic adolescents were interviewed subsequently to realize the behavioral problems existing along with neuroticism. Thirty-six of thalassemic and all forty normal adolescents returned the questionnaires. The responses suggest a marked difference in total neuroticism score and all other variables except that of hysteria. The interview on parents of thalassemic adolescents exposed various behavioral problems in these adolescents. Thalassemic adolescents were having higher scores in neuroticism. Some behavioral problems are also found to exist along with neurotic manifestations. There remains a need to improve the management of thalassemia in terms of psychological aspects in order to improve the mental health of this group.

  3. Adrenal extramedullary hematopoiesis associated with β-thalassemia major


    Bijan Keikhaei; Ahmad Soltani Shirazi; Mahboob Mohammad Pour


    The presence of apparently normal hematopoietic tissue outside of bone marrow cavity is defined as extramedullary hema - topoiesis (EMH). EMH is a rare complication in thalassemia major (TM) and adrenal gland as well. This report describes a case of adrenal EMH in a 26-year-old man with β-TM. He has been transfused with regular blood transfusion since 9 months. During the routine physical examination he was incidentally found to have a hypoechoic mass at his abdominal ultrasonography. Abdomin...

  4. Body Composition in Adult Patients with Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Marianna Vlychou


    Full Text Available Objective. To assess body composition in adult male and female patients with thalassemia major by dual-energy X-ray absorptiometry (DXA and to compare the findings with a group of healthy age-matched controls. Methods. Our study group included sixty-two patients (27 males, mean age 36 years, and 35 females, mean age 36.4 years and fifteen age-matched healthy controls. All patients had an established diagnosis of thalassemia major and followed a regular blood transfusion scheme since childhood and chelation treatment. Fat, lean, and bone mineral density (BMD were assessed with dual-energy X-ray absorptiometry. Ferritin levels and body mass index of all patients and controls were also recorded. Student t-test and Wilcoxon test were performed and statistical significance was set at p<0.05. Results. BMD and whole body lean mass are lower in both male and female adult patients compared with controls (p<0.01 in both groups, whereas whole body fat mass was found to have no statistically significant difference compared to controls. Regional trunk fat around the abdomen was found to be lower in male patients compared to controls (p=0.02. Conclusion. Severe bone loss and diminished lean mass are expected in adult male and female patients with thalassemia major. Fat changes seem to affect mainly male patients.

  5. Nitroblue tetrazolium test in patients with beta-thalassemia major

    International Nuclear Information System (INIS)

    Ghaffari, J.; Vahidshahi, K.; Kosaryan, M.; Karami, H.; Mahdavi, M.; Parvinnejad, N.


    Objective to assess the neutrophil function in thalassemia major (TM)patients and compare it with the control group and to recognize its relevantfactors. This was a retrospective cohort study, which was carried out fromOctober 2007 to February 2008 in the Thalassemia research Center in Boo AliSina Hospital in Sari, Mazandaran, North of Iran. The study populationconsisted of TM patients in Boo Ali Sina Teaching Hospital. The method ofsampling in the case group was systematic and it was target based in thecontrol group. The sample size determined was based on previous studies.Thalassemia major was diagnosed based on hemoglobin electrophoresis (casegroup). The control group was their brothers and sisters, who had +-5 yearsof age difference and were of the same gender as the patients. Datacollection was based on interview, investigating demographic characteristicsand also obtaining medical information from medical records of the patients.The neutrophil function was by performing nitroblue tetrazolium (NBT)reduction test. The test was carried out on both groups and the data wereanalyzed by software using SPSS version 13.0. In this study, 39 patients and39 healthy controls were compared. The average age of the patients was21.6+-5.3 years and it was 22.4+-5.1 years in healthy controls (p=0.7). Therewas a significant correlation between the test's results and the patients age(p=0.008). The rate of impaired NBT results in the patients was 36%, while itwas 10% in controls, which were significantly different. The neutrophilactivity based on NBT test was 89.9+-11.6% in the case group and 93.7+-2.51%in the control group (p=0.025). This study indicates that neutrophil activityin thalassemia patients was significantly lower, compared to the normalcontrol group, especially in young patients. Based on the results, evaluationof neutrophil function and pyogenic infections in TM patients seemsnecessary. (author)

  6. Current and future alternative therapies for beta-thalassemia major

    Directory of Open Access Journals (Sweden)

    Edouard de Dreuzy


    Full Text Available Beta-thalassemia is a group of frequent genetic disorders resulting in the synthesis of little or no β-globin chains. Novel approaches are being developed to correct the resulting α/β-globin chain imbalance, in an effort to move beyond the palliative management of this disease and the complications of its treatment (e.g. life-long red blood cell transfusion, iron chelation, splenectomy, which impose high costs on healthcare systems. Three approaches are envisaged: fetal globin gene reactivation by pharmacological compounds injected into patients throughout their lives, allogeneic hematopoietic stem cell transplantation (HSCT, and gene therapy. HSCT is currently the only treatment shown to provide an effective, definitive cure for β-thalassemia. However, this procedure remains risky and histocompatible donors are identified for only a small fraction of patients. New pharmacological compounds are being tested, but none has yet made it into common clinical practice for the treatment of beta-thalassemia major. Gene therapy is in the experimental phase. It is emerging as a powerful approach without the immunological complications of HSCT, but with other possible drawbacks. Rapid progress is being made in this field, and long-term efficacy and safety studies are underway.

  7. Allogeneic stem cell transplantation for thalassemia major in India

    Directory of Open Access Journals (Sweden)

    Vikram Mathews


    Full Text Available Allogeneic stem cell transplantation (allo-SCT is the only currently available curative treatment for thalassemia major. Since it was first done in 1981, several thousand patients have benefited from it and it is now possible to offer this treatment in different parts of the world with good results. With better risk stratification and supportive care, the results of allo-SCT are now very good even in high risk patients who have significant iron overload related organ dysfunction. The improvements have mainly been in the conditioning strategies with less toxic myeloablation and management of the complications of SCT. However, several challenges remain. Transplant related complications still cause significant morbidity and mortality. There is data to show that the results of transplantation as best if done in well transfused and chelated patients <7 years of age. As only a third of the patients will have a matched related donor, there is need for investigating SCT with alternative donors. Experience with SCT for thalassemia major from matched unrelated donors or haplo-identical donors is still limited but needs further exploration. Adequate management needs to be provided post-SCT for all pre-existing complications particularly iron chelation to prevent further organ dysfunction. Systematic follow-up is needed to measure long term outcomes. The biggest challenges in India are the cost of this treatment and access to centres capable of providing this treatment. With greater support from the government, health insurance and philanthropic programs, there has been a rapid increase in the number of SCTs for thalassemia major in India. The number centres providing this treatment are also increasing making this curative treatment more widely available in India.

  8. Adrenal extramedullary hematopoiesis associated with β-thalassemia major

    Directory of Open Access Journals (Sweden)

    Bijan Keikhaei


    Full Text Available The presence of apparently normal hematopoietic tissue outside of bone marrow cavity is defined as extramedullary hema - topoiesis (EMH. EMH is a rare complication in thalassemia major (TM and adrenal gland as well. This report describes a case of adrenal EMH in a 26-year-old man with β-TM. He has been transfused with regular blood transfusion since 9 months. During the routine physical examination he was incidentally found to have a hypoechoic mass at his abdominal ultrasonography. Abdominal computed tomography scan revealed a right well-defined suprarenal mass 7.7¥7.3¥5.8 cm in size. The diagnosis of EMH was confirmed with ultrasonographic-guided fine needle biopsy. Treatment options which include intensified regular blood transfusion and hydroxyurea have been started.

  9. Adrenal extramedullary hematopoiesis associated with β-thalassemia major. (United States)

    Keikhaei, Bijan; Shirazi, Ahmad Soltani; Pour, Mahboob Mohammad


    The presence of apparently normal hematopoietic tissue outside of bone marrow cavity is defined as extramedullary hematopoiesis (EMH). EMH is a rare complication in thalassemia major (TM) and adrenal gland as well. This report describes a case of adrenal EMH in a 26-year-old man with β-TM. He has been transfused with regular blood transfusion since 9 months. During the routine physical examination he was incidentally found to have a hypoechoic mass at his abdominal ultrasonography. Abdominal computed tomography scan revealed a right well-defined suprarenal mass 7.7×7.3×5.8 cm in size. The diagnosis of EMH was confirmed with ultrasonographic-guided fine needle biopsy. Treatment options which include intensified regular blood transfusion and hydroxyurea have been started.

  10. Magnetic resonance imaging of transfusional hemosiderosis complicating thalassemia major

    International Nuclear Information System (INIS)

    Brasch, R.C.; Wesbey, G.E.; Gooding, C.A.; Koerper, M.A.


    Tissue deposits of hemosiderin, a paramagnetic iron-protein complex, resulted in marked abnormalities of magnetic resonance (MR) spin-echo signal intensity within the viscera of three children with transfusional hemosiderosis and thalassemia major. In all patients the liver and bone marrow demonstrated abnormally low spin-echo intensities and the kidneys and muscles had abnormally high intensities. These observations correlate with in vitro MR observation of ferric (Fe +3 ) solutions, in which concentrations of ferric salts greater than 20 mmol yielded higher intensities than did water alone. MR imaging is sensitive to the tissue deposition of hemosiderin, and MR intensity appears to provide a rough measure of the amount of iron deposited

  11. Serum Prohepcidin Levels in Children with Thalassemia Major and Intermedia

    Directory of Open Access Journals (Sweden)

    Celil Yılmaz


    Full Text Available Objective: To determine the role of hepcidin hormone levels in iron accumulation in patients with thalassemia major (TM and thalassemia intermedia (TI. Materials and Methods: Serum prohepcidin and ferritin levels were determined in 34 patient with TM, 10 patient with TI, who attended the Department of Pediatric Hematology Adnan Menderes University Medical Faculty and the Department of Pediatrics at Aydın Atatürk State Hospital between 1 September 2006 and 30 September 2007 and 40 control patients without infection/inflammation, hepatitis or liver failure. Serum prohepcidin levels were measured using a commercial enzyme-linked immunosorbent assay kit (DRG International, Inc. Marburg, Germany; ferritin was studied with chemiluminescence method (Immulite 2000 DPC. Results: Mean serum ferritin levels in TM, TI and control groups were 2347.97±1724.81 ng/mL (range: 144-8015 ng/mL, 1352.40±918.94 ng/mL (range: 311-3109 ng/mL, and 33.35±12.03 ng/mL (range: 20-69.1 ng/mL, respectively. Serum prohepcidin levels in the same groups were 221.78±74.38 ng/mL (range: 7l.14-446.57 ng/mL, 173.31±52.14 ng/mL (range: 100.83-267.69 ng/mL, and 218.20±50.37 ng/mL (range: 116.18-330.43 ng/mL, respectively. There was a statistically significant difference in prohepcidin levels between patients with TI and control group only (p=0.016. No correlation was found between prohepcidin and ferritin levels in all groups (r=-0.023, p=0.839. Conclusion: Low levels of prohepcidin in patients with TI may be related to increased erythropoietic activity. Prohepcidin can be an indicator of active erythropoiesis.

  12. Human parvovirus B19 in patients with beta thalassemia major from Tehran, Iran. (United States)

    Arabzadeh, Seyed Ali Mohammad; Alizadeh, Farideh; Tavakoli, Ahmad; Mollaei, Hamidreza; Bokharaei-Salim, Farah; Karimi, Gharib; Farahmand, Mohammad; Mortazavi, Helya Sadat; Monavari, Seyed Hamidreza


    Due to the tropism of human parvovirus B19 to erythroid progenitor cells, infection in patients with an underlying hemolytic disorder such as beta-thalassemia major leads to suppression of erythrocyte formation, referred to as transient aplasia crisis (TAC), which may be life-threatening. We investigated the prevalence of parvovirus B19 among patients with beta thalassemia major attending the Zafar Adult Thalassemia Clinic in Tehran, Iran. This cross-sectional study was performed to determine the presence of parvovirus B19 DNA in blood samples and parvovirus B19 genotypes in plasma samples of patients with thalassemia major. The population consisted of 150 patients with beta-thalassemia major who attended the Zafar clinic in Tehran. Specimens were studied using a real-time polymerase chain reaction assay. The prevalence of parvovirus B19 in our study population was 4%. Of 150 patients with thalassemia, six (4%) were positive for B19 DNA. There was no significant correlation between blood transfusion frequency and B19 DNA positivity. Finally, phylogenetic analysis of human parvovirus B19 revealed genotype I in these six patients. In this study, acute B19 infections were detected in patients with beta thalassemia major. Screening of such high-risk groups can considerably reduce the incidence and prevalence of B19 infection; thus, screening is required for epidemiologic surveillance and disease-prevention measures.

  13. Magnetic measurements on human erythrocytes: Normal, beta thalassemia major, and sickle (United States)

    Sakhnini, Lama


    In this article magnetic measurements were made on human erythrocytes at different hemoglobin states (normal and reduced hemoglobin). Different blood samples: normal, beta thalassemia major, and sickle were studied. Beta thalassemia major and sickle samples were taken from patients receiving lifelong blood transfusion treatment. All samples examined exhibited diamagnetic behavior. Beta thalassemia major and sickle samples showed higher diamagnetic susceptibilities than that for the normal, which was attributed to the increase of membrane to hemoglobin volume ratio of the abnormal cells. Magnetic measurements showed that the erythrocytes in the reduced state showed less diamagnetic response in comparison with erythrocytes in the normal state. Analysis of the paramagnetic component of magnetization curves gave an effective magnetic moment of μeff=7.6 μB per reduced hemoglobin molecule. The same procedure was applied to sickle and beta thalassemia major samples and values for μeff were found to be comparable to that of the normal erythrocytes.

  14. Seroprevalence of parvovirus B19 infection in patients with beta thalassemia major in Fayoum University Hospital

    Directory of Open Access Journals (Sweden)

    Mohamed E. Al Ghwass


    Conclusion: Parvovirus B19 infection is detected in high rates among children with beta thalassemia major. Measures to avoid iatrogenic and nosocomial transmission have to be implemented including screening of donated blood for B19 especially blood given to patients with hematological disorders. Also data from this study support the need for introduction of an approved B19 vaccine that primarily protects children with thalassemia major against that infection.

  15. Evaluation of Bone Mineral Density in Children with Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Betül Bakan


    Full Text Available Aim: Fragile bones develop due to various factors in thalassemic patients. Even with optimum management, osteoporosis occurs, contributing to morbidity in majority of patients with thalassemia major (TM. Our aim was to evaluate bone health of thalassemic children using biochemical parameters and bone mineral density (BMD, and to emphasize the precautionary measures and early diagnosis of osteoporosis. Material and Methods: Thirteen children (5 females, 8 males, age <18 years with TM were included in the study. Age, duration, weight, height, transfusion frequency, medication use were recorded. Following laboratory analysis were obtained: Whole blood count, fasting blood glucose, ferritin, alanine aminotransferase, aspartate aminotransferase, calcium, phosphorus, alkaline phosphatase, thyroid stimulating hormone, free thyroxin, and intact parathyroid hormone (iPTH. BMD was determined using dual energy X-ray absorptiometry (DXA from femur and lumbar vertebrae. Patients with DXA Z-score <-2 was defined as osteoporotic. Results: The mean age was 7.85±3.17 years and body mass index (BMI was 14.68±1.93 kg/m2. The rest of the results were as follows: Lumbar BMD 0.464±0.108 g/cm2; total femur BMD 0.581± 0.114 g/cm2; lumbar DEXA Z-score 2.44±1.60; total femur DEXA -0.93±1.19. Osteoporosis ratio was determined as 69% in the lumbar vertebrae and 10% in the femur. A significant positive correlation was found between lumbar-femoral BMD and BMI, and a significant negative correlation was observed between femoral BMD and iPTH. Conclusion: BMD is low in thalassemic children. Despite regular transfusions and chelation therapy, osteoporosis starts early in life. (Turkish Journal of Osteoporosis 2012;18: 72-7


    Directory of Open Access Journals (Sweden)

    Naouel GUIRAT


    Full Text Available Beta-thalassemia major (TM is among prevalent hereditary disorders imposing high expenses on health-care system worldwide. The patient’s survival is dependent on lifetime blood transfusion which leads to iron overload and its toxicity on various organs including endocrine glands. This article provides an overview of  endocrine disorders in beta-TM patients. This single center investigation enrolled 28 beta-TM patients (16 males, 12 females  regularly transfused with packed red cell since early years of life. For each patient were determined: age, sex, number of transfusions received, history of splenectomy and anthropometric parameters. Evaluation for hormonal status including growth, gonadal, thyroid, adrenal cortex, and parathyroid glands was done for all patients. Dual energy X-ray absorptiometry was used to diagnose osteoporosis. Assessment of iron overload status was performed by measuring the serum ferritin concentration and the results of magnetic resonance imaging T2*. Growth retardation was found in 16 of the 28 studied patients (57 %.Thirteen among them had delayed puberty. Spontaneous puberty was achieved in 16 cases. Growth hormone (GH deficiency was found in 10 cases (35 %. Seventeen among the studied patients (60 % developed disorders of glucose homeostasis. Subclinical hypothyroidism was found in six patients (21 %. Intensive chelation therapy had allowed the reversibility of this complication in five cases. Adrenal Insufficiency was found in 9 cases (32%. Hypoparathyroidism has occurred in one case. Ten of the 28 studied patients had osteoporosis (35%. Twenty-three of the 28 studied patients (82% had at least one endocrine complication.

  17. Hypoparathyroidism and intracerebral calcification in patients with beta-thalassemia major

    Energy Technology Data Exchange (ETDEWEB)

    Karimi, M. [Iran-Shiraz-Namazee Hospital, Namazee Square, Hematology Research Center, Department of Pediatrics, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail:; Rasekhi, A.R. [Iran-Shiraz-Namazee Hospital, Namazee Square, Imaging Research Center, Department of Radiology, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail:; Rasekh, M. [Iran-Shiraz-Namazee Hospital, Namazee Square, Department of Endocrinology and Metabolism, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail:; Nabavizadeh, S.A. [Iran-Shiraz-Namazee Hospital, Namazee Square, Imaging Research Center, Department of Radiology, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail:; Assadsangabi, R. [Iran-Shiraz-Namazee Hospital, Namazee Square, Imaging Research Center, Department of Radiology, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail:; Amirhakimi, G.H. [Iran-Shiraz-Namazee Hospital, Namazee Square, Department of Endocrinology and Metabolism, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail:


    Background: Hypoparathyroidism is one of the most important endocrine complications of thalassemia major. This study was conducted to evaluate the prevalence of intracerebral calcifications in patients with thalassemia with and without hypoparathyroidism. Methods: 47 beta-thalassemia patients with hypoparathyroidism underwent a brain CT scan to investigate the presence and extent of intracerebral calcification. 30 age- and sex-matched beta-thalassemic patients with normal parathyroid function who had undergone brain CT for headache, or some other minor neurologic problems were also enrolled in the study serving as controls. The amount of intracerebral calcification, hematologic parameters, and some clinical findings were compared between both groups. Results: Intracerebral calcification was present in 54.2% of beta-thalassemia patients with hypoparathyroidism. The most frequent sites of calcification were basal ganglia, and frontoparietal areas of the brain. Thalami, internal capsule, cerebellum and posterior fossa were other less frequently calcified regions of the brain. In contrast, there was no evidence of intracerebral calcifications in the 30 thalassemic patients with normal parathyroid function. There was not a statistically significant difference between serum ferritin concentrations in thalassemia patient with hypoparathyroidism and those with normal parathyroid function (2781 vs. 2178, P > 0.05). Conclusion: Intracranial calcification is a common finding in thalassemia patients with hypoparathyroidism, it can be extensive and involves most regions of the brain.

  18. Hypoparathyroidism and intracerebral calcification in patients with beta-thalassemia major

    International Nuclear Information System (INIS)

    Karimi, M.; Rasekhi, A.R.; Rasekh, M.; Nabavizadeh, S.A.; Assadsangabi, R.; Amirhakimi, G.H.


    Background: Hypoparathyroidism is one of the most important endocrine complications of thalassemia major. This study was conducted to evaluate the prevalence of intracerebral calcifications in patients with thalassemia with and without hypoparathyroidism. Methods: 47 beta-thalassemia patients with hypoparathyroidism underwent a brain CT scan to investigate the presence and extent of intracerebral calcification. 30 age- and sex-matched beta-thalassemic patients with normal parathyroid function who had undergone brain CT for headache, or some other minor neurologic problems were also enrolled in the study serving as controls. The amount of intracerebral calcification, hematologic parameters, and some clinical findings were compared between both groups. Results: Intracerebral calcification was present in 54.2% of beta-thalassemia patients with hypoparathyroidism. The most frequent sites of calcification were basal ganglia, and frontoparietal areas of the brain. Thalami, internal capsule, cerebellum and posterior fossa were other less frequently calcified regions of the brain. In contrast, there was no evidence of intracerebral calcifications in the 30 thalassemic patients with normal parathyroid function. There was not a statistically significant difference between serum ferritin concentrations in thalassemia patient with hypoparathyroidism and those with normal parathyroid function (2781 vs. 2178, P > 0.05). Conclusion: Intracranial calcification is a common finding in thalassemia patients with hypoparathyroidism, it can be extensive and involves most regions of the brain.

  19. Evaluation of pulmonary function in beta-thalassemia major patients

    International Nuclear Information System (INIS)

    Eidani, I.; Keikhaei, B.; Rahim, F.; Bagheri, A.


    Objective: To describe and quantify the functional change of the lung in patients with beta-thalassemia major (TM) and determine the correlation between pulmonary function test (PFT) results with hemoglobin, ferritin and age changes. Methodology: Pulmonary function tests were performed on 60 transfusion-dependent patients with TM, ranging in age from 10 to 45 years. Percent-predicted values for forced expiratory volume in one second (FEV1), and forced expiratory flows (FEF) 25-75% were significantly reduced, whereas forced expiratory vital capacity (FVC) and FEV1/FVC were closed to normal limits, indicating a restrictive disease. All factors including; FVC, FEV1, and FEV1/FVC, FEF 25-75% were negatively correlated with age and ferritin levels. In contrast, all factors including; FVC, FEV1, and FEV1/FVC, FEF 25-75% were positively correlated with hemoglobin (Hb). We performed linear regression analysis to study the simultaneous influence of the presence of age, ferritin, and Hb on obstructive PFT indexes. Results: Pulmonary function test results were normal in only 32 (53.3%) of 60 patients and the rest 28 cases (46.7%) showed abnormal pulmonary function. FEV1 and FEF 25% - 75% have significant negative correlation with age (r = - 0.64 p(r) = 0.003 and r = - 0.58 p(r) = 0.02 respectively), also have significant positive correlation with Hb (r = 0.31 p(r) = 0.015 and r = 0.33 p(r) = 0.01 respectively), and only FEF 25% - 75% has significant negative correlation with ferritin (r -0.26 p(r) = 0.04). Conclusion: The present study has shown that restrictive disease and reduced lung diffusing capacity are the predominant abnormalities of pulmonary function patients with TM. The low hemoglobin concentration and a fall in the diffusing capacity of the alveola - capillary membrane, together with the dependence of the reduced pulmonary diffusing capacity on age and serum ferritin levels, as well as of the entity of restrictive disease on age, suggests that pulmonary

  20. Evaluation of cardiac functions in patients with thalassemia major

    International Nuclear Information System (INIS)

    Kucuk, N.O.; Aras, G.; Sipahi, T.; Ibis, E.; Akar, N.; Soylu, A.; Erbay, G.


    It is known that a blood transfusion is necessary for survival in patients with thalassemia, but it may cause myocardial dysfunction due to myocardial siderosis as in other organs. The aim of this study was to evaluate myocardial perfusion by means of stress thallium scanning (MPS) and left ventricular functions by rest radionuclide ventriculography (RNV). Twenty-one patients at ages 9-16 (mean 12.1±3.2) who have been diagnosed with thalassemia for 4-15 years mean 12.7±4.8) were included in the study. They had blood transfusion 78-318 times (mean 162.1±71). MPS and RNV was performed within two days after the any transfusion. MPS showed ischemia in 3 patients and normal perfusion in 18 patients. RNV revealed normal systolic parameters (wall motion, EF, PER, TPE) but diminished diastolic parameters (TPF, PFR) compared with normal values (p<0.05). We conclude that ischemia or fixed defects may be seen in stress MPS as results of cardiac involvement in patients with thalassemia. But, RNV is an important and preferable test for the early detection of subclinic cardiomyopathy. RNV may therefore show diastolic abnormalities before the systolic abnormalities show up. (author)

  1. Evaluation of cardiac functions in patients with thalassemia major

    Energy Technology Data Exchange (ETDEWEB)

    Kucuk, N.O.; Aras, G.; Sipahi, T.; Ibis, E.; Akar, N.; Soylu, A.; Erbay, G. [Ankara Univ. (Turkey). Medical School


    It is known that a blood transfusion is necessary for survival in patients with thalassemia, but it may cause myocardial dysfunction due to myocardial siderosis as in other organs. The aim of this study was to evaluate myocardial perfusion by means of stress thallium scanning (MPS) and left ventricular functions by rest radionuclide ventriculography (RNV). Twenty-one patients at ages 9-16 (mean 12.1{+-}3.2) who have been diagnosed with thalassemia for 4-15 years mean 12.7{+-}4.8) were included in the study. They had blood transfusion 78-318 times (mean 162.1{+-}71). MPS and RNV was performed within two days after the any transfusion. MPS showed ischemia in 3 patients and normal perfusion in 18 patients. RNV revealed normal systolic parameters (wall motion, EF, PER, TPE) but diminished diastolic parameters (TPF, PFR) compared with normal values (p<0.05). We conclude that ischemia or fixed defects may be seen in stress MPS as results of cardiac involvement in patients with thalassemia. But, RNV is an important and preferable test for the early detection of subclinic cardiomyopathy. RNV may therefore show diastolic abnormalities before the systolic abnormalities show up. (author)

  2. Decreased bone uptake of technetium-99m polyphosphate in thalassemia major

    International Nuclear Information System (INIS)

    Valdez, V.A.; Jacobstein, J.G.


    Bone scans were performed with Tc-99m stannous polyphosphate on four patients with thalassemia major. Three of the scans show generalized decrease in skeletal uptake of the radiopharmaceutical, associated with renal enlargement and markedly increased renal radioactivity. The skeletal findings are consistent with the known bone abnormalities in thalassemia major, which are secondary to the extensive marrow hyperplasia and include loss of trabeculae and cortical thinning with consequent loss of bone mass. The increased renal uptake is probably due in part to the increased renal excretion (secondary to the poor bone uptake) and in part to the tubular dilatation and renal enlargement associated with thalassemia major. In addition, the presence of excessive amounts of iron in these patients may play a role in both the skeletal and renal findings

  3. Levels of Beta-2 Microglobulin and Cystatin C in Beta Thalassemia Major Patients

    Directory of Open Access Journals (Sweden)

    Ayse Kacar


    Full Text Available Aim: Thalassemia is accepted to be the most common genetic disease in the world. This study was performed to establish whether there was a glomerular renal damage, which was usually a less mentioned subject in patients with Beta Thalassemia Major, and to compare urea, creatinine and creatinine clearance with early indicators of kidney damage as Cystatin-C and %u03B2-2 microglobulin as on determining the glomerular damage. Material and Method: This study was prospectively performed in patients, who were regularly followed in the children hematology outpatient clinic with a diagnosis of Beta Thalassemia Major. Results: There was no statistically significant difference between urea and levels of creatinine clearance and Cystatin-C. There was a statistically negative relationship between creatinine and creatinine clearance at an advanced level as 53.7% (p: 0.002, p

  4. Regional consensus opinion for the management of Beta thalassemia major in the Arabian Gulf area (United States)


    Thalassemia syndrome has diverse clinical presentations and a global spread that has far exceeded the classical Mediterranean basin where the mutations arose. The mutations that give rise to either alpha or beta thalassemia are numerous, resulting in a wide spectrum of clinical severity ranging from carrier state to life-threatening, inherited hemolytic anemia that requires regular blood transfusion. Beta thalassemia major constitutes a remarkable challenge to health care providers. The complications arising due to the anemia, transfusional iron overload, as well as other therapy-related complications add to the complexity of this condition. To produce this consensus opinion manuscript, a PubMed search was performed to gather evidence-based original articles, review articles, as well as published work reflecting the experience of physicians and scientists in the Arabian Gulf region in an effort to standardize the management protocol. PMID:24044606

  5. [Results of hematopoietic stem cell transplantation in hemoglobinopathies: thalassemia major and sickle cell disease]. (United States)

    Hladun, R; Elorza, I; Olivé, T; Dapena, J L; Llort, A; Sánchez de Toledo, J; Díaz de Heredia, C


    The prevalence of hemoglobinopathies in Spain is increasing as a result of immigration. Thalassemia major presents with chronic hemolytic anemia that requires regular red blood cell transfusions within the first year of life. Patients with sickle cell disease suffer from chronic anemia, vasculopathy and progressive damage in almost any organ. There is decreased life expectancy in both conditions. Allogeneic hematopoietic stem cell transplantation represents the only potentially curative option. Seventeen patients (fourteen thalassemia major, and three sickle cell disease) underwent allogeneic hematopoietic stem cell transplantations. In the thalassemia group, nine donors were HLA-geno-identical siblings, two were partially matched related donors (one HLA allele mismatch), and three unrelated donors. All three patients with sickle cell disease were transplanted from HLA-geno-identical siblings. The source of stem cells was bone marrow in sixteen cases. Median patient age at transplant was six years (range: 1-16) in the thalassemia group, and twelve years (range: 8-15) in the sickle cell disease group. The graft was successful in all patients. Secondary graft rejection was observed in two thalassemia patients rendering them dependent on blood transfusions. Complete chimerism was observed in thirteen patients and, although mixed chimerism occurred in two, with all of them showing normal hemoglobin levels after transplantation and not requiring further transfusion support. Patients affected by sickle cell disease did not present with new vaso-occlusive crises, and stabilization of pulmonary and neurological function was observed. Chronic graft-versus-host disease was detected in three patients affected by thalassemia, and hypogonadotrophic hypogonadism in five patients. We conclude that for thalassemia major and sickle cell disease, allogenic hematopoietic stem cell transplantation from HLA-geno-identical siblings offers a high probability of complication-free survival

  6. Post-transfusion hypertension, convulsion and intracranial haemorrhage in beta-thalassemia major

    International Nuclear Information System (INIS)

    Masood, S.A.; Zaidi, A.


    The haematologic disorder b-thalassemia major is common in Pakistan. We describe a patient with undiagnosed thalassemia presenting with hypertension and convulsions and found to have cerebral haemorrhage on neuro-imaging. He had been transfused 2 weeks before this illness. Our experience is similar to a few case reports described in literature that were found to have cerebral haemorrhages post-mortem after a similar clinical presentation. All patients had a blood transfusion within 2 weeks prior to the presentation so association with transfusion has been proposed. We have reviewed the several mechanisms presented and discussed the findings. (author)

  7. Assessment of cognitive function in children with beta-thalassemia major: a cross-sectional study. (United States)

    Raafat, Nelly; El Safy, Usama; Khater, Nahed; Hassan, Tamer; Hassan, Basheir; Siam, Ahmed; Youssef, Amira; El Shabrawy, Amany


    Multiple risk factors contribute to cognitive impairment in children with β-thalassemia major. For a more refined understanding of this issue, we attempted to evaluate cognitive function in β-thalassemia major patients and identify the relationship between possible cognitive dysfunction and the following: demography, transfusion and chelation characteristics, iron overload, and disease complications. We studied 100 β-thalassemia major children and 100 healthy controls who matched well in terms of age, sex, and socioeconomic status. All participants underwent psychometric assessment using Wechsler Intelligence Scale for Children-Third Edition, Arabic version. The mean Full-Scale IQ and Performance IQ of patients were significantly lower than those of controls, whereas no significant difference was found for Verbal IQ. No significant relationship existed between IQ and any of the assessed parameters. We concluded that Performance IQ, not Verbal IQ, was significantly affected in β-thalassemia major patients, but there was no clear association between IQ and any of the parameters. © The Author(s) 2014.

  8. Mixed chimerism following hematopoietic stem cell transplantation in pediatric thalassemia major patients: a single center experience

    Directory of Open Access Journals (Sweden)

    Elif Ünal İnce


    Full Text Available Objective: Stable mixed chimerism (MC may result in cure for thalassemia major patients following hematopoietic stem cell transplantation (HSCT, but rejection can occur. Twenty-eight HSCTs for thalassemia major were reviewed retrospectively to evaluate the clinical course of MC with possible risk factors and predictors of outcome, with a median follow-up of 1669 days (811-3576 days. Materials and Methods: Chimerism was detected by fluorescence in situ hybridization (FISH or multiplex polymerase chain reaction depending on the sex match between the donor and the recipient. Results: Primary rejection, stable MC and full donor chimerism was detected in 3.6%, 17.8% and 78.6% of patients, respectively. Clinically, 4/5 patients with stable MC had thalassemia trait with donor chimerism as low as 14%. One patient was started on pRBC transfusions at 2.5 years postHSCT. Conclusion: Stable MC can result in cure for thalassemia major patients. The clinical picture remains as the best guide for intervention until a more reliable predictor is available.

  9. A Comparison of Quality of Life between Adolescences with Beta Thalassemia Major and their Healthy Peers

    Directory of Open Access Journals (Sweden)

    Shahram Baraz


    Full Text Available Background The chronic genetic blood disorder, thalassemia, affects Quality of life (QOL negatively. Regarding this, if adolescences with thalassemia are treated well, they will grow into an adult who will have a good potential for participating in society. Objectives: to determine the strongest predictor of QOL, compare QOL between the adolescents with beta-type major and their peers in Abadan city. Materials and Methods This was a cross-sectional study; the population consisted of 65 beta thalassemia major patients and 65  healthy peers with the same ages as the witness group. The data collection tools included SF-36 questionnaire and a questionnaire for demographic information. Data analysis was performed using independent t-test, correlation and linear regression by SPSS-16. Results The results of the study revealed that there is a significant difference (P < 0.05 in the average quality of life between the two groups of the study. On the other hand, the results showed that there was a meaningful relation between different aspects of life quality and family history of thalassemia            (P< 0.05. Also, there was a negative correlation between quality of life and the frequency of blood transfusion per year (P< 0.05. Conclusion Adolescences with beta thalassemia major do not have a desirable quality of life, therefore, this fact shows the necessity of serious reforming in various fields of health care, treatment, family, social and financial support, and rehabilitation that need more attention from health care policymakers.

  10. Alloimmunization and autoimmunization in transfusion dependent thalassemia major patients: Study on 319 patients

    Directory of Open Access Journals (Sweden)

    Hari Krishan Dhawan


    Full Text Available Background: The development of anti-red blood cell antibodies (both allo-and autoantibodies remains a major problem in thalassemia major patients. We studied the frequency of red blood cell (RBC alloimmunization and autoimmunization among thalassemia patients who received regular transfusions at our center and analyzed the factors, which may be responsible for development of these antibodies. Materials and Methods: The study was carried out on 319 multiply transfused patients with β-thalassemia major registered with thalassemia clinic at our institute. Clinical and transfusion records of all the patients were examined for age of patients, age at initiation of transfusion therapy, total number of blood units transfused, transfusion interval, status of splenectomy or other interventions. Alloantibody screening and identification was done using three cell and 11 cell panel (Diapanel, Bio-rad, Switzerland respectively. To detect autoantibodies, autocontrol was carried out using polyspecific coombs (IgG + C3d gel cards. Results: Eighteen patients out of total 319 patients (5.64% developed alloantibodies and 90 (28.2% developed autoantibodies. Nine out of 18 patients with alloantibodies also had autoantibodies. Age at first transfusion was significantly higher in alloimmunized than non-immunized patients (P = 0.042. Out of 23 alloantibodies, 52.17% belonged to Rh blood group system (Anti-E = 17%, Anti D = 13%, Anti-C = 13%, Anti-C w = 9%, 35% belonged to Kell blood group system, 9% of Kidd and 4% of Xg blood group system. Conclusion: Alloimmunization was detected in 5.64% of multitransfused thalassemia patients. Rh and Kell blood group system antibodies accounted for more than 80% of alloantibodies. This study re-emphasizes the need for RBC antigen typing before first transfusion and issue of antigen matched blood (at least for Rh and Kell antigen. Early institution of transfusion therapy after diagnosis is another means of decreasing

  11. Investigating Challenges Facing Self-Management Empowerment Education in Adolescents and Youths with Major Thalassemia

    Directory of Open Access Journals (Sweden)



    Full Text Available Background Thalassemia is considered an important public health problem worldwide, especially in developing and poor countries. Although several advanced techniques have been developed for prevention of thalassemia in the recent years, many adolescents and youths are still living with this disease. Independence from parents, decisions about high-risk behaviors, uncovering the identity, and adapting to mental and physical effects of the disease occur together in adolescents. Objectives This study was conducted to explore challenges of self-management empowerment in adolescents and youths with major thalassemia. Materials and Methods This was a descriptive-exploratory study. The study population consisted of adolescents and youths with major thalassemia who had medical records in the Bushehr Thalassemia Center, affiliated with Bushehr University of Medical Sciences. The study samples were purposively selected. Demographic information questionnaire and empowerment questionnaire were used to collect data from the semistructured interview. We analyzed qualitative data by content analysis method and quantitative data by descriptive (mean, standard deviation and analytical (Student's t-test, ANOVA and Pearson’s correlation coefficient statistical methods, using the statistical software SPSS 18. Results In qualitative part of the study, data from semistructured in-depth interviews with 15 participants were coded and summarized in five themes including: 1 awareness of personal changes; 2 need for adaptation; 3 maintaining independence and self-management; 4 uncovering the identity and role playing; and 5 sense of control and satisfaction. Results of the quantitative part showed that the overall score of participants on empowerment was 92.46 of 149 scores, which showed a moderate situation in the empowerment of these individuals. In addition, the empowerment score showed no statistically significant correlation with demographic characteristics

  12. Cord Compression due to Extramedullary Hematopoiesis in an Adolescent with Known Beta Thalassemia Major (United States)

    Soman, Salil; Rosenfeld, David L; Roychowdhury, Sudipta; Drachtman, Richard A; Cohler, Alan


    We describe a 16 year-old male with β thalassemia major and gait disturbances that had not been given blood transfusions due to a severe childhood transfusion reaction. Thoracic spine MRI demonstrated hematopoietic marrow throughout the spine and epidural masses causing cord compression consistent with extramedullary hematopoiesis (EMH). After treatment with steroids, radiotherapy and monitored blood transfusions, the patient demonstrated significant improvement of his paraspinal lesions and near complete resolution of his neurological symptoms. While EMH causing cord compression in adolescents is rare in the current era of bone marrow transplantation or chronic transfusions, it should be considered when thalassemia major patients present with neurological deficits. The well defined imaging features of EMH can play a central role in its diagnosis and management, especially because surgical and / or radiotherapeutic intervention are often considered in cases of failed medical treatment. PMID:22470615

  13. Cord Compression due to Extramedullary Hematopoiesis in an Adolescent with Known Beta Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Alan COHLER


    Full Text Available We describe a 16 year-old male with ß thalassemia major and gait disturbances that had not been given blood transfusions due to a severe childhood transfusion reaction. Thoracic spine MRI demonstrated hematopoietic marrow throughout the spine and epidural masses causing cord compression consistent with extramedullary hematopoiesis (EMH. After treatment with steroids, radiotherapy and monitored blood transfusions, the patient demonstrated significant improvement of his paraspinal lesions and near complete resolution of his neurological symptoms. While EMH causing cord compression in adolescents is rare in the current era of bone marrow transplantation or chronic transfusions, it should be considered when thalassemia major patients present with neurological deficits. The well defined imaging features of EMH can play a central role in its diagnosis and management, especially because surgical and / or radiotherapeutic intervention are often considered in cases of failed medical treatment.

  14. [Beta thalassemia major and pregnancy during adolescence: report of two cases]. (United States)

    Trigo, Lucas Augusto Monteiro Castro; Surita, Fernanda Garanhani; Parpinelli, Mary Angela; Pereira, Belmiro Gonçalves; Fertrin, Kleber Yotsumoto; Costa, Maria Laura


    Beta thalassemia major is a rare hereditary blood disease in which impaired synthesis of beta globin chains causes severe anemia. Medical treatment consists of chronic blood transfusions and iron chelation. We describe two cases of adolescents with beta thalassemia major with unplanned pregnancies and late onset of prenatal care. One had worsening of anemia with increased transfusional requirement, fetal growth restriction, and placental senescence. The other was also diagnosed with hypothyroidism and low maternal weight, and was admitted twice during pregnancy due to dengue shock syndrome and influenza H1N1-associated respiratory infection. She also developed fetal growth restriction and underwent vaginal delivery at term complicated by uterine hypotonia. Both patients required blood transfusions after birth and chose medroxyprogesterone as a contraceptive method afterwards. This report highlights the importance of medical advice on contraceptive methods for these women and the role of a specialized prenatal follow-up in association with a hematologist.

  15. Cord Compression due to Extramedullary Hematopoiesis in an Adolescent with Known Beta Thalassemia Major


    Soman, Salil; Rosenfeld, David L; Roychowdhury, Sudipta; Drachtman, Richard A; Cohler, Alan


    We describe a 16 year-old male with ß thalassemia major and gait disturbances that had not been given blood transfusions due to a severe childhood transfusion reaction. Thoracic spine MRI demonstrated hematopoietic marrow throughout the spine and epidural masses causing cord compression consistent with extramedullary hematopoiesis (EMH). After treatment with steroids, radiotherapy and monitored blood transfusions, the patient demonstrated significant improvement of his paraspinal lesions a...

  16. Urine β2 Microglobulin and other Biochemical Indices in β Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Yazdan Ghandi


    Full Text Available To find if some indices have predictive value for renal complications. We conducted a cross sectional and included 80 patients with the age ranged 5-17 years, all with the proven diagnosis of β-thalassemia major. A urine and 5 ml of blood sample were obtained from all of the cases. Biochemical indices such as serum levels of creatinine, Na, Mg, Hb, and ferritin and also urine levels of Na, Mg, creatinine and β2 microglobulin was measured. All data analysis was performed using SPSS 14.0. P-Spearman test was applied to assess correlation between urine beta-2-microglobulin and other variables. Patients GFR was in normal range. Abnormal level of urine β2 microglobulin was reported in 44 patients (55%. P Spearman test proved correlation only between urine β2 microglobulin and FE-Mg. We concluded that renal proximal tubular dysfunction may oocur in children with β thalassemia major without clinical manifestations of renal dysfunction or decrease in GFR. We warn not to rely only on GFR as a early indicator for renal complications among children with β thalassemia major.

  17. MR imaging of femoral marrow in treated β-thalassemia major

    International Nuclear Information System (INIS)

    Shen Jun; Liang Biling; Chen Jianyu; Zhao Jiquan; Xu Honggui; Chen Chun


    Objective: To investigate MR imaging features of femoral marrow in treated β-thalassemia major. Methods: MR imaging of the proximal femoral marrow was performed in 35 cases of β-thalassemia major and 45 age- and sex-matched normal children as control. Coronal images of femoral marrow with the techniques of spin echo and fast field echo (FFE) were obtained. On T 1 -weighted imaging the red and yellow femoral marrow were judged and marrow distribution was classified into five groups. The hemosiderosis of marrow was judged on the basis of signal intensity of marrow on FFE imaging. The marrow distribution classification and the hemosiderosis on MR imaging were correlated with clinical features. Results: On FFE, marrow hemosiderosis occurred in 15 patients with a marked hypo-intensity signal and was related to the age (P=0.032). On T 1 -weighted imaging, the femoral marrow in 35 patients was classified as group III and IV, while the marrow distribution was group I or II in all normal children, there was statistically significant difference (P<0.001). The marrow distribution correlated positively with blood transfusion (P=0.049). Conclusion: The red marrow hyperplasia and hemosiderosis could occur in the femoral marrow of the treated β-thalassemia major. The marrow hyperplasia on MR imaging was related to the blood transfusion, and the hemosiderosis related to the age. (authors)

  18. Serum ferritin, serum nitric oxide, and cognitive function in pediatric thalassemia major

    Directory of Open Access Journals (Sweden)

    Septiana Nur Qurbani


    Full Text Available Background Hemolysis and repeated blood transfusions in children with thalassemia major cause iron overload in various organs, including the brain, and may lead to neurodegeneration. Hemolysis also causes decreased levels of nitric oxide, which serves as a volume transmitter and slow dynamic modulation, leading to cognitive impairment. Objective To assess for correlations between serum ferritin as well as nitric oxide levels and cognitive function in children with thalassemia major.  Methods This analytical study with cross-sectional design on 40 hemosiderotic thalassemia major patients aged 6−14 years, was done at the Thalassemia Clinic in Dr. Hasan Sadikin Hospital, Bandung, West Java, from May to June 2015. Serum ferritin measurements were performed by an electrochemiluminescence immunoassay; serum nitric oxide was assayed by a colorimetric procedure based on Griess reaction; and cognitive function was assessed by the Wechsler Intelligence Scale for Children test. Statistical analysis was done using Spearman’s Rank correlation, with a significance value of 0.05. Results Abnormal values in verbal, performance, and full scale IQ were found in 35%, 57.5% and 57.5%, respectively. Serum nitric oxide level was significantly correlated with performance IQ (P=0.022, but not with verbal IQ (P=0.359 or full scale IQ (P=0.164. There were also no significant correlations between serum ferritin level and full scale, verbal, or performance IQ (P=0.377, 0.460, and 0.822, respectively. Conclusion Lower serum nitric oxide level is significantly correlated to lower cognitive function, specifically in the performance IQ category. However, serum ferritin level has no clear correlation with cognitive function.

  19. Multiple transfused thalassemia major: Ocular manifestations in a hospital-based population

    Directory of Open Access Journals (Sweden)

    Taneja Rashi


    Full Text Available Purpose: To study the ocular manifestations in multiple transfused beta-thalassemia major patients and assess the ocular side-effects of iron chelating agents. Materials and Methods: In this prospective observational study, 45 multiple transfused beta-thalassemia major children between six months and 21 years of age were enrolled and assigned groups according to the treatment regimens suggested. Group A received only blood transfusions, Group B blood transfusions with subcutaneous desferrioxamine, Group C blood transfusions with desferrioxamine and oral deferriprone and Group D blood transfusions with deferriprone. Ocular status at the time of enrolment was documented. Subjects were observed quarterly for one year for changes in ocular status arising due to the disease process and due to iron chelation therapy. Children with hemoglobinopathies other than beta-thalassemia major, congenital ocular anomalies and anemia due to other causes were excluded. Results: Ocular involvement was observed in 58% of patients. Lenticular opacities were the most common ocular finding (44%, followed by decreased visual acuity (33%. An increased occurrence of ocular changes was observed with increase of serum ferritin and serum iron levels as well as with higher number of blood transfusions received. Desferrioxamine seemed to have a protective influence on retinal pigment epithelium (RPE mottling. Occurrence of lenticular opacities and RPE degeneration correlated positively with use of desferrioxamine and deferriprone respectively. Follow-up of patients for one year did not reveal any change in ocular status. Conclusion: Regular ocular examinations can aid in preventing, delaying or ameliorating the ocular complications of thalassemia.

  20. Frequency of hepatitis B and hepatitis C in multi - transfused beta thalassemia major patients

    International Nuclear Information System (INIS)

    Iqbal, M.M.; Hassan, S.; Aziz, S.


    To determine the frequency of hepatitis B and C virus infection among children with beta thalassemia major registered at Military Hospital Rawalpindi. Children attending Thalassemia Centre Military Hospital Rawalpindi for regular blood transfusion were registered. They belonged to different ethnic groups and came from different parts of the country. Their demographic data was recorded, detailed history taken and physical examination was carried out. Their serum samples were tested for hepatitis B surface antigen and anti HCV antibody assay with third generation commercial ELISA method. During the study; 141 patients of beta thalassemia major were screened. Out of them 50 patients (35.5% ,95% confidence interval 27.8-43.5)w ere found hepatitis C virus antibody positive and 1 patient (0.7 %) hepatitis B surface antigen positive. One patient (0.7%) had both hepatitis B and C virus infection. Mean age of hepatitis C infected patients was 10.4+3.85y ears (range 2-16 years). Mean age of uninfected patients was 6.1 + 3.59 years. (p value 0.000) In addition, the results indicate that higher prevalence of anti-HCV was significantly associated with longer duration of transfusion (p value <0.003). In spite of the fact that screened blood is used for transfusions, still a large number of patients have been found infected with hepatitis C. Therefore more accurate techniques are required for screening of blood to prevent transfusion associated transmission. (author)

  1. The survival analysis of beta thalassemia major patients in South East of Iran

    International Nuclear Information System (INIS)

    Roudbari, M.; Soltani-Rad, M.; Roudbari, S.


    The objective was to determine the survival of beta-thalassemia major patients with transfusion, and its related factors in Southeast of Iran. This cross-sectional study was performed in Zahedan, Iran in 2007. The sample included patients who were referred from all over the Zahedan Thalassemia Center from 1998 to 2006. The data were collected using the patient's records, which were recorded by the staff during transfusion. The data included demographic and medical information blood group, blood RH, the kind of transfused blood [KTB], annual number of transfusions [ANOT], accompanied disease [AD], Hemoglobin [Hb] and ferritin level. For data analysis, the Kaplan-Meyer method, and Long Rank test together with Cox Regression were used. Forty-six of 578 patients died and 99% survived for the first year. The ages survival proportions were 5 (97.9%), 10 (97%), 15 (92.1%), and 20 (81.2%) years. The survival time showed significant relationships with the ANOT p=0.0053, KTB p=0.003, Hb=0.002 and ferritin level p=0.0087, and AD p=0.00. Using regular transfusion, paying attention to screening of transfused blood, increasing the families knowledge on the disease to prevent the bearing of thalassemia fetus, are recommended; finally, the detection and treating of the AD, are of great importance to extend the lifetime of the patients. (author)

  2. Glucose homeostasis in Egyptian children and adolescents with β-Thalassemia major: Relationship to oxidative stress

    Directory of Open Access Journals (Sweden)

    Kotb Abbass Metwalley


    Full Text Available Background: Oxidative stress in children with β-thalassemia may contribute to shortened life span of erythrocytes and endocrinal abnormalities. Aim: This study was aimed to evaluate glucose homeostasis in Egyptian children and adolescents with β-thalassemia major and its relation to oxidative stress. Materials and Methods: Sixty children and adolescents with β-thalassemia major were studied in comparison to 30 healthy age and sex-matched subjects. Detailed medical history, thorough clinical examination, and laboratory assessment of oral glucose tolerance test (OGTT, serum ferritin, alanine transferase (ALT, fasting insulin levels, plasma malondialdehyde (MDA as oxidant marker and serum total antioxidants capacity (TAC were performed. Patients were divided into two groups according to the presence of abnormal OGTT. Results: The prevalence of diabetes was 5% (3 of 60 and impaired glucose tolerance test (IGT was 8% (5 of 60. Fasting blood glucose, 2-hour post-load plasma glucose, serum ferritin, ALT, fasting insulin level, homeostatic model assessment for insulin resistance index (HOMA-IR and MDA levels were significantly elevated while TAC level was significantly decreased in thalassemic patients compared with healthy controls (P < 0.001 for each. The difference was more evident in patients with abnormal OGTT than those with normal oral glucose tolerance (P < 0.001 for each. We also observed that thalassemic patients not receiving or on irregular chelation therapy had significantly higher fasting, 2-h post-load plasma glucose, serum ferritin, ALT, fasting insulin, HOMA-IR, oxidative stress markers OSI and MDA levels and significantly lower TAC compared with either those on regular chelation or controls. HOMA-IR was positively correlated with age, serum ferritin, ALT, MDA, and negatively correlated with TAC. Conclusions: The development of abnormal glucose tolerance in Egyptian children and adolescents with β--thalassemia is associated with

  3. Endocrinopathies in Turkish children with Beta thalassemia major: results from a single center study. (United States)

    Isik, Pamir; Yarali, Nese; Tavil, Betül; Demirel, Fatma; Karacam, Gülşah Bayram; Sac, Rukiye Unsal; Fettah, Ali; Ozkasap, Serdar; Kara, Abdurrahman; Tunc, Bahattin


    The endocrinological complications in β-thalassemia major patients do affect the life quality to a large extend. In this study, the endocrinological complications of 47 β-thalassemia patients, who have been followed-up at our hospital's pediatric hematology department, were evaluated. Out of β-thalassemia major cases included to this study, the 55.3% was male and 44.7% was female. The patients' mean levels of ferritin, whose mean age was 10.0 ± 4.5 years (2-20 years), were 2497 ± 1469 ng/mL (472-8558 ng/mL). At least one endocrinological pathology in 27 out of 47 (57.4%) and more than one endocrinological pathology in 14 out of 47 (29.7%) thalassemia patients were observed. The most frequently observed complication in followed-up cases was vitamin D insufficiency and deficiency (78.2%). The other complications in decreasing order were pubertal failure (41.6%), growth retardation (25.5%), decreased bone-mineral density (22.2%), secondary hyperparathyroidism (11.5%), overt hypothyroidism (4.25%), subclinical hypothyroidism (2.12%), and impaired glucose tolerance (2.12%). There was no statistically significant difference between serum mean ferritin level and endocrin complications (P > .05). Four patients (8.5%) had decreased signal intensity in pituitary magnetic resonance imaging (MRI) but this finding was not associated with ferritin levels (P = .87). MRI parameters were similar between patients with and without gonadal dysfunction. Mean height of the pituitary gland was 4.98 ± 1.1 mm (3-9 mm) and this was similar to those normal values in the literature. Ferritin levels were not correlated with pituitary height (P > .05). Beta thalassemia major, having the potential of leading to multisystemic complications, is a chronic disease that should be treated and followed-up by a multidisciplinary approach. Due to frequently encountered endocrinological complications, beta thalassemic patients should be followed-up regularly by hematology and endocrinology

  4. A cross-sectional study of metabolic and endocrine complications in beta-thalassemia major

    International Nuclear Information System (INIS)

    Najafipour, F.; Aliasgarzadeh, A.; Aghamohamadzadeh, N.; Bahrami, A.; Mobasri, M.; Niafar, M.; Khoshbaten, M.


    Iron overload is a major problem in patients with beta-thalassemia major, and it has many structural and metabolic consequences. The aim of this study was evaluation of endocrine disturbances in patients with beta-thalassemia major who were older than 10 years of age. In this cross-sectional study, investigator collected demographic data and medical histories, as well as menstrual history in females, from the medical records of 56 patients with beta-thalassemia major. Patients were examined to determine their pubertal status and the standard deviation score for height for evaluation of short stature. For evaluation of glucose tolerance, a fasting blood glucose and oral glucose tolerance tests were performed. Evidence for diabetes mellitus was based on American Diabetes Association and World Health Organization criteria. Serum levels of calcium, phosphorous, thyroid-stimulating hormone, free thyroxin, luteinizing hormone and follicular-stimulating hormone and estradiol in girls and testosterone in boys were measured. The mean and standard deviation for age in the 56 patients (36 males and 20 females) was 15.62+-4.44 years. Diabetes mellitus was present in 5 patients (8.9%), impaired fasting glucose was found in 16 patients (28.6%) and an impaired glucose tolerance test was found in 4 patients (7.1%). Short stature (standard deviation score <-2) was seen in 25 (70%) boys and 14 (73%) girls. Impaired puberty was found in 40 patients (71%). Hypocalcaemia and primary overt hyperthyroidism were present in 23 (41%) and 9 patients (16%), respectively. Only eight patients (14.3%) had no endocrine abnormalities. Despite therapy with deferoxamine to treat iron overload, the risk of secondary endocrine dysfunction remained high. Hypogonadism was one of the most frequent endocrine complications. Impaired glucose tolerance, short stature, hypocalcemia, subclinical and overt hypothyroidism are also frequent. (author)

  5. Bone metabolism and mineral density in patients with beta-thalassemia major

    International Nuclear Information System (INIS)

    Dundar, U.; Kupesiz, A.; Yesilipeck, A.; Ozdem, S.; Gultekin, M.; Gilgil, E.; Tuncer, T.


    To evaluate bone metabolism in patients with beta-thalassemia major and to determine the factors associated with the development of osteoporosis. We studied 25 patients with thalassemia major with a mean age of 18.4 years (rang 5-31), age and gender matched 24 healthy controls who were attending the outpatient physical medicine and rehabilitation clinic of Akdeniz University Hospital between January 2004 and March 2004 in Turkey. Bone mineral density (BMD) of lumbar spine (L-1-L4) and proximal femur were determined using dual x-ray absorptiometry (DXA). Venous blood samples were obtained for determination of blood cell count and markers of bone formation and resorption. The BMD values, both at lumbar and femoral neck levels were significantly lower in patients compared to controls. Serum N-telopeptide level was slightly higher, whereas osteocalcin was slightly lower in patients, however, the values were not statistically significant. Plasma levels of insulin like growth factor-1 (IGF-I) and insulin like growth factor for binding protein-3 (IGFBP-3) were significantly lower in patients. Also, serum levels of estradiol and progesterone in females, luteinizing, hormone and follicle-stimulating hormone in both genders were significantly lower in patients. Serum levels of free testosterone and total testosterone were lower in patients, but not statistically significant. Patients also had significantly higher serum phosphorous levels and lower serum calcitonin levels compared to controls. The BMD is decreased in thalassemic patients. Growth retardation, growth hormone/IGF-I/IGFP-3 axis dysfunction, gonadal dysfunction and hypothalomo-pituitary-gonadal axis dysfunction may be responsible for the development of osteoporosis in the patients with beta-thalassemia major. (author)

  6. Immunological Evaluation of -Thalassemia Major Patients Receiving Oral Iron Chelator Deferasirox

    International Nuclear Information System (INIS)

    Aleem, A.; Alsaleh, K.; Algahtani, F.; Momen, A. A.; Shakoor, Z.; Iqbal, Z.


    Objective: To determine the immune abnormalities and occurrence of infections in transfusion-dependent -thalassemia major patients receiving oral iron chelator deferasirox (DFX). Study Design: An observational study. Place and Duration of Study: Hematology Clinics, King Khalid University Hospital, Riyadh, Saudi Arabia, from July to December 2010. Methodology: Seventeen patients with -thalassemia major (12 females, median age 26 years) receiving deferasirox (DFX) for a median duration of 27 months were observed for any infections and had their immune status determined. Immune parameters studied included serum immunoglobulins and IgG subclasses, serum complement (C3 and C4) and anti-nuclear antibody (ANA) level, total B and T-lymphocytes, CD4+ and CD8+ counts, CD4+/CD8+ ratio, and natural killer (NK) cells. Immunological parameters of the patients were compared with age, gender, serum ferritin level and splenectomy status. Lymphocyte subsets were also compared with age and gender matched normal controls. Results: A considerable reduction in serum ferritin was achieved by DFX from a median level of 2528 to 1875 mol/l. Serum IgG levels were increased in 7 patients. Low C4 levels were found in 9 patients. Total B and T-lymphocytes were increased in 14 patients each, while CD4+, CD8+ and NK cells were increased in 13, 12 and 11 patients respectively. Absolute counts for all lymphocyte subsets were significantly higher compared to the normal controls (p=0.05 for all parameters). Raised levels of IgG were associated with older age, female gender, splenectomized status and higher serum ferritin levels but this did not reach statistical significance except for the higher ferritin levels (p=0.044). Increased tendency to infections was not observed. Conclusion: Patients with -thalassemia major receiving DFX exhibited significant immune abnormalities. Changes observed have been described previously, but could be related to DFX. The immune abnormalities were not associated with

  7. Consanguinity Ratio in Beta-Thalassemia Major Patients in District Bannu

    International Nuclear Information System (INIS)

    Khan, M. S.; Ahmed, M.; Khan, R. A.; Mushtaq, N.; Shah, M. W. U.


    Objective: To assess the frequency of consanguinity in b-thalassemia major patients and its association with age, gender and hepatitis C virus antibody positivity. Methods: The cross-sectional study was conducted from June 2013 to July 2014 at various hospitals of district Bannu in the North Western Khyber Pakhtunkhwa province of Pakistan. Data was recorded on a predesigned questionnaire. Results: Out of 180 subjects, 133(74 percent) parents were cousins, while 47(26 percent) were unrelated. The frequency of anti-hepatitis C virus antibody positivity was 14(7.77 percent). Conclusion: High prevalence of the disease in the study region was due to consanguineous marriages. (author)

  8. Visualization of the liver with sup(99m)Tc-EHDP in thalassemia major

    International Nuclear Information System (INIS)

    Valdez, V.A.; Jacobstein, J.G.


    A case is reported in which substantial liver uptake of sup(99m)Tc-hydroxyethylidene diphosphonate sup(99m)Tc-EHDP) was seen on bone scan. The patient, a 25-year-old male with the diagnosis of thalassemia major made at the age of 3 years, had received regular blood transfusions over many years. Clinical and laboratory evidence of hemosiderosis suggests that the presence of large quantities of iron in the liver of this patient may have been responsible for the hepatic uptake of the bone scanning agent. (orig.)

  9. Splenectomized versus non-splenectomized patients with thalassemia major: Echocardiographic comparison

    International Nuclear Information System (INIS)

    Morsy, Mohamed-Mofeed F.; Ahmed, Ali A.; Al-Najjar, Abdulhameed A.; Almuzainy, Ibrahim S.; Alhawsawi, Zakria M.; Alserafi, Mona H.


    Objective was to study the effect of splenectomy in patients with thalassemia major on the cardiovascular system through echocardiographic study. A prospective, cross-sectional study was carried out from December 2006 to December 2007. Patients from the Thalassemia Center in the Maternity and Children's Hospital, Madina, Kingdom of Saudi Arabia, were screened by means of history, physical examination, laboratory studies and echocardiography. Fifty-seven patients were studied: 36 were non-splenectomized, while 21 were surgically splenectomized. The 2 study groups were well matched for age, gender, height and weight. The total amount of blood given previous year (6577+-206.9 ml versus 5390.5+-220.2 ml, p=0.0005) and the annual transfusion index (200.9+-11.3 ml versus 134.1+-7.3, p=0.0001) were significantly lower in the splenectomized group. There was no significant difference between 2 groups regarding laboratory studies. Left ventricular systolic function shows no difference regarding fraction shortening between the 2 groups. The mitral valve E/A ratio was significantly higher in the splenectomized group (1.6+-0.2 versus1.4+-0.2, p=0.02). The pulmonary artery pressure was higher in the splenectomized group (34.2+-9.1 versus 20.8+-9.2 mm Hg, p=0.0001). There was a significantly higher number of patients with pulmonary hypertension in the splenectomized group (14[66.7%] versus 6[1.7%], p=0.0004). Splenectomized patients with thalassemia major are at high risk of having impaired diastolic left ventricular function and pulmonary hypertension. (author)

  10. Side effects of Deferasirox Iron Chelation in Patients with Beta Thalassemia Major or Intermedia

    Directory of Open Access Journals (Sweden)

    Murtadha Al-Khabori


    Full Text Available Objectives: Chelating agents remain the mainstay in reducing the iron burden and extending patient survival in homozygous beta-thalassemia but adverse and toxic effects may increase with the institution and long term use of this essential therapy. This study aimed to estimate the incidence of deferasirox (DFX side effects in patients with thalassemia major or intermedia.Methods: A retrospective study of 72 patients (mean age: 20.3±0.9 yrs; 36 male, 36 female with thalassemia major or intermedia treated at Sultan Qaboos University Hospital, Oman, was performed to assess the incidence of side effects related to deferasirox over a mean of 16.7 month follow-up period.Results: Six patients experienced rashes and 6 had gastro-intestinal upset. DFX was discontinued in 18 patients for the following reasons: persistent progressive rise(s in serum creatinine (7 patients; 40% mean serum creatinine rise from baseline, feeling unwell (2, severe diarrhea (1, pregnancy (1, death unrelated to chelator (2 and rise in serum transaminases (2. Three patients were reverted to desferoxamine and deferiprone combination therapy as DFX was no longer biochemically effective after 18 months of therapy. There was no correlation between baseline serum ferritin and serum creatinine or a rise in serum creatinine. Cardiac MRI T2* did not change with DFX therapy. However, there was an improvement in liver MRI T2* (p=0.013.Conclusion: Renal side effects related to deferasirox appear to be higher than those reported in published clinical trials. Further larger studies are required to confirm these findings.

  11. Shortened of the crown and root lengths of the mandibular permanent molar in beta major thalassemia children

    Directory of Open Access Journals (Sweden)

    Indra Primathena


    Full Text Available Beta major thalassemia is a genetically inherited blood disorder due to a genetic mutation on the polypeptide chains of hemoglobin which is manifested in the growth and development of the tooth. The objectives of the investigation were to obtain differences of the crown and root lengths of the mandibular first right side permanent molar between beta major thalassemia children and normal children group at the matching ages of 11 to 13 years old. The descriptive comparative method was used in the study and samples were selected using the purposive sampling technique. Sample numbers, which were obtained using the consecutive sampling technique, consists of 12 children of beta major thalassemia and 12 of normal children at the matching ages of 11 to 13 years. Periapical radiographs of both thalassemia and normal children were administered using the method of Seow and Lai. Data were analyzed using t-test method. The study revealed that the crown and root lengths of the mandibular first right side permanent molar of beta major thalassemia children were shorter than normal children at the ages of 11 to 13 years.

  12. Prevalence and Intensity of Depression in Mothers of Children with Beta-Thalassemia Major In Talghani Hospital of Gorgan, Iran

    Directory of Open Access Journals (Sweden)

    Nargesbeygom Mirbehbahani


    Full Text Available Background: Thalassemia is a chronic disease that it leads to psychological and social problems for parents. Mothers are at markedly increased risk of suffering from psychological distress and depression because they usually take on a considerable part of extra care that their children need.This study was designed to determine prevalence and intensity of depression in mothers with a thalassemic child. Material and Methods: In this cross – sectional study, 65 mothers of children with thalassemia major (case group and 65 mothers of children without thalassemia major (control group were assessed using the Beck Depression Inventory (BDI. Data were analyzed by using SPSS (v 16.0 for windows. Results: Prevalence of depression was significantly higher in case group than that in control group (84.6%vs. 56.9%, p <0.05. Moderate depression had a highest prevalence in the both groups (33.4% in case group and 30.8% in control group. Prevalence of severe depression in case group was markedly higher than that in control group (29.2% vs. 3.1% p<0.05. There was a significant difference between intensity of depression in mothers of case group that had another child with beta-thalassemia major (p<0.05. Conclusion: Mothers of children with thalassemia major are vulnerable to depression. They need psychosocial support to promote their health.

  13. Noninvasive analysis of skin iron and zinc levels in beta-thalassemia major and intermedia

    International Nuclear Information System (INIS)

    Gorodetsky, R.; Goldfarb, A.; Dagan, I.; Rachmilewitz, E.A.


    Diagnostic x-ray spectrometry, a method based on x-ray fluorescence analysis, was used for noninvasive determination of iron and zinc in two distinct skin areas, representing predominantly dermal and epidermal tissues, in 56 patients with beta-thalassemia major and intermedia. The mean iron levels in the skin of patients with beta-thalassemia major and intermedia were elevated by greater than 200% and greater than 50%, respectively, compared with control values. The zinc levels of both skin areas examined were within the normal range. The data indicate that the rate and number of blood transfusions, which correlated well with serum ferritin levels (r . 0.8), are not the only factors that determine the amount of iron deposition in the skin (r less than 0.6). Other sources of iron intake contribute to the total iron load in the tissues, particularly in patients who are not given multiple transfusions. The noninvasive quantitation of skin levels may reflect the extent of iron deposition in major parenchymal organs. Repeated DXS examinations of the skin could monitor the clearance of iron from the tissues of patients with iron overload in the course of therapy with chelating agents

  14. The Correlation between Troponin and Ferritin Serum Levels in the Patients with Major Beta-Thalassemia

    Directory of Open Access Journals (Sweden)

    Iraj Shahramian


    Full Text Available Background: Thalassemia is a hereditary hemoglobinopathy whose most common complication is cardiac involvement which ends up in these patients’ death. Since troponin is a sensitive and specific marker for the detection of microinfarct, we studied the relationship between troponin and ferritin serum levels for early diagnosis of cardiac involvement in these patients. Materials and Methods: This case-control study was performed on 80 patients, including 40 patients with major thalassemia and normal echocardiography and 40 healthy volunteers ranging from 6 months to 16 years old. All the children were examined and the eligible children who were not infected with known heart disease, iron deficiency anemia, kidney disease, diabetes, fever, and systemic diseases were enrolled into the study after obtaining written informed consents from their parents. At 8:00 A.M. before breakfast, 5cc blood was drawn from these children. After collecting the samples, ferritin and troponin serum levels were evaluated using ELISA and electro- kymonolonsense methods, respectively. The gathered data were analyzed through the SPSS statistical software (v. 20 and T-test. Besides, P value<0.05 was considered as statistically significant. Results: The study results revealed a significant difference between the two groups regarding the mean of the serum levels of troponin (P=0.045 and ferritin (P=0.001. In this study, no significant correlation was observed between serum troponin and ferritin levels and age and BMI in the two groups. Also, no significant relationship was found between serum troponin level and sex (P=0.264. Conclusions: In microinfarct, troponin increases independent of ferritin; therefore, it can be used for early detection of cardiac involvement in thalassemia patients to determine the sub-clinical effects.

