In Vivo Diffuse Optical Tomography and Fluorescence Molecular Tomography

Directory of Open Access Journals (Sweden)

Mingze Li

2010-01-01

Full Text Available Diffuse optical tomography (DOT and fluorescence molecular tomography (FMT are two attractive imaging techniques for in vivo physiological and psychological research. They have distinct advantages such as non-invasiveness, non-ionizing radiation, high sensitivity and longitudinal monitoring. This paper reviews the key components of DOT and FMT. Light propagation model, mathematical reconstruction algorithm, imaging instrumentation and medical applications are included. Future challenges and perspective on optical tomography are discussed.

Spin-diffusions and diffusive molecular dynamics

Science.gov (United States)

Farmer, Brittan; Luskin, Mitchell; Plecháč, Petr; Simpson, Gideon

2017-12-01

Metastable configurations in condensed matter typically fluctuate about local energy minima at the femtosecond time scale before transitioning between local minima after nanoseconds or microseconds. This vast scale separation limits the applicability of classical molecular dynamics (MD) methods and has spurned the development of a host of approximate algorithms. One recently proposed method is diffusive MD which aims at integrating a system of ordinary differential equations describing the likelihood of occupancy by one of two species, in the case of a binary alloy, while quasistatically evolving the locations of the atoms. While diffusive MD has shown itself to be efficient and provide agreement with observations, it is fundamentally a model, with unclear connections to classical MD. In this work, we formulate a spin-diffusion stochastic process and show how it can be connected to diffusive MD. The spin-diffusion model couples a classical overdamped Langevin equation to a kinetic Monte Carlo model for exchange amongst the species of a binary alloy. Under suitable assumptions and approximations, spin-diffusion can be shown to lead to diffusive MD type models. The key assumptions and approximations include a well-defined time scale separation, a choice of spin-exchange rates, a low temperature approximation, and a mean field type approximation. We derive several models from different assumptions and show their relationship to diffusive MD. Differences and similarities amongst the models are explored in a simple test problem.

Diffusion of inorganic ion aqueous solution into hydrophilic polymer fiber and molecular orientation

International Nuclear Information System (INIS)

Kawaguchi, Akio

2001-01-01

The adsorption process of iodine to nylon 6 (polyamide-6), as well as deiodination process, has been an issue of controversy in the past half century from the view points related to the conversion of hydrogen bonding (α phase vs. γ phase). In the researches since late '80s, it has been revealed that the adsorption or inclusion of iodine to polyamides causes formations of various kind of structures to be called complexes whether they are crystalline or amorphous, and the formation of complex is reflected on the physical properties (especially on adsorption and ion mobility). Among them, it has been reported about both the doubly-oriented samples and the non-oriented samples that the ion diffusion causes molecular chain orientation during the complex formation. In the present experiment the change of molecular orientation in the early stage of the complex formation is studied by the time-resolved measurement with synchrotron radiation facility at SPring-8. Through-view and edge-view diffraction patterns of doubly oriented nylon 6 and non-oriented one were measured at 0.1 nm wavelength introducing I2-KI aqueous solution. It is observed that the formation of complex (i.e. diffusion of polyiodine) is attained in about 0.3 to 0.4 sec. even in non-oriented sample. From the analysis of the diffraction behavior, it is summarized that the inclusion of iodine into the crystalline phase of nylon 6 is possible from either sides of the molecular directions, namely normal diffusion and parallel diffusion. It is concluded that the diffusion and adsorption of inorganic ions including polyiodine to polyamide causes not only the formation of complexes in the crystalline phase but also give motive force to change structure in the surrounding non-crystalline region. (S. Funahashi)

Calculating effective diffusivities in the limit of vanishing molecular diffusion

International Nuclear Information System (INIS)

Pavliotis, G.A.; Stuart, A.M.; Zygalakis, K.C.

2009-01-01

In this paper we study the problem of the numerical calculation (by Monte Carlo methods) of the effective diffusivity for a particle moving in a periodic divergent-free velocity field, in the limit of vanishing molecular diffusion. In this limit traditional numerical methods typically fail, since they do not represent accurately the geometry of the underlying deterministic dynamics. We propose a stochastic splitting method that takes into account the volume-preserving property of the equations of motion in the absence of noise, and when inertial effects can be neglected. An extension of the method is then proposed for the cases where the noise has a non-trivial time-correlation structure and when inertial effects cannot be neglected. The method of modified equations is used to explain failings of Euler-based methods. The new stochastic geometric integrators are shown to outperform standard Euler-based integrators. Various asymptotic limits of physical interest are investigated by means of numerical experiments, using the new integrators

Translational and rotational diffusion of flexible PEG and rigid dendrimer probes in sodium caseinate dispersions and acid gels

NARCIS (Netherlands)

Salami, S.; Rondeau-Mouro, C.; Barhoum, M.; Duynhoven, van J.P.M.; Mariette, F.

2014-01-01

The dynamics of rigid dendrimer and flexible PEG probes in sodium caseinate dispersions and acid gels, including both translational diffusion and rotational diffusion, were studied by NMR. Above the onset of the close-packing limit (C ~ 10 g/100 g H2O), translational diffusion of the probe depended

Translational and rotational diffusion of flexible PEG and rigid dendrimer probes in sodium caseinate dispersions and acid gels.

Science.gov (United States)

Salami, Souad; Rondeau-Mouro, Corinne; Barhoum, Myriam; van Duynhoven, John; Mariette, François

2014-09-01

The dynamics of rigid dendrimer and flexible PEG probes in sodium caseinate dispersions and acid gels, including both translational diffusion and rotational diffusion, were studied by NMR. Above the onset of the close-packing limit (C ∼ 10 g/100 g H2 O), translational diffusion of the probe depended on its flexibility and on the fluctuations of the matrix chains. The PEG probe diffused more rapidly than the spherical dendrimer probe of corresponding hydrodynamic radius. The greater conformational flexibility of PEG facilitated its motion through the crowded casein matrix. Rotational diffusion was, however, substantially less hindered than the translational diffusion and depended on the local protein-probe friction which became high when the casein concentration increased. The coagulation of the matrix led to the formation of large voids, which resulted in an increase in the translational diffusion of the probes, whereas the rotational diffusion of the probes was retarded in the gel, which could be attributed to the immobilized environment surrounding the probe. Quantitative information from PFG-NMR and SEM micrographs have been combined for characterizing microstructural details in SC acid gels. © 2014 Wiley Periodicals, Inc.

Diffusion of tritiated water (HTO) in dextran+water mixtures

International Nuclear Information System (INIS)

Comper, W.D.; Van Damme, M.P.I.; Preston, B.N.

1982-01-01

The diffusion of HTO has been measured in dextran solutions using an open-ended capillary technique and a newly developed Sundeloef diffusion cell. HTO diffusion has been examined as a function of dextran concentration and molecular weight. These results, together with our previous results on the intradiffusion and mutual-diffusion coefficients of dextrans, now provide a complete set of conventional translational diffusion coefficients for both components in this binary system. Various assumptions associated with the theoretical description of polymer translational motion can now be examined. (author)

Rotational diffusion of a molecular cat

Science.gov (United States)

Katz-Saporta, Ori; Efrati, Efi

We show that a simple isolated system can perform rotational random walk on account of internal excitations alone. We consider the classical dynamics of a ''molecular cat'': a triatomic molecule connected by three harmonic springs with non-zero rest lengths, suspended in free space. In this system, much like for falling cats, the angular momentum constraint is non-holonomic allowing for rotations with zero overall angular momentum. The geometric nonlinearities arising from the non-zero rest lengths of the springs suffice to break integrability and lead to chaotic dynamics. The coupling of the non-integrability of the system and its non-holonomic nature results in an angular random walk of the molecule. We study the properties and dynamics of this angular motion analytically and numerically. For low energy excitations the system displays normal-mode-like motion, while for high enough excitation energy we observe regular random-walk. In between, at intermediate energies we observe an angular Lévy-walk type motion associated with a fractional diffusion coefficient interpolating between the two regimes.

Spatial Mapping of Translational Diffusion Coefficients Using Diffusion Tensor Imaging: A Mathematical Description.

Science.gov (United States)

Shetty, Anil N; Chiang, Sharon; Maletic-Savatic, Mirjana; Kasprian, Gregor; Vannucci, Marina; Lee, Wesley

2014-01-01

In this article, we discuss the theoretical background for diffusion weighted imaging and diffusion tensor imaging. Molecular diffusion is a random process involving thermal Brownian motion. In biological tissues, the underlying microstructures restrict the diffusion of water molecules, making diffusion directionally dependent. Water diffusion in tissue is mathematically characterized by the diffusion tensor, the elements of which contain information about the magnitude and direction of diffusion and is a function of the coordinate system. Thus, it is possible to generate contrast in tissue based primarily on diffusion effects. Expressing diffusion in terms of the measured diffusion coefficient (eigenvalue) in any one direction can lead to errors. Nowhere is this more evident than in white matter, due to the preferential orientation of myelin fibers. The directional dependency is removed by diagonalization of the diffusion tensor, which then yields a set of three eigenvalues and eigenvectors, representing the magnitude and direction of the three orthogonal axes of the diffusion ellipsoid, respectively. For example, the eigenvalue corresponding to the eigenvector along the long axis of the fiber corresponds qualitatively to diffusion with least restriction. Determination of the principal values of the diffusion tensor and various anisotropic indices provides structural information. We review the use of diffusion measurements using the modified Stejskal-Tanner diffusion equation. The anisotropy is analyzed by decomposing the diffusion tensor based on symmetrical properties describing the geometry of diffusion tensor. We further describe diffusion tensor properties in visualizing fiber tract organization of the human brain.

A new scaling for the rotational diffusion of molecular probes in polymer solutions.

Science.gov (United States)

Qing, Jing; Chen, Anpu; Zhao, Nanrong

2017-12-13

In the present work, we propose a new scaling form for the rotational diffusion coefficient of molecular probes in semi-dilute polymer solutions, based on a theoretical study. The mean-field theory for depletion effect and semi-empirical scaling equation for the macroscopic viscosity of polymer solutions are properly incorporated to specify the space-dependent concentration and viscosity profiles in the vicinity of the probe surface. Following the scheme of classical fluid mechanics, we numerically evaluate the shear torque exerted on the probes, which then allows us to further calculate the rotational diffusion coefficient D r . Particular attention is given to the scaling behavior of the retardation factor R rot ≡ D/D r with D being the diffusion coefficient in pure solvent. We find that R rot has little relevance to the macroscopic viscosity of the polymer solution, while it can be well featured by the characteristic length scale r h /δ, i.e. the ratio between the hydrodynamic radius of the probe r h and the depletion thickness δ. Correspondingly, we obtain a novel scaling form for the rotational retardation factor, following R rot = exp[a(r h /δ) b ] with rather robust parameters of a ≃ 0.51 and b ≃ 0.56. We apply the theory to an extensive calculation for various probes in specific polymer solutions of poly(ethylene glycol) (PEG) and dextran. Our theoretical results show good agreements with the experimental data, and clearly demonstrate the validity of the new scaling form. In addition, the difference of the scaling behavior between translational and rotational diffusions is clarified, from which we conclude that the depletion effect plays a more significant role on the local rotational diffusion rather than the long-range translation diffusion.

EQUIVALENCE VERSUS NON-EQUIVALENCE IN ECONOMIC TRANSLATION

Directory of Open Access Journals (Sweden)

Cristina, Chifane

2012-01-01

Full Text Available This paper aims at highlighting the fact that “equivalence” represents a concept worth revisiting and detailing upon when tackling the translation process of economic texts both from English into Romanian and from Romanian into English. Far from being exhaustive, our analysis will focus upon the problems arising from the lack of equivalence at the word level. Consequently, relevant examples from the economic field will be provided to account for the following types of non-equivalence at word level: culturespecific concepts; the source language concept is not lexicalised in the target language; the source language word is semantically complex; differences in physical and interpersonal perspective; differences in expressive meaning; differences in form; differences in frequency and purpose of using specific forms and the use of loan words in the source text. Likewise, we shall illustrate a number of translation strategies necessary to deal with the afore-mentioned cases of non-equivalence: translation by a more general word (superordinate; translation by a more neutral/less expressive word; translation by cultural substitution; translation using a loan word or loan word plus explanation; translation by paraphrase using a related word; translation by paraphrase using unrelated words; translation by omission and translation by illustration.

Comparison of non-Gaussian and Gaussian diffusion models of diffusion weighted imaging of rectal cancer at 3.0 T MRI.

Science.gov (United States)

Zhang, Guangwen; Wang, Shuangshuang; Wen, Didi; Zhang, Jing; Wei, Xiaocheng; Ma, Wanling; Zhao, Weiwei; Wang, Mian; Wu, Guosheng; Zhang, Jinsong

2016-12-09

Water molecular diffusion in vivo tissue is much more complicated. We aimed to compare non-Gaussian diffusion models of diffusion-weighted imaging (DWI) including intra-voxel incoherent motion (IVIM), stretched-exponential model (SEM) and Gaussian diffusion model at 3.0 T MRI in patients with rectal cancer, and to determine the optimal model for investigating the water diffusion properties and characterization of rectal carcinoma. Fifty-nine consecutive patients with pathologically confirmed rectal adenocarcinoma underwent DWI with 16 b-values at a 3.0 T MRI system. DWI signals were fitted to the mono-exponential and non-Gaussian diffusion models (IVIM-mono, IVIM-bi and SEM) on primary tumor and adjacent normal rectal tissue. Parameters of standard apparent diffusion coefficient (ADC), slow- and fast-ADC, fraction of fast ADC (f), α value and distributed diffusion coefficient (DDC) were generated and compared between the tumor and normal tissues. The SEM exhibited the best fitting results of actual DWI signal in rectal cancer and the normal rectal wall (R 2  = 0.998, 0.999 respectively). The DDC achieved relatively high area under the curve (AUC = 0.980) in differentiating tumor from normal rectal wall. Non-Gaussian diffusion models could assess tissue properties more accurately than the ADC derived Gaussian diffusion model. SEM may be used as a potential optimal model for characterization of rectal cancer.

Free diffusion of translation of macromolecules in solution with the rayleigh interferometer

International Nuclear Information System (INIS)

Leger, J.J.

1969-01-01

The aim of this study is to develop a rapid and accurate measurement, with the Rayleigh interferometer, of the free diffusion coefficient of translation of macromolecules in solution. After having explained the choice of a diffusion cell with laminar lateral flow, and explained the principle of the Rayleigh interferometer, a semi-automatic technique of free diffusion are then introduced. Solutions are proposed for systems composed of two or three components, such as biopolymers. The paper ends by drafting the possible treatment of recorded experimental data by means of electronic computer. (author) [fr

Simultaneous characterization of rotational and translational diffusion of optically anisotropic particles by optical microscopy

International Nuclear Information System (INIS)

Giavazzi, Fabio; Cerbino, Roberto; Haro-Pérez, Catalina

2016-01-01

We probe the roto-translational Brownian motion of optically anisotropic particles suspended in water with a simple and straightforward optical microscopy experiment that does not require positional or rotational particle tracking. We acquire a movie of the suspension placed between two polarizing elements and we extract the translational diffusion coefficient D T and the rotational diffusion coefficient D R from the analysis of the temporal correlation properties of the spatial Fourier modes of the intensity fluctuations in the movie. Our method is successfully tested with a dilute suspension of birefringent spherical colloidal particles obtained by polymerizing an emulsion of droplets of liquid crystal in a nematic phase, whose roto-translational dynamics is found to be well described by theory. The simplicity of our approach makes our method a viable alternative to particle tracking and depolarized dynamic light scattering. (paper)

Molecular imaging of prostate cancer: translating molecular biology approaches into the clinical realm.

Science.gov (United States)

Vargas, Hebert Alberto; Grimm, Jan; F Donati, Olivio; Sala, Evis; Hricak, Hedvig

2015-05-01

The epidemiology of prostate cancer has dramatically changed since the introduction of prostate-specific antigen (PSA) screening in the 1980's. Most prostate cancers today are detected at early stages of the disease and are considered 'indolent'; however, some patients' prostate cancers demonstrate a more aggressive behaviour which leads to rapid progression and death. Increasing understanding of the biology underlying the heterogeneity that characterises this disease has led to a continuously evolving role of imaging in the management of prostate cancer. Functional and metabolic imaging techniques are gaining importance as the impact on the therapeutic paradigm has shifted from structural tumour detection alone to distinguishing patients with indolent tumours that can be managed conservatively (e.g., by active surveillance) from patients with more aggressive tumours that may require definitive treatment with surgery or radiation. In this review, we discuss advanced imaging techniques that allow direct visualisation of molecular interactions relevant to prostate cancer and their potential for translation to the clinical setting in the near future. The potential use of imaging to follow molecular events during drug therapy as well as the use of imaging agents for therapeutic purposes will also be discussed. • Advanced imaging techniques allow direct visualisation of molecular interactions in prostate cancer. • MRI/PET, optical and Cerenkov imaging facilitate the translation of molecular biology. • Multiple compounds targeting PSMA expression are currently undergoing clinical translation. • Other targets (e.g., PSA, prostate-stem cell antigen, GRPR) are in development.

Measurement of molecular diffusion coefficients of carbon dioxide and methane in heavy oil

Energy Technology Data Exchange (ETDEWEB)

Gu, Y.; Tharanivasan, A.K.; Yang, C. [Regina Univ., SK (Canada)

2004-07-01

Vapour extraction (VAPEX) is a solvent-based thermal recovery process which is considered to be a viable process for recovering heavy oil. In order to develop a solvent-based enhanced oil recovery (EOR) operation, it is necessary to know the rate and extent of oil mobilization by the solvent. The molecular diffusion coefficient of solvent gas in heavy oil must be known. In this study, the pressure decay method was used to measure the molecular diffusivity of a gas solvent in heavy oil by monitoring the decaying pressure. The pressure decay method is a non-intrusive method in which physical contact is made between the gas solvent and the heavy oil. The pressure versus time data are measured until the heavy oil reaches complete saturation. The diffusion coefficient can be determined from the measured data and a mathematical model. In this study, the molecular diffusion coefficients of carbon dioxide-heavy oil and methane-heavy oil systems were measured and compared. The experiments were performed in closed high-pressure cells at constant reservoir temperature. An analytical solution was also obtained to predict the pressure in the gas phase and for the boundary conditions at the solvent-heavy oil interface for each solvent. Solvent diffusivity was determined by finding the best match of the numerically predicted and experimentally measured pressures.

Molecular Dynamics Simulation of Salt Diffusion in Polyelectrolyte Assemblies.

Science.gov (United States)

Zhang, Ran; Duan, Xiaozheng; Ding, Mingming; Shi, Tongfei

2018-06-05

The diffusion of salt ions and charged probe molecules in polyelectrolyte assemblies is often assumed to follow a theoretical hopping model, in which the diffusing ion is hopping between charged sites of chains based on electroneutrality. However, experimental verification of diffusing pathway at such microscales is difficult, and the corresponding molecular mechanisms remain elusive. In this study, we perform all-atom molecular dynamics (MD) simulations of salt diffusion in polyelectrolyte (PE) assembly of poly (sodium 4-styrenesulfonate) (PSS) and poly (diallyldimethylammonium chloride) (PDAC). Besides the ion hopping mode, the diffusing trajectories are found presenting common features of a jump process, i.e., subjecting to PE relaxation, water pockets in the structure open and close, thus the ion can move from one pocket to another. Anomalous subdiffusion of ions and water is observed due to the trapping scenarios in these water pockets. The jump events are much rarer compared with ion hopping but significantly increases salt diffusion with increasing temperature. Our result strongly indicates that salt diffusion in hydrated PDAC/PSS is a combined process of ion hopping and jump motion. This provides new molecular explanation for the coupling of salt motion with chain motion and the nonlinear increase of salt diffusion at glass transition temperature.

Oxygen and nitrogen diffusion in coal-molecular sieve

International Nuclear Information System (INIS)

Stefanescu, Doina Maria

1996-01-01

Recently, the air separation process based on selective adsorption of carbon-molecular sieves has been developed strongly. The separation is based on the system kinematics and depends on the oxygen diffusion in adsorber micropores. The oxygen is preferentially adsorbed and in given conditions it is possible to obtain nitrogen of high purity. Recent theoretical and experimental studies concerning the production of nitrogen by PSA process have shown that the obtained performances can not be described by a constant diffusion model. The paper present the 'dual' model assumed for O 2 and N 2 diffusion through molecular sieve as well as the experimental data obtained in the adsorption study on carbon material produced at ICIS to determine the diffusivity values in micropores

Non-linear frequency response of non-isothermal adsorption controlled by micropore diffusion with variable diffusivity

Directory of Open Access Journals (Sweden)

MENKA PETKOVSKA

2000-12-01

Full Text Available The concept of higher order frequency response functions (FRFs is used for the analysis of non-linear adsorption kinetics on a particle scale, for the case of non-isothermal micropore diffusion with variable diffusivity. Six series of FRFs are defined for the general non-isothermal case. A non-linerar mathematical model is postulated and the first and second order FRFs derived and simulated. A variable diffusivity influences the shapes of the second order FRFs relating the sorbate concentration in the solid phase and t he gas pressure significantly, but they still keep their characteristics which can be used for discrimination of this from other kinetic mechanisms. It is also shown that first and second order particle FRFs offter sufficient information for an easy and fast estimation of all model parameters, including those defining the system non-linearity.

Atomistic mechanism of microRNA translation upregulation via molecular dynamics simulations.

Directory of Open Access Journals (Sweden)

Wei Ye

Full Text Available MicroRNAs are endogenous 23-25 nt RNAs that play important gene-regulatory roles in animals and plants. Recently, miR369-3 was found to upregulate translation of TNFα mRNA in quiescent (G0 mammalian cell lines. Knock down and immunofluorescence experiments suggest that microRNA-protein complexes (with FXR1 and AGO2 are necessary for the translation upregulation. However the molecular mechanism of microRNA translation activation is poorly understood. In this study we constructed the microRNA-mRNA-AGO2-FXR1 quadruple complex by bioinformatics and molecular modeling, followed with all atom molecular dynamics simulations in explicit solvent to investigate the interaction mechanisms for the complex. A combined analysis of experimental and computational data suggests that AGO2-FXR1 complex relocalize microRNA:mRNA duplex to polysomes in G0. The two strands of dsRNA are then separated upon binding of AGO2 and FXR1. Finally, polysomes may improve the translation efficiency of mRNA. The mutation research confirms the stability of microRNA-mRNA-FXR1 and illustrates importance of key residue of Ile304. This possible mechanism can shed more light on the microRNA-dependent upregulation of translation.

Self-consistent molecular dynamics calculation of diffusion in higher n-alkanes.

Science.gov (United States)

Kondratyuk, Nikolay D; Norman, Genri E; Stegailov, Vladimir V

2016-11-28

Diffusion is one of the key subjects of molecular modeling and simulation studies. However, there is an unresolved lack of consistency between Einstein-Smoluchowski (E-S) and Green-Kubo (G-K) methods for diffusion coefficient calculations in systems of complex molecules. In this paper, we analyze this problem for the case of liquid n-triacontane. The non-conventional long-time tails of the velocity autocorrelation function (VACF) are found for this system. Temperature dependence of the VACF tail decay exponent is defined. The proper inclusion of the long-time tail contributions to the diffusion coefficient calculation results in the consistency between G-K and E-S methods. Having considered the major factors influencing the precision of the diffusion rate calculations in comparison with experimental data (system size effects and force field parameters), we point to hydrogen nuclear quantum effects as, presumably, the last obstacle to fully consistent n-alkane description.

Incorporating translation into sociolinguistic research: translation policy in an international non-governmental organisation

OpenAIRE

Tesseur, Wine

2017-01-01

This article explores aspects of translation, multilingualism and language policy in the field of transnational civil society. By focusing on translation policies at Amnesty International, an international non-governmental organisation that performs a key role in global governance, this article seeks to contribute to a globalisation-sensitive sociolinguistics. It argues that combining a sociolinguistic approach, more precisely linguistic ethnography, with translation studies leads to an incre...

Molecular Diffusion through Cyanobacterial Septal Junctions.

Science.gov (United States)

Nieves-Morión, Mercedes; Mullineaux, Conrad W; Flores, Enrique

2017-01-03

Heterocyst-forming cyanobacteria grow as filaments in which intercellular molecular exchange takes place. During the differentiation of N 2 -fixing heterocysts, regulators are transferred between cells. In the diazotrophic filament, vegetative cells that fix CO 2 through oxygenic photosynthesis provide the heterocysts with reduced carbon and heterocysts provide the vegetative cells with fixed nitrogen. Intercellular molecular transfer has been traced with fluorescent markers, including calcein, 5-carboxyfluorescein, and the sucrose analogue esculin, which are observed to move down their concentration gradient. In this work, we used fluorescence recovery after photobleaching (FRAP) assays in the model heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120 to measure the temperature dependence of intercellular transfer of fluorescent markers. We find that the transfer rate constants are directly proportional to the absolute temperature. This indicates that the "septal junctions" (formerly known as "microplasmodesmata") linking the cells in the filament allow molecular exchange by simple diffusion, without any activated intermediate state. This constitutes a novel mechanism for molecular transfer across the bacterial cytoplasmic membrane, in addition to previously characterized mechanisms for active transport and facilitated diffusion. Cyanobacterial septal junctions are functionally analogous to the gap junctions of metazoans. Although bacteria are frequently considered just as unicellular organisms, there are bacteria that behave as true multicellular organisms. The heterocyst-forming cyanobacteria grow as filaments in which cells communicate. Intercellular molecular exchange is thought to be mediated by septal junctions. Here, we show that intercellular transfer of fluorescent markers in the cyanobacterial filament has the physical properties of simple diffusion. Thus, cyanobacterial septal junctions are functionally analogous to metazoan gap junctions

Time scale of diffusion in molecular and cellular biology

International Nuclear Information System (INIS)

Holcman, D; Schuss, Z

2014-01-01

Diffusion is the driver of critical biological processes in cellular and molecular biology. The diverse temporal scales of cellular function are determined by vastly diverse spatial scales in most biophysical processes. The latter are due, among others, to small binding sites inside or on the cell membrane or to narrow passages between large cellular compartments. The great disparity in scales is at the root of the difficulty in quantifying cell function from molecular dynamics and from simulations. The coarse-grained time scale of cellular function is determined from molecular diffusion by the mean first passage time of molecular Brownian motion to a small targets or through narrow passages. The narrow escape theory (NET) concerns this issue. The NET is ubiquitous in molecular and cellular biology and is manifested, among others, in chemical reactions, in the calculation of the effective diffusion coefficient of receptors diffusing on a neuronal cell membrane strewn with obstacles, in the quantification of the early steps of viral trafficking, in the regulation of diffusion between the mother and daughter cells during cell division, and many other cases. Brownian trajectories can represent the motion of a molecule, a protein, an ion in solution, a receptor in a cell or on its membrane, and many other biochemical processes. The small target can represent a binding site or an ionic channel, a hidden active site embedded in a complex protein structure, a receptor for a neurotransmitter on the membrane of a neuron, and so on. The mean time to attach to a receptor or activator determines diffusion fluxes that are key regulators of cell function. This review describes physical models of various subcellular microdomains, in which the NET coarse-grains the molecular scale to a higher cellular-level, thus clarifying the role of cell geometry in determining subcellular function. (topical review)

Time scale of diffusion in molecular and cellular biology

Science.gov (United States)

Holcman, D.; Schuss, Z.

2014-05-01

Diffusion is the driver of critical biological processes in cellular and molecular biology. The diverse temporal scales of cellular function are determined by vastly diverse spatial scales in most biophysical processes. The latter are due, among others, to small binding sites inside or on the cell membrane or to narrow passages between large cellular compartments. The great disparity in scales is at the root of the difficulty in quantifying cell function from molecular dynamics and from simulations. The coarse-grained time scale of cellular function is determined from molecular diffusion by the mean first passage time of molecular Brownian motion to a small targets or through narrow passages. The narrow escape theory (NET) concerns this issue. The NET is ubiquitous in molecular and cellular biology and is manifested, among others, in chemical reactions, in the calculation of the effective diffusion coefficient of receptors diffusing on a neuronal cell membrane strewn with obstacles, in the quantification of the early steps of viral trafficking, in the regulation of diffusion between the mother and daughter cells during cell division, and many other cases. Brownian trajectories can represent the motion of a molecule, a protein, an ion in solution, a receptor in a cell or on its membrane, and many other biochemical processes. The small target can represent a binding site or an ionic channel, a hidden active site embedded in a complex protein structure, a receptor for a neurotransmitter on the membrane of a neuron, and so on. The mean time to attach to a receptor or activator determines diffusion fluxes that are key regulators of cell function. This review describes physical models of various subcellular microdomains, in which the NET coarse-grains the molecular scale to a higher cellular-level, thus clarifying the role of cell geometry in determining subcellular function.

Universality of Viscosity Dependence of Translational Diffusion Coefficients of Carbon Monoxide, Diphenylacetylene, and Diphenylcyclopropenone in Ionic Liquids under Various Conditions.

Science.gov (United States)

Kimura, Y; Kida, Y; Matsushita, Y; Yasaka, Y; Ueno, M; Takahashi, K

2015-06-25

Translational diffusion coefficients of diphenylcyclopropenone (DPCP), diphenylacetylene (DPA), and carbon monoxide (CO) in 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide ([BMIm][NTf2]) and 1-ethyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide ([EMIm][NTf2]) were determined by the transient grating (TG) spectroscopy under pressure from 0.1 to 200 MPa at 298 K and from 298 to 373 K under 0.1 MPa. Diffusion coefficients of these molecules at high temperatures in tributylmethylphosphonium bis(trifluoromethanesulfonyl)imide ([P4441][NTf2]), and tetraoctylphosphonium bis(trifluoromethanesulfonyl)imide ([P8888][NTf2]), and also in the mixtures of [BMIm][NTf2], N-methyl-N-propylpiperidinium bis(trifluoromethanesulfonyl)imide ([Pp13][NTf2]), and trihexyltetradecylphosphonium bis(trifluoromethanesulfonyl)imide ([P66614][NTf2]) with ethanol or chloroform have been determined. Diffusion coefficients except in ILs of phosphonium cations were well scaled by the power law of T/η, i.e., (T/η)(P), where T and η are the absolute temperature and the viscosity, irrespective of the solvent species, pressure and temperature, and the compositions of mixtures. The values of the exponent P were smaller for the smaller size of the molecules. On the other hand, the diffusion coefficients in ILs of phosphonium cations with longer alkyl chains were larger than the values expected from the correlation obtained by other ILs and conventional liquids. The deviation becomes larger with increasing the number of carbon atoms of alkyl-chain of cation, and with decreasing the molecular size of diffusing molecules. The molecular size dependence of the diffusion coefficient was correlated by the ratio of the volume of the solute to that of the solvent as demonstrated by the preceding work (Kaintz et al., J. Phys. Chem. B 2013 , 117 , 11697 ). Diffusion coefficients have been well correlated with the power laws of both T/η and the relative volume of the solute to the solvent.

Molecular dynamics and diffusion a compilation

CERN Document Server

Fisher, David

2013-01-01

The molecular dynamics technique was developed in the 1960s as the outgrowth of attempts to model complicated systems by using either a) direct physical simulation or (following the great success of Monte Carlo methods) by b) using computer techniques. Computer simulation soon won out over clumsy physical simulation, and the ever-increasing speed and sophistication of computers has naturally made molecular dynamics simulation into a more and more successful technique. One of its most popular applications is the study of diffusion, and some experts now even claim that molecular dynamics simulation is, in the case of situations involving well-characterised elements and structures, more accurate than experimental measurement. The present double volume includes a compilation (over 600 items) of predicted solid-state diffusion data, for all of the major materials groups, dating back nearly four decades. The double volume also includes some original papers: "Determination of the Activation Energy for Formation and ...

Diffusion in Liquids : Equilibrium Molecular Simulations and Predictive Engineering Models

NARCIS (Netherlands)

Liu, X.

2013-01-01

The aim of this thesis is to study multicomponent diffusion in liquids using Molecular Dynamics (MD) simulations. Diffusion plays an important role in mass transport processes. In binary systems, mass transfer processes have been studied extensively using both experiments and molecular simulations.

Molecular Diffusion through Cyanobacterial Septal Junctions

Directory of Open Access Journals (Sweden)

Mercedes Nieves-Morión

2017-01-01

Full Text Available Heterocyst-forming cyanobacteria grow as filaments in which intercellular molecular exchange takes place. During the differentiation of N2-fixing heterocysts, regulators are transferred between cells. In the diazotrophic filament, vegetative cells that fix CO2 through oxygenic photosynthesis provide the heterocysts with reduced carbon and heterocysts provide the vegetative cells with fixed nitrogen. Intercellular molecular transfer has been traced with fluorescent markers, including calcein, 5-carboxyfluorescein, and the sucrose analogue esculin, which are observed to move down their concentration gradient. In this work, we used fluorescence recovery after photobleaching (FRAP assays in the model heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120 to measure the temperature dependence of intercellular transfer of fluorescent markers. We find that the transfer rate constants are directly proportional to the absolute temperature. This indicates that the “septal junctions” (formerly known as “microplasmodesmata” linking the cells in the filament allow molecular exchange by simple diffusion, without any activated intermediate state. This constitutes a novel mechanism for molecular transfer across the bacterial cytoplasmic membrane, in addition to previously characterized mechanisms for active transport and facilitated diffusion. Cyanobacterial septal junctions are functionally analogous to the gap junctions of metazoans.

Communication: A method to compute the transport coefficient of pure fluids diffusing through planar interfaces from equilibrium molecular dynamics simulations.

Science.gov (United States)

Vermorel, Romain; Oulebsir, Fouad; Galliero, Guillaume

2017-09-14

The computation of diffusion coefficients in molecular systems ranks among the most useful applications of equilibrium molecular dynamics simulations. However, when dealing with the problem of fluid diffusion through vanishingly thin interfaces, classical techniques are not applicable. This is because the volume of space in which molecules diffuse is ill-defined. In such conditions, non-equilibrium techniques allow for the computation of transport coefficients per unit interface width, but their weak point lies in their inability to isolate the contribution of the different physical mechanisms prone to impact the flux of permeating molecules. In this work, we propose a simple and accurate method to compute the diffusional transport coefficient of a pure fluid through a planar interface from equilibrium molecular dynamics simulations, in the form of a diffusion coefficient per unit interface width. In order to demonstrate its validity and accuracy, we apply our method to the case study of a dilute gas diffusing through a smoothly repulsive single-layer porous solid. We believe this complementary technique can benefit to the interpretation of the results obtained on single-layer membranes by means of complex non-equilibrium methods.

Modelling non-homogeneous stochastic reaction-diffusion systems: the case study of gemcitabine-treated non-small cell lung cancer growth.

Science.gov (United States)

Lecca, Paola; Morpurgo, Daniele

2012-01-01

Reaction-diffusion based models have been widely used in the literature for modeling the growth of solid tumors. Many of the current models treat both diffusion/consumption of nutrients and cell proliferation. The majority of these models use classical transport/mass conservation equations for describing the distribution of molecular species in tumor spheroids, and the Fick's law for describing the flux of uncharged molecules (i.e oxygen, glucose). Commonly, the equations for the cell movement and proliferation are first order differential equations describing the rate of change of the velocity of the cells with respect to the spatial coordinates as a function of the nutrient's gradient. Several modifications of these equations have been developed in the last decade to explicitly indicate that the tumor includes cells, interstitial fluids and extracellular matrix: these variants provided a model of tumor as a multiphase material with these as the different phases. Most of the current reaction-diffusion tumor models are deterministic and do not model the diffusion as a local state-dependent process in a non-homogeneous medium at the micro- and meso-scale of the intra- and inter-cellular processes, respectively. Furthermore, a stochastic reaction-diffusion model in which diffusive transport of the molecular species of nutrients and chemotherapy drugs as well as the interactions of the tumor cells with these species is a novel approach. The application of this approach to he scase of non-small cell lung cancer treated with gemcitabine is also novel. We present a stochastic reaction-diffusion model of non-small cell lung cancer growth in the specification formalism of the tool Redi, we recently developed for simulating reaction-diffusion systems. We also describe how a spatial gradient of nutrients and oncological drugs affects the tumor progression. Our model is based on a generalization of the Fick's first diffusion law that allows to model diffusive transport in non

Molecular motion in restricted geometries

Indian Academy of Sciences (India)

Molecular dynamics in restricted geometries is known to exhibit anomalous behaviour. Diffusion, translational or rotational, of molecules is altered significantly on confinement in restricted geometries. Quasielastic neutron scattering (QENS) offers a unique possibility of studying molecular motion in such systems. Both time ...

Non-Gaussian diffusion in static disordered media

Science.gov (United States)

Luo, Liang; Yi, Ming

2018-04-01

Non-Gaussian diffusion is commonly considered as a result of fluctuating diffusivity, which is correlated in time or in space or both. In this work, we investigate the non-Gaussian diffusion in static disordered media via a quenched trap model, where the diffusivity is spatially correlated. Several unique effects due to quenched disorder are reported. We analytically estimate the diffusion coefficient Ddis and its fluctuation over samples of finite size. We show a mechanism of population splitting in the non-Gaussian diffusion. It results in a sharp peak in the distribution of displacement P (x ,t ) around x =0 , that has frequently been observed in experiments. We examine the fidelity of the coarse-grained diffusion map, which is reconstructed from particle trajectories. Finally, we propose a procedure to estimate the correlation length in static disordered environments, where the information stored in the sample-to-sample fluctuation has been utilized.

The birth and spread of IWRM - A case study of global policy diffusion and translation

Directory of Open Access Journals (Sweden)

Jeremy Allouche

2016-10-01

Full Text Available How did the idea of IWRM emerge at the global level? Why has IWRM become so popular and so resilient, at least in discourse and policy? What has caused IWRM policies to diffuse across time and space? The principal goal of this article is to identify a set of concepts and mechanisms to study the global diffusion and translation of IWRM through coercion, cooperation, or learning from the ground. The article will also highlight the extent to which this global diffusion was contested and translated into different meanings in terms of policy orientation. Overall, IWRM was a mindset of a particular period where the water policy paradigm was evolving in the same direction as sustainable development and other related paradigms in a post-Rio moment. There were no clear alternatives at the time but now IWRM is being questioned. This IWRM fatigue is leading to other framings and discourses around the water-food-energy nexus and the green economy.

Personal Knowledge Management in the Training of Non-Literary Translators

DEFF Research Database (Denmark)

Kastberg, Peter

2009-01-01

of problems. As Karl Popper states we may even say that a profession is a conglomerate of acknowledged problems and the disciplinary-internal resources with which to solve these problems (Popper 1979[1962]:108). The particular translation problem, which I will be discussing in this paper, was reintroduced...... to us by the German translation scholar Reiss back in the 1980s when she laconically stated that "you cannot translate what you do not understand". In this article I will discuss one particular aspect of this problem, namely how students of non-literary translation are currently taught to reach...... the ground for rethinking how we deal with subject matter in the training of non-literary translators   KEYWORDS   Translator training, translation curricula, subject matter competence, Personal Knowledge Management...

Predicting the influence of long-range molecular interactions on macroscopic-scale diffusion by homogenization of the Smoluchowski equation

Energy Technology Data Exchange (ETDEWEB)

Kekenes-Huskey, P. M., E-mail: pkekeneshuskey@ucsd.edu [Department of Pharmacology, University of California San Diego, La Jolla, California 92093-0636 (United States); Gillette, A. K. [Department of Mathematics, University of Arizona, Tucson, Arizona 85721-0089 (United States); McCammon, J. A. [Department of Pharmacology, University of California San Diego, La Jolla, California 92093-0636 (United States); Department of Chemistry, Howard Hughes Medical Institute, University of California San Diego, La Jolla, California 92093-0636 (United States)

2014-05-07

The macroscopic diffusion constant for a charged diffuser is in part dependent on (1) the volume excluded by solute “obstacles” and (2) long-range interactions between those obstacles and the diffuser. Increasing excluded volume reduces transport of the diffuser, while long-range interactions can either increase or decrease diffusivity, depending on the nature of the potential. We previously demonstrated [P. M. Kekenes-Huskey et al., Biophys. J. 105, 2130 (2013)] using homogenization theory that the configuration of molecular-scale obstacles can both hinder diffusion and induce diffusional anisotropy for small ions. As the density of molecular obstacles increases, van der Waals (vdW) and electrostatic interactions between obstacle and a diffuser become significant and can strongly influence the latter's diffusivity, which was neglected in our original model. Here, we extend this methodology to include a fixed (time-independent) potential of mean force, through homogenization of the Smoluchowski equation. We consider the diffusion of ions in crowded, hydrophilic environments at physiological ionic strengths and find that electrostatic and vdW interactions can enhance or depress effective diffusion rates for attractive or repulsive forces, respectively. Additionally, we show that the observed diffusion rate may be reduced independent of non-specific electrostatic and vdW interactions by treating obstacles that exhibit specific binding interactions as “buffers” that absorb free diffusers. Finally, we demonstrate that effective diffusion rates are sensitive to distribution of surface charge on a globular protein, Troponin C, suggesting that the use of molecular structures with atomistic-scale resolution can account for electrostatic influences on substrate transport. This approach offers new insight into the influence of molecular-scale, long-range interactions on transport of charged species, particularly for diffusion-influenced signaling events

Nuclear spin relaxation by translational diffusion in solids

International Nuclear Information System (INIS)

Barton, W.A.; Sholl, C.A.

1978-01-01

The theory of nuclear spin relaxation by translational diffusion in solids developed in previous papers is applied to two-spin systems and third-nearest-neighbour jump models in FCC crystals. The two-spin systems describe the dipole-dipole interactions between stationary host spins and spins migrating amongst either the tetrahedral or the octahedral interstitial sites. The tetrahedral sites in a FCC crystal form a SC lattice and two models, the symmetric and asymmetric jump models, are considered for third-nearest-neighbour jumps on this lattice. Numerical results for the correlation function relevant for single crystals and polycrystals are presented over the entire temperature range. It is found that the simpler, but unphysical, symmetric jump model is a good approximation to the more complicated asymmetric jump model. (author)

Translational Applications of Molecular Imaging and Radionuclide Therapy

International Nuclear Information System (INIS)

Welch, Michael J.; Eckelman, William C.; Vera, David

2005-01-01

Molecular imaging is becoming a larger part of imaging research and practice. The Office of Biological and Environmental Research of the Department of Energy funds a significant number of researchers in this area. The proposal is to partially fund a workshop to inform scientists working in nuclear medicine and nuclear medicine practitioners of the recent advances of molecular imaging in nuclear medicine as well as other imaging modalities. A limited number of topics related to radionuclide therapy will also be discussed. The proposal is to request partial funds for the workshop entitled ''Translational Applications of Molecular Imaging and Radionuclide Therapy'' to be held prior to the Society of Nuclear Medicine Annual Meeting in Toronto, Canada in June 2005. The meeting will be held on June 17-18. This will allow scientists interested in all aspects of nuclear medicine imaging to attend. The chair of the organizing group is Dr. Michael J. Welch. The organizing committee consists of Dr. Welch, Dr. William C. Eckelman and Dr. David Vera. The goal is to invite speakers to discuss the most recent advances of modern molecular imaging and therapy. Speakers will present advances made in in vivo tagging imaging assays, technical aspects of small animal imaging, in vivo imaging and bench to bedside translational study; and the role of a diagnostic scan on therapy selection. This latter topic will include discussions on therapy and new approaches to dosimetry. Several of these topics are those funded by the Department of Energy Office of Biological and Environmental Research

Comparing three knowledge communication strategies - Diffusion, Dissemination and Translation - through randomized controlled studies.

Science.gov (United States)

Lane, Joseph P; Stone, Vathsala I

2015-01-01

This paper describes a series of three randomized controlled case studies comparing the effectiveness of three strategies for communicating new research-based knowledge (Diffusion, Dissemination, Translation), to different Assistive Technology (AT) stakeholder groups. Pre and post intervention measures for level of knowledge use (unaware, aware, interested, using) via the LOKUS instrument, assessed the relative effectiveness of the three strategies. The latter two approaches were both more effective than diffusion but also equally effective. The results question the value added by tailoring research findings to specific audiences, and instead supports the critical yet neglected role for relevance in determining knowledge use by stakeholders.

Solutions for a non-Markovian diffusion equation

International Nuclear Information System (INIS)

Lenzi, E.K.; Evangelista, L.R.; Lenzi, M.K.; Ribeiro, H.V.; Oliveira, E.C. de

2010-01-01

Solutions for a non-Markovian diffusion equation are investigated. For this equation, we consider a spatial and time dependent diffusion coefficient and the presence of an absorbent term. The solutions exhibit an anomalous behavior which may be related to the solutions of fractional diffusion equations and anomalous diffusion.

Bench to bedside molecular functional imaging in translational cancer medicine: to image or to imagine?

International Nuclear Information System (INIS)

Mahajan, A.; Goh, V.; Basu, S.; Vaish, R.; Weeks, A.J.; Thakur, M.H.; Cook, G.J.

2015-01-01

Ongoing research on malignant and normal cell biology has substantially enhanced the understanding of the biology of cancer and carcinogenesis. This has led to the development of methods to image the evolution of cancer, target specific biological molecules, and study the anti-tumour effects of novel therapeutic agents. At the same time, there has been a paradigm shift in the field of oncological imaging from purely structural or functional imaging to combined multimodal structure–function approaches that enable the assessment of malignancy from all aspects (including molecular and functional level) in a single examination. The evolving molecular functional imaging using specific molecular targets (especially with combined positron-emission tomography [PET] computed tomography [CT] using 2- [ 18 F]-fluoro-2-deoxy-D-glucose [FDG] and other novel PET tracers) has great potential in translational research, giving specific quantitative information with regard to tumour activity, and has been of pivotal importance in diagnoses and therapy tailoring. Furthermore, molecular functional imaging has taken a key place in the present era of translational cancer research, producing an important tool to study and evolve newer receptor-targeted therapies, gene therapies, and in cancer stem cell research, which could form the basis to translate these agents into clinical practice, popularly termed “theranostics”. Targeted molecular imaging needs to be developed in close association with biotechnology, information technology, and basic translational scientists for its best utility. This article reviews the current role of molecular functional imaging as one of the main pillars of translational research. -- Highlights: •Molecular functional imaging (MFI) gives insight into the tumor biology and intratumoral heterogeneity. •It has potential role in identifying radiomic signatures associated with underlying gene-expression. •Radiomics can be used to create a road map

Molecular dynamics on diffusive time scales from the phase-field-crystal equation.

Science.gov (United States)

Chan, Pak Yuen; Goldenfeld, Nigel; Dantzig, Jon

2009-03-01

We extend the phase-field-crystal model to accommodate exact atomic configurations and vacancies by requiring the order parameter to be non-negative. The resulting theory dictates the number of atoms and describes the motion of each of them. By solving the dynamical equation of the model, which is a partial differential equation, we are essentially performing molecular dynamics simulations on diffusive time scales. To illustrate this approach, we calculate the two-point correlation function of a fluid.

Molecular dynamics study of water molecule diffusion in oil-paper insulation materials

International Nuclear Information System (INIS)

Liao Ruijin; Zhu Mengzhao; Yang Lijun; Zhou Xin; Gong Chunyan

2011-01-01

Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.

Molecular dynamics study of water molecule diffusion in oil-paper insulation materials

Energy Technology Data Exchange (ETDEWEB)

Liao Ruijin [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Zhu Mengzhao, E-mail: xiaozhupost@163.co [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Yang Lijun; Zhou Xin; Gong Chunyan [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China)

2011-03-01

Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.

Rotational laser cooling of vibrationally and translationally cold molecular ions

DEFF Research Database (Denmark)

Staanum, Peter; Højbjerre, Klaus; Skyt, Peter Sandegaard

2010-01-01

Stationary molecules in well-defined internal states are of broad interest for physics and chemistry. In physics, this includes metrology 1, 2, 3 , quantum computing 4, 5 and many-body quantum mechanics 6, 7 , whereas in chemistry, state-prepared molecular targets are of interest for uni......-molecular reactions with coherent light fields 8, 9 , for quantum-state-selected bi-molecular reactions 10, 11, 12 and for astrochemistry 12 . Here, we demonstrate rotational ground-state cooling of vibrationally and translationally cold MgH+ ions, using a laser-cooling scheme based on excitation of a single...

Effects of pair correlation functions on intermolecular nuclear relaxation by translational and rotational diffusion in liquids

International Nuclear Information System (INIS)

Fries, P.

1978-01-01

In order to study the intermolecular relaxation due to magnetic dipolar interactions, we calculate the spectral densities resulting from random translational and rotational motions of spherical molecules carrying off-centre spins. The relative translational motion is treated in the frame-work of a general diffusion equation (the Smoluchowski equation) which takes into account the existence of effective forces between the molecules. This model implies a pair correlation function. i.e. a non unifom relative distribution of the molecules. The analytical calculations are carried out by taking correctly into account the hard sphere boundary conditions for the molecules. Explicit numerical calculations of the spectral densities are performed using finite difference methods and the pair correlation function of Verlet and Weiss obtained by computer experiments. The resulting calculations allow one to interpret the relaxation exhibited by benzene and some of its monohalogen derivatives which has been measured by Jonas et al. at various pressures. The effects of pair correlation and eccentricity contribute to a noticeable enhancement of the spectral densities, especially as the frequency increases. The translational correlation times calculated from the Stokes formula and those deduced from intermolecular relaxation studies are compared. It is shown that in order to distinguish which of the dynamical models is appropriate, measurements must be made as a function of frequency [fr

Quantifying Multistate Cytoplasmic Molecular Diffusion in Bacterial Cells via Inverse Transform of Confined Displacement Distribution.