  15. Beta thalassemia major: The effect of age on glomerular filtration rate

    Directory of Open Access Journals (Sweden)

    Majid Malaki


    Full Text Available Thalassemia is a common hereditary hemoglobinopathy disorder that affects many organs in the body. Estimation of kidney function is important, as it is the vital organ that plays the major role in the elimination of accumulated iron as well as the chelating drugs that have to be used as therapy. Sixty- three patients aged 1-29 years, with a mean ± SD of 14 ± 6.7 years, affected with beta- thalassemia major in Tabriz Children′s Hospital were evaluated for their renal function on the basis of their age, serum iron, serum ferritin and serum creatinine levels along with two methods of estimating glomerular filtration rate (GFR; by Schwartz method for those under 18 years old and using Modification of Diet in Renal Disease (MDRD formula for those who were 18 years and above. Elevation of serum creatinine denoting renal dysfunction was not seen in our patients, but hyperfiltration was a common finding. An increasing GFR was observed, which corresponded to age, but no relationships were seen between serum iron, serum ferritin, regular blood transfusion, chelating therapy to GFR.

  16. Spinal cord compression secondary to extramedullary hematopoiesis: A rareness in a young adult with thalassemia major. (United States)

    Fareed, Shehab; Soliman, Ashraf T; De Sanctis, Vincenzo; Kohla, Samah; Soliman, Dina; Khirfan, Diala; Tambuerello, Adriana; Talaat, Mohamed; Nashwan, Abdulqadir; Caparrotti, Palmira; Yassin, Mohamed A


    We report a case of a thalassemia major male patient with back pain associated to severe weakness in lower extremities resulting in the ability to ambulate only with assistance. An urgent magnetic resonance imaging (MRI) of  thoracic and lumbosacral spine was requested. A posterior intraspinal extradural mass lesion compressing the spinal cord at the level of thoracic T5-8 was present, suggesting an extramedullary hematopoietic centre, compressing the spinal cord. He was treated successfully with thalassemia major alone. The patient was treated with blood transfusion, dexamethasone, morphine and paracetamol, followed by radiotherapy in 10 fractions to the spine (daily fraction of 2Gy from T3 to T9, total dose 20 Gy). His pain and neurologic examination quickly improved. A new MRI of the spine, one week after radiotherapy, showed an improvement of the extramedullary hematopoietic mass compression. In conclusion, EMH should be considered in every patient with ineffective erythropoiesis and spinal cord symptoms. MRI is the most effective method of demonstrating EMH. The rapid recognition and treatment can dramatically alleviate symptoms. There is still considerable controversy regarding indications, benefits, and risks of each of modality of treatment due to the infrequency of this disorder.

  17. The ICET-A Recommendations for the Diagnosis and Management of Disturbances of Glucose Homeostasis in Thalassemia Major Patients (United States)

    De Sanctis, Vincenzo; Soliman, Ashraf T.; Elsedfy, Heba; Yaarubi, Saif AL; Skordis, Nicos; Khater, Doaa; El Kholy, Mohamed; Stoeva, Iva; Fiscina, Bernadette; Angastiniotis, Michael; Daar, Shahina; Kattamis, Christos


    Iron overload in patients with thalassemia major (TM) affects glucose regulation and is mediated by several mechanisms. The pathogenesis of glycaemic abnormalities in TM is complex and multifactorial. It has been predominantly attributed to a combination of reduced insulin secretory capacity and insulin resistance. The exact mechanisms responsible for progression from norm glycaemia to overt diabetes in these patients are still poorly understood but are attributed mainly to insulin deficiency resulting from the toxic effects of iron deposited in the pancreas and insulin resistance. A group of endocrinologists, haematologists and paediatricians, members of the International Network of Clinicians for Endocrinopathies in Thalassemia and Adolescence Medicine (ICET-A) convened to formulate recommendations for the diagnosis and management of abnormalities of glucose homeostasis in thalassemia major patients on the basis of available evidence from clinical and laboratory data and consensus practice. The results of their work and discussions are described in this article. PMID:27872738

  18. Clinical And Radiological Assessment Of Deferiprone Related Knee Arthropathy In Children With P-Thalassemia Major

    International Nuclear Information System (INIS)

    Mokhtar, G.M.; Tantawy, A.A.; Abdelmaksoud, A.A.; Shams, M.A.; Tantawy, W.; Sakr, H.; Nassar, N.


    Objectives: To evaluate deferiprone related knee arthropathy in patients with fi-thalassemia major undergoing chelation therapy with deferiprone (LI). Materials and Methods. This study included 40 patients with β- thalassemia major on deferiprone; their ages ranged from 8 to 18 years with a mean age of 12.6 ± 3 years. Forty age and sex matched patients on desferal served as controls. Patients were subjected to clinical knee joint examination using the modified hemophilia joint health score (JHS), bilateral knee joint X-ray and bilateral knee joint ultrasound. Twenty patients of the deferiprone group with positive knee joint ultrasound findings were subjected to knee MRI. Data collected included age, sex, transfusion index, chelation history (dose, duration, and adverse effects), history of splenectomy and symptoms of knee or other joints arthropathy. Weight, height, BMI and Tanner staging of the patients were recorded. Laboratory investigations included CBC, ALT, serum ferritin, viral hepatitis markers (B,C) and echocardiography. Results: Among deferiprone group; 25 patients (62.5%) had knee symptoms while; 93.3% of the asymptomatic patients had evidence of knee joint affection by JHS compared to 17 symptomatic patients (42.5%) among desferal group (ρ> 0.05). Among deferiprone group 7 patients (17.5%) had symptoms of other joints arthropathy. Knee symptoms were more prevalent with longer duration of deferiprone therapy (ρ<0.05), knee joint effusion in US (ρ< 0.05) and Higher platelet count (ρ<0.05), while in desferal group it was related to poor compliance (ρ< 0.01) and higher serum ferritin levels (ρ=<0.01). JHS ranged from 0-33 with 39 (97.5%) affected patients. JHS was positively correlated to age, weight, height, BMI, Tanner staging and platelet count (ρ<0.01), and negatively correlated to transfusion index (ρ<0.01) with no significant correlation to ultrasound or MRI findings. JHS was higher among splenectomized patients in both groups (ρ<0.01). No

  19. Effects of blood transfusion on exercise capacity in thalassemia major patients.

    Directory of Open Access Journals (Sweden)

    Daniela Benedetto

    Full Text Available Anemia has an important role in exercise performance. However, the direct link between rapid changes of hemoglobin and exercise performance is still unknown.To find out more on this topic, we studied 18 beta-thalassemia major patients free of relevant cardiac dysfunction (age 33.5±7.2 years,males = 10. Patients performed a maximal cardiopulmolmonary exercise test (cycloergometer, personalized ramp protocol, breath-by-breath measurements of expired gases before and the day after blood transfusion (500 cc of red cell concentrates. After blood transfusion, hemoglobin increased from 10.5±0.8 g/dL to 12.1±1.2 (p<0.001, peak VO2 from 1408 to 1546mL/min (p<0.05, and VO2 at anaerobic threshold from 965 to 1024mL/min (p<0.05. No major changes were observed as regards heart and respiratory rates either at peak exercise or at anaerobic threshold. Similarly, no relevant changes were observed in ventilation efficiency, as evaluated by the ventilation vs. carbon dioxide production relationship, or in O2 delivery to the periphery as analyzed by the VO2 vs. workload relationship. The relationship between hemoglobin and VO2 changes showed, for each g/dL of hemoglobin increase, a VO2 increase = 82.5 mL/min and 35 mL/min, at peak exercise and at anaerobic threshold, respectively. In beta-thalassemia major patients, an acute albeit partial anemia correction by blood transfusion determinates a relevant increase of exercise performance, observed both at peak exercise and at anaerobic threshold.

  20. Effect of Average Annual Mean Serum Ferritin Levels on QTc Interval and QTc Dispersion in Beta-Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Yazdan Ghandi


    Full Text Available Background There is evidence indicating impaired cardiomyocytic contractility, delayed electrical conduction and increased electrophysiological heterogeneities due to iron toxicity in beta-thalassemia major patients. In the present study, we compared the electrocardiographic and echocardiographic features of beta-thalassemia major patients with a healthy control group. Materials and Methods The average annual serum ferritin levels of fifty beta-thalassemia major patients were assessed. For each patient, corrected QT (QTc intervals and QTc dispersions (QTcd were calculated and V1S and V5R were measured. All subjects underwent two-dimensional M-mode echocardiography and Doppler study and were compared with 50 healthy subjects as a control group. Results QTc interval and dispersion were significantly higher in beta-thalassemia major patients (P= 0.001. The mean V5R (20.04 ± 4.34 vs. 17.14 ± 2.55 mm and V1S (10.24 ± 2.62 vs. 7.83 ± 0.38 mm showed considerably higher mean values in patients in comparison with control group.Peak mitral inflow velocity at early diastole and early to late ratio in the case- group was markedly higher(P

  1. Treating thalassemia major-related iron overload: the role of deferiprone

    Directory of Open Access Journals (Sweden)

    Berdoukas V


    Full Text Available Vasilios Berdoukas,1 Kallistheni Farmaki,2 Susan Carson,1 John Wood,3 Thomas Coates11Division of Hematology/Oncology, Children's Hospital Los Angeles, Los Angeles, CA, USA; 2Thalassemia Unit, General Hospital of Corinth, Corinth, Greece; 3Division of Cardiology, Children's Hospital Los Angeles, Los Angeles, CA, USAAbstract: Over the last 20 years, management for thalassemia major has improved to the point where we predict that patients' life expectancy will approach that of the normal population. These outcomes result from safer blood transfusions, the availability of three iron chelators, new imaging techniques that allow specific organ assessment of the degree of iron overload, and improvement in the treatment of hepatitis. In October 2011, the Food and Drug Administration licensed deferiprone, further increasing the available choices for iron chelation in the US. The ability to prescribe any of the three chelators as well as their combinations has led to more effective reduction of total body iron. The ability to determine the amount of iron in the liver and heart by magnetic resonance imaging allows the prescription of the most appropriate chelation regime for patients and to reconsider what our aims with respect to total body iron should be. Recent evidence from Europe has shown that by normalizing iron stores not only are new morbidities prevented but also reversal of many complications such as cardiac failure, hypothyroidism, hypogonadism, impaired glucose tolerance, and type 2 diabetes can occur, improving survival and patients' quality of life. The most effective way to achieve normal iron stores seems to be with the combination of deferoxamine and deferiprone. Furthermore, outcomes should continue to improve in the future. Starting relative intensive chelation in younger children may prevent short stature and abnormal pubertal maturation as well as other iron-related morbidities. Also, further information should become available on the

  2. Parathyroid hormone in pediatric patients with β-thalassemia major ...

    African Journals Online (AJOL)

    Mostafa El-Nashar


    Apr 9, 2016 ... 1. Introduction. Beta-thalassemia is an inherited anemia caused by unbalanced ... The work has been carried out in accordance with the World ... The life expectancy of patients with b-thalassemia has greatly improved with ...

  3. Hematopoietic stem cell transplantation from non-sibling matched family donors for patients with thalassemia major in Jordan. (United States)

    Hussein, Ayad Ahmed; Al-Zaben, Abdulhadi; Khattab, Eman; Haroun, Anas; Frangoul, Haydar


    There are limited data on the outcome of patients with thalassemia receiving HSCT from non-sibling matched family donors. Of the 341 patients with thalassemia major that underwent donor search at our center from January 2003 to December 2011, 236 (69.2%) had fully matched family donor of which 28 patients (8.2%) had non-sibling matched family donors identified. We report on seven patients with a median age of eight yr (4-21) who underwent myeloablative (n = 4) or RIC (n = 3) HSCT. The median age of the donors was 33 yr (4-47), three were parents, two first cousins, one paternal uncle, and one paternal aunt. All patients achieved primary neutrophil and platelet engraftment at a median of 18 (13-20) and 16 days (11-20), respectively. One patient developed grade II acute GVHD, and two patients developed limited chronic GVHD. One patient experienced secondary GF requiring a second transplant. At a median follow-up of 69 months (7-110), all patients are alive and thalassemia free. Our data emphasize the need for extended family HLA typing for patients with thalassemia major in regions where there is high rate of consanguinity. Transplant from non-sibling matched family donor can result in excellent outcome. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Oral Health and Dentofacial Anomalies among β-THALASSEMIA Major in Erbil City, Iraq (United States)

    Saeed, Lamya M.; Majeed, Vian O.


    Thalassemias are a heterogeneous group of genetic disorders characterized by hypochromic microcytic anemia that caused by deficient synthesis of one or more of globin subunits of human hemoglobin. This study has been conducted in the Northern part of Iraq among 238 subjects having β-thalassemia major (BTM). To evaluate their oral health status, dentofacial anomalies of patients who attended the Thalassemic center in Erbil city, were compared to 258 subjects of a control group according to the criteria suggested by the WHO in 1997, which is used to assess permanent teeth. Only 8.51% of the total study group demonstrated crowding of anterior teeth in one or both segments compared to the control group. Spacing in the incisal segments was higher, namely 19.23% in BTM compared to13.6% in the control group with a statistically significant difference (p<0.05). A higher percentage of both study and control groups were having an overbite grade (0.3-5.0 mm) of 49.59%, and 56.81%, respectively. It was found that the distal deviation from the normal anteroposterior molar relation in BTM was higher compared to the control group. Nearly similar percentages of patients were found to have an over jet grade(0.0-3.5 mm). Values of plaque and gingival health indices were recorded to be higher among the study group (plaque index = 1.570, ∓0.321 and gingival index = 1.205, ∓0.308). Differences were statistically highly significant for all indices (p<0.01). This may indicate that there is a negative attitude and poor dental knowledge of thalassemic subjects and their parents toward proper oral hygiene and dental health.

  5. Detection of Early Right Ventricular Dysfunction in Young Patients With Thalassemia Major Using Tissue Doppler Imaging (United States)

    Bornaun, Helen; Dedeoglu, Reyhan; Oztarhan, Kazim; Dedeoglu, Savas; Erfidan, Erkan; Gundogdu, Muge; Aydogan, Gonul; Cengiz, Dicle


    Background Myocardial iron overload is the most common cause of mortality in patients with thalassemia major (TM), also known as beta-thalassemia. T2* cardiovascular magnetic resonance imaging (MRI) is the best way of monitoring cardiac iron, and new echocardiographic techniques can be used to assess cardiac function. Objectives The aim of this study was to assess the systolic and diastolic right ventricular (RV) function of patients with TM using tissue Doppler imaging (TDI) and to determine whether this echocardiographic technique is an adequate diagnostic tool for the screening and detection of subclinical cardiac dysfunction. Patients and Methods Eighty-four patients with TM were evaluated by conventional echocardiography and pulse-wave TDI. The data of the TM group (Group 1) were compared with that of 85 age- and sex-matched healthy controls (Group 2). Cardiovascular T2* MRI examinations were performed in 49 of the 85 patients. Results The patients with TM had significantly lower values for weight, height, body mass index, systolic arterial pressure, deceleration time, E’/A’, and ejection time (ET) than the controls. Group 1 also had significantly higher values for peak early diastolic velocity (E) over peak late diastolic velocity (A), peak early diastolic velocity of TDI (E’), peak late diastolic velocity of TDI (A’), E/E’, isovolumetric relaxation time, isovolumetric contraction time, and RV magnetic perfusion imaging (MPI) than Group 2. Conclusions RV diastolic dysfunction occurs before systolic deterioration in patients with TM and cannot be screened with conventional echocardiographic techniques. In routine practice, TDI measurements, MPI (for global function) and the E/E’ parameter (for diastolic function) can be used to screen and detect early RV dysfunction. PMID:27617076

  6. Resolution of alloimmunization and refractory autoimmune hemolytic anemia in a multi-transfused beta-thalassemia major patient

    Directory of Open Access Journals (Sweden)

    Joseph Philip


    Full Text Available Beta-thalassemia is one of the most prevalent autosomal disorders, which affect more than 400,000 newborn per year worldwide. In India, the carrier rate of beta-thalassemia varies from 3-17%. The overall rate of alloimmunization in thalassemia patients has been reported to be 5-30% in the world, which is mostly contributed by the alloimmunization to minor blood group antigen. Among Asians, the incidence of red cell alloimmunization is 22%. The recommended treatment for beta-thalassemia major is regular blood transfusion every 3 to 4 weeks. The development of anti-red cell antibodies (alloantibodies and/or autoantibodies can significantly complicate transfusion therapy. Alloantibodies are commonly associated with red cell hemolysis. Red cell autoantibodies appear less frequently, but they can result in clinical hemolysis called autoimmune hemolytic anemia (AIHA, and in difficulty in cross-matching blood. Patients with autoantibodies may have a higher transfusion rate and often require immunosuppressive drugs or alternative treatments including intravenous immunoglobulin (IVIg and rituximab (anti-CD20 monoclonal antibody.

  7. Study of Insulin Resistance in Patients With β Thalassemia Major and Validity of Triglyceride Glucose (TYG) Index. (United States)

    Ansari, Arif M; Bhat, Kamalakshi G; Dsa, Smitha S; Mahalingam, Soundarya; Joseph, Nitin


    Complications like impaired glucose tolerance and diabetes mellitus due to iron overload need early identification in thalassemia. We studied the proportion of insulin resistance in thalassemia major patients on chronic transfusion, identified insulin resistance using homeostasis model assessment of insulin resistance (HOMA-IR) and triglyceride glucose (TYG) index, compared them and validated TYG index. In total, 73 thalassemia patients on regular transfusion for 3 years with serum ferritin >1500 ng/mL were studied. Serum ferritin, fasting blood glucose, triglycerides, and insulin levels were measured, HOMA-IR, and TYG index calculated and analyzed. Mean fasting glucose, triglyceride, and serum insulin values were 104 mg/dL, 164.18 mg/dL, and 19.6 m IU/mL, respectively. Mean serum ferritin was 5156 ng/mL. Insulin resistance was prevalent in one third of thalassemia patients and showed increase with age and serum ferritin. Insulin resistance by HOMA-IR was 32% as against 16% by TYG index with a cut-off value of 4.3. Using receiver operating charecteristic curve analysis, it was found that, by lowering the value of TYG index to 4.0215, sensitivity improved to 78.3% (from 39.13%) with specificity of 70%. Hence, we recommend a newer lower cut-off value of 4.0215 for TYG index for better sensitivity and specificity in identifying insulin resistance.

  8. Prospects and future of conservative management of beta thalassemia major in a developing country

    International Nuclear Information System (INIS)

    Rahman, M.; Lodhi, Y.


    Objective: To assess the efficacy, prospects and future of conservative management of beta thalassemia major patients in a developing country. Design: Patients registered at IHBTS were studied over a period of three years. They consented to being managed on moderate transfusion regimen, aiming to maintain a pre-transfusion haemoglobin(Hgb) level of 9.0 plus minus 1.0 g per dL. We studied their transfusion requirements, status for transfusion transmitted infections (TTls), serum ferritin levels and complications developing as a result of iron overload. Subjects: Initially all registered patients were included in this study. Sporadic patients as well as dropouts occurring due to any reason, (patients concurrently seeking treatment at other centres as well, or complying poorly to advised chelation therapy) were excluded from the study. The data presented here conforms to a cohort of 60 regular patients who adhered best to our selection criteria. Main Outcome Measures: 1) The study highlights the deficiencies and problems of conservative management for beta thalassemia major. 2) The major impact of our study is the message that conservative management in a poor country, like ours, is a no-win situation. 3) There is an urgent need to immediately start a prevention programme. Results: In the younger patients, blood consumption even on the moderate transfusion regimen is 120ml/kg/year, however with ascending age the consumption increases to 240ml/kg/year. A substantive number of the patients are either Hep C (35%) or Hep B (1.7%) positive. There are no HIV positive patients. Serum ferritin levels vary widely and could not be controlled due to poor compliance to chelation. 50% of the patients developed one or other complications of iron overload. The cost of treatment depending on the quality of care, is tremendous and beyond the reach of the common man. Conclusions: Conservative management may be the best alternative and at times the only hope for patients in our country

  9. Pulsed and Tissue Doppler Echocardiographic Changes in Patients with Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Taysir S. Garadah


    Full Text Available Background Doppler echocardiographic studies of left ventricle (LV systolic and diastolic function in patients with β-Thalassemia Major (β-TM had shown different patterns of systolic and diastolic dysfunction. Aim This cross-sectional study was designed to study the LV systolic and diastolic function in patients with β-TM using Pulsed Doppler (PD and Tissue Doppler (TD echocardiography. Methods All patients were evaluated clinically and by echocardiography, The study included patients with β-TM (n = 38, age 15.7 ± 8.9 years compared with an age-matched control group (n = 38, age 15.9 ± 8.9 years. The pulse Doppler indices were normalized for age and heart rate. Results Compared with control patients, M-Mode showed that patients with β-TM have thicker LV septal wall index (0.659 ± 0.23 vs. 0.446 ± 0.219 cm, P ≤ 0.001, posterior wall index (0.659 ± 0.235 vs. 0.437 ± 0.214 cm, P ≤ 0.01, and larger LVEDD index is (3.99 ± 0.48 vs. 2.170 ± 0.57 mm. P = 0.035. Pulsed Doppler showed high LV trans-mitral E wave velocity (70.818 ± 10.139 vs. 57.532 ± 10.139, p = 0.027 and E/A ratio (1.54 vs. 1.23, P ≤ 0.01. The duration of Deceleration time (DT and isovolumic relaxation time (IVRT were significantly shorter in patients with β-TM (150.234 ± 20.0.23 vs. 167.123 ± 19.143 msec, P ≤ 0.01 and (60.647 ± 6.77 vs. 75.474 ± 5.83 msec, P ≤ 0.001, respectively. The ratio of transmitral E wave velocity to the tissue Doppler E wave at the basal septal mitral annulus E/Em – was significantly higher in β-TM group (14.024 ± 2.29 vs. 12.132 ± 1.82, P ≤ 0.01. The Tissue Doppler systolic velocity (Sm and the early diastolic velocity (Em were significantly lower in β-TM group compared to control (4.31 ± 1.2 cm/s vs. 6.95 ± 2.1, P ≤ 0.01 and 4.31 ± 2.7 cm/s vs. 5.82 ± 2.5, P ≤ 0.01 respectively. The tricuspid valve velocity was significantly higher than controls (2.993 ± 0.569 vs. 1.93 ± 0.471 m/sec, respectively, P ≤ 0

  10. Metabolic syndrome in Iraqi female patients with major β-thalassemia

    Directory of Open Access Journals (Sweden)

    Shaemaa Hadi Abdulsada


    Full Text Available Patients with β-thalassemia may have an increased risk for diabetes mellitus and cardiovascular diseases due to high level of iron which may lead to insulin resistanceand metabolic syndrome. So this study aimed to evaluate the levels of lipids profile in Iraqi female patients with β-thalassemia. Forty twofemale (age 15-30 years were enrolled in this study. Blood was collected and the sera were separated from (22 female patients with β-thalassemia who were attended the Ibn-Al-Baladi hospital from September 2012 to January 2013 and (20 healthy subject as a control group. Body mass index (BMI, lipid profile, FSG, insulin, insulin resistance, insulin sensitivity, B-cell function, iron, atherogenic index of serum were estimated. The results showed the presence of a significant increase in serum iron and significant decrease in insulin, B-cell function, LDL, VLDL, and TC in serum of patients with β-thalassemia when compared with control group. BMI also showed a significant decrease in patients when compared with the controls. Serum Insulin resistance, insulin sensitivity, HDL, TG, AIS, and FSG showed no-significant differences in patients with β-thalassemia when compared with control group. We concluded there was no metabolic syndrome in female patients with β-thalassemia.

  11. Evaluation of cognition in children with beta-thalassemia major and healthy counterparts in terms of abstract thinking and visual organization

    Directory of Open Access Journals (Sweden)

    Samaneh Homayouni-Meymandi


    Conclusion: The results show the potential impact of the disease on children›s cognitive levels and suggest that children with beta-thalassemia major need more attention in the field of education to promote their understanding.

  12. A randomized, controlled study evaluating effects of amlodipine addition to chelators to reduce iron loading in patients with thalassemia major. (United States)

    Eghbali, Aziz; Kazemi, Hamideh; Taherahmadi, Hassan; Ghandi, Yazdan; Rafiei, Mohammad; Bagheri, Bahador


    Cardiomyopathy due to iron overload can be fatal in patients with thalassemia major. Calcium channel blockers seem to be effective to reduce iron loading. Our goal was to study effects of amlodipine addition to chelators on iron loading in patients with thalassemia major. This randomized, controlled, and single-center trial was performed on 56 patients with thalassemia major. Patients were randomized 1:1 to combined group (iron chelator plus amlodipine) or control group (iron chelator) for 1 year. Iron content was measured by magnetic resonance imaging; heart T2*, and liver T2*. Serum ferritin was also measured. After 12 months of treatment, myocardial T2* values had significant improvement in combined group (21.9 ± 8.0 ms to 24.5 ± 7.6 ms; P < .05); Difference between two groups was significant (P = .02). Combined treatment had no effect on hepatic T2* value (9.6 ± 2.8 ms to 9.5 ± 3.6 ms); difference between two groups was not significant (P = .2). In addition, a significant reduction was seen in serum ferritin levels in two groups. Mild gastrointestinal upset was the most common untoward effect. Addition of amlodipine to iron chelators has beneficial effects for reduction of iron loading in patients with thalassemia major. This combination therapy seems safe. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. MR imaging of deferoxamine-induced bone dysplasia in an 8-year-old female with thalassemia major

    International Nuclear Information System (INIS)

    Miller, T.T.; Caldwell, G.; Kaye, J.J.; Arkin, S.; Burke, S.; Brill, P.W.


    Bone changes in thalassemic patients receiving deferoxamine therapy for iron chelation include metaphyseal and growth plate irregularities. We present a case of an 8-year-old female with thalassemia major, who had magnetic resonance imaging after plain radiographs had shown metaphyseal changes in the distal femur. The signal characteristics of these abnormalities were consistent with hyaline cartilage; the surrounding marrow showed no evidence of iron overrload. (orig.)

  14. Evaluation of cardiac and hepatic iron overload in thalassemia major patients with T2* magnetic resonance imaging. (United States)

    Wahidiyat, Pustika Amalia; Liauw, Felix; Sekarsari, Damayanti; Putriasih, Siti Ayu; Berdoukas, Vasili; Pennell, Dudley J


    Recent advancements have promoted the use of T2* magnetic resonance imaging (MRI) in the non-invasive detection of iron overload in various organs for thalassemia major patients. This study aims to determine the iron load in the heart and liver of patients with thalassemia major using T2* MRI and to evaluate its correlation with serum ferritin level and iron chelation therapy. This cross-sectional study included 162 subjects diagnosed with thalassemia major, who were classified into acceptable, mild, moderate, or severe cardiac and hepatic iron overload following their T2* MRI results, respectively, and these were correlated to their serum ferritin levels and iron chelation therapy. The study found that 85.2% of the subjects had normal cardiac iron stores. In contrast, 70.4% of the subjects had severe liver iron overload. A significant but weak correlation (r = -0.28) was found between cardiac T2* MRI and serum ferritin, and a slightly more significant correlation (r = 0.37) was found between liver iron concentration (LIC) and serum ferritin. The findings of this study are consistent with several other studies, which show that patients generally manifest with liver iron overload prior to cardiac iron overload. Moreover, iron accumulation demonstrated by T2* MRI results also show a significant correlation to serum ferritin levels. This is the first study of its kind conducted in Indonesia, which supports the fact that T2* MRI is undoubtedly valuable in the early detection of cardiac and hepatic iron overload in thalassemia major patients.

  15. MR imaging of deferoxamine-induced bone dysplasia in an 8-year-old female with thalassemia major

    Energy Technology Data Exchange (ETDEWEB)

    Miller, T.T. (Dept. of Radiology and Nuclear Medicine, Hospital for Special Surgery, New York, NY (United States)); Caldwell, G. (Dept. of Orthopedic Surgery, Hospital for Special Surgery, New York, NY (United States)); Kaye, J.J. (Dept. of Radiology and Nuclear Medicine, Hospital for Special Surgery, New York, NY (United States)); Arkin, S. (Dept. of Pediatrics, Mount Sinai Medical Center, New York, NY (United States)); Burke, S. (Dept. of Orthopedic Surgery, Hospital for Special Surgery, New York, NY (United States)); Brill, P.W. (Dept. of Radiolgy, New York Hospital, Cornell Univ. Medical Center, New York, NY (United States))


    Bone changes in thalassemic patients receiving deferoxamine therapy for iron chelation include metaphyseal and growth plate irregularities. We present a case of an 8-year-old female with thalassemia major, who had magnetic resonance imaging after plain radiographs had shown metaphyseal changes in the distal femur. The signal characteristics of these abnormalities were consistent with hyaline cartilage; the surrounding marrow showed no evidence of iron overrload. (orig.)

  16. [Pretreatment doses of antithymocyte globubin-fresenius for allogeneic hematopoietic stem cell transplantation for beta-thalassemia major]. (United States)

    Li, Chunfu; Wang, Yanhua; Wu, Xuedong; Pei, Fuyu; He, Yuelin; Feng, Xiaoqin; Liu, Huaying


    To investigate the effects of different doses of antithymocyte globubin-fresenius (ATG-F) for allogeneic hematopoietic stem cell transplantation (allo-HSCT) in patients with beta-thalassemia Major. Sixty-four children with beta-thalassemia major undergoing allo-HSCT were divided into two equal groups to receive ATG-F pretreatments at high (30 mg/kg) or low (15 mg/kg) doses as part of the conditioning regimen including mainly cyclophosphamide, busulfan, fludarabine, and thiotepa. The outcomes of the patients were compared between the two groups. No obvious difference were noted in the time to leukocyte and platelet engraftment between the two groups. The incidence of grade II-IV acute graft-versus-host disease (aGVHD) appeared to be higher in the low-dose group than in the high-dose group (12.5% vs 9.4%). The incidence of grade III-IV aGVHD was also higher in the low dose group (12.5% vs 6.3%), but the difference was not statistically significant. Application of high-dose ATG-F was associated with a higher rate of probable and possible fungal infection (P<0.05). The two doses of ATG-F is feasible as a part of the conditioning regimen for allo-HSCT in children with beta-thalassemia major.

  17. The pancreas in {beta}-thalassemia major: MR imaging features and correlation with iron stores and glucose disturbunces

    Energy Technology Data Exchange (ETDEWEB)

    Papakonstantinou, Olympia [University Hospital of Heraklion, Medical School of Crete, Department of Radiology, Heraklion, Crete (Greece); Attikon Hospital, 2nd Department of Radiology, Athens (Greece); Ladis, Vasilios; Kostaridou, Stavroula; Berdousi, Helen; Kattamis, Christos [Thalassemia Unit, University of Athens, ' ' Aghia Sophia' ' Children' s Hospital, Athens (Greece); Maris, Thomas; Gourtsoyiannis, Nicholas [University Hospital of Heraklion, Medical School of Crete, Department of Radiology, Heraklion, Crete (Greece)


    The study aims at describing the MR features of pancreas in beta-thalassemia major, investigating the relations between MR findings and glucose disturbances and between hepatic and pancreatic siderosis. Signal intensity ratios of the pancreas and liver to right paraspinous muscle (P/M, L/M) were retrospectively assessed on abdominal MR imaging studies of 31 transfusion-dependent patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 10 healthy controls, using T1- (120/4/90), intermediate in and out of phase - (120/2.7, 4/20), and T2*-(120/15/20) weighted GRE sequences. Using the signal drop of the liver and pancreas on opposed phase images, we recorded serum ferritin and results of oral glucose tolerance test (OGTT). Decreased L/M and P/M on at least the T2* sequence were noticed in 31/31 and 30/31 patients, respectively, but no correlation between P/M and L/M was found. Patients with pathologic OGTT displayed a higher degree of hepatic siderosis (p < 0.04) and signal drop of pancreas on opposed phase imaging (p < 0.025), implying fatty replacement of pancreas. P/M was neither correlated with glucose disturbances nor serum ferritin. Iron deposition in the pancreas cannot be predicted by the degree of hepatic siderosis in beta-thalassemia major. Fatty replacement of the pancreas is common and may be associated with glucose disturbances. (orig.)

  18. The pancreas in β-thalassemia major: MR imaging features and correlation with iron stores and glucose disturbunces

    International Nuclear Information System (INIS)

    Papakonstantinou, Olympia; Ladis, Vasilios; Kostaridou, Stavroula; Berdousi, Helen; Kattamis, Christos; Maris, Thomas; Gourtsoyiannis, Nicholas


    The study aims at describing the MR features of pancreas in beta-thalassemia major, investigating the relations between MR findings and glucose disturbances and between hepatic and pancreatic siderosis. Signal intensity ratios of the pancreas and liver to right paraspinous muscle (P/M, L/M) were retrospectively assessed on abdominal MR imaging studies of 31 transfusion-dependent patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 10 healthy controls, using T1- (120/4/90), intermediate in and out of phase - (120/2.7, 4/20), and T2*-(120/15/20) weighted GRE sequences. Using the signal drop of the liver and pancreas on opposed phase images, we recorded serum ferritin and results of oral glucose tolerance test (OGTT). Decreased L/M and P/M on at least the T2* sequence were noticed in 31/31 and 30/31 patients, respectively, but no correlation between P/M and L/M was found. Patients with pathologic OGTT displayed a higher degree of hepatic siderosis (p < 0.04) and signal drop of pancreas on opposed phase imaging (p < 0.025), implying fatty replacement of pancreas. P/M was neither correlated with glucose disturbances nor serum ferritin. Iron deposition in the pancreas cannot be predicted by the degree of hepatic siderosis in beta-thalassemia major. Fatty replacement of the pancreas is common and may be associated with glucose disturbances. (orig.)


    Directory of Open Access Journals (Sweden)

    Giuseppina Messina


    Full Text Available Background. The reproductive and sexual health issues concerning persons affected by thalassemia major are complex. The study was planned to investigate the psychological attitudes and expectations in a group of thalassemic pregnant women attending hospital for regular blood transfusion. Methods. The study included 20 consecutive thalassemic patients and a control group of 42 healthy pregnant volunteers. We evaluated the personality structure by Rorschach's test and the presence of psychic symptoms by SCL-90-R and STAI. Results. Narcissism and sexual traumas are significantly higher in thalassemic women with respects to the control group. Also the percent of anxiety and depression observed with the SCL-90-R was significantly higher than in control group. The score observed with the STAI shows that the state of anxiety changed significantly between thalassemic pregnant women and the control group, even though the scores values aren’t pathologic in neither group. Conclusions. This study addresses the need for developing, implementing and evaluating proper psychological support for thalassemic pregnant patients. The limit of this study is to analyze just thalassemic women because it doesn’t consider other pathologies; so the results can’t be extended to other pathologies different from thalassemic. Moreover, psychological screening and support prior to, during and following pregnancy would be indicated. Since not there are psychological studies in literature on the pregnancy in the thalassemic patients, the evaluation of the effects of pregnancy on the thalassemic disease will be the aim of future psychological investigations.

  20. Patterns of physical growth and dental development in Jordanian children and adolescents with thalassemia major. (United States)

    Hattab, Faiez N


    Dental development and physical growth are of particular interest in pediatric dentistry and orthodontics. This study evaluated these variables in patients with thalassemia major (TM). Physical growth was assessed in 54 patients (31 males and 23 females) aged 5.5 to 18.3 years and dental development was analyzed using panoramic radiographs from 39 of the 54 patients. The Demirjian system was used to characterize dental development of the seven left mandibular permanent teeth. Chronologic age (CA) and dental age (DA) were compared using the paired t-test, and the correlation between CA and extent of delay in dental development (DA minus CA) was assessed using Pearson's correlation coefficients. Growth retardation (development in 31 of 39 (79.5%) of participants (mean delay, 1.12 years in males and 0.81 years in females; range, 0.1 to 2.7 years). The mean difference between CA and DA was 0.97 years (P children and adolescents with TM, the proportions of those who had short stature, were underweight, and had a low growth rate increased with age. In addition, participants had significant delays in dental development.

  1. [Long-term effects of combined therapy in patients with beta-thalassemia major]. (United States)

    Bagnulo, S; Giannini, A M; Moscatelli, F; Stragapede, L; Acquafredda, A; Dammacco, A


    We evaluated therapy complications in 19 beta-thalassemia major patients (mean age from 3 years/5 months and 1 years/6 months) who were followed at II Pediatric Department-University of Bari. 3 out of 19 patients underwent allogenic BMT from matched related donor; 2 out of 19 underwent splenectomy. All of them were receiving hypertransfusion therapy and continuous chelation with DFO. In all patients we performed physical examination, laboratory assays, cardiac and endocrinologic function tests, serum HBV-HCV-HIV antibodies, otoscopy and audiometric test, fundus oculi, skeletal x-ray. 1 out of 19 patients, who was under 15, had a slight dilatation of left ventricle and arythmia. All patients were HBsAb positive. 4/19 patients were HCV Ab positive (ELISA test) with an increase in ALT-AST serum levels since at least 6 months. In 3 of them we assessed RIBA test, always positive. 3 of them underwent liver biopsy (1 iron overload 2 chronic active hepatitis). All patients were HIV Ab negative. 4/15 patients revealed low GH levels after Arginina test. 13 pre-pubescent patients had normal results with GNRH test but lower results after FSH test. 1 pubescent patient had gonadotropic hypophyseal deficit. 4 patients had subclinic hypothiroidism. We couldn't find any sequelas in bone-eyes-ears. Hypertransfusion therapy, chelation, profilaxis of infections improved length and quality of life in thalassemic patients. Hypogonadotropic hypogonadism remains a serious sequela and we think it needs to be treated.

  2. Cardiac tamponade as a manifestation of extrapulmonary tuberculosis in β thalassemia major patient (United States)

    Harahap, S.; Pramudita, A.; Lusiani


    Cardiac tamponade is a medical emergency condition. Rapid diagnosis and determination of the etiology with epidemiologic consideration may lead to earlier treatment and improved survival. Occasionally, the etiology may be clearly related to a recognized underlying disease, but the possibility of unrelated etiologies should be considered. Pericarditis tuberculosis, a rare manifestation of extrapulmonary tuberculosis in a non-HIV patient, has to be deliberate as one of the etiology, especially in the endemic area. Here, we report a case of 28 years old male with β thalassemia major presented with excessive exertion breathlessness progressing to orthopnea. Sign of cardiac tamponade was identified from echocardiography which showed large pericardial effusion with swinging heart and right atrial systolic collapse. Pericardiocentesis was performed immediately, drained 870 ml of hemorrhagic fluid from inserted pigtail. The patient was treated with the anti-tuberculosis regimen and oral corticosteroid after real-time polymerase chain reaction of Mycobacterium tuberculosis positivity in pericardial fluid. MRI T2 confirmed no haemosiderosis in patient’s heart. After treatment, the patient responded well and showed clinical improvement.

  3. Renal tubular dysfunction in pediatric patients with beta-thalassemia major

    Directory of Open Access Journals (Sweden)

    Ali Ahmadzadeh


    Full Text Available To evaluate the prevalence of renal tubular dysfunction in children with β-thalassemia (β-T major, we studied the glomerular and tubular function in 140 children with β-T major and compared them to a healthy control group at our center from May 2007 to April 2008. Fresh first morning samples were collected from each patient and analyzed for sodium, potassium, calcium (Ca, protein, uric acid (UA, creatinine (Cr, urine osmolality and urinary N-acetyl-β-D-glucosaminidase (UNAG activity. Blood samples were also collected for complete blood count, blood urea nitrogen (BUN, fasting blood sugar, serum creatinine (SCr, electrolytes, and ferritin before transfusion. Among the study patients, 72 were males, and the mean age was 11.5 (ranging 7-16 years. SCr levels were all within normal limits and all of them had normal glomerular filtration rate (GFR. The mean UNAG was 17.8 IU/L in the study patients (normal 0.15-11.5 IU/L and 3.2 IU/L in the control group (P 0.21 (P = 0.006. Nine (6.4% thalassemic patients with a mean age of 12 years had proteinuria (Upr/UCr > 0.2. Sixty-nine (49.3% out of the 140 patients and 45 (65.2% of the patients having UNAG had uricosuria also (UUA/UCr > 0.26. Ten (7% patients had microscopic hematuria and 10 (7% patients with a mean age of 13.5 years had glucosuria or diabetes mellitus. We conclude that tubular dysfunction is a relative common complication of the β-T major; UNAG and its index are the best to detect renal tubular dysfunction in these patients. Currently, periodic measurement of UCa/UCr and UUA/UCr ratios as well as urinalysis are recommended.

  4. Endocrine dysfunction and growth retardation assessment in children with beta -thalassemia major

    International Nuclear Information System (INIS)

    Noureldin, A.M.; Ahmed, A.M.


    Children suffering from beta-thalassemia major are reported to have endocrine abnormalities and growth retardation. This study was carried out to study the cause of their growth retardation and determine the extent and rate of endocrine complications. Twenty beta-thalassemic major pubertal children, with mean baemoglobin and ferritin concentration of 8.8±0.6 and 3.597± 1.931, respectively, and twenty pubertal control children were used in the study. The anthropometric measurements that carried out revealed significant low growth rate in patient groups in comparison with control. Patients divided into two groups; I) D-thal with delayed growth and II) S-thal with stunted growth. Basal serum thyoid hormones (T 3 and T 4 ) and thyroid stimulating hormone (TSH) were measured in patient groups and control group. T 3 showed highly significant decrease (P 4 showed non-significant change and TSH showed highly significant increase (P<0.001). Serum growth hormone showed significant lower concentrations in patient groups with values of 2.163±0.9 ng/ml, (P<0.01) and 1.832±1.9ng/ml, (P<0.01) for delayed growth thalassemic group (D-thal) and stunted growth thalassemic group (S-thal), respectively. Serum concentration of insulin growth factor-1 (IGF-1) hormone was studied. D-thal and S-thal had significant lower basal IGF-1 concentrationsof-58.44% (P<0.001) for D-thal and -64.37%, (P<0.001) for S-thal

  5. Survival Analysis and its Associated Factors of Beta Thalassemia Major in Hamadan Province

    Directory of Open Access Journals (Sweden)

    Reza Zamani


    Full Text Available Background: There currently is a lack of knowledge about the long-term survival of patients with beta thalassemia (BT, particularly in regions with low incidence of the disease. The aim of the present study was to determine the survival rate of the patients with BT major and the factors associated with the survival time. Methods: This retrospective cohort study was performed in Hamadan province, located in the west of Iran. The study included patients that referred to the provincial hospitals during 16 year period from 1997 to 2013. The follow up of each subject was calculated from the date of birth to the date of death. Demographic and clinical data were extracted from patients’ medical records using a checklist. Statistical analysis included the Kaplan-Meier method to analyze survivals, log-rank to compare curves between groups, and Cox regression for multivariate prognostic analysis. Results: A total of 133 patients with BT major were enrolled, 54.9% of whom were male and 66.2% were urban. The 10-, 20- and 30-year survival rate for all patients were 98.3%, 88.4% and 80.5%, respectively. Based on hazard ratio (HR, we found that accompanied diseases (P=0.01, blood type (P=0.03 and residency status (P=0.01 were significant predictors for the survival time of patients. Conclusion: The survival rate of BT patients has improved. Future researches such as prospective designs are required for the estimation of survival rate and to find other prognostic factors, which have reliable sources of data.

  6. Increased levels of advanced glycation end products positively correlate with iron overload and oxidative stress markers in patients with β-thalassemia major. (United States)

    Mirlohi, Maryam Sadat; Yaghooti, Hamid; Shirali, Saeed; Aminasnafi, Ali; Olapour, Samaneh


    The impaired biosynthesis of the β-globin chain in β-thalassemia leads to the accumulation of unpaired alpha globin chains, failure in hemoglobin formation, and iron overload due to frequent blood transfusion. Iron excess causes oxidative stress and massive tissue injuries. Advanced glycation end products (AGEs) are harmful agents, and their production accelerates in oxidative conditions. This study was conducted on 45 patients with major β-thalassemia who received frequent blood transfusions and chelation therapy and were compared to 40 healthy subjects. Metabolic parameters including glycemic and iron indices, hepatic and renal functions tests, oxidative stress markers, and AGEs (carboxymethyl-lysine and pentosidine) levels were measured. All parameters were significantly increased in β-thalassemia compared to the control except for glutathione levels. Blood glucose, iron, serum ferritin, non-transferrin-bound iron (NTBI), MDA, soluble form of low-density lipoprotein receptor, glutathione peroxidase, total reactive oxygen species (ROS), and AGE levels were significantly higher in the β-thalassemia patients. Iron and ferritin showed a significant positive correlation with pentosidine (P overload in β-thalassemia major patients and highlight the enhanced formation of AGEs, which may play an important role in the pathogenesis of β-thalassemia major.

  7. Prevalence of hepatitis G virus in Pakistani children with transfusion dependent beta- thalassemia major. (United States)

    Moatter, T; Adil, S; Haroon, S; Azeemuddin, S; Hassan, F; Khurshid, M


    We ought to obtain data on the prevalence of the newly discovered tranfusion transmittable hepatitis G virus in polytransfused b- thalassemia major children. Each individual had received multiple blood transfusions, from 12 to 36 per year. No documentation of prior hepatic infection was available. Serum samples were collected prospectively from the randomly selected subjects and were analyzed for HGV RNA by polymerase chain reaction using primer specific for two different regions of the HGV genome. Among the 100 individuals examined 21 were positive for HGV RNA. Four patients had evidence of dual infection, both HGV RNA and HCV RNA were isolated from their sera. While in one sample presence of both HGV RNA and HBV DNA was established. Only one child was positive for hepatitis E antibodies. The sera of 10 children were reactive for hepatitis B surface antigen whereas 35 individuals were positive for hepatitis C virus antibody. The ALT levels were variable in HGV infected children. Four out of 16 (25%) showed peak ALT levels of 218 IU/I, 8/16 (50%) children demonstrated slightly elevated ALT levels whereas 25% individuals showed normal ALT levels. Alkaline Phosphatase levels were elevated in 90% of the children and 20% patients of this series also had higher GGT levels. The observed AP levels were not statistically different among HGV, HGV/HCV or HGV/HBV groups. Even though the ALT levels were deranged in the children with HGV alone but none of the children had demonstrated symptoms of liver disease, their direct and total bilirubin levels were normal and no complain of jaundice was recorded. In conclusion, our findings suggested that like other blood borne hepatic viruses, HGV is also prevalent in the high risk group of multiple transfused patients in Pakistan but our results support the absence of any causal relationship between HGV and hepatitis.

  8. Morphological and dimensional characteristics of dental arch in children with beta thalassemia major

    Directory of Open Access Journals (Sweden)

    Disha Kumar


    Full Text Available Background and Objectives: The aim of this study was to examine the arch dimensions of beta thalassemia major patients in comparison with normal individuals. Materials and Methods: Dental arch dimensions were compared between thalassemic patients and normal individuals in the age group of 12–16 years in the maxillary and mandibular arch corresponding to each other regarding age, sex and Angle's molar relationship. A total number of sixty cases in each group were taken. Maxillary and mandibular impressions were made with alginate for all the sixty participants in each group and poured with die stone. Measurement of inter incisor, inter canine, inter premolar and intermolar arch width, arch depth, right anterior, right posterior, left anterior, and left posterior arch length was carried out from each cast using digital Vernier caliper.Results: Unpaired t-test was used for comparison between the two groups. Statistically, a significant difference was found between the case and control groups in the maxillary arch in intercanine width, inter premolar width, intermolar width, right anterior arch length, right posterior arch length, and left anterior arch length. However, no statistically significant difference was found between the groups in inter incisor width, left posterior arch length, and arch depth in the maxillary arch. In the mandibular arch, statistically significant difference was found between the case and control groups in inter canine width, inter premolar width, inter molar width, and left anterior arch length. However, no statistically significant difference was found between the case and control groups in the mandibular arch in interincisor width, right anterior arch length, right posterior arch length, and left posterior arch length. Conclusion: Dental arch widths and arch lengths were significantly reduced in thalassemic patients as compared to normal individuals for the maxillary and mandibular arches.

  9. Anxiety, depression and quality of life in patients with beta thalassemia major and their caregivers. (United States)

    Yengil, Erhan; Acipayam, Can; Kokacya, Mehmet Hanifi; Kurhan, Faruk; Oktay, Gonul; Ozer, Cahit


    Mental health and health related quality of life is commonly affected in patients with chronic problems and their caregivers. In the present study, it was aimed to assess depression and anxiety in patients with beta thalassemia major (BTM) and in their caregivers; and to evaluate effects of these disorders on quality of life. The study was carried out in a district Hereditary Hemoglobinopathy Center and included 88 patients with BTM and 63 of their caregivers. All subjects were assessed using Beck Depression Inventory (BDI), Beck Anxiety Inventory (BAI) and Short Form-36 (SF-36) by a trained psychiatry resident via face-to-face interview. The BDI scores were 17 or above in 20.5% of the patients with BTM and 28.6% of their caregivers (P = 0.248). Of the patients with BTM, there were mild anxiety symptoms in 19.3%, while moderate and severe anxiety symptoms in 14.8% and 4.5%, respectively. Anxiety levels were similar between the patients with BTM and their caregivers (P = 0.878). It was found that BDI and BAI scores were negatively correlated to scores of physical health and mental health components of SF-36 in patients with BTM and their caregivers. In linear regression analysis, it was seen that depression affected physical and mental health of the patients with BTM and their caregivers regardless from anxiety. BTM leads an increase in the frequency of depression and anxiety in both patients and their caregivers, and affects negatively physical and mental components of quality of life.

  10. Quality of Life in Patients with Thalassemia Major in a Developing Country

    International Nuclear Information System (INIS)

    Siddiqui, S. H.; Ishtiaq, R.; Sajid, F.; Sajid, R.


    Objective: To determine the problems faced by thalassemic patients in their personal, psychological and social life. Study Design: A cross-sectional multi-centre survey. Place and Duration of Study: Karachi, Lahore and Quetta Centres of Fatimid Foundation, from October 2009 to October 2010. Methodology: An indigenously developed Qualifty of Life (QoL) questionnaire modified from SF-36 questionnaire was administered to 101 transfusion dependent subjects suffering from thalassemia major. Variables were analyzed using SPSS version 15 for descriptive statistics. Results: The mean age of the subjects was 10.5 years ranging from 6 - 21 years. Less than one third of the patients felt that their health was slightly worse as compared to last year. Forty five (44%) of the patients felt loneliness due to their disease. Parents of 36 (35.6%) of the children at times did not allow their children to play because of their disease. Twenty eight (27.7%) stated difficulty in mingling with children of their age. Seventy one (70.3%) of the patients reported that at some or all times they were worried about their future life and career while 70 (69.3%) admitted being taken extra care of by their friends and 56 (55.4%) by their teachers. Conclusion: The quality of life of surveyed thalassemic patients was immensely affected. Having physical impairments, social stresses, financial burdens and problems with their education and career make them very much vulnerable to psychological trauma very early in their life. All of this creates a hindrance in their way of developing into autonomous functioning adults. (author)

  11. Quality of life among Iranian patients with beta-thalassemia major using the SF-36 questionnaire

    Directory of Open Access Journals (Sweden)

    Sezaneh Haghpanah

    Full Text Available CONTEXT AND OBJECTIVE Patients with beta-thalassemia major (β-TM experience physical, psychological and social problems that lead to decreased quality of life (QoL. The aim here was to measure health-related QoL and its determinants among patients with β-TM, using the Short Form-36 (SF-36 questionnaire. DESIGN AND SETTING Cross-sectional study at the Hematology Research Center of Shiraz University of Medical Sciences, in southern Iran. METHODS One hundred and one patients with β-TM were randomly selected. After the participants' demographics and disease characteristics had been recorded, they were asked to fill out the SF-36 questionnaire. The correlations of clinical and demographic factors with the QoL score were evaluated. RESULTS There were 44 men and 57 women of mean age 19.52 ± 4.3 years (range 12-38. On two scales, pain (P = 0.041 and emotional role (P = 0.009, the women showed significantly lower scores than the men. Lower income, poor compliance with iron-chelating therapy and presence of comorbidities were significantly correlated with lower SF-36 scores. These factors were also found to be determinants of worse SF-36 scores in multivariate analysis. CONCLUSIONS We showed that the presence of disease complications, poor compliance with iron-chelating therapy and poor economic status were predictors of worse QoL among patients with β-TM. Prevention and proper management of disease-related complications, increased knowledge among patients regarding the importance of managing comorbidities and greater compliance with iron-chelating therapy, along with psychosocial and financial support, could help these patients to cope better with this chronic disease state.

  12. Comparison of Bone Mineral Density in Thalassemia Major Patients with Healthy Controls

    Directory of Open Access Journals (Sweden)

    Mahesh Chand Meena


    Full Text Available Chronic hemoglobinopathies like thalassemia are associated with many osteopathies like osteoporosis. Methods. This observational study was carried out to compare the bone mineral density (BMD in transfusion dependent thalassemics with that of healthy controls. Thirty-two thalassemia patients, aged 2–18 years, and 32 age and sex matched controls were studied. The bone mineral concentration (BMC and BMD were assessed at lumbar spine, distal radius, and neck of femur. Biochemical parameters like serum calcium and vitamin D levels were also assessed. Results. The BMC of neck of femur was significantly low in cases in comparison to controls. We also observed significantly lower BMD at the lumbar spine in cases in comparison to controls. A significantly positive correlation was observed between serum calcium levels and BMD at neck of femur. Conclusion. Hence, low serum calcium may be used as a predictor of low BMD especially in populations where incidence of hypovitaminosis D is very high.

  13. Right ventricular volumes and function in thalassemia major patients in the absence of myocardial iron overload

    Directory of Open Access Journals (Sweden)

    Porter John B


    Full Text Available Abstract Aim We aimed to define reference ranges for right ventricular (RV volumes, ejection fraction (EF in thalassemia major patients (TM without myocardial iron overload. Methods and results RV volumes, EF and mass were measured in 80 TM patients who had no myocardial iron overload (myocardial T2* > 20 ms by cardiovascular magnetic resonance. All patients were receiving deferoxamine chelation and none had evidence of pulmonary hypertension or other cardiovascular comorbidity. Forty age and sex matched healthy non-anemic volunteers acted as controls. The mean RV EF was higher in TM patients than controls (males 66.2 ± 4.1% vs 61.6 ± 6%, p = 0.0009; females 66.3 ± 5.1% vs 62.6 ± 6.4%, p = 0.017, which yielded a raised lower threshold of normality for RV EF in TM patients (males 58.0% vs 50.0% and females 56.4% vs 50.1%. RV end-diastolic volume index was higher in male TM patients (mean 98.1 ± 17.3 mL vs 88.4 ± 11.2 mL/m2, p = 0.027, with a higher upper limit (132 vs 110 mL/m2 but this difference was of borderline significance for females (mean 86.5 ± 13.6 mL vs 80.3 ± 12.8 mL/m2, p = 0.09, with upper limit of 113 vs 105 mL/m2. The cardiac index was raised in TM patients (males 4.8 ± 1.0 L/min vs 3.4 ± 0.7 L/min, p Conclusion The normal ranges for functional RV parameters in TM patients with no evidence of myocardial iron overload differ from healthy non-anemic controls. The new reference RV ranges are important for determining the functional effects of myocardial iron overload in TM patients.

  14. Pituitary gland height evaluated by MR in patients with β-thalassemia major: a marker of pituitary gland function

    International Nuclear Information System (INIS)

    Argyropoulou, M.I.; Metafratzi, Z.; Efremidis, S.C.; Kiortsis, D.N.; Bitsis, S.; Tsatoulis, A.


    In transfusion-dependent β-thalassemia major, increased iron deposition in the pituitary gland has a cytotoxic effect leading mainly to hypogonadotropic hypogonadism. Our purpose was to assess in these patients the height of the pituitary gland and to evaluate whether it represents a marker of pituitary gland function. In 29 patients with β-thalassemia major and 35 age- and gender-matched controls the pituitary gland height was evaluated in a midline sagittal scan using a spin echo T1-weighted (500/20 TR/TE) sequence. In all patients, an extensive endocrine evaluation was performed, including measurements of spontaneous and stimulated levels of gonadotropins, thyroid hormones, growth hormone, insulin-like growth factor, and adrenal hormones. The pituitary gland height was lower in thalassemic patients with hypogonadotropic hypogonadism (n=15) (mean 3.48; SD 0.46) than in the age- and gender-matched controls (mean 6.29; SD 0.77), (P<0.001). No statistically significant difference was found between thalassemic patients without hormone dysfunction (n=14) (mean 5.34; SD 1.52) and age- and gender-matched controls (mean 5.91; SD 1.06). We conclude that in thalassemic patients the pituitary gland height is an additional marker of pituitary gland function and might be useful in clinical management. (orig.)

  15. Pituitary gland height evaluated by MR in patients with {beta}-thalassemia major: a marker of pituitary gland function

    Energy Technology Data Exchange (ETDEWEB)

    Argyropoulou, M.I.; Metafratzi, Z.; Efremidis, S.C. [Dept. of Radiology, Univ. of Ioannina (Greece); Kiortsis, D.N. [Dept. of Physiology, Univ. of Ioannina (Greece); Bitsis, S.; Tsatoulis, A. [Dept. of Internal Medicine, Univ. of Ioannina (Greece)


    In transfusion-dependent {beta}-thalassemia major, increased iron deposition in the pituitary gland has a cytotoxic effect leading mainly to hypogonadotropic hypogonadism. Our purpose was to assess in these patients the height of the pituitary gland and to evaluate whether it represents a marker of pituitary gland function. In 29 patients with {beta}-thalassemia major and 35 age- and gender-matched controls the pituitary gland height was evaluated in a midline sagittal scan using a spin echo T1-weighted (500/20 TR/TE) sequence. In all patients, an extensive endocrine evaluation was performed, including measurements of spontaneous and stimulated levels of gonadotropins, thyroid hormones, growth hormone, insulin-like growth factor, and adrenal hormones. The pituitary gland height was lower in thalassemic patients with hypogonadotropic hypogonadism (n=15) (mean 3.48; SD 0.46) than in the age- and gender-matched controls (mean 6.29; SD 0.77), (P<0.001). No statistically significant difference was found between thalassemic patients without hormone dysfunction (n=14) (mean 5.34; SD 1.52) and age- and gender-matched controls (mean 5.91; SD 1.06). We conclude that in thalassemic patients the pituitary gland height is an additional marker of pituitary gland function and might be useful in clinical management. (orig.)

  16. Sequential alternating deferiprone and deferoxamine treatment compared to deferiprone monotherapy: main findings and clinical follow-up of a large multicenter randomized clinical trial in -thalassemia major patients

    DEFF Research Database (Denmark)

    Pantalone, Gaetano Restivo; Maggio, Aurelio; Vitrano, Angela


    In β-thalassemia major (β-TM) patients, iron chelation therapy is mandatory to reduce iron overload secondary to transfusions. Recommended first line treatment is deferoxamine (DFO) from the age of 2 and second line treatment after the age of 6 is deferiprone (L1). A multicenter randomized open...... thalassemia patients were randomized and underwent intention-to-treat analysis. Statistically, a decrease of serum ferritin level was significantly higher in alternating sequential L1-DFO patients compared with L1 alone patients (p = 0.005). Kaplan-Meier survival analysis for the two chelation treatments did...

  17. Iron chelation therapy in thalassemia major: a systematic review with meta-analyses of 1520 patients included on randomized clinical trials

    DEFF Research Database (Denmark)

    Maggio, Aurelio; Filosa, Aldo; Vitrano, Angela


    The effectiveness of deferoxamine (DFO), deferiprone (DFP), or deferasirox (DFX) in thalassemia major was assessed. Outcomes were reported as means±SD, mean differences with 95% CI, or standardized mean differences. Statistical heterogeneity was tested using χ2 (Q) and I2. Sources of bias...

  18. Longitudinal study on thyroid function in patients with thalassemia major: High incidence of central hypothyroidism by 18 years

    Directory of Open Access Journals (Sweden)

    Ashraf T Soliman


    Full Text Available Introduction: Primary hypothyroidism is one of the most frequent complications observed in-patients suffering from thalassemia. We investigated and reviewed the thyroid function in all thalassemic patients attending the Pediatric Endocrine Clinic of Hamad Medical Center, Doha, Qatar during the last 10 years of follow-up. Patients and Methods: A total of 48 patients with ί-thalassemia major between 5 years and 18 years of age. Thyroid dysfunction was defined as follows: Overt hypothyroidism (low Free thyroxine [FT4] and increased thyroid-stimulating hormone [TSH] levels >5 μIU/ml; subclinical hypothyroidism (normal FT4, TSH between 5 μIU/ml and 10 μIU/ml and central (secondary hypothyroidism (low FT4 and normal or decreased TSH. Results: A total of 48 patients (22 males and 26 females completed a 12 year-period of follow-up. During this period, hypothyroidism was diagnosed in 17/48 (35% of patients. There was no significant difference in the prevalence in males 7/22 (32% versus females 10/26 (38%. Sixteen of the patients had hypothyroidism after the age of 10 years (94%. The prevalence of overt hypothyroidism had risen from 0% at the age of 7 years to 35% at the age of 18 years. None of the patients had high anti-thyroperoxidase antibody titers. Out of 17 patients, 13 patients with hypothyroidism had normal or low TSH level (not appropriately elevated indicative of defective hypothalamic pituitary response to low FT4 (central hypothyroidism. Three patients (6.3% had subclinical hypothyroidism (TSH between 5 uIU/ml and 10 uIU/ml and normal FT4. The general trend of FT4 level showed progressive decrease over the 12 years, whereas, TSH levels did not show a corresponding increase. These data suggested defective hypothalamic pituitary thyroid axis involving both TSH and FT4 sretion in patients with thalassemia major over time. There was a significant negative correlation between serum ferritin and FT4 (r = −0.39, P = 0.007, but no correlation

  19. Evaluation of tissue doppler echocardiography and T2* magnetic resonance imaging in iron load of patients with thalassemia major. (United States)

    Saravi, Mehrdad; Tamadoni, Ahmad; Jalalian, Rozita; Mahmoodi-Nesheli, Hassan; Hojati, Mosatafa; Ramezani, Saeed


    Iron-mediated cardiomyopathy is the main complication of thalassemia major (TM) patients. Therefore, there is an important clinical need in the early diagnosis and risk stratification of patients. The aim of this study was to evaluate the efficacy of tissue doppler imaging (TDI) to study cardiac iron overload in patients with TM using T2* magnetic resonance (MR) as the gold-standard non-invasive diagnostic test. A total of 100 TM patients with the mean age of 19±7 years and 100 healthy controls 18.8±7 years were evaluated. Conventional echocardiography, TDI, and cardiac MRI T2* were performed in all subjects. TDI measures included myocardial systolic (Sm), early (Em) and late (Am) diastolic velocities at basal and middle segments of septal and lateral LV wall. The TM patients were also subgrouped according to those with iron load (T2* ≤ 20 ms) and those without (T2* > 20 ms), and also severe (T2* ≤ 10 ms) versus the non-severe (T2* ≤ 10 ms). Using T2* cardiovascular MR, abnormal myocardial iron load (T2* ≤ 20 ms) was detected in 84% of the patients and among these, 50% (42/84) had severe (T2* ≤ 10 ms) iron load. The mean T2* was 11.6±8.6 ms (5-36.7). A negative linear correlation existed between transfusion period of patients and T2* levels (r = -0.53, p=0.02). The following TDI measures were lower in patients than in controls: basal septal Am (p<0.05), mid-septal Em and Am (p<0.05), basal lateral Am (p<0.05), mid-lateral LV wall Sm (p<0.05) and Am (p<0.05). Tissue doppler imaging is helpful in predicting the presence of myocardial iron load in Thalassemia patients. Therefore, it can be used for screening of thalassemia major patients.

  20. Factors associated with continuing emergence of β-thalassemia major despite prenatal testing: a cross-sectional survey

    Directory of Open Access Journals (Sweden)

    Al Sabbah H


    Full Text Available Haleama Al Sabbah,1 Sarah Khan,1 Abdallah Hamadna,2 Lamia Abu Ghazaleh,2 Anwar Dudin,2 Bashar Adnan Karmi3 1College of Natural and Health Sciences, Zayed University, Dubai, UAE; 2Faculty of Medicine, An-Najah National University, Nablus, Palestine; 3Thalassemia Patients’ Friends Society, Ramallah, Palestine Purpose: Health care initiatives focusing on prenatal testing and premarital genetic screening aiming to reduce the incidence of β-thalassemia have emerged during the last decade. In Palestine, 4% of the population are known thalassemia carriers with new cases continuing to appear despite the availability of prenatal testing. This study aims to identify factors that influence the decision to retain or abort fetuses affected by β-thalassemia in Palestine. Methods: Convenience sampling was used to select 32 women (72 fetuses who were at risk of having a baby with β-thalassemia. A questionnaire on prenatal testing, test results, pregnancy outcomes, and factors influencing the decision to terminate the pregnancy were used for this cross-sectional study. The data were analyzed using SPSS version 17. Results: Among the fetuses screened, 36 (50% were thalassemia carriers and 20 (28% had β-thalassemia; 17 (85% affected fetuses were aborted. Religious beliefs were the most cited reason for opposing abortion while prior experience with β-thalassemia patients and awareness programs promoted abortions. Mothers who opted to retain an affected fetus had modest educational attainment. Higher educational level was significantly associated with the decision to abort an affected fetus (p<0.05. Conclusion: A religious consensus is needed on the abortion of fetuses affected by β-thalassemia. Improving female education and increasing awareness on thalassemia could help reduce the incidence of β-thalassemia in Palestine and around the world. Keywords: abortion, Islam, fetus, awareness

  1. The Effects of Group Play Therapy on Self-Concept Among 7 to 11 Year-Old Children Suffering From Thalassemia Major. (United States)

    Tomaj, Ome Kolsoum; Estebsari, Fatemeh; Taghavi, Taraneh; Borim Nejad, Leili; Dastoorpoor, Maryam; Ghasemi, Afsaneh


    Children suffering from thalassemia have higher levels of depression and lower levels of self-concept. The aim of this study was to determine if group play therapy could significantly increase self-concept among children with thalassemia major ages 7 to 11 years old in teaching hospitals of Golestan province, Iran, in 2012. In this randomized, controlled clinical trial, 60 children with thalassemia major were randomly assigned to intervention (30 children) and control (30 children) groups. The intervention included eight 45 to 60 minute sessions during four weeks, during which the intervention group received group play therapy. The control group received no interventions. Self-concept was measured three times using the Piers-Harris children's self-concept scale: before, immediately after, and a month after the intervention. For the intervention group, results showed that the mean self-concept score was significantly higher at the second point in time compared to the baseline (P 0.05). The results showed that group play therapy improves self-concept in children suffering from thalassemia major.

  2. Carotid intima-media thickness and oxidative stress markers for assessment of atherosclerosis in children with β thalassemia major

    Directory of Open Access Journals (Sweden)

    Geetanjali Jindal


    Full Text Available The present study evaluates carotid intimamedia thickness (CIMT in children with β thalassemia major to assess atherosclerosis and its relation to the underlying proposed causative mechanisms via lipid peroxidation product malondialdehyde (MDA, oxidized lowdensity lipoproteins (LDL, total antioxidant level, and lipid profile. A cross sectional study was conducted on 62 children (31 cases and 31 controls. CIMT by high resolution ultrasound and biochemical parameters i.e., total cholesterol, triglycerides, high-density lipoproteins, LDL, Oxidized LDL, lipoprotein (a, lipid peroxidation product MDA and total antioxidant were measured in enrolled subjects and compared. In our study, CIMT was significantly increased in β thalassemia major patients’ as compared to healthy controls. Mean CIMT in cases was 0.69±0.11 mm and in controls 0.51±0.07 mm. Mean oxidized LDL (EU/mL in cases 39.3±34.4 (range 14.4 to 160 was significantly raised (P=0.02, t test as compared to controls 23.9±13.4 (range 12 to 70. In our study we found MDA levels (nmol/mL to be increased in β thalassemia patients as compared to controls. Mean MDA was 10.0±3.27 (4.41 to 17.48 in cases while in controls was 6.87±4.55 (1.5 to 17.9. Our study results show CIMT as an early marker of atherogenesis in β thalassemia major. Oxidative stress markers are also increased in β thalassemia major patients and lipoprotein (a shows a positive correlation with CIMT. The present study points towards various atherogenetic mechanisms in β thalassemia major. 本研究评价β重型地中海贫血患儿颈动脉内膜中层厚度(CIMT),以评估动脉粥样硬化,以及与潜在通过血脂过氧化反应产物丙二醛(MDA)、氧化低密度脂蛋白(LDL)、总抗氧化水平和血脂谱所提出致病机制之间的关系。 在62名儿童(31例病例和31例对照)中进行了一项横断面研究。 在入组受试者中通过高分辨率超声和生化指标(

  3. Awareness among Parents of β-Thalassemia Major Patients Regarding Prenatal Diagnosis and Premarital Screening in Day Care Centre of Transfusion Medicine Department. (United States)

    Rudra, S; Chakrabarty, P; Hossain, M A; Ripon, M J; Rudra, M; Mirza, T T


    Thalassemia is one of the most common genetic diseases in the world. It is a major health problem, brings much morbidity, early mortality and a great deal of misery for a family both financially and emotionally. The patients suffering from beta thalassemia major do not survive for more than 5 years without blood transfusion. Blood transfusion is usually administered every two to five weeks to maintain the pre-transfusion hemoglobin level of 9-10 gm/dL. This study carried out in the department of Transfusion Medicine of Mymensingh Medical College Hospital from January 2014 to June 2014. A total of 200 parents were interviewed. There was a slight preponderance of females which accounted for 57.5% of the parents. Ninety seven (45.5%) had an income less than Rs. 5000 per month. Nearly 50% were illiterate with only 24.5% with a higher education. Consanguinity was positive in 72.5% of the parents with extended family history of thalassemia positive in 40.8%. Only 29.5% were immunized against Hepatitis B. Around 27.5% did not know whether they should be immunized. Fifty five percent of parents knew children should receive Dysferol. Twelve percent were aware of consanguinity to be a risk factor for thalassaemia with only 5% having undergone antenatal diagnosis. Parental knowledge about thalassemia and its preventive measures is inadequate; this requires intervention in the form of public health education programs concentrating on high risk/targeted population.

  4. The frequency of hypothyroidism and its relationship with HCV positivity in patients with thalassemia major in southern Iran. (United States)

    Haghpanah, Sezaneh; Jelodari, Shohreh; Karamifar, Hammdollah; Saki, Forough; Rahimi, Rahil; De Sanctis, Vincenzo; Dehbozorgian, Javad; Karimi, Mehran


    Hypothyroidism is one the most complication due to iron overload in patients with β-thalassemia major (TM). On the other hand these patients are prone to Hepatitis C virus (HCV) infection that can cause  thyroid dysfunction by itself or as the side effect of treatment with interferon (INF) or IFN plus ribavirin. The aim of this study is to evaluate the association of hypothyroidism with HCV positivity and serum ferritin levels in patients with TM. In this cross-sectional study, 201 randomly selected patients with TM who were registered at the Thalassemia Clinic of a tertiary hospital in Shiraz, southern Iran were investigated. Thyroid function tests and serologic screening assays for HCV seropositivity (HCV Ab and HCV-RNA) were conducted for all patients. Frequency of hypothyroidism was 22.9% including 19.9% subclinical hypothyroidism, 2% primary overt hypothyroidism and 1% central hypothyroidism. Eighty six patients (42.8%) were HCV Ab positive and 60 patients (29.9%) were HCV RNA positive. No significant relationship was found between hypothyroidism and HCV positivity or receiving IFN-α (P>0.05). Hypothyroidism showed a borderline significant association with high serum ferritin levels in TM patients (P=0.055). Our results showed no significant association between hypothyroidism and HCV infection in TM patients. It seems that the main mechanism of hypothyroidism in our patients is iron overload; however, for better evaluation a larger multicenter study is recommended.  Also due to the importance of consequences of HCV infection, more careful pre-transfusional screening of blood should be considered in TM patients.

  5. Evaluation of some essential element levels in thalassemia major patients in Mosul district, Iraq. (United States)

    Al-Samarrai, Abdulmunaim H; Adaay, Mohaisen H; Al-Tikriti, Khudhair A; Al-Anzy, Muayed M


    To evaluate the levels of some essential elements in thalassemic patients in Mosul, Iraq. One hundred and five thalassemic blood transfusion dependent children, 2.5-18 years of age attending Ibn-Al-Atheer teaching hospital in Mosul City, Iraq, during 2005, were used in this study. Fifty-four healthy subjects served as a control group. Patients were allocated in a non-randomized prospective cross-sectional hospital based study. Essential elements levels were estimated. The mean, standard deviation, correlation coefficient, and z-test were used. P-values copper, and potassium levels were found among the 105 thalassemic patients compared to the 54 controls. Levels of calcium, phosphate, and sodium were within normal limits. Fluctuations in the essential elements levels seem to be related to the different complications associated with the disease. Zinc deficiency may be attributed to hyperzincuria resulted from the release of Zn from hemolyzed red cells. Hypercupremia occurs in acute and chronic infections and hemochromatosis, which is a principal complication of thalassemia. Increased Na levels may be due to renal damage. Hypomagnesemia may occur due to hypoparathyroidism.

  6. A study of some aspects of auto immunity in children with thalassemia major

    International Nuclear Information System (INIS)

    El Adham, E.K


    This study is subjected to estimate the study of the most common autoimmune complications in thalassemia and the prevalence of different auto antibodies so as to evaluate its correlation with personal data including age, sex, growth parameters, Hepatitis C virus infection ferritin level and type of iron chelation therapy methodology : Different Abs including anti cardiolipin, antitistone, ANA, Anti erythropoietin by ELISA technique Hepatitis C virus by ELISA. Ferritin by IRMA (Immune radiometric assay), Protein C, S. Antithrombin III by ELISA result of the study were analyzed by appropriate statistical methods .The results showed that age of Hepatitis C virus negative cases was significantly lower than Hepatitis C virus Positive cases, ferritin levels were significantly higher in patients on defripone than those as desferrioxamine, anti erythropoietin was detected in 93.3% of cases regarding the antithrombotic factors deficiency. Protein C was deficient in 26.67% of cases. Protein S was deficient in 13.33% only and no cases showed anti thrombin III deficiency. No special relation was found between these abnormalities and type of chelation , Conclusions: Auto immunity may be a cofactor in the development of life threatening complication

  7. A comparative study of partial vs total splenectomy in thalassemia major patients

    Directory of Open Access Journals (Sweden)

    Bahador Ali


    Full Text Available Background : In this study, we show the advantages of partial splenectomy (PS over total splenectomy (TS regarding the chances of overwhelming postsplenectomy sepsis (OPSI. Materials and Methods: From February 1991 to December 1999, 143 cases of β-thalassemia underwent PS. 1/3, 1/4 of the splenic tissue was preserved. One hundred and ten cases were followed for an average of 5 years. None of the patients received vaccination or prophylactic antibiotics. Pre- and postoperative hematological profiles, IgM levels, recurrence of hypersplenism and septic episodes were compared among the data of 60 cases TS; all these cases have been operated in the same hospital. Results: Hematological profile significantly increased and transfusion requirement approximately reduced to three-fold. After 3 years, 22.7% in PS and 13.3% in TS groups required the same amount of preoperative transfusion. After 5 years, these percentages were 27.3 and 18.3%, respectively. Two patients in PS and six in TS group developed signs of sepsis. Conclusion : Vaccination or prophylactic antibiotics are not necessary after PS. The risk of sepsis in PS without antibiotics is less than that in TS with antibiotics, and resplenectomy after PS is not associated with serious complications.

  8. Orthodontic Consideration in Patients with Beta-Thalassemia Major: Case Report and Literature Review. (United States)

    Einy, Shmuel; Hazan-Molina, Hagai; Ben-Barak, Ayelet; Aizenbud, Dror

    Beta Thalassemia (βT) patients present a unique facial appearance and specific craniofacial, jaw and dental patterns. Although this anomaly often requires orthodontic management, βT patients have received scant attention in the orthodontic and dental literature over the past 50 years. The aim of this article is to review the characteristic craniofacial and dental manifestation pattern of βT patients and to emphasize their preferred orthodontic management protocol by presenting a βT orthodontic treated patient. A 10 year old patient presented with a complaint of severe esthetic and functional disorders due to her diagnosis of βT. We initiated orthodontic treatment including a combined orthopedic and functional treatment modality to improve facial appearance. Maxillary restraint and increased mandibular size during treatment along with an increase in the vertical dimension were achieved. The patient presented with Angle class I molar relationship, with reduction of the excessive overjet and deep overbite. Orthodontic treatment comprised of maxillary orthopedic treatment directed especially toward premaxilla with light forces, and mandibular modification by functional appliance along with fixed orthodontic treatment is recommended in βT patients.

  9. Metabolic and endocrinologic complications in beta-thalassemia major: a multicenter study in Tehran

    Directory of Open Access Journals (Sweden)

    Hashemi Reza


    Full Text Available Abstract Background The combination of transfusion and chelation therapy has dramatically extended the life expectancy of thalassemic patients. The main objective of this study is to determine the prevalence of prominent thalassemia complications. Methods Two hundred twenty patients entered the study. Physicians collected demographic and anthropometric data and the history of therapies as well as menstrual histories. Patients have been examined to determine their pubertal status. Serum levels of 25(OH D, calcium, phosphate, iPTH were measured. Thyroid function was assessed by T3, T4 and TSH. Zinc and copper in serum were determined by flame atomic absorption spectrophotometry. Bone mineral density (BMD measurements at lumbar and femoral regions have been done using dual x-ray absorptiometry. The dietary calcium, zinc and copper intakes were estimated by food-frequency questionnaires. Results Short stature was seen in 39.3% of our patients. Hypogonadism was seen in 22.9% of boys and 12.2% of girls. Hypoparathyroidism and primary hypothyroidism was present in 7.6% and 7.7% of the patients. About 13 % of patients had more than one endocrine complication with mean serum ferritin of 1678 ± 955 micrograms/lit. Prevalence of lumbar osteoporosis and osteopenia were 50.7% and 39.4%. Femoral osteoporosis and osteopenia were present in 10.8% and 36.9% of the patients. Lumbar BMD abnormalities were associated with duration of chelation therapy. Low serum zinc and copper was observed in 79.6% and 68% of the study population respectively. Serum zinc showed significant association with lumbar but not femoral BMD. In 37.2% of patients serum levels of 25(OH D below 23 nmol/l were detected. Conclusion High prevalence of complications among our thalassemics signifies the importance of more detailed studies along with therapeutic interventions.

  10. Endocrine profile of β-thalassemia major patients followed from childhood to advanced adulthood in a tertiary care center

    Directory of Open Access Journals (Sweden)

    Vincenzo De Sanctis


    Full Text Available Aim: Chronic iron overload resulting from frequent transfusions, poor compliance to efficient chelation therapy and chronic liver disease is basically responsible for the most severe complications of thalassemia major (TM. Before conventional treatment, TM was entirely childhood disease with a very short survival. Today, survival improved to 40–50 years and becomes a prevalent disease of adulthood and in the near future it will be one of senility. Furthermore, clinical phenotype of TM is changing with age and appearance of severe complications from the heart and endocrine glands that require special health care from well-informed specialists. Objectives: The aims of our study were to: (1 Imprint the clinical profile of long-lived TM patients; (2 evaluate retrospectively the cumulative incidence of endocrine diseases; (3 identify potential risk factors; and (4 orient the physicians in the modified clinical phenotype and the relative patients' health needs. Design: A retrospective cross-sectional study followed from childhood to adulthood by the same physician in a tertiary thalassemia clinic. Participants: Forty-three long-lived TM patients (mean age: 50.3 ± 10.8 years; range: 45.8–59.5 years; 23 females were studied. Patients and Methods: An extensive medical history, with detailed clinical and laboratory data, endocrine complications, and current treatments, was obtained. Results: The data indicate that 88.4% of adult TM patients suffered from at least one endocrine complication. The majority of patients developed endocrine complications in the second decade of life when serum ferritin level was very high (12/23 TM female and 8/20 TM male patients, the serum ferritin levels at the diagnosis were above 5.000 ng/ml. Conclusions: These data underline that endocrine and bone complications in adult TM patients are highly prevalent and necessitate close monitoring, treatment, and follow-up. Physicians' strategies to optimize chelation therapy

  11. Beta-Thalassemia Major and Female Fertility: The Role of Iron and Iron-Induced Oxidative Stress (United States)

    Roussou, Paraskevi; Tsagarakis, Nikolaos J.; Diamanti-Kandarakis, Evanthia


    Endocrine complications due to haemosiderosis are present in a significant number of patients with beta-thalassemia major (BTM) worldwide and often become barriers in their desire for parenthood. Thus, although spontaneous fertility can occur, the majority of females with BTM is infertile due to hypogonadotropic hypogonadism (HH) and need assisted reproductive techniques. Infertility in these women seems to be attributed to iron deposition and iron-induced oxidative stress (OS) in various endocrine organs, such as hypothalamus, pituitary, and female reproductive system, but also through the iron effect on other organs, such as liver and pancreas, contributing to the impaired metabolism of hormones and serum antioxidants. Nevertheless, the gonadal function of these patients is usually intact and fertility is usually retrievable. Meanwhile, a significant prooxidants/antioxidants imbalance with subsequent increased (OS) exists in patients with BTM, which is mainly caused by tissue injury due to overproduction of free radicals by secondary iron overload, but also due to alteration in serum trace elements and antioxidant enzymes. Not only using the appropriate antioxidants, essential trace elements, and minerals, but also regulating the advanced glycation end products, could probably reduce the extent of oxidative damage and related complications and retrieve BTM women's infertility. PMID:24396593

  12. Associations between a health-promoting lifestyle and quality of life among adults with beta-thalassemia major. (United States)

    Maheri, Aghbabak; Sadeghi, Roya; Shojaeizadeh, Davoud; Tol, Azar; Yaseri, Mehdi; Ebrahimi, Mojtaba


    A health-promoting lifestyle (HPL) is a factor that affects the quality of life (QoL) in patients with beta-thalassemia (β-thalassemia). Due to the lack of studies of this issue, this study aimed to determine the association between HPL and QoL among adults with β-thalassemia. This cross-sectional (descriptive-analytic) study was conducted among 389 adult patients with β-thalassemia in Tehran, Iran. The research instrument included a questionnaire consisting of three parts: demographic items, the Short-Form Health Survey and the Health-Promoting Lifestyle Profile. The data were analyzed using SPSS version 23.0. The results were considered significant at the conventional pthalassemia; these four dimensions explained 37.9% of the variance in QoL. QoL and HPL were not at acceptable levels among patients with thalassemia. Therefore, educational interventions emphasizing spiritual growth, physical activity, and interpersonal relations are necessary for patients with thalassemia.

  13. Liver fibrosis alleviation after co-transplantation of hematopoietic stem cells with mesenchymal stem cells in patients with thalassemia major. (United States)

    Ghavamzadeh, Ardeshir; Sotoudeh, Masoud; Hashemi Taheri, Amir Pejman; Alimoghaddam, Kamran; Pashaiefar, Hossein; Jalili, Mahdi; Shahi, Farhad; Jahani, Mohammad; Yaghmaie, Marjan


    The aims of this study are to determine the replacement rate of damaged hepatocytes by donor-derived cells in sex-mismatched recipient patients with thalassemia major and to determine whether co-transplantation of mesenchymal stem cells and hematopoietic stem cells (HSCs) can alleviate liver fibrosis. Ten sex-mismatched donor-recipient pairs who received co-transplantation of HSCs with mesenchymal stem cells were included in our study. Liver biopsy was performed before transplantation. Two other liver biopsies were performed between 2 and 5 years after transplantation. The specimens were studied for the presence of donor-derived epithelial cells or hepatocytes using fluorescence in situ hybridization by X- and Y-centromeric probes and immunohistochemical staining for pancytokeratin, CD45, and a hepatocyte-specific antigen. All sex-mismatched tissue samples demonstrated donor-derived hepatocyte independent of donor gender. XY-positive epithelial cells or hepatocytes accounted for 11 to 25% of the cells in histologic sections of female recipients in the first follow-up. It rose to 47-95% in the second follow-up. Although not statistically significant, four out of ten patients showed signs of improvement in liver fibrosis. Our results showed that co-transplantation of HSC with mesenchymal stem cells increases the rate of replacement of recipient hepatocytes by donor-derived cells and may improve liver fibrosis.

  14. Adrenal glands in beta-thalassemia major: magnetic resonance (MR) imaging features and correlation with iron stores

    International Nuclear Information System (INIS)

    Drakonaki, Eleni; Papakonstantinou, Olympia; Maris, Thomas; Gourtsoyiannis, Nicholas; Vasiliadou, Artemis; Papadakis, Alex


    This study aimed at describing the magnetic resonance (MR) imaging features of the adrenal glands in beta-thalassemic patients and at investigating the relation between adrenal and hepatic siderosis. Adrenal signal intensity (SI) was retrospectively assessed on abdominal MR studies of 35 patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 12 healthy controls, using T1- (120/4/90), intermediate - (120/4/20), and T2*- (120/15/20) weighted GRE sequences. Adrenal SI was graded as grade 0 (normal SI on all sequences), grade 1 (hypointensity on T2* alone), or grade 2 (hypointensity on at least T2*). Adrenal size was measured in the thalassemic patients and compared with normative data. Liver-to-muscle (L/M) SI ratios, expressing hepatic siderosis, were estimated on each sequence. Serum ferritin levels were recorded. Adrenal hypointensity (grades 1 and 2) was noted in 24/35 (68.6%) patients. L/M ratios correlated significantly with adrenal SI in all sequences. Patients with grade 1 and grade 2 adrenal SI had significantly decreased L/M ratios compared with grade 0. Serum ferritin correlated significantly with L/M values but not with adrenal SI. Adrenal size was within normal limits. Diffuse hypointensity in normal-sized adrenals is a common MR finding in beta-thalassemic patients and correlates with the degree of hepatic siderosis. (orig.)

  15. Adrenal glands in beta-thalassemia major: magnetic resonance (MR) imaging features and correlation with iron stores

    Energy Technology Data Exchange (ETDEWEB)

    Drakonaki, Eleni; Papakonstantinou, Olympia; Maris, Thomas; Gourtsoyiannis, Nicholas [University Hospital of Heraklion, Department of Radiology, Heraklion (Greece); Vasiliadou, Artemis [Aghios Georgios Hospital of Chania, Thalassemia Unit, Chania (Greece); Papadakis, Alex [Venizelion Hospital of Heraklion, Thalassemia Unit, Heraklion (Greece)


    This study aimed at describing the magnetic resonance (MR) imaging features of the adrenal glands in beta-thalassemic patients and at investigating the relation between adrenal and hepatic siderosis. Adrenal signal intensity (SI) was retrospectively assessed on abdominal MR studies of 35 patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 12 healthy controls, using T1- (120/4/90), intermediate - (120/4/20), and T2*- (120/15/20) weighted GRE sequences. Adrenal SI was graded as grade 0 (normal SI on all sequences), grade 1 (hypointensity on T2* alone), or grade 2 (hypointensity on at least T2*). Adrenal size was measured in the thalassemic patients and compared with normative data. Liver-to-muscle (L/M) SI ratios, expressing hepatic siderosis, were estimated on each sequence. Serum ferritin levels were recorded. Adrenal hypointensity (grades 1 and 2) was noted in 24/35 (68.6%) patients. L/M ratios correlated significantly with adrenal SI in all sequences. Patients with grade 1 and grade 2 adrenal SI had significantly decreased L/M ratios compared with grade 0. Serum ferritin correlated significantly with L/M values but not with adrenal SI. Adrenal size was within normal limits. Diffuse hypointensity in normal-sized adrenals is a common MR finding in beta-thalassemic patients and correlates with the degree of hepatic siderosis. (orig.)

  16. Beta-thalassemia

    Directory of Open Access Journals (Sweden)

    Origa Raffaella


    Full Text Available Abstract Beta-thalassemias are a group of hereditary blood disorders characterized by anomalies in the synthesis of the beta chains of hemoglobin resulting in variable phenotypes ranging from severe anemia to clinically asymptomatic individuals. The total annual incidence of symptomatic individuals is estimated at 1 in 100,000 throughout the world and 1 in 10,000 people in the European Union. Three main forms have been described: thalassemia major, thalassemia intermedia and thalassemia minor. Individuals with thalassemia major usually present within the first two years of life with severe anemia, requiring regular red blood cell (RBC transfusions. Findings in untreated or poorly transfused individuals with thalassemia major, as seen in some developing countries, are growth retardation, pallor, jaundice, poor musculature, hepatosplenomegaly, leg ulcers, development of masses from extramedullary hematopoiesis, and skeletal changes that result from expansion of the bone marrow. Regular transfusion therapy leads to iron overload-related complications including endocrine complication (growth retardation, failure of sexual maturation, diabetes mellitus, and insufficiency of the parathyroid, thyroid, pituitary, and less commonly, adrenal glands, dilated myocardiopathy, liver fibrosis and cirrhosis. Patients with thalassemia intermedia present later in life with moderate anemia and do not require regular transfusions. Main clinical features in these patients are hypertrophy of erythroid marrow with medullary and extramedullary hematopoiesis and its complications (osteoporosis, masses of erythropoietic tissue that primarily affect the spleen, liver, lymph nodes, chest and spine, and bone deformities and typical facial changes, gallstones, painful leg ulcers and increased predisposition to thrombosis. Thalassemia minor is clinically asymptomatic but some subjects may have moderate anemia. Beta-thalassemias are caused by point mutations or, more rarely

  17. Bone marrow changes in beta-thalassemia major: quantitative MR imaging findings and correlation with iron stores

    International Nuclear Information System (INIS)

    Drakonaki, Eleni E.; Karantanas, Apostolos H.; Maris, Thomas G.; Papadakis, Alex


    The purpose of this study is to describe the MR imaging features of bone marrow in beta-thalassemia major and investigate their relation to ferritin, liver and spleen siderosis. Spinal bone marrow was prospectively assessed on abdominal MR studies of 40 transfused beta-thalassemic patients and 15 controls using T1-w, Pd, T2*-w Gradient Echo (GRE) and T1-w turbo Spin Echo (TSE) sequences. Signal intensity (SI) ratios of liver, spleen and bone marrow to paraspinous muscles (L/M, S/M, B/M respectively) and the respective T2 relaxation rates (1/T2) were calculated. Serum ferritin levels were recorded. Bone marrow hypointensity in at least T2*-w GRE sequence was noted in 29/40 (72.5%) patients. Eleven/40 patients exhibited normal B/M on all MR sequences. Five/40 patients had normal B/M and low L/M. B/M correlated with L/M in T1-w TSE sequence only (r = 0.471, p = 0.05). B/M correlated with S/M and mean ferritin values in all sequences (r > 0.489, p - 0.496, p < 0.03 respectively). Marrow 1/T2 did not correlate with ferritin values or liver and spleen 1/T2. B/M in transfused beta-thalassemic patients is related to splenic siderosis and ferritin levels. Although marrow is usually hypointense, it may occasionally display normal SI coexisting with liver hypointensity, a pattern typical of primary hemochromatosis. (orig.)

  18. On improvement in ejection fraction with iron chelation in thalassemia major and the risk of future heart failure

    Directory of Open Access Journals (Sweden)

    Carpenter JP


    Full Text Available Abstract Background Trials of iron chelator regimens have increased the treatment options for cardiac siderosis in beta-thalassemia major (TM patients. Treatment effects with improved left ventricular (LV ejection fraction (EF have been observed in patients without overt heart failure, but it is unclear whether these changes are clinically meaningful. Methods This retrospective study of a UK database of TM patients modelled the change in EF between serial scans measured by cardiovascular magnetic resonance (CMR to the relative risk (RR of future development of heart failure over 1 year. Patients were divided into 2 strata by baseline LVEF of 56-62% (below normal for TM and 63-70% (lower half of the normal range for TM. Results A total of 315 patients with 754 CMR scans were analyzed. A 1% absolute increase in EF from baseline was associated with a statistically significant reduction in the risk of future development of heart failure for both the lower EF stratum (EF 56-62%, RR 0.818, p Conclusion These data show that during treatment with iron chelators for cardiac siderosis, small increases in LVEF in TM patients are associated with a significantly reduced risk of the development of heart failure. Thus the iron chelator induced improvements in LVEF of 2.6% to 3.1% that have been observed in randomized controlled trials, are associated with risk reductions of 25.5% to 46.4% for the development of heart failure over 12 months, which is clinically meaningful. In cardiac iron overload, heart mitochondrial dysfunction and its relief by iron chelation may underlie the changes in LV function.

  19. Assessment of status of thyroid function in patients of beta thalassemia major, reporting to OPD of military hospital, rawalpindi

    International Nuclear Information System (INIS)

    Jehanzeb, K.


    Objective: To determine the status of thyroid functions in patients of Beta Thalassemia Major, reporting to OPD of Military Hospital, Rawalpindi. Study Design: Descriptive cross sectional study. Place and Duration of Study: Paediatric Outpatients Department of Military Hospital, Rawalpindi from 1st Jan to 30th Jun 2012. Material and Methods: After taking informed consent from the parents of all the children fulfilling the inclusion criteria, detailed history was taken and blood samples were drawn by strict aseptic means. Samples taken from these patients included complete blood and thyroid profile (serum thyroxine T4, triiodothyronine T3 and thyroid stimulating hormone TSH). These blood samples were labeled and sent to Armed Forces Institute of Pathology (AFIP), Rawalpindi for analysis by enzyme-linked immunosorbent assay (ELISA). Primary hypothyroidism was defined by TSH levels >4IU/ml. Statistical analysis was done at the end of study using SPSS version 10. Significance for association was calculated using student t-test. Results: Sixty patients fulfilled the inclusion criteria out of these sixty four patients lost the follow up while 56 patients completed the study. Out of 56 patients, 21 (37.5 percent) had biochemical evidence of hypothyroidism. Mean Ferritin level was 3924 +- 1247ng/ml in hypothyroid and 3136 +- 1387ng/ml in euthyroid patients indicating a significant difference in mean serum ferritin levels between hypothyroid patients and others. Conclusion: The study demonstrates hypothyroidism in a significant number of hyper transfused Beta- thalassemic patients, emphasizing the importance of monitoring thyroid functions in thalassemic patients, particularly in those receiving suboptimal chelation. (author)

  20. Bone marrow changes in beta-thalassemia major: quantitative MR imaging findings and correlation with iron stores

    Energy Technology Data Exchange (ETDEWEB)

    Drakonaki, Eleni E.; Karantanas, Apostolos H. [University Hospital of Heraklion, Radiology Department, Heraklion, Crete (Greece); Maris, Thomas G. [University of Crete, Department of Medical Physics, Heraklion, Crete (Greece); Papadakis, Alex [Venizelion General Hospital, Heraklion, Crete (Greece)


    The purpose of this study is to describe the MR imaging features of bone marrow in beta-thalassemia major and investigate their relation to ferritin, liver and spleen siderosis. Spinal bone marrow was prospectively assessed on abdominal MR studies of 40 transfused beta-thalassemic patients and 15 controls using T1-w, Pd, T2*-w Gradient Echo (GRE) and T1-w turbo Spin Echo (TSE) sequences. Signal intensity (SI) ratios of liver, spleen and bone marrow to paraspinous muscles (L/M, S/M, B/M respectively) and the respective T2 relaxation rates (1/T2) were calculated. Serum ferritin levels were recorded. Bone marrow hypointensity in at least T2*-w GRE sequence was noted in 29/40 (72.5%) patients. Eleven/40 patients exhibited normal B/M on all MR sequences. Five/40 patients had normal B/M and low L/M. B/M correlated with L/M in T1-w TSE sequence only (r = 0.471, p = 0.05). B/M correlated with S/M and mean ferritin values in all sequences (r > 0.489, p < 0.01 and r > - 0.496, p < 0.03 respectively). Marrow 1/T2 did not correlate with ferritin values or liver and spleen 1/T2. B/M in transfused beta-thalassemic patients is related to splenic siderosis and ferritin levels. Although marrow is usually hypointense, it may occasionally display normal SI coexisting with liver hypointensity, a pattern typical of primary hemochromatosis. (orig.)

  1. Impact of educational programme regarding chelation therapy on the quality of life for B-thalassemia major children. (United States)

    Abu Samra, Omayma; Auda, Wafaa; Kamhawy, Heba; Al-Tonbary, Youssef


    Objectives Thalassemia is the most common genetic disorder in Egypt, with an estimated carrier rate of 9-10%. It is a genetic blood disorder which can be fatal if proper chelation is not received. The introduction of chelating agents capable of removing excessive iron from the body has dramatically increased life expectancy and improved the overall quality of life. The aim of this study was to assess the impact of educational programmes regarding chelation therapy on the quality of life of thalassemic children. Methods The study was carried out at the Mansoura University Children's Hospital in the period between March 2010 and May 2011. It included 173 B-thalassemia children (84 boys and 89 girls) with age ranging between 8-18 years. The researcher used a predesigned interviewing questionnaire to collect data regarding children's knowledge about thalassemia and its management, especially regarding chelation therapy. The paediatric quality-of-life inventory tool (Peds QL 4.0 generic core) was also used to assess the studied children's quality of life. Results There was a significant statistical difference of the studied children's knowledge regarding chelation therapy and their quality of life. Conclusion There was a positive effect of the educational programme in improving children's knowledge score and their quality of life. Application of educational programmes for thalassemic children and their nurses regarding chelation therapy and its importance in preventing thalassemia complications is established.

  2. thalassemia induced hypercoagulability

    African Journals Online (AJOL)

    Subjects and methods: Venous blood samples were collected from ten normal control subjects and thirty patients with beta-thalassemia major (divided into two groups, splenectomized and unsplenectomized). To all studied individuals, plasma substance P and sP-selectin were assayed by an enzyme linked Immunosorbent ...

  3. 2,3,7,8-tetrachlorodibenzo-p-dioxin decrease expression of aryl hydrocarbon receptor in peripheral lymphocyte of β-thalassemia major patients. (United States)

    Ghatrehsamani, Mahdi; Soleimani, Masoud; Esfahani, Behjat Al-Sadat Moayedi; Hakemi, Mazdak Ganjalikhani; Shirzad, Hedayatollah; Eskandari, Nahid; Adib, Minoo


    β-thalassemia major is a hereditary disease with inefficient erythropoiesis. Level of inflammatory cytokine is elevated in these patients. In this study, we investigate the effect of aryl hydrocarbon receptor (AhR) ligand, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), on the expression of inflammatory mediators in β-thalassemia major patient's lymphocytes. Peripheral blood mononuclear cells of patients and healthy participants was isolated and cultured in favor of lymphocytes increment. Based on the treatment, we divided the cell into four groups. The orders of group's treatments were no treatment, tumor necrosis factor-α (TNF-α) treatment, TNF-α and TCDD treatment, TCDD treatment in Group 1-4, respectively. After cell culture, we extracted the cells RNA and converted them to cDNA. Real-time polymerase chain reaction was performed to assessment relative expression of caspase-1, NLRP3, and AhR. We compared all patient groups with equal healthy (control) groups. Results showed that expression of caspase-1 in patients (Groups 1 and 2) was significantly lower than healthy individuals (P 0.05). Expression of AhR in other groups of patients (3 and 4) was significantly lower than control groups (P < 0.05). Expression of caspase-1 in Group 4 was significantly larger than the control group (P < 0.001). We show here that chronic inflammation decrease caspase-1 expression and exposure of human lymphocytes to TCDD promote caspase-1 expression. Furthermore, activation of AhR with TCDD decreases AhR expression in lymphocytes of β-thalassemia major disease.


    Directory of Open Access Journals (Sweden)

    Athanasios Aessopos


    Full Text Available Heart disease is the leading cause of mortality and one of the main causes of morbidity in beta-thalassemia. Patients with homozygous thalassemia may have either a severe phenotype which is usually transfusion dependent or a milder form that is thalassemia intermedia.  The two main factors that determine cardiac disease in homozygous β thalassemia are the high output state that results from chronic tissue hypoxia, hypoxia-induced compensatory reactions and iron overload.  The high output state playing a major role in thalassaemia intermedia and the iron load being more significant in the major form. Arrhythmias, vascular involvement that leads to an increased pulmonary vascular resistance and an increased systemic vascular stiffness and valvular abnormalities also contribute to the cardiac dysfunction in varying degrees according to the severity of the phenotype.  Endocrine abnormalities, infections, renal function and medications can also play a role in the overall cardiac function.  For thalassaemia major, regular and adequate blood transfusions and iron chelation therapy are the mainstays of management. The approach to thalassaemia intermedia, today, is aimed at monitoring for complications and initiating, timely, regular transfusions and/or iron chelation therapy.  Once the patients are on transfusions, then they should be managed in the same way as the thalassaemia major patients.  If cardiac manifestations of dysfunction are present in either form of thalassaemia, high pre transfusion Hb levels need to be maintained in order to reduce cardiac output and appropriate intensive chelation therapy needs to be instituted.  In general recommendations on chelation, today, are usually made according to the Cardiac Magnetic Resonance findings, if available.  With the advances in the latter technology and the ability to tailor chelation therapy according to the MRI findings as well as the availability of three iron chelators, together with

  5. Serum ferritin levels, socio-demographic factors and desferrioxamine therapy in multi-transfused thalassemia major patients at a government tertiary care hospital of Karachi, Pakistan

    Directory of Open Access Journals (Sweden)

    Rehman Anis


    Full Text Available Abstract Background Beta thalassemia is the most frequent genetic disorder of haemoglobin synthesis in Pakistan. Recurrent transfusions lead to iron-overload manifested by increased serum Ferritin levels, for which chelation therapy is required. Findings The study was conducted in the Pediatric Emergency unit of Civil Hospital Karachi after ethical approval by the Institutional Review Board of Dow University of Health Sciences. Seventy nine cases of beta thalassemia major were included after a written consent. The care takers were interviewed for the socio-demographic variables and the use of Desferrioxamine therapy, after which a blood sample was drawn to assess the serum Ferritin level. SPSS 15.0 was employed for data entry and analysis. Of the seventy-nine patients included in the study, 46 (58.2% were males while 33 (41.8% were females. The mean age was 10.8 (± 4.5 years with the dominant age group (46.2% being 10 to 14 years. In 62 (78.8% cases, the care taker education was below the tenth grade. The mean serum Ferritin level in our study were 4236.5 ng/ml and showed a directly proportional relationship with age. Desferrioxamine was used by patients in 46 (58.2% cases with monthly house hold income significant factor to the use of therapy. Conclusions The mean serum Ferritin levels are approximately ten times higher than the normal recommended levels for normal individuals, with two-fifths of the patients not receiving iron chelation therapy at all. Use of iron chelation therapy and titrating the dose according to the need can significantly lower the iron load reducing the risk of iron-overload related complications leading to a better quality of life and improving survival in Pakistani beta thalassemia major patients. Conflicts of Interest: None

  6. Thalassemias and hemoglobinopathies in Turkey. (United States)

    Canatan, Duran


    Thalassemias and hemoglobinopathies are a serious health problem in Turkey. There is a 70-year history of thalassemia in Turkey. The first patient with β-thalassemia major (β-TM) was reported in 1941. The first clinical and hematological studies were published by Aksoy in 1958. The overall incidence of β-thalassemia (β-thal) was reported by Çavdar and Arcasoy to be 2.1% in 1971. Important steps such as written regulations, education and prevention campaigns, have been taken to prevent thalassemia in Turkey by the Ministry of Health (MOH), the Turkish National Hemoglobinopathy Council (TNHC) and the Thalassemia Federation of Turkey (TFT) since 2000. A national hemoglobinopathy prevention program was started in provinces with a high prevalence by the MOH in 2003. While the percentage of premarital screening test was 30.0% of all couples in 2003, it reached 86.0% in 2013. While the number of newborn with thalassemias and hemoglobinopathies was 272 in 2002, it had dropped to 25 in 2010. There has been a 90.0% reduction of affected births in the last 10 years.

  7. Non-transfusion-dependent thalassemias (United States)

    Musallam, Khaled M.; Rivella, Stefano; Vichinsky, Elliott; Rachmilewitz, Eliezer A.


    Non-transfusion-dependent thalassemias include a variety of phenotypes that, unlike patients with beta (β)-thalassemia major, do not require regular transfusion therapy for survival. The most commonly investigated forms are β-thalassemia intermedia, hemoglobin E/β-thalassemia, and α-thalassemia intermedia (hemoglobin H disease). However, transfusion-independence in such patients is not without side effects. Ineffective erythropoiesis and peripheral hemolysis, the hallmarks of disease process, lead to a variety of subsequent pathophysiologies including iron overload and hypercoagulability that ultimately lead to a number of serious clinical morbidities. Thus, prompt and accurate diagnosis of non-transfusion-dependent thalassemia is essential to ensure early intervention. Although several management options are currently available, the need to develop more novel therapeutics is justified by recent advances in our understanding of the mechanisms of disease. Such efforts require wide international collaboration, especially since non-transfusion-dependent thalassemias are no longer bound to low- and middle-income countries but have spread to large multiethnic cities in Europe and the Americas due to continued migration. PMID:23729725

  8. Regulatory B cells (CD19(+)CD38(hi)CD24(hi)) in alloimmunized and non-alloimmunized children with β-thalassemia major. (United States)

    Zahran, Asmaa M; Elsayh, Khalid I; Saad, Khaled; Embaby, Mostafa; Ali, Ahmed M


    β-Thalassemia major (BTM) is considered the most common hemoglobinopathy in Egypt and is one of the major health problems in our locality. We investigated the frequency of B-regulatory cells (CD19(+)CD38(hi)CD24(hi)); (Bregs) among polytransfused alloimmunized and non-alloimmunized children with BTM. The study included 110 polytransfused pediatric patients with β-thalassemia major. Clinical and transfusion records of all studied patients were reviewed. Indirect antiglobulin test was performed to detect the presence of alloantibodies. We used flow cytometry for detection of CD19(+)CD38(hi)CD24(hi) regulatory B cells. Alloimmunization was detected in 35.5% of thalassemic patients (39/110). The analysis of our data showed a significantly higher frequency of Bregs (CD19(+)CD38(hi)CD24(hi)) in the peripheral blood of both alloimmunized and non-alloimmunized patients as compared to healthy controls. Our data showed that the frequencies of CD19(+)CD24(hi)CD38(hi) Bregs cells were significantly increased in children with BTM. Our data suggested that Bregs cells could play a role in the clinical course of BTM. The relationship of Bregs to immune disorders in BTM children remains to be determined. Further longitudinal study with a larger sample size is warranted to explore the mechanisms of Breg cells in the disease process in BTM patients. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Effect of long-term transfusion therapy on the glycometabolic status and pancreatic beta cell function in patients with beta Thalassemia major

    Directory of Open Access Journals (Sweden)

    Kamalakshi G Bhat


    Full Text Available Background: Diabetes mellitus is a major complication of iron overload in patients with beta thalassemia major. Design: This is a descriptive study conducted in a Tertiary Care Teaching Hospital to analyze beta cell function and insulin resistance, and their relation to iron overload status in beta thalassemia major. Fasting glucose, two-hour post load glucose, fasting insulin, alanine amino transaminase (ALT, and ferritin were used as outcome measures. The homeostatic model assessment (HOMA model was used to calculate the beta cell function and insulin resistance index. Results: Of the 30 cases, 20% had impaired fasting glucose, 3.3% had impaired glucose tolerance, and none had diabetes. Fasting glucose was not significant between the cases and controls (P = 0.113. Fasting insulin (P = 0.001, ferritin (P = 0.001, and ALT (P = 0.001 levels were significantly high in the cases. Insulin resistance index was significantly higher in the cases (P = 0.001 as also the beta cell function (P = 0.001. With increase in age and the number of units transfused there is a decline in beta cell function, fasting insulin, and insulin resistance after attaining the maximum level. This suggests that initial insulin resistance is followed by insulin depletion due to loss of beta cell function, leading to diabetes mellitus. Conclusion: Impaired glucose tolerance (IGT and insulin resistance precede the onset of insulin-dependent diabetes and adequate chelation therapy is essential for delaying the onset or for prevention of diabetes.


    International Nuclear Information System (INIS)

    NASSAR, E.M.


    The present study aimed to determine the benefits of vitamin E as antioxidant supplement in β thalassemia children who are at risk of iron overload due to multiple blood transfusion and oxidative stress. Antioxidant markers, oxidative products, hematological parameters and biomarkers of cell damage were studied in 24 transfusion-dependent β -thalassemia children before and after treatment with vitamin E at a dose of 10 mg/kg /day for a period of four weeks. Plasma thiobarbituric acid reactive species (TBARS) and urinary 8-hydroxy-2 ' -deoxyguanosine (8-OHdG) were analyzed as oxidative markers, whereas the plasma vitamin E and the activities of the antioxidant enzymes glutathione peroxidase (GSH-Px), superoxide dismutase(SOD) and catalase were measured to show the antioxidant status of thalassemic children. All these parameters were also studied in 15 non-anemic healthy controls .The results showed that all the patients had increased signs of iron overload and cell damage that were obvious from the increase in serum iron, ferritin, alanine transaminases (ALT), aspartate transaminases (AST) and both total and direct bilirubin .The level of plasma vitamin E in the thalassemia patients were found to be significantly lower as compared to normal subjects (1.3 ± 0.7 and 3.14 ± 1.5 mg % , respectively). The activities of antioxidants enzymes, glutathione peroxidase and catalase in untreated β-thalassemic patients were found to be significantly (P<0.001) less than that of the normal subjects. However, SOD level was significantly increased. Markers of free radical injury such as TBARS , urinary 8-OHdG levels in thalassemic children were significantly higher than control levels . All these changes in the antioxidant status as well as the hematological parameters, iron overload and cell damage markers in β-thalassemia patients showed significant improvement after vitamin E supplementation. Vitamin E levels showed significant positive correlations with each of Hb, GSH

  11. Overview of the current issues and advances in haemopoietic stem cell transplantation for β-thalassemia major

    Directory of Open Access Journals (Sweden)

    S.S. Anak


    Full Text Available Bone marrow transplantation (BMT is the only possible curative treatment for β-thalassemia major. The largest experience occurred in Pesaro, Italy, where the BMT was applied after a standard risk assessment. The patients were divided into 3 risk classes based on liver size by physical examination, the presence or absence of fibrosis by liver biopsy, and adherence to regular iron chelation. Outcomes were mainly affected by the risk status. After modifications to the conditioning regimens, the risk of transplantation-related complications in highrisk recipients reduced considerably. As a result, outcomes after transplantation have become more similar across risk categories. For BMT, most centers use bone marrow instead of peripheral blood in thalassemia. Some studies showed that peripheral blood stem cell transplantation (PBSCT is better than BMT with regard to hematologic recovery, hospitalization period, leukemia-free survival, overall survival (OS, and transplant-related mortality (TRM. No significant differences were seen in grade II to IV acute GVHD (aGVHD; but the incidence of chronic GVHD (cGVHD was significantly higher in the PBSCT group. BMT from unrelated donors may offer similar results to those obtained using HLA-identical family donors, at least for patients who are not fully compliant with conventional treatment and do not yet show severe complications of iron overload. All studies conclude that MUD BMT might be a good alternative for patients with less risk factors. Another study concluded that, at present, due to high graft failure and GVHD rates, BMT from alternative donors should be restricted to patients who have poor life expectancies because they cannot receive adequate conventional treatment or because of alloimmunization to minor blood antigens. In another study unrelated cord blood transplantation (CBT was compared to related donor transplantation for children with β-thalassemia. The results were comparable to the

  12. Facts about Thalassemia (United States)

    ... CDC’s Work Related Information UDC System Basics About Thalassemia Recommend on Facebook Tweet Share Compartir Did You ... to death. What are the different types of thalassemia? When we talk about different “types” of thalassemia, ...

  13. Thalassemia: Healthy Living (United States)

    ... Thalassemia” More What can a person living with thalassemia do to stay healthy? A healthy lifestyle is ... disorder”, as well as making healthy choices. Managing Thalassemia Thalassemia is a treatable disorder that can be ...

  14. Peripheral neuropathy in thalassemia

    International Nuclear Information System (INIS)

    Sawaya, Raja A.; Tahir, A.; Zahad, L.


    Patients with thalassemia may complain of numbness and weakness of lower extremities. The aim of the study was to determine whether these patients suffer from a polyneuropathy and to determine any contributing factors for the development of neuropathy. We examined 30 patients with thalasemia major and intermedia, clinically and electrophysiologically. We correlated these findings with demographics, blood status and treatment and compared electrophysiologic data with 30 age and sex matched normal subjects or historical controls. We found that 78% of thalassemia patients suffer from a mild sensory polyneuropathy. The neuropathy seemed to be worse in the intermedia type. Thalassemia patients who received blood transfusions and deferoaximine had better nerve faction than those who did not, irrespective of the dose of the deferoxamine. The neuropathy was worse for the older patients, irrespective of the sex. The hemoglobin level, and the fact that some patients underwent spleenctomy, did not affect the status of the patient's nerves. Patients with thalassemia may suffer from a sensor polyneuropathy especially as they grow older and they are not optimally treated. (author)

  15. Hypertriglyceridemia Thalassemia Syndrome: Common Disease, Uncommon Association. (United States)

    Das, Lipsa; Samprathi, Madhusudan; Shukla, Umesh; Bandyopadhyay, Debapriya; Das, Rashmi Ranjan


    Hypertriglyceridemia has been rarely described with thalassemia, an entity called hypertriglyceridemia-thalassemia syndrome. The authors describe a young infant diagnosed with thalassemia major with severe hypertriglyceridemia. The presence of severe hypertriglyceridemia in this child which rapidly resolved after transfusion, probably suggests a self limited mechanism which may not require therapy. Though hypertriglyceridemia has been reported with hemolytic anemias, the mechanism is unclear. This case illustrates that thalassemia may be associated with hypertriglyceridemia; once familial and secondary causes are ruled out, clinicians may wait for spontaneous resolution before considering specific therapy.

  16. The Prevention of Thalassemia (United States)

    Cao, Antonio; Kan, Yuet Wai


    The thalassemias are among the most common inherited diseases worldwide, affecting individuals originating from the Mediterranean area, Middle East, Transcaucasia, Central Asia, Indian subcontinent, and Southeast Asia. As the diseases require long-term care, prevention of the homozygous state constitutes a major armament in the management. This article discusses the major prevention programs that are set up in many countries in Europe, Asia, and Australia, often drawing from the experience in Sardinia. These comprehensive programs involve carrier detections, molecular diagnostics, genetic counseling, and prenatal diagnosis. Variability of clinical severity can be attributable to interactions with α-thalassemia and mutations that increase fetal productions. Special methods taht are currently quite expensive and not widely applicable are preimplantation and preconception diagnosis. The recent successful studies of fetal DNA in maternal plasma may allow future prenatal diagnosis that is noninvasive for the fetus. PMID:23378598

  17. Study on effectiveness of transfusion program in thalassemia major patients receiving multiple blood transfusions at a transfusion centre in Western India

    Directory of Open Access Journals (Sweden)

    Shah Neeraj


    Full Text Available Background : Children suffering from beta-thalassemia major require repeated blood transfusions which may be associated with dangers like iron overload and contraction of infections such as HIV, HCV, and HBsAg which ultimately curtail their life span. On the other hand, inadequate transfusions lead to severe anemia and general fatigue and debility. Materials and Methods: Data were obtained from 142 beta-thalassemia major patients aged 3 years or more receiving regular blood transfusions at a transfusion centre in Western India from 1 April 2009 to 30 June 2009. The clinical data and laboratory results were subsequently analyzed. Results: Of the 142 patients, 76 (53.5% were undertransfused (mean Hb <10 gm%. 96 (67% of the patients were taking some form of chelation therapy but out of them only 2 (2% were adequately chelated (S. ferritin <1000 ng/ml. 5 (3.5% of the patients were known diabetics on insulin therapy. 103 (72% of the patients were retarded in terms of growth. The prevalence of transfusion-transmitted infections (TTIs such as HCV, HIV, and HBsAg was respectively 45%, 2%, and 2%, with the prevalence of HCV being significantly more than the general population. The HCV prevalence showed positive correlation with the age of the patients and with the total no of blood transfusions received. As many as 15% (6 out of 40 children who were born on or after 2002 were HCV positive despite the blood they received being subjected to screening for HCV. Conclusions: The study suggests the need to step up the transfusions to achieve hemoglobin goal of 10 gm% (as per the moderate transfusion regimen and also to institute urgent and effective chelation measures with the aim of keeping serum ferritin levels below 1000 ng/ml to avoid the systemic effects of iron overload. In addition, strict monitoring of the children for endocrinopathy and other systemic effects of iron overload should be done. Rigid implementation of quality control measures for the

  18. Alpha Thalassemia (For Parents) (United States)

    ... Safe Videos for Educators Search English Español Alpha Thalassemia KidsHealth / For Parents / Alpha Thalassemia What's in this ... Symptoms Diagnosis Treatment Print en español Alfa talasemia Thalassemias Thalassemias are a group of blood disorders that ...

  19. Beta Thalassemia (For Parents) (United States)

    ... Safe Videos for Educators Search English Español Beta Thalassemia KidsHealth / For Parents / Beta Thalassemia What's in this ... Symptoms Diagnosis Treatment Print en español Beta talasemia Thalassemias Thalassemias are a group of blood disorders that ...

  20. Pathogenesis of chronic rhinosinusitis in patients affected by β-thalassemia major and sickle cell anaemia post allogenic bone marrow transplant. (United States)

    Martino, F; Di Mauro, R; Paciaroni, K; Gaziev, J; Alfieri, C; Greco, L; Floris, R; Di Girolamo, S; Di Girolamo, M


    Sickle cell anemia (SCA) and β -thalassemia major are well-recognized beta-globin gene disorders of red blood cells associated to mortality and morbidity included bone morbidities due to ineffective erythropoiesis and bone marrow expansion, which affect every part of the skeleton. While there are an abundance of described disease manifestations of the head and neck, the manner of paranasal sinuses involvement and its relations to β-thalassemia and SCA process was not studied yet. Therefore, the aim of this study was to investigate a possible increased risk of rhinosinusitis and the real pathogenetic mechanism of it, comparing these two hematological diseases using msCT, gold standard for paranasal sinuses evaluation. A retrospective analysis of 90 patients affected by β-thalassemia major or SCA (respectively 59 and 31) underwent allogeneic bone marrow transplantation (BMT), and 44 control subjects was performed. Both patient categories and control group have been subjected to hematological and radiological evaluation using 64-multidetector-row CT scanner without contrast injection. Statistical analysis reveals that patients of the two study groups exhibit a significantly increased risk of sinusitis in comparison with the normal controls (RR: 3.55 for β-thalassemic pediatric subjects; RR: 3.35 for SCA pediatric subjects). A significant difference (p < 0,5) was found between the β -thalassemic patients on the one side, and SCA and control group on the other side, with regard to the evaluation of the typical anatomic alteration of maxillary sinus: β-thalassemic children had significant increase in the bone thickness of anterior and lateral sinus walls and significant reduction in volume and density compared to SCA patients and control group, with normal conditions of these parameters. In these hematological patients, there is an increased incidence of sinonasal infections due their therapy-induced immunosuppression post transplantation. In

  1. Thalassemia and related hemoglobinopathies. (United States)

    Sarnaik, Sharada A


    Hemoglobinopathies are the most common single gene disorders in man. There are several hundred of these disorders though the thalassemias -- alpha and beta and the sickling disorders make up the vast majority. Recent advances in the understanding of the hemoglobin structure and the genetics of its synthesis has contributed significantly to the understanding of these diseases. Disorders include those with reduced globin synthesis, abnormal globin chains and failure to switch globin chain synthesis at the appropriate age. This review focuses on the clinical features, diagnosis and management strategies of the alpha and beta thalassemias, the sickling disorders and touches on a few rarer hemoglobinopathies. It also emphasizes prevention strategies and chronic transfusion safety in countries like India where there are limited resources.

  2. Correlation between T2* cardiovascular magnetic resonance with left ventricular function and mass in adolescent and adult major thalassemia patients with iron overload. (United States)

    Djer, Mulyadi M; Anggriawan, Shirley L; Gatot, Djajadiman; Amalia, Pustika; Sastroasmoro, Sudigdo; Widjaja, Patricia


    to assess for a correlation between T2*CMR with LV function and mass in thalassemic patients with iron overload. a cross-sectional study on thalassemic patients was conducted between July and September 2010 at Cipto Mangunkusumo and Premier Hospitals, Jakarta, Indonesia. Clinical examinations, review of medical charts, electrocardiography, echocardiography, and T2*CMR were performed. Cardiac siderosis was measured by T2*CMR conduction time. Left ventricle diastolic and systolic functions, as well as LV mass index were measured using echocardiography. Correlations between T2*CMR and echocardiography findings, as well as serum ferritin were determined using Pearson's and Spearman's tests. thirty patients aged 13-41 years were enrolled, of whom two-thirds had -thalassemia major and one-third had HbE/-thalassemia. Diastolic dysfunction was identified in 8 patients, whereas systolic function was normal in all patients. Increased LV mass index was found in 3 patients. T2*CMR conduction times ranged from 8.98 to 55.04 ms and a value below 20 ms was demonstrated in 14 patients. There was a statistically significant moderate positive correlation of T2*CMR conduction time with E/A ratio (r = 0.471, P = 0.009), but no correlation was found with LV mass index (r=0.097, P=0.608). A moderate negative correlation was found between T2*CMR and serum ferritin (r = -0.514, P = 0.004), while a moderate negative correlation was found between serum ferritin and E/A ratio (r = -0.425, P = 0.019). T2*CMR myocardial conduction time has a moderate positive correlation with diastolic function, moderate negative correlation with serum ferritin, but not with LV mass index and systolic function.

  3. The Hemoglobin E Thalassemias (United States)

    Fucharoen, Suthat; Weatherall, David J.


    Hemoglobin E (HbE) is an extremely common structural hemoglobin variant that occurs at high frequencies throughout many Asian countries. It is a β-hemoglobin variant, which is produced at a slightly reduced rate and hence has the phenotype of a mild form of β thalassemia. Its interactions with different forms of α thalassemia result in a wide variety of clinical disorders, whereas its coinheritance with β thalassemia, a condition called hemoglobin E β thalassemia, is by far the most common severe form of β thalassemia in Asia and, globally, comprises approximately 50% of the clinically severe β-thalassemia disorders. PMID:22908199

  4. Low bone mineral density in thalassemia major: Sanjay Gandhi Post Graduate Institute experience and a brief focus on underlying factors behind the cause

    Directory of Open Access Journals (Sweden)

    Kritanjali Singh


    Full Text Available Thalassemia major is a genetic disorder and blood transfusion is critical for survival in these patients. Over the course of the past three decades, hyper transfusion therapy in these patients has shown has dramatically extended life expectancy and improved quality of life. Unfortunately, this type of therapy also increased the incidence of complications due to iron overload. The aim of this study was to assess bone mineral density (BMD in patients with β-thalassemia major and to determine their biochemical and hormonal profiles that may affect BMD. A cross- sectional study was carried out in Sanjay Gandhi – PGIMS, a tertiary care hospital over period of 3 years on all β-thalassemia major patients above 7 years receiving regular transfusion. Patients with transfusion dependent anaemia other than β thalassemia major were excluded. Physical examination, laboratory tests and bone density measurements were performed. Then, the data were analyzed. The total number of children over 7 years of age with β-thalassemia major receiving regular blood transfusions during the study period was 150. Mean hemoglobin was 7.8±0.6g/dL and the mean serum ferritin level 5295±2736 ng/mL. Short stature was seen in 54.7% boys and 28.7% of girls. Prevalence of lumbar osteoporosis and osteopenia were 42.5% and 37.5%. Femoral osteoporosis and osteopenia were present in 32.5% and 55% of the patients. Impaired puberty, hypothyroidism, diabetes mellitus, hypoparathyroidism were observed in 26%, 18%, 7%, and 15%, of patients, respectively. Nearly 75% of patients had low bone mineral density. Bone mineral density was significantly associated with short stature (P=0.002, hypogonadism (P=0.006, hypoparathyroidism (P=0.038, hypothyroidism (P=0.044 and vitamin D deficiency (P<0.001. High prevalence of complications among our thalassemics signifies the importance of more detailed studies along with therapeutic interventions. 重型地中海贫血是一种遗传疾病,

  5. Relationship between elevated liver enzyme with iron overload and viralhepatitis in thalassemia major patients in Northern Iran

    International Nuclear Information System (INIS)

    Ameli, M.; Besharati, S.; Nemati, K.; Zamani, F.


    Objective was to determine the relationship between elevated liverenzymes with iron overload and viral hepatitis in thalassemia patients. Thisdescriptive cross-sectional study was carried out in the thalassemic ward ofTonekabon Hospital, Mazandaran, Northern Iran from 20 April to 20 Septemberof 2006. Patients were studied with respect to age, liver enzymes,anti-hepatitis C virus (anti-HCV) antibody and hepatitis B surface antigen(HBsAg), transferring saturation (TSAT)and blood transfusion index(multiplication of frequency and units of transfusion). Alanineaminotransferase (ALT) >=40 U/L was considered elevated. Sixty-five patientswere evaluated (median age 19.51+-8.9 years, range 4-54). Eleven patientswere anti-HCV positive (16.9%). The mean serum ferritin was significantlyhigher in patients with ALT>=40 (2553.08 ug/L versus 1783.7750 ug/L)(p=0.012). The mean ALT was significantly higher in patients with TSAT >=60%(41.26 U/L versus 28.82 U/L) (p=0.021). The relationship between ALT>=40 andanti-HCV positively was statistically significant. The mean ALT was 60.91 U/Lin anti-HCV positive patients and 39.29 U/L in the negative group (p=0.001).The mean serum iron and transfusion index were significantly higher inanti-HCV positive versus negative patients (234.0 versus 195.4815; p=0.02),(1693.6 versus 1036.29, p=0.014). Close association between elevated ALT withiron overload, transfusion index, age and anti-HCV positivity in thalassemiapatients of Tonekabon is recommended to re-evaluate transfusion and Desferaldoses and therapies other than blood transfusion. (author)

  6. Thalassemia: Complications and Treatment (United States)

    ... on Facebook Tweet Share Compartir If I have thalassemia, how does it affect my body? Since your ... like flu shots and other vaccines. How is thalassemia treated? The type of treatment a person receives ...

  7. Detection of glycemic abnormalities in adolescents with beta thalassemia using continuous glucose monitoring and oral glucose tolerance in adolescents and young adults with β-thalassemia major: Pilot study

    Directory of Open Access Journals (Sweden)

    Ashraf T Soliman


    Full Text Available Background: Both insulin deficiency and resistance are reported in patients with β-thalassemia major (BTM. The use of continuous blood glucose monitoring (CGM, among the different methods for early detection of glycemic abnormalities, has not been studied thoroughly in these adolescents. Materials and Methods: To assess the oralglucose tolerance (OGT and 72-h continuous glucose concentration by the continuous glucose monitoring system (CGMS and calculate homeostatic model assessment (HOMA, and the quantitative insulin sensitivity check index (QUICKI was conducted in 16 adolescents with BTM who were receiving regular blood transfusions every 2-4 weeks and iron-chelation therapy since early childhood. Results: Sixteen adolescents with BTM (age: 19.75 ± 3 years were investigated. Using OGTT, (25% had impaired fasting blood (plasma glucose concentration (BG (>5.6 mmol/L. 2-h after the glucose load, one of them had BG = 16.2 mmol/L (diabetic and two had impaired glucose tolerance (IGT (BG > 7.8 and 11.1 mmol/L and 9 with IGT (56%. HOMA and QUICKI revealed levels 0.33 (0.36 ± 0.03, respectively, ruling out significant insulin resistance in these adolescents. There was a significant negative correlation between the β-cell function (B% on one hand and the fasting and the 2-h BG (r=−0.6, and − 0.48, P < 0.01, respectively on the other hand. Neither fasting serum insulin nor c-peptide concentrations were correlated with fasting BG or ferritin levels. The average and maximum blood glucose levels during CGM were significantly correlated with the fasting BG (r = 0.68 and 0.39, respectively, with P < 0.01 and with the BG at 2-hour after oral glucose intake (r = 0.87 and 0.86 respectively, with P < 0.001. Ferritin concentrations were correlated with the fasting BG and the 2-h blood glucose levels in the OGTT (r = 0.52, and r = 0.43, respectively, P < 0.01 as well as with the average BG recorded by CGM (r = 0.75, P < 0.01. Conclusion: CGM has proven to

  8. Estimates of the effect on hepatic iron of oral deferiprone compared with subcutaneous desferrioxamine for treatment of iron overload in thalassemia major: a systematic review

    Directory of Open Access Journals (Sweden)

    Caro J


    Full Text Available Abstract Background Beta thalassemia major requires regular blood transfusions and iron chelation to alleviate the harmful accumulation of iron. Evidence on the efficacy and safety of the available agents, desferrioxamine and deferiprone, is derived from small, non-comparative, heterogeneous observational studies. This evidence was reviewed to quantitatively compare the ability of these chelators to reduce hepatic iron. Methods The literature was searched using Medline and all reports addressing the effect of either chelator on hepatic iron were considered. Data were abstracted independently by two investigators. Analyses were performed using reported individual patient data. Hepatic iron concentrations at study end and changes over time were compared using ANCOVA, controlling for initial iron load. Differences in the proportions of patients improving were tested using χ2. Results Eight of 11 reports identified provided patient-level data relating to 30 desferrioxamine- and 68 deferiprone-treated patients. Desferrioxamine was more likely than optimal dose deferiprone to decrease hepatic iron over the average follow-up of 45 months (odds ratio, 19.0, 95% CI, 2.4 to 151.4. The degree of improvement was also larger with desferrioxamine. Conclusions This analysis suggests that desferrioxamine is more effective than deferiprone in lowering hepatic iron. This comparative analysis – despite its limitations – should prove beneficial to physicians faced with the challenge of selecting the optimal treatment for their patients.

  9. Distribution of thalassemias and associated hemoglobinopathies identified by prenatal diagnosis in Taiwan. (United States)

    Peng, Ching-Tien; Liu, Su-Ching; Peng, Yi-Chin; Lin, Tsai-Hsiu; Wang, Shiow-Jain; Le, Ching-Yi; Shih, Mu-Chin; Tien, Ni; Lu, Jang-Jih; Lin, Chien-Yu


    Hemoglobin (Hb) gene disorders are common hereditary disorders in Taiwan, and α- and β-thalassemias are among the well-known Hb disorders here. Our study provides a primary reference for designing a locally relevant antenatal diagnostic test to control the spread of thalassemia. Between 1998 and 2011, prenatal diagnoses for identifying thalassemia and hemoglobinopathies were performed on 1240 fetuses at risk for α-hydrops and β-thalassemia major. Of 1240 specimens analyzed, 1082 (87%) were obtained by amniocentesis; 125 (10%), by chorionic villus sampling; and 33 (3%), by cordocentesis. Prenatal diagnoses revealed that 21.5% of these fetuses as thalassemia major (including α-thalassemia hydrops, β-thalassemia major, and Hb E/β-thalassemia); 50.2%, for thalassemia minor (include α-thalassemia carrier, β-thalassemia carrier, and α-thalassemia combined β-thalassemia carrier); and 28.3% for normal type (include non-α, β-thalassemia). The most common α-hydrops were SEA (Southeast Asian) and Philippine type (frequencies of 74.91 and 5.24%, respectively). The frequency of the IVS-II-654 combined codons 41/42 mutation, the most common β-thalassemia major mutation in this region, was 5.24%. Two fetuses were found with E/β-thalassemia (HbE/IVS-II-654 and HbE/codons 41/42, respectively). Since 1993, Taiwan's Department of Health adopted a national program for screening pregnancies to control spread of thalassemia. In the last 10years, less than 3 such cases have occurred per year. After 2003, this number was 0 for a total of 4years (2003, 2004, 2007, and 2008). In Taiwan, incidence and frequency of thalassemia genotypes were similar to those previously reported. The national program for screening pregnancies to control spread of thalassemia that resulted in a marked decline in the number of newborns with thalassemia major. Interestingly, prenatal diagnoses revealed 21.5% for thalassemia major, 50.2% for thalassemia minor, 28.3% normal comparison of thalassemia

  10. Premature epiphyseal fusion and extramedullary hematopoiesis in thalassemia

    International Nuclear Information System (INIS)

    Colavita, N.; Orazi, C.; Danza, S.M.; Falappa, P.G.; Fabbri, R.


    The main skeletal abnormalities in β-thalassemia are widening of medullary spaces, rarefaction of bone trabeculae, thinning of cortical bone, and perpendicular periosteal spiculation. Premature epiphyseal fusion (PEF) and extramedullary hematopoiesis (EH) are found, though more rarely. The incidence of PEF and EH in 64 patients affected by β-thalassemia is reported. The different incidence of such complications in thalassemia major and intermedia is reported, and a possible correlation with transfusion regimen is also considered. (orig.)

  11. Genetics Home Reference: beta thalassemia (United States)

    ... Facebook Twitter Home Health Conditions Beta thalassemia Beta thalassemia Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Beta thalassemia is a blood disorder that reduces the production ...

  12. Genetics Home Reference: alpha thalassemia (United States)

    ... Facebook Twitter Home Health Conditions Alpha thalassemia Alpha thalassemia Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Alpha thalassemia is a blood disorder that reduces the production ...

  13. β-Thalassemia intermedia: a comprehensive overview and novel approaches. (United States)

    Asadov, Chingiz; Alimirzoeva, Zohra; Mammadova, Tahira; Aliyeva, Gunay; Gafarova, Shahla; Mammadov, Jeyhun


    β-Thalassemia intermedia is a clinical condition of intermediate gravity between β-thalassemia minor, the asymptomatic carrier, and β-thalassemia major, the transfusion-dependent severe anemia. It is characterized by a significant clinical polymorphism, which is attributable to its genetic heterogeneity. Ineffective erythropoiesis, chronic anemia, and iron overload contribute to the clinical complications of thalassemia intermedia through stepwise pathophysiological mechanisms. These complications, including splenomegaly, extramedullary erythropoiesis, iron accumulation, leg ulcers, thrombophilia, and bone abnormalities can be managed via fetal hemoglobin induction, occasional transfusions, chelation, and in some cases, stem cell transplantation. Given its clinical diversity, thalassemia intermedia patients require tailored approaches to therapy. Here we present an overview and novel approaches to the genetic basis, pathophysiological mechanisms, clinical complications, and optimal management of thalassemia intermedia.

  14. The Correlation of Cardiac and Hepatic Hemosiderosis as Measured by T2*MRI Technique with Ferritin Levels and Hemochromatosis Gene Mutations in Iranian Patients with Beta Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Mohammad Soleiman Soltanpour


    Full Text Available Objectives: Organ-specific hemosiderosis and iron overload complications are more serious and more frequent in some patients with beta thalassemia major (BTM compared with others. We investigated whether coinheritance of HFE H63D or C282Y gene mutations in patients with BTM contributes to the phenotypic variation of iron overload complications and assessed the correlation of cardiac and hepatic hemosiderosis with plasma ferritin levels. Methods: We studied 60 patients with BTM with a mean age of 17.5±9.1 years from the Northwest of Iran. HFE gene mutations were analyzed using the polymerase chain reaction-restriction fragment length polymorphism method. Cardiac and hepatic hemosiderosis was assessed using T2*magnetic resonance imaging (MRI. Ferritin levels were measured using the enzyme immunoassay method. Results: Ferritin levels showed a strong inverse correlation with hepatic T2*MRI values (r = -0.631, p = 0.001 but a poor correlation with cardiac T2*MRI values (r = -0.297, p = 0.044. The correlation between cardiac T2*MRI values and hepatic T2*MRI values was poor and insignificant (r = 0.287, p = 0.058. Genotype and allele distribution of HFE H63D and C282Y mutation did not differ significantly between patients with and without hepatic or cardiac hemosiderosis (p > 0.050. However, carriers of HFE 63D allele had significantly higher ferritin levels compared with non-carriers (1 903±993 vs. 992±683, p < 0.001. Conclusions: Cardiac T2*MRI values showed a poor correlation with hepatic T2*MRI values and ferritin levels. Accurate assessment of cardiac iron overload in patients with BTM can only be done using the T2*MRI technique. Additionally, HFE H63D is a significant determinant factor for elevated ferritin levels in BTM patients.

  15. Role of vitamin C as an adjuvant therapy to different iron chelators in young β-thalassemia major patients: efficacy and safety in relation to tissue iron overload. (United States)

    Elalfy, Mohsen S; Saber, Maha M; Adly, Amira Abdel Moneam; Ismail, Eman A; Tarif, Mohamed; Ibrahim, Fatma; Elalfy, Omar M


    Vitamin C, as antioxidant, increases the efficacy of deferoxamine (DFO). To investigate the effects of vitamin C as an adjuvant therapy to the three used iron chelators in moderately iron-overloaded young vitamin C-deficient patients with β-thalassemia major (β-TM) in relation to tissue iron overload. This randomized prospective trial that included 180 β-TM vitamin C-deficient patients were equally divided into three groups (n = 60) and received DFO, deferiprone (DFP), and deferasirox (DFX). Patients in each group were further randomized either to receive vitamin C supplementation (100 mg daily) or not (n = 30). All patients received vitamin C (group A) or no vitamin C (group B) were followed up for 1 yr with assessment of transfusion index, hemoglobin, iron profile, liver iron concentration (LIC) and cardiac magnetic resonance imaging (MRI) T2*. Baseline vitamin C was negatively correlated with transfusion index, serum ferritin (SF), and LIC. After vitamin C therapy, transfusion index, serum iron, SF, transferrin saturation (Tsat), and LIC were significantly decreased in group A patients, while hemoglobin and cardiac MRI T2* were elevated compared with baseline levels or those in group B without vitamin C. The same improvement was found among DFO-treated patients post-vitamin C compared with baseline data. DFO-treated patients had the highest hemoglobin with the lowest iron, SF, and Tsat compared with DFP or DFX subgroups. Vitamin C as an adjuvant therapy possibly potentiates the efficacy of DFO more than DFP and DFX in reducing iron burden in the moderately iron-overloaded vitamin C-deficient patients with β-TM, with no adverse events. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Pulmonary hypertension associated with thalassemia syndromes (United States)

    Fraidenburg, Dustin R.; Machado, Roberto F.