Science.gov (United States)

Chen, Tai-Yen; Jung, Won; Santiago, Ace George; Yang, Feng; Krzemiński, Łukasz; Chen, Peng

2015-11-12

Single-molecule tracking (SMT) of fluorescently tagged cytoplasmic proteins can provide valuable information on the underlying biological processes in living cells via subsequent analysis of the displacement distributions; however, the confinement effect originated from the small size of a bacterial cell skews the protein's displacement distribution and complicates the quantification of the intrinsic diffusive behaviors. Using the inverse transformation method, we convert the skewed displacement distribution (for both 2D and 3D imaging conditions) back to that in free space for systems containing one or multiple (non)interconverting Brownian diffusion states, from which we can reliably extract the number of diffusion states as well as their intrinsic diffusion coefficients and respective fractional populations. We further demonstrate a successful application to experimental SMT data of a transcription factor in living E. coli cells. This work allows a direct quantitative connection between cytoplasmic SMT data with diffusion theory for analyzing molecular diffusive behavior in live bacteria.

Anatomic mapping of molecular subtypes in diffuse glioma.

Science.gov (United States)

Tang, Qisheng; Lian, Yuxi; Yu, Jinhua; Wang, Yuanyuan; Shi, Zhifeng; Chen, Liang

2017-09-15

Tumor location served as an important prognostic factor in glioma patients was considered to postulate molecular features according to cell origin theory. However, anatomic distribution of unique molecular subtypes was not widely investigated. The relationship between molecular phenotype and histological subgroup were also vague based on tumor location. Our group focuses on the study of glioma anatomic location of distinctive molecular subgroups and histology subtypes, and explores the possibility of their consistency based on clinical background. We retrospectively reviewed 143 cases with both molecular information (IDH1/TERT/1p19q) and MRI images diagnosed as cerebral diffuse gliomas. The anatomic distribution was analyzed between distinctive molecular subgroups and its relationship with histological subtypes. The influence of tumor location, molecular stratification and histology diagnosis on survival outcome was investigated as well. Anatomic locations of cerebral diffuse glioma indicate varied clinical outcome. Based on that, it can be stratified into five principal molecular subgroups according to IDH1/TERT/1p19q status. Triple-positive (IDH1 and TERT mutation with 1p19q codeletion) glioma tended to be oligodendroglioma present with much better clinical outcome compared to TERT mutation only group who is glioblastoma inclined (median overall survival 39 months VS 18 months). Five molecular subgroups were demonstrated with distinctive locational distribution. This kind of anatomic feature is consistent with its corresponding histological subtypes. Each molecular subgroup in glioma has unique anatomic location which indicates distinctive clinical outcome. Molecular diagnosis can be served as perfect complementary tool for the precise diagnosis. Integration of histomolecular diagnosis will be much more helpful in routine clinical practice in the future.

The Green’s functions for peridynamic non-local diffusion

Science.gov (United States)

Wang, L. J.; Xu, J. F.

2016-01-01

In this work, we develop the Green’s function method for the solution of the peridynamic non-local diffusion model in which the spatial gradient of the generalized potential in the classical theory is replaced by an integral of a generalized response function in a horizon. We first show that the general solutions of the peridynamic non-local diffusion model can be expressed as functionals of the corresponding Green’s functions for point sources, along with volume constraints for non-local diffusion. Then, we obtain the Green’s functions by the Fourier transform method for unsteady and steady diffusions in infinite domains. We also demonstrate that the peridynamic non-local solutions converge to the classical differential solutions when the non-local length approaches zero. Finally, the peridynamic analytical solutions are applied to an infinite plate heated by a Gauss source, and the predicted variations of temperature are compared with the classical local solutions. The peridynamic non-local diffusion model predicts a lower rate of variation of the field quantities than that of the classical theory, which is consistent with experimental observations. The developed method is applicable to general diffusion-type problems. PMID:27713658

Molecular Dimensions of Gastric Cancer: Translational and Clinical Perspectives

Directory of Open Access Journals (Sweden)

Yoon Young Choi

2016-01-01

Full Text Available Gastric cancer is a global health burden and has the highest incidence in East Asia. This disease is complex in nature because it arises from multiple interactions of genetic, local environmental, and host factors, resulting in biological heterogeneity. This genetic intricacy converges on molecular characteristics reflecting the pathophysiology, tumor biology, and clinical outcome. Therefore, understanding the molecular characteristics at a genomic level is pivotal to improving the clinical care of patients with gastric cancer. A recent landmark study, The Cancer Genome Atlas (TCGA project, showed the molecular landscape of gastric cancer through a comprehensive molecular evaluation of 295 primary gastric cancers. The proposed molecular classification divided gastric cancer into four subtypes: Epstein-Barr virus–positive, microsatellite unstable, genomic stable, and chromosomal instability. This information will be taken into account in future clinical trials and will be translated into clinical therapeutic decisions. To fully realize the clinical benefit, many challenges must be overcome. Rapid growth of high-throughput biology and functional validation of molecular targets will further deepen our knowledge of molecular dimensions of this cancer, allowing for personalized precision medicine.

Molecular Dimensions of Gastric Cancer: Translational and Clinical Perspectives.

Science.gov (United States)

Choi, Yoon Young; Noh, Sung Hoon; Cheong, Jae-Ho

2016-01-01

Gastric cancer is a global health burden and has the highest incidence in East Asia. This disease is complex in nature because it arises from multiple interactions of genetic, local environmental, and host factors, resulting in biological heterogeneity. This genetic intricacy converges on molecular characteristics reflecting the pathophysiology, tumor biology, and clinical outcome. Therefore, understanding the molecular characteristics at a genomic level is pivotal to improving the clinical care of patients with gastric cancer. A recent landmark study, The Cancer Genome Atlas (TCGA) project, showed the molecular landscape of gastric cancer through a comprehensive molecular evaluation of 295 primary gastric cancers. The proposed molecular classification divided gastric cancer into four subtypes: Epstein-Barr virus-positive, microsatellite unstable, genomic stable, and chromosomal instability. This information will be taken into account in future clinical trials and will be translated into clinical therapeutic decisions. To fully realize the clinical benefit, many challenges must be overcome. Rapid growth of high-throughput biology and functional validation of molecular targets will further deepen our knowledge of molecular dimensions of this cancer, allowing for personalized precision medicine.

Basic Studies of Non-Diffusive Transport in Plasmas

Energy Technology Data Exchange (ETDEWEB)

Morales, George J. [University of California, Los Angeles, CA (United States); Maggs, James E. [University of California, Los Angeles, CA (United States)

2014-10-25

The project expanded and developed mathematical descriptions, and corresponding numerical modeling, of non-diffusive transport to incorporate new perspectives derived from basic transport experiments performed in the LAPD device at UCLA, and at fusion devices throughout the world. By non-diffusive it is meant that the transport of fundamental macroscopic parameters of a system, such as temperature and density, does not follow the standard diffusive behavior predicted by a classical Fokker-Planck equation. The appearance of non-diffusive behavior is often related to underlying microscopic processes that cause the value of a system parameter, at one spatial position, to be linked to distant events, i.e., non-locality. In the LAPD experiments the underlying process was traced to large amplitude, coherent drift-waves that give rise to chaotic trajectories. Significant advances were made in this project. The results have lead to a new perspective about the fundamentals of edge transport in magnetically confined plasmas; the insight has important consequences for worldwide studies in fusion devices. Progress was also made in advancing the mathematical techniques used to describe fractional diffusion.

Molecular dynamics simulation of self-diffusion coefficients for liquid metals

International Nuclear Information System (INIS)

Ju Yuan-Yuan; Zhang Qing-Ming; Gong Zi-Zheng; Ji Guang-Fu

2013-01-01

The temperature-dependent coefficients of self-diffusion for liquid metals are simulated by molecular dynamics methods based on the embedded-atom-method (EAM) potential function. The simulated results show that a good inverse linear relation exists between the natural logarithm of self-diffusion coefficients and temperature, though the results in the literature vary somewhat, due to the employment of different potential functions. The estimated activation energy of liquid metals obtained by fitting the Arrhenius formula is close to the experimental data. The temperature-dependent shear-viscosities obtained from the Stokes—Einstein relation in conjunction with the results of molecular dynamics simulation are generally consistent with other values in the literature. (atomic and molecular physics)

LARP1 functions as a molecular switch for mTORC1-mediated translation of an essential class of mRNAs.

Science.gov (United States)

Hong, Sungki; Freeberg, Mallory A; Han, Ting; Kamath, Avani; Yao, Yao; Fukuda, Tomoko; Suzuki, Tsukasa; Kim, John K; Inoki, Ken

2017-06-26

The RNA binding protein, LARP1, has been proposed to function downstream of mTORC1 to regulate the translation of 5'TOP mRNAs such as those encoding ribosome proteins (RP). However, the roles of LARP1 in the translation of 5'TOP mRNAs are controversial and its regulatory roles in mTORC1-mediated translation remain unclear. Here we show that LARP1 is a direct substrate of mTORC1 and Akt/S6K1. Deep sequencing of LARP1-bound mRNAs reveal that non-phosphorylated LARP1 interacts with both 5' and 3'UTRs of RP mRNAs and inhibits their translation. Importantly, phosphorylation of LARP1 by mTORC1 and Akt/S6K1 dissociates it from 5'UTRs and relieves its inhibitory activity on RP mRNA translation. Concomitantly, phosphorylated LARP1 scaffolds mTORC1 on the 3'UTRs of translationally-competent RP mRNAs to facilitate mTORC1-dependent induction of translation initiation. Thus, in response to cellular mTOR activity, LARP1 serves as a phosphorylation-sensitive molecular switch for turning off or on RP mRNA translation and subsequent ribosome biogenesis.

The effect of rotational and translational energy exchange on tracer diffusion in rough hard sphere fluids.

Science.gov (United States)

Kravchenko, Olga; Thachuk, Mark

2011-03-21

A study is presented of tracer diffusion in a rough hard sphere fluid. Unlike smooth hard spheres, collisions between rough hard spheres can exchange rotational and translational energy and momentum. It is expected that as tracer particles become larger, their diffusion constants will tend toward the Stokes-Einstein hydrodynamic result. It has already been shown that in this limit, smooth hard spheres adopt "slip" boundary conditions. The current results show that rough hard spheres adopt boundary conditions proportional to the degree of translational-rotational energy exchange. Spheres for which this exchange is the largest adopt "stick" boundary conditions while those with more intermediate exchange adopt values between the "slip" and "stick" limits. This dependence is found to be almost linear. As well, changes in the diffusion constants as a function of this exchange are examined and it is found that the dependence is stronger than that suggested by the low-density, Boltzmann result. Compared with smooth hard spheres, real molecules undergo inelastic collisions and have attractive wells. Rough hard spheres model the effect of inelasticity and show that even without the presence of attractive forces, the boundary conditions for large particles can deviate from "slip" and approach "stick."

Neutron diffuse scattering in magnetite due to molecular polarons

International Nuclear Information System (INIS)

Yamada, Y.; Wakabayashi, N.; Nicklow, R.M.

1980-01-01

A detailed neutron diffuse scattering study has been carried out in order to verify a model which describes the property of valence fluctuations in magnetite above T/sub V/. This model assumes the existence of a complex which is composed of two excess electrons and a local displacement mode of oxygens within the fcc primitive cell. The complex is called a molecular polaron. It is assumed that at sufficiently high temperatures there is a random distribution of molecular polarons, which are fluctuating independently by making hopping motions through the crystal or by dissociating into smaller polarons. The lifetime of each molecular polaron is assumed to be long enough to induce an instantaneous strain field around it. Based on this model, the neutron diffuse scattering cross section due to randomly distributed dressed molecular polarons has been calculated. A precise measurement of the quasielastic scattering of neutrons has been carried out at 150 K. The observed results definitely show the characteristics which are predicted by the model calculation and, thus, give evidence for the existence of the proposed molecular polarons. From this standpoint, the Verwey transition of magnetite may be viewed as the cooperative ordering process of dressed molecular polarons. Possible extensions of the model to describe the ordering and the dynamical behavior of the molecular polarons are discussed

Mesoscopic non-coherence as phase diffusion

International Nuclear Information System (INIS)

Milman, Perola; Davidovich, Luiz; Castin, Yvan

1997-01-01

In this work, we approach to the question whether it is possible to describe the process of non-coherence in terms of phase diffusion ψ. We will show that this can be done, for an electromagnetic field mode in a cavity interacting with a continuum of modes outside the cavity, for any value of α, where |α> is an eigenstate of the lowering operator for the harmonic oscillator. The description in terms of phase diffusion will occurs however in context of continuous observation of the field exiting the cavity. In this sense, the non-coherence process description as a quantum phase diffusion corresponds to an realization of the evolution described by the master equation, in terms of a stochastic Schroedinger equation. We will demonstrate that the average on many realizations corresponds exactly to the result obtained from the master equation

Post-processing interstitialcy diffusion from molecular dynamics simulations

Energy Technology Data Exchange (ETDEWEB)

Bhardwaj, U., E-mail: haptork@gmail.com [Computational Analysis Division, BARC, Visakhapatnam, Andhra Pradesh, 530012 (India); Bukkuru, S. [Nuclear Physics Dept., Andhra University, Visakhapatnam, 530003 (India); Warrier, M. [Computational Analysis Division, BARC, Visakhapatnam, Andhra Pradesh, 530012 (India)

2016-01-15

An algorithm to rigorously trace the interstitialcy diffusion trajectory in crystals is developed. The algorithm incorporates unsupervised learning and graph optimization which obviate the need to input extra domain specific information depending on crystal or temperature of the simulation. The algorithm is implemented in a flexible framework as a post-processor to molecular dynamics (MD) simulations. We describe in detail the reduction of interstitialcy diffusion into known computational problems of unsupervised clustering and graph optimization. We also discuss the steps, computational efficiency and key components of the algorithm. Using the algorithm, thermal interstitialcy diffusion from low to near-melting point temperatures is studied. We encapsulate the algorithms in a modular framework with functionality to calculate diffusion coefficients, migration energies and other trajectory properties. The study validates the algorithm by establishing the conformity of output parameters with experimental values and provides detailed insights for the interstitialcy diffusion mechanism. The algorithm along with the help of supporting visualizations and analysis gives convincing details and a new approach to quantifying diffusion jumps, jump-lengths, time between jumps and to identify interstitials from lattice atoms. -- Graphical abstract:.

Post-processing interstitialcy diffusion from molecular dynamics simulations

International Nuclear Information System (INIS)

Bhardwaj, U.; Bukkuru, S.; Warrier, M.

2016-01-01

An algorithm to rigorously trace the interstitialcy diffusion trajectory in crystals is developed. The algorithm incorporates unsupervised learning and graph optimization which obviate the need to input extra domain specific information depending on crystal or temperature of the simulation. The algorithm is implemented in a flexible framework as a post-processor to molecular dynamics (MD) simulations. We describe in detail the reduction of interstitialcy diffusion into known computational problems of unsupervised clustering and graph optimization. We also discuss the steps, computational efficiency and key components of the algorithm. Using the algorithm, thermal interstitialcy diffusion from low to near-melting point temperatures is studied. We encapsulate the algorithms in a modular framework with functionality to calculate diffusion coefficients, migration energies and other trajectory properties. The study validates the algorithm by establishing the conformity of output parameters with experimental values and provides detailed insights for the interstitialcy diffusion mechanism. The algorithm along with the help of supporting visualizations and analysis gives convincing details and a new approach to quantifying diffusion jumps, jump-lengths, time between jumps and to identify interstitials from lattice atoms. -- Graphical abstract:

Dense fluid self-diffusion coefficient calculations using perturbation theory and molecular dynamics

Directory of Open Access Journals (Sweden)

COELHO L. A. F.

1999-01-01

Full Text Available A procedure to correlate self-diffusion coefficients in dense fluids by using the perturbation theory (WCA coupled with the smooth-hard-sphere theory is presented and tested against molecular simulations and experimental data. This simple algebraic expression correlates well the self-diffusion coefficients of carbon dioxide, ethane, propane, ethylene, and sulfur hexafluoride. We have also performed canonical ensemble molecular dynamics simulations by using the Hoover-Nosé thermostat and the mean-square displacement formula to compute self-diffusion coefficients for the reference WCA intermolecular potential. The good agreement obtained from both methods, when compared with experimental data, suggests that the smooth-effective-sphere theory is a useful procedure to correlate diffusivity of pure substances.

An axisymmetric non-hydrostatic model for double-diffusive water systems

Science.gov (United States)

Hilgersom, Koen; Zijlema, Marcel; van de Giesen, Nick

2018-02-01

The three-dimensional (3-D) modelling of water systems involving double-diffusive processes is challenging due to the large computation times required to solve the flow and transport of constituents. In 3-D systems that approach axisymmetry around a central location, computation times can be reduced by applying a 2-D axisymmetric model set-up. This article applies the Reynolds-averaged Navier-Stokes equations described in cylindrical coordinates and integrates them to guarantee mass and momentum conservation. The discretized equations are presented in a way that a Cartesian finite-volume model can be easily extended to the developed framework, which is demonstrated by the implementation into a non-hydrostatic free-surface flow model. This model employs temperature- and salinity-dependent densities, molecular diffusivities, and kinematic viscosity. One quantitative case study, based on an analytical solution derived for the radial expansion of a dense water layer, and two qualitative case studies demonstrate a good behaviour of the model for seepage inflows with contrasting salinities and temperatures. Four case studies with respect to double-diffusive processes in a stratified water body demonstrate that turbulent flows are not yet correctly modelled near the interfaces and that an advanced turbulence model is required.

Diffusion equation and non-holonomy

International Nuclear Information System (INIS)

Gomes, Luiz Carlos; Lobo, R.; Simao, F.R.A.

1980-01-01

The diffusion equation for particles in a Riemannian space subject to a single constraint is discussed. The implications of the holonomy and non-holonomy of this single constraint is also discussed. (L.C.) [pt

Molecular dynamics simulation of diffusion bonding of Al–Cu interface

International Nuclear Information System (INIS)

Li, Chang; Li, Dongxu; Tao, Xiaoma; Chen, Hongmei; Ouyang, Yifang

2014-01-01

The effects of temperature on diffusion bonding of Al–Cu interface have been investigated by using molecular dynamics (MD) technique with the embedded atomic method (EAM) potentials. The simulated results indicate that the Cu atoms predominantly diffuse into the Al side in the process of diffusion bonding, and the thickness of the interfacial region depends on temperature, with higher temperatures resulting in larger thickness. In the course of diffusion bonding, the interfacial region became disordered. In addition, the Cu atoms diffuse at low ratios but can deeply diffuse into the interior of Al, and the Al atoms diffuse at high ratios but hardly diffuse into the interior of Cu. The results show that the appropriate temperature range for diffusion bonding of Al–Cu interface is 750–800 K, and the diffusion activation energies of Al and Cu are 0.77 eV and 0.50 eV, respectively. Finally, in this work, three diffusion mechanisms of Cu atoms in Al lattice have been found and the main diffusion mechanism is the nearest neighbor hopping mechanism. (paper)

HIGH-ENERGY COSMIC-RAY DIFFUSION IN MOLECULAR CLOUDS: A NUMERICAL APPROACH

International Nuclear Information System (INIS)

Fatuzzo, M.; Melia, F.; Todd, E.; Adams, F. C.

2010-01-01

The propagation of high-energy cosmic rays (CRs) through giant molecular clouds constitutes a fundamental process in astronomy and astrophysics. The diffusion of CRs through these magnetically turbulent environments is often studied through the use of energy-dependent diffusion coefficients, although these are not always well motivated theoretically. Now, however, it is feasible to perform detailed numerical simulations of the diffusion process computationally. While the general problem depends upon both the field structure and particle energy, the analysis may be greatly simplified by dimensionless analysis. That is, for a specified purely turbulent field, the analysis depends almost exclusively on a single parameter-the ratio of the maximum wavelength of the turbulent field cells to the particle gyration radius. For turbulent magnetic fluctuations superimposed over an underlying uniform magnetic field, particle diffusion depends on a second dimensionless parameter that characterizes the ratio of the turbulent to uniform magnetic field energy densities. We consider both of these possibilities and parametrize our results to provide simple quantitative expressions that suitably characterize the diffusion process within molecular cloud environments. Doing so, we find that the simple scaling laws often invoked by the high-energy astrophysics community to model CR diffusion through such regions appear to be fairly robust for the case of a uniform magnetic field with a strong turbulent component, but are only valid up to ∼50 TeV particle energies for a purely turbulent field. These results have important consequences for the analysis of CR processes based on TeV emission spectra associated with dense molecular clouds.

Translational regulation shapes the molecular landscape of complex disease phenotypes

Czech Academy of Sciences Publication Activity Database

Schafer, S.; Adami, E.; Heinig, M.; Rodrigues, K. E. C.; Kreuchwig, F.; Šilhavý, Jan; van Heesch, S.; Simaite, D.; Rajewsky, N.; Cuppen, E.; Pravenec, Michal; Vingron, M.; Cook, S. A.; Hubner, N.

2015-01-01

Roč. 6, May 2015 (2015), s. 7200 ISSN 2041-1723 R&D Projects: GA ČR(CZ) GB14-36804G; GA MŠk(CZ) LL1204; GA MŠk(CZ) 7E10067 Institutional support: RVO:67985823 Keywords : translational regulation * RNA sequencing * ribosome profiling * rat Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 11.329, year: 2015

Translationally invariant and non-translationally invariant empirical effective interactions

International Nuclear Information System (INIS)

Golin, M.; Zamick, L.

1975-01-01

In this work empirical deficiencies of the core-renormalized realistic effective interactions are examined and simple corrective potentials are sought. The inability of the current realistic interactions to account for the energies of isobaric analog states is noted, likewise they are unable to reproduce the changes in the single-particle energies, as one goes from one closed shell to another. It is noted that the Schiffer interaction gives better results for these gross properties and this is attributed to a combination of several facts. First, to the inclusion of long range terms in the Schiffer potential, then to the presence of relative p-state terms (l=1), in addition to the usual relative s-state terms (l=0). The strange shape of the above interaction is further attributed to the fact that it is translationally invariant whereas the theory of core-polarization yields non-translationally invariant potentials. Consequently, as a correction to the monopole deficiencies of the realistic interactions the term Vsub(mon)=ar 2 (1)r 2 (2)+r 2 (1)+β[r 4 (1)r 2 (2)r 4 (2) ] is proposed. (Auth.)

Molecular exchange of n-hexane in zeolite sieves studied by diffusion-diffusion and T{sub 1}-diffusion nuclear magnetic resonance exchange spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Neudert, Oliver; Stapf, Siegfried; Mattea, Carlos, E-mail: carlos.mattea@tu-ilmenau.de [Fachgebiet Technische Physik II/Polymerphysik, Institute of Physics, Technische Universitaet Ilmenau, PO Box 100 565, 98684 Ilmenau (Germany)

2011-03-15

Molecular exchange properties and diffusion of n-hexane embedded in a bimodal pore structure with characteristic length scales in the order of nano and micrometres, respectively, formed by packing of zeolite particles, are studied. Two-dimensional (2D) nuclear magnetic resonance (NMR) diffusion correlation experiments together with relaxation-diffusion correlation experiments are performed at low magnetic field using a single-sided NMR scanner. The exchange time covers a range from 10{sup -3} to 10{sup -1} s. The molecular exchange properties are modulated by transport inside the zeolite particles. Different exchange regimes are observed for molecules starting from different positions inside the porous sample. The influence of the spin-lattice relaxation properties of the fluid molecules inside the zeolite particles on the signal intensity is also studied. A Monte Carlo simulation of the exchange process is performed and is used to support the analysis of the experimental data.

Preisach hysteresis model for non-linear 2D heat diffusion

International Nuclear Information System (INIS)

Jancskar, Ildiko; Ivanyi, Amalia

2006-01-01

This paper analyzes a non-linear heat diffusion process when the thermal diffusivity behaviour is a hysteretic function of the temperature. Modelling this temperature dependence, the discrete Preisach algorithm as general hysteresis model has been integrated into a non-linear multigrid solver. The hysteretic diffusion shows a heating-cooling asymmetry in character. The presented type of hysteresis speeds up the thermal processes in the modelled systems by a very interesting non-linear way

Maxwell–Stefan diffusion and dynamical correlation in molten LiF-KF: A molecular dynamics study

Energy Technology Data Exchange (ETDEWEB)

Jain, Richa Naja, E-mail: ltprichanaja@gmail.com; Chakraborty, Brahmananda; Ramaniah, Lavanya M. [High Pressure & Synchrotron Radiation Physics Division, Bhabha Atomic Research Centre, Trombay, Mumbai-85 (India)

2016-05-23

In this work our main objective is to compute Dynamical correlations, Onsager coefficients and Maxwell-Stefan (MS) diffusivities for molten salt LiF-KF mixture at various thermodynamic states through Green–Kubo formalism for the first time. The equilibrium molecular dynamics (MD) simulations were performed using BHM potential for LiF–KF mixture. The velocity autocorrelations functions involving Li ions reflect the endurance of cage dynamics or backscattering with temperature. The magnitude of Onsager coefficients for all pairs increases with increase in temperature. Interestingly most of the Onsager coefficients has almost maximum magnitude at the eutectic composition indicating the most dynamic character of the eutectic mixture. MS diffusivity hence diffusion for all ion pairs increases in the system with increasing temperature. Smooth variation of the diffusivity values denies any network formation in the mixture. Also, the striking feature is the noticeable concentration dependence of MS diffusivity between cation-cation pair, Đ{sub Li-K} which remains negative for most of the concentration range but changes sign to become positive for higher LiF concentration. The negative MS diffusivity is acceptable as it satisfies the non-negative entropy constraint governed by 2{sup nd} law of thermodynamics. This high diffusivity also vouches the candidature of molten salt as a coolant.