    Chronic hemolytic anemia has increasingly been identified as an important risk factor for the development of pulmonary hypertension. Within the thalassemia syndromes, there are multiple mechanisms, both distinct and overlapping, by which pulmonary hypertension develops and that differ among β-thalassemia major or intermedia patients. Pulmonary hypertension in β-thalassemia major correlates with the severity of hemolysis, yet in patients whose disease is well treated with chronic transfusion therapy, the development of pulmonary hypertension can be related to cardiac dysfunction and the subsequent toxic effects of iron overload rather than hemolysis. β-thalassemia intermedia, on the other hand, has a higher incidence of pulmonary hypertension owing to the low level of hemolysis that exists over years without the requirement for frequent transfusions, while splenectomy is shown to play an important role in both types. Standard therapies such as chronic transfusion have been shown to mitigate pulmonary hypertension, and appropriate chelation therapy can avoid the toxic effects of iron overload, yet is not indicated in many patients. Limited evidence exists for the use of pulmonary vasodilators or other therapies, such as l-carnitine, to treat pulmonary hypertension associated with thalassemia. Here we review the most recent findings regarding the pathogenic mechanisms, epidemiology, presentation, diagnosis, and treatment of pulmonary hypertension in thalassemia syndromes. PMID:27008311

  17. Coexistence of Malaria and Thalassemia in Malaria Endemic Areas of Thailand (United States)

    Kuesap, Jiraporn; Chaijaroenkul, W.; Rungsihirunrat, K.; Pongjantharasatien, K.; Na-Bangchang, Kesara


    Hemoglobinopathy and malaria are commonly found worldwide particularly in malaria endemic areas. Thalassemia, the alteration of globin chain synthesis, has been reported to confer resistance against malaria. The prevalence of thalassemia was investigated in 101 malaria patients with Plasmodium falciparum and Plasmodium vivax along the Thai-Myanmar border to examine protective effect of thalassemia against severe malaria. Hemoglobin typing was performed using low pressure liquid chromatography (LPLC) and α-thalassemia was confirmed by multiplex PCR. Five types of thalassemia were observed in malaria patients. The 2 major types of thalassemia were Hb E (18.8%) and α-thalassemia-2 (11.9%). There was no association between thalassemia hemoglobinopathy and malaria parasitemia, an indicator of malaria disease severity. Thalassemia had no significant association with P. vivax infection, but the parasitemia in patients with coexistence of P. vivax and thalassemia was about 2-3 times lower than those with coexistence of P. falciparum and thalassemia and malaria without thalassemia. Furthermore, the parasitemia of P. vivax in patients with coexistence of Hb E showed lower value than coexistence with other types of thalassemia and malaria without coexistence. Parasitemia, hemoglobin, and hematocrit values in patients with coexistence of thalassemia other than Hb E were significantly lower than those without coexistence of thalassemia. Furthermore, parasitemia with coexistence of Hb E were 2 times lower than those with coexistence of thalassemia other than Hb E. In conclusion, the results may, at least in part, support the protective effect of thalassemia on the development of hyperparasitemia and severe anemia in malaria patients. PMID:26174819

  18. Diabetes mellitus complicating β-thalassemia: a case report

    African Journals Online (AJOL)

    A case of beta-thalassemia major complicated by diabetes mellitus in a Fiji national is presented. The mechanisms involved in the pathogenesis of this complication are highlighted. Keywords: β-thalassemia, diabetes mellitus, iron overload. Annals of African Medicine Vol.2(1) 2003: 36-38 ...

  19. β-Thalassemia Intermedia: A Bird’s-Eye View

    Directory of Open Access Journals (Sweden)

    Anthony Haddad


    Full Text Available Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum’s extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison

  20. β-Thalassemia Intermedia: A Bird’s-Eye View (United States)

    Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali


    Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum’s extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe

  1. β-Thalassemia Intermedia: A Bird's-Eye View. (United States)

    Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali


    Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum's extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe β-thalassemia

  2. Adipocytokine concentrations in children with different types of beta-thalassemia. (United States)

    Enli, Yaşar; Balci, Yasemin I; Gönen, Cafer; Uzun, Ebru; Polat, Aziz


    Beta-thalassemia is an inherited blood disorder. It results from the impaired production of β-globin chains, leading to a relative excess of alpha-globin chains. Clinical severity separates this disease into three main subtypes: β- thalassemia major, β-thalassemia intermedia and β-thalassemia minor, the former two being clinically more significant. Inflammatory processes may play an important role in some of the complications of thalassemia. Adipose tissue is one of the most important endocrine and secretory organs that release adipocytokines like adiponectin, resistin and visfatin. The aim of our study was to analyze adipocytokine concentrations (adiponectin, resistin and visfatin) in different types of β-thalassemia patients and determine any possible correlations with disease severity. We recruited 29 patients who were transfusion-dependent β-thalassemia-major patients, 17 patients with β-thalassemia intermedia, 30 β-thalassemia minor patients. The control group consisted of 30 healthy children. Anthropometric measurements, complete blood count, biochemical parameters, serum concentrations of adiponectin, resistin, visfatin were performed for all subjects. Resistin and visfatin concentrations were significantly higher in β-thalassemia minor patients than in controls. Adiponetin, resistin and visfatin concentrations were significantly higher in both β-thalassemia intermedia and major patients than in controls. The concentrations of adiponectin, resistin and visfatin were significantly higher in both β-thalassemia intermedia and major patients than in β-thalassemia minor patients. There was no significant difference between β-thalassemia intermedia and β-thalassemia major patients for adipocytokines concentrations. We speculate that these adipocytokines may play a role in the development of complications in β-thalassaemia.

  3. Beta thalassemia - a review

    Directory of Open Access Journals (Sweden)

    R Jha


    Full Text Available Thalassemia is a globin gene disorder that results in a diminished rate of synthesis of one or more of the globin chains. About 1.5% of the global population (80 to 90 million people are carriers of beta Thalassemia. More than 200 mutations are described in beta thalassemia. However not all mutations are common in different ethnic groups. The only effective way to reduce burden of thalassemia is to prevent birth of homozygotes. Diagnosis of beta thalassemia can be done by fetal DNA analysis for molecular defects of beta thalassemia or by fetal blood analysis. Hematopoietic stem cell transplantation is the only available curative approach for Thalassemia. Many patients with thalassemia in underdeveloped nations die in childhood or adolescence. Programs that provide acceptable care, including transfusion of safe blood and supportive therapy including chelation must be established.DOI: Journal of Pathology of Nepal; Vol.4,No. 8 (2014 663-671

  4. Simple and Easy to Perform Preimplantation Genetic Diagnosis for β-thalassemia Major Using Combination of Conventional and Fluorescent Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Rasoul Salehi


    Full Text Available Background: Thalassemias are the most common monogenic disorders in many countries throughout the world. The best practice to control the prevalence of the disease is prenatal diagnosis (PND services. Extensive practicing of PND proved effective in reducing new cases but on the other side of this success high abortion rate is hided, which ethically unfair and for many couples, especially with a previous experience of a therapeutic abortion, or moral concerns, is not a suitable choice. Preimplantation genetic diagnosis (PGD is a strong alternative to conventional PND. At present PGD is the only abortion free fetal diagnostic process. Considering the fact that there are more than 6000 single gene disorders affecting approximately 1 in 300 live-births, the medical need for PGD services is significant. Materials and Methods: In the present study development of a PGD protocol for a thalassemia trait couple using nested multiplex fluorescent polymerase chain reaction (PCR for the combination of polymorphic linked short tandem repeat (STR markers and thalassemia mutations is described. Restriction fragment length polymorphism used to discriminate between wild and mutated alleles. Results: In PGD clinical cycle, paternal and maternal alleles for D11S988 and D11S1338 STR markers were segregated as it was expected. PCR product for IVSII-1 mutation was subsequently digested with BtscI restriction enzyme to differentiate normal allele from the mutant allele. The mother's mutation, being a comparatively large deletion, was detectable through size differences on agarose gel. Conclusion: The optimized single cell protocol developed and evaluated in this study is a feasible approach for preimplantation diagnosis of β-thalassemia in our patients.

  5. Imaging features of thalassemia

    Energy Technology Data Exchange (ETDEWEB)

    Tunaci, M.; Tunaci, A.; Engin, G.; Oezkorkmaz, B.; Acunas, G.; Acunas, B. [Dept. of Radiology, Istanbul Univ. (Turkey); Dincol, G. [Dept. of Internal Medicine, Istanbul Univ. (Turkey)


    Thalassemia is a kind of chronic, inherited, microcytic anemia characterized by defective hemoglobin synthesis and ineffective erythropoiesis. In all thalassemias clinical features that result from anemia, transfusional, and absorptive iron overload are similar but vary in severity. The radiographic features of {beta}-thalassemia are due in large part to marrow hyperplasia. Markedly expanded marrow space lead to various skeletal manifestations including spine, skull, facial bones, and ribs. Extramedullary hematopoiesis (ExmH), hemosiderosis, and cholelithiasis are among the non-skeletal manifestations of thalassemia. The skeletal X-ray findings show characteristics of chronic overactivity of the marrow. In this article both skeletal and non-skeletal manifestations of thalassemia are discussed with an overview of X-ray findings, including MRI and CT findings. (orig.)

  6. Imaging features of thalassemia

    International Nuclear Information System (INIS)

    Tunaci, M.; Tunaci, A.; Engin, G.; Oezkorkmaz, B.; Acunas, G.; Acunas, B.; Dincol, G.


    Thalassemia is a kind of chronic, inherited, microcytic anemia characterized by defective hemoglobin synthesis and ineffective erythropoiesis. In all thalassemias clinical features that result from anemia, transfusional, and absorptive iron overload are similar but vary in severity. The radiographic features of β-thalassemia are due in large part to marrow hyperplasia. Markedly expanded marrow space lead to various skeletal manifestations including spine, skull, facial bones, and ribs. Extramedullary hematopoiesis (ExmH), hemosiderosis, and cholelithiasis are among the non-skeletal manifestations of thalassemia. The skeletal X-ray findings show characteristics of chronic overactivity of the marrow. In this article both skeletal and non-skeletal manifestations of thalassemia are discussed with an overview of X-ray findings, including MRI and CT findings. (orig.)

  7. Risk of Erectile Dysfunction in Transfusion-naive Thalassemia Men (United States)

    Chen, Yu-Guang; Lin, Te-Yu; Lin, Cheng-Li; Dai, Ming-Shen; Ho, Ching-Liang; Kao, Chia-Hung


    Abstract Based on the mechanism of pathophysiology, thalassemia major or transfusion-dependent thalassemia patients may have an increased risk of developing organic erectile dysfunction resulting from hypogonadism. However, there have been few studies investigating the association between erectile dysfunction and transfusion-naive thalassemia populations. We constructed a population-based cohort study to elucidate the association between transfusion-naive thalassemia populations and organic erectile dysfunction This nationwide population-based cohort study involved analyzing data from 1998 to 2010 obtained from the Taiwanese National Health Insurance Research Database, with a follow-up period extending to the end of 2011. We identified men with transfusion-naive thalassemia and selected a comparison cohort that was frequency-matched with these according to age, and year of diagnosis thalassemia at a ratio of 1 thalassemia man to 4 control men. We analyzed the risks for transfusion-naive thalassemia men and organic erectile dysfunction by using Cox proportional hazards regression models. In this study, 588 transfusion-naive thalassemia men and 2337 controls were included. Total 12 patients were identified within the thalassaemia group and 10 within the control group. The overall risks for developing organic erectile dysfunction were 4.56-fold in patients with transfusion-naive thalassemia men compared with the comparison cohort after we adjusted for age and comorbidities. Our long-term cohort study results showed that in transfusion-naive thalassemia men, there was a higher risk for the development of organic erectile dysfunction, particularly in those patients with comorbidities. PMID:25837766

  8. Serum zinc level in thalassemia

    International Nuclear Information System (INIS)

    Keikhaei, B.; Badavi, M.; Pedram, M.; Zandian, K.


    To compare serum zinc level between Thalassemia Major (TM) patients and normal population at Shafa Hospital in South West of Iran. A total of 25 male and 36 female of TM patients were enrolled in this study. Out of 61 patients thirty were treated by deferroxamine (DFO) and 31 were on the combination of DFO and deferiprone (DEF) protocol therapy. Sixty normal subjects of the matching age and gender were recruited as controls. From each patient and control group 2 ml of blood was taken in fasting condition. Cell blood count and serum zinc were carried out for both thalassemia patients and normal subjects. The mean age of patients and control group was 15+- 5 years. Mean serum zinc level was 68.97+- 21.12 mu g/dl, 78.10-28.50 mu g/dl, and 80.16+- 26.54 mu g/dl in the TM with DFO, TM with DFO + DEF combination protocol and control group respectively. There was no significant correlation between patients and control group. However 50 percent of TM with DFO, 38.7 percent of TM with DFO + DEF and 32.8 percent of control group had hypozincemia. Nearly 40 to 50 percent of TM patients and one third of normal subjects are suffering from hypozincemia. This study shows that low level of serum zinc is a health problem in both thalassemia patients and normal population in South West of Iran. (author)

  9. Laboratory investigation of hemoglobinopathies and thalassemias: review and update. (United States)

    Clarke, G M; Higgins, T N


    Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

  10. Frequency of Thalassemia in Iran and Khorasan Razavi

    Directory of Open Access Journals (Sweden)

    Gholam Hasan Khodaei


    Full Text Available Introduction: Beta-thalassemia is the most common hereditary disease in Iran. More than two million carriers of beta-thalassemia live in Iran. Since the Iranian population is a mixture of different ethnic groups, it is necessary to determine the frequency  in the different parts of the country. Materials and Methods: This descriptive study is a cross sectional study with helping by professional groups fighting diseases in Khorasan Razavi province.   Results: In Iran, according to World Health Organization, about 4 percent of the population, are carriers of the thalassemia gene. In other words, about 2-3 million people are suffering from thalassemia minor.Now, more than 18 thousand cases of thalassemia are scattered across the country in different provinces, are different. Mazandaran, Gilan, Hormozgan, Khuzestan, kohgiloyeh, Fars, Bushehr, Sistan and Baluchestan, Kerman and Isfahan, are 10 provinces with high prevalence in our country. We have 342 cases of thalassemia major in Khorasan Razavi province.   Conclusion: Prevalence  of thalassemia in our country is 3.6%  and Iran is located on the belt of thalassemia and due to a history of consanguinity, this disease has a prevalence of 0.6% among in the provinces of Khorasan Razavi.

  11. Thalassemia intermedia: An overview

    African Journals Online (AJOL)

    Rabah M. Shawky


    Apr 25, 2012 ... abnormalities occur due to massive expansion of erythroid bone marrow activity ..... [3] Savage D, Wood NAP, Bidwell JL, Fitches A, Old JM, Hui KM. Detection of b-thalassemia mutations using DNA heteroduplex generator ...

  12. Learning about Thalassemia (United States)

    Skip to main content Learning About Thalassemia Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

  13. β-Thalassemia Intermedia: A Clinical Perspective (United States)

    Musallam, Khaled M.; Taher, Ali T.; Rachmilewitz, Eliezer A.


    Our understanding of the molecular and pathophysiological mechanisms underlying the disease process in patients with β-thalassemia intermedia has substantially increased over the past decade. Earlier studies observed that patients with β-thalassemia intermedia experience a clinical-complications profile that is different from that in patients with β-thalassemia major. In this article, a variety of clinical morbidities are explored, and their associations with the underlying disease pathophysiology and risk factors are examined. These involve several organs and organ systems including the vasculature, heart, liver, endocrine glands, bone, and the extramedullary hematopoietic system. The effects of some therapeutic interventions on the development of clinical complications are also discussed. PMID:22762026

  14. [Current management of thalassemia intermedia]. (United States)

    Thuret, I


    Thalassemia intermedia is a clinical entity where anemia is mild or moderate, requiring no or occasional transfusion. Non-transfusion-dependent thalassemia encompasses 3 main clinical forms: beta-thalassemia intermedia, hemoglobin E/beta-thalassemia and alpha-thalassemia intermedia (HbH disease). Clinical severity of thalassemia intermedia increases with age, with more severe anemia and more frequent complications such as extramedullary hematopoiesis and iron overload mainly related to increased intestinal absorption. Numerous adverse events including pulmonary hypertension and hypercoagulability have been associated with splenectomy, often performed in thalassemia intermedia patients. The potential preventive benefit of transfusion and chelation therapies on the occurrence of numerous complications supports the strategy of an earlier therapeutic intervention. Increasing knowledge about pathophysiological mechanisms involved in thalassemia erythropoiesis and related iron overload is currently translating in novel therapeutic approaches. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  15. Insulin-like growth factor-1 levels in children with Beta-thalassemia minor


    Mehran Karimi; Hamdollah Karamifar; Nargrs Sobhani


    Objective: Growth retardation in children with b-thalassemia major is multifactorial. Some etiologies described for this condition are hemochromatosis, disturbed growth hormone (GH) / insulin growth factor-1 (IGF-1) axis, undernutrition and hypermetabolism. It has also been proven that growth retardation is present in b-thalassemia major children despite regular transfusion and chelation. Our aim was to evaluate the level of IGF-1 in b-thalassemia minor subjects and compare it with that in he...

  16. Iron chelation with deferasirox in adult and pediatric patients with thalassemia major: efficacy and safety during 5 years' follow-up. (United States)

    Cappellini, M Domenica; Bejaoui, Mohamed; Agaoglu, Leyla; Canatan, Duran; Capra, Marcello; Cohen, Alan; Drelichman, Guillermo; Economou, Marina; Fattoum, Slaheddine; Kattamis, Antonis; Kilinc, Yurdanur; Perrotta, Silverio; Piga, Antonio; Porter, John B; Griffel, Louis; Dong, Victor; Clark, Joan; Aydinok, Yesim


    Patients with β-thalassemia require lifelong iron chelation therapy from early childhood to prevent complications associated with transfusional iron overload. To evaluate long-term efficacy and safety of once-daily oral iron chelation with deferasirox, patients aged ≥ 2 years who completed a 1-year, phase 3, randomized trial entered a 4-year extension study, either continuing on deferasirox (deferasirox cohort) or switching from deferoxamine to deferasirox (crossover cohort). Of 555 patients who received ≥ 1 deferasirox dose, 66.8% completed the study; 43 patients (7.7%) discontinued because of adverse events. In patients with ≥ 4 years' deferasirox exposure who had liver biopsy, mean liver iron concentration significantly decreased by 7.8 ± 11.2 mg Fe/g dry weight (dw; n = 103; P < .001) and 3.1 ± 7.9 mg Fe/g dw (n = 68; P < .001) in the deferasirox and crossover cohorts, respectively. Median serum ferritin significantly decreased by 706 ng/mL (n = 196; P < .001) and 371 ng/mL (n = 147; P < .001), respectively, after ≥ 4 years' exposure. Investigator-assessed, drug-related adverse events, including increased blood creatinine (11.2%), abdominal pain (9.0%), and nausea (7.4%), were generally mild to moderate, transient, and reduced in frequency over time. No adverse effect was observed on pediatric growth or adolescent sexual development. This first prospective study of long-term deferasirox use in pediatric and adult patients with β-thalassemia suggests treatment for ≤ 5 years is generally well tolerated and effectively reduces iron burden. This trial was registered at as #NCT00171210.

  17. Xmni polymorphism and disease severity in patients with beta thalassemia from northern Pakistan

    International Nuclear Information System (INIS)

    Hanif, T.B.; Ahmed, S.; Anwar, J.


    Thalassemia is a heterogeneous disorder and several genetic factors influence the severity of thalassemia. An accurate and early diagnosis of a mild thalassemia genotype helps to avoid unnecessary transfusion and its complications. The aim of this study is to identify the association between XmnI polymorphism and disease severity in patients with ?-thalassemia from northern Pakistan. Methods: The cross sectional study was conducted at the Department of Haematology, Armed Forces Institute of Pathology (AFIP) Rawalpindi, from September 2006 to June 2009. A total of 90 subjects including 30 with thalassemia major, 30 with thalassemia intermedia and 30 normal individuals were studied. DNA from each subject was tested for 15 ?-thalassemia mutations and the presence of XmnI polymorphism using Amplification Refractory Mutation System and Restriction Fragment Length Polymorphism respectively. Results: One normal and one thalassemia major subject were found to be positive for homozygous and heterozygous XmnI polymorphism respectively. Among the thalassemia intermedia group, XmnI polymorphism was found in 12/30 patients, of whom 10 were homozygous and 2 were heterozygous for it. Conclusion: XmnI polymorphism is an important genotypic factor in Pakistani population for making a prospective diagnosis of thalassemia intermedia and predicting the severity of the disease. (author)

  18. Hepatitis G virus infection and genotypes in Iraqi thalassemia patients

    Directory of Open Access Journals (Sweden)

    Maryam S Ibrahim


    Conclusion: the prevalence rate of HGV RNA in β-thalassemia major patients is 18.2%, while the prevalence rate of anti-HGV (past infection is 10.4%. No one of thalassemia patients had HGV RNA and anti-HGV simultaneously. The Gene sequence analysis of PCR products identified HGV genotypes 2 and 5 with percentage of 91.7% and 8.3% respectively

  19. Insulin-like growth factor-1 levels in children with Beta-thalassemia minor

    Directory of Open Access Journals (Sweden)

    Mehran Karimi


    Full Text Available Objective: Growth retardation in children with b-thalassemia major is multifactorial. Some etiologies described for this condition are hemochromatosis, disturbed growth hormone (GH / insulin growth factor-1 (IGF-1 axis, undernutrition and hypermetabolism. It has also been proven that growth retardation is present in b-thalassemia major children despite regular transfusion and chelation. Our aim was to evaluate the level of IGF-1 in b-thalassemia minor subjects and compare it with that in healthy children. Material and Methods: Fifty children aged 6 months to 15 years with b-thalassemia minor (32 males, 18 females and 50 age- and sex-matched normal healthy children were selected. Medical history was taken and complete physical examination was done in each case; IGF-1 level was checked in all cases. This study was done in Shiraz, southern Iran, during 2005.Results: IGF-1 levels were significantly lower in b-thalassemia minor children than normal children (P = 0.015. This result demonstrates that some etiologies of growth failure in b-thalassemia major other than those described to date can exist, which may be shared with b-thalassemia minor in feature or may be transformed by genes that are either expressed or not.Conclusion: We conclude that in addition to that observed in b-thalassemia major, IGF-1 level is also decreased in b-thalassemia minor, and these two may have similar etiologies.

  20. Role of Three-Dimensional Speckle Tracking Echocardiography in the Quantification of Myocardial Iron Overload in Patients with Beta-Thalassemia Major. (United States)

    Li, Shu-Juan; Hwang, Yu-Yan; Ha, Shau-Yin; Chan, Godfrey C F; Mok, Amanda S P; Wong, Sophia J; Cheung, Yiu-Fai


    The new three-dimensional speckle tracking echocardiography (3DSTE) may enable comprehensive quantification of global left ventricular (LV) myocardial mechanics. Twenty-four patients aged 29.3 ± 5.2 years and 22 controls were studied. 3DSTE was performed to assess LV 3D global strain, twist and torsion, ejection fraction, and systolic dyssynchrony index (SDI). The LV SDI was calculated as % of SD of times-to-peak strain of 16 segments/RR interval. The global performance index (GPI) was calculated as (global 3D strain·torsion)/SDI. Area under the receiver operating characteristic curve (AUC) was calculated to determine the capability of 3DSTE parameters to discriminate between patients with (cardiac magnetic resonance T2* overload. Compared with controls, patients had significantly lower LV global 3D strain (P overload. The LV composite index of strain, torsion, and dyssynchrony derived from 3DSTE enables sensitive detection of myocardial iron overload in patients with thalassemia. © 2016, Wiley Periodicals, Inc.

  1. Marrow heterotopia in thalassemia

    Energy Technology Data Exchange (ETDEWEB)

    Papavasiliou, C.; Gouliamos, A.; Andreou, J.


    The subject of marrow heterotopia has been reviewed on the basis of 15 cases suffering from thalassemia. Other cases reported in the literature were also reviewed. Using conventional radiography, scintigraphy, computerized tomography and myelography, 17% of the cases admitted into the hospital with the diagnosis of Thalassemia, were found to have macroscopic masses of marrow heterotopia. The most common site of development of these masses was the costovertebral gutter, followed by the anterior end of the ribs and the extradural space of the spinal canal. In one case, masses were located in the maxillary antra. The clinical implications, the pathogenesis of the masses and the differential diagnosis from other tumour-like entities are discussed. Three patients presented with symptoms and signs of spinal cord compression. All three patients were treated satisfactorily with small doses of radiotherapy.

  2. A new alpha(0)-thalassemia deletion found in a Dutch family (--(AW)).

    NARCIS (Netherlands)

    Phylipsen, M.; Vogelaar, I.P.; Schaap, R.A.; Arkesteijn, S.G.; Boxma, G.L.; Helden, W.C. van; Wildschut, I.C.; Bruin-Roest, A.C. de; Giordano, P.C.; Harteveld, C.L.


    Alpha-thalassemia is an inherited hemoglobin disorder characterized by a microcytic hypochromic anemia caused by a quantitative reduction of the alpha-globin chain. The majority of the alpha-thalassemias is caused by deletions in the alpha-globin gene cluster. A deletion in the alpha-globin gene

  3. Molecular Diagnostics of ?-Thalassemia


    Atanasovska, B; Bozhinovski, G; Chakalova, L; Kocheva, S; Karanfilski, O; Plaseska-Karanfiska, D


    A high-quality hemoglobinopathy diagnosis is based on the results of a number of tests including assays for molecular identification of causative mutations. We describe the current diagnostic strategy for the identification of ?-thalassemias and hemoglobin (Hb) variants at the International Reference Laboratory for Haemoglobinopathies, Research Centre for Genetic Engineering and Biotechnology (RCGEB) ?Georgi D. Efremov,? Skopje, Republic of Macedonia. Our overall approach and most of the meth...

  4. Diagnosis of Compound Heterozygous Hb Tak/β-Thalassemia and HbD-Punjab/β-Thalassemia by HbA2 Levels on Capillary Electrophoresis. (United States)

    Panyasai, Sitthichai; Sakkhachornphop, Supachai; Pornprasert, Sakorn


    A misdiagnosis of β-thalassemia carrier in samples with Hb Tak and HbD-Punjab, the β-variants, can be a cause of inappropriate genetic counseling thus having a new case of β-thalassemia major. A capillary electrophoresis (CE) is very efficient in separating and quantifying HbA 2 . In this study, HbA 2 levels of samples which were doubted for compound heterozygous Hb Tak/β-thalassemia or heterozygous HbD-Punjab/β-thalassemia were measured and compared between CE and high performance liquid chromatography (HPLC). The molecular confirmation for Hb Tak, HbD-Punjab and β-thalassemia codons 17 (A > T), 41/42 (-TCTT), 71/72 (+A) and IVSI-nt1 (G > T) mutations and 3.4 kb deletion were also performed. Based on DNA analysis, 3 cases were diagnosed as compound heterozygous Hb Tak/β-thalassemia and one for HbD-Punjab/β-thalassemia. The elevated HbA 2 levels were found in all 4 samples with rages of 4.6-7.3% on CE while those were not found on HPLC. Thus, the elevated HbA 2 measured by CE can be used as a screening parameter for differentiating the homozygote of Hb Tak and HbD-Punjab from the compound heterozygote of these hemoglobinopathies and β-thalassemia.

  5. Oxidative stress and age-related changes in T cells: is thalassemia a model of accelerated immune system aging? (United States)

    Ghatreh-Samani, Mahdi; Esmaeili, Nafiseh; Soleimani, Masoud; Asadi-Samani, Majid; Ghatreh-Samani, Keihan; Shirzad, Hedayatolah


    Iron overload in β-thalassemia major occurs mainly due to blood transfusion, an essential treatment for β-thalassemia major patients, which results in oxidative stress. It has been thought that oxidative stress causes elevation of immune system senescent cells. Under this condition, cells normally enhance in aging, which is referred to as premature immunosenescence. Because there is no animal model for immunosenescence, most knowledge on the immunosenescence pattern is based on induction of immunosenescence. In this review, we describe iron overload and oxidative stress in β-thalassemia major patients and how they make these patients a suitable human model for immunosenescence. We also consider oxidative stress in some kinds of chronic virus infections, which induce changes in the immune system similar to β-thalassemia major. In conclusion, a therapeutic approach used to improve the immune system in such chronic virus diseases, may change the immunosenescence state and make life conditions better for β-thalassemia major patients.

  6. Mutation analysis of β-thalassemia in East-Western Indian population: a recent molecular approach

    Directory of Open Access Journals (Sweden)

    Shah PS


    Full Text Available Parth S Shah,1 Nidhi D Shah,2 Hari Shankar P Ray,3 Nikunj B Khatri,3 Ketan K Vaghasia,3 Rutvik J Raval,4 Sandip C Shah,3 Mandava V Rao5 1Department of Medicine, Lahey Hospital and Medical Center, Boston, MA, 2Department of Pediatrics, Nassau University Medical Centre, New York, NY, USA; 3Supratech Micropath Laboratory and Research Institute, 4Department of Zoology, 5School of Sciences, Gujarat University, Ahmedabad, Gujarat, India Background: β-Thalassemia is the most prevalent genetic disorder in India. Its traits and coinheritance vary from mild to severe conditions, resulting in thalassemia minor, intermediate, and major, depending upon many factors.Purpose: The objective of this study was to identify the incidence of β-thalassemia traits, their coinheritance, and mutations, as well as to support the patients already diagnosed with β-thalassemia in East-Western Indian population for better management.Patients and methods: Seventy-five referral cases for β-thalassemia were analyzed for various β-thalassemia traits, heterozygosity, and homozygosity conditions. Blood phenotypic parameters using cell counter and capillary electrophoresis were investigated. Analyses of eight common mutations of thalassemia in India were carried out using polymerase chain reaction-amplification refractory mutation system, end point polymerase chain reaction, and DNA sequencing methods.Results: Of these (75 referral cases from East-Western Indian region, 68 were positive for β-thalassemia (90.67%. The majority of case types were of β-thalassemia minor (49, 65.33%, followed by HbE traits (6, 8.0% and β-thalassemia major, including heterozygous and homozygous (5, 6.66%; 4, 5.33% types and then HbE homozygous (2, 2.66%, as well as one each of the HbE/β-thalassemia and HbD/β-thalassemia (1, 1.34% combination. Mutation analysis also revealed that the highest frequency of mutation was c.92+5G>C (41, 60.29% followed by deletion 619bp (9, 13.23% and c.79G>A (8, 11

  7. Evaluation of the glucocorticoid, mineralocorticoid, and adrenal androgen secretion dynamics in a large cohort of patients aged 6-18 years with transfusion-dependent β-thalassemia major, with an emphasis on the impact of cardiac iron load. (United States)

    Uçar, Ahmet; Öner, Nergiz; Özek, Gülcihan; Çetinçakmak, Mehmet Güli; Abuhandan, Mahmut; Yıldırım, Ali; Kaya, Cemil; Ünverdi, Sena; Emeksiz, Hamdi Cihan; Yılmaz, Yasin; Yetim, Aylin


    The variable presence of adrenal insufficiency (AI) due to hypocortisolemia (HC) in patients with thalassemia is well established; however, the prevalence of adrenocortical hypofunction (ACH) in the zona glomerulosa and zona reticularis of the adrenal cortex is unknown. To establish the prevalence of ACH, we examined the cortisol response to 1-µg and 250-µg ACTH tests, plasma aldosterone (A)/plasma renin activity (PRA) ratio, and serum dehydroepiandrosterone sulfate (DHEAS) levels in a large cohort of patients with thalassemia, and to investigate the impact of total body iron load (TBIL) on adrenocortical function. The setting used was University hospital and government-based tertiary care center. One hundred twenty-one (52 females) patients with β-thalassemia major (β-TM) and 72 healthy peers (38 females) were enrolled. The patients underwent a 250-µg cosyntropin test if their peak cortisol was <500 nmol/L in a 1-µg cosyntropin test. Magnetic resonance imaging (MRI) was performed to assess the MRI-based liver iron content and cardiac MRI T2* iron. The associations between ACH and TBIL were investigated. The patients with thalassemia had lower ACTH, cortisol, DHEAS, and A/PRA values compared with the controls (p < 0.001). Thirty-nine patients (32.2 %) had HC [primary (n = 1), central (n = 36), combined (n = 2)], and 47 (38.8 %) patients had reduced DHEAS levels; 29 (24.0 %) patients had reduced A/PRA ratios. Forty-six (38.0 %) patients had hypofunction in one of the adrenal zones, 26 (21.5 %) had hypofunction in two adrenal zones, and 9 (7.4 %) had hypofunction in all three zones. Patient age and TBIL surrogates were significant independent parameters associated with ACH. Cardiac MRI T2* iron was the only significant parameter that predicted the severity of ACH at a cut-off of 20.6 ms, with 81 % sensitivity and 78 % specificity. Patients with thalassemia have a high prevalence of AI due to HC and zona glomerulosa and zona reticularis

  8. Diabetes in Patients with ß-thalassemia or other Hemoglobinopathies - Analysis from the DPV Database. (United States)

    Warncke, K; Konrad, K; Kohne, E; Hammer, E; Ohlenschläger, U; Herrlinger, S; Jäger, A; Holl, R W


    Background: Diabetes mellitus is a common endocrinopathy in patients with thalassemia major, but the occurrence of hemoglobinopathies is rare in Germany and Western Europe. The longitudinal German-Austrian DPV (Diabetes Patienten Verlaufsdokumentation) registry allows a comprehensive characterization of this group of patients. Patients/methods: Patients from the DPV-registry agedthalassemia major or other hemoglobinopathies were compared to patients with type 1 diabetes (T1D) and type 2 diabetes (T2D) using the statistical software SAS 9.4. Results: 94 patients (0.13% of patients) with hemoglobinopathies are registered in DPV. 82.4% of 17 patients with thalassemia major, 100% of 12 patients with sickle cell disease (SCD) and >90% of 65 patients with other hemoglobinopathies receive insulin treatment. In the majority of patients with thalassemia major, hemosiderosis is documented. Patients with thalassemia major developed diabetes at a median age of 14.6 [IQR 8.4-18.0] years (9.0 years [5.3-12.5] in T1D; 18.7 years [14.2-25.6] in TD2; both pthalassemia major is probably caused by hemosiderosis due to polytransfusion, while patients with SCD/thalassemia minor are most likely affected by T1D. The high rate of hypoglycemia in patients with ß-thalassemia major may be caused by liver fibrosis and a lack of hepatic glycogen stores. © Georg Thieme Verlag KG Stuttgart · New York.

  9. A new tool for the assessment of satisfaction with iron chelation therapy (ICT-Sat) for patients with β-thalassemia major. (United States)

    Elalfy, Mohsen S; Massoud, Walid; Elsherif, Nayera H; Labib, Jonair H; Elalfy, Omar M; Elaasar, Safaa; von Mackensen, Sylvia


    High satisfaction with iron chelation is a major determinant for adherence to ICT in beta-thalassaemia major (β-TM) patients. In this study, a new tool to assess different domains of satisfaction for available forms of ICT was developed and validated. The impact of patients' satisfaction with ICT has been tested. Items were generated via focus groups and a preliminary version with 24 items (ICT-Sat) with an additional item for treatment preference and a knowledge questionnaire (KQ) was developed. 170 β-TM patients from three Thalassaemia centers in Egypt, aged 2-32 years received three questionnaires to fill in; the new ICT-Sat, a KQ, and a previously validated tool for satisfaction with ICT (SICT) and retested 4-6 weeks later to ensure re-test reliability. Type of chelation, drug related adverse events, compliance with ICT, and serum ferritin level (SF) during the year prior to the study as well as available cardiac T2*data were recorded. One hundred and fifty two β-TM patients completed all questionnaires; median age was 12 years. The final 15 remaining ICT-Sat items, yielding to four domain scores, explained 70.6% of the total variance. The "perceived effectiveness" and "fear and worries" domains of the ICT-Sat correlated significantly with the domains "perceived effectiveness" and "acceptance" of the SICT. Patients treated with oral ICT were more satisfied with perceived effectiveness, and their side effects. A new clinically based ICT-Sat tool was developed and revealed good psychometric characteristics. Adherence to ICT was better correlated with "perceived effectiveness" and SF level. Copyright © 2012 Wiley Periodicals, Inc.

  10. Psychopathological tendencies and quality of life among patients with thalassemia

    International Nuclear Information System (INIS)

    Anwar, K.; Waqar, S.


    To explore the relationship between psychopathological tendencies and Quality of Life (QoL) among patients with Thalassemia major. Methodology: In this correlational study, data were collected from the blood transfusion dependent patients of beta-thalassemia major in Rawalpindi and Islamabad hospitals from September to December 2014. Urdu version of Worlds Health Organization Quality of Life Scale-BREF (WHOQOL-BREF) and Brief Symptom Inventory (BSI) methods were administered on 74 patients of thalassemia major. Pearson Product Correlation, Independent Sample t-test, One-way ANOVA and Post Hoc analysis were used. Results: There was higher levels of somatization, hostility and obsessive compulsive (OC) and lower levels of psychoticism. There was negatively affected social and psychological domains of life while comparatively better QoL related to environmental conditions of the patients. There was negative relationship between psychopathological tendencies and QoL among patients. Moreover, mother's education level negatively related with psychopathological tendencies among patients. Males scored high on depression and interpersonal sensitivity, whereas females scored high on anxiety, paranoid ideation and somatization. Female patients experienced better QoL as compared to male counterparts. Conclusion: There were higher degrees of psychopathological tendencies among patients with thalassemia major which affected their QoL mainly on social and psychological domains. (author)


    Directory of Open Access Journals (Sweden)

    Vincenzo De Sanctis


    Full Text Available Objective: This cross-sectional study was designed to give insights into relationship between Insulin-Growth-Factor 1 (IGF-1 levels and diabetic retinopathy (DR in a sample of  thalassaemia major(TM patients with insulin dependent diabetes mellitus (IDDM. Τhis relation was not previously evaluated, despite the fact that both diseases co-exist  in the same patient. The  study   also  describes the clinical and biochemical profile of the associated complications in TM patients with and without IDDM.    Design: A population-based cross-sectional study.   Participants:The study  includes 19 consecutive TM patients with IDDM and 31 age- and sex-matched TM patients without  IDDM who visited our out-patient clinics for an endocrine assessment   Methods: An extensive medical history, with data on associated complications and current medications, was obtained. Blood samples were drawn in the morning after an overnight fast to measure the serum concentrations of IGF-1, glucose, fructosamine , free thyroxine (FT4, thyrotropin (TSH and biochemical analysis . Serologic screening assays for hepatitis C virus seropositivity (HCVab and HCV-RNA were also evaluated,  applying routine laboratory methods.Plasma total IGF-1 was measured by a chemiluminescent immunometric assay (CLIA method. Ophthalmology evaluation was done by the same researcher using stereoscopic fundus biomicroscopy through dilated pupils. DR was graded using the scale developed by the Global Diabetic Retinopathy Group. Iron stores were assessed by direct and indirect methods.   Results:Eighteen TM patients with IDDM (94.7 % and 10 non-diabetic patients (32.2 % had IGF-1 levels below the 2.5th percentile of the normal values for the Italian population. The mean serum IGF-1 concentrations were significantly lower in the diabetic versus the non-diabetic TM groups (p < 0.001. DR was present in in 4 (21 % of 19 TM patients with IDDM and was associated with the main classical risk

  12. [Clinical analysis of three cases with beta-thalassemia]. (United States)

    Li, X Y; Liu, M J; Xu, L H; Xu, H G; Chen, H L; Fang, J P


    Objective: To study the diagnostic strategy of β-thalassemia through retrospective analysis of 3 cases of β-thalassemia. Methods: Three patients were admitted to the Department of Pediatrics, Sun Yat-sen Memorial Hospital of Sun Yat-sen University from January 2014 to June 2015. The clinical manifestations, hemoglobin electrophoresis and gene detection of these patients and their parents were analyzed, diagnostic ideas and key points were discussed when beta thalassemia gene detection did not explain clinical manifestations or hemoglobin electrophoresis. Results: Case 1, boy, 5 years old, was diagnosed as compound heterozygotes of β41-42 and IVS-Ⅱ-654 with hereditary persistence of fetal hemoglobin(HPFH) according to the clinical manifestations of mild anemia, normal size of liver and spleen, 92.8% fetal hemoglobin (HbF) and gene analysis. Case 2, girl, 3 years old, was confirmed the diagnosis of thalassemia intermedia with β41-42 heterozygote compound and ααα anti3.7 heterozygote in accordance with the manifestations of severe anemia, hepatosplenomegaly, 8.6% HbF, 4.1% hemoglobin A 2 (HbA 2 ) and gene analysis. Case 3, girl, 3 years old, with severe anemia, hepatosplenomegaly, 51.2% HbF and 3.7% HbA 2 , was diagnosed as thalassemia major with compound heterozygotes of PolyA (T→C) and β17 by DNA sequencing. Conclusion: The diagnosis of β-thalassemia should be confirmed by clinical manifestations of hemolytic anemia, hemoglobin electrophoresis, gene diagnosis and family survey.

  13. Thalassemia in the United Arab Emirates: Why it can be prevented but not eradicated.

    Directory of Open Access Journals (Sweden)

    Sehjeong Kim

    Full Text Available Thalassemia is a genetic blood disorder that causes abnormal hemoglobin. Hemoglobin is a protein in red blood cells that carries oxygen and is made of two proteins from four α-globin genes and two β-globin genes. A defect in one or more of these genes causes thalassemia. The treatment of thalassemia mostly depends on life-long blood transfusions and removal of excessive iron from the blood stream. Such tremendous blood consumption puts pressure on the national blood stock in many countries. In particular, in the United Arab Emirates (UAE, various forms of thalassemia prevention have been used and hence, the substantial reduction of the thalassemia major population has been achieved. However, the thalassemia carrier population still remains high, which leads to the potential increase in the thalassemia major population through carrier-carrier marriages. In this work, we investigate the long-term impact and efficacy of thalassemia prevention measures via mathematical modeling at a population level. To our best knowledge, this type of assessment has not been done before and there is no mathematical model that has investigated such a problem for thalassemia or any blood disorders at a population level. By using UAE data, we perform numerical simulations of our model and conduct sensitivity analysis of parameter values to see which parameter values affect most the dynamics of our model. We discover that the prevention measures can contribute to reduce the prevalence of the disease only in the short term but not eradicate the disease in the long term.

  14. Transfusion regimens in thalassemia intermedia

    Directory of Open Access Journals (Sweden)

    Z. Karakas


    Full Text Available Thalassemia intermedia (TI is a heterogeneous disease, in terms of both clinical manifestations and underlying molecular defects. Some TI patients are asymptomatic until adult life, whereas others are symptomatic from early childhood. In contrast with patients with Thalassemia major (TM, the severity of anemia is less and the patients do not require transfusions during at least the first few years of life. Many patients with TI, especially older ones, have been exposed to the multiple long-term effects of chronic anemia and tissue hypoxia and their compensatory reactions, including enhanced erythropoiesis and increased iron absorption. Bone marrow expansion and extramedullary hematopoiesis lead to bone deformities and liver and spleen enlargement. Therapeutic strategies in TI are not clear and different criteria are used to decide the initiation of transfusion and chelation therapy, modulation of fetal hemoglobin production, and hematopoietic stem cell transplantation on an individual basis. The clinical picture of well-treated TM patients with regular transfusionchelation therapy is better from TI patients who have not received adequate transfusion therapy. There is a significant role of early blood transfusion to prevent and treat complications commonly associated with TI, such as extramedullary erythropoiesis and bone deformities, autoimmune hemolytic anemia, leg ulcers, gallstones, pseudoxantoma elasticum, hyperuricosuria, gout and pulmonary hypertension, which are rarely seen in thalassemia major. Nowadays, indications of transfusion in patients with TI are chronic anemia (Hb < 7 g/dL, bone deformities, growth failure, extramedullary erythropoiesis, heart failure, pregnancy and preparation for surgical procedures. Conclusion: Adequate (regular or tailored transfusion therapy is an important treatment modality for increasing the quality of life in patients with thalassemia intermedia during childhood. 就临床表象和潜在的分子缺

  15. Mutation analysis of β-thalassemia in East-Western Indian population: a recent molecular approach (United States)

    Shah, Parth S; Shah, Nidhi D; Ray, Hari Shankar P; Khatri, Nikunj B; Vaghasia, Ketan K; Raval, Rutvik J; Shah, Sandip C; Rao, Mandava V


    Background β-Thalassemia is the most prevalent genetic disorder in India. Its traits and coinheritance vary from mild to severe conditions, resulting in thalassemia minor, intermediate, and major, depending upon many factors. Purpose The objective of this study was to identify the incidence of β-thalassemia traits, their coinheritance, and mutations, as well as to support the patients already diagnosed with β-thalassemia in East-Western Indian population for better management. Patients and methods Seventy-five referral cases for β-thalassemia were analyzed for various β-thalassemia traits, heterozygosity, and homozygosity conditions. Blood phenotypic parameters using cell counter and capillary electrophoresis were investigated. Analyses of eight common mutations of thalassemia in India were carried out using polymerase chain reaction-amplification refractory mutation system, end point polymerase chain reaction, and DNA sequencing methods. Results Of these (75) referral cases from East-Western Indian region, 68 were positive for β-thalassemia (90.67%). The majority of case types were of β-thalassemia minor (49, 65.33%), followed by HbE traits (6, 8.0%) and β-thalassemia major, including heterozygous and homozygous (5, 6.66%; 4, 5.33%) types and then HbE homozygous (2, 2.66%), as well as one each of the HbE/β-thalassemia and HbD/β-thalassemia (1, 1.34%) combination. Mutation analysis also revealed that the highest frequency of mutation was c.92+5G>C (41, 60.29%) followed by deletion 619bp (9, 13.23%) and c.79G>A (8, 11.76%) in our study group. Five cases (nos. 24, 27, 33, 58, and 71) exhibited coinheritance between β0/β+ (2), β0/β D (1), and c.124_127delTTCT/β+ or β0(2) affecting the Rajasthani and Gujarati populations in our study of the Western region of India. Conclusion We strongly recommend these Western populations for genetic screening before adopting reproductive technologies and interracial marital relations. PMID:28546763

  16. Hydroxyurea for hemoglobin E/β-thalassemia: a systematic review and meta-analysis. (United States)

    Algiraigri, Ali H; Kassam, Aliya


    Hemoglobin E-beta thalassemia (Hb E/β-thalassemia) is a distinct, yet common, type of β-thalassemia, in which the patient co-inherits a β-thalassemia allele from one parent, and a structural variant, Hb E, from the other parent. This co-inheritance leads to remarkable clinical heterogeneity, varying degrees of chronic anemia, and a wide spectrum of complications due to ineffective erythropoiesis and iron overload. Hydroxyurea (HU), an oral chemotherapeutic drug, is expected to decrease disease severity. To assess the clinical efficacy and safety of HU in Hb E/β-thalassemia patients. We searched MEDLINE, EMBASE, Cochrane databases, and major preceding conferences for studies that assessed HU in Hb E/β-thalassemias patients. The effect size was estimated as a proportion (responder/sample size). Qualities of eligible studies were assessed using NIH tools. A total of five [one randomized clinical trial (RCT) and four observational] studies involving 106 patients were included. HU was associated with a significant RR of 46% with no statistical heterogeneity. No serious adverse effects were reported. Patients with Hb E/β-thalassemia may benefit from a trial of HU, though large RCTs assessing efficacy should be conducted to confirm the findings of this meta-analysis and to assess long-term toxicity and response sustainability.

  17. Relationship between Personality Traits and Happiness in Patients with Thalassemia

    Directory of Open Access Journals (Sweden)

    Babollah Bakhshipour


    Full Text Available Background: The aim of this study was determining the relationship between personality traits and happiness in patients with major thalassemia. Materials and Methods: The design of this study was descriptive (correlational study. The target population of this study was all under-treated patients with major thalassemia in Amirkola thalassemia center in 2011. Among these patients, 150 patients were sampled using simple random sampling method and Morgan's table. The data were analyzed by means of calculating Pearson correlation coefficients and multiple linear regression analysis. The patients were asked to complete NEO-five factor Inventory (short form and Oxford happiness inventory. Results: Based on the results, the coefficient of regression analysis of NEO personality factors (big five and happiness was 0.45, which shows a linear relationship between personality factors of NEO and happiness in patients with thalassemia. Thus, there is a statistically significant relationship among personality traits (neuroticism, extroversion, openness, agreeableness, conscientiousness and happiness. Conclusion: Among personality traits, extroversion, flexibility, agreeableness and conscientiousness had positive statistically meaningful relationship with happiness i.e. patients with lower scores in neuroticism, were happier.

  18. Risk of erectile dysfunction in transfusion-naive thalassemia men: a nationwide population-based retrospective cohort study. (United States)

    Chen, Yu-Guang; Lin, Te-Yu; Lin, Cheng-Li; Dai, Ming-Shen; Ho, Ching-Liang; Kao, Chia-Hung


    Based on the mechanism of pathophysiology, thalassemia major or transfusion-dependent thalassemia patients may have an increased risk of developing organic erectile dysfunction resulting from hypogonadism. However, there have been few studies investigating the association between erectile dysfunction and transfusion-naive thalassemia populations. We constructed a population-based cohort study to elucidate the association between transfusion-naive thalassemia populations and organic erectile dysfunction. This nationwide population-based cohort study involved analyzing data from 1998 to 2010 obtained from the Taiwanese National Health Insurance Research Database, with a follow-up period extending to the end of 2011. We identified men with transfusion-naive thalassemia and selected a comparison cohort that was frequency-matched with these according to age, and year of diagnosis thalassemia at a ratio of 1 thalassemia man to 4 control men. We analyzed the risks for transfusion-naive thalassemia men and organic erectile dysfunction by using Cox proportional hazards regression models. In this study, 588 transfusion-naive thalassemia men and 2337 controls were included. Total 12 patients were identified within the thalassaemia group and 10 within the control group. The overall risks for developing organic erectile dysfunction were 4.56-fold in patients with transfusion-naive thalassemia men compared with the comparison cohort after we adjusted for age and comorbidities. Our long-term cohort study results showed that in transfusion-naive thalassemia men, there was a higher risk for the development of organic erectile dysfunction, particularly in those patients with comorbidities.

  19. Bone marrow transplantation in patients with Thalassemia

    Directory of Open Access Journals (Sweden)

    Ghavamzadeh A


    Full Text Available During April, 1991 and September, 1993, eighteen patients with major thalassemia admitted to Shariati BMT center. Seventeen patients were transplanted were from HLA identical siblings and one from. his HLA identical father. Eleven of the donors were the known cases of minor thalassemia. The range of patients' age was within 3-10 years (with the average of 5 years and 11 months. Among them, seven patients were male and eleven were female. As the other international BMT centers, we classified our patients into three classes. Our criteria for this classification were hepatomegaly, ferretin, and liver fibrous; 60% of our patients were put in class I and 40% in class II. All of our patients revealed a GVHD (severe graft vs. host disease three weeks post-BMT as pruritus, diarrhea, and skin erythema especially in hands and feet. Two of the patients showed severe GVHD. One of the patients had chimerism after BMT. Although one year after BMT has passed, the patients is still depended on blood transfusion. One patient, despite graft rejection, died nine months post-BMT; another one died after +70 due to GVHD. During 2.5 years, the overall graft survival rate was 88% in our center

  20. Guidelines for the Standard Monitoring of Patients With Thalassemia: Report of the Thalassemia Longitudinal Cohort. (United States)

    Tubman, Venée N; Fung, Ellen B; Vogiatzi, Maria; Thompson, Alexis A; Rogers, Zora R; Neufeld, Ellis J; Kwiatkowski, Janet L


    Chronic transfusion therapy has played a central role in extending life expectancy for patients with hemoglobinopathies such as thalassemia. However, this life-saving therapy is associated with numerous complications that now comprise the bulk of management considerations for patients with thalassemia. This review reports on the experience of the Thalassemia Longitudinal Cohort and reviews available literature to establish guidelines for the management of patients with thalassemia.

  1. Thalassemia and Hemoglobin E in Southern Thai Blood Donors

    Directory of Open Access Journals (Sweden)

    Manit Nuinoon


    Full Text Available Thalassemia and hemoglobin E (Hb E are common in Thailand. Individuals with thalassemia trait usually have a normal hemoglobin concentration or mild anemia. Therefore, thalassemic individuals who have minimum acceptable Hb level may be accepted as blood donors. This study was aimed at determining the frequency of α-thalassemia 1 trait, β-thalassemia trait, and Hb E-related syndromes in Southern Thai blood donors. One hundred and sixteen voluntary blood donors, Southern Thailand origin, were recruited for thalassemia and Hb E screening by red blood cell indices/dichlorophenolindophenol precipitation test. β-Thalassemia and Hb E were then identified by high performance liquid chromatography and 4 common α-thalassemia deletions were characterized by a single tube-multiplex gap-polymerase chain reaction. Overall frequency of hemoglobinopathies was 12.9%, classified as follows: homozygous α-thalassemia 2 (1.7%, heterozygous α-thalassemia 1 (1.7%, heterozygous β-thalassemia without α-thalassemia (0.9%, heterozygous Hb E without α-thalassemia (5.2%, double heterozygotes for Hb E/α-thalassemia 1 (1.7%, homozygous Hb E without α-thalassemia (0.9%, and homozygous Hb E with heterozygous α-thalassemia 2 (0.9%. The usefulness of thalassemia screening is not only for receiving highly effective red blood cells in the recipients but also for encouraging the control and prevention program of thalassemia in blood donors.

  2. Thalassemia and Hemoglobin E in Southern Thai Blood Donors (United States)

    Kruachan, Kwanta; Sengking, Warachaya; Horpet, Dararat; Sungyuan, Ubol


    Thalassemia and hemoglobin E (Hb E) are common in Thailand. Individuals with thalassemia trait usually have a normal hemoglobin concentration or mild anemia. Therefore, thalassemic individuals who have minimum acceptable Hb level may be accepted as blood donors. This study was aimed at determining the frequency of α-thalassemia 1 trait, β-thalassemia trait, and Hb E-related syndromes in Southern Thai blood donors. One hundred and sixteen voluntary blood donors, Southern Thailand origin, were recruited for thalassemia and Hb E screening by red blood cell indices/dichlorophenolindophenol precipitation test. β-Thalassemia and Hb E were then identified by high performance liquid chromatography and 4 common α-thalassemia deletions were characterized by a single tube-multiplex gap-polymerase chain reaction. Overall frequency of hemoglobinopathies was 12.9%, classified as follows: homozygous α-thalassemia 2 (1.7%), heterozygous α-thalassemia 1 (1.7%), heterozygous β-thalassemia without α-thalassemia (0.9%), heterozygous Hb E without α-thalassemia (5.2%), double heterozygotes for Hb E/α-thalassemia 1 (1.7%), homozygous Hb E without α-thalassemia (0.9%), and homozygous Hb E with heterozygous α-thalassemia 2 (0.9%). The usefulness of thalassemia screening is not only for receiving highly effective red blood cells in the recipients but also for encouraging the control and prevention program of thalassemia in blood donors. PMID:25050123

  3. Renal tubular dysfunction nephrocalcinosis in a patient with BetaThalassemia Minor

    International Nuclear Information System (INIS)

    Prabahar, M.R.; Jain, M.; Chandrasekaran, V.; Indumathi, E.; Soundrarajan, P.


    Thalassemia is a hereditary anemia resulting from defect in hemoglobinproduction. Beta thalassemia is due to impaired production. Beta thalassemiais due to impaired production of beta globin chains, leading to a relativeexcess of alpha globin chains. The term beta thalassemia minor is used todescribe heterozygotes, who carry one normal beta globin and one betathalassemic allele. The vast majority of these patients are asymptomatic.However, a variety of renal tubular abnormalities including hypercaliuria,hypomagnesemia with renal magnesium wasting, decreased tubular absorption ofphosphorous, hypouricemia with renal uric acid wasting, renal glycosuria andtubular proteinuria have been described even in patients with betathalassemia minor. We here in report a 24-year old patient who was found tohave thalassemia minor and nephrocalcinosis with evidence of renal tubulardysfunction. Investigations revealed normal renal function, hypercalciuria,reduced tubular reabsorption of phosphorous, hypomagnesemia and renalmagnesium wasting. Screening for aminoaciduria was found to be negative. Anacid loading test revealed normal urinary acidification. Ultrasonogram of theabdomen revealed nephrocalcinosis and splenomegaly. Detailed work up foranemia showed normal white cell and platelet count while peripheral smearshowed microcytic hypochromic anemia with few target cells. Hemoglobinelectrophoresis revealed hemoglobin A of 92%, hemoglobin A2 of 6.2% andhemoglobin F of 1.8% consistent with beta thalassemia minor. Her parentalscreening was normal. A diagnosis of beta thalassemia minor with renaltubular dysfunction was made and the patient was started on thiazidediuretics to reduce hypercalciuria and advised regular follow-up. (author)


    Directory of Open Access Journals (Sweden)

    Anita Nadkarni


    Full Text Available The clinical presentation of   b-thalassemia intermedia phenotypes are influenced by many factors .The persistence of fetal hemoglobin and  several polymorphisms located in the promoters of  g- and b-globin genes are some of them .The aim of this study was to evaluate the combined effect of  the -158Gg (CàT polymorphism and of the (ATx(Ty configuration, as well as their eventual association with elevated levels of HbF  in  b-thalassemia carriers, b-thalassemia Intermedia , b-thalassemia major and normal controls of Indian origin. The -158 Gg T allele was found to be associated with increased levels of HbF in b-thalassemia carriers, and not in wild-type subjects. In the homozygous group the -158 Gg T allele was significantly higher in the thalassemia intermedia group (66% as against the thalassemia major group (21%. The (AT9(T5 allele did not show any association with raised HbF levels. However 24% of milder cases showed presence of this allele. This study suggests that two regions of the b globin cluster, whether in cis or in trans to each other, can interact to enhance HbF expression when a b thalassemic determinant is present in heterozigosity and help in amelioration of the severity of the disease in homozygotes.

  5. The marrow heterotopia in thalassemia

    International Nuclear Information System (INIS)

    Papavasiliou, C.; Gouliamos, A.; Andreou, J.


    The subject of marrow heterotopia has been reviewed on the basis of 15 cases suffering from thalassemia. Other cases reported in the literature were also reviewed. Using conventional radiography, scintigraphy, computerized tomography and myelography, 17% of the cases admitted into the hospital with the diagnosis of Thalassemia, were found to have macroscopic masses of marrow heterotopia. The most common site of development of these masses was the costovertebral gutter, followed by the anterior end of the ribs and the extradural space of the spinal canal. In one case, masses were located in the maxillary antra. The clinical implications, the pathogenesis of the masses and the differential diagnosis from other tumour-like entities are discussed. Three patients presented with symptoms and signs of spinal cord compression. All three patients were treated satisfactorily with small doses of radiotherapy. (orig.)

  6. Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study


    Selma Ünal; Günay Balta; Fatma Gümrük


    Objective: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. Materials and Methods: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6?6.1 years, range: 3-30 years) with beta-thalassemia major (BTM) and 13 beta-thalassemia intermedia (BTI) patients (6 males and 7 females; ...

  7. Pain in thalassemia - an emerging complication

    Directory of Open Access Journals (Sweden)

    P.J. Giardina


    Full Text Available Many thalassemia subjects both transfused Major (TM and nontransfused Intermedia (TI suffer from longstanding bone disease, reduced or low bone mass (osteopenia or osteoporosis, fractures and bone pain. Unexpected musculoskeletal disease occurs despite longstanding hypertransfusion and new iron chelation strategies. Conditions which have been implicated in its pathogenesis include the massive ineffective erythropoiesis, chronic hypoxia associated with anemia, the local metabolic dysfunction from hemochromatosis, iron chelation toxicity, trace mineral deficiencies such as zinc deficiency, low vitamin D concentrations, the effect of endocrine dysfunction such as hypoparathyroidism, hypogonadism and growth hormone deficiency from hemochromatosis and the chronic inflammatory state induced by iron excess. The pathogenesis of bone disease has been attributed to the underlying marrow expansion of medullary bone caused by the massive ineffective erythropoiesis and subsequent cortical thinning. The process of normal bone health is maintained by a metabolic interplay of several hormonal factors including growth hormone, estrogen, testosterone, parathyroid hormone all of which can be diminished by iron overload in Thalassemia. Trace metals and vitamins including calcium, copper, zinc or vitamin C can also be deficient from iron excess or iron chelation which are also important contributors to bone metabolism. Indeed toxicities of iron chelation itself on bone development in the growing child associated with zinc deficiency, high Deferoxamine dosing and low iron burdens or the collagenous joint disease associated with deferiprone chelation have further contributed to the current musculoskeletal disease of Thalassemias. Decreased spinal height, vertebral flattening and scoliosis have also been reported. Magnetic Resonance Imaging (MRI of adolescent and adult β Thalassemia Major and Intermedia patients with osteoporosis and pain have assisted in defining the

  8. Aseptic necrosis of femoral head complicating thalassemia

    International Nuclear Information System (INIS)

    Orzincolo, C.; Castaldi, G.; Scutellary, P.N.; Bariani, L.; Pinca, A.


    Aseptic necrosis of the femoral head is described in 4 patients, selected from 280 patients with homozygous β-thalassemia (Cooley anemia). The incidence of the complication appears to be very high (14.5per mille) in thalassemia, compared to the general population. The possible mechanism are discussed. (orig.)

  9. Prevalence of Pulmonary Hypertension in Patients with Thalassemia Intermedia in 2009: a single center's experience. (United States)

    Moghaddam, Hassan Mottaghi; Badiei, Zahra; Eftekhari, Kambiz; Shakeri, Reza; Farhangi, Hamid


    There are various clinical symptoms of thalassemia intermedia, and they lie roughly between those of major and minor forms of the disease. Patients with thalassemia intermedia occasionally require blood transfusions. This renders them susceptible to pulmonary arterial hypertension (PAH) syndrome, which is one of the most significant complications in patients with thalassemia intermedia. PAH is more common in in thalassemia intermedia than in thalassemia major, and it may cause cardiac complications in patients who are older than 30. The objective of this study was to estimate the prevalence of PAH in thalassemia intermedia patients so that they can be referred expeditiously for treatment, thereby preventing the complications that occur later. This cross sectional study was conducted under the supervision of hematology department of Mashhad Medical University. Forty-one patients with thalassemia intermedia were examined at the Sarvar Thalassemia and Hemophilia Clinic of Mashhad. Electrocardiography, chest radiography, and echocardiography tests were performed for all of the patients by the same pediatric cardiologist. The data were processed by SPSS software, version 11.5, and the results were analyzed using chi-squared, Student's t, and Mann-Whitney tests. The mean age of the patients was 21.93±8.34. They had been under pediatric heart specialists' constant examination and treatment since their childhood when they were diagnosed with TI, and continue to receive regular follow-up care. The prevalence of pulmonary hypertension was 24% in our study population. In patients with thalassemia intermedia, the left ventricular (LV) mass indices were about 3-5 times higher than would be expected in a normal population. Patients with higher LV mass indices have a greater risk of developing pulmonary hypertension, and those with serum ferritin levels below 1000 ng/ml are less susceptible to diastolic dysfunction. Pulmonary hypertension is common in patients with thalassemia

  10. Approaches to management of beta-thalassemia intermedia

    Directory of Open Access Journals (Sweden)

    Joseph E. Maakaron


    Full Text Available Thalassemia intermedia is a genetically diverse group of diseases that is the result of an imbalance in the production of the alpha and beta chains with ensuing chronic hemolysis, ineffective erythropoiesis, and iron overload.Resulting complications include bone changes, hypercoagulability, and end-organ damage due to iron overload. This decade has witnessed major breakthroughs in the management of thalassemia. In this article, we examine these novelties in therapy including iron chelation therapy, stem cell transplant, and gene therapy.Iron chelation therapy has been revolutionized with the advent of deferasirox, a once-daily oral iron chelator, that has been shown to be safe and efficacious.Gene therapy was also at the core of this revolution with the discovery of novel gene elements and viral vectors allowing for better control and improved outcomes.

  11. Growth and endocrine disorders in thalassemia: The international network on endocrine complications in thalassemia (I-CET position statement and guidelines

    Directory of Open Access Journals (Sweden)

    Vincenzo De Sanctis


    Full Text Available The current management of thalassemia includes regular transfusion programs and chelation therapy. It is important that physicians be aware that endocrine abnormalities frequently develop mainly in those patients with significant iron overload due to poor compliance to treatment, particularly after the age of 10 years. Since the quality of life of thalassemia patients is a fundamental aim, it is vital to monitor carefully their growth and pubertal development in order to detect abnormalities and to initiate appropriate and early treatment. Abnormalities should be identified and treatment initiated in consultation with a pediatric or an adult endocrinologist and managed accordingly. Appropriate management shall put in consideration many factors such as age, severity of iron overload, presence of chronic liver disease, thrombophilia status, and the presence of psychological problems. All these issues must be discussed by the physician in charge of the patient′s care, the endocrinologist and the patient himself. Because any progress in research in the field of early diagnosis and management of growth disorders and endocrine complications in thalassemia should be passed on to and applied adequately to all those suffering from the disease, on the 8 May 2009 in Ferrara, the International Network on Endocrine Complications in Thalassemia (I-CET was founded in order to transmit the latest information on these disorders to the treating physicians. The I-CET position statement outlined in this document applies to patients with transfusion-dependent thalassemia major to help physicians to anticipate, diagnose, and manage these complications properly.

  12. The impact of thalassemia on Southeast Asian and Asian Indian families in the United States: a qualitative study. (United States)

    Liem, Robert I; Gilgour, Brynnan; Pelligra, Stephanie A; Mason, Maryann; Thompson, Alexis A


    To describe the challenges, including sociocultural and socioeconomic barriers, faced by an urban immigrant population in the United States affected by thalassemia major. Ethnographic, semi-structured, 1-on-1 interviews using an interview guide developed for this study. Digital recordings were transcribed and data analyzed using constant comparative method. University-based, Comprehensive Thalassemia Program at Children's Memorial Hospital, Chicago, IL, USA. Fourteen Southeast Asian and Asian Indian parents of children with transfusion dependent thalassemia. Qualitative descriptions of parental experiences, frequency of codes applied to interviews and emergent themes. Thalassemia has its greatest impact on the emotional and social well-being of affected children and their parents. Current and future concerns were related to disease-specific complications and challenges with management such as transfusions and chelation therapy. These perceptions were tied to parental hope for a cure, a frequently coded coping mechanism. Despite their availability, few parents relied on support systems beyond immediate family members due to perceived public knowledge gaps about thalassemia. Culturally based past experiences and barriers did not emerge as dominant themes in our analysis. The impact of thalassemia is tremendous for affected children and their parents and is due more to factors that were either disease-specific or common to other chronic disease models rather than those influenced by culture. The unmet needs of these families require additional investigation to facilitate the development of initiatives aimed at improving quality of life and lessening overall impact of thalassemia

  13. Assessment of serum ferritin levels in thalassemia and non-thalassemia patients presented with anemia

    Directory of Open Access Journals (Sweden)

    Mohammed Mahdi Abdulomohsin AL-Zubaidi


    Objectives: The aim of this study was to assess serum ferritin levels in B-thalassemia patients, and to compare it with non-thalassemic anemia and healthy control. Materials and methods : A prospective cross sectional study conducted at Thalassemia Center in Ibn Al- Baladi Hospital for Children and Women during the period from1st February to 30th May 2014 during their attendance to out-patient clinic. A total .number of 101 patients complaining of anemia (51 patients with thalassemia, 50 with non-thalassemia in addition to 50 healthy subjects considered as control. All patients were tested for Serum ferritin levels and all results were obtained through automated quantitative test for use Vidas machine Results : The mean serum ferritin levels in cases of thalassemia was 9542 ± 782 ng/ml while serum ferritin levels in control sample was 138 ± 323 ng/ml in male and 28 ± 108 ng/ml in female . in patients with non-thalassemia anemia, the levels of serum ferritin was 1 ± 80 ng/ml. Age of all patients in this study ranged from 3day-9year .the age of thalassemia patients ranged from 1-6 year and p-value was(0.23 while the age of patients with non-thalassemia anemia was 1-5 year and p-value was (0.11. Conclusion: This study confirm that serum ferritin is high in patients wih thalassemia than non thalassemia.

  14. Splenectomy for Children With Thalassemia: Total or Partial Splenectomy, Open or Laparoscopic Splenectomy. (United States)

    Al-Salem, Ahmed H


    Splenomegaly and hypersplenism are common complications among children with thalassemia necessitating splenectomy. Thirty-six children (27 β-thalassemia major, 3 Hb H disease, and 6 thalassemia intermediate) had total splenectomy (11 laparoscopic and 13 open splenectomy) or partial splenectomy (12 patients). In the partial splenectomy group, 2 with Hb H required no transfusions. For those with β-thalassemia major who had partial splenectomy (9 patients), there was a reduction in the number of transfusions from a preoperative mean of 15.2 transfusions per year to a postoperative mean of 8.2 transfusions per year. Subsequently and as a result of increase in the size of splenic remnant, their transfusions increased, but none required total splenectomy. Twenty-four patients had total splenectomy (13 open and 11 laparoscopic splenectomy). Their postsplenectomy transfusions decreased from a preoperative mean of 17.8 transfusions per year to a postoperative mean of 10 transfusions per year. There was no mortality, and none developed postoperative sepsis or thrombotic complications. Total splenectomy is beneficial for children with β-thalassemia major and hypersplenism by reducing their transfusion requirements. Laparoscopic splenectomy is however more beneficial. Partial splenectomy reduces their transfusion requirements, but only as a temporary measure, and so it is recommended for children younger than 5 years of age.