Extracting the diffusion tensor from molecular dynamics simulation with Milestoning

International Nuclear Information System (INIS)

Mugnai, Mauro L.; Elber, Ron

2015-01-01

We propose an algorithm to extract the diffusion tensor from Molecular Dynamics simulations with Milestoning. A Kramers-Moyal expansion of a discrete master equation, which is the Markovian limit of the Milestoning theory, determines the diffusion tensor. To test the algorithm, we analyze overdamped Langevin trajectories and recover a multidimensional Fokker-Planck equation. The recovery process determines the flux through a mesh and estimates local kinetic parameters. Rate coefficients are converted to the derivatives of the potential of mean force and to coordinate dependent diffusion tensor. We illustrate the computation on simple models and on an atomically detailed system—the diffusion along the backbone torsions of a solvated alanine dipeptide

Non-diffusive transport in 3-D pressure driven plasma turbulence

International Nuclear Information System (INIS)

Del-Castillo-Negrete, D.; Carreras, B.A.; Lynch, V.

2005-01-01

Numerical evidence of non-diffusive transport in 3-dimensional, resistive, pressure-gradient-driven plasma turbulence is presented. It is shown that the probability density function (pdf) of tracers is strongly non-Gaussian and exhibits algebraic decaying tails. To describe these results, a transport model using fractional derivative operators in proposed. The model incorporates in a unified way non-locality (i.e., non-Fickian transport), memory effects (i.e., non-Markovian transport), and non-diffusive scaling features known to be present in fusion plasmas. There is quantitative agreement between the model and the turbulent transport numerical calculations. In particular, the model reproduces the shape and space-time scaling of the pdf, and the super-diffusive scaling of the moments. (author)

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

Optimizing Filter-Probe Diffusion Weighting in the Rat Spinal Cord for Human Translation

Directory of Open Access Journals (Sweden)

Matthew D. Budde

2017-12-01

Full Text Available Diffusion tensor imaging (DTI is a promising biomarker of spinal cord injury (SCI. In the acute aftermath, DTI in SCI animal models consistently demonstrates high sensitivity and prognostic performance, yet translation of DTI to acute human SCI has been limited. In addition to technical challenges, interpretation of the resulting metrics is ambiguous, with contributions in the acute setting from both axonal injury and edema. Novel diffusion MRI acquisition strategies such as double diffusion encoding (DDE have recently enabled detection of features not available with DTI or similar methods. In this work, we perform a systematic optimization of DDE using simulations and an in vivo rat model of SCI and subsequently implement the protocol to the healthy human spinal cord. First, two complementary DDE approaches were evaluated using an orientationally invariant or a filter-probe diffusion encoding approach. While the two methods were similar in their ability to detect acute SCI, the filter-probe DDE approach had greater predictive power for functional outcomes. Next, the filter-probe DDE was compared to an analogous single diffusion encoding (SDE approach, with the results indicating that in the spinal cord, SDE provides similar contrast with improved signal to noise. In the SCI rat model, the filter-probe SDE scheme was coupled with a reduced field of view (rFOV excitation, and the results demonstrate high quality maps of the spinal cord without contamination from edema and cerebrospinal fluid, thereby providing high sensitivity to injury severity. The optimized protocol was demonstrated in the healthy human spinal cord using the commercially-available diffusion MRI sequence with modifications only to the diffusion encoding directions. Maps of axial diffusivity devoid of CSF partial volume effects were obtained in a clinically feasible imaging time with a straightforward analysis and variability comparable to axial diffusivity derived from DTI

Negligible fractionation of Kr and Xe isotopes by molecular diffusion in water

Science.gov (United States)

Tyroller, Lina; Brennwald, Matthias S.; Busemann, Henner; Maden, Colin; Baur, Heinrich; Kipfer, Rolf

2018-06-01

Molecular diffusion is a key transport process for noble gases in water. Such diffusive transport is often thought to cause a mass-dependent fractionation of noble gas isotopes that is inversely proportional to the square root of the ratio of their atomic mass, referred to as the square root relation. Previous studies, challenged the commonly held assumption that the square root relation adequately describes the behaviour of noble gas isotopes diffusing through water. However, the effect of diffusion on noble gas isotopes has only been determined experimentally for He, Ne and Ar to date, whereas the extent of fractionation of Kr and Xe has not been measured. In the present study the fractionation of Kr and Xe isotopes diffusing through water immobilised by adding agar was quantified through measuring the respective isotope ratio after diffusing through the immobilised water. No fractionation of Kr and Xe isotopes was observed, even using high-precision noble gas analytics. These results complement our current understanding on isotopic fractionation of noble gases diffusing through water. Therefore this complete data set builds a robust basis to describe molecular diffusion of noble gases in water in a physical sound manner which is fundamental to assess the physical aspects of gas dynamics in aquatic systems.

Molecular weight dependence of exciton diffusion in poly(3-hexylthiophene)

DEFF Research Database (Denmark)

Masri, Zarifi; Ruseckas, Arvydas; Emelianova, Evguenia V.

2013-01-01

A joint experimental and theoretical study of singlet exciton diffusion in spin-coated poly(3-hexylthiophene) (P3HT) films and its dependence on molecular weight is presented. The results show that exciton diffusion is fast along the co-facial π–π aggregates of polymer chromophores and about 100...... times slower in the lateral direction between aggregates. Exciton hopping between aggregates is found to show a subtle dependence on interchain coupling, aggregate size, and Boltzmann statistics. Additionally, a clear correlation is observed between the effective exciton diffusion coefficient...

Translational research of optical molecular imaging for personalized medicine.

Science.gov (United States)

Qin, C; Ma, X; Tian, J

2013-12-01

In the medical imaging field, molecular imaging is a rapidly developing discipline and forms many imaging modalities, providing us effective tools to visualize, characterize, and measure molecular and cellular mechanisms in complex biological processes of living organisms, which can deepen our understanding of biology and accelerate preclinical research including cancer study and medicine discovery. Among many molecular imaging modalities, although the penetration depth of optical imaging and the approved optical probes used for clinics are limited, it has evolved considerably and has seen spectacular advances in basic biomedical research and new drug development. With the completion of human genome sequencing and the emergence of personalized medicine, the specific drug should be matched to not only the right disease but also to the right person, and optical molecular imaging should serve as a strong adjunct to develop personalized medicine by finding the optimal drug based on an individual's proteome and genome. In this process, the computational methodology and imaging system as well as the biomedical application regarding optical molecular imaging will play a crucial role. This review will focus on recent typical translational studies of optical molecular imaging for personalized medicine followed by a concise introduction. Finally, the current challenges and the future development of optical molecular imaging are given according to the understanding of the authors, and the review is then concluded.

Developing a Macroscopic Mechanistic Model for Low Molecular Weight Diffusion through Polymers in the Rubbery State

DEFF Research Database (Denmark)

Martinez-Lopez, Brais; Huguet, P.; Gontard, N.

2016-01-01

Raman microspectroscopy was used to determine the Fickian diffusivity of two families of low molecular weight molecules through amorphous polystyrene in the rubbery state. Different effects of the temperature on diffusivity for each of the families suggested that molecular mobility is controlled...... by both the volume and flexibility of the diffusing substance when the movement of polymer chains can generate stress induced deformation of molecules. The diffusing molecules were represented as Newtonian spring–bead systems, which allowed us to quantify their flexibility, in function of the vibration...... frequency of their bonds by reconstructing their theoretical spectra. Results showed that the use of molecular descriptors that take into account flexibility rather than the most stable conformation of the diffusing molecules may improve the description of the diffusion behavior caused by variations...

Molecular profiling reveals biologically discrete subsets and pathways of progression in diffuse glioma

Science.gov (United States)

Ceccarelli, Michele; Barthel, Floris P.; Malta, Tathiane M.; Sabedot, Thais S.; Salama, Sofie R.; Murray, Bradley A.; Morozova, Olena; Newton, Yulia; Radenbaugh, Amie; Pagnotta, Stefano M.; Anjum, Samreen; Wang, Jiguang; Manyam, Ganiraju; Zoppoli, Pietro; Ling, Shiyung; Rao, Arjun A.; Grifford, Mia; Cherniack, Andrew D.; Zhang, Hailei; Poisson, Laila; Carlotti, Carlos Gilberto; Pretti da Cunha Tirapelli, Daniela; Rao, Arvind; Mikkelsen, Tom; Lau, Ching C.; Yung, W.K. Alfred; Rabadan, Raul; Huse, Jason; Brat, Daniel J.; Lehman, Norman L.; Barnholtz-Sloan, Jill S.; Zheng, Siyuan; Hess, Kenneth; Rao, Ganesh; Meyerson, Matthew; Beroukhim, Rameen; Cooper, Lee; Akbani, Rehan; Wrensch, Margaret; Haussler, David; Aldape, Kenneth D.; Laird, Peter W.; Gutmann, David H.; Noushmehr, Houtan; Iavarone, Antonio; Verhaak, Roel G.W.

2015-01-01

SUMMARY Therapy development for adult diffuse glioma is hindered by incomplete knowledge of somatic glioma driving alterations and suboptimal disease classification. We defined the complete set of genes associated with 1,122 diffuse grade II-III-IV gliomas from The Cancer Genome Atlas and used molecular profiles to improve disease classification, identify molecular correlations, and provide insights into the progression from low- to high-grade disease. Whole genome sequencing data analysis determined that ATRX but not TERT promoter mutations are associated with increased telomere length. Recent advances in glioma classification based on IDH mutation and 1p/19q co-deletion status were recapitulated through analysis of DNA methylation profiles, which identified clinically relevant molecular subsets. A subtype of IDH-mutant glioma was associated with DNA demethylation and poor outcome; a group of IDH-wildtype diffuse glioma showed molecular similarity to pilocytic astrocytoma and relatively favorable survival. Understanding of cohesive disease groups may aid improved clinical outcomes. PMID:26824661

Perturbation of hydration layer in solvated proteins by external electric and electromagnetic fields: Insights from non-equilibrium molecular dynamics

Science.gov (United States)

Nandi, Prithwish K.; Futera, Zdenek; English, Niall J.

2016-11-01

Given the fundamental role of water in governing the biochemistry of enzymes, and in regulating their wider biological activity (e.g., by local water concentration surrounding biomolecules), the influence of extraneous electric and electromagnetic (e/m) fields thereon is of central relevance to biophysics and, more widely, biology. With the increase in levels of local and atmospheric microwave-frequency radiation present in modern life, as well as other electric-field exposure, the impact upon hydration-water layers surrounding proteins, and biomolecules generally, becomes a particularly pertinent issue. Here, we present a (non-equilibrium) molecular-dynamics-simulation study on a model protein (hen egg-white lysozyme) hydrated in water, in which we determine, inter alia, translational self-diffusivities for both hen egg-white lysozyme and its hydration layer together with relaxation dynamics of the hydrogen-bond network between the protein and its hydration-layer water molecules on a residue-per-residue basis. Crucially, we perform this analysis both above and below the dynamical-transition temperature (at ˜220 K), at 300 and 200 K, respectively, and we compare the effects of external static-electric and e/m fields with linear-response-régime (r.m.s.) intensities of 0.02 V/Å. It was found that the translational self-diffusivity of hen egg-white lysozyme and its hydration-water layer are increased substantially in static fields, primarily due to the induced electrophoretic motion, whilst the water-protein hydrogen-bond-network-rearrangement kinetics can also undergo rather striking accelerations, primarily due to the enhancement of a larger-amplitude local translational and rotational motion by charged and dipolar residues, which serves to promote hydrogen-bond breakage and re-formation kinetics. These external-field effects are particularly evident at 200 K, where they serve to induce the protein- and solvation-layer-response effects redolent of dynamical

Non-contact translation-rotation sensor using combined effects of magnetostriction and piezoelectricity.

Science.gov (United States)

Yang, Bintang; Liu, Qingwei; Zhang, Ting; Cao, Yudong; Feng, Zhiqiang; Meng, Guang

2012-10-15

Precise displacement sensors are an important topic in precision engineering. At present, this type of sensors typically have a single feature of either translation or rotation measurement. They are also inconvenient to integrate with the host devices. In this report we propose a new kind of sensor that enables both translation and rotation measurement by using the combined effect of magnetostriction and piezoelectricity. As a proof of concept, we experimentally realized a prototype of non-contact translation-rotation precise sensor. In the current research stage, through both theoretical and experimental study, the non-contact displacement sensor is shown to be feasible for measuring both translation and rotation either in coarse or fine measurement. Moreover, owing to its compact, rigid structure and fewer components, it can be easily embedded in host equipment.

Non-Contact Translation-Rotation Sensor Using Combined Effects of Magnetostriction and Piezoelectricity

Directory of Open Access Journals (Sweden)

Guang Meng

2012-10-01

Full Text Available Precise displacement sensors are an important topic in precision engineering. At present, this type of sensors typically have a single feature of either translation or rotation measurement. They are also inconvenient to integrate with the host devices. In this report we propose a new kind of sensor that enables both translation and rotation measurement by using the combined effect of magnetostriction and piezoelectricity. As a proof of concept, we experimentally realized a prototype of non-contact translation-rotation precise sensor. In the current research stage, through both theoretical and experimental study, the non-contact displacement sensor is shown to be feasible for measuring both translation and rotation either in coarse or fine measurement. Moreover, owing to its compact, rigid structure and fewer components, it can be easily embedded in host equipment.

Pattern formation due to non-linear vortex diffusion

Science.gov (United States)

Wijngaarden, Rinke J.; Surdeanu, R.; Huijbregtse, J. M.; Rector, J. H.; Dam, B.; Einfeld, J.; Wördenweber, R.; Griessen, R.

Penetration of magnetic flux in YBa 2Cu 3O 7 superconducting thin films in an external magnetic field is visualized using a magneto-optic technique. A variety of flux patterns due to non-linear vortex diffusion is observed: (1) Roughening of the flux front with scaling exponents identical to those observed in burning paper including two distinct regimes where respectively spatial disorder and temporal disorder dominate. In the latter regime Kardar-Parisi-Zhang behavior is found. (2) Fractal penetration of flux with Hausdorff dimension depending on the critical current anisotropy. (3) Penetration as ‘flux-rivers’. (4) The occurrence of commensurate and incommensurate channels in films with anti-dots as predicted in numerical simulations by Reichhardt, Olson and Nori. It is shown that most of the observed behavior is related to the non-linear diffusion of vortices by comparison with simulations of the non-linear diffusion equation appropriate for vortices.

Complete motif analysis of sequence requirements for translation initiation at non-AUG start codons.

Science.gov (United States)

Diaz de Arce, Alexander J; Noderer, William L; Wang, Clifford L

2018-01-25

The initiation of mRNA translation from start codons other than AUG was previously believed to be rare and of relatively low impact. More recently, evidence has suggested that as much as half of all translation initiation utilizes non-AUG start codons, codons that deviate from AUG by a single base. Furthermore, non-AUG start codons have been shown to be involved in regulation of expression and disease etiology. Yet the ability to gauge expression based on the sequence of a translation initiation site (start codon and its flanking bases) has been limited. Here we have performed a comprehensive analysis of translation initiation sites that utilize non-AUG start codons. By combining genetic-reporter, cell-sorting, and high-throughput sequencing technologies, we have analyzed the expression associated with all possible variants of the -4 to +4 positions of non-AUG translation initiation site motifs. This complete motif analysis revealed that 1) with the right sequence context, certain non-AUG start codons can generate expression comparable to that of AUG start codons, 2) sequence context affects each non-AUG start codon differently, and 3) initiation at non-AUG start codons is highly sensitive to changes in the flanking sequences. Complete motif analysis has the potential to be a key tool for experimental and diagnostic genomics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Hydrogen rotational and translational diffusion in calcium borohydride from quasielastic neutron scattering and DFT

DEFF Research Database (Denmark)

Blanchard, Didier; Riktor, M.D.; Maronsson, Jon Bergmann

2010-01-01

Hydrogen dynamics in crystalline calcium borohydride can be initiated by long-range diffusion or localized motion such as rotations, librations, and vibrations. Herein, the rotational and translational diffusion were studied by quasielastic neutron scattering (QENS) by using two instruments...... with different time scales in combination with density functional theory (DFT) calculations. Two thermally activated reorientational motions were observed, around the 2-fold (C2) and 3-fold (C3) axes of the BH4− units, at temperature from 95 to 280K. The experimental energy barriers (EaC2 = 0.14 eV and EaC3 = 0...... of the interstitial H2 might come from the synthesis of the compound or a side reaction with trapped synthesis residue leading to the partial oxidation of the compound and hydrogen release....

Patterns of diagnostic marker assessment in adult diffuse glioma

DEFF Research Database (Denmark)

Woehrer, Adelheid; Kristensen, Bjarne W.; Vital, Anne

2017-01-01

The 2016 update of the WHO classification has introduced an integrated diagnostic approach that incorporates both tumor morphology and molecular information. This conceptual change has far-reaching implications, especially for neuropathologists who are in the forefront of translating molecular...... markers to routine diagnostic use. Adult diffuse glioma is a prototypic example for a group of tumors that underwent substantial regrouping, and it represents a major workload for surgical neuropathologists. Hence, we conducted a survey among members of the European Confederation of Neuropathological...

Non-AUG translation: a new start for protein synthesis in eukaryotes.

Science.gov (United States)

Kearse, Michael G; Wilusz, Jeremy E

2017-09-01

Although it was long thought that eukaryotic translation almost always initiates at an AUG start codon, recent advancements in ribosome footprint mapping have revealed that non-AUG start codons are used at an astonishing frequency. These non-AUG initiation events are not simply errors but instead are used to generate or regulate proteins with key cellular functions; for example, during development or stress. Misregulation of non-AUG initiation events contributes to multiple human diseases, including cancer and neurodegeneration, and modulation of non-AUG usage may represent a novel therapeutic strategy. It is thus becoming increasingly clear that start codon selection is regulated by many trans -acting initiation factors as well as sequence/structural elements within messenger RNAs and that non-AUG translation has a profound impact on cellular states. © 2017 Kearse and Wilusz; Published by Cold Spring Harbor Laboratory Press.

Speciation of copper diffused in a bi-porous molecular sieve

International Nuclear Information System (INIS)

Huang, C.-H.; Paul Wang, H.; Wei, Y.-L.; Chang, J.-E.

2010-01-01

To better understand diffusion of copper in the micro- and mesopores, speciation of copper in a bi-porous molecular sieve (BPMS) possessing inter-connecting 3-D micropores (0.50-0.55 nm) and 2-D mesopores (4.1 nm) has been studied by X-ray absorption near edge structure (XANES) spectroscopy. It is found that about 77% (16% of CuO nanoparticles and 61% of CuO clusters) and 23% (CuO ads ) of copper can be diffused into the meso- and micropores, respectively, in the BPMS. At least two diffusion steps in the BPMS may be involved: (i) free diffusion of copper in the mesopores and (ii) diffusion-controlled copper migrating into the micropores of the BPMS. The XANES data also indicate that diffusion rate of copper in the BPMS (4.68x10 -5 g/s) is greater than that in the ZSM-5 (1.11x10 -6 g/s) or MCM-41 (1.17x10 -5 g/s).

Speciation of copper diffused in a bi-porous molecular sieve

Science.gov (United States)

Huang, C.-H.; Paul Wang, H.; Wei, Y.-L.; Chang, J.-E.

2010-07-01

To better understand diffusion of copper in the micro- and mesopores, speciation of copper in a bi-porous molecular sieve (BPMS) possessing inter-connecting 3-D micropores (0.50-0.55 nm) and 2-D mesopores (4.1 nm) has been studied by X-ray absorption near edge structure (XANES) spectroscopy. It is found that about 77% (16% of CuO nanoparticles and 61% of CuO clusters) and 23% (CuO ads) of copper can be diffused into the meso- and micropores, respectively, in the BPMS. At least two diffusion steps in the BPMS may be involved: (i) free diffusion of copper in the mesopores and (ii) diffusion-controlled copper migrating into the micropores of the BPMS. The XANES data also indicate that diffusion rate of copper in the BPMS (4.68×10 -5 g/s) is greater than that in the ZSM-5 (1.11×10 -6 g/s) or MCM-41 (1.17×10 -5 g/s).

A model for self-diffusion of guanidinium-based ionic liquids: a molecular simulation study.

Science.gov (United States)

Klähn, Marco; Seduraman, Abirami; Wu, Ping

2008-11-06

We propose a novel self-diffusion model for ionic liquids on an atomic level of detail. The model is derived from molecular dynamics simulations of guanidinium-based ionic liquids (GILs) as a model case. The simulations are based on an empirical molecular mechanical force field, which has been developed in our preceding work, and it relies on the charge distribution in the actual liquid. The simulated GILs consist of acyclic and cyclic cations that were paired with nitrate and perchlorate anions. Self-diffusion coefficients are calculated at different temperatures from which diffusive activation energies between 32-40 kJ/mol are derived. Vaporization enthalpies between 174-212 kJ/mol are calculated, and their strong connection with diffusive activation energies is demonstrated. An observed formation of cavities in GILs of up to 6.5% of the total volume does not facilitate self-diffusion. Instead, the diffusion of ions is found to be determined primarily by interactions with their immediate environment via electrostatic attraction between cation hydrogen and anion oxygen atoms. The calculated average time between single diffusive transitions varies between 58-107 ps and determines the speed of diffusion, in contrast to diffusive displacement distances, which were found to be similar in all simulated GILs. All simulations indicate that ions diffuse by using a brachiation type of movement: a diffusive transition is initiated by cleaving close contacts to a coordinated counterion, after which the ion diffuses only about 2 A until new close contacts are formed with another counterion in its vicinity. The proposed diffusion model links all calculated energetic and dynamic properties of GILs consistently and explains their molecular origin. The validity of the model is confirmed by providing an explanation for the variation of measured ratios of self-diffusion coefficients of cations and paired anions over a wide range of values, encompassing various ionic liquid classes

Lattice Boltzmann method for multi-component, non-continuum mass diffusion

International Nuclear Information System (INIS)

Joshi, Abhijit S; Peracchio, Aldo A; Grew, Kyle N; Chiu, Wilson K S

2007-01-01

Recently, there has been a great deal of interest in extending the lattice Boltzmann method (LBM) to model transport phenomena in the non-continuum regime. Most of these studies have focused on single-component flows through simple geometries. This work examines an ad hoc extension of a recently developed LBM model for multi-component mass diffusion (Joshi et al 2007 J. Phys. D: Appl. Phys. 40 2961) to model mass diffusion in the non-continuum regime. In order to validate the method, LBM results for ternary diffusion in a two-dimensional channel are compared with predictions of the dusty gas model (DGM) over a range of Knudsen numbers. A calibration factor based on the DGM is used in the LBM to correlate Knudsen diffusivity to pore size. Results indicate that the LBM can be a useful tool for predicting non-continuum mass diffusion (Kn > 0.001), but additional research is needed to extend the range of applicability of the algorithm for a larger parameter space. Guidelines are given on using the methodology described in this work to model non-continuum mass transport in more complex geometries where the DGM is not easily applicable. In addition, the non-continuum LBM methodology can be extended to three-dimensions. An envisioned application of this technique is to model non-continuum mass transport in porous solid oxide fuel cell electrodes

Determination of molecular diffusion coefficient in n-alkane binary mixtures: empirical correlations.

Science.gov (United States)

De Mezquia, D Alonso; Bou-Ali, M Mounir; Larrañaga, M; Madariaga, J A; Santamaría, C

2012-03-08

In this work we have measured the molecular diffusion coefficient of the n-alkane binary series nC(i)-nC(6), nC(i)-nC(10), and nC(i)-nC(12) at 298 K and 1 atm and a mass fraction of 0.5 by using the so-called sliding symmetric tubes technique. The results show that the diffusion coefficient at this concentration is proportional to the inverse viscosity of the mixture. In addition, we have also measured the diffusion coefficient of the systems nC(12)-nC(6), nC(12)-nC(7), and nC(12)-nC(8) as a function of concentration. From the data obtained, it is shown that the diffusion coefficient of the n-alkane binary mixtures at any concentration can be calculated from the molecular weight of the components and the dynamic viscosity of the corresponding mixture at 50% mass fraction.

Molecular dynamics simulation of three plastic additives' diffusion in polyethylene terephthalate.

Science.gov (United States)

Li, Bo; Wang, Zhi-Wei; Lin, Qin-Bao; Hu, Chang-Ying

2017-06-01

Accurate diffusion coefficient data of additives in a polymer are of paramount importance for estimating the migration of the additives over time. This paper shows how this diffusion coefficient can be estimated for three plastic additives [2-(2'-hydroxy-5'-methylphenyl) (UV-P), 2,6-di-tert-butyl-4-methylphenol (BHT) and di-(2-ethylhexyl) phthalate (DEHP)] in polyethylene terephthalate (PET) using the molecular dynamics (MD) simulation method. MD simulations were performed at temperatures of 293-433 K. The diffusion coefficient was calculated through the Einstein relationship connecting the data of mean-square displacement at different times. Comparison of the diffusion coefficients simulated by the MD simulation technique, predicted by the Piringer model and experiments, showed that, except for a few samples, the MD-simulated values were in agreement with the experimental values within one order of magnitude. Furthermore, the diffusion process for additives is discussed in detail, and four factors - the interaction energy between additive molecules and PET, fractional free volume, molecular shape and size, and self-diffusion of the polymer - are proposed to illustrate the microscopic diffusion mechanism. The movement trajectories of additives in PET cell models suggested that the additive molecules oscillate slowly rather than hopping for a long time. Occasionally, when a sufficiently large hole was created adjacently, the molecule could undergo spatial motion by jumping into the free-volume hole and consequently start a continuous oscillation and hop. The results indicate that MD simulation is a useful approach for predicting the microstructure and diffusion coefficient of plastic additives, and help to estimate the migration level of additives from PET packaging.

Calculation of the mutual diffusion coefficient by equilibrium and nonequilibrium molecular dynamics

International Nuclear Information System (INIS)

Erpenbeck, J.J.; Kincaid, J.M.

1986-01-01

A nonequilibrium molecular dynamics method for the calculation of the mutual diffusion coefficient for a mixture of hard spheres is described. The method is applied to a 50-50 mixture of equidiameter particles having a mass ratio of 0.1 for the two species, at a volume of three times close-packing. By extrapolating the results to the limit of vanishing concentration gradient and infinite system size, we obtain a value in statistical agreement with the result obtained using a Green-Kubo molecular dynamics procedure, which is also described. The nonequilibrium calculation yields a mutual diffusion coefficient which decreases slightly with increasing concentration gradient. The Green-Kubo timecorrelation function for mutual diffusion displays a slow decay with time, qualitatively similar to the long-time tail which has been predicted by the hydrodynamic theory of Pomeau

Single-molecule diffusion and conformational dynamics by spatial integration of temporal fluctuations

KAUST Repository

Serag, Maged F.

2014-10-06

Single-molecule localization and tracking has been used to translate spatiotemporal information of individual molecules to map their diffusion behaviours. However, accurate analysis of diffusion behaviours and including other parameters, such as the conformation and size of molecules, remain as limitations to the method. Here, we report a method that addresses the limitations of existing single-molecular localization methods. The method is based on temporal tracking of the cumulative area occupied by molecules. These temporal fluctuations are tied to molecular size, rates of diffusion and conformational changes. By analysing fluorescent nanospheres and double-stranded DNA molecules of different lengths and topological forms, we demonstrate that our cumulative-area method surpasses the conventional single-molecule localization method in terms of the accuracy of determined diffusion coefficients. Furthermore, the cumulative-area method provides conformational relaxation times of structurally flexible chains along with diffusion coefficients, which together are relevant to work in a wide spectrum of scientific fields.

Single-molecule diffusion and conformational dynamics by spatial integration of temporal fluctuations

KAUST Repository

Serag, Maged F.; Abadi, Maram; Habuchi, Satoshi

2014-01-01

Single-molecule localization and tracking has been used to translate spatiotemporal information of individual molecules to map their diffusion behaviours. However, accurate analysis of diffusion behaviours and including other parameters, such as the conformation and size of molecules, remain as limitations to the method. Here, we report a method that addresses the limitations of existing single-molecular localization methods. The method is based on temporal tracking of the cumulative area occupied by molecules. These temporal fluctuations are tied to molecular size, rates of diffusion and conformational changes. By analysing fluorescent nanospheres and double-stranded DNA molecules of different lengths and topological forms, we demonstrate that our cumulative-area method surpasses the conventional single-molecule localization method in terms of the accuracy of determined diffusion coefficients. Furthermore, the cumulative-area method provides conformational relaxation times of structurally flexible chains along with diffusion coefficients, which together are relevant to work in a wide spectrum of scientific fields.

Analysis of fractional non-linear diffusion behaviors based on Adomian polynomials

Directory of Open Access Journals (Sweden)

Wu Guo-Cheng

2017-01-01

Full Text Available A time-fractional non-linear diffusion equation of two orders is considered to investigate strong non-linearity through porous media. An equivalent integral equation is established and Adomian polynomials are adopted to linearize non-linear terms. With the Taylor expansion of fractional order, recurrence formulae are proposed and novel numerical solutions are obtained to depict the diffusion behaviors more accurately. The result shows that the method is suitable for numerical simulation of the fractional diffusion equations of multi-orders.

Penetration of Cosmic Rays into Dense Molecular Clouds: Role of Diffuse Envelopes

Science.gov (United States)

Ivlev, A. V.; Dogiel, V. A.; Chernyshov, D. O.; Caselli, P.; Ko, C.-M.; Cheng, K. S.

2018-03-01

A flux of cosmic rays (CRs) propagating through a diffuse ionized gas can excite MHD waves, thus generating magnetic disturbances. We propose a generic model of CR penetration into molecular clouds through their diffuse envelopes, and identify the leading physical processes controlling their transport on the way from a highly ionized interstellar medium to the dense interior of the cloud. The model allows us to describe a transition between a free streaming of CRs and their diffusive propagation, determined by the scattering on the self-generated disturbances. A self-consistent set of equations, governing the diffusive transport regime in an envelope and the MHD turbulence generated by the modulated CR flux, is characterized by two dimensionless numbers. We demonstrate a remarkable mutual complementarity of different mechanisms leading to the onset of the diffusive regime, which results in a universal energy spectrum of the modulated CRs. In conclusion, we briefly discuss implications of our results for several fundamental astrophysical problems, such as the spatial distribution of CRs in the Galaxy as well as the ionization, heating, and chemistry in dense molecular clouds. This paper is dedicated to the memory of Prof. Vadim Tsytovich.

A comparison of molecular dynamics and diffuse interface model predictions of Lennard-Jones fluid evaporation

Energy Technology Data Exchange (ETDEWEB)

Barbante, Paolo [Dipartimento di Matematica, Politecnico di Milano - Piazza Leonardo da Vinci 32 - 20133 Milano (Italy); Frezzotti, Aldo; Gibelli, Livio [Dipartimento di Scienze e Tecnologie Aerospaziali, Politecnico di Milano - Via La Masa 34 - 20156 Milano (Italy)

2014-12-09

The unsteady evaporation of a thin planar liquid film is studied by molecular dynamics simulations of Lennard-Jones fluid. The obtained results are compared with the predictions of a diffuse interface model in which capillary Korteweg contributions are added to hydrodynamic equations, in order to obtain a unified description of the liquid bulk, liquid-vapor interface and vapor region. Particular care has been taken in constructing a diffuse interface model matching the thermodynamic and transport properties of the Lennard-Jones fluid. The comparison of diffuse interface model and molecular dynamics results shows that, although good agreement is obtained in equilibrium conditions, remarkable deviations of diffuse interface model predictions from the reference molecular dynamics results are observed in the simulation of liquid film evaporation. It is also observed that molecular dynamics results are in good agreement with preliminary results obtained from a composite model which describes the liquid film by a standard hydrodynamic model and the vapor by the Boltzmann equation. The two mathematical model models are connected by kinetic boundary conditions assuming unit evaporation coefficient.

Effect of Grain Size on Differential Desorption of Volatile Species and on Non-ideal MHD Diffusivity

Science.gov (United States)

Zhao, Bo; Caselli, Paola; Li, Zhi-Yun

2018-05-01

We developed a chemical network for modeling the chemistry and non-ideal MHD effects from the collapsing dense molecular clouds to protostellar disks. First, we re-formulated the cosmic-ray desorption rate by considering the variations of desorption rate over the grain size distribution. We find that the differential desorption of volatile species is amplified by the grains larger than 0.1 μm, because larger grains are heated to a lower temperature by cosmic-rays and hence more sensitive to the variations in binding energies. As a result, atomic nitrogen N is ˜2 orders of magnitude more abundant than CO; N2H+ also becomes a few times more abundant than HCO+ due to the increased gas-phase N2. However, the changes in ionization fraction due to freeze-out and desorption only have minor effects on the non-ideal MHD diffusivities. Our chemical network confirms that the very small grains (VSGs: below a few 100 Å) weakens the efficiency of both ambipolar diffusion and Hall effect. In collapsing dense cores, a maximum ambipolar diffusion is achieved when truncating the MRN size distribution at 0.1 μm, and for a maximum Hall effect, the truncation occurs at 0.04 μm. We conclude that the grain size distribution is crucial to the differential depletion between CO and N2 related molecules, as well as to the non-ideal MHD diffusivities in dense cores.

Image denoising using non linear diffusion tensors

International Nuclear Information System (INIS)

Benzarti, F.; Amiri, H.

2011-01-01

Image denoising is an important pre-processing step for many image analysis and computer vision system. It refers to the task of recovering a good estimate of the true image from a degraded observation without altering and changing useful structure in the image such as discontinuities and edges. In this paper, we propose a new approach for image denoising based on the combination of two non linear diffusion tensors. One allows diffusion along the orientation of greatest coherences, while the other allows diffusion along orthogonal directions. The idea is to track perfectly the local geometry of the degraded image and applying anisotropic diffusion mainly along the preferred structure direction. To illustrate the effective performance of our model, we present some experimental results on a test and real photographic color images.

Calculation of the mutual diffusion coefficient by equilibrium and nonequilibrium molecular dynamics

International Nuclear Information System (INIS)

Erpenbeck, J.J.; Kincaid, J.M.

1985-01-01

A nonequilibrium molecular dynamics method for the calculation of the mutual diffusion coefficient for a mixture of hard spheres is described. The method is applied to a 50-50 mixture of equidiameter particles having a mass ratio of 0.1 for the two species, at a volume of three times close-packing. By extrapolating the results to the limit of vanishing concentration gradient and infinite system size, we obtain a value in statistical agreement with the result obtained using a Green-Kubo molecular dynamics procedure which is also described. The nonequilibrium calculation yields a mutual diffusion coefficient which decreases slightly with increasing concentration gradient. The Green-Kubo time correlation function for mutual diffusion displays a slow decay with time, qualitatively similar to the long-time tail which has been predicted by the hydrodynamic theory of Pomeau

An evaluation of a translator for finite element data to resistor/capacitor data for the heat diffusion equation

International Nuclear Information System (INIS)

Manteufel, R.D.; Klein, D.E.; Yoshimura, H.R.

1988-01-01

This paper evaluates a translator for finite element data to resistor/capacitor data (FEM/RC) for the numerical solution of heat diffusion problems. The translator involves the derivation of thermal resistors and capacitors, implicit in the heat balance formulation of the finite difference method. It uses a finite element mesh, which consists of nodes and elements and is implicit in the Galerkin finite element method (GFEM). This hybrid translation method, FEM/RC, has been incorporated in Q/TRAN, a new thermal analysis computer code. This evaluation compares Q/TRAN, HEATING-6, and a research code employing GFEM on a purely mathematical, highly nonlinear steady-state conduction benchmark problem. The evaluation concludes that the FEM/RC technique has numerical characteristics that are consistent with comparable schemes for the benchmark problem. FEM/RC also accurately translates skewed meshes. Because FEM/RC generates resistors and capacitors, it appears to offer a more efficient method than the classical GFEM

Connecting the molecular scale to the continuum scale for diffusion processes in smectite-rich porous media.

Science.gov (United States)

Bourg, Ian C; Sposito, Garrison

2010-03-15

In this paper, we address the manner in which the continuum-scale diffusive properties of smectite-rich porous media arise from their molecular- and pore-scale features. Our starting point is a successful model of the continuum-scale apparent diffusion coefficient for water tracers and cations, which decomposes it as a sum of pore-scale terms describing diffusion in macropore and interlayer "compartments." We then apply molecular dynamics (MD) simulations to determine molecular-scale diffusion coefficients D(interlayer) of water tracers and representative cations (Na(+), Cs(+), Sr(2+)) in Na-smectite interlayers. We find that a remarkably simple expression relates D(interlayer) to the pore-scale parameter δ(nanopore) ≤ 1, a constrictivity factor that accounts for the lower mobility in interlayers as compared to macropores: δ(nanopore) = D(interlayer)/D(0), where D(0) is the diffusion coefficient in bulk liquid water. Using this scaling expression, we can accurately predict the apparent diffusion coefficients of tracers H(2)0, Na(+), Sr(2+), and Cs(+) in compacted Na-smectite-rich materials.

Markov Jump Processes Approximating a Non-Symmetric Generalized Diffusion

International Nuclear Information System (INIS)

Limić, Nedžad

2011-01-01

Consider a non-symmetric generalized diffusion X(⋅) in ℝ d determined by the differential operator A(x) = -Σ ij ∂ i a ij (x)∂ j + Σ i b i (x)∂ i . In this paper the diffusion process is approximated by Markov jump processes X n (⋅), in homogeneous and isotropic grids G n ⊂ℝ d , which converge in distribution in the Skorokhod space D([0,∞),ℝ d ) to the diffusion X(⋅). The generators of X n (⋅) are constructed explicitly. Due to the homogeneity and isotropy of grids, the proposed method for d≥3 can be applied to processes for which the diffusion tensor {a ij (x)} 11 dd fulfills an additional condition. The proposed construction offers a simple method for simulation of sample paths of non-symmetric generalized diffusion. Simulations are carried out in terms of jump processes X n (⋅). For piece-wise constant functions a ij on ℝ d and piece-wise continuous functions a ij on ℝ 2 the construction and principal algorithm are described enabling an easy implementation into a computer code.

The arbitrary order mimetic finite difference method for a diffusion equation with a non-symmetric diffusion tensor

Science.gov (United States)

Gyrya, V.; Lipnikov, K.

2017-11-01

We present the arbitrary order mimetic finite difference (MFD) discretization for the diffusion equation with non-symmetric tensorial diffusion coefficient in a mixed formulation on general polygonal meshes. The diffusion tensor is assumed to be positive definite. The asymmetry of the diffusion tensor requires changes to the standard MFD construction. We present new approach for the construction that guarantees positive definiteness of the non-symmetric mass matrix in the space of discrete velocities. The numerically observed convergence rate for the scalar quantity matches the predicted one in the case of the lowest order mimetic scheme. For higher orders schemes, we observed super-convergence by one order for the scalar variable which is consistent with the previously published result for a symmetric diffusion tensor. The new scheme was also tested on a time-dependent problem modeling the Hall effect in the resistive magnetohydrodynamics.

Diffuse Gliomas for Nonneuropathologists: The New Integrated Molecular Diagnostics.

Science.gov (United States)

Lee, Sunhee C

2018-05-18

Diffuse gliomas comprise the bulk of "brain cancer" in adults. The recent update to the 4th edition of the World Health Organization's classification of tumors of the central nervous system reflects an unprecedented change in the landscape of the diagnosis and management of diffuse gliomas that will affect all those involved in the management and care of patients. Of the recently discovered gene alterations, mutations in the Krebs cycle enzymes isocitrate dehydrogenases (IDHs) 1 and 2 have fundamentally changed the way the gliomas are understood and classified. Incorporating information on a few genetic parameters (IDH, ATRX and/or p53, and chromosome 1p19q codeletion), a relatively straightforward diagnostic algorithm has been generated with robust and reproducible results that correlate with patients' survival far better than relying on conventional histology alone. Evidence also supports the conclusion that the vast majority of diffuse gliomas without IDH mutations (IDH-wild-type astrocytomas) behave like IDH-wild-type glioblastomas ("molecular GBM"). Together, these changes reflect a big shift in the practice of diagnostic neuropathology in which tumor risk stratification aligns better with molecular information than histology/grading. The purpose of this review is to provide the readers with a brief synopsis of the changes in the 2016 World Health Organization update with an emphasis on diffuse gliomas and to summarize key gene abnormalities on which these classifications are based. Practical points involved in day-to-day diagnostic workup are also discussed, along with a comparison of the various diagnostic tests, including immunohistochemistry, with an emphasis on targeted next-generation sequencing panel technology as a future universal approach.

On the coupling between molecular diffusion and solvation shell exchange

DEFF Research Database (Denmark)

Møller, Klaus Braagaard; Rey, Rossend; Masia, Marco

2005-01-01

The connection between diffusion and solvent exchanges between first and second solvation shells is studied by means of molecular dynamics simulations and analytic calculations, with detailed illustrations for water exchange for the Li+ and Na+ ions, and for liquid argon. First, two methods...

Diverging effects of isotopic fractionation upon molecular diffusion of noble gases in water: mechanistic insights through ab initio molecular dynamics simulations.

Science.gov (United States)

Pinto de Magalhães, Halua; Brennwald, Matthias S; Kipfer, Rolf

2017-03-22

Atmospheric noble gases are routinely used as natural tracers to analyze gas transfer processes in aquatic systems. Their isotopic ratios can be employed to discriminate between different physical transport mechanisms by comparison to the unfractionated atmospheric isotope composition. In many applications of aquatic systems molecular diffusion was thought to cause a mass dependent fractionation of noble gases and their isotopes according to the square root ratio of their masses. However, recent experiments focusing on isotopic fractionation within a single element challenged this broadly accepted assumption. The determined fractionation factors of Ne, Ar, Kr and Xe isotopes revealed that only Ar follows the prediction of the so-called square root relation, whereas within the Ne, Kr and Xe elements no mass-dependence was found. The reason for this unexpected divergence of Ar is not yet understood. The aim of our computational exercise is to establish the molecular-resolved mechanisms behind molecular diffusion of noble gases in water. We make the hypothesis that weak intermolecular interactions are relevant for the dynamical properties of noble gases dissolved in water. Therefore, we used ab initio molecular dynamics to explicitly account for the electronic degrees of freedom. Depending on the size and polarizability of the hydrophobic particles such as noble gases, their motion in dense and polar liquids like water is subject to different diffusive regimes: the inter-cavity hopping mechanism of small particles (He, Ne) breaks down if a critical particle size achieved. For the case of large particles (Kr, Xe), the motion through the water solvent is governed by mass-independent viscous friction leading to hydrodynamical diffusion. Finally, Ar falls in between the two diffusive regimes, where particle dispersion is propagated at the molecular collision time scale of the surrounding water molecules.

Excitation and charge transfer in He+ + H collisions. A molecular approach including two-electron translation factors

International Nuclear Information System (INIS)

Errea, L.F.; Mendez, L.; Riera, A.

1983-01-01

In a previous paper we have pointed out that the common-translation-factor (CTF) method is the only one which, at present, and within the framework of the molecular model of atomic collisions, can be shown to be both convergent and computationally fast, even for many-electron systems. In this Communication we check that this second statement is correct, presenting, for the first time, a molecular calculation involving two-electron translation factors, for He + + H collisions. A careful study of the sensitivity of the calculated cross sections to the choice of the CTF is performed, and conclusions on that sensitivity are drawn, for several types of processes

Numerical Solutions for Convection-Diffusion Equation through Non-Polynomial Spline

Directory of Open Access Journals (Sweden)

Ravi Kanth A.S.V.

2016-01-01

Full Text Available In this paper, numerical solutions for convection-diffusion equation via non-polynomial splines are studied. We purpose an implicit method based on non-polynomial spline functions for solving the convection-diffusion equation. The method is proven to be unconditionally stable by using Von Neumann technique. Numerical results are illustrated to demonstrate the efficiency and stability of the purposed method.

Enhancing Rotational Diffusion Using Oscillatory Shear

KAUST Repository

Leahy, Brian D.

2013-05-29

Taylor dispersion - shear-induced enhancement of translational diffusion - is an important phenomenon with applications ranging from pharmacology to geology. Through experiments and simulations, we show that rotational diffusion is also enhanced for anisotropic particles in oscillatory shear. This enhancement arises from variations in the particle\\'s rotation (Jeffery orbit) and depends on the strain amplitude, rate, and particle aspect ratio in a manner that is distinct from the translational diffusion. This separate tunability of translational and rotational diffusion opens the door to new techniques for controlling positions and orientations of suspended anisotropic colloids. © 2013 American Physical Society.

Bulk-mediated surface diffusion: non-Markovian desorption dynamics

International Nuclear Information System (INIS)

Revelli, Jorge A; Budde, Carlos E; Prato, Domingo; Wio, Horacio S

2005-01-01

Here we analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework, when the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption as well as its motion in the bulk is governed by Markovian dynamics. We study the diffusion of particles in both semi-infinite and finite cubic lattices, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The results are compared with known Markovian cases showing the differences that can be exploited to distinguish between Markovian and non-Markovian desorption mechanisms in experimental situations

Molecular Structure and Dynamics of Water on Pristine and Strained Phosphorene: Wetting and Diffusion at Nanoscale.

Science.gov (United States)

Zhang, Wei; Ye, Chao; Hong, Linbi; Yang, Zaixing; Zhou, Ruhong

2016-12-06

Phosphorene, a newly fabricated two-dimensional (2D) nanomaterial, has emerged as a promising material for biomedical applications with great potential. Nonetheless, understanding the wetting and diffusive properties of bio-fluids on phosphorene which are of fundamental importance to these applications remains elusive. In this work, using molecular dynamics (MD) simulations, we investigated the structural and dynamic properties of water on both pristine and strained phosphorene. Our simulations indicate that the diffusion of water molecules on the phosphorene surface is anisotropic, with strain-enhanced diffusion clearly present, which arises from strain-induced smoothing of the energy landscape. The contact angle of water droplet on phosphorene exhibits a non-monotonic variation with the transverse strain. The structure of water on transverse stretched phosphorene is demonstrated to be different from that on longitudinal stretched phosphorene. Moreover, the contact angle of water on strained phosphorene is proportional to the quotient of the longitudinal and transverse diffusion coefficients of the interfacial water. These findings thereby offer helpful insights into the mechanism of the wetting and transport of water at nanoscale, and provide a better foundation for future biomedical applications of phosphorene.

Self-diffusion in monodisperse three-dimensional magnetic fluids by molecular dynamics simulations

Energy Technology Data Exchange (ETDEWEB)

Dobroserdova, A.B. [Ural Federal University, Lenin Av. 51, Ekaterinburg (Russian Federation); Kantorovich, S.S., E-mail: alla.dobroserdova@urfu.ru [Ural Federal University, Lenin Av. 51, Ekaterinburg (Russian Federation); University of Vienna, Sensengasse 8, Vienna (Austria)

2017-06-01

In the present work we study the self-diffusion behaviour in the three-dimensional monodisperse magnetic fluids using the Molecular Dynamics Simulation and Density Functional Theory. The peculiarity of computer simulation is to study two different systems: dipolar and soft sphere ones. In the theoretical method, it is important to choose the approximation for the main structures, which are chains. We compare the theoretical results and the computer simulation data for the self-diffusion coefficient as a function of the particle volume fraction and magnetic dipole-dipole interaction parameter and find the qualitative and quantitative agreement to be good. - Highlights: • The paper deals with the study of the self-diffusion in monodisperse three-dimensional magnetic fluids. • The theoretical approach contains the free energy density functional minimization. • Computer simulations are performed by the molecular dynamics method. • We have a good qualitative and quantitative agreement between the theoretical results and computer simulation data.

Meredys, a multi-compartment reaction-diffusion simulator using multistate realistic molecular complexes

Directory of Open Access Journals (Sweden)

Le Novère Nicolas

2010-03-01

Full Text Available Abstract Background Most cellular signal transduction mechanisms depend on a few molecular partners whose roles depend on their position and movement in relation to the input signal. This movement can follow various rules and take place in different compartments. Additionally, the molecules can form transient complexes. Complexation and signal transduction depend on the specific states partners and complexes adopt. Several spatial simulator have been developed to date, but none are able to model reaction-diffusion of realistic multi-state transient complexes. Results Meredys allows for the simulation of multi-component, multi-feature state molecular species in two and three dimensions. Several compartments can be defined with different diffusion and boundary properties. The software employs a Brownian dynamics engine to simulate reaction-diffusion systems at the reactive particle level, based on compartment properties, complex structure, and hydro-dynamic radii. Zeroth-, first-, and second order reactions are supported. The molecular complexes have realistic geometries. Reactive species can contain user-defined feature states which can modify reaction rates and outcome. Models are defined in a versatile NeuroML input file. The simulation volume can be split in subvolumes to speed up run-time. Conclusions Meredys provides a powerful and versatile way to run accurate simulations of molecular and sub-cellular systems, that complement existing multi-agent simulation systems. Meredys is a Free Software and the source code is available at http://meredys.sourceforge.net/.