  15. Recent patents and technology transfer for molecular diagnosis of β-thalassemia and other hemoglobinopathies. (United States)

    Breveglieri, Giulia; Finotti, Alessia; Borgatti, Monica; Gambari, Roberto


    Biological tests and genetic analyses for diagnosis and characterization of hematological diseases in health laboratories are designed with the aim of meeting the major medical needs of hospitals and pharmaceutical companies involved in this field of applied biomedicine. Genetic testing approaches to perform diagnosis consist of molecular techniques, which should be absolutely reproducible, fast, sensitive, cheap, and portable. Biological tests analyzed involve adult/newborn subjects, whereas genetic analyses involve adult thalassemia patients, newborns, embryos/fetuses (including non-invasive prenatal diagnosis), pre-implantation embryos, and pre-fertilization oocytes. The most recent findings in the diagnostic approach for β-thalassemias are related to three major fields of investigation: moving towards ultrasensitive methodologies for effective detection of the primary causative mutation of β-thalassemia, including the development of polymerase chain reaction-free approaches and non-invasive prenatal diagnosis; comparing analyses of the genotype of β-thalassemia patients to high-HbF-associated polymorphisms; introducing whole genome association assays and next-generation sequencing. All these issues should be considered and discussed in the context of several aspects, including regulatory, ethical and social issues. DNA sequence data aligned with the identification of genes central to the induction, development, progression, and outcome of β-thalassemia will be a key point for directing personalized therapy.


    Directory of Open Access Journals (Sweden)

    Deborah Rund


    Full Text Available


    The clinical approach to thalassemia and hemoglobinopathies, specifically Sickle Cell Disease (SCD, based on transfusions, iron chelation and bone marrow transplantation has ameliorated their prognosis. Nevertheless, infections still may cause serious complications in these patients. The susceptibility to infections in thalassemia and SCD arises both from a large spectrum of immunological abnormalities and from exposure to specific infectious agents. Four fundamental issues will be focused upon as central causes of immune dysfunction: the diseases themselves; iron overload, transfusion therapy and the role of the spleen. Thalassemia and SCD differ in their pathogenesis and clinical course. It will be outlined how these differences affect immune dysfunction, the risk of infections and the types of most frequent infections in each disease. Moreover, since transfusions are a fundamental tool for treating these patients, their safety is paramount in reducing the risks of infections. In recent years, careful surveillance worldwide and improvements in laboratory tests reduced greatly transfusion transmitted infections, but the problem is not completely resolved. Finally, selected topics will be discussed regarding Parvovirus B19 and transfusion transmitted infections as well as the prevention of infectious risk postsplenectomy or in presence of functional asplenia.

  17. Thalassemia, extramedullary hematopoiesis, and spinal cord compression: A case report. (United States)

    Bukhari, Syed Sarmad; Junaid, Muhammad; Rashid, Mamoon Ur


    Extramedullary hematopoiesis (EMH) refers to hematopoiesis outside of the medulla of the bone. Chronic anemia states such as thalassemia can cause hematopoietic tissue to expand in certain locations. We report a case of spinal cord compression due to recurrent spinal epidural EMH, which was treated with a combination of surgery and radiotherapy. Pakistan has one of the highest incidence and prevalence of thalassemia in the world. We describe published literature on diagnosis and management of such cases. An 18-year-old male presented with bilateral lower limb paresis. He was a known case of homozygous beta thalassemia major. He had undergone surgery for spinal cord compression due to EMH 4 months prior to presentation. Symptom resolution was followed by deterioration 5 days later. He was operated again at our hospital with complete resection of the mass. He underwent local radiotherapy to prevent recurrence. At 2 years follow-up, he showed complete resolution of symptoms. Follow-up imaging demonstrated no residual mass. The possibility of EMH should be considered in every patient with ineffective erythropoiesis as a cause of spinal cord compression. Treatment of such cases is usually done with blood transfusions, which can reduce the hematopoietic drive for EMH. Other options include surgery, hydroxyurea, radiotherapy, or a combination of these on a case to case basis.

  18. Glutathione Redox System in β-Thalassemia/Hb E Patients

    Directory of Open Access Journals (Sweden)

    Ruchaneekorn W. Kalpravidh


    Full Text Available β-thalassemia/Hb E is known to cause oxidative stress induced by iron overload. The glutathione system is the major endogenous antioxidant that protects animal cells from oxidative damage. This study aimed to determine the effect of disease state and splenectomy on redox status expressed by whole blood glutathione (GSH/glutathione disulfide (GSSG and also to evaluate glutathione-related responses to oxidation in β-thalassemia/Hb E patients. Twenty-seven normal subjects and 25 β-thalassemia/Hb E patients were recruited and blood was collected. The GSH/GSSG ratio, activities of glutathione-related enzymes, hematological parameters, and serum ferritin levels were determined in individuals. Patients had high iron-induced oxidative stress, shown as significantly increased serum ferritin, a decreased GSH/GSSG ratio, and increased activities of glutathione-related enzymes. Splenectomy increased serum ferritin levels and decreased GSH levels concomitant with unchanged glutathione-related enzyme activities. The redox ratio had a positive correlation with hemoglobin levels and negative correlation with levels of serum ferritin. The glutathione system may be the body’s first-line defense used against oxidative stress and to maintain redox homeostasis in thalassemic patients based on the significant correlations between the GSH/GSSH ratio and degree of anemia or body iron stores.

  19. Burden of thalassemia in India: The road map for control

    Directory of Open Access Journals (Sweden)

    Roshan Colah


    Full Text Available The thalassemias and structural haemoglobin variants are the commonest monogenic disorders globally. India has a huge burden with an estimated 100,000 patients with a β thalassemia syndrome and around 150,000 patients with sickle cell disease, but few among them are optimally managed, and allogeneic stem cell transplant is unaffordable for the majority of families. A feasible option for control is to promote education and awareness programmes, intensify screening in all the states with micromapping to assess the true burden, and develop adequate facilities for genetic counselling and prenatal diagnosis in public sector Institutions. Government and non-government organizations have been working towards this goal for the last 3 to 4 decades but community control in a vast and diverse country is challenging and a national programme reaching all rural regions where almost 70% of the population resides is yet to begin. Strategies to control thalassemia need to include 1 Educating health professionals, school and college students, pregnant women and the population at large 2 Establishing prenatal diagnosis facilities in different regions of the country 3 Setting up a greater number of Day Care Centres for managing existing thalassemia patients 4 Developing cost-effective facilities for stem cell transplantation across the country. This review explores strategies by which Central and State Governments, NGOs, Parents-Patients Societies and Corporate Houses can work together to successfully reduce the burden of hemoglobinopathies in India. Guidelines for implementation of such a national programme have recently been prepared by the National Health Mission, Ministry of Health and Family Welfare with the help of several experts in the country.

  20. Thalassemia mutations in Gaziantep, Turkey

    African Journals Online (AJOL)



    Feb 22, 2010 ... Table 3. Frequency of β-thalassemia mutations in the Eastern Mediterranean. Mutation. This study Turkey Cyprus Greece Syria Palestine Bulgaria Azerbaijan Iran Iraq. IVS 1.110 (G>A). 29.1. 39.3. 79.7. 42.1. 24.1. 17.6. 24.2. 20.2. 4.8 1.9. IVS 2.1 (G>A). 12.3. 4.7. -. 3.3. 4.2. 2.9. -. -. 33.9 18.3. IVS 1.1 (G>A).

  1. Double heterozygocity for hemoglobin C and beta thalassemia dominant: A rare case of thalassemia intermedia

    Directory of Open Access Journals (Sweden)

    Alexandra Agapidou


    Full Text Available Beta thalassemia dominant results from mutations in the β globin chain gene resulting in the production of elongated, highly unstable beta globin chains. Several such mutations have been described and in a heterozygous state they may confer a phenotype more severe than that of β thalassemia trait and lead to a clinical syndrome of thalassemia intermedia and its associated complications such as extramedullary hemopoiesis, bone disease, endocrinopathies and iron overload even in the absence of transfusion. In this report we present a case of double heterozygocity for HbC and β thalassemia dominant leading to a series of complications that were treated successfully once the correct diagnosis was made.

  2. High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group. (United States)

    Tan, Jin-Ai Mary Anne; Lee, Ping-Chin; Wee, Yong-Chui; Tan, Kim-Lian; Mahali, Noor Fadzlin; George, Elizabeth; Chua, Kek-Heng


    Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.

  3. Gene Therapy in Thalassemia and Hemoglobinopathies


    Breda, Laura; Gambari, Roberto; Rivella, Stefano


    Sickle cell disease (SCD) and ß-thalassemia represent the most common hemoglobinopathies caused, respectively, by the alteration of structural features or deficient production of the ß-chain of the Hb molecule. Other hemoglobinopathies are characterized by different mutations in the α- or ß-globin genes and are associated with anemia and might require periodic or chronic blood transfusions. Therefore, ß-thalassemia, SCD and other hemoglobinopathies are excellent candidates for genetic approac...

  4. Hepcidin is suppressed by erythropoiesis in hemoglobin E β-thalassemia and β-thalassemia trait (United States)

    Jones, Emma; Pasricha, Sant-Rayn; Allen, Angela; Evans, Patricia; Fisher, Chris A.; Wray, Katherine; Premawardhena, Anuja; Bandara, Dyananda; Perera, Ashok; Webster, Craig; Sturges, Pamela; Olivieri, Nancy F.; St. Pierre, Timothy; Armitage, Andrew E.; Porter, John B.; Weatherall, David J.


    Hemoglobin E (HbE) β-thalassemia is the most common severe thalassemia syndrome across Asia, and millions of people are carriers. Clinical heterogeneity in HbE β-thalassemia is incompletely explained by genotype, and the interaction of phenotypic variation with hepcidin is unknown. The effect of thalassemia carriage on hepcidin is also unknown, but it could be relevant for iron supplementation programs aimed at combating anemia. In 62 of 69 Sri Lankan patients with HbE β-thalassemia with moderate or severe phenotype, hepcidin was suppressed, and overall hepcidin inversely correlated with iron accumulation. On segregating by phenotype, there were no differences in hepcidin, erythropoiesis, or hemoglobin between severe or moderate disease, but multiple linear regression showed that erythropoiesis inversely correlated with hepcidin only in severe phenotypes. In moderate disease, no independent predictors of hepcidin were identifiable; nevertheless, the low hepcidin levels indicate a significant risk for iron overload. In a population survey of Sri Lankan schoolchildren, β-thalassemia (but not HbE) trait was associated with increased erythropoiesis and mildly suppressed hepcidin, suggesting an enhanced propensity to accumulate iron. In summary, the influence of erythropoiesis on hepcidin suppression associates with phenotypic disease variation and pathogenesis in HbE β-thalassemia and indicates that the epidemiology of β-thalassemia trait requires consideration when planning public health iron interventions. PMID:25519750

  5. My Story: Real Stories of People Living with Thalassemia (United States)

    ... Share Compartir Real Stories from People living with Thalassemia On this Page Rahul’s Story Aaron’s Story Rahul’s ... is Rahul Kapoor, and I was born with thalassemia, a blood disorder which requires transfusions every other ...

  6. The prevalence of Hepatitis C virus antibodies among thalassemia patients referring to Shahid Beheshti Hospital, Abadan, Iran

    Directory of Open Access Journals (Sweden)

    Sara Kooti


    Full Text Available Abstract: Hepatitis C virus (HCV infection as an awesome medical issue is one of the most important pathogens of the human. Youngsters with thalassemia who get visit blood transfusions will be endangered with a high danger of HCV contamination. The point of this review is to decide the predominance of HCV disease among thalassemia patients in Abadan, Khuzestan region that is situated in the south-west of Iran. For this study a specific questionnaire on demographic information (Demographic information, for example, age, number of blood transfusions were acquired from patient records in which completed by trained personnel and also blood samples were taken at the same time in order to check the presence and amount of anti-HCV-Ab as a result, it showed that 11.17% (179/20, 11.17% of samples were positive. The HCV contamination is an illness which influences the extensive number of thalassemia patients in the world. The Lack of knowledge about blood safety of HCV contamination as the most predominant transfusion-transmitted sickness of blood in thalassemia patients is a major threat to public health in a group of countries in which the most obtained data from this region came from provinces of Iran. The anti-HCV prevalence in patients with thalassemia who live in Khuzestan province is less than other provinces of Iran and also neighbor countries and researchers should be paid attention to hepatitis C infection in order to prevent thalassemia cases.


    Directory of Open Access Journals (Sweden)

    M. Domenica Cappellini


    Full Text Available As the life expectancy of β-thalassemia patients has markedly improved over the last decade, several new complications are being recognized. The presence of a high incidence of thromboembolic events, mainly in thalassemia intermedia patients, has led to the identification of a hypercoagulable state in thalassemia. In this review, the molecular and cellular mechanisms leading to hypercoagulability in thalassemia are highlighted, and the current clinical experience is summarized. Recommendations for thrombosis prophylaxis are also discussed.

  8. Thalassemia and Hemoglobin E in Southern Thai Blood Donors


    Nuinoon, Manit; Kruachan, Kwanta; Sengking, Warachaya; Horpet, Dararat; Sungyuan, Ubol


    Thalassemia and hemoglobin E (Hb E) are common in Thailand. Individuals with thalassemia trait usually have a normal hemoglobin concentration or mild anemia. Therefore, thalassemic individuals who have minimum acceptable Hb level may be accepted as blood donors. This study was aimed at determining the frequency of α-thalassemia 1 trait, β-thalassemia trait, and Hb E-related syndromes in Southern Thai blood donors. One hundred and sixteen voluntary blood donors, Southern Thailand origin, were ...



    Türkkan, Emine; Berrak, Su Gülsün; Canpolat, Cengiz


    The Beta ((3) thalassemia syndromes are a heterogeneous group of genetic disorders. The frequency of thalassemia is dependent on the ethnic origins of the patient population. Turkey is located in a geographic area of the world where thalassemia syndromes are common. The incidence rate of (3-thalassemia carriers was stated to be 2 per cent in Turkey. Clinical manifestations are diverse and range from asymptomatic hypochromia and microcytosis to profound anemia leading to death in early childho...

  10. Quality of life assessment of children with thalassemia


    Masyitah Sri Wahyuni; Muhammad Ali; Nelly Rosdiana; Bidasari Lubis


    Background Thalassemia is a chronic disease that is becoming a major health problem in the world, including the Mediterranean, as well as Malaysia, Thailand and Indonesia. This condition clearly affects the patient's quality of life, because of the condition itself and the effects of treatment. Assessment is needed to detennine actions to be taken to improve the quality of life in thalassemic children. Objective To assess the differences in quality of life of thalassemic children comp...

  11. Prevalence of Co-Inheritance of Alpha-Thalassemia with Beta-Thalassemia and Beta-Hemoglobinopathy in Ahvaz City


    Najmaddin Saki; Akbar Dorgalaleh; Zahra Kashani Khatib; Shaban Alizadeh; Fakher Rahim; Hamid Galehdari; Bijan Kaikhaei; Mohammad Pedram; Ali Dehghani Fard


    Background: Co-inheritance of hemoglobin gene defects is a rare important status that can lead to double heterozygote or homozygote with significant clinical manifestations. Such conditions can be observed in co-inheritance of alpha-thalassemia with beta-thalassemia or hemoglobinopathy. The aim of this study was to evaluate the prevalence of alpha-thalassemia with beta-thalassemia and hemoglobinopathy co-inheritance in a considerable number of Iranian.   Methods: This descriptive study was pe...

  12. Prevalence of β-thalassemia and other haemoglobinopathies in six cities in India: a multicentre study. (United States)

    Mohanty, D; Colah, R B; Gorakshakar, A C; Patel, R Z; Master, D C; Mahanta, J; Sharma, S K; Chaudhari, U; Ghosh, M; Das, S; Britt, R P; Singh, S; Ross, C; Jagannathan, L; Kaul, R; Shukla, D K; Muthuswamy, V


    The population of India is extremely diverse comprising of more than 3,000 ethnic groups who still follow endogamy. Haemoglobinopathies are the commonest hereditary disorders in India and pose a major health problem. The data on the prevalence of β-thalassemias and other haemoglobinopathies in different caste/ethnic groups of India is scarce. Therefore the present multicentre study was undertaken in six cities of six states of India (Maharashtra, Gujarat, West Bengal, Assam, Karnataka and Punjab) to determine the prevalence of haemoglobinopathies in different caste/ethnic groups using uniform methodology. Fifty-six thousand seven hundred eighty individuals (college students and pregnant women) from different caste/ethnic groups were screened. RBC indices were measured on an automated haematology counter while the percentage of HbA(2), HbF and other abnormal Hb variants were estimated by HPLC on the Variant Hemoglobin Testing System. The overall prevalence of β-thalassemia trait was 2.78 % and varied from 1.48 to 3.64 % in different states, while the prevalence of β-thalassemia trait in 59 ethnic groups varied from 0 to 9.3 %. HbE trait was mainly seen in Dibrugarh in Assam (23.9 %) and Kolkata in West Bengal (3.92 %). In six ethnic groups from Assam, the prevalence of HbE trait varied from 41.1 to 66.7 %. Few subjects with δβ-thalassemia, HPFH, HbS trait, HbD trait, HbE homozygous and HbE β-thalassemia as well as HbS homozygous and HbS-β-thalassemia (India.

  13. Preventing thalassemia in Lebanon: successes and challenges in a developing country. (United States)

    Abi Saad, Michele; Haddad, Anthony G; Alam, Elie S; Aoun, Sanaa; Maatouk, Pascale; Ajami, Najat; Khairallah, Therese; Koussa, Suzanne; Musallam, Khaled M; Taher, Ali T


    Thalassemia continues to be a major health burden. The chronicity of the disease and the high cost of life-long treatment make prevention strategies crucial in the management of this disease. In this article, we revisit different successful prevention strategies, and underline the Lebanese model. The Chronic Care Center (CCC), Beirut, is the only specialized center in Lebanon for the treatment and prevention of thalassemia. The current number of patients registered up to August 2013 was 724, representing cases from all over Lebanon. In 1994, the center launched a national prevention program following the World Health Organization (WHO) recommendations. The major activities of the program include awareness campaigns, screening for thalassemia carriers in the general population and high risk groups, registry of new cases and follow-up on the mandatory premarital law (established at the same time). Screening programs showed a carrier rate of around 2.3% in the general population, and 4.0-41.0% in high risk groups. The major pitfall in the law is that only persons with a mean corpuscular volume (MCV) of >70.0 fL are asked to perform further hemoglobin (Hb) testing. A significant decrease in the number of new cases of thalassemia patients in Lebanon reflects the efforts deployed in the prevention of the disease. However, some limitations are faced in reaching a complete eradication of the disease, mainly due to the fact that abortion is illegal and due to pitfalls and incorrect implementation of the premarital law.

  14. Prevalence of Co-Inheritance of Alpha-Thalassemia with Beta-Thalassemia and Beta-Hemoglobinopathy in Ahvaz City

    Directory of Open Access Journals (Sweden)

    Najmaddin Saki


    Full Text Available Background: Co-inheritance of hemoglobin gene defects is a rare important status that can lead to double heterozygote or homozygote with significant clinical manifestations. Such conditions can be observed in co-inheritance of alpha-thalassemia with beta-thalassemia or hemoglobinopathy. The aim of this study was to evaluate the prevalence of alpha-thalassemia with beta-thalassemia and hemoglobinopathy co-inheritance in a considerable number of Iranian.   Methods: This descriptive study was performed on patients with abnormal hematological findings in favor of alpha-thalassemia, beta-thalassemia or beta-hemoglobinopathies. Patients with low MCV and MCH levels and high HbA2 (>3.5 and those with low MCV and MCH and normal or low HbA2 were candidate for molecular analysis for beta and alpha thalassemia respectively. Abnormal Hb electrophoresis was diagnostic criteria for molecular analysis of beta-hemoglobinopathies.   Results: Study revealed that more than half of the patients with alpha-thalassemia affected simultaneously by beta-thalassemia and about thirty percent inherited beta-hemoglobinopathies. Among patients with beta-thalassemia, HbSCd6 (A-T was the most common mutation and in alpha-thalassemic patients α 3.7 was the commonest mutation.   Conclusion: Relatively high prevalence of co-inheritance of alfa-thalassemia with beta-thalassemia and hemoglobinopathies reflect the necessity of genetic consulting and molecular analysis in diagnosis of such conditions.

  15. Thalassemia (United States)

    ... Report Cards Careers Archives Pregnancy Before or between pregnancies Nutrition, weight & fitness Prenatal care Is it safe? Labor & ... Careers Archives Health Topics Pregnancy Before or between pregnancies Nutrition, weight & fitness Prenatal care Is it safe? Labor & ...

  16. Beliefs about chelation among thalassemia patients

    Directory of Open Access Journals (Sweden)

    Trachtenberg Felicia L


    Full Text Available Abstract Background Understanding patients’ views about medication is crucial to maximize adherence. Thalassemia is a congenital blood disorder requiring chronic blood transfusions and daily iron chelation therapy. Methods The Beliefs in Medicine Questionnaire (BMQ was used to assess beliefs in chelation in thalassemia patients from North America and London in the Thalassemia Longitudinal Cohort (TLC of the Thalassemia Clinical Research Network (TCRN. Chelation adherence was based on patient report of doses administered out of those prescribed in the last four weeks. Results Of 371 patients (ages 5-58y, mean 24y, 93% were transfused and 92% receiving chelation (26% deferoxamine (DFO; a slow subcutaneous infusion via portable pump, 63% oral, 11% combination. Patients expressed high “necessity” for transfusion (96%, DFO chelation (92% and oral chelation (89%, with lower “concern” about treatment (48%, 39%, 19% respectively. Concern about oral chelation was significantly lower than that of DFO (p Conclusions Despite their requirement for multimodal therapy, thalassemia patients have positive views about medicine, more so than in other disease populations. Patients may benefit from education about the tolerability of chelation and strategies to effectively cope with side effects, both of which might be beneficial in lowering body iron burden. identifier NCT00661804

  17. Bone marrow transplantation for thalassemia: a global perspective

    Directory of Open Access Journals (Sweden)

    Mohamed Hamed Hussein


    Full Text Available Even though severe thalassemia is a preventable disease, over 100,000 new cases are born yearly, particularly in the Middle East and South-East Asia. Most of these children may not reach adulthood because long-term appropriate supportive care is either inaccessible or unaffordable. Bone marrow transplantation (BMT remains the only available definitive cure and success rates can be very high in appropriately selected patients, i.e. low-risk younger children with a matched family donor. In these circumstances BMT may be justified medically, ethically as well as financially, in fact, the cost of low-risk BMT is equivalent to that of a few years of non-curative supportive. This manuscript will briefly review the current status of bone marrow transplantation for thalassemia major with particular emphasis on a global prospective and present the experience of the Cure2Children Foundation supporting sustainable and scalable start up BMT programs in low-resource settings. The initial twelve consecutive patients managed in two start up BMT units in Pakistan (Children’s Hospital of the Pakistan Institute of Medical Sciences, Islamabad and India (South East Asia Institute for Thalassemia, Jaipur were included in this analysis. These initial six patients per each institution where purposely chosen as the focus of this report because they represent the steepest phase of the learning curve. The median age at transplant was 3.9 years, range 0.9 to 6.0, liver was no greater than 2 cm from costal margin, and all received matched related BMT. A structured on-site focused training program as well as ongoing intensive on-line cooperation was provided by the Cure2Children team of professionals. At a median follow-up of 7.5 months (range 3.5 to 33.5 months both thalassemia-free and overall survival are 92%, one patient died of encephalitis-meningitis of unknown cause. No rejections where observed. Neutrophil recovery occurred at a median of 15.5 days (range 13

  18. Study of alpha hemoglobin stabilizing protein expression in patients with β thalassemia and sickle cell anemia and its impact on clinical severity. (United States)

    Mahmoud, Hanan Mohamed; Shoeib, Ahmed Al-Saiid Hamed; Abd El Ghany, Shereen Mohamed; Reda, Marwa Mohamed; Ragab, Iman Ahmed


    The α hemoglobin stabilizing protein (AHSP) binds α-Hb and prevents its precipitation limiting free α-Hb toxicities. Our aim was to study AHSP expression in β thalassemia syndromes in relation to their clinical severity and to compare it with its level in sickle cell anemia. We compared patients with β-thalassemia (n=37) (β-thalassemia major (BTM) (n=19) and β-thalassemia intermedia (BTI) (n=18)) with 12 patients with sickle cell anemia as regards clinical severity, age at presentation, transfusion dependency, mean pre-transfusion hemoglobin level, use of hydroxyurea and AHSP expression by real time quantitative PCR. Median (and IQR) AHSP expression was significantly higher in patients with sickle cell anemia 2275 (3898) compared to thalassemia 283 (718), P=0.001, with no significant difference between BTM and BTI (P=0.346). It was also significantly higher in non-transfusion dependent patients with β thalassemia (NTDT) compared to transfusion dependent ones (P=0.019), and in patients on hydroxyurea therapy (Psickle cell anemia versus thalassemia, with no significant difference between BTM and BTI. Expression was higher in patients with NTDT and on hydroxyurea therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Cardiac complications in beta-thalassemia: From mice to men (United States)

    Kumfu, Sirinart; Fucharoen, Suthat; Chattipakorn, Siriporn C.


    Beta-thalassemia is an inherited hemoglobin disorder caused by reduced or absent synthesis of the beta globin chains of hemoglobin. This results in variable outcomes ranging from clinically asymptomatic to severe anemia, which then typically requires regular blood transfusion. These regular blood transfusions can result in an iron overload condition. The iron overload condition can lead to iron accumulation in various organs, especially in the heart, leading to iron overload cardiomyopathy, which is the major cause of mortality in patients with thalassemia. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects that iron overload has on the hearts of β-thalassemic mice under conditions of iron overload as well as the efficacy of pharmacological interventions to combat these adverse effects on the heart are reviewed and discussed. The in-depth understanding of biomolecular alterations in the heart of these iron overload thalassemic mice will help give guidance for more effective therapeutic approaches in the near future. Impact statement Iron overload cardiomyopathy is a major cause of morbidity and mortality in patients with thalassemia. Since investigation of iron overload cardiomyopathy in thalassemia patients has many limitations, a search for an animal model for this condition has been ongoing for decades. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects of

  20. Cardiac complications in beta-thalassemia: From mice to men. (United States)

    Kumfu, Sirinart; Fucharoen, Suthat; Chattipakorn, Siriporn C; Chattipakorn, Nipon


    Beta-thalassemia is an inherited hemoglobin disorder caused by reduced or absent synthesis of the beta globin chains of hemoglobin. This results in variable outcomes ranging from clinically asymptomatic to severe anemia, which then typically requires regular blood transfusion. These regular blood transfusions can result in an iron overload condition. The iron overload condition can lead to iron accumulation in various organs, especially in the heart, leading to iron overload cardiomyopathy, which is the major cause of mortality in patients with thalassemia. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects that iron overload has on the hearts of β-thalassemic mice under conditions of iron overload as well as the efficacy of pharmacological interventions to combat these adverse effects on the heart are reviewed and discussed. The in-depth understanding of biomolecular alterations in the heart of these iron overload thalassemic mice will help give guidance for more effective therapeutic approaches in the near future. Impact statement Iron overload cardiomyopathy is a major cause of morbidity and mortality in patients with thalassemia. Since investigation of iron overload cardiomyopathy in thalassemia patients has many limitations, a search for an animal model for this condition has been ongoing for decades. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects of

  1. Management of ß-thalassemia – Consensus and controversies!

    Directory of Open Access Journals (Sweden)

    Mamta V. Manglani


    Full Text Available The mainstay of treatment of ß-Thalassemia major includes life-long regular packed red cell transfusions and iron chelation. With advances in understanding the molecular biology and its implications in the patients, newer modalities are now being explored to offer a better quality of life to transfusion dependent thalassemic patients. Improved safety of transfusions, newer chelator drugs and combination of chelators have improved outcomes in these patients. Amlodipine along with chelators may be a future option for preventing cardiac iron overload related complications. Drugs which improve HbF levels and thus ameliorate anemia such as hydroxyurea, butyrates azacytidine etc. have also been explored with little relief to transfusion dependent patients. HSCT, which is the only curative treatment available at present, has its own limitations as sibling donors may not be available to many. However, there has been extensive work done on improving outcomes with MUD and Haplo-identical HSCT in the recent times. Gene therapy using lentiviral vectors is also offering great hope to these children. Induced Pluripotent Stem Cells (iPSC is a promising advance in the treatment of thalassemia. Several newer molecules targeting different pathophysiologic aspects are being explored and have met with good success. These include luspatercept, sotatercept, macrophage inhibition, JAK2 inhibition using ruxolitinib etc. Controversies regarding use of wheat grass and ESAs are relatively less worrisome. But use of thalidomide should be done with great caution. Despite its success reported in anecdotal reports, in the absence of adequate data with larger trials, its role in routine management of thalassemia syndromes remains to be ascertained.

  2. Beta-thalassemia- institution based analysis of ethnic and geographic distribution, effect of consanguinity and safety of chorionic villus sampling as a diagnostic, tool for pre-natal diagnosis in selected patients

    International Nuclear Information System (INIS)

    Abdullah, K.N.; Liaqat, J.; Azim, W.


    To study the ethnic and geographic distribution of Beta-thalassemia amongst the patients included and to study the effect of consanguinity in promoting this disease. Also, to establish the safety of CVS when used as a pre-natal diagnostic tool in aiding the early diagnosis of Beta-thalassemia in selected patients. Study Design: Descriptive Study. Place and Duration of Study: PNS Shifa Karachi, from Jan 2008 to Dec 2008. Patients and Methods: A total of 223 women out of 240 that were referred from all over Sindh to PNS Shifa Hospital Karachi for susceptible gene mutations participated in the study. The standard procedure that was used in this study was trans-abdominal aspiration of chorionic villi through suction needle. The samples were then sent for further analysis to the Pathology Department at PNS Shifa Hospital Karachi. Results: In our study population Beta-thalassemia was most prevalent in Sindhi 107 (48%) followed by Punjabi 46 (21%), 27 (12%) Pathan, and 43 (19%) Balochi. Out of 223 women, 95 were of thalassemia trait, while 85 were of thalassemia major. Fifty five percent of thalassemia trait and 56% of thalassemia major fetus parents were first cousins. The rate of pregnancy loss after performing CVS was 2.0% with no complications reported. Conclusion: It is concluded that highest percentage of thalassemia is in first cousins and sindhi origin families are mostly affected. However CVS is a safe and effective tool for prenatal diagnosis and subsequent counselling in selected couples. (author)

  3. Molecular identification of Sicilian (dߺ-thalassemia associated with ß-thalassemia and hemoglobin S in Brazil

    Directory of Open Access Journals (Sweden)

    Andrade T.G. de


    Full Text Available We describe the clinical and molecular characteristics of two unrelated Brazilian families with an association of the Sicilian form of (deltaߺ-thalassemia with hemoglobin S and ß-thalassemia. Direct sequencing of the ß-globin gene showed only the hemoglobin S mutation in patient 1 and the ß-thalassemia IVS1-110 in patient 2. The other allele was deleted in both patients and PCR of DNA samples of the breakpoint region of both patients showed a band of approximately 1,150 bp, expected to be observed in the DNA of carriers of Sicilian (deltaߺ-thalassemia. The nucleotide sequence of this fragment confirmed the Sicilian deletion. There are few reports concerning the Hb S/(deltaߺ-thalassemia association and patient 2 is the first reported case of Sicilian type of (deltaߺ-thalassemia in association with ß-thalassemia documented at the molecular level.

  4. Physical growth in children with transfusion-dependent thalassemia

    Directory of Open Access Journals (Sweden)

    Harish K Pemde


    were significantly higher in patients with short stature than in the patients with normal height. Regression analysis showed that an increase of 3571 units of serum ferritin was associated with a decrease of one point in height z-scores. One-fifth (19.40% of adolescent patients had delayed puberty.Conclusion: Approximately one-third (33.11% of patients with transfusion-dependent thalassemia major were of short stature. In this group of patients with pretransfusion Hb levels maintained at desired levels, physical growth was correlated with status of iron overload.Keywords: thalassemia, growth, body mass index, serum ferritin 

  5. Papillary Fibroelastoma as a Cause of Cardiogenic Embolic Stroke in a β-Thalassemia Patient: Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Re-I Chin


    Full Text Available We describe a case of a young male without stroke risk factors who presented with a sudden onset of left-sided weakness, left hand numbness, and left eye blurriness. CT scan of the head without contrast and diffusion-weighted MRI of the brain with contrast revealed an ischemic stroke in the right middle cerebral artery distribution. Transesophageal echocardiography (TEE revealed a mobile pedunculated mass on the posterior surface of the mitral valve. This mass was resected and pathology showed a cardiac papillary fibroelastoma (CPFE, which was determined to be the cause of the patient’s cardioembolic stroke. Further workup also found that patient had microcytic anemia secondary to β-thalassemia intermedia, a rare hematologic disorder due to defective hemoglobin synthesis. Recently, another case report suggested β-thalassemia major may underlie the pathogenesis of CPFE. β-Thalassemia major causes a state of chronic inflammation and endothelial damage, which can mediate CPFE formation. Based on literature review, this is the first case report of a CPFE in a patient with β-thalassemia intermedia. This hypothesis-generating case report calls attention to the need for elucidating the relationship between CPFE and β-thalassemia in future studies to better understand the diagnosis and management of a rare cardiac tumor.

  6. Genetics Home Reference: alpha thalassemia X-linked intellectual disability syndrome (United States)

    ... Alpha thalassemia X-linked intellectual disability syndrome Alpha thalassemia X-linked intellectual disability syndrome Printable PDF Open ... to view the expand/collapse boxes. Description Alpha thalassemia X-linked intellectual disability syndrome is an inherited ...

  7. What Unrelated Hematopoietic Stem Cell Transplantation in Thalassemia Taught us about Transplant Immunogenetics (United States)

    La Nasa, Giorgio; Vacca, Adriana; Littera, Roberto; Piras, Eugenia; Orru, Sandro; Greco, Marianna; Carcassi, Carlo; Caocci, Giovanni


    Although the past few decades have shown an improvement in the survival and complication-free survival rates in patients with beta-thalassemia major and gene therapy is already at an advanced stage of experimentation, hematopoietic stem cell transplantation (HSCT) continues to be the only effective and realistic approach to the cure of this chronic non-malignant disease. Historically, human leukocyte antigen (HLA)-matched siblings have been the preferred source of donor cells owing to superior outcomes compared with HSCT from other sources. Nowadays, the availability of an international network of voluntary stem cell donor registries and cord blood banks has significantly increased the odds of finding a suitable HLA matched donor. Stringent immunogenetic criteria for donor selection have made it possible to achieve overall survival (OS) and thalassemia-free survival (TFS) rates comparable to those of sibling transplants. However, acute and chronic graft-versus-host disease (GVHD) remains the most important complication in unrelated HSCT in thalassemia, leading to significant rates of morbidity and mortality for a chronic non-malignant disease. A careful immunogenetic assessment of donors and recipients makes it possible to individualize appropriate strategies for its prevention and management. This review provides an overview of recent insights about immunogenetic factors involved in GVHD, which seem to have a potential role in the outcome of transplantation for thalassemia. PMID:27872728

  8. Premarital Screening of Beta Thalassemia Minor in north-east of Iran (United States)

    Hashemizadeh, H; Noori, R


    Background Beta thalassemia is a preventable disease. Iran has about 20,000Patients who are homozygote for β-thalassaemia and 3,750,000 carriers. The aim of this study was to determine the prevalence of beta thalassemia minor among men who underwent premarital screening in Quchana city in Khorasan Razavi region of Iran Materials and Methods This research is a descriptive cross-sectional study. From 2010 to 2011, all participants (1000) under marriage coming to health center of Quchan underwent routine mandatory tests. Participants were considered to have beta-thalassemia minor on the condition that hey had a mean corpuscular volume (MCV) 3.5%. Venous blood was taken into an EDTA tube and the complete blood count and red blood cell indices were measured with a Coulter automated cell counter. Electrophoresis was performed on cellulose acetate. Results Mean and SD of hemoglobin, MCV and MCH were 16±2.9, 91±4 and 28.4±2, respectively. Hemoglobin A2 Higher than 3.5 percent was reported as 3.5%.The prevalence of beta-thassemia minor with high hemoglobin A2 and microcytic hypochromic anemia was 3.5% (P-value). Conclusion In countries with high prevalence of hemoglobinopathies, a premarital screening program is helpful for identification and prevention of high-risk marriages. Detecting carrier couples with premarital screening program is an effective way of controlling thalassemia major. PMID:24575266

  9. Evaluation of Discrimination Indices Validity for Screening of β-Thalassemia Trait

    Directory of Open Access Journals (Sweden)

    Ahmadi A.


    Full Text Available AbstractBackground and Objectives: β-thalassemia trait (β-TT and iron deficiency anemia (IDA are the most common forms of microcytic anemia. Screening of β-thalassemia trait is important for medical counseling before marriage and preventing β-thalassemia major birth results. The most common problem in screening -TT is differentiating it from IDA. The aim of this study was to define the sensitivity, specificity, and predictive values of some discrimination indices for screening of β-TT in a sample of such patients.Methods: A total of 82 patients with microcytic anemia (MCV< 80 fl were selected from Namazi Hospital, Shiraz, Iran, and 9 discrimination indices were calculated for them. The patients were divided intotwo groups: 42 patients with β-TT and 40 patients with IDA. The sensitivity, specificity, positive and negative predictive values and Youden,s index of each discrimination index were calculated for screening β-TT.Results: None of the discrimination indices showed 100% of sensitivity and specificity. But the Shin and Lal index, RDW index and RBC count showed the highest and valuable value for screening β-TT.Conclusion: Some discrimination indices like Shin and Lal index, RDW index and RBC index are valuable indices in screening β-TT.Keywords: Beta- Thalassemia; Anemia, Iron Deficiency.


    Directory of Open Access Journals (Sweden)

    Giorgio La Nasa


    Full Text Available Abstract Although the past few decades have shown an improvement in the survival and complication-free survival rates in patients with beta-thalassemia major and gene therapy is already at an advanced stage of experimentation, hematopoietic stem cell transplantation (HSCT continues to be the only effective and realistic approach to the cure of this chronic non-malignant disease. Historically, human leukocyte antigen (HLA-matched siblings have been the preferred source of donor cells owing to superior outcomes compared with HSCT from other sources. Nowadays, the availability of an international network of voluntary stem cell donor registries and cordon blood banks has significantly increased the odds of finding a suitable HLA matched donor. Stringent immunogenetic criteria for donor selection have made it possible to achieve overall survival (OS and thalassemia-free survival (TFS rates comparable to those of sibling transplants. However, acute and chronic graft-versus-host disease (GVHD remains the most important complication in unrelated HSCT in thalassemia, leading to considerable rates of morbidity and mortality for a chronic non-malignant disease. A careful immunogenetic assessment of donors and recipients makes it possible to individuate appropriate strategies for its prevention and management. This review provides an overview on recent insights about immunogenetic factors involved in GVHD, which seem to have a potential role in the outcome of transplantation for thalassemia.

  11. The effects of beta-carotene and vitamin E on erythrocytes lipid peroxidation in beta-thalassemia patients

    Directory of Open Access Journals (Sweden)

    Soleiman Mahjoub


    Full Text Available BACKGROUND: Thalassemia is the most common hereditary disease in the world. Thalassemic erythrocytes are exposed to higher oxidative stress and lipid peroxidation. The aim of this study was to investigate the effects of beta-carotene and vitamin E on erythrocytes lipid peroxidation in beta-thalassemia patients.
    METHODS: A prospective double-blind, placebo-controlled study of the effect of beta-carotene and vitamin E on lipid peroxidation in erythrocytes membranes was performed on 120 beta-thalassemia major patients in four groups. The patients were supplemented for 4 weeks as follows: group 1 with beta-carotene (13 mg/day, group 2 with vitamin E (550 mg/day, group 3 with beta-carotene plus vitamin E and group 4 with placebo. We prepared all capsules for 4 roups in the same shape and color. Measurements of serum beta-carotene and vitamin E were performed by high performance
    liquid chromatography. After preparation of ghost cells from blood specimens, malondialdehyde (MDA was determined as index of lipid peroxidation in erythrocytes membranes before and after treatment. RESULTS: The levels of serum beta-carotene and vitamin E were significantly lower and MDA concentrations in erythrocytes membranes were significantly higher in beta-thalassemia patients compared to controls (P<0.001. In groups that treated with vitamin supplements for 4-weeks, lipid peroxidation rates were significantly reduced after treatment (P<0.001, but in placebo group there was not significant difference (P>0.05.
    CONCLUSIONS: Our findings provide evidence that an oral treatment with beta-carotene and vitamin E can significantly reduce lipid peroxidation of erythrocytes membranes and could be useful in management of beta-thalassemia major patients. KEYWORDS: Beta-thalassemia major, beta-carotene, vitamin E, malondialdehyde, lipid peroxidation.

  12. Low-cost matched sibling bone marrow transplant for standard-risk thalassemia in a limited-resource setting

    Directory of Open Access Journals (Sweden)

    Stalin Ramprakash


    Full Text Available Thalassemias are the most common inherited genetic disorder in India and a major public health burden with bone marrow transplant (BMT considered the only established curative therapy. We describe outcomes for patients (n = 71 with standard-risk thalassemia (liver size 80 at the last follow up. 5 patients (7% died, mortality related to transplant. Enough data existed for 2 centers in India (36/71 transplants to analyze overall costs from admission up to one-year post-BMT which revealed a median cost of Rs 7,30,445 ($11519 [Range Rs 4,52,821–10,32,842 ($ 7079–16147]. In conclusion, children with thalassemia in resource limited settings can achieve good outcomes with BMT at a reasonable cost.

  13. Embryo genome profiling by single-cell sequencing for preimplantation genetic diagnosis in a β-thalassemia family

    DEFF Research Database (Denmark)

    Xu, Yanwen; Chen, Shengpei; Yin, Xuyang


    for a β-thalassemia-carrier couple to have a healthy second baby. We carried out sequencing for single blastomere cells and the family trio and further developed the analysis pipeline, including recovery of the missing alleles, removal of the majority of errors, and phasing of the embryonic genome...... leukocyte antigen matching tests. CONCLUSIONS: This retrospective study in a β-thalassemia family demonstrates a method for embryo genome recovery through single-cell sequencing, which permits detection of genetic variations in preimplantation genetic diagnosis. It shows the potential of single...

  14. α:Non–α and Gγ:Aγ globin chain ratios in thalassemia intermedia patients treated with hydroxyurea

    Directory of Open Access Journals (Sweden)

    Abbas Najjari


    Conclusions: Improvement in α:non-α ratio and consequent decrease of free α-globin chain might be the cause of beneficial effects of hydroxyurea therapy. Two patients who felt better didn't show significant increase in their fetal hemoglobin level, and this is in contradiction with the hypothesis claiming that the HbF level increase is the cause of such therapeutic effect. In spite of the unclear mechanism of action of this drug, hydroxyurea therapy had noticeable impacts on thalassemia intermedia and also sickle cell disease and even patients suffering from thalassemia major.

  15. β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies. (United States)

    Rivella, Stefano


    β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.


    Directory of Open Access Journals (Sweden)

    Seham Ragab


    Full Text Available Background: Cardiac iron toxicity is the leading cause of death among  β-halassaemia major (TM  patients.  Once  heart failure becomes overt , it will be  difficult to reverse . Objectives: To investigate non overt cardiac dysfunctions  in TM patients using  pulsed wave Tissue Doppler  Imaging (TD I and its relation to the iron overload and brain natruritic peptide (BNP. Methods: Thorough  clinical , conventional echo and  pulsed  wave TDI  parameters were compared between  asymtomatic 25 β-TM  patients  and 20 age and gender matched individuals. Serum ferritin and plasma BNP  levels were assayed by  ELISA .  Results: TM patients had significant higher mitral inflow early diastolic (E wave and  non significant other conventional echo  parameters. Pulsed wave TDI revealed systolic and diastolic dysfunctions in the form of significant higher  isovolumetric contraction time (ICT , ejection time ( E T and  isovolumetric relaxation time (IRT with significantly lower  mitral annulus  early diastolic velocity E` (12.07 ±2.06 vs 15.04±2.65 ,P= 0.003  in patients compared to  controls. Plasma BNP was higher in patients compared to the controls.  Plasma BNP and serum ferritin had significant correlation with each other and with pulsed wave conventional and TDI indices of systolic and diastolic functions.  Patients with E/E` ≥ 8 had  significant higher  serum ferritin  and plasma BNP levels compared to those with E/E` ratio < 8 without difference in Hb levels .Conclusion:  Pulsed wave TDI  is an  important diagnostic tool for latent cardiac dysfunction in iron loaded TM patients and is related to iron overload and BNP .

  17. The Diagnostic Value of Pulsed Wave Tissue Doppler Imaging in Asymptomatic Beta- Thalassemia Major Children and Young Adults; Relation to Chemical Biomarkers of Left Ventricular Function and Iron Overload. (United States)

    Ragab, Seham M; Fathy, Waleed M; El-Aziz, Walaa FAbd; Helal, Rasha T


    Cardiac iron toxicity is the leading cause of death among β-halassaemia major (TM) patients. Once heart failure becomes overt, it is difficult to reverse. To investigate non-overt cardiac dysfunctions in TM patients using pulsed wave Tissue Doppler Imaging (TD I) and its relation to iron overload and brain natriuretic peptide (BNP). Thorough clinical, conventional echo and pulsed wave TDI parameters were compared between asymptomatic 25 β-TM patients and 20 age and gender matched individuals. Serum ferritin and plasma BNP levels were assayed by ELISA. TM patients had significant higher mitral inflow early diastolic (E) wave and non significant other conventional echo parameters. In the patient group, pulsed wave TDI revealed systolic dysfunctions, in the form of significant higher isovolumetric contraction time (ICT), and lower ejection time (E T), with diastolic dysfunction in the form of higher isovolumetric relaxation time (IRT), and lower mitral annulus early diastolic velocity E' (12.07 ±2.06 vs 15.04±2.65, P= 0.003) compared to the controls. Plasma BNP was higher in patients compared to the controls. Plasma BNP and serum ferritin had a significant correlation with each other and with pulsed wave conventional and TDI indices of systolic and diastolic functions. Patients with E/E' ≥ 8 had significant higher serum ferritin and plasma BNP levels compared to those with ratio wave TDI is an important diagnostic tool for latent cardiac dysfunction in iron-loaded TM patients and is related to iron overload and BNP.

  18. Percutaneous transhepatic portal vein stenting in a patient with benign non-transplant postoperative portal vein stenosis: A case report


    Madhusudhan, KS; Agrawal, Nikhil; Srivastava, Deep N; Pal, Sujoy; Gupta, Arun K


    Extrahepatic portal vein stenosis is caused by a variety of benign and malignant diseases and results in development of symptoms due to portal hypertension. Benign post-surgical adhesions causing portal vein stenosis in non-transplant population is an uncommon etiology of portal hypertension. Endovascular treatment of such patients with angioplasty and stenting is uncommonly reported in literature. We report a case of portal hypertension caused by benign postoperative portal vein fibrosis, su...

  19. Thalassemia paravertebral tumors and bone marrow scan

    International Nuclear Information System (INIS)

    Huglo, D.; Rose, C.; Deveaux, M.; Bauters, F.; Marchandise, X.


    Two first cousins with thalassemia and with a paravertebral mass had had an indium 111 chloride bone marrow scan. Result of scan influenced therapy: medical treatment in one case where an extramedullary erythropoiesis was confirmed, surgical treatment in the other case. The use of dual-isotope SPECT (indium 111 chloride, HDP -99 Tc) constitutes a contribution to the establishment of diagnosis of extramedullary erythropoiesis, giving to bone marrow scintigraphy a merited importance, avoiding the biopsy. (authors). 15 refs., 5 figs

  20. Increased knowledge of thalassemia promotes early carrier status examination among medical students

    Directory of Open Access Journals (Sweden)

    Julius Broto Dewanto


    A higher thalassemia knowledge score causes medical students to be willing to undergo thalassemia carrier status examination at an earlier point in timing. A well-organized educational program focusing on thalassemia and early screening in young adults may enhance the thalassemia prevention program.

  1. Regional and ethnic distribution of beta thalassemia mutations and effect of consanguinity in patients referred for prenatal diagnosis

    International Nuclear Information System (INIS)

    Hafeez, M.


    To determine the regional and ethnic distribution of beta thalassemia mutation and the effect of consanguinity in patients referred for prenatal diagnosis of beta b-thalassemia and to target the high risk population for screening. A total of 499 couples were referred to Gentec Lab., Lahore, from all over Pakistan for prenatal diagnosis of b-thalassemia. After counseling, chorionic villus sampling was done between 10-16 weeks of gestation. DNA analysis was done by Amplification Refractory Mutation System (ARMS) for type of mutation in the Armed Forces Institute of Pathology, Rawalpindi. Ethnicity, race and consanguineous relationship of parents was determined.b-thalassemia was prevalent in Punjabis (60.7%) followed by Saraikees (25.5%). Castewise it was most frequent in Rajputs followed by Jatts, Arain, Sheikhs and Pathans. 56.7% of the couples were first cousins and 19.8% were relatives. The commonest mutations were Frameshift 8-9 (Fr8-9) 33.5%, Intervening Sequence 1-5 (IVS 1-5) 17.2%, Fr4142 - 8%, IVS 1-1 - 5.2%, Deletion 619 (Del 619) 4.2% and Codon 5 (Cd 5) - 4.2%. In samples sent for analysis, 53.1% turned out to be carriers (trait), 25.3% were diseased (thalassemia major) and 21.6% were normal. P-value of all results was less than 0.001. In this series, the highest frequency was found in Punjabi Rajputs. The commonest mutation was Fr 8-9. Most parents were first cousins. Premarital thalassemia carrier testing can effectively reduce the disease. (author)

  2. Quantitative T2* magnetic resonance imaging for evaluation of iron deposition in the brain of β-thalassemia patients. (United States)

    Akhlaghpoor, S; Ghahari, A; Morteza, A; Khalilzadeh, O; Shakourirad, A; Alinaghizadeh, M R


    Iron overload is a common clinical problem in patients with β-thalassemia major. The purpose of this study was to assess the presence of excess iron in certain areas of the brain (thalamus, midbrain, adenohypophysis and basal ganglia) in patients with β-thalassemia major and evaluate the association with serum ferritin and liver iron content. A cross-sectional study on 53 patients with β-thalassemia major and 40 healthy controls was carried out. All patients and healthy controls underwent magnetic resonance imaging (MRI) examinations of the brain and liver. Multiecho fast gradient echo sequence was used and T2* values were calculated based on the Brompton protocol. Correlations between T2* values in the brain with T2* values in the liver as well as serum ferritin levels were investigated. There were no significant differences between patients and healthy controls with respect to age and sex. Patients had significantly lower T2* values in basal ganglia (striatum), thalamus and adenohypophysis compared to controls while there were no differences in the midbrain (red nucleus). There were no significant correlations between liver T2* values or serum ferritin with T2* values of basal ganglia (striatum), thalamus and adenohypophysis in patients or healthy controls. There were no significant correlations between T2* values of adenohypophysis and thalamus or basal ganglia (striatum) while these variables were significantly correlated in healthy controls. Serum ferritin and liver iron content may not be good indicators of brain iron deposition in patients with β thalassemia major. Nevertheless, the quantitative T2* MRI technique is useful for evaluation of brain iron overload in β thalassemia major patients.

  3. Spectrum of α-thalassemia mutations in Qazvin Province, Iran

    African Journals Online (AJOL)



    Dec 5, 2011 ... α-Thalassemia is a widespread inherited disease particularly prevalent in the middle East Asia population, including Iran. The aim of this study was to define the molecular spectrum and frequency of α-thalassemia mutations in prospective couples of Qazvin province. A total of 120,000 subjects were.

  4. β-Thalassemia and Polycythemia vera : Targeting chronic stress erythropoiesis

    NARCIS (Netherlands)

    Crielaard, Bart J; Rivella, Stefano

    β-Thalassemia and Polycythemia vera are genetic disorders which affect the synthesis of red blood cells, also referred to as erythropoiesis. Although essentially different in clinical presentation - patients with β-thalassemia have an impairment in β-globin synthesis leading to defective

  5. Peripheral Neuropathy: Not a Feature of Childhood Thalassemia

    African Journals Online (AJOL)

    Sedat Işıkay

    an iron chelator, used for transfusion dependent thalassemia patients has been associated with sensorineural and sensorimotor neurotoxicity.[7,8] However, the data in literature regarding the peripheral neuropathy and beta thalassemia is limited. Moreover, there is a gap in literature about the factors that have a role in.

  6. Coinheritance of Β-Thalassemia and Sickle Cell Anaemia

    African Journals Online (AJOL)



    Nov 6, 2016 ... ABSTRACT. BACKGROUND: Genes for haemoglobin S are found in high frequencies in Nigeria. However, there is little information on beta thalassemia in sickle cell anaemia in this population. The clinical presentation of HbS- β thalassemia is enormously variable, ranging from an asymptomatic state to a ...

  7. Marcadores eletrocardiográficos para detecção precoce de doença cardíaca em pacientes com talassemia beta maior Electrocardiographic markers for the early detection of cardiac disease in patients with beta-thalassemia major

    Directory of Open Access Journals (Sweden)

    Kemal Nisli


    Full Text Available OBJETIVO: Analisar comparativamente a dispersão da onda P (DOP em pacientes com talassemia beta maior (β-TM e indivíduos saudáveis (controles para a detecção precoce do risco de arritmias. MÉTODOS: Oitenta e uma crianças com β-TM, com idades entre 4 e 19 anos, e 74 crianças saudáveis (grupo controle foram submetidas a exame eletrocardiográfico e ecocardiograma transtorácico de rotina para avaliação cardíaca. A DOP foi calculada como a diferença entre as durações máxima e mínima da onda P. RESULTADOS: Houve uma diferença estatisticamente significativa entre o grupo de estudo e o grupo controle no pico de velocidade do fluxo transmitral no início da diástole (E e na razão E/fluxo transmitral tardio (A. A duração máxima da onda P e a DOP foram significativamente maiores nos pacientes com β-TM do que nos indivíduos controles. CONCLUSÕES: O aumento da DOP em nossos pacientes com β-TM pode estar relacionado à depressão na condução intra-atrial, devido à dilatação atrial, e ao aumento da atividade simpática. Estes pacientes devem ser acompanhados atentamente devido à possibilidade de ocorrência de arritmias com risco de vida.OBJECTIVE: To comparatively evaluate P-wave dispersion (PWD in patients with β-thalassemia major (TM and healthy control subjects for the early prediction of arrhythmia risk. METHODS: Eighty-one children with β-TM, aged 4-19 years, and 74 healthy children (control group underwent routine electrocardiography and transthoracic echocardiography for cardiac evaluation. PWD was calculated as the difference between the maximum and the minimum P-wave duration. RESULTS: There was a statistically significant difference between study and control groups in peak early (E mitral inflow velocity and E/late (A velocity ratio. Maximum P-wave duration and PWD were found to be significantly higher in β-TM patients than in control subjects. CONCLUSIONS: Increased PWD in our β-TM patients might be related

  8. Relation of anthropometric measurements to ocular biometric changes and refractive error in children with thalassemia. (United States)

    Elkitkat, Rania S; El-Shazly, Amany A; Ebeid, Weam M; Deghedy, Marwa R


    To evaluate and correlate anthropometric, biometric, and refractive error changes in thalassemia major (TM). One hundred children with TM and another hundred healthy controls were recruited. Height, weight, body mass index (BMI), and occipitofrontal circumference (OFC) were the anthropometric parameters recorded. Full ophthalmologic examination was performed, including best-corrected visual acuity, cycloplegic refraction, slit-lamp examination, Goldmann applanation tonometry, indirect ophthalmoscopy, keratometry (K readings), and ocular biometry. Compared to controls, children with TM were shorter and lighter, with a smaller BMI (pbiometric data, patients with thalassemia had steeper mean K readings (p = 0.03), shorter axial length (AXL) (p = 0.005), shorter vitreous chamber depth (pbiometric changes (steeper corneas and thicker lenses) to reach emmetropization, with an exaggerated response and subsequent myopic shift. However, growth retardation is not directly related to ocular growth changes, myopic shift, or variations in biometric parameters.

  9. Some endocrinal aspects of pancreas in beta thalassemia

    Energy Technology Data Exchange (ETDEWEB)

    Badder, M A; Megahed, Y M; Gafer, M; Abdel Kariem, M M [Pediatric dept., faculty of medicine, Zagazig university and Middle eastern regional Radioisotope Center for The Arab Countries, (Egypt)


    The study was carried out to evaluate endocrinal aspects of the pancreas in thalassemia children, ages 5 - 10 years maintained under either regular or irregular iron chelation therapy. A matched control on healthy children, was included for comparison. As regards laboratory findings, fasting and post prandial blood sugar was significantly elevated in thalassemia children than the control and serum insulin was significantly lower in the irregular iron chelation group than both in the regular one and in the control group. Most cases of diabetic thalassemia children clinically and biochemically were of irregular iron chelation and with older age. They were frequently higher transfused. There is significant rise of serum ferritin in diabetic group than in diabetic thalassemia children. In conclusion, pancreatic dysfunction can be detected in thalassemia children, but regular iron chelation can reduce its occurrence. 10 tabs.

  10. Some endocrinal aspects of pancreas in beta thalassemia

    International Nuclear Information System (INIS)

    Badder, M.A.; Megahed, Y.M.; Gafer, M.; Abdel Kariem, M.M.


    The study was carried out to evaluate endocrinal aspects of the pancreas in thalassemia children, ages 5 - 10 years maintained under either regular or irregular iron chelation therapy. A matched control on healthy children, was included for comparison. As regards laboratory findings, fasting and post prandial blood sugar was significantly elevated in thalassemia children than the control and serum insulin was significantly lower in the irregular iron chelation group than both in the regular one and in the control group. Most cases of diabetic thalassemia children clinically and biochemically were of irregular iron chelation and with older age. They were frequently higher transfused. There is significant rise of serum ferritin in diabetic group than in diabetic thalassemia children. In conclusion, pancreatic dysfunction can be detected in thalassemia children, but regular iron chelation can reduce its occurrence. 10 tabs

  11. Subclinical renal abnormalities in young thalassemia major and ...

    African Journals Online (AJOL)

    Amira A.M. Adly


    Aug 11, 2014 ... atinine ratio and urinary b2 microglobulin were measured. Fractional ... characterized by anomalies in the synthesis of the b chains of hemoglobin (Hb) ..... significantly higher serum creatinine and blood urea nitrogen values ...

  12. The epidemiologic transition of thalassemia and associated hemoglobinopathies in southern Taiwan. (United States)

    Wang, Hui-Ching; Hsieh, Li-Ling; Liu, Yi-Chang; Hsiao, Hui-Hua; Lin, Shu-Kai; Tsai, Wen-Chan; Liu, Ta-Chih


    Since 1993, following the National Thalassemia Major Prevention Program and an increase in immigration and interracial marriages, especially in southern Taiwan, the distribution of hemoglobinopathies may have changed. This study investigates the epidemiologic transition of hemoglobinopathies. We analyzed 1870 specimens collected between 2003 and 2012 in southern Taiwan, used gap-polymerase chain reaction and PCR-restriction fragment length polymorphism-based methods, and confirmed genotypes of hemoglobinopathies by DNA sequencing. We found a 91% reduction in the incidence of thalassemia major compared with samples from between 1986 and 1995. The most common genotypes of α-thalassemia and α Hb variants were the SEA type (69.4%) and Hb Quong Sze (1.54%). The most common genotypes of β-thalassemia and β Hb variants were IVS-II-654 (46.2%) and Hb E (2.2%), respectively. Compared with studies performed in different areas of and time intervals in Taiwan, a higher prevalence of -α 3.7 , Hb Quong Sze, and Hb E and a lower prevalence of the SEA type were found in this study. However, the SEA type remained the most common genotype observed. In addition, an increasing number of cases with an -α 3.7 type carrier, Hb Quong Sze carrier, and G γ (A γ δβ)° were identified following a peak of interracial marriages between 2003 and 2005, reflecting a regional difference and the impact of interracial marriage. In conclusion, global migration and international marriage have changed the distribution of hemoglobinopathies in Taiwan. A more comprehensive prenatal screening for new immigrants with a longer follow-up is warranted.

  13. Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

    Directory of Open Access Journals (Sweden)

    Selma Ünal


    Full Text Available OBJECTIVE: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. METHODS: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years with beta-thalassemia major (BTM and 13 beta-thalassemia intermedia (BTI patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13-26 years were included in the study. The control group comprised 100 healthy blood donors. RESULTS: Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM or BTI, or in control group. CONCLUSION: The C282Y mutation, which is supposed to be responsible for the majority of hereditary hemochromatosis, was not found to have a role in the development of hemochromatosis in beta-thalassemia patients and was not detected in a healthy Turkish population. However, research on larger cohorts of individuals is required in order to determine the exact prevalence of the HFE gene mutation in Turkish populations from diverse ethnic origins and whether it would have an impact on iron loading in thalassemic populations.

  14. Hydroxyurea for nontransfusion-dependent β-thalassemia: A systematic review and meta-analysis. (United States)

    Algiraigri, Ali H; Wright, Nicola A M; Paolucci, Elizabeth Oddone; Kassam, Aliya


    Nontransfusion-dependent β-thalassemia (NTDβT) syndromes consist of β-thalassemia intermedia and moderate hemoglobin E/β thalassemias. They are characterized by varying degrees of chronic anemia and a wide spectrum of complications due to ineffective erythropoiesis and iron overload from chronic transfusions. Hydroxyurea (HU), an oral chemotherapeutic drug, is anticipated to decrease disease severity. We performed a meta-analysis to evaluate the clinical efficacy and safety of HU in NTDβT patients of any age. MEDLINE, EMBASE, Cochrane databases, and major conference proceedings for studies that assessed HU in NTDβT patients were searched. Qualities of eligible studies were assessed by National Institutes of Health tools. Seventeen studies, collectively involving 709 patients, fulfilled the eligibility criteria. HU was associated with a significant decrease in transfusion need in severe NTDβT with complete and overall (≥50%) response rates of 42% and 79%, respectively. For mild NTDβT, HU was effective in raising hemoglobin by 1g/L in 64% of patients. HU appears to be effective, well tolerated, and associated with mild and transient adverse events. NTDβT patients may benefit from a trial of HU, although large randomized clinical trials assessing its efficacy should be conducted to confirm the findings of this meta-analysis and to assess its long-term toxicity and response sustainability. Copyright © 2017 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

  15. Social Determinants of Health from the Perspective of Women with Thalassemia: A Qualitative Study

    Directory of Open Access Journals (Sweden)

    Aboo Torab Talebi


    Full Text Available Background and Objective: In recent years, social determinants of health have received much attention from researchers in the social sciences. One of the major problems of the health sector in developing countries is the unequal distribution of health which leads to inequalities in social status and living conditions of people. The purpose of this study was to identify and describe the social determinants of health from the perspective of women with the Thalassemia disease.Materials and Methods: This study is a qualitative and thematic analysis. Participants in the study were 24 women with Thalassemia disease. The sampling method was purposeful. To collect qualitative data observation and participation, semi-structured interviews and study of the documents were used. For data analysis, thematic analysis and Wolcott method were used.Results: Social determinants of health from the perspective of women with thalassemia included economic factors (lack of interest-free banking facilities, health expenditure, social factors (inequality in employment, cultural factors (lack of awareness in society and health factors (inefficient health services.Conclusion: If the needs of disadvantaged people, women, and patients in the design and management of the health system be considered, health system performance would be desirable.

  16. Intracranial extramedullary hematopoiesis in patients with thalassemia: a case report and review of the literature. (United States)

    Eskazan, Ahmet Emre; Ar, Muhlis Cem; Baslar, Zafer


    Extramedullary hematopoiesis (EH) is a compensatory phenomenon that results in the production of blood cell precursors outside the marrow in patients with chronic hemolytic anemia and ineffective erythropoiesis. EH usually involves the liver, spleen, and lymph nodes. It can also be found at paravertebral, intrathoracic, or pelvic locations. Intracranial EH is a rare entity and often asymptomatic but can sometimes lead to symptomatic tumor-like masses. Treatment options are controversial and include hypertransfusion, surgical excision, radiotherapy, and hydroxyurea (HU). Successful treatment of an intracranial EH mass with HU and blood transfusions in a beta-thalassemia major patient was discussed along with a review of the published literature on intracranial EH in thalassemia. In our patient, the extramedullary hematopoietic mass in the interhemispheric fissure showed a marked improvement after 6 months of HU and hypertransfusion therapy. In the English literature, there are a few cases with intracranial EH and thalassemia, which were treated with different treatment modalities, with different outcomes. There is no standard treatment approach in patients with symptomatic EH. HU with hypertransfusion regimen is a reasonable first-choice modality in treating intracranial EH masses. © 2012 American Association of Blood Banks.


    Directory of Open Access Journals (Sweden)

    Ariel Koren


    Full Text Available Background:β Thalassemia major is characterized by hemolytic anemia, ineffectiveerythropoiesis and hemosiderosis. About 4 % of the world population carries a Thalassemiagene. Management includes blood transfusions and iron chelation, this treatmentis costly and population screening may be significantly more cost benefit. Purpose: Thepurpose of the current study is to analyze the cost of running a preventionprogram for β Thalassemia in Israel and compare it to the actual expensesincurred by treating Thalassemia patients. Methods: Threecost parameters were analyzed and compared: The prevention program, routinetreatment of patients and treatment of complications. An estimation of theexpenses needed to treat patients that present with complications werecalculated based on our ongoing experience in treatment of deterioratingpatients. Results andConclusions: The cost of preventing one affected newborn was $63,660 comparedto $1,971,380 for treatment of a patient during 50 years (mean annual cost:  $39,427. Thus, the prevention of 45 affectednewborns over a ten years period represents a net saving of $88.5 million tothe health budget. Even after deducting the cost of the prevention program ($413.795/yr., the program still represents abenefit of $ 76 million over ten years. Each prevented case could pay thescreening and prevention program for 4.6 ys.

  18. Spinal cord compression due to extramedullary hematopoiesis in beta-thalassemia intermedia

    International Nuclear Information System (INIS)

    Munn, Rita K.; Kramer, Carol A.; Arnold, Susanne M.


    Background: Extramedullary hematopoiesis (EMH) occurs in many disorders, including thalassemias and other hemoglobinopathies, and commonly presents in the spleen and liver. We present a case of spinal cord compression in a patient with beta-thalassemia intermedia, and review the literature and available treatment options. Patient and Methods: A 35-year-old black female with beta-thalassemia intermedia presented with a 3-week history of back pain and lower extremity weakness. Neurologic examination was consistent with spinal cord compression, and gadolinium enhanced magnetic resonance imaging (MRI) confirmed this diagnosis. She was given intravenous steroids and radiotherapy was begun in 200 cGy fractions to a total dose of 2000 cGy. Results: At the completion of radiotherapy the patient was ambulatory with mild residual weakness. MRI scans 16 months later showed smaller, but persistent masses, and she remains asymptomatic 5 years from her diagnosis. Conclusion: Recognition of spinal cord EMH requires prompt physical examination and MRI for accurate diagnosis. EMH can be managed with radiation, surgery, transfusions, or a combination of these therapies. Radiation in conservative doses of (750-3500 cGy) is non-invasive, avoids the surgical risks of potentially severe hemorrhage and incomplete resection, and has a high complete remission rate in the majority of patients. Relapse rates are moderate (37.5%), but retreatment provides excellent chance for second remission

  19. Partial Splenectomy in the treatment of an adult with β thalassemia intermedia: A case report. (United States)

    Correia, João Guardado; Moreira, Nídia; Costa Almeida, Carlos Eduardo; Reis, Luís Simões


    Thalassemia is a common disease which treatment is often based on splenectomy. The risks associated with total splenectomy stimulated partial splenectomy as a potentially alternative therapy. A 45 year-old female patient with long term follow-up for β thalassemia intermedia started to develop signs of hypersplenism and iron overload. A partial splenectomy was performed and was observed a marked hematologic improvement while preserving the desired splenic function. Partial splenectomy proved to provide a persistent decrease in hemolytic rate while preserving the integrity of splenic phagocytic function, presenting itself as an effective alternative to total splenectomy. After being subjected to partial splenectomy, our patient experienced a sustained control of hemolysis and showed no signs of hypersplenism or iron overload. No splenic regrowth or infectious complications were observed. The major drawbacks of partial splenectomy are the increased risk of intra- and postoperative bleeding, splenic remnant torsion and splenic regrowth. Partial splenectomy is an alternative to total splenectomy for the treatment of adult β Thalassemia intermedia patients avoiding the risks associated with total splenectomy.