Perspectives in molecular imaging through translational research, human medicine, and veterinary medicine.

Science.gov (United States)

Berry, Clifford R; Garg, Predeep

2014-01-01

The concept of molecular imaging has taken off over the past 15 years to the point of the renaming of the Society of Nuclear Medicine (Society of Nuclear Medicine and Molecular Imaging) and Journals (European Journal of Nuclear Medicine and Molecular Imaging) and offering of medical fellowships specific to this area of study. Molecular imaging has always been at the core of functional imaging related to nuclear medicine. Even before the phrase molecular imaging came into vogue, radionuclides and radiopharmaceuticals were developed that targeted select physiological processes, proteins, receptor analogs, antibody-antigen interactions, metabolites and specific metabolic pathways. In addition, with the advent of genomic imaging, targeted genomic therapy, and theranostics, a number of novel radiopharmaceuticals for the detection and therapy of specific tumor types based on unique biological and cellular properties of the tumor itself have been realized. However, molecular imaging and therapeutics as well as the concept of theranostics are yet to be fully realized. The purpose of this review article is to present an overview of the translational approaches to targeted molecular imaging with application to some naturally occurring animal models of human disease. © 2013 Published by Elsevier Inc.

Diffusion is capable of translating anisotropic apoptosis initiation into a homogeneous execution of cell death.

LENUS (Irish Health Repository)

Huber, Heinrich J

2010-01-01

ABSTRACT: BACKGROUND: Apoptosis is an essential cell death process throughout the entire life span of all metazoans and its deregulation in humans has been implicated in many proliferative and degenerative diseases. Mitochondrial outer membrane permeabilisation (MOMP) and activation of effector caspases are key processes during apoptosis signalling. MOMP can be subject to spatial coordination in human cancer cells, resulting in intracellular waves of cytochrome-c release. To investigate the consequences of these spatial anisotropies in mitochondrial permeabilisation on subsequent effector caspase activation, we devised a mathematical reaction-diffusion model building on a set of partial differential equations. RESULTS: Reaction-diffusion modelling suggested that even if strong spatial anisotropies existed during mitochondrial cytochrome c release, these would be eliminated by free diffusion of the cytosolic proteins that instantiate the apoptosis execution network. Experimentally, rapid sampling of mitochondrial permeabilisation and effector caspase activity in individual HeLa cervical cancer cells confirmed predictions of the reaction-diffusion model and demonstrated that the signalling network of apoptosis execution could efficiently translate spatial anisotropies in mitochondrial permeabilisation into a homogeneous effector caspase response throughout the cytosol. Further systems modelling suggested that a more than 10,000-fold impaired diffusivity would be required to maintain spatial anisotropies as observed during mitochondrial permeabilisation until the time effector caspases become activated. CONCLUSIONS: Multi-protein diffusion efficiently contributes to eliminating spatial asynchronies which are present during the initiation of apoptosis execution and thereby ensures homogeneous apoptosis execution throughout the entire cell body. For previously reported biological scenarios in which effector caspase activity was shown to be targeted selectively to

Diffusion of hydrogen, hydrogen sulfide and large molecular weight anions in bentonite

International Nuclear Information System (INIS)

Eriksen, T.E.; Jacobsson, A.

1982-01-01

The diffusivities of HS - and H 2 have been determined from profile analysis and steady state transport experiments. The diffusivity of HS - was found to be 9x10 - 12 and 4x10xsec 1 in MX-80 and Erbsloeh bentonite respectively. The results are in fair agreement with the results earlier obtained for Cl - and I - . The H 2 diffusivity calculated from steady state transport was found to be surprisingly low (3.6x10 - 12 m 2 xsec - 1 ). Various heavy anions with molecular weights 290-30x10 3 were found to migrate through MX-80 bentonite with diffusivities in the range (2,1-0,75)x10 - 15 m 2 xsec - 1 . (Author)

Diffusion-controlled interface kinetics-inclusive system-theoretic propagation models for molecular communication systems

Science.gov (United States)

Chude-Okonkwo, Uche A. K.; Malekian, Reza; Maharaj, B. T.

2015-12-01

Inspired by biological systems, molecular communication has been proposed as a new communication paradigm that uses biochemical signals to transfer information from one nano device to another over a short distance. The biochemical nature of the information transfer process implies that for molecular communication purposes, the development of molecular channel models should take into consideration diffusion phenomenon as well as the physical/biochemical kinetic possibilities of the process. The physical and biochemical kinetics arise at the interfaces between the diffusion channel and the transmitter/receiver units. These interfaces are herein termed molecular antennas. In this paper, we present the deterministic propagation model of the molecular communication between an immobilized nanotransmitter and nanoreceiver, where the emission and reception kinetics are taken into consideration. Specifically, we derived closed-form system-theoretic models and expressions for configurations that represent different communication systems based on the type of molecular antennas used. The antennas considered are the nanopores at the transmitter and the surface receptor proteins/enzymes at the receiver. The developed models are simulated to show the influence of parameters such as the receiver radius, surface receptor protein/enzyme concentration, and various reaction rate constants. Results show that the effective receiver surface area and the rate constants are important to the system's output performance. Assuming high rate of catalysis, the analysis of the frequency behavior of the developed propagation channels in the form of transfer functions shows significant difference introduce by the inclusion of the molecular antennas into the diffusion-only model. It is also shown that for t > > 0 and with the information molecules' concentration greater than the Michaelis-Menten kinetic constant of the systems, the inclusion of surface receptors proteins and enzymes in the models

DCXE, Time-Dependent Xe Diffusion in Non-Multiplying Slab

International Nuclear Information System (INIS)

Horikami, K.; Kawasaki, S.

1969-01-01

1 - Nature of physical problem solved: Programme DCXE was designed for the analysis of the diffusion phenomena of xenon in non-multiplying media (slab geometry) and solves the Fick's second diffusion equation with boundary conditions. Initial distribution of xenon in the media at time 0 and 0 value of distribution at both ends of media at any positive time. 2 - Method of solution: Difference approximation is used to solve Fick's second diffusion equation. Strict stability condition is chosen between time and spatial intervals

DCXE, Time-Dependent Xe Diffusion in Non-Multiplying Slab

Energy Technology Data Exchange (ETDEWEB)

Horikami, K; Kawasaki, S [Japan Atomic Energy Research Institute, Tokai, Ibaraki (Japan)

1969-01-01

1 - Nature of physical problem solved: Programme DCXE was designed for the analysis of the diffusion phenomena of xenon in non-multiplying media (slab geometry) and solves the Fick's second diffusion equation with boundary conditions. Initial distribution of xenon in the media at time 0 and 0 value of distribution at both ends of media at any positive time. 2 - Method of solution: Difference approximation is used to solve Fick's second diffusion equation. Strict stability condition is chosen between time and spatial intervals.

GW-Bodies and P-Bodies Constitute Two Separate Pools of Sequestered Non-Translating RNAs.

Directory of Open Access Journals (Sweden)

Prajal H Patel

Full Text Available Non-translating RNAs that have undergone active translational repression are culled from the cytoplasm into P-bodies for decapping-dependent decay or for sequestration. Organisms that use microRNA-mediated RNA silencing have an additional pathway to remove RNAs from active translation. Consequently, proteins that govern microRNA-mediated silencing, such as GW182/Gw and AGO1, are often associated with the P-bodies of higher eukaryotic organisms. Due to the presence of Gw, these structures have been referred to as GW-bodies. However, several reports have indicated that GW-bodies have different dynamics to P-bodies. Here, we use live imaging to examine GW-body and P-body dynamics in the early Drosophila melanogaster embryo. While P-bodies are present throughout early embryonic development, cytoplasmic GW-bodies only form in significant numbers at the midblastula transition. Unlike P-bodies, which are predominantly cytoplasmic, GW-bodies are present in both nuclei and the cytoplasm. RNA decapping factors such as DCP1, Me31B, and Hpat are not associated with GW-bodies, indicating that P-bodies and GW-bodies are distinct structures. Furthermore, known Gw interactors such as AGO1 and the CCR4-NOT deadenylation complex, which have been shown to be important for Gw function, are also not present in GW-bodies. Use of translational inhibitors puromycin and cycloheximide, which respectively increase or decrease cellular pools of non-translating RNAs, alter GW-body size, underscoring that GW-bodies are composed of non-translating RNAs. Taken together, these data indicate that active translational silencing most likely does not occur in GW-bodies. Instead GW-bodies most likely function as repositories for translationally silenced RNAs. Finally, inhibition of zygotic gene transcription is unable to block the formation of either P-bodies or GW-bodies in the early embryo, suggesting that these structures are composed of maternal RNAs.

Carbon diffusion in molten uranium: an ab initio molecular dynamics study

Science.gov (United States)

Garrett, Kerry E.; Abrecht, David G.; Kessler, Sean H.; Henson, Neil J.; Devanathan, Ram; Schwantes, Jon M.; Reilly, Dallas D.

2018-04-01

In this work we used ab initio molecular dynamics within the framework of density functional theory and the projector-augmented wave method to study carbon diffusion in liquid uranium at temperatures above 1600 K. The electronic interactions of carbon and uranium were described using the local density approximation (LDA). The self-diffusion of uranium based on this approach is compared with literature computational and experimental results for liquid uranium. The temperature dependence of carbon and uranium diffusion in the melt was evaluated by fitting the resulting diffusion coefficients to an Arrhenius relationship. We found that the LDA calculated activation energy for carbon was nearly twice that of uranium: 0.55 ± 0.03 eV for carbon compared to 0.32 ± 0.04 eV for uranium. Structural analysis of the liquid uranium-carbon system is also discussed.

Excitation and charge transfer in He/sup +/ + H collisions. A molecular approach including two-electron translation factors

Energy Technology Data Exchange (ETDEWEB)

Errea, L.F.; Mendez, L.; Riera, A.

1983-06-01

In a previous paper we have pointed out that the common-translation-factor (CTF) method is the only one which, at present, and within the framework of the molecular model of atomic collisions, can be shown to be both convergent and computationally fast, even for many-electron systems. In this Communication we check that this second statement is correct, presenting, for the first time, a molecular calculation involving two-electron translation factors, for He/sup +/ + H collisions. A careful study of the sensitivity of the calculated cross sections to the choice of the CTF is performed, and conclusions on that sensitivity are drawn, for several types of processes.

Thermal parameter identification for non-Fourier heat transfer from molecular dynamics

Science.gov (United States)

Singh, Amit; Tadmor, Ellad B.

2015-10-01

Fourier's law leads to a diffusive model of heat transfer in which a thermal signal propagates infinitely fast and the only material parameter is the thermal conductivity. In micro- and nano-scale systems, non-Fourier effects involving coupled diffusion and wavelike propagation of heat can become important. An extension of Fourier's law to account for such effects leads to a Jeffreys-type model for heat transfer with two relaxation times. We propose a new Thermal Parameter Identification (TPI) method for obtaining the Jeffreys-type thermal parameters from molecular dynamics simulations. The TPI method makes use of a nonlinear regression-based approach for obtaining the coefficients in analytical expressions for cosine and sine-weighted averages of temperature and heat flux over the length of the system. The method is applied to argon nanobeams over a range of temperature and system sizes. The results for thermal conductivity are found to be in good agreement with standard Green-Kubo and direct method calculations. The TPI method is more efficient for systems with high diffusivity and has the advantage, that unlike the direct method, it is free from the influence of thermostats. In addition, the method provides the thermal relaxation times for argon. Using the determined parameters, the Jeffreys-type model is able to reproduce the molecular dynamics results for a short-duration heat pulse where wavelike propagation of heat is observed thereby confirming the existence of second sound in argon. An implementation of the TPI method in MATLAB is available as part of the online supplementary material.

The CO Transition from Diffuse Molecular Gas to Dense Clouds

Science.gov (United States)

Rice, Johnathan S.; Federman, Steven

2017-06-01

The atomic to molecular transitions occurring in diffuse interstellar gas surrounding molecular clouds are affected by the local physical conditions (density and temperature) and the radiation field penetrating the material. Our optical observations of CH, CH^{+}, and CN absorption from McDonald Observatory and the European Southern Observatory are useful tracers of this gas and provide the velocity structure needed for analyzing lower resolution ultraviolet observations of CO and H_{2} absorption from Far Ultraviolet Spectroscopic Explorer. We explore the changing environment between diffuse and dense gas by using the column densities and excitation temperatures from CO and H_{2} to determine the gas density. The resulting gas densities from this method are compared to densities inferred from other methods such as C_{2} and CN chemistry. The densities allow us to interpret the trends from the combined set of tracers. Groupings of sight lines, such as those toward h and χ Persei or Chameleon provide a chance for further characterization of the environment. The Chameleon region in particular helps illuminate CO-dark gas, which is not associated with emission from H I at 21 cm or from CO at 2.6 mm. Expanding this analysis to include emission data from the GOT C+ survey allows the further characterization of neutral diffuse gas, including CO-dark gas.

Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

Science.gov (United States)

Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

2008-01-01

Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

Demonstration of non-Gaussian restricted diffusion in tumor cells using diffusion-time dependent diffusion weighted MR contrast

Directory of Open Access Journals (Sweden)

Tuva Roaldsdatter Hope

2016-08-01

Full Text Available The diffusion weighted imaging (DWI technique enables quantification of water mobility for probing microstructural properties of biological tissue, and has become an effective tool for collecting information about the underlying pathology of cancerous tissue. Measurements using multiple b-values have indicated a bi-exponential signal attenuation, ascribed to fast (high ADC and slow (low ADC diffusion components. In this empirical study, we investigate the properties of the diffusion time (∆ - dependent components of the diffusion-weighted (DW signal in a constant b-value experiment. A Xenograft GBM mouse was imaged using ∆ = 11 ms, 20 ms, 40 ms, 60 ms and b=500-4000 s/mm2 in intervals of 500s/mm2. Data was corrected for EPI distortions and the ∆-dependence on the DW signal was measured within three regions of interest (intermediate- and high-density tumor regions and normal appearing brain tissue regions (NAB. In this empirical study we verify the assumption that the slow decaying component of the DW-signal is non-Gaussian and dependent on ∆, consistent with restricted diffusion of the intracellular space. As the DW-signal as a function of ∆ is specific to restricted diffusion, manipulating ∆ at constant b-value (cb provides a complementary and direct approach for separating the restricted from the hindered diffusion component. Our results show that only tumor tissue signal of our data demonstrate ∆-dependence, based on a bi-exponential model with a restricted diffusion component, we successfully estimated the restricted ADC, signal volume fraction and cell size within each tumor ROI.

Rotational Laser Cooling of Vibrationally and Translationally Cold Molecular Ions

DEFF Research Database (Denmark)

Drewsen, Michael

2011-01-01

[7,8,9]. Furthermore, in order to learn more about the chemistry in interstellar clouds, astrochemists can benefit greatly from direct measurements on cold reactions in laboratories [9]. Working with MgH+ molecular ions in a linear Paul trap, we routinely cool their translational degree of freedom...... by sympathetic cooling with Doppler laser cooled Mg+ ions. Giving the time for the molecules to equilibrate internally to the room temperature blackbody radiation, the vibrational degree of freedom will freeze out, leaving only the rotational degree of freedom to be cooled. We report here on the implementation...... results imply that, through this technique, cold molecular-ion experiments can now be carried out at cryogenic temperatures in room-temperature set-ups. References [1] Koelemeij, J. C. J., Roth, B., Wicht, A., Ernsting, I. and Schiller, S., Phys. Rev. Lett. 98, 173002 (2007). [2] Hudson, J. J., Sauer, B...

Non-cognate translation priming in masked priming lexical decision experiments: A meta-analysis.

Science.gov (United States)

Wen, Yun; van Heuven, Walter J B

2017-06-01

The masked translation priming paradigm has been widely used in the last 25 years to investigate word processing in bilinguals. Motivated by studies reporting mixed findings, in particular for second language (L2) to first language (L1) translation priming, we conducted, for the first time in the literature, a meta-analysis of 64 masked priming lexical decision experiments across 24 studies to assess the effect sizes of L1-L2 and L2-L1 non-cognate translation priming effects in bilinguals. Our meta-analysis also investigated the influence of potential moderators of translation priming effects. The results provided clear evidence of significant translation priming effects for both directions, with L1-L2 translation priming significantly larger than L2-L1 translation priming (i.e., effect size of 0.86 vs. 0.31). The analyses also revealed that L1-L2 translation effect sizes were moderated by the interval between prime and target (ISI), whereas L2-L1 translation effect sizes were modulated by the number of items per cell. Theoretical and methodological implications of this meta-analysis are discussed and recommendations for future studies are provided.

Molecular dynamics simulation of metallic impurity diffusion in liquid lead-bismuth eutectic (LBE)

Science.gov (United States)

Gao, Yun; Takahashi, Minoru; Cavallotti, Carlo; Raos, Guido

2018-04-01

Corrosion of stainless steels by lead-bismuth eutectic (LBE) is an important problem which depends, amongst other things, on the diffusion of the steel components inside this liquid alloy. Here we present the results of classical molecular dynamics simulations of the diffusion of Fe and Ni within LBE. The simulations complement experimental studies of impurity diffusion by our group and provide an atomic-level understanding of the relevant diffusion phenomena. They are based on the embedded atom method (EAM) to represent many-body interactions among atoms. The EAM potentials employed in our simulations have been validated against ab initio density functional calculations. We show that the experimental and simulation results for the temperature-dependent viscosity of LBE and the impurity diffusion coefficients can be reconciled by assuming that the Ni and Fe diffuse mainly as nanoscopic clusters below 1300 K. The average Fe and Ni cluster sizes decrease with increasing the temperature and there is essentially single-atom diffusion at higher temperatures.

Superstatistical generalised Langevin equation: non-Gaussian viscoelastic anomalous diffusion

Science.gov (United States)

Ślęzak, Jakub; Metzler, Ralf; Magdziarz, Marcin

2018-02-01

Recent advances in single particle tracking and supercomputing techniques demonstrate the emergence of normal or anomalous, viscoelastic diffusion in conjunction with non-Gaussian distributions in soft, biological, and active matter systems. We here formulate a stochastic model based on a generalised Langevin equation in which non-Gaussian shapes of the probability density function and normal or anomalous diffusion have a common origin, namely a random parametrisation of the stochastic force. We perform a detailed analysis demonstrating how various types of parameter distributions for the memory kernel result in exponential, power law, or power-log law tails of the memory functions. The studied system is also shown to exhibit a further unusual property: the velocity has a Gaussian one point probability density but non-Gaussian joint distributions. This behaviour is reflected in the relaxation from a Gaussian to a non-Gaussian distribution observed for the position variable. We show that our theoretical results are in excellent agreement with stochastic simulations.

Effect of annealing on structural changes and oxygen diffusion in amorphous HfO2 using classical molecular dynamics

Science.gov (United States)

Shen, Wenqing; Kumari, Niru; Gibson, Gary; Jeon, Yoocharn; Henze, Dick; Silverthorn, Sarah; Bash, Cullen; Kumar, Satish

2018-02-01

Non-volatile memory is a promising alternative to present memory technologies. Oxygen vacancy diffusion has been widely accepted as one of the reasons for the resistive switching mechanism of transition-metal-oxide based resistive random access memory. In this study, molecular dynamics simulation is applied to investigate the diffusion coefficient and activation energy of oxygen in amorphous hafnia. Two sets of empirical potential, Charge-Optimized Many-Body (COMB) and Morse-BKS (MBKS), were considered to investigate the structural and diffusion properties at different temperatures. COMB predicts the activation energy of 0.53 eV for the temperature range of 1000-2000 K, while MBKS predicts 2.2 eV at high temperature (1600-2000 K) and 0.36 eV at low temperature (1000-1600 K). Structural changes and appearance of nano-crystalline phases with increasing temperature might affect the activation energy of oxygen diffusion predicted by MBKS, which is evident from the change in coordination number distribution and radial distribution function. None of the potentials make predictions that are fully consistent with density functional theory simulations of both the structure and diffusion properties of HfO2. This suggests the necessity of developing a better multi-body potential that considers charge exchange.

A surgical navigation system for non-contact diffuse optical tomography and intraoperative cone-beam CT

Science.gov (United States)

Daly, Michael J.; Muhanna, Nidal; Chan, Harley; Wilson, Brian C.; Irish, Jonathan C.; Jaffray, David A.

2014-02-01

A freehand, non-contact diffuse optical tomography (DOT) system has been developed for multimodal imaging with intraoperative cone-beam CT (CBCT) during minimally-invasive cancer surgery. The DOT system is configured for near-infrared fluorescence imaging with indocyanine green (ICG) using a collimated 780 nm laser diode and a nearinfrared CCD camera (PCO Pixelfly USB). Depending on the intended surgical application, the camera is coupled to either a rigid 10 mm diameter endoscope (Karl Storz) or a 25 mm focal length lens (Edmund Optics). A prototype flatpanel CBCT C-Arm (Siemens Healthcare) acquires low-dose 3D images with sub-mm spatial resolution. A 3D mesh is extracted from CBCT for finite-element DOT implementation in NIRFAST (Dartmouth College), with the capability for soft/hard imaging priors (e.g., segmented lymph nodes). A stereoscopic optical camera (NDI Polaris) provides real-time 6D localization of reflective spheres mounted to the laser and camera. Camera calibration combined with tracking data is used to estimate intrinsic (focal length, principal point, non-linear distortion) and extrinsic (translation, rotation) lens parameters. Source/detector boundary data is computed from the tracked laser/camera positions using radiometry models. Target registration errors (TRE) between real and projected boundary points are ~1-2 mm for typical acquisition geometries. Pre-clinical studies using tissue phantoms are presented to characterize 3D imaging performance. This translational research system is under investigation for clinical applications in head-and-neck surgery including oral cavity tumour resection, lymph node mapping, and free-flap perforator assessment.

Computing the blood brain barrier (BBB) diffusion coefficient: A molecular dynamics approach

Energy Technology Data Exchange (ETDEWEB)

Shamloo, Amir, E-mail: shamloo@sharif.edu; Pedram, Maysam Z.; Heidari, Hossein; Alasty, Aria, E-mail: aalasti@sharif.edu

2016-07-15

Various physical and biological aspects of the Blood Brain Barrier (BBB) structure still remain unfolded. Therefore, among the several mechanisms of drug delivery, only a few have succeeded in breaching this barrier, one of which is the use of Magnetic Nanoparticles (MNPs). However, a quantitative characterization of the BBB permeability is desirable to find an optimal magnetic force-field. In the present study, a molecular model of the BBB is introduced that precisely represents the interactions between MNPs and the membranes of Endothelial Cells (ECs) that form the BBB. Steered Molecular Dynamics (SMD) simulations of the BBB crossing phenomenon have been carried out. Mathematical modeling of the BBB as an input-output system has been considered from a system dynamics modeling viewpoint, enabling us to analyze the BBB behavior based on a robust model. From this model, the force profile required to overcome the barrier has been extracted for a single NP from the SMD simulations at a range of velocities. Using this data a transfer function model has been obtained and the diffusion coefficient is evaluated. This study is a novel approach to bridge the gap between nanoscale models and microscale models of the BBB. The characteristic diffusion coefficient has the nano-scale molecular effects inherent, furthermore reducing the computational costs of a nano-scale simulation model and enabling much more complex studies to be conducted. - Highlights: • Molecular dynamics simulation of crossing nano-particles through the BBB membrane at different velocities. • Recording the position of nano-particle and the membrane-NP interaction force profile. • Identification of a frequency domain model for the membrane. • Calculating the diffusion coefficient based on MD simulation and identified model. • Obtaining a relation between continuum medium and discrete medium.

CO2 diffusion in champagne wines: a molecular dynamics study.

Science.gov (United States)

Perret, Alexandre; Bonhommeau, David A; Liger-Belair, Gérard; Cours, Thibaud; Alijah, Alexander

2014-02-20

Although diffusion is considered as the main physical process responsible for the nucleation and growth of carbon dioxide bubbles in sparkling beverages, the role of each type of molecule in the diffusion process remains unclear. In the present study, we have used the TIP5P and SPC/E water models to perform force field molecular dynamics simulations of CO2 molecules in water and in a water/ethanol mixture respecting Champagne wine proportions. CO2 diffusion coefficients were computed by applying the generalized Fick's law for the determination of multicomponent diffusion coefficients, a law that simplifies to the standard Fick's law in the case of champagnes. The CO2 diffusion coefficients obtained in pure water and water/ethanol mixtures composed of TIP5P water molecules were always found to exceed the coefficients obtained in mixtures composed of SPC/E water molecules, a trend that was attributed to a larger propensity of SPC/E water molecules to form hydrogen bonds. Despite the fact that the SPC/E model is more accurate than the TIP5P model to compute water self-diffusion and CO2 diffusion in pure water, the diffusion coefficients of CO2 molecules in the water/ethanol mixture are in much better agreement with the experimental values of 1.4 - 1.5 × 10(-9) m(2)/s obtained for Champagne wines when the TIP5P model is employed. This difference was deemed to rely on the larger propensity of SPC/E water molecules to maintain the hydrogen-bonded network between water molecules and form new hydrogen bonds with ethanol, although statistical issues cannot be completely excluded. The remarkable agreement between the theoretical CO2 diffusion coefficients obtained within the TIP5P water/ethanol mixture and the experimental data specific to Champagne wines makes us infer that the diffusion coefficient in these emblematic hydroalcoholic sparkling beverages is expected to remain roughly constant whathever their proportions in sugars, glycerol, or peptides.

Diffusion constant in hot and dense hadronic matter. A hadro-molecular-dynamic calculation

International Nuclear Information System (INIS)

Sasaki, N.; Miyamura, O.; Muroya, S.; Nonaka, C.

2002-01-01

We evaluate baryon/charge diffusion constant of dense and hot hadronic matter based on the molecular dynamical method by using a hadronic collision generator which describes nuclear collisions at energies 10 1-2 GeV/A and satisfies detailed balance at low temperatures (T ≤ 200 MeV). For the hot and dense hadronic matter of the temperature range, T = 100 - 200 MeV and baryon number density, n B =0.16 fm -3 - 0.32 fm -3 , charge diffusion constant D gradually increases from 0.5 fmc to 2 fmc with temperature and is almost independent of baryon number density. Based on the obtained diffusion constant we make simple discussions on the diffusion of charge fluctuation in ultrarelativistic nuclear collisions. (author)

Scanning, non-contact, hybrid broadband diffuse optical spectroscopy and diffuse correlation spectroscopy system.

Science.gov (United States)

Johansson, Johannes D; Mireles, Miguel; Morales-Dalmau, Jordi; Farzam, Parisa; Martínez-Lozano, Mar; Casanovas, Oriol; Durduran, Turgut

2016-02-01

A scanning system for small animal imaging using non-contact, hybrid broadband diffuse optical spectroscopy (ncDOS) and diffuse correlation spectroscopy (ncDCS) is presented. The ncDOS uses a two-dimensional spectrophotometer retrieving broadband (610-900 nm) spectral information from up to fifty-seven source-detector distances between 2 and 5 mm. The ncDCS data is simultaneously acquired from four source-detector pairs. The sample is scanned in two dimensions while tracking variations in height. The system has been validated with liquid phantoms, demonstrated in vivo on a human fingertip during an arm cuff occlusion and on a group of mice with xenoimplanted renal cell carcinoma.

Molecular dynamics simulations of interfacial interactions between small nanoparticles during diffusion-limited aggregation

International Nuclear Information System (INIS)

Lu, Jing; Liu, Dongmei; Yang, Xiaonan; Zhao, Ying; Liu, Haixing; Tang, Huan; Cui, Fuyi

2015-01-01

Graphical abstract: - Highlights: • Diffusion-limited aggregation is analyzed using molecular dynamic simulations. • The aggregation processand aggregate structure vary with particle size. • Particle-particle interaction and surface diffusion result in direct bonding. • Water-mediated interaction is responsible for the separation betweennanoparticles. - Abstract: Due to the limitations of experimental methods at the atomic level, research on the aggregation of small nanoparticles (D < 5 nm) in aqueous solutions is quite rare. The aggregation of small nanoparticles in aqueous solutions is very different than that of normal sized nanoparticles. The interfacial interactions play a dominant role in the aggregation of small nanoparticles. In this paper, molecular dynamics simulations, which can explore the microscopic behavior of nanoparticles during the diffusion-limited aggregation at an atomic level, were employed to reveal the aggregation mechanism of small nanoparticles in aqueous solutions. First, the aggregation processes and aggregate structure were depicted. Second, the particle–particle interaction and surface diffusion of nanoparticles during aggregation were investigated. Third, the water-mediated interactions during aggregation were ascertained. The results indicate that the aggregation of nanoparticle in aqueous solutions is affected by particle size. The strong particle–particle interaction and high surface diffusion result in the formation of particle–particle bonds of 2 nm TiO 2 nanoparticles, and the water-mediated interaction plays an important role in the aggregation process of 3 and 4 nm TiO 2 nanoparticles.

RASPA: molecular simulation software for adsorption and diffusion in flexible nanoporous materials

NARCIS (Netherlands)

Dubbeldam, D.; Calero, S.; Ellis, D.E.; Snurr, R.Q.

2016-01-01

A new software package, RASPA, for simulating adsorption and diffusion of molecules in flexible nanoporous materials is presented. The code implements the latest state-of-the-art algorithms for molecular dynamics and Monte Carlo (MC) in various ensembles including symplectic/measure-preserving

Anisotropic Rotational Diffusion Studied by Nuclear Spin Relaxation and Molecular Dynamics Simulation: An Undergraduate Physical Chemistry Laboratory

Science.gov (United States)

Fuson, Michael M.

2017-01-01

Laboratories studying the anisotropic rotational diffusion of bromobenzene using nuclear spin relaxation and molecular dynamics simulations are described. For many undergraduates, visualizing molecular motion is challenging. Undergraduates rarely encounter laboratories that directly assess molecular motion, and so the concept remains an…

Translating molecular medicine into clinical tools: doomed to fail by neglecting basic preanalytical principles

Directory of Open Access Journals (Sweden)

Mannello Ferdinando

2009-10-01

Full Text Available Abstract This commentary discusses a study on measurements of matrix metalloproteinase 9 (MMP-9 in serum of pseudoxanthoma elasticum patients recently published in Journal of Molecular Medicine. This study can be considered the typical "obstacle" to effective translational medicine as previously documented in JTM journal. Although serum has been frequently proven as inappropriate sample for determining numerous circulating MMPs, among them MMP-9, there are over and over again studies, as in this case, that measure MMP-9 in serum. Comparative measurements in serum and plasma samples demonstrated higher concentrations for MMP-9 in serum due to the additional release from leukocytes and platelets following the coagulation/fibrinolysis process. From this example it can be concluded that translating basic research discoveries into clinical tools needs a more intensive exchange between basic biomedical research and clinical scientists already in an early stage. Otherwise a lost of translation, as discussed in JTM journal, seems to be inevitable.

Diffusing diffusivity: Rotational diffusion in two and three dimensions

Science.gov (United States)

Jain, Rohit; Sebastian, K. L.

2017-06-01

We consider the problem of calculating the probability distribution function (pdf) of angular displacement for rotational diffusion in a crowded, rearranging medium. We use the diffusing diffusivity model and following our previous work on translational diffusion [R. Jain and K. L. Sebastian, J. Phys. Chem. B 120, 3988 (2016)], we show that the problem can be reduced to that of calculating the survival probability of a particle undergoing Brownian motion, in the presence of a sink. We use the approach to calculate the pdf for the rotational motion in two and three dimensions. We also propose new dimensionless, time dependent parameters, αr o t ,2 D and αr o t ,3 D, which can be used to analyze the experimental/simulation data to find the extent of deviation from the normal behavior, i.e., constant diffusivity, and obtain explicit analytical expressions for them, within our model.

Diffusion-driven growth of nanowires by low-temperature molecular beam epitaxy

Energy Technology Data Exchange (ETDEWEB)

Rueda-Fonseca, P.; Orrù, M. [Univ. Grenoble Alpes, F-38000 Grenoble (France); CNRS, Institut NEEL, F-38000 Grenoble (France); CEA, INAC, F-38000 Grenoble (France); Bellet-Amalric, E.; Robin, E. [Univ. Grenoble Alpes, F-38000 Grenoble (France); CEA, INAC, F-38000 Grenoble (France); Den Hertog, M.; Genuist, Y.; André, R.; Tatarenko, S.; Cibert, J., E-mail: joel.cibert@neel.cnrs.fr [Univ. Grenoble Alpes, F-38000 Grenoble (France); CNRS, Institut NEEL, F-38000 Grenoble (France)

2016-04-28

With ZnTe as an example, we use two different methods to unravel the characteristics of the growth of nanowires (NWs) by gold-catalyzed molecular beam epitaxy at low temperature. In the first approach, CdTe insertions have been used as markers, and the nanowires have been characterized by scanning transmission electron microscopy, including geometrical phase analysis and energy dispersive electron spectrometry; the second approach uses scanning electron microscopy and the statistics of the relationship between the length of the tapered nanowires and their base diameter. Axial and radial growth are quantified using a diffusion-limited model adapted to the growth conditions; analytical expressions describe well the relationship between the NW length and the total molecular flux (taking into account the orientation of the effusion cells), and the catalyst-nanowire contact area. A long incubation time is observed. This analysis allows us to assess the evolution of the diffusion lengths on the substrate and along the nanowire sidewalls, as a function of temperature and deviation from stoichiometric flux.

Molecular dynamics simulations of diffusion and clustering along critical isotherms of medium-chain n-alkanes.

Science.gov (United States)

Mutoru, J W; Smith, W; O'Hern, C S; Firoozabadi, A

2013-01-14

Understanding the transport properties of molecular fluids in the critical region is important for a number of industrial and natural systems. In the literature, there are conflicting reports on the behavior of the self diffusion coefficient D(s) in the critical region of single-component molecular systems. For example, D(s) could decrease to zero, reach a maximum, or remain unchanged and finite at the critical point. Moreover, there is no molecular-scale understanding of the behavior of diffusion coefficients in molecular fluids in the critical regime. We perform extensive molecular dynamics simulations in the critical region of single-component fluids composed of medium-chain n-alkanes-n-pentane, n-decane, and n-dodecane-that interact via anisotropic united-atom potentials. For each system, we calculate D(s), and average molecular cluster sizes κ(cl) and numbers N(cl) at various cluster lifetimes τ, as a function of density ρ in the range 0.2ρ(c) ≤ ρ ≤ 2.0ρ(c) at the critical temperature T(c). We find that D(s) decreases with increasing ρ but remains finite at the critical point. Moreover, for any given τ critical point.

Molecular dynamics simulation of nanoscale surface diffusion of heterogeneous adatoms clusters

International Nuclear Information System (INIS)

Imran, Muhammad; Hussain, Fayyaz; Ullah, Hafeez; Ahmad, Ejaz; Rashid, Muhammad; Ismail, Muhammad; Cai, Yongqing; Javid, M Arshad; Ahmad, S A

2016-01-01

Molecular dynamics simulation employing the embedded atom method potential is utilized to investigate nanoscale surface diffusion mechanisms of binary heterogeneous adatoms clusters at 300 K, 500 K, and 700 K. Surface diffusion of heterogeneous adatoms clusters can be vital for the binary island growth on the surface and can be useful for the formation of alloy-based thin film surface through atomic exchange process. The results of the diffusion process show that at 300 K, the diffusion of small adatoms clusters shows hopping, sliding, and shear motion; whereas for large adatoms clusters (hexamer and above), the diffusion is negligible. At 500 K, small adatoms clusters, i.e., dimer, show almost all possible diffusion mechanisms including the atomic exchange process; however no such exchange is observed for adatoms clusters greater than dimer. At 700 K, the exchange mechanism dominates for all types of clusters, where Zr adatoms show maximum tendency and Ag adatoms show minimum or no tendency toward the exchange process. Separation and recombination of one or more adatoms are also observed at 500 K and 700 K. The Ag adatoms also occupy pop-up positions over the adatoms clusters for short intervals. At 700 K, the vacancies are also generated in the vicinity of the adatoms cluster, vacancy formation, filling, and shifting can be observed from the results. (paper)

Peptide self-association in aqueous trifluoroethanol monitored by pulsed field gradient NMR diffusion measurements

Energy Technology Data Exchange (ETDEWEB)

Yao Shenggen [Biomolecular Research Institute (Australia); Howlett, Geoffrey J. [University of Melbourne, Department of Biochemistry and Molecular Biology (Australia); Norton, Raymond S. [Biomolecular Research Institute (Australia)

2000-02-15

Defining the self-association state of a molecule in solution can be an important step in NMR-based structure determination. This is particularly true of peptides, where there can be a relatively small number of long-range interactions and misinterpretation of an intermolecular NOE as an intramolecular contact can have a dramatic influence on the final calculated structure. In this paper, we have investigated the use of translational self-diffusion coefficient measurements to detect self-association in aqueous trifluoroethanol of three peptides which are analogues of the C-terminal region of human neuropeptide Y. Experimentally measured diffusion coefficients were extrapolated to D{sup 0}, the limiting value as the peptide concentration approaches zero, and then converted to D{sub 20,w}, the diffusion coefficient after correction for temperature and the viscosity of the solvent. A decrease in D{sub 20,w} of about 16% was found for all three peptides in aqueous TFE (30% by volume) compared with water, which is in reasonable agreement with the expected decrease upon dimerisation, the presence of which was indicated by sedimentation equilibrium measurements. Apparent molecular masses of these peptides in both solutions were also calculated from their diffusion coefficients and similar results were obtained. Several potential internal standards, including acetone, acetonitrile, dimethylsulfoxide and dioxane, were assessed as monitors of solution viscosity over a range of trifluoroethanol concentrations. Compared with independent measurements of viscosity, acetonitrile was the most accurate standard among these four. The practical limitations of a quantitative assessment of peptide self-association from translational diffusion coefficients measured by PFGNMR, including the calculation of apparent molecular mass, are also discussed.

Non-parametric Estimation of Diffusion-Paths Using Wavelet Scaling Methods

DEFF Research Database (Denmark)

Høg, Esben

In continuous time, diffusion processes have been used for modelling financial dynamics for a long time. For example the Ornstein-Uhlenbeck process (the simplest mean-reverting process) has been used to model non-speculative price processes. We discuss non--parametric estimation of these processes...

Non-Parametric Estimation of Diffusion-Paths Using Wavelet Scaling Methods

DEFF Research Database (Denmark)

Høg, Esben

2003-01-01

In continuous time, diffusion processes have been used for modelling financial dynamics for a long time. For example the Ornstein-Uhlenbeck process (the simplest mean--reverting process) has been used to model non-speculative price processes. We discuss non--parametric estimation of these processes...

Molecular Dynamic Simulation of Water Vapor and Determination of Diffusion Characteristics in the Pore

Science.gov (United States)

Nikonov, Eduard G.; Pavluš, Miron; Popovičová, Mária

2018-02-01

One of the varieties of pores, often found in natural or artificial building materials, are the so-called blind pores of dead-end or saccate type. Three-dimensional model of such kind of pore has been developed in this work. This model has been used for simulation of water vapor interaction with individual pore by molecular dynamics in combination with the diffusion equation method. Special investigations have been done to find dependencies between thermostats implementations and conservation of thermodynamic and statistical values of water vapor - pore system. The two types of evolution of water - pore system have been investigated: drying and wetting of the pore. Full research of diffusion coefficient, diffusion velocity and other diffusion parameters has been made.

Molecular Dynamics Simulations of Grain Boundary and Bulk Diffusion in Metals.

Science.gov (United States)

Plimpton, Steven James

Diffusion is a microscopic mass transport mechanism that underlies many important macroscopic phenomena affecting the structural, electrical, and mechanical properties of metals. This thesis presents results from atomistic simulation studies of diffusion both in bulk and in the fast diffusion paths known as grain boundaries. Using the principles of molecular dynamics single boundaries are studied and their structure and dynamic properties characterized. In particular, tilt boundary bicrystal and bulk models of fcc Al and bcc alpha-Fe are simulated. Diffusion coefficients and activation energies for atomic motion are calculated for both models and compared to experimental data. The influence of the interatomic pair potential on the diffusion is studied in detail. A universal relation between the melting temperature that a pair potential induces in a simulated bulk model and the potential energy barrier height for atomic hopping is derived and used to correlate results for a wide variety of pair potentials. Using these techniques grain boundary and bulk diffusion coefficients for any fcc material can be estimated from simple static calculations without the need to perform more time-consuming dynamic simulations. The influences of two other factors on grain boundary diffusion are also studied because of the interest of the microelectronics industry in the diffusion related reliability problem known as electromigration. The first factor, known to affect the self diffusion rate of Al, is the presence of Cu impurity atoms in Al tilt boundaries. The bicrystal model for Al is seeded randomly with Cu atoms and a simple hybrid Morse potential used to model the Al-Cu interaction. While some effect due to the Cu is noted, it is concluded that pair potentials are likely an inadequate approximation for the alloy system. The second factor studied is the effect of the boundary orientation angle on the diffusion rate. Symmetric bcc Fe boundaries are relaxed to find optimal

Mapping the Diffusion Potential of a Reconstructed Au(111) Surface at Nanometer Scale with 2D Molecular Gas

International Nuclear Information System (INIS)

Yan Shi-Chao; Xie Nan; Gong Hui-Qi; Guo Yang; Shan Xin-Yan; Lu Xing-Hua; Sun Qian

2012-01-01

The adsorption and diffusion behaviors of benzene molecules on an Au(111) surface are investigated by low-temperature scanning tunneling microscopy. A herringbone surface reconstruction of the Au(111) surface is imaged with atomic resolution, and significantly different behaviors are observed for benzene molecules adsorbed on step edges and terraces. The electric field induced modification in the molecular diffusion potential is revealed with a 2D molecular gas model, and a new method is developed to map the diffusion potential over the reconstructed Au(111) surface at the nanometer scale. (condensed matter: structure, mechanical and thermal properties)

Glioblastoma update: molecular biology, diagnosis, treatment, response assessment, and translational clinical trials [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Frank Lieberman

2017-10-01

Full Text Available This is an exciting time in neuro-oncology. Discoveries elucidating the molecular mechanisms of oncogenesis and the molecular subtypes of glioblastoma multiforme (GBM have led to new diagnostic and classification schemes with more prognostic power than histology alone. Molecular profiling has become part of the standard neuropathological evaluation of GBM. Chemoradiation followed by adjuvant temozolomide remains the standard therapy for newly diagnosed GBM, but survival remains unsatisfactory. Patients with recurrent GBM continue to have a dismal prognosis, but neuro-oncology centers with active clinical trial programs are seeing a small but increasing cadre of patients with longer survival. Molecularly targeted therapeutics, personalized therapy based on molecular profiling of individual tumors, and immunotherapeutic strategies are all being evaluated and refined in clinical trials. Understanding of the molecular mechanisms of tumor-mediated immunosuppression, and specifically interactions between tumor cells and immune effector cells in the tumor microenvironment, has led to a new generation of immunotherapies, including vaccine and immunomodulatory strategies as well as T-cell-based treatments. Molecularly targeted therapies, chemoradiation, immunotherapies, and anti-angiogenic therapies have created the need to develop more reliable neuroimaging criteria for differentiating the effects of therapy from tumor progression and changes in blood–brain barrier physiology from treatment response. Translational clinical trials for patients with GBM now incorporate quantitative imaging using both magnetic resonance imaging and positron emission tomography techniques. This update presents a summary of the current standards for therapy for newly diagnosed and recurrent GBM and highlights promising translational research.

Non-Brownian diffusion in lipid membranes: Experiments and simulations.

Science.gov (United States)

Metzler, R; Jeon, J-H; Cherstvy, A G

2016-10-01

The dynamics of constituents and the surface response of cellular membranes-also in connection to the binding of various particles and macromolecules to the membrane-are still a matter of controversy in the membrane biophysics community, particularly with respect to crowded membranes of living biological cells. We here put into perspective recent single particle tracking experiments in the plasma membranes of living cells and supercomputing studies of lipid bilayer model membranes with and without protein crowding. Special emphasis is put on the observation of anomalous, non-Brownian diffusion of both lipid molecules and proteins embedded in the lipid bilayer. While single component, pure lipid bilayers in simulations exhibit only transient anomalous diffusion of lipid molecules on nanosecond time scales, the persistence of anomalous diffusion becomes significantly longer ranged on the addition of disorder-through the addition of cholesterol or proteins-and on passing of the membrane lipids to the gel phase. Concurrently, experiments demonstrate the anomalous diffusion of membrane embedded proteins up to macroscopic time scales in the minute time range. Particular emphasis will be put on the physical character of the anomalous diffusion, in particular, the occurrence of ageing observed in the experiments-the effective diffusivity of the measured particles is a decreasing function of time. Moreover, we present results for the time dependent local scaling exponent of the mean squared displacement of the monitored particles. Recent results finding deviations from the commonly assumed Gaussian diffusion patterns in protein crowded membranes are reported. The properties of the displacement autocorrelation function of the lipid molecules are discussed in the light of their appropriate physical anomalous diffusion models, both for non-crowded and crowded membranes. In the last part of this review we address the upcoming field of membrane distortion by elongated membrane

A molecular dynamics study on the oxygen diffusion in doped fluorites: the effect of the dopant distribution

Energy Technology Data Exchange (ETDEWEB)

Tarancon, A. [M2E/XaRMAE/IREC, Department of Advanced Materials for Energy Applications, Catalonia Institute for Energy Research (IREC), Josep Pla 2, Torre 2, B2, 08019 Barcelona (Spain); Morata, A.; Peiro, F. [MIND/XaRMAE/IN2UB, Department of Electronics, University of Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Dezanneau, G. [Laboratoire Structures, Proprietes et Modelisation des Solides, Grande Voie des Vignes, Ecole Centrale Paris, F-92295 Chatenay-Malabry Cedex (France)

2011-02-15

The effect of the dopant distribution on the oxygen diffusion in doped fluorites typically used for solid oxide fuel cells electrolyte applications has been analysed by using molecular dynamics simulations. The oxygen mass transport in both yttria-stabilized zirconia (YSZ) and gadolinia-doped ceria has been studied and compared in the range of temperatures between 1,159 and 1,959 K. A new methodology based on the analysis of local environments is used to describe the diffusion process at an atomic scale. Preferred vacancy migration pathways, most suitable conduction models, energy landscapes and jump efficiency have been detailed for each material. Finally, a particular case of non-random distribution of dopants in YSZ is presented in order to quantitatively evaluate the effect of the dopant pattern on the mass transport properties and the potential of the methodology developed here for understanding and foreseeing real configurations at the nanoscale. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

A model of non-Gaussian diffusion in heterogeneous media

Science.gov (United States)

Lanoiselée, Yann; Grebenkov, Denis S.

2018-04-01

Recent progress in single-particle tracking has shown evidence of the non-Gaussian distribution of displacements in living cells, both near the cellular membrane and inside the cytoskeleton. Similar behavior has also been observed in granular materials, turbulent flows, gels and colloidal suspensions, suggesting that this is a general feature of diffusion in complex media. A possible interpretation of this phenomenon is that a tracer explores a medium with spatio-temporal fluctuations which result in local changes of diffusivity. We propose and investigate an ergodic, easily interpretable model, which implements the concept of diffusing diffusivity. Depending on the parameters, the distribution of displacements can be either flat or peaked at small displacements with an exponential tail at large displacements. We show that the distribution converges slowly to a Gaussian one. We calculate statistical properties, derive the asymptotic behavior and discuss some implications and extensions.

Word reading and translation in bilinguals: The impact of formal and informal translation expertise

Directory of Open Access Journals (Sweden)

Adolfo M. García

2014-11-01

Full Text Available Studies on bilingual word reading and translation have examined the effects of lexical variables (e.g., concreteness, cognate status by comparing groups of non-translators with varying levels of L2 proficiency. However, little attention has been paid to another relevant factor: translation expertise (TI. To explore this issue, we administered word reading and translation tasks to two groups of non-translators possessing different levels of informal TI (Experiment 1, and to three groups of bilinguals possessing different levels of translation training (Experiment 2. Reaction-time recordings showed that in all groups reading was faster than translation and unaffected by concreteness and cognate effects. Conversely, in both experiments, all groups translated concrete and cognate words faster than abstract and non-cognate words, respectively. Notably, an advantage of backward over forward translation was observed only for low-proficiency non-translators (in Experiment 1. Also, in Experiment 2, the modifications induced by translation expertise were more marked in the early than in the late stages of training and practice. The results suggest that TI contributes to modulating inter-equivalent connections in bilingual memory.

Communication: Influence of external static and alternating electric fields on water from long-time non-equilibrium ab initio molecular dynamics

Science.gov (United States)

Futera, Zdenek; English, Niall J.

2017-07-01

The response of water to externally applied electric fields is of central relevance in the modern world, where many extraneous electric fields are ubiquitous. Historically, the application of external fields in non-equilibrium molecular dynamics has been restricted, by and large, to relatively inexpensive, more or less sophisticated, empirical models. Here, we report long-time non-equilibrium ab initio molecular dynamics in both static and oscillating (time-dependent) external electric fields, therefore opening up a new vista in rigorous studies of electric-field effects on dynamical systems with the full arsenal of electronic-structure methods. In so doing, we apply this to liquid water with state-of-the-art non-local treatment of dispersion, and we compute a range of field effects on structural and dynamical properties, such as diffusivities and hydrogen-bond kinetics.