  20. Fetal red blood cell parameters in thalassemia and hemoglobinopathies. (United States)

    Karnpean, Rossarin; Fucharoen, Goonnapa; Fucharoen, Supan; Ratanasiri, Thawalwong


    With the lack of fetal blood specimens in routine practice, little is known about red blood cell (RBC) parameters of fetuses with various thalassemia syndromes. This study aimed to describe these in various forms of thalassemia. The study was performed on 93 fetal blood specimens obtained from pregnant women by cordocentesis during 18-24 weeks of gestation. RBC parameters were recorded on automated analyzer. Hemoglobin (Hb) and DNA analyses were performed for definite genotyping. No significant difference in RBC parameters was observed between non-thalassemic fetuses and those with β-thalassemia trait, Hb E trait, homozygous Hb E and β-thalassemia/Hb E disease. However, in those with α(0)-thalassemia trait and double heterozygous α(0)-thalassemia/Hb E, slight reduction in mean corpuscular volume (MCV) was noted. Fetuses with the Hb H disease showed significant reductions in Hb, MCV and mean corpuscular Hb (MCH). Marked reductions in Hb, hematocrit, MCH and mean cell Hb concentration and increased RBC distribution width with numerous nucleated RBC were clearly observed in Hb Bart's hydrops fetalis. Simple analysis of fetal RBC parameters is useful for making presumptive prenatal diagnosis of α-thalassemia syndromes including Hb H disease and Hb Bart's hydrops fetalis which can then be confirmed by Hb and DNA analyses. Copyright © 2013 S. Karger AG, Basel.

  1. Intracranial Extramedullary Hematopoiesis in Beta-Thalassemia

    International Nuclear Information System (INIS)

    Karki, Bivek; Xu, Yi Kai; Wu, Yuan Kui; Tamrakar, Karuna


    Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

  2. Intracranial extramedullary hematopoiesis in beta-thalassemia. (United States)

    Karki, Bivek; Xu, Yi-Kai; Tamrakar, Karuna; Wu, Yuan-Kui


    Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

  3. Intracranial Extramedullary Hematopoiesis in Beta-Thalassemia

    Energy Technology Data Exchange (ETDEWEB)

    Karki, Bivek; Xu, Yi Kai; Wu, Yuan Kui [Nan fang Hospital, Southern Medical University, Guangzhou (China); Tamrakar, Karuna [Zhujiang Hospital, Southern Medical University, Guangzhou (China)


    Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

  4. Diagnostic Value of N Terminal Pro B Type Natriuretic Peptide (NT-pro BNP in Cardiac Involvement in Patients with Beta- Thalassemia

    Directory of Open Access Journals (Sweden)

    Noor Mohammad Noori


    Full Text Available Background Heart failure is a major cause of death in thalassemia. The study aimed to determine the diagnostic value of N Terminal Pro B Type Natriuretic Peptide (NT-pro BNP, to early diagnose the cardiac involvement in beta- thalassemia major patients. Materials and Methods  80 thalassemia patients aged 7 to 18 years old (patients group, and 80 healthy age and gender matched controls were enrolled in the case-control study. Patients were selected from those attending to the clinic of Aliasghar hospital, Zahedan-Iran. They were subjected to echo-Doppler tissue and conventional examination for both right and left heart function. Data were analysis using SPSS 18.0 software. Results  NT-pro BNP increased in patients compared the controls (P

  5. A study of membrane protein defects and alpha hemoglobin chains of red blood cells in human beta thalassemia

    International Nuclear Information System (INIS)

    Rouyer-Fessard, P.; Garel, M.C.; Domenget, C.; Guetarni, D.; Bachir, D.; Colonna, P.; Beuzard, Y.


    The soluble pool of alpha hemoglobin chains present in blood or bone marrow cells was measured with a new affinity method using a specific probe, beta A hemoglobin chain labeled with [ 3 H]N-ethylmaleimide. This pool of soluble alpha chains was 0.067 ± 0.017% of hemoglobin in blood of normal adult, 0.11 ± 0.03% in heterozygous beta thalassemia and ranged from 0.26 to 1.30% in homozygous beta thalassemia intermedia. This elevated pool of soluble alpha chains observed in human beta thalassemia intermedia decreased 33-fold from a value of 10% of total hemoglobin in bone marrow cells to 0.3% in the most dense red blood cells. The amount of insoluble alpha chains was measured by using the polyacrylamide gel electrophoresis in urea and Triton X-100. In beta thalassemia intermedia the amount of insoluble alpha chains was correlated with the decreased spectrin content of red cell membrane and was associated with a decrease in ankyrin and with other abnormalities of the electrophoretic pattern of membrane proteins. The loss and topology of the reactive thiol groups of membrane proteins was determined by using [ 3 H]N-ethylmaleimide added to membrane ghosts prior to urea and Triton X-100 electrophoresis. Spectrin and ankyrin were the major proteins with the most important decrease of thiol groups

  6. Percutaneous transhepatic portal vein stenting in a patient with benign non-transplant postoperative portal vein stenosis: A case report

    Directory of Open Access Journals (Sweden)

    KS Madhusudhan


    Full Text Available Extrahepatic portal vein stenosis is caused by a variety of benign and malignant diseases and results in development of symptoms due to portal hypertension. Benign post-surgical adhesions causing portal vein stenosis in non-transplant population is an uncommon etiology of portal hypertension. Endovascular treatment of such patients with angioplasty and stenting is uncommonly reported in literature. We report a case of portal hypertension caused by benign postoperative portal vein fibrosis, successfully treated by self-expandable metallic stent.


    Directory of Open Access Journals (Sweden)

    Paolo Cianciulli


    Full Text Available Transfusional hemosiderosis is a frequent complication in patients with transfusion dependent chronic diseases such as  thalassemias and severe type of sickle cell diseases. As there are no physiological mechanisms to excrete the iron contained in transfused red cells (1 unit of blood contains approximately 200 mg of iron the excess of iron is stored in various organs. Cardiomyopathy is the most severe complication covering more than 70% of the causes of death of thalassemic patients. Although the current reference standard iron chelator deferoxamine (DFO has been used clinically for over four decades, its effectiveness is limited by a demanding therapeutic regimen that leads to poor compliance. Despite poor compliance, because of the inconvenience of subcutaneous infusion, DFO improved considerably the survival and quality of life of patients with thalassemia. Deferiprone since 1998 and Deferasirox since 2005 were licensed for clinical use. The oral chelators have a better compliance because of oral use, a comparable efficacy to DFO in iron excretion and probably a better penetration to myocardial cells. Considerable increase in iron excretion was documented with combination therapy of DFO and Deferiprone. The proper use of the three chelators will improve the prevention and treatment of iron overload, it will reduce  complications, and improve survival and quality of life of transfused patients


    Directory of Open Access Journals (Sweden)

    Marco Marziali


    Full Text Available Hematopoietic stem cell transplantation (HSCT still remains the only definitive cure currently available for patients with thalassemia and sickle cell anemia.  Results of transplant in thalassemia  and in sickle cell anemia  have steadily improved over the last two decades due to improvements in preventive strategies, and effective control of transplant-related complications. From 2004 through  2009,  145 consecutive patients with thalassemia and sickle cell anemia, ethnically heterogeneous from Mediterranean and Middle East countries, were given HSCT in the International Center for Transplantation in Thalassemia and Sickle Cella Anemia in Rome. This experience is characterized by two peculiarities: patients were ethnically very heterogeneous and the vast majority of these patients were not regularly transfesed/chelated and therefore were highly sensitized due to RBC transfusions without leukodepletion filters. Consequently, they could have a high risk of graft rejection as a result of sensitization to HLA antigens. The Rome experience of SCT in patients with thalassemia and sickle cell anemia confirmed the results obtained in Pesaro, and most importantly showed the reproducibility of these results in other centers.

  9. Quantitative assessment of metal dysregulation in β-thalassemia patients in comparison with healthy controls by ICP-MS and chemometric analyses. (United States)

    Farooq, Sabiha; Mazhar, Wardah; Siddiqui, Amna Jabbar; Ansari, Saqib Hussain; Musharraf, Syed Ghulam


    β-Thalassemia is one of the most common inherited disorders and is widely distributed throughout the world. Owing to severe deficiencies in red blood cell production, blood transfusion is required to correct anemia for normal growth and development but causes additional complications owing to iron overload. The aim of this study is to quantify the biometal dysregulations in β-thalassemia patients as compared with healthy controls. A total of 17 elements were analyzed in serum samples of β-thalassemia patients and healthy controls using ICP-MS followed by chemometric analyses. Out of these analyzed elements, 14 showed a significant difference between healthy and disease groups at p 3. A PLS-DA model revealed an excellent separation with 89.8% sensitivity and 97.2% specificity and the overall accuracy of the model was 92.2%. This metallomic study revealed that there is major difference in metallomic profiling of β-thalassemia patients specifically in Co, Mn, Ni, V and Ba, whereas the fold changes in Co, Mn, V and Ba were found to be greater than that in Fe, providing evidence that, in addition to Fe, other metals are also altered significantly and therefore chelation therapy for other metals may also needed in β-thalassemia patients. Copyright © 2018 John Wiley & Sons, Ltd.

  10. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations. (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth


    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  11. Tracheostomy as a bridge to spontaneous breathing and awake-ECMO in non-transplant surgical patients. (United States)

    Swol, J; Strauch, J T; Schildhauer, T A


    The tracheostomy is a frequently used procedure for the respiratory weaning of ventilated patients allows sedation free ECLS use in awake patient. The aim of this study is to assess the possibility and highlight the benefits of lowering the impact of sedation in surgical non-transplant patients on ECLS. The specific objective was to investigate the use of tracheostomy as a bridge to spontaneous breathing on ECLS. Of the 95 patients, 65 patients received a tracheostomy, and 5 patients were admitted with a tracheostoma. One patient was cannulated without intubation, one is extubated during ECLS course after 48 hours. 4 patients were extubated after weaning and the removal of ECLS. 19 patients died before the indication to tracheostomy was given. Tracheostomy can bridge to spontaneous breathing and awake-ECMO in non-transplant surgical patients. The "awake ECMO" strategy may avoid complications related to mechanical ventilation, sedation, and immobilization and provide comparable outcomes to other approaches for providing respiratory support. © 2017 The Authors. European Journal of Heart Failure © 2017 European Society of Cardiology.


    Directory of Open Access Journals (Sweden)

    Maria Cristina Rosatelli


    Moreover, in order to reduce the choice of   interrupting  the pregnancy in case of affected fetus, Preimplantation or Preconceptional Genetic Diagnosis (PGD has been setting up for several diseases including thalassemias.

  13. Study on Moessbauer spectra of hemoglobin in thalassemia

    International Nuclear Information System (INIS)

    Guo Xuanhui; Zhao Nanming; Zhang Xiufang


    The 57 Fe Moessbauer spectra of erythrocytes in normal subjects and nine patients of different thalassemias were studied. Together with clinical analysis, the correlation between the components in the spectra and different types of anemias was discussed. (orig.)

  14. Study on Mössbauer spectra of hemoglobin in thalassemia (United States)

    Xuanhui, Guo; Nanming, Zhao; Xiufang, Zhang; Naifei, Gao; Youwen, Huang; Rongxin, Wang


    The57Fe Mössbauer spectra of erythrocytes in normal subjects and nine patients of different thalassemias were studied. Together with clinical analysis, the correlation between the components in the spectra and different types of anemias was discussed.

  15. Atypical location of extramedullary hematopoietic masses in thalassemia

    International Nuclear Information System (INIS)

    Gemenis, T.; Philippou, A.; Gouliamos, A.; Kalovidouris, A.; Papavasiliou, C.; Papacharalambus, X.; Panani, A.; Chalevelakis, G.; Raptis, S.


    A case of β-thalassemia with multiple foci of extramedullary hematopoiesis (EH) is reported. EH masses were demonstrated in the presacral and the costovertebral space. EH foci were also encountered in the spleen. (orig.) [de

  16. RESEARCH ARTICLE The prevalence and spectrum of thalassemia ...

    Indian Academy of Sciences (India)


    Thalassemia is the most common autosomal recessive disorder worldwide (Joly et al. ... results from a gross gene deletion (Bank 2015; Colah et al. ... France) to assess the concentration of hemoglobin (Hb) A, A2, and F, and any abnormal.

  17. Echocardiographic evaluation of thalassemia intermedia patients in Duhok, Iraq. (United States)

    Mohammad, Ameen Mosa


    Cardiac complications are among the most serious problems of thalassemia intermedia patients. The current study was initiated to address the latter issue through the study of the echocardiographic findings and correlate it with clinical characteristics of thalassemia intermedia patients in Duhok, Kurdistan region, Iraq. An echocardiographic assessment of 61 beta-thalassemia intermedia cases was performed. It included 30 males and 31 females, with a mean age 19.6 ± 7.5 years. The standard echostudy of two-dimension and M-mode measurements of cardiac chambers were done. The continuous doppler regurgitant jet of tricuspid and pulmonary valves were recorded. Left ventricle diastolic function was assessed by pulsed doppler of mitral valve inflow. To correlate the clinical with echocardiographic findings, patients were divided, according to tricuspid regurgitant velocity, into three groups (intermedia patients. Therapeutic trails targeting these complications are indicated, and echocardiographic assessment is necessary to be offered early for thalassemia intermedia.

  18. Hematopoietic Stem Cell Transplantation in Thalassemia and Sickle Cell Anemia (United States)

    Lucarelli, Guido; Isgrò, Antonella; Sodani, Pietro; Gaziev, Javid


    The globally widespread single-gene disorders β-thalassemia and sickle cell anemia (SCA) can only be cured by allogeneic hematopoietic stem cell transplantation (HSCT). HSCT treatment of thalassemia has substantially improved over the last two decades, with advancements in preventive strategies, control of transplant-related complications, and preparative regimens. A risk class–based transplantation approach results in disease-free survival probabilities of 90%, 84%, and 78% for class 1, 2, and 3 thalassemia patients, respectively. Because of disease advancement, adult thalassemia patients have a higher risk for transplant-related toxicity and a 65% cure rate. Patients without matched donors could benefit from haploidentical mother-to-child transplantation. There is a high cure rate for children with SCA who receive HSCT following myeloablative conditioning protocols. Novel non-myeloablative transplantation protocols could make HSCT available to adult SCA patients who were previously excluded from allogeneic stem cell transplantation. PMID:22553502

  19. Thalassemia, extramedullary hematopoiesis, and spinal cord compression: A case report


    Bukhari, Syed Sarmad; Junaid, Muhammad; Rashid, Mamoon Ur


    Background: Extramedullary hematopoiesis (EMH) refers to hematopoiesis outside of the medulla of the bone. Chronic anemia states such as thalassemia can cause hematopoietic tissue to expand in certain locations. We report a case of spinal cord compression due to recurrent spinal epidural EMH, which was treated with a combination of surgery and radiotherapy. Pakistan has one of the highest incidence and prevalence of thalassemia in the world. We describe published literature on diagnosis and m...

  20. Molecular basis for dominantly inherited inclusion body β-thalassemia

    International Nuclear Information System (INIS)

    Thein, S.L.; Hesketh, C.; Wood, W.G.; Clegg, J.B.; Old, J.M.; Weatherall, D.J.; Taylor, P.; Temperley, I.J.; Hutchinson, R.M.


    Analysis of the molecular basis of dominantly inherited β-thalassemia in four families has revealed different mutations involving exon 3 of the β-globin gene. It is suggested that the phenotypic difference between this condition and the more common recessive forms of β-thalassemia lies mainly in the length and stability of the abnormal translation products that are synthesized and, in particular, whether they are capable of binding heme and producing aggregations that are relatively resistant to proteolytic degradation

  1. Attitudes and beliefs among high- and low-risk population groups towards β-thalassemia prevention: a cross-sectional descriptive study from India. (United States)

    Chawla, Swati; Singh, Rajnish Kumar; Lakkakula, Bhaskar V K S; Vadlamudi, Raghavendra Rao


    β-thalassemia is an autosomal recessive blood disorder caused by gene mutations that affect all aspects of β-globin production. In majority of Asian countries including India, the frequency of β-thalassemia is closely intertwined with social, cultural, and religious issues of the respective country. Several national level screening programs imparted education regarding β-thalassemia, but follow-up evaluation revealed that education was not effective. It has been hypothesized that the beliefs and attitudes, carrier screening, and education among "high risk communities" will have far-reaching implications towards β-thalassemia prevention in the country. The present study is aimed to investigate attitudes, intention, and behavior of β-thalassemia high- and low-risk ethnic groups towards carrier screening and education. A structured questionnaire on knowledge, attitude, and practice regarding β-thalassemia was administered on 926 individuals belong to Arora, a high-risk ethnic group for β-thalassemia (347 rural (AR) and 202 urban (AU)) and 377 cosmopolitan commoners (CC) aged above 18 years of both sexes. To understand the relationship between various questions, Pearson's correlation test and factor analysis was performed. The responses were further categorized into the theory of planned behavior (TPB) constructs with the measures of the main constructs reported as a mean. Various dimensions of knowledge, attitude, and practice reveal that the urban groups (AU and CC) are better aware of the disease "β-thalassemia" than the rural group (AR) who witness suffering at close quarters. The AR group is more positive for preventive measures than the urban groups. Significant correlations and factor analysis show "intentions" for premarital and prenatal screening highly loaded as outcome behaviors. The Ajzen's "Theory of planned behavior" support that the "intention" and "perceived behavior control" are better predictors of "outcome behavior" compared to "attitude


    Directory of Open Access Journals (Sweden)

    Seham Ragab


    Full Text Available Background  :Serum haptoglobin (Hp is a reliable marker for hemolysis regardless the inflammatory state.  Objective: We investigated the possible relation between Hp depletion and hemolysis severity, hepatitis C virus (HCV infection and iron load in β-thalassemia children. Methods: Twenty  two β-thalassemia major (TM ,20 β-thalassemia  intermedia (TI children with 20 age and sex matched healthy controls were involved. Pre-transfusion hemoglobin level was considered . Serum ferritin , Hp  and transferrin receptor  levels (sTfR  (by ELISA , alanine aminotransferase (ALT and  aspartate aminotransferase (AST  (by colorimetric method were assayed. Markers of hepatitis C virus  (HCV  were done by PCR. Results:  The mean Hp levels among the studied groups were as follows; 8.02 ± 0.93 (mg/dl , 8.6 ±0.72 (mg/dl  and 122  ± 18.5(mg/dl   for TM ,TI and the controls respectively . Both patient groups had significantly lower Hp level compared to the controls (P<0.0001  with significant lower level in TM compared to TI  children ( P= 0.034  .Significant inverse correlations were  found between serum Hp and sTfR levels in thalassemia children combined and in each group (TM and TI as well as among HCV infected children. STfR   was the only significant independent predictor for  serum Hp level (t= -5.585 , P<0.0001 . Among  HCV infected patients , no significant correlation was found between serum Hp and serum transaminases  .Conclusion:  Serum Hp depletion in thalassemia had significant relation to disease severity and correlated   well with their erythropoietic activity, as assessed by the measurement of  sTfR without significant relation  HCV infection . Large sample  multicenter studies are  recommended.

  3. Molecular Diagnosis of Thalassemias and Hemoglobinopathies: An ACLPS Critical Review. (United States)

    Sabath, Daniel E


    To describe the use of molecular diagnostic techniques for patients with hemoglobin disorders. A clinical scenario is presented in which molecular diagnosis is important for genetic counseling. Globin disorders, techniques for their diagnosis, and the role of molecular genetic testing in managing patients with these disorders are described in detail. Hemoglobin disorders, including thalassemias and hemoglobinopathies, are among the commonest genetic diseases, and the clinical laboratory is essential for the diagnosis of patients with these abnormalities. Most disorders can be diagnosed with protein-based techniques such as electrophoresis and chromatography. Since severe syndromes can result due to inheritance of combinations of globin genetic disorders, genetic counseling is important to prevent adverse outcomes. Protein-based methods cannot always detect potentially serious thalassemia disorders; in particular, α-thalassemia may be masked in the presence of β-thalassemia. Deletional forms of β-thalassemia are also sometimes difficult to diagnose definitively with standard methods. Molecular genetic testing serves an important role in identifying individuals carrying thalassemia traits that can cause adverse outcomes in offspring. Furthermore, prenatal genetic testing can identify fetuses with severe globin phenotypes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail:

  4. Prevalence of hepatosplenomegaly in beta thalassemia minor subjects in Iran

    Energy Technology Data Exchange (ETDEWEB)

    Karimi, Mehran [Hemostasis and Thrombosis Unit, Hematology Research Center, school of Medicine, Shiraz University of medical sciences, Shiraz (Iran, Islamic Republic of)], E-mail:; Bagheri, Mohammad Hadi [Department of Radiology, School of Medicine, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of); Tahmtan, Mehdi [Hemostasis and Thrombosis Unit, Hematology Research Center, school of Medicine, Shiraz University of medical sciences, Shiraz (Iran, Islamic Republic of); Shakibafard, Alireza [Department of Radiology, School of Medicine, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of); Rashid, Murtaza [Hemostasis and Thrombosis Unit, Hematology Research Center, school of Medicine, Shiraz University of medical sciences, Shiraz (Iran, Islamic Republic of)


    Introduction: Thalassemia is the most common hereditary blood disorder in the world. Iran is located on the thalassemic belt and there is a high prevalence of the hepatosplenomegaly in beta thalassemia minor patients which is reported to be very variable. The goal of this research was to study the frequency of these signs in the cases with beta thalassemia minor patients in Iran. Materials and methods: Two hundred and fifty-nine cases that referred to center for pre-marriage tests were divided into two groups according to their MCV, MCH, and HbA2 (beta thalassemia minor cases and control groups). Liver and spleen sizes were determined by ultrasonographic method and the two groups were compared with each other. Results: Average spleen volumes in case and control groups were 163.48 {+-} 133.97 and 126.29 {+-} 53.98 mm{sup 3}, respectively. Average spleen lengths in case and control groups were 10.71 {+-} 1.52 and 10.60 {+-} 5.4 cm, respectively. Conclusion: In the regions with high frequency of beta thalassemia, in case of finding large spleen size in the ultrasonography, a probable harmless differential diagnosis will be beta thalassemia minor that is not indicative of any serious disease. Volumetric measurement of spleen is more reliable for detection of splenomegaly in these patients.

  5. Recent trends in the gene therapy of β-thalassemia (United States)

    Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto


    The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

  6. Altered erythropoiesis and iron metabolism in carriers of thalassemia (United States)

    Guimarães, Jacqueline S.; Cominal, Juçara G.; Silva-Pinto, Ana Cristina; Olbina, Gordana; Ginzburg, Yelena Z.; Nandi, Vijay; Westerman, Mark; Rivella, Stefano; de Souza, Ana Maria


    The thalassemia syndromes (α- and β-thalassemia) are the most common and frequent disorders associated with ineffective erythropoiesis. Imbalance of α- or β-globin chain production results in impaired red blood cell synthesis, anemia and more erythroid progenitors in the blood stream. While patients affected by these disorders show definitive altered parameters related to erythropoiesis, the relationship between the degree of anemia, altered erythropoiesis and dysfunctional iron metabolism have not been investigated in both α-thalassemia carriers (ATC) and β-thalassemia carriers (BTC). Here we demonstrate that ATC have a significantly reduced hepcidin and increased soluble transferrin receptor levels but relatively normal hematological findings. In contrast, BTC have several hematological parameters significantly different from controls, including increased soluble transferrin receptor and erythropoietin levels. These changings in both groups suggest an altered balance between erythropoiesis and iron metabolism. The index sTfR/log ferrin and (hepcidin/ferritin)/sTfR are respectively increased and reduced relative to controls, proportional to the severity of each thalassemia group. In conclusion, we showed in this study, for the first time in the literature, that thalassemia carriers have altered iron metabolism and erythropoiesis. PMID:25307880

  7. Prevalence of hepatosplenomegaly in beta thalassemia minor subjects in Iran

    International Nuclear Information System (INIS)

    Karimi, Mehran; Bagheri, Mohammad Hadi; Tahmtan, Mehdi; Shakibafard, Alireza; Rashid, Murtaza


    Introduction: Thalassemia is the most common hereditary blood disorder in the world. Iran is located on the thalassemic belt and there is a high prevalence of the hepatosplenomegaly in beta thalassemia minor patients which is reported to be very variable. The goal of this research was to study the frequency of these signs in the cases with beta thalassemia minor patients in Iran. Materials and methods: Two hundred and fifty-nine cases that referred to center for pre-marriage tests were divided into two groups according to their MCV, MCH, and HbA2 (beta thalassemia minor cases and control groups). Liver and spleen sizes were determined by ultrasonographic method and the two groups were compared with each other. Results: Average spleen volumes in case and control groups were 163.48 ± 133.97 and 126.29 ± 53.98 mm 3 , respectively. Average spleen lengths in case and control groups were 10.71 ± 1.52 and 10.60 ± 5.4 cm, respectively. Conclusion: In the regions with high frequency of beta thalassemia, in case of finding large spleen size in the ultrasonography, a probable harmless differential diagnosis will be beta thalassemia minor that is not indicative of any serious disease. Volumetric measurement of spleen is more reliable for detection of splenomegaly in these patients

  8. Non-transfusion Dependent Thalassemias: A Developing Country Perspective. (United States)

    Mukherjee, Somnath; Das, Rashmi R; Raghuwanshi, Babita


    Non-transfusion-dependent thalassemias (NTDT) encompass a group of hereditary chronic hemolytic anemia, which, as the name indicates, not require regular blood transfusion for survival. These include β-thalassemia intermedia, hemoglobin E/β-thalassemia, and Hemoglobin H disease (α- thalassemia intermedia). Individuals with structural variant of hemoglobin especially Hemoglobin S and Hemoglobin C associated with "α" or "β" thalassemia in heterozygous condition may also present with similar features of NTDT. NTDT patients are not immune to the development of transfusion unrelated complications in the long run. These hereditary chronic hemolytic anemias are still under-recognized in developing countries like India, where the disease burden might be high causing significant morbidity. The pathophysiologic hallmark that characterizes this group of disorders (ineffective erythropoiesis, hemolysis, chronic anemia) leads to a number of serious complications, similar to transfusion dependent thalassemia. So, timely diagnosis and institution of appropriate preventive/remedial measures as well as education of patient population can help decrease the morbidity to a significant extent. In the present review, focus will be on the pathophysiological mechanisms and available management options of NTDT from a developing country perspective like India.

  9. Quality of Life in Children with Thalassemia and their Caregivers in India. (United States)

    Sharma, Sapna; Seth, Bageshree; Jawade, Prashant; Ingale, Madhavi; Setia, Maninder Singh


    To assess and compare the Quality of Life (QOL) of children with beta-thalassemia major on regular transfusion therapy with normal children, and of the caregivers of children with beta-thalassemia major to that of caregivers of normal children. A cross-sectional comparison of QOL in 75 thalassemic and 80 non-thalassemic children was conducted using the PedsQL™ 4.0 generic core scale. Also self-rated health was assessed in their caregivers using Short Form-36 Health Survey. The total QOL score according to child-self report [83.7 (10.8) vs. 97.6 (3.3); p < 0.001] and parent-proxy report [84.2 (11.9) vs. 96.7 (3.5); p < 0.001] was significantly lower in cases as compared with controls. It was found that a significantly higher proportion of caregivers of cases reported poor health compared with caregivers of controls (29.2% vs. 2.5%, p < 0.001). Even after adjusting for age, sex, socio-economic status, and total QOL score by the parent, it was found that caregivers of thalassemic children were significantly more likely to report poor health compared with those of controls (odds ratio: 15.8, 95% confidence intervals: 2.8-89.9). Health Related QOL is significantly affected in children with beta-thalassemia major on regular transfusion across all age groups, gender and socio-economic classes and also in their caregivers.

  10. beta-thalassaemia major hos børn og unge i Danmark

    DEFF Research Database (Denmark)

    Jung, Anne; Main, Katharina Maria; Scheibel, Elma


    INTRODUCTION: Beta-thalassemia major occurs with increasing frequency among Danish children as a result of immigration. The aim of the study was to estimate the occurrence of beta-thalassemia major in Denmark, analyse the treatment and organ functions, and identify areas for an improved treatment...... strategy. MATERIAL AND METHODS: During 1998-99 all Danish pediatric departments were contacted for identification of children aged 0-18 years with beta-thalassemia major. Blood transfusions and chelation therapy were registered, and for Eastern Denmark clinical, endocrine, cardiac, and serologic parameters...... were performed. RESULTS: Twenty-six children had beta-thalassemia major. Out of these, 20 received blood transfusions, and 17 patients were chelated. Eight patients were not chelated owing to previous bone marrow transplantation, treatment with hydroxyurea or ferritin

  11. Beta-thalassaemia major hos børn og unge i Danmark

    DEFF Research Database (Denmark)

    Jung, A.; Main, K.M.; Scheibel, E.


    INTRODUCTION: Beta-thalassemia major occurs with increasing frequency among Danish children as a result of immigration. The aim of the study was to estimate the occurrence of beta-thalassemia major in Denmark, analyse the treatment and organ functions, and identify areas for an improved treatment...... strategy. MATERIAL AND METHODS: During 1998-99 all Danish pediatric departments were contacted for identification of children aged 0-18 years with beta-thalassemia major. Blood transfusions and chelation therapy were registered, and for Eastern Denmark clinical, endocrine, cardiac, and serologic parameters...... were performed. RESULTS: Twenty-six children had beta-thalassemia major. Out of these, 20 received blood transfusions, and 17 patients were chelated. Eight patients were not chelated owing to previous bone marrow transplantation, treatment with hydroxyurea or ferritin

  12. The effect of some medical treatments on the red blood cells in the patients with thalassemia

    International Nuclear Information System (INIS)

    Zhang Xiufang; Shen Linming; Bao Hongxia


    The Moessbauer spectroscopy and circular dichroism measurements have been used to investigate the effect of some medical treatments on the red blood cells (RBCs) of the patients with HbH disease and β-thalassemia major, respectively. The results indicate that both splenectomy and treatment with myleran are effective to alleviate the symptoms of anemia for some patients, but both of them are different in the effect on the RBCs of the patients. On the basis of the results, a hypothesis on the course of denaturation in hemoglobin of the patients is proposed

  13. The effect of some medical treatments of Thalassemia on the red blood cells

    International Nuclear Information System (INIS)

    Zhang Xiufang; Shen Linming; Bao Hongxia; Din Xiaolan; Wang Rongxin; Huang Youwen; Liu Yuanyuan; Gao Naifei


    The Moessbauer spectroscopy (MS) and circular dichroism (CD) measurements have been used to investigate the effect of some medical treatments on the red blood cells (RBCs) of the patients with HbH disease and β-thalassemia (Thal.) major, respectively. The results indicate that both splenectomy and treatment with myleran are effective to alleviate the symptoms of anemia for some patients, but both of them are different in the effect on the RBCs of the patients. On the basis of the results, a hypothesis on the course of denaturation in hemoglobin (Hb) of the patients is proposed. (orig.)

  14. Extramedullary Hematopoiesis in a Man With β-Thalassemia: An Uncommon Cause of an Adrenal Mass

    Directory of Open Access Journals (Sweden)



    Full Text Available Introduction Extramedullary hematopoiesis (EMH commonly occurs in the spleen, liver and lymph nodes. Rare cases of EMH in the adrenal gland have been reported. Case Presentation We report the case of a 33-year-old man from the South of Iran suffering from major β-thalassemia, who underwent open left adrenalectomy and the histopathology revealed EMH. Conclusions In patients in which a history of hematologic disorders exists, careful imaging and hormonal assay should be done to certify a diagnosis of EMH. However, the surgical management becomes inevitable in certain cases.

  15. Non-transplant therapies for patients with hepatocellular carcinoma and Child-Pugh-Turcotte class B cirrhosis. (United States)

    Granito, Alessandro; Bolondi, Luigi


    Underlying liver cirrhosis is present in most patients with hepatocellular carcinoma, and liver transplantation is the only treatment strategy to cure both diseases. All other hepatocellular carcinoma treatment strategies have to take into account residual liver function that concurs with the patient's prognosis and might limit their feasibility. In patients with hepatocellular carcinoma and Child-Pugh-Turcotte class B (CPT-B), owing to borderline liver function, any intervention might be offset by liver function deterioration. In this setting, the decision for hepatocellular carcinoma treatment requires a comprehensive assessment of liver function, not restricted to the CPT classification, in addition to a careful evaluation of the prognostic effect of hepatocellular carcinoma compared with cirrhosis. In this Review, we provide an overview of the literature regarding the benefits and harms of non-transplant therapies in patients with hepatocellular carcinoma and CPT-B cirrhosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Hubungan Jumlah Darah Transfusi, Pemberian Deferoksamin, dan Status Gizi Dengan Kadar Seng Plasma Pada Penderita Thalassemia Mayor Anak

    Directory of Open Access Journals (Sweden)

    Ivan Rachmad Bachtiar


    Full Text Available Roles of zinc have been known in many important biologic activities. Previous studies found that there were low plasma zinc level in children with major thalassemia. The aim of this study was to determinate correlation the amount of blood transfusion, deferoxamine usage and nutrition status with plasma zinc level in pediatric major thalassemia. The cross-sectional study was conducted from Mei to June 2008 at Clinic of Pediatric Thalassemia Dr. Hasan Sadikin Hospital Bandung with subjects below 14 years. The amount of blood transfusion was calculated, deferoxamine usage was divided into optimal and non-optimal, nutritional status was classified into well-nourished and undernourished. Statistical analysis were performed with Pearson correlation test and Chi square test, with 95% confidence interval. The amount of 57 subjects consisted of 29 boys and 28 girls, ages ranged from 2 years 1 month to 13 years 9 months. The plasma zinc levels ranged from 42 to 91 g/dL (68.65; 11.68 and the amount of blood transfusion ranged from 1,680 to 45,700 mL (17,913.25; 10,404.18. The Pearson correlation test which showed the correlation between plasma zinc level and the amount of blood transfusion was stated by r=-0.189; p=0.0795. Chi-square test showed the impact of deferoxamine usage and nutritional status on plasma zinc level were x2=0.073; p=0.786 and x2=0.468; p=0.494. We conclude that the amount of blood transfusion, deferoxamine usage, and nutritional status are not correlated with plasma zinc level in children with major thalassemia.

  17. Thalassemia treatment and prevention in Uva Province, Sri Lanka: a public opinion survey. (United States)

    Mudiyanse, Rasnayaka M


    Due to its excessive cost thalassemia management is a major health care problem in Sri Lanka. The majority of doctors are using only desferrioxamine (DFO), in grossly inadequate doses mainly because of its unavailability. Deferiprone (L1), which is more affordable, is not used due to fear of toxicity, as previously reported. Arthropathy attributed to L1 has been observed in some patients, and has led to the discontinuation of the drug in all patients, without scientific rationale. The proposed thalassemia prevention project for Uva Province is based on prevention of marriages between carriers. This could be achieved by carrier screening and counseling of teenagers and adolescents well before they select their partners. In Sri Lanka, people find their marriage partners at their work place or universities, by themselves, or with the help of professional marriage brokers (they are called Kapuwa), through relatives and close friends. This process of finding a partner may also be helped by paper advertisements. However, in addition to the appearance and attitude of the prospective partner, the caste, social background and horoscope are major considerations in selecting a partner. Even when they select partners on their own at the work place or university, they keep these factors in the back of their minds to ensure social acceptance. Many relationships are given up due to objections and advice from parents when the caste or social background does not match. A horoscope is a written document that almost every child gets, written by a professional horoscope reader and depending on the time of birth. It is believed, according to the horoscope, that a person's attitudes, desires, future prospects of finding a suitable partner, could be predicted. It is rare to proceed with a marriage if the horoscope does not match. These customs are considered less seriously among educated people when they find their partner at the work place or university. The concept of thalassemia risk

  18. Oxidative stress and antioxidant status in beta-thalassemia heterozygotes

    Directory of Open Access Journals (Sweden)

    Luciana de Souza Ondei


    Full Text Available Background: Several studies have evaluated the oxidant and antioxidant status of thalassemia patients but most focused mainly on the severe and intermediate states of the disease. Moreover, the oxidative status has not been evaluated for the different beta-thalassemia mutations. Objective: To evaluate lipid peroxidation and Trolox equivalent antioxidant capacity in relation to serum iron and ferritin in beta thalassemia resulting from two different mutations (CD39 and IVS-I-110 compared to individuals without beta-thalassemia. Methods: One hundred and thirty subjects were studied, including 49 who were heterozygous for beta-thalassemia and 81 controls. Blood samples were subjected to screening tests for hemoglobin. Allele-specific polymerase chain reaction was used to confirm mutations for beta-thalassemia, an analysis of thiobarbituric acid reactive species was used to determine lipid peroxidation, and Trolox equivalent antioxidant capacity evaluations were performed. The heterozygous beta-thalassemia group was also evaluated for serum iron and ferritin status. Results: Thiobarbituric acid reactive species (486.24 ± 119.64 ng/mL and Trolox equivalent antioxidant capacity values (2.23 ± 0.11 mM/L were higher in beta-thalassemia heterozygotes compared to controls (260.86 ± 92.40 ng/mL and 2.12 ± 0.10 mM/L, respectively; p-value < 0.01. Increased thiobarbituric acid reactive species values were observed in subjects with the CD39 mutation compared with those with the IVS-I-110 mutation (529.94 ± 115.60 ng/mL and 453.39 ± 121.10 ng/mL, respectively; p-value = 0.04. However, average Trolox equivalent antioxidant capacity values were similar for both mutations (2.20 ± 0.08 mM/L and 2.23 ± 0.12 mM/L, respectively; p-value = 0.39. There was no influence of serum iron and ferritin levels on thiobarbituric acid reactive species and Trolox equivalent antioxidant capacity values. Conclusion: This study shows an increase of oxidative stress and

  19. Thalassemia and hemoglobinopathies in Thua Thien Hue Province, Central Vietnam. (United States)

    Nguyen, Hoa Van; Sanchaisuriya, Kanokwan; Nguyen, Dung; Phan, Hoa Thi Thuy; Siridamrongvattana, Sirivara; Sanchaisuriya, Pattara; Fucharoen, Supan; Fucharoen, Goonnapa; Schelp, Frank P


    A community-based assessment of thalassemias and hemoglobinopathies was conducted at the Thua Thien Hue Province, Central Vietnam. By cluster sampling, a total of 410 pregnant women attending the antenatal care service at 30 commune health centers were recruited consecutively from September 2011 to June 2012. Hemoglobin (Hb) analysis was performed using an automated Hb analyzer. α-Thalassemia (α-thal) genes were identified by polymerase chain reaction (PCR)-based techniques. Out of the 410 pregnant women, 2.7% carried α(0)-thal and 1.2% were β-thal carriers. One woman with the - -(THAI) deletion was also found. Among the females under survey, structural Hb variants with 3.2% Hb E [β26(B8)Glu→Lys, GAG>AAG; HBB: c.78G>C] and 3.7% Hb Constant Spring [Hb CS; α142, Term→Gln, TAA>CAA (α2); HBA2: c.427T>C] were found. Assessing the frequency of thalassemias and hemoglobinopathies by ethnicity, Kinh (Vietnamese) and ethnic minority groups, Hb CS with a high frequency of 24.0% was observed in the ethnic minority groups. These results provide basic population-based information, are useful not only for implementing measures for prevention and control of thalassemias in the region but also for studying the importance of thalassemias and hemoglobinopathies in ethnic minorities within Southeast Asia.

  20. Setting up low-risk bone marrow transplantation for children with thalassemia may facilitate pediatric cancer care

    Directory of Open Access Journals (Sweden)

    Lawrence B Faulkner


    Full Text Available Background: In many South Asian countries there is shortage of centers providing care for pediatric malignancies. This report describes the experience of the Cure2Children Foundation (C2C in supporting, both financially and professionally, the startup of two bone marrow transplant (BMT centers, one in Pakistan and one in India, for the cure of transfusion-dependent thalassemia. Even though transplantation is generally considered as a more complex and advanced step relatively to basic pediatric cancer care, the authors argue that BMT for low-risk thalassemia patients with a matched sibling is a relatively simple procedure amenable to focused training. Materials and Methods: Since 2008 the C2C, an Italian Nongovernmental Organization (NGO, has supported a BMT network in Pakistan. The primary aim of this project was to assess feasibility, outcomes, and costs of matched-related BMT for thalassemia in young low-risk children employing a well established and quite tolerable strategy employed in Italy. This initiative relied primarily on focused training and task-shift strategies within a structured cooperation program. The initial success of that strategy led to its replication in India with 100 total BMTs performed over the past 4 years, 91 of which were for thalassemia major. Results: Low-risk matched-related BMT in children younger than 5 years could deliver a 92% thalassemia-free survival with 100% performance score and no extensive chronic graft versus host disease (GVHD, for an average cost of 10,000 USD per BMT. Within an existing hospital facility, 50,000 USD were sufficient to renovate and fully equip a 2-3 bedded start up BMT unit capable of performing safe low-risk compatible marrow transplantation. Conclusions: In low resource settings matched-related low-risk BMT for thalassemia can be performed with outcomes comparable to richer countries and with a fraction of the costs. Within structured and intensive cooperation, good outcomes can be


    Ruangrai, Waraporn; Jindadamrongwech, Sumalee


    Genetic factors influencing Hb F content in adult red blood cells include β-thalassemia genotypes, co-inheritance of α-thalassemia traits and single nucleotide polymorphisms (SNPs). Genotyping of α- and β-thalassemia and five SNPs in β-globin gene cluster previously identified in genome-wide association studies as being markers of elevated Hb F in β-thalassemia were performed in 81 subjects diagnosed with β-thalassemia/Hb E. Hb F levels are higher (0.9-7.1 g/dl) in subjects (n = 57) with the severe compared to mild β-thalassemia (0.8-2.5 g/ dl) (n = 4) genotypes, and are similarly low (0.7-3.5 g/dl) in those (n = 15) with α-thalassemia co-inheritance. Hb F levels in non-thalassemia controls (n = 150) range from 0 to 0.15 g/dl. The presence of homozygous minor alleles of the 5 SNPs are significant indicators of β-thalassemia/Hb E individuals with high Hb F (> 4 g/dl), independent of their thalassemia genotypes. Given that re-activation of γ-globin genes leads to amelioration of β-thalassemia severity, understanding how genetic factors up-regulate Hb F production may lead to possible therapeutic interventions, genetically or pharmacologically, of this debilitating disease in the not too distant future.

  2. Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan. (United States)

    Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca


    β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.

  3. Thalidomide has a significant effect in patients with thalassemia intermedia. (United States)

    Li, YunShuan; Ren, Quan; Zhou, Yali; Li, Pingping; Lin, Wanhua; Yin, Xiaolin


    To investigate the effect of thalidomide in patients with thalassemia intermedia. We observed the effect of thalidomide in seven patients with thalassemia intermedia requiring blood transfusion. Four of the patients were transfusion-independent, and three patients were transfusion-dependent. For the four transfusion-independent patients, hemoglobin concentration increased significantly (≥2 g/dl) in three and moderately (1-2 g/dl) in one. After 3 months of treatment, hemoglobin concentration increased 3.2 ± 1.2 g/dl compared to pretreatment. Among the three transfusion-dependent patients, transfusion was terminated after one month of treatment in one patient and decreased >50% in the other two patients, accompanied by an increase in the average hemoglobin concentration. Thalidomide had a significant effect in patients with thalassemia intermedia. Further studies of a larger scale and more rigorous design are warranted.

  4. Internal distribution of excess iron and sources of serum ferritin in patients with thalassemia

    Energy Technology Data Exchange (ETDEWEB)

    Cazzola, M; Bergamaschi, G; Dezza, L; Borgna-Pignatti, C C; De Stefano, P; Bongo, I G; Avato, F [Pavia Univ. (Italy)


    Liver and spleen iron concentrations, serum ferritin level and binding of S-ferritin to concanavalin A (Con A) were measured in 12 patients with thalassemia major or intermedia at the time of splenectomy. All these subjects had increased liver iron concentration, most of them had hepatic fibrosis but none of them had histological evidence of chronic hepatitis. No patient had ascorbic acid deficiency. Serum ferritin concentration was increased in all cases, ranging from 266 to 5504 In all but 2 subjects most of the protein did not bind to Con A, thus behaving as tissue ferritin. There were highly significant correlations between serum ferritin concentration, amount of blood transfused and liver iron concentration. On the average, iron concentration in the liver was about 3 times that in the spleen. The findings obtained suggest that in patients with thalassemia major or intermedia most of the iron is deposited in parenchymal tissues and most of the S-ferritin derives by leakage from the cytosol of iron-loaded parenchymal cells. S-ferritin is a valid index of liver iron overload in thalassemic patients witout complications such as viral hepatitis and/or ascorbic acid defiency.

  5. Post Splenectomy Outcome in β-Thalassemia. (United States)

    Merchant, Rashid H; Shah, Ami R; Ahmad, Javed; Karnik, Alka; Rai, Nooralam


    To evaluate changes in annual blood transfusion requirements and complications after splenectomy in patients with β-thalassemia. Forty post-splenectomy β-thalassemic patients aged 8-33 y, receiving regular blood transfusions and chelation therapy were included and non transfusion dependant patients were excluded from this retrospective cross-sectional study. Details about their surgery, transfusion requirements, and platelet levels were recorded on a standard proforma. All patients underwent a B-mode and color-coded duplex sonography of the hepatoportal system during the study period. The average ferritin level in the year prior to the study was 4432 mcg/L (range 480-12,200 mcg/L). The annual blood transfusion requirement in the first year and 5 y post splenectomy [mean ± SD (138.41 ± 90.38 ml/kg/y); (116 ± 41.44 ml/kg/y)] were significantly different from requirements before splenectomy [(mean ± SD) 294.85 ± 226 ml/kg/y; p value splenectomy with a mean rise of 4,51,000/mm(3) (p value splenectomy. Increase in annual blood transfusion requirement should be investigated to find the cause.

  6. Beta-thalassemia intermedia associated with moyamoya syndrome. (United States)

    Göksel, Basak Karakurum; Ozdogu, Hakan; Yildirim, Tulin; Oğuzkurt, Levent; Asma, Suheyl


    Moyamoya syndrome (MMS) is a progressive disorder. We report a 19-year-old boy with beta-thalassemia who presented with a left hemiparesis. Brain MRI showed old middle cerebral artery and left frontal subcortical white matter infarcts. Brain magnetic resonance angiography and digital subtraction angiography revealed occlusion of the bilateral internal carotid arteries with a rich network of basal collateral vessels. To our knowledge this is the third report of beta-thalassemia intermedia and MMS, and the first report of a patient in Turkey. It emphasizes the potential for cerebral infarct due to anemia, protein S and thrombocytosis.

  7. Relationship between myocardial T2* values and cardiac volumetric and functional parameters in β-thalassemia patients evaluated by cardiac magnetic resonance in association with serum ferritin levels

    Energy Technology Data Exchange (ETDEWEB)

    Liguori, Carlo, E-mail: [Department of Diagnostic Imaging, Campus Bio Medico University, via Alvaro del Portillo 200, 00128 Rome (Italy); Pitocco, Francesca, E-mail: [Department of Diagnostic Imaging, Campus Bio Medico University, via Alvaro del Portillo 200, 00128 Rome (Italy); Di Giampietro, Ilenia, E-mail: [Department of Diagnostic Imaging, Campus Bio Medico University, via Alvaro del Portillo 200, 00128 Rome (Italy); Vivo, Aldo Eros de, E-mail: [Department of Diagnostic Imaging, Campus Bio Medico University, via Alvaro del Portillo 200, 00128 Rome (Italy); Schena, Emiliano, E-mail: [Unit of Measurements and Biomedical Instrumentation, Campus Bio Medico University, via Alvaro del Portillo 200, 00128 Rome (Italy); Cianciulli, Paolo, E-mail: [Thalassemia Unit, Ospedale Sant Eugenio, Piazzale dell’Umanesimo 10, 00143 Rome (Italy); Zobel, Bruno Beomonte, E-mail: [Department of Diagnostic Imaging, Campus Bio Medico University, via Alvaro del Portillo 200, 00128 Rome (Italy)


    Purpose: Myocardial T2* cardiovascular magnetic resonance provides a rapid and reproducible assessment of cardiac iron load in thalassemia patients. Although cardiac involvement is mainly characterized by left ventricular dysfunction caused by iron overload, little is known about right ventricular function. The aim of this study was to assess the relationship between T2* value in myocardium and left–right ventricular volumetric and functional parameters and to evaluate the existing associations between left–right ventricles volumetric and functional parameter, myocardial T2* values and blood ferritin levels. Materials and methods: A retrospective analysis of 208 patients with β-thalassemia major and thalassemia intermedia was performed (109 males and 99 females; mean age 37.7 ± 13 years; 143 thalassemia major, 65 thalassemia intermedia). Myocardial iron load was assessed by T2* measurements, and volumetric functions were analyzed using the steady state free precession sequence. Results: A significant correlation was observed between EFLV and T2* (p = 0.0001), EFRV and T2* (p = 0.0279). An inverse correlation was present between DVLV and T2* (p = 0.0468), SVLV and T2* (p = 0.0003), SVRV and T2* (p = 0.0001). There was no significant correlation between cardiac T2* and LV–RV mass indices. A significant correlation was observed between T2* and serum ferritin levels (p < 0.001) and between EFLV and serum ferritin (p < 0.05). Conclusion: Myocardial iron load assessed by T2* cardiac magnetic resonance is associated with deterioration in left–right ventricular function; this is more evident when T2* values fall below 14 ms. CMR appears to be a promising approach for cardiac risk evaluation in TM patients.

  8. Relationship between myocardial T2* values and cardiac volumetric and functional parameters in β-thalassemia patients evaluated by cardiac magnetic resonance in association with serum ferritin levels

    International Nuclear Information System (INIS)

    Liguori, Carlo; Pitocco, Francesca; Di Giampietro, Ilenia; Vivo, Aldo Eros de; Schena, Emiliano; Cianciulli, Paolo; Zobel, Bruno Beomonte


    Purpose: Myocardial T2* cardiovascular magnetic resonance provides a rapid and reproducible assessment of cardiac iron load in thalassemia patients. Although cardiac involvement is mainly characterized by left ventricular dysfunction caused by iron overload, little is known about right ventricular function. The aim of this study was to assess the relationship between T2* value in myocardium and left–right ventricular volumetric and functional parameters and to evaluate the existing associations between left–right ventricles volumetric and functional parameter, myocardial T2* values and blood ferritin levels. Materials and methods: A retrospective analysis of 208 patients with β-thalassemia major and thalassemia intermedia was performed (109 males and 99 females; mean age 37.7 ± 13 years; 143 thalassemia major, 65 thalassemia intermedia). Myocardial iron load was assessed by T2* measurements, and volumetric functions were analyzed using the steady state free precession sequence. Results: A significant correlation was observed between EFLV and T2* (p = 0.0001), EFRV and T2* (p = 0.0279). An inverse correlation was present between DVLV and T2* (p = 0.0468), SVLV and T2* (p = 0.0003), SVRV and T2* (p = 0.0001). There was no significant correlation between cardiac T2* and LV–RV mass indices. A significant correlation was observed between T2* and serum ferritin levels (p < 0.001) and between EFLV and serum ferritin (p < 0.05). Conclusion: Myocardial iron load assessed by T2* cardiac magnetic resonance is associated with deterioration in left–right ventricular function; this is more evident when T2* values fall below 14 ms. CMR appears to be a promising approach for cardiac risk evaluation in TM patients

  9. Mutation Spectrum of β-Thalassemia and Other Hemoglobinopathies in Chittagong, Southeast Bangladesh. (United States)

    Chatterjee, Tridip; Chakravarty, Amit; Chakravarty, Sudipa; Chowdhury, Mahmood Ahmed; Sultana, Razia


    Thalassemia is one of the most common autosomal recessive blood disorders in the world. It shows a variety of clinical expression, starting from asymptomatic to severe blood transfusion dependence. More than 500 alleles have been characterized in or around the β-globin region. Moreover, most geographical regions have their own characteristics, frequency and availability of these alleles, predominantly circulating within the communities present in that particular region. In this study, we explored the spectrum of β-thalassemia (β-thal) alleles present in Chittagong, Southeast Bangladesh. This study comprises β-thal and Hb E (HBB: c.79 G > A) patients from in and around the area of Chittagong. Not only exploring the complete β-globin mutation spectrum of the area, but we also tried to look at the origin of the mutated alleles. The β-thal mutations of Bangladesh show a relatively wide spectrum of alleles, which further demonstrates the heterogeneity of the disease in this country. Although our study showed that the majority of the mutations have their origin in neighboring countries such as India, countries of Southeast Asia, Pakistan, etc., some unusual alleles do not originate in neighboring countries and put a little more diversity in the overall spectrum of β-thal-specific alleles. Overall, this study demonstrates the mutation spectrum related to β-thal in Chittagong, Southeast Bangladesh.

  10. Extraosseous radiotracer uptake on bone scan in beta-thalassemia: report of one case

    International Nuclear Information System (INIS)

    Guezguez, M.; Nouira, M.; Sfar, R.; Chatti, K.; Ben Fradj, M.; Ben Ali, K.; Ajmi, S.; Essabbah, H.; Zrour, S.


    Red blood cell transfusion, main therapeutic modality of beta-thalassemia, leads to iron overload which may perturb several metabolic ways. The aim of this paper is to illustrate the uptake abnormalities observed on bone scan of thalassaemic patients and to discuss mechanisms of extraosseous accumulation of the radiopharmaceutical in this pathology. We report a 16-year-old child suffering from beta-thalassemia major undergoing transfusion therapy. A bone scan was indicated to look for osseous infection. This study revealed a little skeletal uptake and abnormal liver, splenic and renal accumulation. A repeat bone scan, performed three weeks later showed a better skeletal uptake which enabled the discovery of focal abnormalities and made the diagnostic easier. The effect of iron overload on radiopharmaceuticals uptake in bone scan is known since 1975. Dissociation of 99m Tc from the carrier ligand due to the presence of iron excess seems the most plausible hypothesis. Free 99m Tc can be bound to other tissular substrates which can explain extraosseous uptake. The normally available pool for bone is reduced and then the skeletal uptake decreased. This report limits considerably the sensitivity of the bone scan. A well-led iron chelation and eventually the use of diuretic drug may guarantee a better quality of bone scan images. (authors)

  11. The Thalassemia International Federation: a global public health paradigm

    Directory of Open Access Journals (Sweden)

    Elpidoforos S. Soteriades


    Full Text Available Many international organizations are struggling today to coordinate limited economic and human resources in support of governments’ efforts to advance public health around the world. The United Nations and the World Health Organization, along with others play a pivotal role in this global effort. Furthermore, during the past few decades an increasingly higher percentage of global efforts on public health are carried out by specific health initiatives, international projects and non-governmental patient-oriented organizations. The Thalassemia International Federation (TIF is one such organization focusing on the control of thalassemia around the world. The current paper aims at presenting a comprehensive overview of the mission, goals, objectives and activities of this organization. Our ultimate goal is to highlight TIF’s public health paradigm and diffuse its success at an international levels for others to follow. TIF is devoted to disseminating information, knowledge, experience and best practices around the world to empower patients with thalassemia and their relatives, support health professionals providing care to such patients and promote national and international policies, which secure equal access to quality care for all patients with thalassemia.

  12. Alpha thalassemia among sickle cell anaemia patients in Kampala ...

    African Journals Online (AJOL)

    Keywords: Alpha thalassemia, sickle cell anaemia patients, Kampala, Uganda. DOI: Introduction. In the early 1960's many adults with sickle cell anaemia. (SCA) as well as those with mild disease were reported in Jamaica1. Various factors, both genetic and environmental, are.


    NARCIS (Netherlands)


    We evaluated the use of an HPLC method for screening hemoglobins in cord blood. We studied the genotype frequencies of the structural hemoglobin variants HbS and HbC and the synthesis variants alpha- and beta+-thalassemia in babies born on Curacao. During three months, 67.2% of all (748) newborns

  14. Study of glycolytic intermediates in hereditary elliptocytosis with thalassemia

    Directory of Open Access Journals (Sweden)

    Pavri Roshan


    Full Text Available Glycolytic intermediates like ATP, DPG and GSH have been studied in a family with. hereditary elliptocytosis and thalassemia. Results indicate a fall in ATP with a concomitant rise in DPG in the Patient. Findings are discussed in relation to other data.

  15. Irradiation for progressive paraparesis in β-thalassemia intermedia

    International Nuclear Information System (INIS)

    Wilson, J.J.; Hill, M.E.; Crookston, J.H.


    This article describes the case history of a patient suffering from β-thalassemia intermedia. The patient was treated with radiation to the thoraic spine (1500 rad in 5 days) and his condition improved. Subsequent tomography indicated the success of this type of irradiation without recourse to laminectomy. (T.I.)

  16. Thalassemia and malaria: new insights into an old problem. (United States)

    Clegg, J B; Weatherall, D J


    The hemoglobinopathies are probably the world's most common genetic diseases: The World Health Organization has estimated that at least 5% of the population are carriers for one or other of the most serious forms, the alpha- and beta-thalassemias and the structural variant hemoglobins S, C, and E, which are found at polymorphic frequencies in many countries. All these hemoglobinopathies are believed to provide protection against malaria, and it is thought that, in malarial regions of the world, natural selection has been responsible for elevating and maintaining their gene frequencies, an idea first proposed 50 years ago by J.B.S. Haldane. Epidemiological studies undertaken in the 1950s on hemoglobin S in Africa provided support for the "malaria hypothesis," but until recently it has proved extremely difficult to verify it for the thalassemias. The application of molecular methods has, however, provided new opportunities to address this old question. Population and molecular genetic analysis of thalassemia variants, and microepidemiological studies of the relationship between alpha-thalassemia and malaria in the southwest Pacific, have provided unequivocal evidence for protection. Surprisingly, some of this protection appears to derive from enhanced susceptibility in very young thalassemic children to both Plasmodium falciparum and, especially, P. vivax, and this early exposure appears to provide the basis for better protection in later life.

  17. Recent trends in the gene therapy of β-thalassemia

    Directory of Open Access Journals (Sweden)

    Finotti A


    Full Text Available Alessia Finotti,1–3 Laura Breda,4 Carsten W Lederer,6,7 Nicoletta Bianchi,1–3 Cristina Zuccato,1–3 Marina Kleanthous,6,7 Stefano Rivella,4,5 Roberto Gambari1–3 1Laboratory for the Development of Gene and Pharmacogenomic Therapy of Thalassaemia, Biotechnology Centre of Ferrara University, Ferrara, Italy; 2Associazione Veneta per la Lotta alla Talassemia, Rovigo, Italy; 3Department of Life Sciences and Biotechnology, Section of Biochemistry and Molecular Biology, Ferrara University, Ferrara, Italy; 4Department of Pediatrics, Division of Haematology/Oncology, Weill Cornell Medical College, New York, NY, USA; 5Department of Cell and Development Biology, Weill Cornell Medical College, New York, NY, USA; 6Department of Molecular Genetics Thalassaemia, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus; 7Cyprus School of Molecular Medicine, Nicosia, Cyprus Abstract: The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most

  18. Carrier screening for thalassemia and hemoglobinopathies in Canada. (United States)

    Langlois, Sylvie; Ford, Jason C; Chitayat, David


    To provide recommendations to physicians, midwives, genetic counsellors, and clinical laboratory scientists involved in pre-conceptional or prenatal care regarding carrier screening for thalassemia and hemoglobinopathies (e.g., sickle cell anemia and other qualitative hemoglobin disorders). To determine the populations to be screened and the appropriate tests to offer to minimize practice variations across Canada. The Medline database was searched for relevant articles published between 1986 and 2007 on carrier screening for thalassemia and hemoglobinopathies. Key textbooks were also reviewed. Recommendations were quantified using the Evaluation of Evidence guidelines developed by the Canadian Task Force on Preventive Health Care. The evidence collected from the Medline search was reviewed by the Prenatal Diagnosis Committee of the Canadian College of Medical Geneticists (CCMG) and the Genetics Committee of the Society of Obstetricians and Gynaecologists of Canada (SOGC). Screening of individuals at increased risk of being carriers for thalassemia and hemoglobinopathies can identify couples with a 25% risk of having a pregnancy with a significant genetic disorder for which prenatal diagnosis is possible. Ideally, screening should be done pre-conceptionally. However, for a significant proportion of patients, the screening will occur during the pregnancy, and the time constraint for obtaining screening results may result in psychological distress. This guideline does not include a cost analysis. 1. Carrier screening for thalassemia and hemoglobinopathies should be offered to a woman if she and/or her partner are identified as belonging to an ethnic population whose members are at higher risk of being carriers. Ideally, this screening should be done pre-conceptionally or as early as possible in the pregnancy. (II-2A) 2. Screening should consist of a complete blood count, as well as hemoglobin electrophoresis or hemoglobin high performance liquid chromatography. This

  19. Two cloned β thalassemia genes are associated with amber mutations at codon 39 (United States)

    Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur


    Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

  20. Therapeutic hemoglobin levels after gene transfer in β-thalassemia mice and in hematopoietic cells of β-thalassemia and sickle cells disease patients.

    Directory of Open Access Journals (Sweden)

    Laura Breda

    Full Text Available Preclinical and clinical studies demonstrate the feasibility of treating β-thalassemia and Sickle Cell Disease (SCD by lentiviral-mediated transfer of the human β-globin gene. However, previous studies have not addressed whether the ability of lentiviral vectors to increase hemoglobin synthesis might vary in different patients.We generated lentiviral vectors carrying the human β-globin gene with and without an ankyrin insulator and compared their ability to induce hemoglobin synthesis in vitro and in thalassemic mice. We found that insertion of an ankyrin insulator leads to higher, potentially therapeutic levels of human β-globin through a novel mechanism that links the rate of transcription of the transgenic β-globin mRNA during erythroid differentiation with polysomal binding and efficient translation, as reported here for the first time. We also established a preclinical assay to test the ability of this novel vector to synthesize adult hemoglobin in erythroid precursors and in CD34(+ cells isolated from patients affected by β-thalassemia and SCD. Among the thalassemic patients, we identified a subset of specimens in which hemoglobin production can be achieved using fewer copies of the vector integrated than in others. In SCD specimens the treatment with AnkT9W ameliorates erythropoiesis by increasing adult hemoglobin (Hb A and concurrently reducing the sickling tetramer (Hb S.Our results suggest two major findings. First, we discovered that for the purpose of expressing the β-globin gene the ankyrin element is particularly suitable. Second, our analysis of a large group of specimens from β-thalassemic and SCD patients indicates that clinical trials could benefit from a simple test to predict the relationship between the number of vector copies integrated and the total amount of hemoglobin produced in the erythroid cells of prospective patients. This approach would provide vital information to select the best candidates for these

  1. Hb A1c Determination by Capillary Electrophoresis is an Efficient Method for Detecting β-Thalassemias and Hemoglobin Variants. (United States)

    Orts, Juan A; Zúñiga, Ángel; Bello, Yanis; Fabregat, Aleix B; Vicente, Ana I


    Glycated hemoglobin (Hb A 1c ) determination by multicapillary zone electrophoresis (MZE) can additionally be used to detect Hb A 2 , Hb F and most common hemoglobin (Hb) variants. We assessed the effectiveness of this method for detecting β-thalassemia (β-thal), δβ-thalassemia (δβ-thal) and most common Hb variants. Moreover, Hb F/Hb A 2 is evaluated as an index for discriminating between β- and δβ-thal traits. The theoretical β-thalassemia major (β-TM) birth rate in our healthcare area is calculated and contrasted with real data. A MZE technique was used for Hb A 1c measurements in 27,724 patients. Previous criteria for carrier detection were established and subsequently confirmed by molecular biology techniques. Positive predictive value (PPV) was 100.0%. The prevalence of β-thal trait (including δβ-thal) was 0.34%. The most prevalent mutations (estimated per 100,000 population) were HBB: c.118C > T (57.7%), HBB: c.93-21G>A (50.5%), HBB: c.92 + 1G > A (43.3%), HBB: c.92 + 6T > C (32.5%) and HBB: c.20delA (18.0%) for β-thalassemias, and Hb S (HBB: c.20A > T) (32.5%) and Hb J-Baltimore (HBB:c.3880T>A) (28.9%) for Hb variants. We found a paradoxical result between the theoretical β-TM birth rate and real data. We calculated an optimal Hb F/Hb A 2 index cutoff of 0.71 for discriminating between β- and δβ-thal traits. This method is highly cost-effective for detecting β-thalassemias and common Hb variants. Prevalence results match previous data for the Spanish population. Heterogeneity of mutations in Spain has markedly increased as a consequence of migration. The Hb F/Hb A 2 index cutoff could be used to predict δβ-thal trait.

  2. Consequences and costs of noncompliance with iron chelation therapy in patients with transfusion-dependent thalassemia: a literature review. (United States)

    Delea, Thomas E; Edelsberg, John; Sofrygin, Oleg; Thomas, Simu K; Baladi, Jean-Francois; Phatak, Pradyumna D; Coates, Thomas D


    Patients with thalassemia major require iron chelation therapy (ICT) to prevent complications from transfusional iron overload. Deferoxamine is effective, but requires administration as a slow continuous subcutaneous or intravenous infusion five to seven times per week. Deferiprone is a three-times-daily oral iron chelator, but has limited availability in the United States. Deferasirox is a once-daily oral iron chelator that was approved in the United States in 2005 for patients older than 2 years of age with transfusional iron overload. Published evidence on rates of compliance with ICT and the association between compliance, and the incidence and costs of complications of iron overload, in patients with thalassemia major was reviewed. A total of 18 studies were identified reporting data on compliance with ICT, including 7 that examined deferoxamine only, 6 that examined deferiprone only, and 5 that compared deferoxamine and deferiprone; no studies reporting compliance with deferasirox were identified. In studies of deferoxamine only, estimated mean compliance ranged from 59 to 78 percent. Studies of deferiprone generally reported better compliance, ranging from 79 to 98 percent. Results of comparative studies of deferoxamine and deferiprone suggest that compliance may be better with oral therapy. Numerous studies demonstrate that that poor compliance with ICT results in increased risk of cardiac disease and endocrinopathies, as well as lower survival. Although data on the costs of noncompliance are limited, a recent model-based study estimated the lifetime costs of inadequate compliance with deferoxamine to be $33,142. Inadequate compliance with ICT in thalassemia major is common and results in substantial morbidity and mortality, as well as increased costs.

  3. β-Thalassemia and Polycythemia vera: targeting chronic stress erythropoiesis. (United States)

    Crielaard, Bart J; Rivella, Stefano


    β-Thalassemia and Polycythemia vera are genetic disorders which affect the synthesis of red blood cells, also referred to as erythropoiesis. Although essentially different in clinical presentation - patients with β-thalassemia have an impairment in β-globin synthesis leading to defective erythrocytes and anemia, while patients with Polycythemia vera present with high hemoglobin levels because of excessive red blood cell synthesis - both pathologies may characterized by lasting high erythropoietic activity, i.e. chronic stress erythropoiesis. In both diseases, therapeutic strategies targeting chronic stress erythropoiesis may improve the address phenotype and prevent secondary pathology, such as iron overload. The current review will address the basic concepts of these strategies to reduce chronic stress erythropoiesis, which may have significant clinical implications in the near future. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Thermogravimetric analysis coupled with chemometrics as a powerful predictive tool for ß-thalassemia screening. (United States)

    Risoluti, Roberta; Materazzi, Stefano; Sorrentino, Francesco; Maffei, Laura; Caprari, Patrizia


    β-Thalassemia is a hemoglobin genetic disorder characterized by the absence or reduced β-globin chain synthesis, one of the constituents of the adult hemoglobin tetramer. In this study the possibility of using thermogravimetric analysis (TGA) followed by chemometrics as a new approach for β-thalassemia detection is proposed. Blood samples from patients with β-thalassemia were analyzed by the TG7 thermobalance and the resulting curves were compared to those typical of healthy individuals. Principal Component Analysis (PCA) was used to evaluate the correlation between the hematological parameters and the thermogravimetric results. The thermogravimetric profiles of blood samples from β-thalassemia patients were clearly distinct from those of healthy individuals as result of the different quantities of water content and corpuscular fraction. The hematological overview showed significant decreases in the values of red blood cell indices and an increase in red cell distribution width value in thalassemia subjects when compared with those of healthy subjects. The implementation of a predictive model based on Partial Least Square Discriminant Analysis (PLS-DA) for β-thalassemia diagnosis, was performed and validated. This model permitted the discrimination of anemic patients and healthy individuals and was able to detect thalassemia in clinically heterogeneous patients as in the presence of δβ-thalassemia and β-thalassemia combined with Hb Lepore. TGA and Chemometrics are capable of predicting ß-thalassemia syndromes using only a few microliters of blood without any pretreatment and with an hour of analysis time. A fast, rapid and cost-effective diagnostic tool for the β-thalassemia screening is proposed. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Diffuse Hepatic Calcifications in a Transfusion-Dependent Patient with Beta-Thalassemia: A Case Report

    Directory of Open Access Journals (Sweden)

    Forough Saki


    Full Text Available Hepatic calcification is usually associated with infectious, vascular, or neoplastic processes in the liver. We report the first case of beta-thalassemia major with isolated diffuse hepatic calcification in a 23 year old woman, who had been transfusion-dependent since the age of 6 months. She was referred to our center with a chief complaint of abdominal pain. Computed tomography scan of the abdomen revealed diffuse hepatic calcification in the right, left, and caudate lobes of the liver. Her medical history disclosed hypoparathyroidism as well as chronic hepatitis C virus infection, which was successfully treated but led to early micronodular cirrhosis on liver biopsy. Other studies done to search for the cause of hepatic calcification failed to reveal any abnormalities. We suspect that hypoparathyroidism caused liver calcification, and should be, therefore, considered in the differential diagnosis of hepatic calcification if other causative factors have been ruled out.

  6. Prevalence of Periodontal Disease in Children with Leukemia and Thalassemia


    Marhamah; Maulidita, Hardianti


    Background. Various periodontal disease can occur in children and adolescents. Some can take place quickly and periodontal tissue damage. Several previous studies indicate that systemic diseases associated with periodontal disease in children. Objectives. This study aims to determine the prevalence of periodontal disease in children with leukemia and thalassemia. Methods. The design study is a cross-sectional approach. Periodontal pocket depth measurements performed using the WHO standa...

  7. Malabsorption of vitamin B12 in homozygous β-thalassemia

    International Nuclear Information System (INIS)

    Vlachos, P.; Liakakos, D.


    Schilling tests were performed in ten children aged 5-12 years suffering from homozygous β-thalassemia. 57 Co labelled vitamin B 12 values excreted in the urine have been found much lower than normal and remained low when the same procedure was repeated with the addition of intrinsic factor. The possible factors responsible for this malabsorption of vitamin B 12 seemed to be liver damage and folic acid deficiency. (orig.) [de

  8. Non-transfusion dependent thalassemia: translating evidence to guidelines

    Directory of Open Access Journals (Sweden)

    Afif R. Harb


    Full Text Available The thalassemias are a group of inherited disorders of hemoglobin synthesis characterized by various degrees of defective production of the α- or β-globin chains of adult hemoglobin A. Non-transfusion- dependent thalassemia (NTDT includes a group of thalassemia patients who do not require regular RBC transfusions for survival, but may require occasional transfusions due to infection or pregnancy or may require more regular transfusions later in life due to splenomegaly or other complications. Due to the rising phenomenon of global migration, this previously well-localized entity is currently spreading more and more worldwide reaching Northern America and Northern Europe. The clinical picture of NTDT is governed by the severity of the ineffective erythropoiesis and the chronic hemolytic anemia, which, in turn, lead to iron overload, hypercoagulability, and an array of clinical complications involving almost every organ system. Patients with NTDT suffer from complications that are distinct from those encountered in patients with transfusion- dependent thalassemia (TDT in addition to the complications shared by both TDT and NTDT. As a consequence, patients with NTDT deserve a care specifically tailored to their needs. In the care of patients with NTDT, aiming at a standardized yet personalized care is not an easy task especially that NTDT patients lie on a heterogeneous spectrum with a wide variability in their clinical presentation and response to therapy. Therefore, guidelines emerge as a necessity to answer the specific needs of NTDT patients and the clinicians caring for them. In this article, we summarize the complications most commonly associated with NTDT and the recommendations of the guidelines for the management of patients with NTDT, based on the best available evidence.

  9. X-ray scattering signatures of β-thalassemia

    International Nuclear Information System (INIS)

    Desouky, Omar S.; Elshemey, Wael M.; Selim, Nabila S.


    X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm -1 , respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; β-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of β-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm -1 , in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

  10. X-ray scattering signatures of β-thalassemia (United States)

    Desouky, Omar S.; Elshemey, Wael M.; Selim, Nabila S.


    X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm -1, respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; β-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of β-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm -1, in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

  11. X-ray scattering signatures of {beta}-thalassemia

    Energy Technology Data Exchange (ETDEWEB)

    Desouky, Omar S. [Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT) (Egypt); Elshemey, Wael M. [Biophysics Department, Faculty of Science, Cairo University (Egypt)], E-mail:; Selim, Nabila S. [Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT) (Egypt)


    X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm{sup -1}, respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; {beta}-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of {beta}-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm{sup -1}, in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

  12. Evaluation of the children with beta-thalassemia in terms of their self-concept, behavioral, and parental attitudes. (United States)

    Yalçn, Siddika Songül; Durmuşoğlu-Sendoğdu, Mine; Gümrük, Fatma; Unal, Selma; Karg, Eda; Tuğrul, Belma


    This study was planned to explore the self-concept, behavioral, and parental attitudes of the children with beta-thalassemia major, and the factors that affect them. The study was undertaken between January and June 2004 at the Hacettepe University Ihsan Doğramaci Children's Hospital, Pediatric Hematology Unit, Ankara and 43 voluntary children with beta-thalassemia major on regular blood transfusion and iron chelation treatment between the ages of 5.0 and 18.0 years were included into the study. Age, sex, birth order, school performance, hemoglobin value, serum ferritin levels, associated illness, splenectomy status, presence of thalassemic sibling or relatives, death of thalassemic relatives, place of residence, maternal and paternal education were recorded. Parental Attitude Research Instrument, Piers-Harris Self-Concept Scale, and Child Behavior Checklist were applied. Higher educated mothers have lower overprotection (P=0.009), parental discordance (P=0.044), and discipline scores (P=0.002) than lower educated mothers. In cases with death of thalassemic relatives, democratic/equality attitude scores were decreased (P=0.034). With stepwise multiple linear regression analysis, splenectomy, good school achievement, absence of death of thalassemic relatives, and serum ferritin levels were found to increase Piers-Harris Self-Concept Scale; however, total behavior problem score was found to decrease with increasing age, splenectomy and decreasing overprotection subscale of Parental Attitude Research Instrument scores. The self-esteem and behavior problems of children with thalassemia depended not only on the variables related exclusively to the child (age, school achievement) and the illness-associated conditions (splenectomy, serum ferritin levels) but also on the parental attitude (overprotection).

  13. Prevalence of renal tubular dysfunction in beta thalassemia minor in shiraz

    Directory of Open Access Journals (Sweden)

    Ali Moradi Nakhodcheri


    Full Text Available  Background & objective: β-Thalassemia minor is an asymptomatic hereditary disease. The first study on the relation of renal tubular dysfunction and β-thalassemia minor was performed in 2002 but those studies seem inadequate.The main goal of this study is through evaluation of renal tubular function in 100 patients with thalassemia minor. Materials & Methods: 100 patients with β- thalassemia which confirmed by hemoglobin electrophoresis and CBC as well as RBC indices were studied.14 out of 100 cases exit because of Urinary Tract Infection, diabetes mellitus or hypertension.Complete chemistry profile was performed on serum and urine of all reminder 86 patients (46 female and 40 male. Patients classified into two groups: β-thalassemia minor with anemia and without anemia. Another control group include 50 healthy individuals also considered.Then data analyzed by proper statistical methods. Results: 20 out of 86 reminder cases e.g. 24% showed at least one index of renal tubular dysfunction.58% of patients was been anemic and 42% non anemic. The most prominent tubular dysfunction was seen in a 29 years old lady with glucosuria and without anemia. conclusion: β-Thalassemia minor is common in Iran specially in Fars province. This study revealed significant renal tubular dysfunction in patient with β-thalassemia minor. So it is necessary to check out thalassemic patients for renal function tests periodically. Key words: β-thalassemia, minor,renal tubular dysfunction

  14. Spectrum of types of thalassemias and hemoglobinopathies: study in a tertiary level children hospital in Bangladesh

    Directory of Open Access Journals (Sweden)

    Waqar A. Khan


    Full Text Available Thalassemias and hemoglobinopathies are the most common hemolytic congenital disorders in Bangladesh as in many parts of the world. This study was done to find the common types of thalassemias and abnormal hemoglobin variants seen in Bangladeshi populations. A total of 4813 samples were analyzed for hemoglobin disorders out of which 2308 (49.95% showed abnormalities. The samples were analyzed by Bio Rad D 10 Analyzer in 3914 (81.32% cases, BIORAD VARIANTβ thalassemia short program using the principle of high performance liquid chromatography in 474 (9.85% cases and by CAPILLARYS 2 FLEX PIERCING utilizing capillary electrophoresis in 425 (8.83% cases. The samples were analyzed in the Department of Biochemistry and Molecular Biology of Dhaka Shishu (Children Hospital, Dhaka, Bangladesh. The common hemoglobin disorders seen were β trait 863 (17.94%, Hb E trait 601 (12.50%, Hb E β thalassemia 524 (10.87%, β thalassemia major 192(4.00 %, Hb E disease 99 (2.05%. Other Hb abnormalities detected were Hb D trait 17 (0.35%, Sickle cell trait 4 (0.08%, hereditary persistence of fetal hemoglobin (HPFH 2 (0.04%, and Hb Lepore, δ β thalassemia, sickle cell β thalassemia, Sickle cell disease, compound heterozygote for HbE+D and Hb Q band one case each (0.02%.   与世界许多地方一样,地中海和血红蛋白病是孟加拉国最常见的溶血性先天性疾病。本研究的目的是找到孟加拉国人群的常见地中海贫血类型和异常血红蛋白变体。总共对4813例样本进行了血红蛋白疾病分析,其中2308例(49.95%)显示异常。3914例(81.32%)样本使用Bio Rad D 10分析仪分析,由BIORAD VARIANTβ地中海贫血症短期计划使用高效液相色谱法分析了474例(9.85%),由CAPILLARYS 2 FLEX PIERCING使用毛细管电泳分析了425例(8.83%)。样本在孟加拉达卡的达卡生化与分子生物学教研室进行分析。观察到的常见血红蛋白疾病是863例(17.94%

  15. Vascular endothelial dysfunction in β-thalassemia occurs despite increased eNOS expression and preserved vascular smooth muscle cell reactivity to NO.

    Directory of Open Access Journals (Sweden)

    Ekatherina Stoyanova

    Full Text Available The hereditary β-thalassemia major condition requires regular lifelong blood transfusions. Transfusion-related iron overloading has been associated with the onset of cardiovascular complications, including cardiac dysfunction and vascular anomalies. By using an untransfused murine model of β-thalassemia major, we tested the hypothesis that vascular endothelial dysfunction, alterations of arterial structure and of its mechanical properties would occur despite the absence of treatments.Vascular function and structure were evaluated ex vivo. Compared to the controls, endothelium-dependent vasodilation with acetylcholine was blunted in mesenteric resistance arteries of β-thalassemic mice while the endothelium-independent vasodilator (sodium nitroprusside produced comparable vessel dilation, indicating endothelial cell impairment with preserved smooth muscle cell reactivity to nitric oxide (NO. While these findings suggest a decrease in NO bioavailability, Western blotting showed heightened expression of aortic endothelial NO synthase (eNOS in β-thalassemia. Vascular remodeling of the common carotid arteries revealed increased medial elastin content. Under isobaric conditions, the carotid arteries of β-thalassemic mice exhibited decreased wall stress and softening due to structural changes of the vessel wall.A complex vasculopathy was identified in untransfused β-thalassemic mice characterized by altered carotid artery structure and endothelial dysfunction of resistance arterioles, likely attributable to reduced NO bioavailability despite enhanced vascular eNOS expression.

  16. Critical appraisal of discriminant formulas for distinguishing thalassemia from iron deficiency in patients with microcytic anemia. (United States)

    Urrechaga, Eloísa; Hoffmann, Johannes J M L


    Many discriminant formulas have been reported for distinguishing thalassemia trait from iron deficiency in patients with microcytic anemia. Independent verification of several discriminant formulas is deficient or even lacking. Therefore, we have retrospectively investigated discriminant formulas in a large, well-characterized patient population. The investigational population consisted of 2664 patients with microcytic anemia: 1259 had iron deficiency, 1196 'pure' thalassemia trait (877 β- and 319 α-thalassemia), 150 had thalassemia trait with concomitant iron deficiency or anemia of chronic disease, and 36 had other diseases. We investigated 25 discriminant formulas that only use hematologic parameters available on all analyzers; formulas with more advanced parameters were disregarded. The diagnostic performance was investigated using ROC analysis. The three best performing formulas were the Jayabose (RDW index), Janel (11T), and Green and King formulas. The differences between them were not statistically significant (p>0.333), but each of them had significantly higher area under the ROC curve than any other formula. The Jayabose and Green and King formulas had the highest sensitivities: 0.917 both. The highest specificity, 0.925, was found for the Janel formula, which is a composite score of 11 other formulas. All investigated formulas performed significantly better in distinguishing β- than α-thalassemia from iron deficiency. In our patient population, the Jayabose RDW index, the Green and King formula and the Janel 11T score are superior to all other formulas examined for distinguishing between thalassemia trait and iron deficiency anemia. We confirmed that all formulas perform much better in β- than in α-thalassemia carriers and also that they incorrectly classify approximately 30% of thalassemia carriers with concomitant other anemia as not having thalassemia. The diagnostic performance of even the best formulas is not high enough for making a final

  17. Failure to replicate the internal structure of Greek-specific thalassemia quality of life instrument in adult thalassemia patients in Sabah. (United States)

    Keowmani, Thamron; Lee, Lily Wong Lee


    To study the validity and reliability of the Malay version of the Specific Thalassemia Quality of Life Instrument (STQOLI) in Sabah's adult thalassemia patients. This cross-sectional study was done at Thalassemia Treatment Centre, Queen Elizabeth Hospital in Sabah, Malaysia. Eighty-two adult thalassemia patients who fulfilled the inclusion and exclusion criteria were conveniently selected for participation in the study. The English version of STQOLI was translated into Malay by using forward and back translations. The content of the questionnaire was validated by the chief hematologist of the hospital. The construct validity of the 40-item questionnaire was assessed by principal component analysis with varimax rotation and the scale reliability was assessed by Cronbach's alpha. The study failed to replicate the internal structure of the Greek STQOLI. Instead, 12 factors have been identified from the exploratory factor analysis, which accounted for 72.2% of the variance. However, only eight factors were interpretable. The factors were iron chelation pump impact, transfusion impact, time spent on treatment and its impact on work and social life, sex life, side effects of treatment, cardiovascular problems, psychology, and iron chelation pill impact. The overall scale reliability was 0.913. This study was unable to replicate the internal structure of the Greek STQOLI in Sabah's adult thalassemia patients. Instead, a new structure has emerged that can be used as a guide to develop a questionnaire specific for adult thalassemia patients in Sabah. Future research should focus on the eight factors identified from this study.

  18. Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload. (United States)

    Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal


    This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.

  19. Community genetics and health approaches for bringing awareness in tribals for the prevention of beta-thalassemia in India

    Directory of Open Access Journals (Sweden)

    Ranbir S. Balgir


    Full Text Available Beta (β thalassemia syndromes are a group of hereditary disorders characterized by a genetic deficiency in the synthesis of β-globin chains. In the homozygous state, β-thalassemia (i.e., thalassemia major causes severe transfusion-dependent anemia. Inherited β-thalassemia syndromes cause high degree of hemolytic anemia, recurrent fever, clinical jaundice, frequent infections, bossing of cheek bones, growth retardation, splenomegaly, etc. and are responsible for high infant morbidity, mortality and fetal wastage in India. The victims include the infants, growing children, adolescent girls, pregnant women and a large chunk of ignorant people. In view of heavy genetic load, frequent requirement of blood transfusions, high cost of treatment and management, physical trauma, and mental and psychological harassment to the patients and their families, it has been realized that preventive community health and genetics approach is the most suitable for India. After carrier detection, prenatal diagnosis, and genetic couselling are the important options for couples at high risk for β-thalassemia. A prerequisite for successful prevention and intervention approach in India is the health education, bringing public awareness, sensitization, and community screening for the identification of heterozygotes or carriers in the concerned community. Some suggestions for the prevention of β-thalassemia in the vulnerable communities of India have been over emphasized for amelioration.β地中海贫血综合症是一簇遗传性异常,其特点是β球蛋白链接合处基因缺失。β地贫(或重型地贫)在纯和状态下导致严重的输液依赖型贫血症。遗传性的β地贫综合症引起严重的溶血性贫血、回归热、显性黄疸、常见感染、疼痛危象、颊骨浮肿、生长迟缓、脾肿大等症状,这导致在印度出现婴儿高发病率、死亡率和胎儿夭折。其受害人群包括婴儿、发

  20. Thalassemia in Messina: a sociological approach to chronic disease

    Directory of Open Access Journals (Sweden)

    Silvia Carbone


    Full Text Available Changing the care along with improved treatment, have altered the life of thalassemia patients, one of the world’s most common genetic diseases (Thalassemia International Federation; The new demography of the disease, with its widely variable phenotypes, has implications for its diagnosis, counseling, and management. Improved of the new treatment of this ancient disease is essential for optimizing survival. From June 2010 to January 2011, we interviewed 36 people with thalassemia from a primary care in Messina (Center of Genetics and Immunology. The aim of this study is to show the results of a survey conducted in this Center in Messina. This study shows the importance of influence of a multidisciplinary approach, medical, psychological and social, that addresses the changing treatment and epidemiology of thalassemia in order to ensure a better quality of life and survival. Understanding the influence of all three types of resources, medical, psychological and social, is critical for constructing ways to enhance health capability, chronic disease self-management, and health.  以更好的护理方式改善治疗,改变了地中海贫血(一种世界上最常见的遗传性疾病)患者的生活。地中海贫血国际联合会,。新的疾病人口统计学方法,凭借着不同的方式地中海贫血症的诊断,咨询和管理产生了影响。对于这种古老的疾病,改善的新疗法对病人生存能力至关重要。从2010年6月至2011年1月,我们在墨西拿的一家初级保健中心(遗传学及免疫学)采访了36位地中海贫血患者。本研究的目的是在墨西拿的这家保健中心得出调查结果。研究显示了针对地中海贫血症,运用多学科方法 —— 医疗,心理和社会以确保患者拥有更好的生存力和生活质量的重要影响力。理解这三种资源的影响力 —— 医疗,心理和社会

  1. Thalassemia and hemoglobinopathies in Southeast Asian newborns: diagnostic assessment using capillary electrophoresis system. (United States)

    Srivorakun, Hataichanok; Fucharoen, Goonnapa; Changtrakul, Yossombat; Komwilaisak, Patcharee; Fucharoen, Supan


    We have investigated the Capillarys 2 Hemoglobin testing system to assist in presumptive diagnosis of thalassemia and hemoglobinopathies commonly found in Southeast Asia. Study was conducted on 226 newborns. Hematological parameters were recorded and Hb profiles were examined on the Capillarys 2 Hemoglobin analyzer (SEBIA). DNA analyses were used to establish the final diagnoses. Among 226 newborns examined, 122 had thalassemias with 17 different genotypes. The capillary electrophoresis system could provide useful data for presumptive diagnoses of cases, especially those with Hb E and α-thalassemia. Hb E was found to be 2.6-6.2% in heterozygote whereas Hb Bart's were clearly observed in cases with compound heterozygous or homozygous α(+)-thalassemia and heterozygous α(0)-thalassemia. Hb H disease and other forms of α-thalassemia could be differentiated based on the presence of Hb Bart's and its percentage. The capillary electrophoresis system is applicable to newborn screening for common forms of thalassemia in Southeast Asia. Copyright © 2011 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  2. Is beta-thalassemia trait a protective factor against ischemic cerebrovascular accidents? (United States)

    Karimi, Mehran; Borhani Haghighi, Afshin; Yazdani, Maryam; Raisi, Hamideh; Giti, Rahil; Namazee, Mohammad Reza


    In this research, we sought to determine the association between beta-thalassemia trait and ischemic cerebrovascular accident (CVA). In acase-control study, 148 patients with thromboembolic cerebrovascular events were evaluated for the presence of hypertension, diabetes mellitus, hyperlipidemia, and beta-thalassemia trait. A total of 156 age- and sex-matched patients with no cardiac or cerebrovascular diseases, serving as the control group, were also investigated for the above-mentioned risk factors. We found that 6.1% of patients with ischemic CVA and 12.2% of the control group had beta-thalassemia trait (P = .066). In male patients, the negative association between ischemic CVA and presence of beta-thalassemia trait was significant (P = .008). In patients, the prevalence of hypertension was also significantly different between those with and without beta-thalassemia trait (P = .01); those with beta-thalassemia trait had a lower mean blood pressure than those without the trait. beta-Thalassemia trait may have a protective effect against ischemic CVA that might be caused by the lower arterial blood pressure observed in those with this trait.

  3. Reactivation of fetal hemoglobin in thalassemia and sickle cell disease

    Directory of Open Access Journals (Sweden)

    Sandro Eridani


    Full Text Available Considerable attention has been recently devoted to mechanisms involved in the perinatal hemoglobin switch, as it was long ago established that the survival of fetal hemoglobin (HbF production in significant amount can reduce the severity of the clinical course in severe disorders like β-thalassemia and sickle cell disease (SCD. For instance, when β-thalassemia is associated with hereditary persistence of fetal hemoglobin (HPFH the disease takes a mild course, labeled as thalassemia intermedia. The same clinical amelioration occurs for the association between HPFH and SCD. As for the mechanism of this effect, some information has been obtained from the study of natural mutations at the human β-globin locus in patients with increased HbF, like the Corfu thalassemia mutations. Important evidence came from the discovery that drugs capable of improving the clinical picture of SCD, like decitabine ad hydroxycarbamide, are acting through the reactivation, to some extent, of HbF synthesis. The study of the mechanism of action of these compounds was followed by the identification of some genetic determinants, which promote this event. In particular, among a few genetic factors involved in this process, the most relevant appears the BCL11A gene, which is now credited to be able to silence γ-globin genes in the perinatal period by interaction with several erythroid-specific transcription factors and is actually considered as a barrier to HbF reactivation by known HbF inducing agents. Epigenetics is also a player in the process, mainly through DNA demethylation. This is certified by the recent demonstration that hypomethylating agents such as 5-azacytidine and decitabine, the first compounds used for HbF induction by pharmacology, act as irreversible inhibitors of demethyltransferase enzymes. Great interest has also been raised by the finding that several micro-RNAs, which act as negative regulators of gene expression, have been implicated in the

  4. Paraplegia due to extramedullary hematopoiesis in thalassemia treated successfully with radiation therapy. (United States)

    Malik, Monica; Pillai, Lakshmi S; Gogia, Nidhi; Puri, Tarun; Mahapatra, M; Sharma, Daya Nand; Kumar, Rajat


    Spinal cord compression due to extramedullary hematopoiesis (EMH) is a rare complication of thalassemia and generally presents as paraparesis with sensory impairment. Complete paraplegia is extremely rare in EMH due to thalassemia although it is known to occur in polycythemia vera and sickle cell anemia. Treatment options mostly include surgery and/or radiotherapy. Whereas cases presenting with paraparesis have been treated with either surgery or radiotherapy with equal frequency and efficacy, almost all reported cases with paraplegia have been treated with surgery with or without radiation therapy. We hereby report a case of thalassemia intermedia with paraplegia treated successfully with radiotherapy.

  5. Associations between a+-thalassemia and Plasmodium falciparum malarial infection in northeastern Tanzania

    DEFF Research Database (Denmark)

    Enevold, Anders; Alifrangis, Michael; Sanchez, Juan J


    BACKGROUND: The 2 most common hemoglobinopathies, sickle cell trait and alpha (+)-thalassemia, confer partial resistance to fatal forms of malaria, but the molecular basis for this protection is still not understood. Examination of the relationship between these traits and malaria transmission...... the prevalence of the 2 traits and malariometric indices were investigated by logistic regression. Short tandem repeat (STR) microsatellite allele frequencies were used to assess population substructuring. RESULTS: The frequency of alpha (+)-thalassemia ranged from 10%-25% in high-altitude villages (>1200 m......) to 45%-55% in low-altitude villages (thalassemia decreased by approximately 12% per 100-m increase in altitude (P

  6. Alpha-thalassemia genetic testing: an important anemia diagnostic tool in patients of African heritage. (United States)

    Dasanu, Constantin A


    Inherited alpha-thalassemia genotypes have been shown to have a rather high prevalence in some patient populations of African heritage. These genotypes lead to mild anemia with microcytic indices and a normal hemoglobin electrophoresis. In our outpatient department, we analyzed 54 consecutive patients of African descent with longstanding microcytic anemia, but no evidence of iron deficiency. We detected alpha-thalassemia gene deletions in 94 percent of these patients. Alpha-thalassemia genetic testing appears cost-effective in an otherwise unexplained, longstanding microcytic anemia in patients of African origin.

  7. Hemoglobin Interlaken in combination with beta thalassemia trait

    Directory of Open Access Journals (Sweden)

    Mara J. Ojeda


    Full Text Available We report a rare a1 globin gene variant (Hb Interlaken found in a 63-year-old woman of Italian ancestry living in Buenos Aires Province, Argentina. The variant, a missense mutation at cd15 (GGT → GAT causing a Gly →Asp amino acid substitution and also known as Hb J Oxford, was found in combination with the common thalassemia trait cd 39 (C→T. The clinical picture of the patient was that of a b-thalassemia trait. 我们曾报道在阿根廷布宜诺斯艾利斯一名63岁意大利血统的妇女体内发现罕有的1珠蛋白基因(因特拉肯血红蛋白)变体。研究发现该变体是导致Gly → Asp氨基酸置的错义突变,也称为Hb J Oxford,与常见的地中海贫血性症cd 39 (C → T)有关。该患者临床症状与乙型地中海贫血特征相同。

  8. Phenotype-genotype correlation in β-thalassemia

    Directory of Open Access Journals (Sweden)

    R. Galanello


    Full Text Available The clinical manifestations of β-thalassemia are extremely heterogeneous, ranging from severe transfusion-dependent anemia, to the mild non transfusion dependent thalassemia intermedia and to the asymptomatic carrier state. The remarkable phenotypic variability is primary due to variations in the different globin genes (primary gene modifiers. The main pathophysiological determinant of the severity of β-thalassemia syndromes is the extent of a/non-a globin chain imbalance. Therefore, any factor capable of reducing the globin chain imbalance may have an ameliorating effect on the clinical picture. The most common mechanisms responsible of the amelioration of the phenotype are mild or silent β thalassemia alleles, coinheritance of a thalassemia, or of genetic determinants associated with increased g globin chain production. Rarely, other complex mechanisms including dominantly inherited β thalassemia, somatic deletion of β globin gene and coinheritance of extra a globin genes with heterozygous β thalassemia have been reported. In addition to the variability of the phenotype resulting from primary gene modifiers, other genetic factors (secondary gene modifiers, mapping outside the β and a globin cluster, may influence the disease complications. Among these factors the ones best so far defined are those affecting bilirubin, iron and bone metabolism. However, the new methods of DNA analysis (i.e. GWAS and related methods are expect expand the number of genes or gene variants involved in the phenotypic variability and in the response to treatment of β thalassemia. 从严重的输液依赖型贫血症到轻度非输液依赖性中间型地中海贫血,再到无症状携带状态,β地中海贫血的临床表现极度异源性。 由于不同珠蛋白基因(初级基因修饰因子)发生各种变异,主要表现为显著的表型变异。 α/非α珠蛋白链不平衡程度是加重β地中海贫血综合症

  9. Extramedullary hematopoiesis and paraplegia in a patient with hemoglobin e-Beta thalassemia. (United States)

    Alam, M R; Habib, M S; Dhakal, G P; Khan, M R; Rahim, M A; Chowdhury, A J; Mahmud, T K


    Extramedullary hematopoiesis (EMH) occurs in patients with various hematologic disorders involving a chronic increase in the production of red blood cells, and is often associated polycythemia vera and sickle cell anaemia, but is less common with thalassemia especially with hemoglobin E-beta thalassemia. Spinal cord compression due to EMH is a extremely rare complication of thalassemia and may present with paraparesis or paraplegia with or without sensory impairment. Treatment options mostly include surgery and/or radiotherapy. Whereas cases presenting with paraplegia have been treated with either surgery or radiotherapy with equal frequency and efficacy, almost all reported cases with paraplegia have been treated with surgery with or without radiation therapy. We hereby report a case of hemoglobin E-beta thalassemia with paraplegia treated successfully with radiotherapy.

  10. Red cell distribution width in the diagnosis of iron deficiency anemia and thalassemia trait

    International Nuclear Information System (INIS)

    Adil, M.M.; Junaid, A.; Zaman, I.; Ishtiaque, Z.B.


    To evaluate diagnostic importance of Red Cell Distribution Width (RDW) in differentiating iron deficiency anemia from Thalassemia trait. A total of 100 cases aged 5 months to 50 years of either sex with diagnosed iron deficiency anemia or thalassemia trait were compared with respect to their RDW value. RDW value in iron deficiency anemia was between 36.2% to 55.2% (Mean 44.1%). The range of RDW in Thalassemia trait was 14.7% to 24.9% (Mean 19.8%). Conclusions The very high range of RDW in iron deficiency anemia as compared to slight elevation of the value in thalassemia trait in our study suggests that RDW value obtained from simple Complete Blood Counts (CBC) can help in differentiating the two pathologies. (author)

  11. molecular analysis of intron-1 mutation in β-Globin gene of β-Thalassemia

    International Nuclear Information System (INIS)

    Kamel, S.A.L.M.


    β-thalassemia is considered the most common genetic disorder worldwide, it occurs in a particularly high frequency in abroad belt extending from the mediterranean basin through the middle east, and abundance in egypt. the thalassemias are a group of genetic (inherited) blood disorders that share in common one feature, the defective production of hemoglobin. there are many different disorders with defective hemoglobin synthesis and, hence, many types of thalassemia. about 3% of the world's population (180 million people) carry β-thalassemia genes.the present study was carried out in the biological application department of nuclear research center, atomic energy authority and microbiology department and hematology unit of pediatrics department, faculty of medicine, Zagazig University

  12. Hubungan Kadar Feritin Serum dengan Gangguan Fungsi Paru Pasien Thalassemia Mayor Anak

    Directory of Open Access Journals (Sweden)

    Marte Robiul Sani


    Kesimpulan. Terdapat hubungan bermakna kadar feritin serum dengan gangguan fungsi paru pasien thalassemia mayor anak dan kadar feritin 4.839 μg/L merupakan batasan kadar feritin yang berhubungan dengan gangguan fungsi paru.

  13. Fine-tiling array CGH to improve diagnostics for alpha- and beta-thalassemia rearrangements

    NARCIS (Netherlands)

    Phylipsen, M.; Chaibunruang, A.; Vogelaar, I.P.; Balak, J.R.; Schaap, R.A.; Ariyurek, Y.; Fucharoen, S.; den Dunnen, J.T.; Giordano, P.C.; Bakker, E.; Harteveld, C.L.


    Implementation of multiplex ligation-dependent probe amplification (MLPA) for thalassemia causing deletions has lead to the detection of new rearrangements. Knowledge of the exact breakpoint sequences should give more insight into the molecular mechanisms underlying these rearrangements, and would

  14. [Advances in Pathogenesis and Related Clinical Research of Thromboembolism in Patients with Thalassemia after Splenectomy]. (United States)

    Sun, Na; Cheng, Peng; Deng, Dong-Hong


    Thalassemia is the most common human hereditary hemolytic anemia. Due to splenomegaly and hypersp-lenism, splenectomy can be used as a means of treatment for thalassemia. Various complications following splenectomy, however, especially thromboembolic complications are remarkable. This review summarizes the incidence, clinical manifestations and development time of thromboembolism. The pathogenesis of thromboembolism after splenectomy in thalassemia, such as abnormal platelet number and function, changes in red cell membrane, endothelial cell damage, dysfunction of other procoagulant and anticoagulant factors, and local factors associated with splenectomy are elaborated and the trategies to prevent and treat the thromboembolic events in thalassemia after splenectomy, including the attention to risk factors associated with splenectomy, a reassessment of splenectomy, regular blood transfusion to reduce the ratio of abnormal red blood cells, treatment with anticoagulant and antiplatelet drugs, application of hydroxyurea and stem cell transplantation are discussed.

  15. Effect of Combined versus Monotherapy with Deferoxamine and Deferiprone in Iron Overloaded Thalassemia Patients: a Randomized Clinical Trial

    Directory of Open Access Journals (Sweden)

    Sasan Hejazi


    Full Text Available Background: Patients with transfusional iron overload have depended on iron chelation therapy and improving chelation regimens have been of the highest priority. The aim of this study was to compare effect of combined versus monotherapy with Deferoxamine (DFO and Deferiprone (DFP in iron overloaded beta thalassemia (BT major patients Materials and Methods We studied 36 BT major patients (mean age 7.6±4.6; range 3–16 years attending the Ormieh Motahari hospital for regular transfusional support. Patients were randomly allocated to receive one of the following two treatments: DFO in combination with DFP (n=12, DFO alone (n=12 and DFP alone (n=12. Serum ferritin level, liver enzymes, blood urea nitrogen, and creatinine and side effects were monitored over a 12 months period. Results: After one year, serum ferritin decreased more significantly in patients on DFO+DFP therapy compared to patients who only received DFO or DFP alone (P

  16. β-Thalassemia mutations and hemoglobinopathies in Adana, Turkey: results from a single center study


    Guvenc, Birol; Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan


    Introduction β-Thalassemia and hemoglobinopathies are common genetic disorders in Turkey and in this retrospective study our aim was to determine the frequency of β-thalassemia and hemoglobinopathies in Adana, which is one of the biggest cities located in the southern part of Turkey. Material and methods Data from 3000 individuals admitted to Seyhan Hereditary Blood Disorders Center in Adana were evaluated. The blood samples were collected into EDTA-containing tubes and hematological paramete...

  17. Interaction of malaria with a common form of severe thalassemia in an Asian population (United States)

    O'Donnell, A.; Premawardhena, A.; Arambepola, M.; Samaranayake, R.; Allen, S. J.; Peto, T. E. A.; Fisher, C. A.; Cook, J.; Corran, P. H.; Olivieri, Nancy F.; Weatherall, D. J.


    In many Asian populations, the commonest form of severe thalassemia results from the coinheritance of HbE and β thalassemia. The management of this disease is particularly difficult because of its extreme clinical diversity; although some genetic and adaptive factors have been identified as phenotypic modifiers, the reasons remain unclear. Because the role of the environment in the course of severe thalassemia has been neglected completely and because malaria due to both Plasmodium falciparum and Plasmodium vivax has been prevalent in Sri Lanka, we carried out a pilot study of patients with HbE β thalassemia that showed high frequencies of antibodies to both parasite species and that 28.6% of the children had DNA-based evidence of current infection with P. vivax. Malarial antibodies then were assessed in patients with HbE β thalassemia compared with those in age-matched controls. There was a significant increase in the frequency of antibodies in the thalassemic patients, particularly against P. vivax and in young children. There was also a higher frequency in those who had been splenectomized compared with those with intact spleens, although in the latter it was still higher than that in the controls. The thalassemic patients showed significant correlations between malaria antibody status and phenotype. Patients with HbE β thalassemia may be more prone to malaria, particularly P. vivax, which is reflected in their clinical severity. Because P. vivax malaria is widespread in Asia, further studies of its interaction with HbE β thalassemia and related diseases are required urgently as a part of ongoing thalassemia control programs. PMID:19841268

  18. Coexistence of Southeast Asian ovalocytosis and beta-thalassemia: a molecular and hematological analysis. (United States)

    Fucharoen, Goonnapa; Fucharoen, Supan; Singsanan, Sanita; Sanchaisuriya, Kanokwan


    We describe hematological and molecular characterization of a Thai female who had Southeast Asian ovalocytosis (SAO) associated with beta+-thalassemia trait. The proband had mild microcytosis with Hb 12.9 g/dl, Hct 35.8%, MCV 74.4 fl, MCH 26.8 pg, MCHC 36.0 g/dl, and elevated Hb A2 (5.6%), characteristics of beta-thalassemia trait. Peripheral blood film examination revealed prominent ovalocytosis. However, a one-tube osmotic fragility (OF) test commonly used for thalassemia screening was negative and a normal OF curve was observed. Further polymerase chain reaction (PCR) analyses identified the beta(-28A-G) mutation in the beta-globin gene and a 27 bp deletion in erythrocyte band 3 protein gene, indicating a genetically compound heterozygote. Hematological data of the proband was comparatively presented with those of eight female and 15 male carriers of pure beta-thalassemia with the same mutation. The finding demonstrates that although the association of the SAO and beta-thalassemia does not produce a more severe clinical picture, this could lead to a mis-screening of beta-thalassemia using an OF test as a primary screening test. Additional blood film examination followed by PCR could help in the detection of this unusual genetic interaction in the region. (c) 2006 Wiley-Liss, Inc.

  19. Prevalence of periodontal disease in children with leukemia disease and thalassemia

    Directory of Open Access Journals (Sweden)

    Hardianti Maulidita


    Full Text Available Various periodontal disease can occur in children and adolescents. Some can take place quickly and periodontal tissue damage. Several previous studies indicate that systemic diseases associated with periodontal disease in children. This study aims to determine the prevalence of periodontal disease in children with leukemia and thalassemia. The design study is a cross-sectional approach. Periodontal pocket depth measurements performed using the WHO standard of measurement. The samples in this study were drawn from the entire population using accidental sampling method. Sampled population was pediatric patients with leukemia and thalassemia. These patients were undergoing treatment in hospital Wahidin Sudirohusodo Hospital Makassar. During the study, children with leukemia as many as 18 patients and children with thalassemia by 8 patients. Distribution of pediatric patients suffering from leukemia by CPITN score; score of 2 as many as 10 patients (55.6%, a score of 1 as 6 patients (33.3%, and  score of 0 as many as 2 patients (11.1%. CPITN score in children with thalassemia; scores 2 in 1 patient (12.5%, a score of 1 as 6 patients (75%, and score of 0 by 1 patient (12.5%. Children who have leukemia and thalassemia, showed the rate of occurrence of different periodontal disease. Children with leukemia shows the level of periodontal disease is higher than in children with thalassemia disease.

  20. Association of erythrocyte deformability with red blood cell distribution width in metabolic diseases and thalassemia trait. (United States)

    Vayá, Amparo; Alis, Rafael; Suescún, Marta; Rivera, Leonor; Murado, Julian; Romagnoli, Marco; Solá, Eva; Hernandez-Mijares, Antonio


    Increased red blood distribution width (RDW) in anemia is related to disturbances in the cellular surface/volume ratio, usually accompanied by morphological alterations, while it has been shown in inflammatory diseases that the activity of pro-inflammatory cytokines disturbing erythropoiesis increases RDW. Recently it has been reported that higher RDW is related with decreased erythrocyte deformability, and that it could be related with the association of RDW and increased risk of cardiovascular diseases. In order to analyze the influence of morphological alterations and proinflammatory status on the relationship between RDW and erythrocyte deformability, we analyzed erythrocyte deformability along with RDW and other hematological and biochemical parameters in 36 α-thalassemia, 20 β-thalassemia, 20 δβ-thalassemia trait carriers, 61 metabolic syndrome patients and 76 morbidly obese patients. RDW correlated inversely with erythrocyte deformability in minor β-thalassemia (r =-0.530, p thalassemia is often accompanied by more marked cell-shaped perturbations than other thalassemia traits. This could be the reason for this negative association only in this setting. Higher anisocytosis seems to be associated with greater morphologic alterations (shape/volume), which reduce erythrocyte deformability. The proinflammatory profile in metabolic patients can be related to the positive association of RDW with erythrocyte deformability found in these patients. However, further research is needed to explain the mechanisms underlying this association.

  1. High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand. (United States)

    Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong


    High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.

  2. Failure to replicate the internal structure of Greek-specific thalassemia quality of life instrument in adult thalassemia patients in Sabah

    Directory of Open Access Journals (Sweden)

    Keowmani T


    Full Text Available Thamron Keowmani,1 Lily Wong Lee Lee21Clinical Research Centre, 2Hematology Unit, Queen Elizabeth Hospital, Kota Kinabalu, Sabah, MalaysiaPurpose: To study the validity and reliability of the Malay version of the Specific Thalassemia Quality of Life Instrument (STQOLI in Sabah’s adult thalassemia patients.Patients and methods: This cross-sectional study was done at Thalassemia Treatment Centre, Queen Elizabeth Hospital in Sabah, Malaysia. Eighty-two adult thalassemia patients who fulfilled the inclusion and exclusion criteria were conveniently selected for participation in the study. The English version of STQOLI was translated into Malay by using forward and back translations. The content of the questionnaire was validated by the chief hematologist of the hospital. The construct validity of the 40-item questionnaire was assessed by principal component analysis with varimax rotation and the scale reliability was assessed by Cronbach’s alpha.Results: The study failed to replicate the internal structure of the Greek STQOLI. Instead, 12 factors have been identified from the exploratory factor analysis, which accounted for 72.2% of the variance. However, only eight factors were interpretable. The factors were iron chelation pump impact, transfusion impact, time spent on treatment and its impact on work and social life, sex life, side effects of treatment, cardiovascular problems, psychology, and iron chelation pill impact. The overall scale reliability was 0.913.Conclusion: This study was unable to replicate the internal structure of the Greek STQOLI in Sabah’s adult thalassemia patients. Instead, a new structure has emerged that can be used as a guide to develop a questionnaire specific for adult thalassemia patients in Sabah. Future research should focus on the eight factors identified from this study.Keywords: STQOLI, validity, reliability, Malay, transfusion

  3. Paraspinal extramedullary hematopoiesis in patients with thalassemia intermedia. (United States)

    Haidar, Rachid; Mhaidli, Hani; Taher, Ali T


    Ineffective erythropoiesis in patients with thalassemia intermedia drives extramedullary hematopoietic tumor formation in several parts of the body. Paraspinal involvement has received increasing attention due to the associated morbidity secondary to spinal cord compression. Although the history and physical examination may help narrow the differential diagnosis, radiographic imaging remains essential to confirm the existence of hematopoietic tissue. Characteristic appearance has been observed mainly on magnetic resonance imaging. Several treatment options have been described, including transfusion therapy, laminectomy, radiotherapy, and the use of fetal hemoglobin inducing agents that decrease the hematopoietic drive. However, the ideal management scheme remains controversial. Until large prospective trials evaluate the efficacy and safety of the available treatment options, both in single and in combination therapy, an individualized approach should be entertained.

  4. Moessbauer studies of blood diseases: thalassemia and malaria

    International Nuclear Information System (INIS)

    Bauminger, E.R.


    In 57 F Moessbauer studies of blood samples obtained from patients with thalassemia large amounts of iron, yielding a well defined spectrum, different from that obtained in oxy - or deoxy-hemoglobin, were found. The additional iron component was identified as due to ferritin - the iron storage protein. The amounts of ferritin-like iron were comparable to those of hemoglobin iron and were especially large in reticulocytes. Desferral was found to remove ferritin-like iron from serum, but not from red blood cells. In malaria, a parasite induced blood disease, the iron containing compound in the malarial pigment in rats infected by Plasmodium berghei was found to be trivalent high spin, different from any known iron porphyrin, yet was found to be similar to hemin in human blood cells infected by P. falciparum. The difference in the spectra obtained in RBC infected with drug sensitive and drug resistance strains and the effect of medication on the spectra is discussed. (author)

  5. Iron metabolism in heterozygotes for hemoglobin E (HbE), alpha-thalassemia1, or beta-thalassemia and in compound heterozygotes for HbE/ beta-thalassemia

    NARCIS (Netherlands)

    Zimmermann, M.B.; Fucharoen, S.; Winichagoon, P.; Sirankapracha, P.; Zeder, C.; Gowachirapant, S.; Judprasong, K.; Tanno, T.; Miller, J.L.; Hurrell, R.F.


    BACKGROUND: Despite large populations carrying traits for thalassemia in countries implementing universal iron fortification, there are few data on the absorption and utilization of iron in these persons. OBJECTIVE: We aimed to determine whether iron absorption or utilization (or both) in women

  6. Psychometric properties of the Specific Thalassemia Quality of Life Instrument for adults

    Directory of Open Access Journals (Sweden)

    Lyrakos GN


    Full Text Available Georgios N Lyrakos,1,2 Demetra Vini,2 Helen Aslani,2 Marouso Drosou-Servou212nd Department of Anesthesiology, School of Medicine, University of Athens, Pain Clinic, Attikon University Hospital, 2Thalassemia Unit, General Hospital of Nikaia Ag. Panteleimon, Athens, GreeceBackground: No specific questionnaire has been developed to assess the health-related quality of life of thalassemia patients. Thus, the main objective of this study was to develop, according to psychometric standards, a self-administered Specific Thalassemia Quality of Life Instrument (STQOLI for adult patients.Methods: First, a qualitative phase was conducted to generate items and identify domains using the critical analysis incident technique and a literature review. A list of easily comprehensible, non-redundant items was defined using the Delphi technique and a pilot study on ten thalassemia patients. This phase involved both patients and experts. The second step was a quantitative validation phase comprising a study of 128 thalassemia patients in a single hospital. It was designed to select items, identify dimensions, and measure reliability and internal and concurrent validity. The psychometric and scaling properties of the proposed 41-item Specific Thalassemia Quality of Life Instrument were then assessed among patients recruited from the Thalassemia Unit at the General Hospital of Nikaia, Greece.Results: The final questionnaire had 41 items comprising four main domains and one global item about general health. The factorial structure was satisfactory (loading > 0.40 on each factor of the four domains for all items. Interscale correlations ranged from 0.06 to 0.78, Cronbach's α-coefficients were 0.78 for the psychosocial domain, 0.77 for the chelation domain, 0.72 for the transfusion domain, 0.81 for the disease and symptoms domain, and 0.840 for the total score of the questionnaire.Conclusion: The 41-item Specific Thalassemia Quality of Life Instrument seems to be a

  7. Molecular analysis of the beta-thalassemia phenotype associated with inheritance of hemoglobin E (alpha 2 beta2(26)Glu leads to Lys).


    Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G


    Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with...

  8. Screening of β-thalassemia trait among pregnant women with NESTROFT

    Directory of Open Access Journals (Sweden)

    Hitesh Sarda


    Full Text Available The morbidity of β-thalassemia major has forced medical professionals to formulate screening tests to effectively screen β-thalassemia trait (BTT of which naked eye single tube osmotic fragility test (NESTROFT is the most cost effective test. Optimal time to screen for BTT appears to be during pregnancy, as at risk couples can be offered prenatal diagnosis. We screened 55 pregnant women attending antenatal clinic in a medical college hospital at Bangalore, with NESTROFT. Twelve (21.89% were NESTROFT positive with mean hemoglobin of 11.2 mg % and packed cell volume of 32.6%. Catering predominantly to Vokkaliga community in whom literature reports increased prevalence of BTT, addition of a cost effective test like NESTROFT in the antenatal panel, appears promising.   β地中海贫血症的流行已迫使医护人员制定更有效的屏幕筛查方法(BTT),其中红细胞渗透脆性肉眼一管法(NESTROFT是成本较低的,亦最为有效的筛查方法。最佳的BTT筛查时间是怀孕期,可以为风险夫妇提供产前诊断。我们在班加罗尔医学院产前诊所对55名怀孕女性进行了红细胞渗透脆性肉眼一管法(NESTROFT)筛查。她们中的12位(21.89%)呈NESTROFT阳性,平均血红蛋白值11.2mg、细胞体积32.6%.在Vokkaliga地区发现了有关β地中海贫血症病例的增加,也许,成本低的、亦高效的红细胞渗透脆性肉眼一管法(NESTROFT)能为这一地区的产前筛查带来帮助。

  9. β-Thalassemia Haplotypes in Romania in the Context of Genetic Mixing in the Mediterranean Area. (United States)

    Cherry, Laudy; Calo, Carla; Talmaci, Rodica; Perrin, Pascale; Gavrila, Lucian


    The purpose of this meta-study was to investigate β-thalassemia (β-thal) mutations and their chromosomal background in order to highlight the origin and spread of thalassemia alleles in the European and Mediterranean areas. Screening of more than 100 new Romanian β-thal alleles was also conducted. The results suggest an ancient introduction of mutations at codon 39 (C > T) (HBB: c.118C > T) and IVS-I-6 (T > C) (HBB: c.92 + 6T > C) in Romania. A comparative study was performed based on restriction fragment length polymorphism (RFLP) haplotypes associated with β-thal mutations in Romania and in Mediterranean countries. Each common β-thal allele from different populations exhibits a high degree of haplotype similarity, a sign of a clear unicentric origin for the IVS-I-110 (G > A) (HBB: c.93-21G > A), IVS-I-6, IVS-II-745 (C > G) (HBB: c.316-106C > G) and codon 39 mutations (the 17a [+ - - - - + +], 13c [ - + + - - - +], 17c [ + - - - - - +] and 14a [- + + - + + + ] ancestral RFLP background, respectively), followed by recurrent recombination events. This study also showed that geographic distances played a major role in shaping the spread of the predominant β-thal alleles, whereas no genetic boundaries were detected between broad groups of populations living in the Middle East, Europe and North Africa. The analyses revealed some discrepancies concerning Morocco and Serbia, which suggest some peculiar genetic flows. Marked variations in β(A) were observed between Southeast Asia and the Mediterranean, whereas a relative genetic homogeneity was found around the Mediterranean Basin. This homogeneity is undoubtedly the result of the high level of specific historic human migrations that occurred in this area.

  10. Zinc Status Affects Glucose Homeostasis and Insulin Secretion in Patients with Thalassemia

    Directory of Open Access Journals (Sweden)

    Ellen B. Fung


    Full Text Available Up to 20% of adult patients with Thalassemia major (Thal live with diabetes, while 30% may be zinc deficient. The objective of this study was to explore the relationship between zinc status, impaired glucose tolerance and insulin sensitivity in Thal patients. Charts from thirty subjects (16 male, 27.8 ± 9.1 years with Thal were reviewed. Patients with low serum zinc had significantly lower fasting insulin, insulinogenic and oral disposition indexes (all p < 0.05 and elevated glucose response curve, following a standard 75 g oral load of glucose compared to those with normal serum zinc after controlling for baseline (group × time interaction p = 0.048. Longitudinal data in five patients with a decline in serum zinc over a two year follow up period (−19.0 ± 9.6 μg/dL, showed consistent increases in fasting glucose (3.6 ± 3.2 mg/dL and insulin to glucose ratios at 120 min post glucose dose (p = 0.05. Taken together, these data suggest that the frequently present zinc deficiency in Thal patients is associated with decreased insulin secretion and reduced glucose disposal. Future zinc trials will require modeling of oral glucose tolerance test data and not simply measurement of static indices in order to understand the complexities of pancreatic function in the Thal patient.

  11. Iron Overload and Chelation Therapy in Non-Transfusion Dependent Thalassemia. (United States)

    Bou-Fakhredin, Rayan; Bazarbachi, Abdul-Hamid; Chaya, Bachar; Sleiman, Joseph; Cappellini, Maria Domenica; Taher, Ali T


    Iron overload (IOL) due to increased intestinal iron absorption constitutes a major clinical problem in patients with non-transfusion-dependent thalassemia (NTDT), which is a cumulative process with advancing age. Current models for iron metabolism in patients with NTDT suggest that suppression of serum hepcidin leads to an increase in iron absorption and subsequent release of iron from the reticuloendothelial system, leading to depletion of macrophage iron, relatively low levels of serum ferritin, and liver iron loading. The consequences of IOL in patients with NTDT are multiple and multifactorial. Accurate and reliable methods of diagnosis and monitoring of body iron levels are essential, and the method of choice for measuring iron accumulation will depend on the patient's needs and on the available facilities. Iron chelation therapy (ICT) remains the backbone of NTDT management and is one of the most effective and practical ways of decreasing morbidity and mortality. The aim of this review is to describe the mechanism of IOL in NTDT, and the clinical complications that can develop as a result, in addition to the current and future therapeutic options available for the management of IOL in NTDT.

  12. Iron Overload and Chelation Therapy in Non-Transfusion Dependent Thalassemia

    Directory of Open Access Journals (Sweden)

    Rayan Bou-Fakhredin


    Full Text Available Iron overload (IOL due to increased intestinal iron absorption constitutes a major clinical problem in patients with non-transfusion-dependent thalassemia (NTDT, which is a cumulative process with advancing age. Current models for iron metabolism in patients with NTDT suggest that suppression of serum hepcidin leads to an increase in iron absorption and subsequent release of iron from the reticuloendothelial system, leading to depletion of macrophage iron, relatively low levels of serum ferritin, and liver iron loading. The consequences of IOL in patients with NTDT are multiple and multifactorial. Accurate and reliable methods of diagnosis and monitoring of body iron levels are essential, and the method of choice for measuring iron accumulation will depend on the patient’s needs and on the available facilities. Iron chelation therapy (ICT remains the backbone of NTDT management and is one of the most effective and practical ways of decreasing morbidity and mortality. The aim of this review is to describe the mechanism of IOL in NTDT, and the clinical complications that can develop as a result, in addition to the current and future therapeutic options available for the management of IOL in NTDT.

  13. 'Rakter dosh'--corrupting blood: The challenges of preventing thalassemia in Bengal, India. (United States)

    Chattopadhyay, Sreeparna


    Thalassemia is an inherited blood disorder that has been receiving increasing attention in India. However, prevention of thalassemia in India continues to be difficult despite efforts of public health professionals and the government. Using West Bengal as a case study, this paper attempts to unravel some of the barriers to the prevention campaign and the consequent under utilization of the program. Lack of access, low awareness, low-risk perception and poverty are all important proximate constraints; however, one of the greatest barriers to the program is rooted in cultural notions of blood, marriage, identity, personhood and kinship in Bengali society. Blood is so deeply valued in the Bengali kinship system that this genetic mutation is perceived to be corrupting the blood (rakter dosh). Being a thalassemia carrier (i.e., having thalassemia minor) renders an individual unfit as a suitable marriage partner because of beliefs related to purity of blood, its association with the continuity of the lineage, and subsequent transmission of desirable traits to future generations. The risk of non-marriage affects women disproportionately, and parents are not inclined to test their daughters because of the possibility of not being able to marry them off to eligible suitors. The stigma associated with having thalassemia minor (TMI) is a deterrent to the disclosure of thalassemia status as well as to testing. Using anthropological theories and ethnographic methods, this paper focuses on the gendered process by which the diagnosis of a thalassemia carrier 'spoils' identities, thereby creating a disjuncture between the goals of the prevention program and people's need for social conformity, and ultimately between medical desirability and social desirability. The paper also suggests policies for enhancing the utilization of the program. Finally the conclusions from this study have potential applications for public health prevention programs that confront problems of stigma in

  14. Thalassemia intermedia as a result of heterozygosis for ß0-thalassemia and aaaanti-3.7/aa genotype in a Brazilian patient

    Directory of Open Access Journals (Sweden)

    Kimura E.M.


    Full Text Available We report a case in which the interaction of heterozygosis for both the ß0-IVS-II-1 (G->A mutation and the aaaanti-3.7 allele was the probable cause for the clinical occurrence of thalassemia intermedia. The propositus, a 6-year-old Caucasian Brazilian boy of Portuguese descent, showed a moderately severe chronic anemia in spite of having the ß-thalassemia trait. Investigation of the alpha-globin gene status revealed heterozygosis for alpha-gene triplication (aaa/aa. The patient's father, also presenting mild microcytic and hypochromic anemia, had the same alpha and ß genotypes as his son, while the mother, not related to the father and hematologically normal, was also a carrier of the aaaanti-3.7 allele. The present case emphasizes the need for considering the possibility of alpha-gene triplication in ß-thalassemia heterozygotes who display an unexpected severe phenotype. The ß-thalassemia mutation found here is being described for the first time in Brazil.

  15. Alpha+ -thalassemia protects against anemia associated with asymptomatic malaria: evidence from community-based surveys in Tanzania and Kenya.

    NARCIS (Netherlands)

    Veenemans, J.; Andang'o, P.E.; Mbugi, E.V.; Kraaijenhagen, R.J.; Mwaniki, D.L.; Mockenhaupt, F.P.; Roewer, S.; Olomi, R.M.; Shao, J.F.; Meer, J.W.M. van der; Savelkoul, H.F.J.; Verhoef, H.


    BACKGROUND: In hospital-based studies, alpha(+)-thalassemia has been found to protect against severe, life-threatening falciparum malaria. alpha(+)-Thalassemia does not seem to prevent infection or high parasite densities but rather limits progression to severe disease--in particular, severe

  16. a+- Thalassemia Protects against Anemia Associated with Asymptomatic Malaria: Evidence from Community-Based Surveys in Tanzania and Kenya

    NARCIS (Netherlands)

    Veenemans, J.; Andang'o, P.E.A.; Mbugi, E.V.; Kraaijenhagen, R.; Mwaniki, D.; Mockenhaupt, F.P.; Roewer, S.; Olomi, R.M.; Shao, J.F.; Meer, van der J.W.M.; Savelkoul, H.F.J.; Verhoef, J.C.M.


    Background. In hospital-based studies, ¿+-thalassemia has been found to protect against severe, life-threatening falciparum malaria. ¿+-Thalassemia does not seem to prevent infection or high parasite densities but rather limits progression to severe disease¿in particular, severe malarial anemia. We

  17. Retinal detachment associated with thalassemia major and Marfan′s syndrome-A case report

    Directory of Open Access Journals (Sweden)

    Chatterjee Pranab


    Full Text Available The thalassaemias, unlike a few other disorders of the haemopoietic system, are very rarely accompanied by ophthalmological changed. Marfan′s Syndrome, on the other hand, exhibits a number of ocular manifestations 2. This article describes a case of uniocular retinal detachment associated with both these conditions

  18. Peripheral Blood stem cell transplantation in children with Beta-thalassemia major

    International Nuclear Information System (INIS)

    Farzana, T.; Shamsi, T.S.; Irfan, M.; Ansari, S.H.; Baig, M.I.; Shakoor, N.


    Objective: To share the preliminary data on stem cell transplantation in Pakistan. Results: Engraftment was achieved in all patients except one who required a second dose of bone marrow graft on day +21. Median time to achieve absolute neutrophil count of > 0.5 x 10/sup 9/ /l was 9.0 days (range 8 - 31 days) and platelet count of > 20 x 10/sup 9/ /l was 14 days (12 - 35 days). Acute GVHD was seen in 3 patients, one patient had grade IV gut GVHD; another patient had grade III gut GVHD while third patient had grade II skin GVHD. Median hospital stay was 29 days. Six patients were well and transfusion independent 3 to 36 months post transplant. One episode of primary graft failure required a second dose of bone marrow harvest. Another episode of graft rejection received two doses of donor lymphocytes infusion. There were 4 deaths due to grade IV gut GVHD because of uncontrolled systemic Candida infection and one due to hepatic veno-occlusive (VOD) disease. Conclusion: Allogeneic peripheral blood stem cell transplantation can be safely and economically carried out in Pakistan. Although there had been 4 deaths during 36 months follow-up, with increasing understanding and experience the outcome is expected to improve. (author)


    Directory of Open Access Journals (Sweden)

    Luisella Saba


    Full Text Available


    Prenatal diagnosis of β-thalassemia was accomplished for the first time in the 1970s by globin chain synthesis analysis on fetal blood obtained by placental aspiration at 18-22 weeks gestation. Since then, the molecular definition of the β- globin gene pathology, the development of procedures of DNA analysis, and the introduction of chorionic villous sampling have dramatically improved prenatal diagnosis of this  disease and of related disorders.  Much information is now available about the molecular mechanisms of the diseases and the molecular testing is widespread.

    As prenatal diagnosis has to provide an accurate, safe and early result, an efficient screening of the population and a rapid molecular characterization of the couple at risk, are necessary prerequisites. In the last decades  earlier and less invasive approaches for prenatal diagnosis were developed . A overview of the most promising procedure will be done.

    Moreover, in order to reduce the choice of   interrupting  the pregnancy in case of affected fetus, Preimplantation or Preconceptional Genetic Diagnosis (PGD has been setting up for several diseases including thalassemias.

    Cardiac iron overload in chronically transfused patients with thalassemia, sickle cell anemia, or myelodysplastic syndrome.

    Directory of Open Access Journals (Sweden)

    Mariane de Montalembert

    Full Text Available The risk and clinical significance of cardiac iron overload due to chronic transfusion varies with the underlying disease. Cardiac iron overload shortens the life expectancy of patients with thalassemia, whereas its effect is unclear in those with myelodysplastic syndromes (MDS. In patients with sickle cell anemia (SCA, iron does not seem to deposit quickly in the heart. Our primary objective was to assess through a multicentric study the prevalence of cardiac iron overload, defined as a cardiovascular magnetic resonance T2*8 ECs in the past year, and age older than 6 years. We included from 9 centers 20 patients with thalassemia, 41 with SCA, and 25 with MDS in 2012-2014. Erythrocytapharesis did not consistently prevent iron overload in patients with SCA. Cardiac iron overload was found in 3 (15% patients with thalassemia, none with SCA, and 4 (16% with MDS. The liver iron content (LIC ranged from 10.4 to 15.2 mg/g dry weight, with no significant differences across groups (P = 0.29. Abnormal T2* was not significantly associated with any of the measures of transfusion or chelation. Ferritin levels showed a strong association with LIC. Non-transferrin-bound iron was high in the thalassemia and MDS groups but low in the SCA group (P<0.001. Hepcidin was low in thalassemia, normal in SCA, and markedly elevated in MDS (P<0.001. Two mechanisms may explain that iron deposition largely spares the heart in SCA: the high level of erythropoiesis recycles the iron and the chronic inflammation retains iron within the macrophages. Thalassemia, in contrast, is characterized by inefficient erythropoiesis, unable to handle free iron. Iron accumulation varies widely in MDS syndromes due to the competing influences of abnormal erythropoiesis, excess iron supply, and inflammation.

  1. Birth of healthy children after preimplantation diagnosis of β-thalassemia

    Institute of Scientific and Technical Information of China (English)

    焦泽旭; 庄广伦; 周灿权; 舒益民; 李洁; 梁晓燕


    Background Clinical programs for preventing β-thalassemia are presently based on prospective carrier screening and prenatal diagnosis. This paper report an achievement of a pregnancy with unaffected embryos using in vitro fertilization and embryo transfer (IVF-ET), in combination with preimplantation genetic diagnosis (PGD), for a couple at risk of having children with β-thalassemia.Methods A couple carrying different thalassemia mutations, both a codon 41-42 mutation and the IVS Ⅱ 654 mutation, received standard IVF treatment, with intracytoplasmic sperm injection, embryo biopsiy, single cell polymerase chain reaction (PCR) and DNA analysis. Only unaffected or carrier embryos were transferred to the uterine cavity. After confirmation of pregnancy, a prenatal diagnosis was performed.Results Of a total of 13 embryos analyzed for β-globin mutations, PGD indicated that 2 were normal,3 were affected, and 6 were carriers. Diagnosis could not be made in the other 2 embryos. Three embryos were transferred to the uterus on the third day after oocyte retrieval. Ultrasonography revealed a twin pregnancy with one blighted ovum. The prenatal genetic diagnosis revealed that both fetuses were unaffected, and two healthy boys were born, confirming the results of PGD.Conclusions We developed a single-cell based primer extension preamplification (PEP)-PCR assay for the detection of β-thalassemia mutations. The assays were efficient and accurate at all stages of the procedure, and resulted in the birth of PGD-confirmed β-thalassemia free children in China. PEP was used here in PGD for β-thalassemia.

  2. Increased mitochondrial DNA deletions and copy number in transfusion-dependent thalassemia (United States)

    Calloway, Cassandra


    BACKGROUND. Iron overload is the primary cause of morbidity in transfusion-dependent thalassemia. Increase in iron causes mitochondrial dysfunction under experimental conditions, but the occurrence and significance of mitochondrial damage is not understood in patients with thalassemia. METHODS. Mitochondrial DNA (mtDNA) to nuclear DNA copy number (Mt/N) and frequency of the common 4977-bp mitochondrial deletion (ΔmtDNA4977) were quantified using a quantitative PCR assay on whole blood samples from 38 subjects with thalassemia who were receiving regular transfusions. RESULTS. Compared with healthy controls, Mt/N and ΔmtDNA4977 frequency were elevated in thalassemia (P = 0.038 and P 15 mg/g dry-weight or splenectomy, with the highest levels observed in subjects who had both risk factors (P = 0.003). Myocardial iron (MRI T2* 40/1 × 107 mtDNA, respectively (P = 0.025). Subjects with Mt/N values below the group median had significantly lower Matsuda insulin sensitivity index (5.76 ± 0.53) compared with the high Mt/N group (9.11 ± 0.95, P = 0.008). CONCLUSION. Individuals with transfusion-dependent thalassemia demonstrate age-related increase in mtDNA damage in leukocytes. These changes are markedly amplified by splenectomy and are associated with extrahepatic iron deposition. Elevated mtDNA damage in blood cells may predict the risk of iron-associated organ damage in thalassemia. FUNDING. This project was supported by Children’s Hospital & Research Center Oakland Institutional Research Award and by the National Center for Advancing Translational Sciences, NIH, through UCSF-CTSI grant UL1 TR000004. PMID:27583305

  3. β-Thalassemia Distribution in the Old World: an Ancient Disease Seen from a Historical Standpoint (United States)

    De Sanctis, Vincenzo; Kattamis, Christos; Canatan, Duran; Soliman, Ashraf T.; Elsedfy, Heba; Karimi, Mehran; Daar, Shahina; Wali, Yasser; Yassin, Mohamed; Soliman, Nada; Sobti, Praveen; Al Jaouni, Soad; El Kholy, Mohamed; Fiscina, Bernadette; Angastiniotis, Michael


    Background Haemoglobinopathies constitute the commonest recessive monogenic disorders worldwide, and the treatment of affected individuals presents a substantial global disease burden. β-thalassaemia is characterised by the reduced synthesis (β+) or absence (βo) of the β-globin chains in the HbA molecule, resulting in accumulation of excess unbound α-globin chains that precipitate in erythroid precursors in the bone marrow and in the mature erythrocytes, leading to ineffective erythropoiesis and peripheral haemolysis. Approximately 1.5% of the global population are heterozygotes (carriers) of the β-thalassemias; there is a high incidence in populations from the Mediterranean basin, throughout the Middle East, the Indian subcontinent, Southeast Asia, and Melanesia to the Pacific Islands. Aim The principal aim of this paper is to review, from a historical standpoint, our knowledge about an ancient disease, the β-thalassemias, and in particular, when, how and in what way β-thalassemia spread worldwide to reach such high incidences in certain populations. Results Mutations involving the β-globin gene are the most common cause of genetic disorders in humans. To date, more than 350 β-thalassaemia mutations have been reported. Considering the current distribution of β- thalassemia, the wide diversity of mutations and the small number of specific mutations in individual populations, it seems unlikely that β-thalassemia originated in a single place and time. Conclusions Various processes are known to determine the frequency of genetic disease in human populations. However, it is almost impossible to decide to what extent each process is responsible for the presence of a particular genetic disease. The wide spectrum of β-thalassemia mutations could well be explained by looking at their geographical distribution, the history of malaria, wars, invasions, mass migrations, consanguinity, and settlements. An analysis of the distribution of the molecular spectrum of


    Directory of Open Access Journals (Sweden)

    Vincenzo De Sanctis


    Full Text Available Abstract Background: Haemoglobinopathies constitute the commonest recessive monogenic disorders worldwide, and the treatment of affected individuals presents a substantial global disease burden. β -thalassaemia is characterised by the reduced synthesis (β + or absence (β o of the β-globin chains in the HbA molecule, resulting in accumulation of  excess unbound α-globin chains that precipitate in erythroid precursors in the bone marrow and in the mature erythrocytes, leading to ineffective erythropoiesis and peripheral haemolysis. Approximately 1.5% of the global population are heterozygotes (carriers of the β-thalassemias: there is a high incidence in populations extending from the Mediterranean basin throughout the Middle East, the Indian subcontinent, Southeast Asia, Melanesia and into the Pacific Islands Aim: The principal aim of this paper is to review, from a historical standpoint, our knowledge about an ancient disease, the β-thalassemias, and  in particular, when, how and in what way β-thalassemia spread worldwide to reach such high incidences in certain populations.     Results: Mutations involving the ß-globin gene are the most common cause of genetic disorders  in humans. To date, more than 350 β -thalassaemia mutations have been reported. Considering the current distribution of β- thalassemia, the wide diversity of mutations and the small number of individual population’s specific mutations, it seems unlikely that β-thalassemia originated in a single place and time. Conclusions: Various processes are known to determine the frequency of genetic disease in human populations. However, it is almost impossible to decide to what extent each process is responsible for the presence of a particular genetic disease. The wide spectrum of β-thalassemia mutations could well be explained by looking at its geographical distribution, the history of malaria, wars, invasions, mass migrations, consanguinity and settlements. The

  5. Alpha thalassemia among sickle cell anaemia patients in Kampala, Uganda. (United States)

    Lubega, Irene; Ndugwa, Christopher M; Mworozi, Edison A; Tumwine, James K


    Sickle cell anaemia is prevalent in sub Saharan Africa. While α+-thalassaemia is known to modulate sickle cell anaemia, its magnitude and significance in Uganda have hitherto not been described. To determine the prevalence of α+thalassaemia among sickle cell anaemia patients in Mulago Hospital and to describe the clinical and laboratory findings in these patients. A cross sectional study was carried out on patients with sickle cell anaemia in Kampala. Dried blood spots were used to analyze for the deletional α+ thalassaemia using multiplex polymerase chain reaction. Of the 142 patients with sickle cell anaemia, 110 (77.5%) had the αα+thalassaemia deletion. The gene frequency of (-α) was 0.425. Ninety one percent (100/110) of those with α+thalassaemia were heterozygous (αα/α-). Amongst the patients older than 60 months, 15 (83.3%) of those without αα+thalassaemia had significant hepatomegaly of greater than 4 cm compared to 36 (45.6%) of those with α+thalassaemia (p=0.003). The gene frequency of (-α) of 0.425 noted in this study is higher than that reported from many places in Africa. Concurrent alpha thalassemia might be a protective trait against significant hepatomegaly in sickle cell anaemia patients more than 60 months of age at Mulago hospital.

  6. Spinal cord compression in b-thalassemia: follow-up after radiotherapy

    Directory of Open Access Journals (Sweden)

    Silvana Fahel da Fonseca

    Full Text Available CONTEXT: Spinal cord compression due to extramedullary hematopoiesis is a well-described but rare syndrome encountered in several clinical hematologic disorders, including b-thalassemia. CASE REPORT: We report the case of a patient with intermediate b-thalassemia and crural paraparesis due to spinal cord compression by a paravertebral extramedullary mass. She was successfully treated with low-dose radiotherapy and transfusions. After splenectomy, she was regularly followed up for over four years without transfusion or recurrence of spinal cord compression. DISCUSSION: Extramedullary hematopoiesis should be investigated in patients with hematologic disorders and spinal cord symptoms. The rapid recognition and treatment with radiotherapy can dramatically alleviate symptoms.

  7. Incomplete paraplegia caused by extramedullary hematopoiesis in a patient with thalassemia intermedia. (United States)

    Hisamud-Din, Nurhasyimah; Mustafah, Nadia Mohd; Fauzi, Aishah Ahmad; Hashim, Natiara Mohamad


    Extramedullary hematopoiesis (EMH) is the production of blood cell precursors outside the bone marrow that occur in various hematological diseases. In patients with thalassemia intermedia, ineffective erythropoiesis drives compensatory EMH in the liver, pancreas, pleura, spleen, ribs and spine. We describe a patient with thalassemia intermedia who presented with acute neurological symptoms caused by paraspinal EMH, which responded well to combination therapy of steroid, hypertransfusion, laminectomy and excision of pseudotumor and hydroxyurea therapy to boost the formation of fetal haemoglobin. Prompt recognition of EMH based on clinical presentation and typical radiological findings should be made. Early treatment is recommended to prevent irreversible damage to the spinal cord.

  8. Spinal cord compression in {beta}-thalassemia: follow-up after radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Fonseca, Silvana Fahel da; Figueiredo, Maria Stella; Cancado, Rodolfo Delfini; Nakadakare, Fernando; Segreto, Roberto; Kerbauy, Jose [Universidade Federal de Sao Paulo (UNIFESP), SP (Brazil). Escola Paulista de Medicina


    Spinal cord compression due to extramedullary hematopoiesis is a well-described bu rare syndrome encountered in several hematologic disorders, including {beta}-thalassemia. We report a case of a patient with intermediate {beta}-thalassemia and crural paraparesis due to spinal cord compression by a paravertebral extramedullary mass. She was successfully treated with low-dose radiotherapy and transfusions. After splenectomy, she was regularly followed up for over four years without transfusion or recurrence of spinal cord compression. Extramedullary hematopoiesis should be investigated in patients with hematologic disorders and spinal cord symptoms. The rapid recognition and treatment with radiotherapy can dramatically alleviate symptoms. (author)

  9. the characterization of exon-1 mutation(s) of beta globin gene in beta thalassemia

    International Nuclear Information System (INIS)

    Abass, M.M.E.


    β-thalassemia constitutes one of the most serious health problems worldwide, it is the most common chronic hemolytic anemia in egypt. the aim of this work is to study the mutations of exon-1 of β-globin gene in β-thalassaemic children in sharkia governorate. the present study was included 25 healthy children and 50 patients diagnosed as β-thalassemia. this work showed that the thalassaemic patients had significantly decrease in Hb conc . than the control group (p 2 showed a significant increase as compared with the control group

  10. Reduced risk of uncomplicated malaria episodes in children with a+-thalassemia in northeastern Tanzania

    DEFF Research Database (Denmark)

    Enevold, Anders; Lusingu, John P; Mmbando, Bruno


    the susceptibility to uncomplicated malaria. We compared the risk of suffering from febrile, uncomplicated malaria between individuals carrying three common RBC polymorphisms (sickle cell trait, alpha(+)-thalassemia, and glucose-6-phosphate-dehydrogenase deficiency) and controls. The study was performed in an area...... measured with flow cytometry and ELISA assays, respectively. Regression analyses showed that alpha(+)-thalassemia was associated with a reduced risk of uncomplicated malaria episodes and that this advantageous effect seemed to be more predominant in children older than 5 years of age, but was independent...

  11. Spinal cord compression in β-thalassemia: follow-up after radiotherapy

    International Nuclear Information System (INIS)

    Fonseca, Silvana Fahel da; Figueiredo, Maria Stella; Cancado, Rodolfo Delfini; Nakadakare, Fernando; Segreto, Roberto; Kerbauy, Jose


    Spinal cord compression due to extramedullary hematopoiesis is a well-described bu rare syndrome encountered in several hematologic disorders, including β-thalassemia. We report a case of a patient with intermediate β-thalassemia and crural paraparesis due to spinal cord compression by a paravertebral extramedullary mass. She was successfully treated with low-dose radiotherapy and transfusions. After splenectomy, she was regularly followed up for over four years without transfusion or recurrence of spinal cord compression. Extramedullary hematopoiesis should be investigated in patients with hematologic disorders and spinal cord symptoms. The rapid recognition and treatment with radiotherapy can dramatically alleviate symptoms. (author)

  12. Reproductive outcome in carrier couples of β-thalassemia disorders in a tertiary hospital in central India

    Directory of Open Access Journals (Sweden)

    Ranbir S. Balgir


    Full Text Available The β-thalassemia syndromes and hemoglobin disorders are the major genetic and public health challenges in Central India. In view of dubious credit of the highest infant mortality rate in Madhya Pradesh (62 as against 47 per 1000 live-births of India in 2011 it was presumed that carrier couples of b-thalassemia disorders might be one of the contributing factors to high mortality. A total of 280 couples including their offspring with at least one affected and/or suspected case of β-thalassemia/ sickle cell disorders referred to our Centre from a tertiary hospital, Jabalpur during March 2010 to February 2013 were consecutively studied as matched case controls. Out of 280 couples, 200 were found normal and 80 couples had different b-thalassemia disorders. β-thalassemia carrier couples had significantly higher relative fertility (mean number of conceptions, i.e. 2.457 versus 1.480, higher infant mortality (3.5% versus 1.3%, higher below 10 years mortality (7.0% versus 2.7% and lower surviving offspring (925.9 versus 970.6 than of controls. Still-births were three times lower (12.3, neonatal deaths almost two folds higher (24.7, three folds higher infant mortality (37.0 and almost three times higher below 10 years mortality per 1000 live-births were observed in carriers of β-thalassemia major than in controls. The present study indicated that afflicted couples of these hereditary disorders are increasing the afflicted offspring, being 60.7% surviving against controls (39.3%. This increased production of afflicted (heterozygous and homozygous offspring leads to increased morbidity and mortality and might be contributing towards increased neonatal/infant mortality in Madhya Pradesh of Central India. As a preventive measure, affected families were imparted genetic/marriage counseling.  β-重型地中海贫血综合征和血红蛋白疾患是印度中部地区主要的基因以及公共卫生挑战。据不确切数据,印度中央邦

  13. beta-Thalassemia present in cis to a new beta-chain structural variant, Hb Vicksburg [beta 75 (E19)Leu leads to 0]. (United States)

    Adams, J G; Steinberg, M H; Newman, M V; Morrison, W T; Benz, E J; Iyer, R


    Hemoglobin Vicksburg was discovered in a 6-year-old Black boy who had been anemic since infancy. Examination of his hemolysate revealed 87.5% Hb F, 2.4% Hb A2, and 7.6% Hb Vicksburg, which had the electrophoretic and chromatographic properties of Hb A. Structural analysis of Hb Vicksburg demonstrated a deletion of leucine at beta 75(E19), a new variant. Hb Vicksburg was neither unstable nor subject to posttranslational degradation. The alpha/non-alpha biosynthetic ratio was 2.6. Because the proband appeared to be a mixed heterozygote for Hb Vicksburg and beta 0-thalassemia, Hb Vicksburg should have comprised the major portion of the hemolysate. Thus, Hb Vicksburg was synthesized at a rate considerably lower than would be expected on the basis of gene dosage. There was no reason to suspect abnormal translation of beta Vicksburg mRNA; in individuals with Hb St. Antoine (beta 74 and beta 75 deleted), the abnormal hemoglobin comprised 25% of the hemolysate in the simple heterozygote yet was unstable. Deletion of beta 75, therefore, would not in itself appear to lead to diminished synthesis. There was a profound deficit of beta Vicksburg mRNA when measured by liquid hybridization analysis with beta cDNA. The most plausible explanation for the low output of Hb Vicksburg is that a mutation for beta +-thalassemia is present in cis to the structural mutation.

  14. Effects of α-Thalassemia on HbA1c Measurement. (United States)

    Xu, Anping; Ji, Ling; Chen, Weidong; Xia, Yong; Zhou, Yu


    α-Thalassemia is a benign condition that is often present in patients with diabetes mellitus. Here, we evaluated the effects of different genotypes α-thalassemia on HbA 1c measurement. A total of 189 samples from nondiabetic patients were analyzed. HbA 1c analysis was performed by ion-exchange high-performance liquid chromatography, boronate affinity HPLC, immunoassay, and capillary electrophoresis. Fasting glucose, fructosamin, and HbA 2 were also performed. All samples were confirmed by genotyping for thalassemia. In patients with two or three functional α-genes, HbA 1c values were not significantly different from those of controls (P > 0.05); however, in individuals with α-thalassemia with one functional α-gene (i.e., HbH disease), HbA 1c levels were significantly different from those of controls (P 0.05). In this study, HbA 1c values in samples from individuals with two or three functional α-genes basically reflected the normal mean blood glucose level, while those in samples from individuals with one functional α-gene did not. © 2016 Wiley Periodicals, Inc.

  15. Updates of the HbVar database of human hemoglobin variants and thalassemia mutations

    NARCIS (Netherlands)

    B. Giardine (Belinda); J. Borg (Joseph); E. Viennas (Emmanouil); C. Pavlidis (Cristiana); K. Moradkhani (Kamran); P. Joly (Philippe); M. Bartsakoulia (Marina); C. Riemer (Cathy); W. Miller (Webb); G. Tzimas (Giannis); H. Wajcman (Henri); R.C. Hardison (Ross); G.P. Patrinos (George)


    textabstractHbVar ( is one of the oldest and most appreciated locus-specific databases launched in 2001 by a multi-center academic effort to provide timely information on the genomic alterations leading to hemoglobin variants and all types of thalassemia and

  16. Blood transfusion versus hydroxyurea in beta-thalassemia in Iran: a cost-effectiveness study. (United States)

    Ravangard, Ramin; Mirzaei, Zahra; Keshavarz, Khosro; Haghpanah, Sezaneh; Karimi, Mehran


    Thalassemia intermedia is a type of anemia which has several treatments modalities. We aimed to study the cost effectiveness of two treatments, including blood transfusion and hydroxyurea, in patients with beta-thalassemia intermedia in south of Iran referred to a referral center affiliated to Iran, Shiraz University of Medical Sciences in 2015. This was a cost-effectiveness study which was conducted on 122 patients with beta-thalassemia intermedia. The indicator of effectiveness in this study was the reduction of growth disorder (normal BMI). Data analysis was done using SPSS 21, Excel 2010 and Treeage 2011. Finally, the one-way sensitivity analysis was performed to determine the robustness of the results. The average annual costs of blood transfusion and the use of hydroxyurea in 2015 were 20733.27 purchasing power parity (PPP)$ and 7040.29 PPP$, respectively. The effectiveness of blood transfusion was57.4% while in hydroxyurea group was 60.7%. The results showed that the cost effectiveness of using hydroxyurea was more than that of blood transfusion. Therefore, it is recommended that the use of hydroxyurea in the treatment of patients with beta-thalassemia intermedia would become the first priority, and more basic and supplementary insurance coverage for treating such patients using hydroxyurea should be considered.

  17. Iron Overload Leading to Torsades de Pointes in β-Thalassemia and Long QT Syndrome

    DEFF Research Database (Denmark)

    Refaat, Marwan M; El Hage, Lea; Steffensen, Annette Buur


    The authors present a unique case of torsades de pointes in a β-thalassemia patient with early iron overload in the absence of any structural abnormalities as seen in hemochromatosis. Genetic testing showed a novel KCNQ1 gene mutation 1591C>T [Gln531Ter(X)]. Testing of the gene mutation in Xenopus...

  18. Thalassemia in Western Australia: 11 novel deletions characterized by Multiplex Ligation-dependent Probe Amplification.

    NARCIS (Netherlands)

    Phylipsen, M.; Prior, J.F.; Lim, E.; Lingam, N.; Vogelaar, I.P.; Giordano, P.C.; Finlayson, J.; Harteveld, C.L.


    The number of immigrants in Western Australia from many different areas where hemoglobinopathies are endemic has increased dramatically since the 1970s. Therefore, many different thalassemia mutations have been introduced in the country, which add a technological diagnostic problem to the serious

  19. Low cost biosensor-based molecular differential diagnosis of α-thalassemia (Southeast Asia deletion). (United States)

    Wangmaung, Nantawan; Promptmas, Chamras; Chomean, Sirinart; Sanchomphu, Chularat; Ittarat, Wanida


    Thalassemias are genetic hematologic diseases which the homozygous form of α-thalassemia can cause either death in utero or shortly after birth. It is necessary to accurately identify high-risk heterozygous couples. We developed a quartz crystal microbalance (QCM) to identify the abnormal gene causing the commonly found α-thalassemia1, [Southeast Asia (SEA) deletion]. This work is an improved method of our previous study by reducing both production cost and analysis time. A silver electrode on the QCM surface was immobilized with a biotinylated probe. The α-globin gene fragment was amplified and hybridized with the probe. Hybridization was indicated by changes of quartz oscillation. Each drying step was improved by using an air pump for 30 min instead of the overnight air dry. The diagnostic potency of the silver QCM was evaluated using 70 suspected samples with microcytic hypochromic erythrocytes. The silver QCM could clearly identify samples with abnormal α-globin genes, either homozygous or heterozygous, from normal samples. Thirteen out of 70 blood samples were identified as carrier of α-thalassemia1 (SEA deletion). Results were consistent with the standard agarose gel electrophoresis. Using silver instead of gold QCM could reduce the production expense 10-fold. An air pump drying the QCM surface could reduce the analysis time from 3 days to 4 h. The silver thalassemic QCM was specific, sensitive, rapid, cheap and field applicable. It could be used as a one-step definite diagnosis of α-thalassemia1 (SEA deletion) with no need for the preliminary screening test.

  20. Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR. (United States)

    Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin


    Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.

  1. Prevalence of Beta-Thalassemia in premarital screening in Al-Hassa, Saudi Arabia

    International Nuclear Information System (INIS)

    Al-Suliman, A.


    The Al-Hassa area is one of the regions in Saudi Arabia where hemoglobinopathies are prevalent. The Saudi Ministry of Health designed a protocol for premarital testing after the royal decree in December 2003. The protocol was implemented in a February 2004 order. The aim of this study was to determine the prevalence of beta-thalassemia trait among subjects coming for premarital screening in the Al-Hassa area. From February 2004 to November 2004, healthy subjects coming to six marriages consultation centers in the Al-Hassa area underwent routine mandatory tests. Subjects were considered to have beta-thalassemia trait if they had a mean corpuscular volume (MCV), 80 fL and/or a mean corpuscular hemoglobin (MCH) 3.2%. Venous blood was taken into ETDA tube and the complete blood count and red blood cell indices were measured by a Coulter automated cell counter on the same day of hemoglobin collection. Electrophoresis was done on cellulose acetate. All Saudi participants (n=8918), including 4218 (47.3%) males and 4700 (52.7%) females were screened. The prevalence of beta-thalassemia trait with high hemoglobin A2 and microcytic hypochromic anemia was 3.4% (307/8918). In countries with a high prelevance of hemoglobinopathies, a premarital screening program is helpful for identification and prevention of high-risk marriages. With a 3.4% prevalence of beta-thalassemia trait in premarital couples, future comprehensive programs are needed to know the actual prevalence of beta-thalassemia in Al-Hassa. (author)


    Directory of Open Access Journals (Sweden)

    D. Shimbhu


    Full Text Available The number of mutations underlining b-thalassemia generate a wide variety of different clinical phenotypes. An understanding of the genotype is important for medical personnel in order to provide proper counseling to patients and their families. Characterization of these mutations should aid the planning of a prenatal diagnosis program for bthalassemia. The heterogeneity of the mutations makes it difficult and time consuming to identify the mutation in some individuals. We developed a single-tube multiplex amplification refractory mutation system (multiplex ARMS to identify common ethnic- specific b-thalassemia mutations. Confirmation of multiplex ARMS results was carried out using direct sequencing. Three thousand three hundred twenty two people from Phitsanulok province were screened for the b-thalassemia trait by quantitation of HbA2 with microcolumn chromatography and the genotypes of mutations were characterized using multiplex ARMS and direct sequencing. We found that the deletion at codons 41/42 (-TCTT was the most frequent (48%, codon 17 (A®T (30%, -28 (A®G (6% and IVS-I-1(G®T (6% were the second and third in frequency respectively. A -87 (C®A mutation (4%, IVS II-654 (C®T (2%, codons 71/72 (+A (2% and codon 35 (C®A mutations (2% were also found. These techniques were found to be a valuable tool for analysis of b-thalassemia mutations because they are accurate, simple, and speedy in operation. The application for the diagnosis of severe thalassemia in high-risk pregnancies is promising.

  3. Diagnosis of thalassemia and iron deficiency anemia using confocal and atomic force microscopy (United States)

    Tariq, Saira; Bilal, Muhammad; Shahzad, Shaheen; Firdous, Shamaraz; Aziz, Uzma; Ahmed, Mushtaq


    Anemia is the most prevalent blood disorder, categorized into thalassemia and iron deficiency anemia. In anemia, the morphology of erythrocytes is disturbed, thus leading to abnormal functioning of the erythrocytes. Globally, thalassemia affects 1.3% of individuals and is one of the most widespread monogenic disorders in Pakistan. All over the World, women and children are most frequently affected by a type of nutritional deficiency known as iron deficiency anemia. The morphological changes that occur in erythrocytes due to these diseases are investigated in this study at the nano-scale level. Fifty samples of blood from individuals suffering from thalassemia or iron deficiency anemia were obtained from different hospitals in Rawalpindi and Islamabad. The blood samples were scanned using atomic force microscopy (AFM) and laser scanning confocal microscopy (LSCM) to check the morphological changes in both types of anemia. According to the present study, thalassemia is most prevalent in females in the age group between 5 and 15 years old, and iron deficiency is most prevalent in females in the age groups of 16-25 and 36-45 years old. Erythrocyte morphology is the significant determinant for diagnosing and discriminating between these two types of diseases. The study reports deformed erythrocytes in anemic patients, which were different from the ones that existed in the control. Thalassemia erythrocytes showed a crenated shape, iron deficiency anemia erythrocytes showed an elliptocyte shape and healthy erythrocytes showed a biconcave disk shape when using AFM and LSCM. These techniques seem to be very promising, cheap and less time consuming in determining the structure-function relationship of erythrocytes of thalassemic and iron deficiency anemic patients. The results of LSCM and AFM are quite useful in determining the morphological changes in erythrocytes and to study the disease at the molecular level within short period of time. Hence, we encourage employing

  4. Pathophysiology and treatment of patients with beta-thalassemia – an update [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Eitan Fibach


    Full Text Available Thalassemia (thal is an autosomal recessive, hereditary, chronic hemolytic anemia due to a partial or complete deficiency in the synthesis of α-globin chains (α-thal or β-globin chains (β-thal that compose the major adult hemoglobin (α2β2. It is caused by one or more mutations in the corresponding genes. The unpaired globin chains are unstable; they precipitate intracellularly, resulting in hemolysis, premature destruction of red blood cell [RBC] precursors in the bone marrow, and a short life-span of mature RBCs in the circulation. The state of anemia is treated by frequent RBC transfusions. This therapy results in the accumulation of iron (iron overload, a condition that is exacerbated by the breakdown products of hemoglobin (heme and iron and the increased iron uptake for the chronic accelerated, but ineffective, RBC production. Iron catalyzes the generation of reactive oxygen species, which in excess are toxic, causing damage to vital organs such as the heart and liver and the endocrine system. Herein, we review recent findings regarding the pathophysiology underlying the major symptoms of β-thal and potential therapeutic modalities for the amelioration of its complications, as well as new modalities that may provide a cure for the disease.

  5. Plasma microRNA-451 as a novel hemolytic marker for β0-thalassemia/HbE disease (United States)

    Leecharoenkiat, Kamonlak; Tanaka, Yuka; Harada, Yasuko; Chaichompoo, Porntip; Sarakul, Orawan; Abe, Yasunobu; Smith, Duncan Richard; Fucharoen, Suthat; Svasti, Saovaros; Umemura, Tsukuru


    In Southeast Asia, particularly in Thailand, β0-thalassemia/hemoglobin E (HbE) disease is a common hereditary hematological disease. It is associated with pathophysiological processes, such as the intramedullary destruction of immature erythroid cells and peripheral hemolysis of mature red blood cells. MicroRNA (miR) sequences, which are short non-coding RNA that regulate gene expression in a suppressive manner, serve a crucial role in human erythropoiesis. In the present study, the plasma levels of the erythroid-expressed miRNAs, miR-451 and miR-155, were analyzed in 23 patients with β0-thalassemia/HbE and 16 control subjects. Reverse transcription-quantitative polymerase chain reaction analysis revealed significantly higher levels of plasma miR-451 and miR-155 in β0-thalassemia/HbE patients when compared to the control subjects. Notably, among the β0-thalassemia/HbE patients, a significant increase in miR-451 levels was detected in severe cases when compared with mild cases. The levels of plasma miR-451 correlated with reticulocyte and platelet counts. The results suggest that increased plasma miR-451 levels may be associated with the degree of hemolysis and accelerated erythropoiesis in β0-thalassemia/HbE patients. In conclusion, miR-451 may represent a relevant biomarker for pathological erythropoiesis associated with β0-thalassemia/HbE. PMID:28447765

  6. The Effects of an Orientation Program on Quality of Life of Patients with Thalassemia: a Quasi-Experimental Study. (United States)

    Rafii, Zahra; Ahmadi, Fazlollah; Nourbakhsh, Sayed Mohamad Kazem; Hajizadeh, Ebrahim


    Introduction: Medical advances have improved life expectancy and survival of patients with thalassemia. However, as getting older, patients with thalassemia experience different complications which impair their quality of life. The aim of this study was to examine the effects of a nurse-implemented orientation program on quality of life in patients with thalassemia. Methods: A convenience sample of 55 patients with thalassemia were recruited in this quasi-experimental study. Patients were randomly allocated to control or experimental groups. A demographic questionnaire, Thalassemia quality of life questionnaire, and 36-item short form health survey were used for data collection before and one month after the intervention. In the intervention group, 1.5-month orientation program including of the three steps of inauguration, implementation, and closure was implemented, while the control group received routine care. The Chi-square, independent t-test and paired-samples t-test were used for data analysis by using SPSS ver.13 software. Results: The intervention and control group did not differ significantly from each other regarding demographic characteristics. Moreover, no significant difference was observed between the two groups regarding the quality of life scores after the implementation of orientation program. Conclusion: Implementing a short-term orientation program was not effective in enhancing the quality of life in patients with thalassemia; hence, developing long-term multimodal strategies may result in better improvement.

  7. The Effects of an Orientation Program on Quality of Life of Patients with Thalassemia: a Quasi-Experimental Study

    Directory of Open Access Journals (Sweden)

    Zahra Rafii


    Full Text Available Introduction: Medical advances have improved life expectancy and survival of patients with thalassemia. However, as getting older, patients with thalassemia experience different complications which impair their quality of life. The aim of this study was to examine the effects of a nurse-implemented orientation program on quality of life in patients with thalassemia. Methods: A convenience sample of 55 patients with thalassemia were recruited in this quasi-experimental study. Patients were randomly allocated to control or experimental groups. A demographic questionnaire, Thalassemia quality of life questionnaire, and 36-item short form health survey were used for data collection before and one month after the intervention. In the intervention group, 1.5-month orientation program including of the three steps of inauguration, implementation, and closure was implemented, while the control group received routine care. The Chi-square, independent t-test and paired-samples t-test were used for data analysis by using SPSS ver.13 software. Results: The intervention and control group did not differ significantly from each other regarding demographic characteristics. Moreover, no significant difference was observed between the two groups regarding the quality of life scores after the implementation of orientation program. Conclusion: Implementing a short-term orientation program was not effective in enhancing the quality of life in patients with thalassemia; hence, developing long-term multimodal strategies may result in better improvement.

  8. Co-inheritance of α0 -thalassemia elevates Hb A2 level in homozygous Hb E: Diagnostic implications. (United States)

    Singha, K; Srivorakun, H; Fucharoen, G; Fucharoen, S


    Differentiation of homozygous hemoglobin (Hb) E with and without α 0 -thalassemia is subtle on routine hematological ground. We examined in a large cohort of homozygous Hb E if the level of Hb A 2 is helpful. A total of 592 subjects with homozygous Hb E were recruited from ongoing thalassemia screening program. Additionally, five couples at risk of having fetuses with Hb Bart's hydrops fetalis who were homozygous Hb E were also investigated. Hb analysis was performed using capillary electrophoresis system. Globin genotypes were defined by DNA analysis. Subjects were classified into four groups including pure homozygous Hb E (n=532), homozygous Hb E/α 0 -thalassemia (n=48), Hb Constant Spring EE Bart's disease (n=8), and Hb EE Bart's disease (n=4). The levels of Hb A 2 were found, respectively, to be 4.97±0.69, 6.64±1.02, 4.86±0.87, and 7.60±1.04%. Among five couples at risk, α 0 -thalassemia was identified in three subjects with Hb A 2 >6.0%. Increased Hb A 2 level is a useful marker for differentiation of homozygous Hb E with and without α 0 -thalassemia. This should lead to a significant reduction in number of referral cases of homozygous Hb E for molecular testing of α 0 -thalassemia in routine practice. © 2017 John Wiley & Sons Ltd.

  9. Posterior transverse interarch discrepancy on HbE β thalassemia patients

    Directory of Open Access Journals (Sweden)

    Yuniar Zen


    Full Text Available Background: One of the symptoms that often arises on thalassemia patients is disharmony dentofacial, class II skeletal malocclusion, as a result of the malrelation of maxilla and mandible. This malrelation can be affected by either maxillary bone position, dentoalveolar maxillary position, mandibular bone position, dentoalveolar mandibular position, or combinations of those components. Purpose: The study was aimed to examine whether there is posterior transverse interarch discrepancy on the HbE β thalassemia patients or not. Methods: This study is an observational research with cross-sectional design. The sample consisted of 33 HbE β thalassemia patients and 33 non-thalassemia patients as a control group aged 12–14 years. Lateral cephalogram was carried out and dental casts of maxillary and mandibular dental arches were also taken in all of those patients. Results: There was no difference between the maxillary intermolar width of the HbE β thalassemia patients and that of the normal ones, but the mandibular intermolar width of the HbE β thalassemia patients was significantly smaller than that of the normal ones. Beside that, posterior transverse interarch discrepancy of of the HbE β thalassemia patients was significantly greater than that of the normal ones, which showed great difference between maxillary and mandibular intermolar widths. Conclusion: Posterior transverse interarch discrepancy of the HbE β thalassemia patients was different from that of the normal ones. The dentofacial abnormalities on the HbE β thalassemia patients aged 12–14 years primarily was due to disporposional dentofacial growth in the vertical, sagittal, and transversal directions, especially in the posterior region.Latar belakang: Salah satu akibat yang sering timbul pada penderita talasemia adalah disharmoni dentofasial berupa maloklusi skeletal kelas II yang merupakan kelainan hubungan maksila dan mandibula. Malrelasi ini dapat dipengaruhi oleh posisi

  10. Transfusion Complications in Thalassemia Patients: A Report from the Centers for Disease Control and Prevention (CDC) (United States)

    Vichinsky, Elliott; Neumayr, Lynne; Trimble, Sean; Giardina, Patricia J.; Cohen, Alan R.; Coates, Thomas; Boudreaux, Jeanne; Neufeld, Ellis J.; Kenney, Kristy; Grant, Althea; Thompson, Alexis A.


    Background and Study Objectives Transfusions are the primary therapy for thalassemia but have significant cumulative risks. In 2004, the Centers for Disease Control and Prevention (CDC) established a national blood safety monitoring program for thalassemia. The purpose of this report is to summarize the patient population as well as previous non-immune and immune transfusion complications at the time of enrollment into the program. A focus on factors associated with allo- and auto-immunization in chronically transfused patients and a description of blood product preparation and transfusion practices at the participating institutions are included. Study Design and Methods The CDC Thalassemia Blood Safety Network is a consortium of thalassemia centers, longitudinally following patients to determine transfusion-related complications. Enrollment occurred from 2004 through 2012 and annual data collection is ongoing. Demographic data, transfusion history, and previous transfusion and non-transfusion complications were summarized for patients enrolled between 2004 and 2011. Logistic analyses of factors associated with allo- and auto-immunization were developed. Summary statistics of infections reported at the time of enrollment were also calculated. Results The race/ethnicity of the 407 thalassemia patients enrolled in the Network was predominantly Asian or Caucasian and 27% were immigrants. The average age was 22.3 years ± 13.2 and patients received an average total number of 149 ± 103.4 units of red blood cells. Iron-induced multi-organ dysfunction was common despite chelation. At study entry, 86 patients had previously been exposed to possible transfusion-associated pathogens, including Hepatitis-C (61), Hepatitis B (20), Hepatitis A (3), Parvovirus (9), HIV (4), malaria (1), staphylococcus aureus (1) and babesia (1). As 27% of the population was born outside of the United States (India, Pakistan, Thailand, China, Vietnam and Iran accounting for 57%), the source of

  11. Sickle Cell Beta-Plus Thalassemia with Subcapsular Hematoma of the Spleen

    Directory of Open Access Journals (Sweden)

    Suyash Dahal


    Full Text Available While splenic complications like hypersplenism, sequestration crisis, and infarction are commonly reported in sickle cell variants like sickle cell beta-plus thalassemia, splenic rupture with hematoma is rare. We present a case of a 32-year-old young male who presented with dull left upper quadrant pain who was found to have multiple subcapsular splenic lacerations and hematoma on abdominal imaging. Hemoglobin electrophoresis confirmed sickle cell beta-plus thalassemia in the patient. There was no history of trauma, and rest of the workup for possible cause of spontaneous rupture of spleen was negative. With the patient refusing splenectomy, he was managed conservatively. Clinicians need to be aware of this rare complication of sickle cell variants.

  12. Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia. (United States)

    Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A


    The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.

  13. Nephrogenic diabetes insipidus with intracranial calcification in a child with thalassemia minor. (United States)

    Dimple, Jain; Alka, Jadhav; Mona, Gajre; Atul, Deshmukh


    There are numerous causes for intracranial calcification in children. We describe an unusual cause of intracranial calcification in a child, namely, nephrogenic diabetes insipidus (NDI). A 12-year-old boy presented with seizures and developmental delay. MRI of the brain revealed intracranial calcification. Evaluation showed findings suggestive of NDI. The lack of evidence of any other metabolic defect suggests that these calcifications were secondary to NDI. He also had anemia for which he was investigated and diagnosed as thalassemia minor. Detailed literature review failed to reveal any reported association between NDI and thalassemia minor. We report this case to emphasize the importance of early diagnosis and treatment of NDI to prevent organic brain damage.

  14. Extramedullary hematopoiesis with spinal cord compression in a child with thalassemia intermedia. (United States)

    Ileri, Talia; Azik, Fatih; Ertem, Mehmet; Uysal, Zumrut; Gozdasoglu, Sevgi


    Spinal cord compression due to extramedullary hematopoiesis is an extremely rare complication of thalassemia intermedia. No cases with this complication have been reported in the first decade of life, because masses of heterotropic marrow developed in patients as a result of continuous erythropoiesis. We report the 9-year-old patient suffering from thalassemia intermedia and presenting spinal cord compression. We also review the literature about treatment options, because there is no consensus about the optimal treatment of these patients. Our patient was successfully treated with radiation therapy followed by hydroxyurea. With this combination therapy, he had no recurrence during the 4-year follow-up period. Clinical awareness of this phenomenon with the early treatment is essential for optimizing the successful outcome.

  15. Community participation for thalassemia prevention initiated by village health volunteers in northeastern Thailand. (United States)

    Jopang, Yupin; Petchmark, Suthep; Jetsrisuparb, Arunee; Sanchaisuriya, Kanokwan; Sanchaisuriya, Pattara; Schelp, Frank Peter


    The study was conducted to assess the achievement of a thalassemia screening program at a community level supported by village health volunteers (VHVs) of 2 subdistricts in the northeast of Thailand. One subdistrict served as the intervention and the other as the control area. A training program was organized for the village health volunteers from the intervention area. Essential information about the risk and danger of thalassemia was given to the participants who wanted to have children in the community as well. Of the 206 individuals who wanted to have children living in the intervention area, 190 (92.2%) agreed to undergo screening. Of the 196 individuals within the control area, only 26 (13.3%) voluntarily participated in the screening tests. Attitude toward prevention and knowledge about the disease improved significantly in both areas, but the differences between the scores were statistically significantly higher for individuals living in the intervention area. © 2012 APJPH.

  16. Treating iron overload in patients with non-transfusion-dependent thalassemia (United States)

    Taher, Ali T; Viprakasit, Vip; Musallam, Khaled M; Cappellini, M Domenica


    Despite receiving no or only occasional blood transfusions, patients with non-transfusion-dependent thalassemia (NTDT) have increased intestinal iron absorption and can accumulate iron to levels comparable with transfusion-dependent patients. This iron accumulation occurs more slowly in NTDT patients compared to transfusion-dependent thalassemia patients, and complications do not arise until later in life. It remains crucial for these patients' health to monitor and appropriately treat their iron burden. Based on recent data, including a randomized clinical trial on iron chelation in NTDT, a simple iron chelation treatment algorithm is presented to assist physicians with monitoring iron burden and initiating chelation therapy in this group of patients. Am. J. Hematol. 88:409–415, 2013. © 2013 Wiley Periodicals, Inc. PMID:23475638

  17. Amelogenesis Imperfecta with Taurodontism, Microdontia, and Minor Thalassemia: A Case Report

    Directory of Open Access Journals (Sweden)

    Fatemeh Mazhari


    Full Text Available Amelogenesis imperfecta is a group of genetic disorders that affects both the morphology and quality of tooth structure. Although the disease entity is primarily associated with abnormalities of dental and oral structures, it has been reported to be associated with a few syndromes. A 9-year-old girl with minor thalassemia referred to the Department of Pediatric Dentistry of the Mashhad Faculty of Dentistry with a complaint of sensitivity of first permanent molars. Dental findings consisted of amelogenesis imperfecta, microdontia, posterior cross bite and taurodontism. This is the first report of thalassemia accompanied with amelogenesis imperfecta. Although the patients often are non-symptomatic, the trait can be passed on to a child and if both parents carry the trait, the child could develop a more severe form of the disease; therefore, early diagnosis is important.

  18. Thalassemia and hemoglobinopathies in an ethnic minority group in Central Vietnam: implications to health burden and relationship between two ethnic minority groups. (United States)

    Nguyen, Nga Thi; Sanchaisuriya, Kanokwan; Sanchaisuriya, Pattara; Van Nguyen, Hoa; Phan, Hoa Thi Thuy; Fucharoen, Goonnapa; Fucharoen, Supan


    Thalassemia is a genetic condition that can result in long and expensive treatments, and severe thalassemia may lead to death if left untreated. Couples contributing two genes for thalassemia place their children at particular risk for severe thalassemia. Gene frequency of thalassemia varies in Vietnam, but presents remarkably high levels among some ethnic minority groups. Limited information about thalassemia frequency makes prevention and control of thalassemia difficult. This study aimed to determine gene frequency of certain types of thalassemia among 390 women of reproductive age of the Ta-Oi ethnic minority. Hemoglobin and DNA analyses were carried out to diagnose thalassemia and hemoglobinopathies. Of the total participants, 56.1% (95% CI = 51.1-61.1) carried thalassemia genes. A remarkably high frequency of hemoglobin Constant Spring (Hb CS) of 23.8% (95% CI = 19.7-28.4) was noted. The frequency of α + -thalassemia (-3.7 kb deletion) was 26.4% (95% CI = 22.1-31.1), while hemoglobin E (Hb E) and hemoglobin Paksé (Hb Ps) were identified at frequencies of 14.6 (95% CI = 11.2-18.5) and 2.6% (95% CI = 1.4-5.0), respectively. Further analysis of α-globin gene haplotype revealed the same Hb CS haplotype (+ - M + + -) as of the Co-Tu minority, a neighboring minority of the Ta-Oi, indicating that these two minorities may share the same ancestors. This information will be helpful for further studies in population genetics, as well as the development prevention and control program in the region.

  19. Identification of low frequency anti-erythrocyte antibodies in chronically transfused patient with beta-thalassemia: a case report

    Directory of Open Access Journals (Sweden)

    Ana Rúbia Magalhães Ferreira


    Full Text Available The rate of erythrocyte alloimmunization in tranfusion-dependent patients can reach 50%, although the frequency of clinically relevant antibodies in transfused patients is not fully known, it is estimated that about 1% of patients are sensitized to each unit of transfused RBCs. The aim of this study is to report the case of  an 11-year-old girl with ?-thalassemia major, chronically transfused, which was detected in pre-transfusion protocol, the presence of two rare anti-erythrocyte antibodies: anti-Colton b (anti-Cob and anti-Lutheran 14 (anti-Lu14. To survey the clinical and laboratory patient history, research records filed in the archives of the university hospital in which the patient is monitored system was performed. The phenotyping erythrocyte in multitransfused patients is essential to decrease the risk of complications due to alloimmunization and estimate the availability of compatible blood. Thus, the report of this case may contribute to increase knowledge about of the real frequency of uncommon anti-erythrocyte antibodies in thalassemic patients.

  20. Relationship between Plasma Ferritin Level and Siderocyte Number in Splenectomized β-Thalassemia/HbE Patients

    Directory of Open Access Journals (Sweden)

    A. Tripatara


    Full Text Available Introduction. In iron overload status, excess iron deposits in reticuloendothelial cells and tissues and can be detected using Prussian blue staining. The aim of this paper was to investigate the relationship between siderocyte numbers and plasma ferritin levels (a practically standard marker of iron overload in the blood of the splenectomized and nonsplenectomized β-thalassemia/HbE patients, who are at risk of iron overload. Methods. EDTA blood samples from 64 patients with 35 splenectomized and 29 nonsplenectomized β-thalassemia/HbE patients, who received regular blood transfusions, and 20 normal individuals were investigated for siderocyte numbers, plasma ferritin levels, and complete blood counts. Results. The average percent siderocytes in splenectomized and nonsplenectomized β-thalassemia/HbE patients were 11.5% and 0.08%, respectively, and plasma ferritin levels of 2,332 μg/L and 1,279 μg/L, respectively. Percent siderocytes showed a good correlation with plasma ferritin levels only in splenectomized patients (r=0.69, P<0.001. A receiver operating curve analysis from splenectomized patients’ data indicated that siderocytes at 3% cut-off are the best predictor for plasma ferritin level ≥1,000 μg/L with 92.9% sensitivity and 42.9% specificity. Conclusion. Circulating siderocyte numbers can be used as a screening test for the assessment of the iron overload in splenectomized β-thalassemia/HbE patients in the place where serum ferritin is not available.

  1. Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR

    Directory of Open Access Journals (Sweden)

    Ta-Hsien Lee


    Conclusion: The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic.

  2. Health related quality of life in Middle Eastern children with beta-thalassemia

    Directory of Open Access Journals (Sweden)

    Caocci Giovanni


    Full Text Available Abstract Background Thalassemia is a common disorder worldwide with a predominant incidence in Mediterranean countries, North Africa, the Middle East, India, Central Asia, and Southeast Asia. Whilst substantial progress has been made towards the improvement of Health related quality of life (HRQoL in western countries, scarce evidence-based data exists on HRQol of thalassemia children and adolescents living in developing countries. Methods We studied 60 thalassemia children from Middle Eastern countries with a median age of 10 years (range 5 to 17 years. HRQoL was assessed with the Pediatric Quality of Life Inventory (PedsQL 4.0. The Questionnaire was completed at baseline by all patients and their parents. The agreement between child-self and parent-proxy HRQoL reports and the relationship between HRQoL profiles and socio-demographic and clinical factors were investigated. Results The scores of parents were generally lower than those of their children for Emotional Functioning (mean 75 vs 85; p = 0.002, Psychosocial Health Summary (mean 70.3 vs 79.1; p = 0.015 and the Total Summary Score (mean 74.3 vs 77.7 p = 0.047. HRQoL was not associated with ferritin levels, hepatomegaly or frequency of transfusions or iron chelation therapy. Multivariate analysis showed that a delayed start of iron chelation had a negative impact on total PedsQL scores of both children (p = 0.046 and their parents (p = 0.007. Conclusions The PedsQL 4.0 is a useful tool for the measurement of HRQoL in pediatric thalassemia patients. This study shows that delayed start of iron chelation has a negative impact on children’s HRQoL.

  3. Health related quality of life in Middle Eastern children with beta-thalassemia. (United States)

    Caocci, Giovanni; Efficace, Fabio; Ciotti, Francesca; Roncarolo, Maria Grazia; Vacca, Adriana; Piras, Eugenia; Littera, Roberto; Markous, Raji Suleiman Dawood; Collins, Gary Stephen; Ciceri, Fabio; Mandelli, Franco; Marktel, Sarah; La Nasa, Giorgio


    Thalassemia is a common disorder worldwide with a predominant incidence in Mediterranean countries, North Africa, the Middle East, India, Central Asia, and Southeast Asia. Whilst substantial progress has been made towards the improvement of Health related quality of life (HRQoL) in western countries, scarce evidence-based data exists on HRQol of thalassemia children and adolescents living in developing countries. We studied 60 thalassemia children from Middle Eastern countries with a median age of 10 years (range 5 to 17 years). HRQoL was assessed with the Pediatric Quality of Life Inventory (PedsQL) 4.0. The Questionnaire was completed at baseline by all patients and their parents. The agreement between child-self and parent-proxy HRQoL reports and the relationship between HRQoL profiles and socio-demographic and clinical factors were investigated. The scores of parents were generally lower than those of their children for Emotional Functioning (mean 75 vs 85; p = 0.002), Psychosocial Health Summary (mean 70.3 vs 79.1; p = 0.015) and the Total Summary Score (mean 74.3 vs 77.7 p = 0.047). HRQoL was not associated with ferritin levels, hepatomegaly or frequency of transfusions or iron chelation therapy. Multivariate analysis showed that a delayed start of iron chelation had a negative impact on total PedsQL scores of both children (p = 0.046) and their parents (p = 0.007). The PedsQL 4.0 is a useful tool for the measurement of HRQoL in pediatric thalassemia patients. This study shows that delayed start of iron chelation has a negative impact on children's HRQoL.

  4. Global burden, distribution and prevention of β-thalassemias and hemoglobin E disorders. (United States)

    Colah, Roshan; Gorakshakar, Ajit; Nadkarni, Anita


    The β-thalassemias, including the hemoglobin E disorders, are not only common in the Mediterranean region, South-East Asia, the Indian subcontinent and the Middle East but have now become a global problem, spreading to much of Europe, the Americas and Australia owing to migration of people from these regions. Approximately 1.5% of the global population are heterozygotes or carriers of the β-thalassemias. While the overall frequencies of carriers of these disorders are known in most countries, there have been few attempts at micromapping and wherever this has been done, significant variations are seen even within small geographic regions. Thus, the figures for the estimated numbers of births each year of homozygous β-thalassemia and the severe compound states involving other hemoglobin disorders may be an underestimate. Screening strategies have varied from premarital to antenatal in different countries depending on socio-cultural and religious customs in different populations. Prenatal diagnosis programs are ongoing in many countries and the knowledge of the distribution of mutations has facilitated the establishment of successful control programs. Many of these were through North-South partnerships and networking. Yet, there are many countries in Asia where they are lacking, and South-South partnerships are now being developed in South-East Asia and the Indian subcontinent to link centers with expertise to centers where expertise needs to be developed. Although the carrier frequencies will remain unaltered, this will eventually help to bring down the burden of the birth of affected children with β-thalassemias and hemoglobin E disorders in Asia.

  5. Development of hemoglobin typing control materials for laboratory investigation of thalassemia and hemoglobinopathies. (United States)

    Pornprasert, Sakorn; Tookjai, Monthathip; Punyamung, Manoo; Pongpunyayuen, Panida; Jaiping, Kanokwan


    To date, the hemoglobin (Hb) typing control materials for laboratory investigation of thalassemia with low (1.8%-3.2%) and high (4%-6%) levels of HbA2 are available but there are no Hb typing quality control materials for analysis of thalassemia and hemoglobinopathies which are highly prevalent in South-East Asian countries. The main aim of the present study was to develop the lyophilized Hb typing control materials for laboratory investigation of thalassemia and hemoglobinopathies that are commonly found in South-East Asia. Erythrocytes of blood samples containing Hb Bart's, HbH, HbE, HbF, Hb Constant Spring (CS), Hb Hope, and Hb Q-Thailand were washed and dialysed with 0.85% saline solution. The erythrocytes were then lysed in 5% sucrose solution. The lyophilized Hb typing control materials were prepared by using a freeze drying (lyophilization) method. The high performance liquid chromatography (HPLC) analysis of lyophilized Hb was performed after the storage at -20 °C for 1 year and also after reconstitution and storage at 4 or -20 °C for 30 days. In addition, the Hb analysis was compared between the three different methods of HPLC, low pressure liquid chromatography (LPLC) and capillary electrophoresis (CE). Following a year of storage at -20 °C, the HPLC chromatograms of lyophilized Hb typing control materials showed similar patterns to the equivalent fresh whole blood. The stability of reconstituted Hb typing control materials was also observed through 30 days after reconstitution and storage at -20 °C. Moreover, the Hb typing control materials could be analyzed by three methods, HPLC, LPLC and CE. Even a degraded peak of HbCS was found on CE electropherogram. The lyophilized Hb typing control materials could be developed and used as control materials for investigation of thalassemia and hemoglobinopathies.

  6. Current Standards of Care and Long Term Outcomes for Thalassemia and Sickle Cell Disease. (United States)

    Chonat, Satheesh; Quinn, Charles T


    Thalassemia and sickle cell disease (SCD) are disorders of hemoglobin that affect millions of people worldwide. The carrier states for these diseases arose as common, balanced polymorphisms during human history because they afforded protection against severe forms of malaria. These complex, multisystem diseases are reviewed here with a focus on current standards of clinical management and recent research findings. The importance of a comprehensive, multidisciplinary and lifelong system of care is also emphasized.

  7. Education and employment status of children and adults with thalassemia in North America. (United States)

    Pakbaz, Zahra; Treadwell, Marsha; Kim, Hae-Young; Trachtenberg, Felicia; Parmar, Nagina; Kwiatkowski, Janet L; Cunningham, Melody J; Martin, Marie; Sweeters, Nancy; Neufeld, Ellis J; Giardina, Patricia J; Olivieri, Nancy; Yamashita, Robert C; Vichinsky, Elliott


    Advances in the management of thalassemia have resulted in increased life expectancy and new challenges. We conducted the first survey of education and employment status of people with thalassemia in North America. A total of 633 patients (349 adults and 284 school age children) enrolled in the Thalassemia Clinical Research Network (TCRN) registry in Canada and the U.S. were included in the data analysis. Predictors considered for analysis were age, gender, race/ethnicity, site of treatment (Canada vs. United States), transfusion and chelation status, serum ferritin, and clinical complications. Seventy percent of adults were employed of which 67% reported working full-time. Sixty percent had a college degree and 14% had achieved some post-college education. Eighty-two percent of school age children were at expected grade level. In a multivariate analysis for adults, Whites (OR = 2.76, 95% CI: 1.50-5.06) were more likely to be employed compared to Asians. Higher education in adults was associated with older age (OR = 1.67, 95% CI: 1.29-2.15), female gender (OR = 2.08, 95% CI: 1.32-3.23) and absence of lung disease (OR = 14.3, 95% CI: 2.04-100). Younger children (OR = 5.7 for 10-year increments, 95% CI: 2.0-16.7) and Canadian patients (OR = 5.6, 95% CI: 1.5-20) were more likely to be at the expected education level. Neither transfusion nor chelation was associated with lower employment or educational achievement. Individuals with thalassemia in North America can achieve higher education; however, full-time employment remains a problem. Transfusion and chelation do not affect employment or education status of this patient population. Copyright 2010 Wiley-Liss, Inc.

  8. ARKRAY ADAMS A1c HA-8180T Analyzer for Diagnosis of Thalassemia and Hemoglobinopathies Common in Southeast Asia. (United States)

    Kunwandee, Jatuphol; Srivorakun, Hataichanok; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan


    To evaluate the ARKRAY ADAMS A1c HA-8180T analyzer for diagnosis of thalassemias and hemoglobinopathies commonly found in the Southeast Asian population. Our cohort consisted of 557 specimens from adults referred for thalassemia diagnosis. From these, we selected 457 specimens and subjected them to DNA analysis to determine various thalassemia genotypes. Also, to confirm the reference range for HbA2, we obtained an additional 48 specimens from healthy individuals. We estimated the diagnostic range for Hb E from specimens from another 52 subject individuals previously diagnosed with heterozygous HbE. All of these individuals had negative results in DNA testing for all common α-thalassemia alleles found in Thailand. We performed hemoglobin (Hb) analysis and compared the results with those we derived from testing the CAPILLARYS 2 Flex Piercing device. We defined genotypes via by DNA analysis. Performance evaluation revealed the within- and between-run precision for analysis of HbA2 and HbE, with coefficients of variation (CVs) ranging from 0.6% to 2.5%. We determined the reference ranges of HbA2 and HbE in the HbE heterozygote to be 2.2% to 3.4 % and 25.7% to 31.0%, respectively. We were able to identify all cases of β-thalassemia and HbE disorders. We coeluted HbH and Hb Bart and interfered with acetylated HbF. The ARKRAY ADAMS A1c HA-8180T analyzer could accurately identify which individuals had β-thalassemia and HbE disorders. However, compared with other high-performance liquid chromatography instruments in diagnosing α-thalassemia disease with HbH and Hb Bart, this analyzer is relatively difficult to use. Copyright© by the American Society for Clinical Pathology (ASCP).

  9. Population Screening and Prevention Strategies for Thalassemias and other Hemoglobinopathies of Eastern India: Experience of 18,166 cases. (United States)

    Chatterjee, Tridip; Chakravarty, Amit; Chakravarty, Sudipa


    We evaluated population screening programs (1999-2011), conducted by the Thalassaemia Foundation, Kolkata, India, for the first time in Eastern India in different districts of West Bengal, for prevention of thalassemia comprising screening of heterozygotes and β-thalassemia intermedia (β-TI) cases [β(+), β(++), β(0)/β(+), β(E)/β(E) (codon 26 or HBB: c.79G > A), Hb-E-β-thalassemia (Hb E-β-thal)]. Among 18,166 cases, we found 2092 heterozygotes and 2245 β-TI individuals (who had no information about their disorders). Results were evaluated with standard hematological analyses including erythrocyte indices, hemoglobin (Hb) typing and quantification. Participants were divided into five groups (children, pre-marriage cases, pre-pregnancy cases, affected family members, pregnant women). The objectives of this evaluation were to fix cut-off values of red blood cells (RBCs), mean corpuscular volume (MCV), mean corpuscular Hb (MCH), red blood cell distribution width (RDW) and Hb A2, as the standard World Health Organization (WHO) guidelines were not strictly followed in mass-scale screening programs. We have observed many dilemmas in considering the status of the thalassemia subject, due to presence of some other clinical conditions such as iron deficiency anemia, α-thalassemia (α-thal), δ-thalassemia (δ-thal), clinically silent Hb variants, and some cases of non hemoglobinopathies (such as pregnancy) along with thalassemia. The MCV values varied greatly in different conditions of hemoglobinopathies, whereas MCH provided a more stable measurement. We found an MCH value of <27.0 pg is a suitable cut-off point for screening in this population. Participants with an MCH of <27.0 pg should be investigated further to confirm or exclude a diagnosis of β-thal trait.

  10. Hemoglobin Q-Thailand and its combinations with other forms of thalassemia or hemoglobinopathies in northern Thailand. (United States)

    Panyasai, Sitthichai; Pornprasert, Sakorn


    There have been no reports for the frequency of Hb Q-Thailand [alpha 74(EF3)Asp --> His, GAC > CAC] and its combinations either with other forms of thalassemia or hemoglobinopathies in Northern Thailand. The aims of this study were to search for Hb Q-Thailand and its combinations in Northern Thai population and to analyze fractions of hemoglobin in Hb Q-Thailand and its combinations on high performance liquid chromatography (HPLC) chromatograms and/or capillary electrophoresis (CE) electrophoregrams. Blood samples from public and private hospitals in 7 northern provinces of Thailand were analyzed for thalassemia and hemoglobinopathy diagnoses using HPLC and/or CE and DNA analysis techniques at the Thalassemia Laboratory, Associated Medical Sciences Clinical Service Center, Chiang Mai, Thailand. Hb Q-Thailand was found in 13 of 13,596 (0.10%) samples; 6 were heterozygous Hb Q-Thailand, 4 were compound Hb Q-Thailand/alpha-thalassemia-1 Southeast Asian (SEA) type deletion and 3 with combinations of Hb Q-Thailand/beta(0)-thalassemia, Hb Q-Thailand/Hb E and Hb Q-Thailand/Hb E/alpha-thalassemia-1 SEA type deletion. The fractions of hemoglobin on HPLC chromatograms and CE electrophoregrams were observed based on types of combinations. Hb Q-Thailand and its combinations could be found in northern Thai population with the frequency of 0.10%. Thus, the better understanding of HPLC chromatogram and/or CE electrophoregram patterns of Hb Q-Thailand and its combination is essential for diagnosis and genetic counseling of thalassemia and hemoglobinopathies in this area.

  11. Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia. (United States)

    Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S


    Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

  12. Prenatal control of nondeletional α-thalassemia: first experience in mainland China. (United States)

    Li, Jian; Li, Ru; Zhou, Jian-Ying; Xie, Xing-Mei; Liao, Can; Li, Dong-Zhi


    To demonstrate the performance of nondeletional α-thalassemia prevention at a mainland Chinese hospital. A prenatal control program for nondeletional hemoglobin H (Hb H) disease was conducted from January 2010 to June 2012. All couples were screened for α-thalassemia trait, and for couples in whom one partner was tested positive for α(0) -thalassemia, the other was subjected to screening for Hb Constant Spring and Hb Quong Sze mutations. Prenatal diagnoses were offered in pregnancies of couples at-risk for nondeletional Hb H disease. Of the 30,152 couples screened, 18 (0.06%) were diagnosed as at risk for nondeletional Hb H disease. There were other 13 at-risk couples who were referred to prenatal diagnosis because they had previously an affected child. Of the 31 cases with prenatal invasive tests, 11 (35.5%) had diagnosis by chorionic villous sampling, and 20 (64.5%) had amniocentesis. Totally, 12 fetuses were diagnosed with nondeletional Hb H disease, and all of the affected pregnancies were terminated. Implementation of a prevention and control program accompanying with a referral system for prenatal diagnosis is technically feasible in southern China, and a number of nondeletional Hb H disease have been prevented during the past 3 years of operation. © 2013 John Wiley & Sons, Ltd.

  13. Detection of thalassemia genes using smeared blood film or leukocytes adhering to polysthylene fibers. (United States)

    Tatsumi, N; Yokota, M; Shindoh, K; Funahara, Y; Nathalang, O; Sukpanichnant, S; Bunyaratvej, A; Fucharoen, S


    Presently genetic analyses for thalassemia types require relatively large amounts of heparinized blood (5 to 10 ml), and transport as well as degeneration of these sample is a problem in the developing world. We have developed a new method to simplify this procedure and obtain DNAs from small specimens. As experimental materials, thinly smeared blood on a glass slide or blood filtered with and adhered on polysthylene telephtalate (PST) fibers were used. These materials could be safely stored without interfering with DNA extraction for up to 3 months. The slide materials were digested with proteinase K, and DNA was extracted with Tris-EDTA-phenol:chloroform and precipitated with absolute ethanol. The PST specimens were washed with physiologic saline and treated in the same manner as described above. Products were easily amplified by PCR and digested with restriction endonucleases for beta thalassemia typing as well as for HLA-DQA1 gene typing. Results obtained by this method correlated well with previously reported incidences for thalassemia and HLA-DQA1 types in Thailand. This method can be used in the routine laboratory because it allows for stable and biosafe genetic analyses.

  14. Comparison between β-thalassemia minor and normal individuals using the Wechsler Adult Intelligence Scale. (United States)

    Zangiabadi, Nasser; Yarahmadi, Fahimeh; Darekordi, Ali; Shabani, Mohammad; Dadgar, Mehrak Memaran


    The present study aimed at investigating and comparing patients suffering from β-thalassemia (β-thal) minor with normal individuals in regard to their performances in the short version of the Wechsler Adult Intelligence Scale (WAIS) test. Patients with β-thal minor are carriers of β-thal genes. They have mild microcytic and hypochromic anemia and are usually asymptomatic. In this cross-sectional study, a total of 60 individuals were divided into two equal groups of β-thal minor and normal subjects; they were then studied by the WAIS subscales. The mean performance scores of the normal group in the subtests of arithmetic and vocabulary (p <0.01) and picture completion (p <0.05) were higher than those of the thalassemia group. The mean performance score and ability of the normal group on the verbal scale was higher in comparison to the thalassemia group (p <0.05), while on the non verbal scale, there was no significant difference between the two groups. It can be concluded that β-thal minor negatively influences verbal fluency, reasoning and conceptualization, and sequencing tasks, perceptual skill, prediction of social situations and abstract thinking.

  15. Methemoglobinemia and ascorbate deficiency in hemoglobin E β thalassemia: metabolic and clinical implications (United States)

    Allen, Angela; Fisher, Christopher; Premawardhena, Anuja; Bandara, Dayananda; Perera, Ashok; Allen, Stephen; St Pierre, Timothy; Olivieri, Nancy


    During investigations of the phenotypic diversity of hemoglobin (Hb) E β thalassemia, a patient was encountered with persistently high levels of methemoglobin associated with a left-shift in the oxygen dissociation curve, profound ascorbate deficiency, and clinical features of scurvy; these abnormalities were corrected by treatment with vitamin C. Studies of erythropoietin production before and after treatment suggested that, as in an ascorbate-deficient murine model, the human hypoxia induction factor pathway is not totally dependent on ascorbate levels. A follow-up study of 45 patients with HbE β thalassemia showed that methemoglobin levels were significantly increased and that there was also a significant reduction in plasma ascorbate levels. Haptoglobin levels were significantly reduced, and the high frequency of the 2.2 haptoglobin genotype may place an additional pressure on ascorbate as a free-radical scavenger in this population. There was, in addition, a highly significant correlation between methemoglobin levels, splenectomy, and factors that modify the degree of globin-chain imbalance. Because methemoglobin levels are modified by several mechanisms and may play a role in both adaptation to anemia and vascular damage, there is a strong case for its further study in other forms of thalassemia and sickle-cell anemia, particularly when splenic function is defective. PMID:22885163

  16. Hemoglobinopathies and thalassemia screening among Senoi Orang Asli in Peninsular Malaysia (United States)

    Rong, Danny Koh Xuan; Ismail, Endom; Sabudin, Raja Zahratul Azma Raja; Hussin, Noor Hamidah; Othman, Ainoon


    Orang Asli are the minority indigenous people in Peninsular Malaysia and can be divided into 3 main groups (Negrito, Senoi and Proto Malay) with different six sub-ethnics under each group. Within the Senoi group, the six sub-ethnics are sub-ethnic Mah Meri, Semoq Beri, Che Wong, Jah Hut, Semai and Temiar. This study was aimed to investigate the current prevalence of α- and β-thalassemia and hemoglobinopathies and their mutation types among all six sub-ethnics of Senoi Orang Asli. Blood samples from 685 Senoi participants were collected and sent immediately for routine full blood count analysis and hemoglobin sub-typing. Of 378 subjects screened, 7 subjects were found to be Hemoglobin E (HbE) beta thalassemia carriers, 13 beta thalassaemic, 35 Hemoglobin Constant Spring (HbCS) carriers, 6 compound HbE and HbCS carriers, 32 with HbE disease and 163 HbE heterozygote carriers. The findings of high HbE among Temiars and Jah Huts and high HbCS exclusively in Jah Huts in this study suggest distinct differences across sub-ethnics under Senoi group. Understanding of prevalence and wide spectrum of thalassemia and hemoglobinopathies among Senoi and Orang Asli is essential for national thalassaemia awareness and prevention program, especially in Orang Asli communities.

  17. Relationship among chelator adherence, change in chelators, and quality of life in thalassemia. (United States)

    Trachtenberg, Felicia L; Gerstenberger, Eric; Xu, Yan; Mednick, Lauren; Sobota, Amy; Ware, Hannah; Thompson, Alexis A; Neufeld, Ellis J; Yamashita, Robert


    Thalassemia, a chronic blood disease, necessitates life-long adherence to blood transfusions and chelation therapy to reduce iron overload. We examine stability of health-related quality of life (HRQOL) in thalassemia and adherence to chelation therapy over time, especially after changes in chelator choice. Thalassemia Longitudinal Cohort participants in the USA, UK, and Canada completed the SF-36v2 (ages 14+) and the PF-28 CHQ (parents of children health status) at baseline who made a single change in chelator, but declined among participants with multiple changes and/or high iron burden (worse health status). Mental health improved among participants with lower iron burden, but iron overload was negatively associated with social functioning. Adherence did not significantly change over follow-up except for an increase after a change from deferoxamine (DFO) infusion to oral deferasirox (p = 0.03). Predictors of lower adherence for adults/adolescents at follow-up included side effects, smoking, younger age, problems preparing DFO, increased number of days per week DFO prescribed, and lower physical quality of life . Strategies to balance medical needs with family, work, and personal life may assist in adherence.

  18. Major depression (United States)

    Depression - major; Depression - clinical; Clinical depression; Unipolar depression; Major depressive disorder ... providers do not know the exact causes of depression. It is believed that chemical changes in the ...

  19. Hydroxyurea decreases hospitalizations in pediatric patients with Hb SC and Hb SB+ thalassemia

    Directory of Open Access Journals (Sweden)

    Lebensburger JD


    Full Text Available Jeffrey D Lebensburger, Rakeshkumar J Patel, Prasannalaxmi Palabindela, Christina J Bemrich-Stolz, Thomas H Howard, Lee M HilliardDivision of Pediatric Hematology Oncology, University of Alabama at Birmingham, Birmingham, AL, USAPurpose: Patients with hemoglobin SC (Hb SC and hemoglobin SB+ (Hb SB+ thalassemia suffer from frequent hospitalizations yet strong evidence of a clinical benefit of hydroxyurea (HU in this population is lacking. Patients with recurrent hospitalizations for pain crisis are offered HU at our institution based on small cohort data and anecdotal benefit. This study identifies outcomes from a large cohort of patients with Hb SC and SB+ thalassemia who were treated with HU for 2 years.Materials and methods: A retrospective review was conducted of 32 patients with Hb SC and SB+ thalassemia who were treated with HU. We reviewed the number, and reasons for hospitalization in the 2 years prior to, and 2 years post-HU treatment as well as laboratory changes from baseline, over 1 year.Results: Patients with Hb SC and SB+ thalassemia started on HU for frequent pain, had a significant reduction in hospitalizations over 2 years as compared to the 2 years prior to HU initiation (mean total hospitalizations/year: pre-HU: 1.6 vs post-HU 0.4 hospitalizations, P<0.001; mean pain hospitalizations/year: pre-HU 1.5 vs post-HU 0.3 hospitalizations, P<0.001. Patients demonstrated hematologic changes including an increase in percent fetal hemoglobin (%HbF pre–post HU (4.5% to 7.7%, P=0.002, mean corpuscular volume (74 to 86 fL, P<0,0001, and decrease in absolute neutrophil count (5.0 to 3.2×109/L, P=0.007. Patients with higher doses of HU demonstrated the greatest reduction in hospitalizations but this was unrelated to absolute neutrophil count.Conclusion: This cohort of patients with Hb SC and SB+ thalassemia provides additional support for using HU in patients with recurrent hospitalizations for pain. A large randomized multicenter trial of

  20. Evaluation of the URIT-2900 automated hematology analyzer for screening of thalassemia and hemoglobinopathies in Southeast Asian populations. (United States)

    Karnpean, Rossarin; Pansuwan, Anupong; Fucharoen, Goonnapa; Fucharoen, Supan


    The effectiveness of the URIT-2900 Hematology Analyzer for screening of hemoglobinopathies commonly found in Southeast Asian populations was examined. Appropriate cut-off values of MCV and MCH for screening of α(0) and β thalassemias were derived from the receiver operator characteristic curve conducted initially on 279 subjects with various thalassemia genotypes. Validation was performed additionally in a cohort of another unrelated 313 subjects. The best cut off values of MCV and MCH were found to be 78fL and 27pg, respectively. Using these cut off values in combination with the dichlorophenolindophenol test in screening of α(0) thalassemia, β thalassemia and Hb E in a cohort study revealed 100% sensitivity, 79.6% specificity, 80.0% positive predictive value and 100% negative predictive value. The combined blood cell counting using the URIT-2900 Automated Hematology Analyzer and dichlorophenolindophenol test is suitable for population screening of thalassemia and hemoglobinopathies in Southeast Asia. Copyright © 2011 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  1. Assessing the potential success of cystic fibrosis carrier screening: lessons learned from Tay-Sachs disease and beta-thalassemia. (United States)

    Laberge, A-M; Watts, C; Porter, K; Burke, W


    The objective of this study was to identify factors involved in the success of 2 well-established population-based carrier screening programs - Tay-Sachs disease (TSD) in Ashkenazi Jews and beta-thalassemia in Sardinia and Cyprus - and to assess the potential for success of a population-based cystic fibrosis (CF) carrier screening strategy using these factors. We performed a literature review and key informant interviews. Factors involved in the success of TSD and beta-thalassemia carrier screening programs include disease characteristics (well-defined population at risk, severe disease with predictable course, availability of effective treatment), test characteristics (high sensitivity, straightforward interpretation of results), and community characteristics (involvement of community, support of families and advocacy groups, consensus in favor of avoiding affected births). Current CF screening strategies include few of the factors listed above. Unlike TSD and beta-thalassemia, the purpose of current CF carrier screening strategies is informed reproductive decision-making, without an explicit goal of reducing disease incidence. When compared to TSD and beta-thalassemia, CF is a less favorable candidate for population-based carrier screening. Because of its different purpose, CF carrier screening will require different measures of success than those used for TSD and beta-thalassemia carrier screening, and a consensus on the value or success of CF carrier screening may be difficult to achieve.

  2. Frequency of β-thalassemia trait and other hemoglobinopathies in northern and western India (United States)

    Madan, Nishi; Sharma, Satendra; Sood, S. K.; Colah, Roshan; Bhatia, (Late) H. M.


    INTRODUCTION: India is an ethnically diverse country with an approximate population of 1.2 billion. The frequency of beta-thalassemia trait (βTT) has variously been reported from hemoglobinopathies in different regions and population groups in the country. A high frequency of Hb D has been reported from the North in the Punjabi population, Hb E in the eastern region of India and Hb S is mainly reported from populations of tribal origin from different parts of the country. OBJECTIVES: To study the gene frequency of βTT and other hemoglobinopathies in three regions East (Kolkata), West (Mumbai) and North (Delhi) in larghe population group (schoolchildren) for a more accurate assessment of gene frequency for planning of control programmes for haemoglobinopathies. MATERIALS AND METHODS: This study included 5408 children from 11 schools in Delhi, 5682 from 75 schools in Mumbai and 957 schoolchildren from Kolkata who were screened for βTT and haemoglobinopathies. These included 5684 children from 75 schools in Mumbai and 5408 children from 11 schools in Delhi. Children were 11-18 years of age of both sexes. The final report is, however, only on 11090 schoolchildren from Mumbai and Delhi as data from Kolkata was restricted both in numbers and objectives and could not be included for comparison. RESULTS: The overall gene frequency of βTT in Mumbai and Delhi was 4.05% being 2.68% and 5.47% in children of the two cities respectively. In Mumbai, the gene frequency was evenly distributed. Majority of the children with βTT from Mumbai were from Marathi (38.9%) and Gujarati (25%) speaking groups. Gene frequency was >5% in Bhatias, Khatris, Lohanas and Schedule Castes. In Delhi, a higher incidence was observed in schoolchildren of North and West Delhi (5.8-9.2%). The schoolchildren of North and West Delhi comprised predominantly of Punjabi origin compared to children in the South of the city (2.2%, 2.3%). When analyzed state-wise, the highest incidence