Self and transport diffusivity of CO2 in the metal-organic framework MIL-47(V) explored by quasi-elastic neutron scattering experiments and molecular dynamics simulations.

Science.gov (United States)

Salles, Fabrice; Jobic, Hervé; Devic, Thomas; Llewellyn, Philip L; Serre, Christian; Férey, Gérard; Maurin, Guillaume

2010-01-26

Quasi-elastic neutron scattering measurements are combined with molecular dynamics simulations to determine the self-diffusivity, corrected diffusivity, and transport diffusivity of CO(2) in the metal-organic framework MIL-47(V) (MIL = Materials Institut Lavoisier) over a wide range of loading. The force field used for describing the host/guest interactions is first validated on the thermodynamics of the MIL-47(V)/CO(2) system, prior to being transferred to the investigations of the dynamics. A decreasing profile is then deduced for D(s) and D(o) whereas D(t) presents a non monotonous evolution with a slight decrease at low loading followed by a sharp increase at higher loading. Such decrease of D(t) which has never been evidenced in any microporous systems comes from the atypical evolution of the thermodynamic correction factor that reaches values below 1 at low loading. This implies that, due to intermolecular interactions, the CO(2) molecules in MIL-47(V) do not behave like an ideal gas. Further, molecular simulations enabled us to elucidate unambiguously a 3D diffusion mechanism within the pores of MIL-47(V).

Derivatization and diffusive motion of molecular fullerenes: Ab initio and atomistic simulations

Energy Technology Data Exchange (ETDEWEB)

Berdiyorov, G., E-mail: gberdiyorov@qf.org.qa; Tabet, N. [Qatar Environment and Energy Research Institute (QEERI), Hamad Ben Khalifa University (HBKU), Qatar Foundation, P.O. Box 5825, Doha (Qatar); Harrabi, K. [Department of Physics, King Fahd University of Petroleum and Minerals, 31261 Dhahran (Saudi Arabia); Mehmood, U.; Hussein, I. A. [Department of Chemical Engineering, King Fahd University of Petroleum and Minerals, 31261 Dharan (Saudi Arabia); Peeters, F. M. [Departement Fysica, Universiteit Antwerpen, Groenenborgerlaan 171, B-2020 Antwerpen (Belgium); Zhang, J. [Department of Materials and London Centre for Nanotechnology, Imperial College London, SW7 2AZ London (United Kingdom); McLachlan, M. A. [Department of Materials and Centre for Plastic Electronics, Imperial College London, SW7 2AZ London (United Kingdom)

2015-07-14

Using first principles density functional theory in combination with the nonequilibrium Green's function formalism, we study the effect of derivatization on the electronic and transport properties of C{sub 60} fullerene. As a typical example, we consider [6,6]-phenyl-C{sub 61}-butyric acid methyl ester (PCBM), which forms one of the most efficient organic photovoltaic materials in combination with electron donating polymers. Extra peaks are observed in the density of states (DOS) due to the formation of new electronic states localized at/near the attached molecule. Despite such peculiar behavior in the DOS of an isolated molecule, derivatization does not have a pronounced effect on the electronic transport properties of the fullerene molecular junctions. Both C{sub 60} and PCBM show the same response to finite voltage biasing with new features in the transmission spectrum due to voltage induced delocalization of some electronic states. We also study the diffusive motion of molecular fullerenes in ethanol solvent and inside poly(3-hexylthiophene) lamella using reactive molecular dynamics simulations. We found that the mobility of the fullerene reduces considerably due to derivatization; the diffusion coefficient of C{sub 60} is an order of magnitude larger than the one for PCBM.

Stochastic models for surface diffusion of molecules

Energy Technology Data Exchange (ETDEWEB)

Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

2014-07-28

We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

Non-adiabatic molecular dynamic simulations of opening reaction of molecular junctions

Czech Academy of Sciences Publication Activity Database

Zobač, Vladimír; Lewis, J.P.; Jelínek, Pavel

2016-01-01

Roč. 27, č. 28 (2016), 1-8, č. článku 285202. ISSN 0957-4484 R&D Projects: GA ČR(CZ) GA14-02079S Institutional support: RVO:68378271 Keywords : non-adiabatic molecular dynamics * molecular junctions * molecular switches * DFT Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.440, year: 2016

Why Translation Is Difficult

DEFF Research Database (Denmark)

Carl, Michael; Schaeffer, Moritz Jonas

2017-01-01

The paper develops a definition of translation literality that is based on the syntactic and semantic similarity of the source and the target texts. We provide theoretical and empirical evidence that absolute literal translations are easy to produce. Based on a multilingual corpus of alternative...... translations we investigate the effects of cross-lingual syntactic and semantic distance on translation production times and find that non-literality makes from-scratch translation and post-editing difficult. We show that statistical machine translation systems encounter even more difficulties with non-literality....

A molecular dynamics investigation of the unusual concentration dependencies of Fick diffusivities in silica mesopores

NARCIS (Netherlands)

Krishna, R.; van Baten, J.M.

2011-01-01

Molecular Dynamics (MD) simulations were carried out to determine the self-diffusivitiy, Di,self, the Maxwell-Stefan diffusivity, Ði, and the Fick diffusivity, Di, for methane (C1), ethane (C2), propane (C3), n-butane (nC4), n-pentane (nC5), n-hexane (nC6), n-heptane (nC7), and cyclohexane (cC6) in

Peclet number as affected by molecular diffusion controls transient anomalous transport in alluvial aquifer-aquitard complexes

Science.gov (United States)

Zhang, Yong; Green, Christopher T.; Tick, Geoffrey R.

2015-01-01

This study evaluates the role of the Peclet number as affected by molecular diffusion in transient anomalous transport, which is one of the major knowledge gaps in anomalous transport, by combining Monte Carlo simulations and stochastic model analysis. Two alluvial settings containing either short- or long-connected hydrofacies are generated and used as media for flow and transport modeling. Numerical experiments show that 1) the Peclet number affects both the duration of the power-law segment of tracer breakthrough curves (BTCs) and the transition rate from anomalous to Fickian transport by determining the solute residence time for a given low-permeability layer, 2) mechanical dispersion has a limited contribution to the anomalous characteristics of late-time transport as compared to molecular diffusion due to an almost negligible velocity in floodplain deposits, and 3) the initial source dimensions only enhance the power-law tail of the BTCs at short travel distances. A tempered stable stochastic (TSS) model is then applied to analyze the modeled transport. Applications show that the time-nonlocal parameters in the TSS model relate to the Peclet number, Pe. In particular, the truncation parameter in the TSS model increases nonlinearly with a decrease in Pe due to the decrease of the mean residence time, and the capacity coefficient increases with an increase in molecular diffusion which is probably due to the increase in the number of immobile particles. The above numerical experiments and stochastic analysis therefore reveal that the Peclet number as affected by molecular diffusion controls transient anomalous transport in alluvial aquifer–aquitard complexes.

Visual detection of glial cell line-derived neurotrophic factor based on a molecular translator and isothermal strand-displacement polymerization reaction.

Science.gov (United States)

Zhang, Li-Yong; Xing, Tao; Du, Li-Xin; Li, Qing-Min; Liu, Wei-Dong; Wang, Ji-Yue; Cai, Jing

2015-01-01

Glial cell line-derived neurotrophic factor (GDNF) is a small protein that potently promotes the survival of many types of neurons. Detection of GDNF is vital to monitoring the survival of sympathetic and sensory neurons. However, the specific method for GDNF detection is also un-discovered. The purpose of this study is to explore the method for protein detection of GDNF. A novel visual detection method based on a molecular translator and isothermal strand-displacement polymerization reaction (ISDPR) has been proposed for the detection of GDNF. In this study, a molecular translator was employed to convert the input protein to output deoxyribonucleic acid signal, which was further amplified by ISDPR. The product of ISDPR was detected by a lateral flow biosensor within 30 minutes. This novel visual detection method based on a molecular translator and ISDPR has very high sensitivity and selectivity, with a dynamic response ranging from 1 pg/mL to 10 ng/mL, and the detection limit was 1 pg/mL of GDNF. This novel visual detection method exhibits high sensitivity and selectivity, which is very simple and universal for GDNF detection to help disease therapy in clinical practice.

Molecular structure effects on the post irradiation diffusion in polymer gel dosimeters

Energy Technology Data Exchange (ETDEWEB)

Mattea, F.; Romero, M.; Strumia, M. [Instituto Multidisciplinario de Biologia Vegetal / CONICET, Universidad Nacional de Cordoba, Departamento de Quimica Organica, Ciudad Universitaria, 5000 Cordoba (Argentina); Vedelago, J. [Laboratorio de Investigaciones e Instrumentacion en Fisica Aplicada a la Medicina e Imagenes por Rayos X, Laboratorio 448 FaMAF - UNC, Ciudad Universitaria, 5000 Cordoba (Argentina); Quiroga, A. [Centro de Investigacion y Estudios de Matematica / CONICET, Oficina 318 FaMAF - UNC, Ciudad Universitaria, 5000 Cordoba (Argentina); Valente, M., E-mail: fmattea@gmail.com [Instituto de Fisica E. Gaviola / CONICET, LIIFAMIRx, Oficina 102 FaMAF - UNC, 5000 Cordoba (Argentina)

2014-08-15

Polymer gel dosimeters have specific advantages for recording 3D radiation dose distribution representing a key factor for most of the therapeutic and diagnostic radiation techniques. Radiation-induced polymerization and crosslinking reactions that take place in the dosimeter have been studied for different monomers like acrylamide and N,N-methylene-bis acrylamide (Bis) and most recently for less toxic monomers like N-isopropylacrylamide and Bis. In this work a novel system based on itaconic acid and Bis is proposed, the radical polymerization or gel formation of these monomers has been already studied for the formation of an hydrogel for non dosimetric applications and their reactivity are comparable with the already mentioned systems. Although the 3D structure is maintained after the dosimeter has been irradiated, it is not possible to eliminate the diffusion of the reacted and monomer species in regions of dose gradients within the gel after irradiation. As a consequence the dose information of the dosimeters loose quality over time. The mobility within the gelatin structure of the already mentioned species is related to their chemical structure, and nature. In this work the effect of changes in the chemical structure of the monomers over the dosimetric sensitivity and over the post-irradiation diffusion of species is studied. One of the acrylic acid groups of the itaconic acid molecule is modified to obtain molecules with similar reactivity but different molecular sizes. Dosimetric systems with these modified species, Bis, an antioxidant to avoid oxygen polymerization inhibition, water and gelatin are irradiated in an X-ray tomography at different doses, and the resulting dosimeters are characterized by Raman spectroscopy and optical absorbance to study their feasibility and capabilities as dosimetric systems, and by optical-CT to analyze the diffusion degree after being irradiated. (Author)

Molecular structure effects on the post irradiation diffusion in polymer gel dosimeters

International Nuclear Information System (INIS)

Mattea, F.; Romero, M.; Strumia, M.; Vedelago, J.; Quiroga, A.; Valente, M.

2014-08-01

Polymer gel dosimeters have specific advantages for recording 3D radiation dose distribution representing a key factor for most of the therapeutic and diagnostic radiation techniques. Radiation-induced polymerization and crosslinking reactions that take place in the dosimeter have been studied for different monomers like acrylamide and N,N-methylene-bis acrylamide (Bis) and most recently for less toxic monomers like N-isopropylacrylamide and Bis. In this work a novel system based on itaconic acid and Bis is proposed, the radical polymerization or gel formation of these monomers has been already studied for the formation of an hydrogel for non dosimetric applications and their reactivity are comparable with the already mentioned systems. Although the 3D structure is maintained after the dosimeter has been irradiated, it is not possible to eliminate the diffusion of the reacted and monomer species in regions of dose gradients within the gel after irradiation. As a consequence the dose information of the dosimeters loose quality over time. The mobility within the gelatin structure of the already mentioned species is related to their chemical structure, and nature. In this work the effect of changes in the chemical structure of the monomers over the dosimetric sensitivity and over the post-irradiation diffusion of species is studied. One of the acrylic acid groups of the itaconic acid molecule is modified to obtain molecules with similar reactivity but different molecular sizes. Dosimetric systems with these modified species, Bis, an antioxidant to avoid oxygen polymerization inhibition, water and gelatin are irradiated in an X-ray tomography at different doses, and the resulting dosimeters are characterized by Raman spectroscopy and optical absorbance to study their feasibility and capabilities as dosimetric systems, and by optical-CT to analyze the diffusion degree after being irradiated. (Author)

Asymptotic analysis of discrete schemes for non-equilibrium radiation diffusion

International Nuclear Information System (INIS)

Cui, Xia; Yuan, Guang-wei; Shen, Zhi-jun

2016-01-01

Motivated by providing well-behaved fully discrete schemes in practice, this paper extends the asymptotic analysis on time integration methods for non-equilibrium radiation diffusion in [2] to space discretizations. Therein studies were carried out on a two-temperature model with Larsen's flux-limited diffusion operator, both the implicitly balanced (IB) and linearly implicit (LI) methods were shown asymptotic-preserving. In this paper, we focus on asymptotic analysis for space discrete schemes in dimensions one and two. First, in construction of the schemes, in contrast to traditional first-order approximations, asymmetric second-order accurate spatial approximations are devised for flux-limiters on boundary, and discrete schemes with second-order accuracy on global spatial domain are acquired consequently. Then by employing formal asymptotic analysis, the first-order asymptotic-preserving property for these schemes and furthermore for the fully discrete schemes is shown. Finally, with the help of manufactured solutions, numerical tests are performed, which demonstrate quantitatively the fully discrete schemes with IB time evolution indeed have the accuracy and asymptotic convergence as theory predicts, hence are well qualified for both non-equilibrium and equilibrium radiation diffusion. - Highlights: • Provide AP fully discrete schemes for non-equilibrium radiation diffusion. • Propose second order accurate schemes by asymmetric approach for boundary flux-limiter. • Show first order AP property of spatially and fully discrete schemes with IB evolution. • Devise subtle artificial solutions; verify accuracy and AP property quantitatively. • Ideas can be generalized to 3-dimensional problems and higher order implicit schemes.

Clinical translation of photobiomodulation therapy using evidences from precision molecular pathway analyses (Conference Presentation)

Science.gov (United States)

Arany, Praveen

2017-02-01

Can `light' be a Drug? To satisfy this definition as a pharmaceutical agent, light must be absorbed and change bodily function. Much evidence from our understanding of our visual cycle and Vitamin D metabolism have all noted this phenomenon. Advances in optophotonic technologies along with a better understanding of light-tissue interactions, especially in in vivo optical imaging and optogenetics, are spearheading the popularity of biophotonics in biology and medicine. The use of lasers and light devices at high doses in dermatology, ophthalmology, oncology and dentistry are now considered mainstream for certain clinical applications such as surgery, skin rejuvenation, ocular and soft tissue recontouring, anti-tumor and anti-microbial photodynamic therapy. In contrast, therapeutic use of low dose biophotonics devices is called Low Level Light / Laser Therapy (LLLT), now termed Photobiomodulation (PBM) Therapy. This therapy is defined as a non-thermal use of non-ionizing forms of electromagnetic radiation to alleviate pain, inflammation, modulating the immune responses and promoting wound healing and tissue regeneration. Surprisingly, despite vast volumes of scientific literature from both clinical and laboratory studies noting the phenomenological evidences for this innovative therapy, limited mechanistic insights have prevented the development of rigorous, reproducible clinical protocols. This presentation will outline our current efforts at ongoing efforts in our group to assess molecular pathways and precisely define clinical treatment variables to enable clinical translation with PBM therapies.

Translating research into practice: the role of provider-based research networks in the diffusion of an evidence-based colon cancer treatment innovation.

Science.gov (United States)

Carpenter, William R; Meyer, Anne-Marie; Wu, Yang; Qaqish, Bahjat; Sanoff, Hanna K; Goldberg, Richard M; Weiner, Bryan J

2012-08-01

Provider-based research networks (PBRNs)--collaborative research partnerships between academic centers and community-based practitioners--are a promising model for accelerating the translation of research into practice; however, empirical evidence of accelerated translation is limited. Oxaliplatin in adjuvant combination chemotherapy is an innovation with clinical trial-proven survival benefit compared with prior therapies. The goal of this study is to examine the diffusion of oxaliplatin into community practice, and whether affiliation with the National Cancer Institute's (NCI's) Community Clinical Oncology Program (CCOP)--a nationwide cancer-focused PBRN--is associated with accelerated innovation adoption. This retrospective observational study used linked Surveillance, Epidemiology, and End Results-Medicare and NCI CCOP data to examine Medicare participants with stage III colon cancer initiating treatment in 2003 through 2006, the years surrounding oxaliplatin's Food and Drug Administration approval. A fixed-effects analysis examined chemotherapy use among patients treated outside academic centers at CCOP-affiliated practices compared with non-CCOP practices. Two-group modeling controlled for multiple levels of clustering, year of chemotherapy initiation, tumor characteristics, patient age, race, comorbidity, Medicaid dual-eligibility status, and education. Of 4055 community patients, 35% received 5-fluoruracil, 20% received oxaliplatin, 7% received another chemotherapy, and 38% received no chemotherapy. Twenty-five percent of CCOP patients received oxaliplatin, compared with 19% of non-CCOP patients. In multivariable analysis, CCOP exposure was associated with higher odds of receiving guideline-concordant treatment in general, and oxaliplatin specifically. These findings contribute to a growing set of evidence linking PBRNs with a greater probability of receiving treatment innovations and high-quality cancer care, with implications for clinical and research

Norovirus translation requires an interaction between the C Terminus of the genome-linked viral protein VPg and eukaryotic translation initiation factor 4G.

Science.gov (United States)

Chung, Liliane; Bailey, Dalan; Leen, Eoin N; Emmott, Edward P; Chaudhry, Yasmin; Roberts, Lisa O; Curry, Stephen; Locker, Nicolas; Goodfellow, Ian G

2014-08-01

Viruses have evolved a variety of mechanisms to usurp the host cell translation machinery to enable translation of the viral genome in the presence of high levels of cellular mRNAs. Noroviruses, a major cause of gastroenteritis in man, have evolved a mechanism that relies on the interaction of translation initiation factors with the virus-encoded VPg protein covalently linked to the 5' end of the viral RNA. To further characterize this novel mechanism of translation initiation, we have used proteomics to identify the components of the norovirus translation initiation factor complex. This approach revealed that VPg binds directly to the eIF4F complex, with a high affinity interaction occurring between VPg and eIF4G. Mutational analyses indicated that the C-terminal region of VPg is important for the VPg-eIF4G interaction; viruses with mutations that alter or disrupt this interaction are debilitated or non-viable. Our results shed new light on the unusual mechanisms of protein-directed translation initiation. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Molecular Dynamics and Monte Carlo simulations resolve apparent diffusion rate differences for proteins confined in nanochannels

Energy Technology Data Exchange (ETDEWEB)

Tringe, J.W., E-mail: tringe2@llnl.gov [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA (United States); Ileri, N. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA (United States); Department of Chemical Engineering & Materials Science, University of California, Davis, CA (United States); Levie, H.W. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA (United States); Stroeve, P.; Ustach, V.; Faller, R. [Department of Chemical Engineering & Materials Science, University of California, Davis, CA (United States); Renaud, P. [Swiss Federal Institute of Technology, Lausanne, (EPFL) (Switzerland)

2015-08-18

Highlights: • WGA proteins in nanochannels modeled by Molecular Dynamics and Monte Carlo. • Protein surface coverage characterized by atomic force microscopy. • Models indicate transport characteristics depend strongly on surface coverage. • Results resolve of a four orders of magnitude difference in diffusion coefficient values. - Abstract: We use Molecular Dynamics and Monte Carlo simulations to examine molecular transport phenomena in nanochannels, explaining four orders of magnitude difference in wheat germ agglutinin (WGA) protein diffusion rates observed by fluorescence correlation spectroscopy (FCS) and by direct imaging of fluorescently-labeled proteins. We first use the ESPResSo Molecular Dynamics code to estimate the surface transport distance for neutral and charged proteins. We then employ a Monte Carlo model to calculate the paths of protein molecules on surfaces and in the bulk liquid transport medium. Our results show that the transport characteristics depend strongly on the degree of molecular surface coverage. Atomic force microscope characterization of surfaces exposed to WGA proteins for 1000 s show large protein aggregates consistent with the predicted coverage. These calculations and experiments provide useful insight into the details of molecular motion in confined geometries.

Contribution of the actomyosin motor to the temperature-dependent translational diffusion of water by cytoplasmic streaming in Elodea canadensis cells.

Science.gov (United States)

Vorob'ev, V N; Anisimov, A V; Dautova, N R

2004-12-01

The extent to which the actomyosin motor responsible for cytoplasmic streaming contributes to the translational diffusion of water in Elodea canadensis cells was studied by a nuclear magnetic resonance (NMR) spin-echo technique. The relative contribution of the actomyosin motor was determined from the corresponding apparent diffusion coefficient by the Einstein-Smolukhovsky relation. It is equal to the difference between the diffusional displacements of the cytoplasmic and the bulk water (deltaX). The NMR data show that the temperature dependence of deltaX is humpshaped, which is characteristic of enzyme reactions. At the same time, the apparent diffusion coefficient of cytoplasmic water increases with an increase in temperature. The most significant contribution of the actomyosin motor to deltaX is observed at temperatures below 20 degrees C. Within the temperature range of 20 to 33 degrees C, deltaX changes only slightly, and a further increase in temperature reduces deltaX to zero.

Field theory of absorbing phase transitions with a non-diffusive conserved field

International Nuclear Information System (INIS)

Pastor-Satorras, R.; Vespignani, A.

2000-04-01

We investigate the critical behavior of a reaction-diffusion system exhibiting a continuous absorbing-state phase transition. The reaction-diffusion system strictly conserves the total density of particles, represented as a non-diffusive conserved field, and allows an infinite number of absorbing configurations. Numerical results show that it belongs to a wide universality class that also includes stochastic sandpile models. We derive microscopically the field theory representing this universality class. (author)

The Role of Molecular Diagnostics in the Management of Patients with Gliomas.

Science.gov (United States)

Wirsching, Hans-Georg; Weller, Michael

2016-10-01

The revised World Health Organization (WHO) classification of tumors of the central nervous system of 2016 combines biology-driven molecular marker diagnostics with classical histological cancer diagnosis. Reclassification of gliomas by molecular similarity beyond histological boundaries improves outcome prediction and will increasingly guide treatment decisions. This change in paradigms implies more personalized and eventually more efficient therapeutic approaches, but the era of molecular targeted therapies for gliomas is yet at its onset. Promising results of molecularly targeted therapies in genetically less complex gliomas with circumscribed growth such as subependymal giant cell astrocytoma or pilocytic astrocytoma support further development of molecularly targeted therapies. In diffuse gliomas, several molecular markers that predict benefit from alkylating agent chemotherapy have been identified in recent years. For example, co-deletion of chromosome arms 1p and 19q predicts benefit from polychemotherapy with procarbazine, CCNU (lomustine), and vincristine (PCV) in patients with anaplastic oligodendroglioma, and the presence of 1p/19q co-deletion was integrated as a defining feature of oligodendroglial tumors in the revised WHO classification. However, the tremendous increase in knowledge of molecular drivers of diffuse gliomas on genomic, epigenetic, and gene expression levels has not yet translated into effective molecular targeted therapies. Multiple reasons account for the failure of early clinical trials of molecularly targeted therapies in diffuse gliomas, including the lack of molecular entry controls as well as pharmacokinetic and pharmacodynamics issues, but the key challenge of specifically targeting the molecular backbone of diffuse gliomas is probably extensive clonal heterogeneity. A more profound understanding of clonal selection, alternative activation of oncogenic signaling pathways, and genomic instability is warranted to identify effective

Mass transfer of SCWO processes: Molecular diffusion and mass transfer coefficients of inorganic nitrate species in sub- and supercritical water

Energy Technology Data Exchange (ETDEWEB)

Goemans, M.G.E.; Gloyna, E.F. [Univ. of Texas, Austin, TX (United States). Dept. of Civil Engineering; Buelow, S.J. [Los Alamos National Lab., NM (United States)

1996-04-01

Molecular diffusion coefficients of lithium-, sodium-, potassium-, cesium-, calcium-, and strontium nitrate in subcritical water were determined by analysis of Taylor dispersion profiles. Pressures ranged from 300 to 500 bar at temperatures ranging from 25{degrees}C to 300{degrees}C. The reported diffusion values were determined at infinite dilution. Molecular diffusion coefficients were 10 to 20 times faster in near-critical subcritical water than in water at ambient temperature and pressure (ATP). These findings implied that the diffusion rates were more liquid like than they were gas like, hence experimental results were correlated with diffusion models for liquids. The subcritical diffusion data presented in this work, and supercritical diffusion results published elsewhere were correlated with hydrodynamic diffusion equations. Both the Wilke-Chang correlation and the Stokes-Einstein equation yielded predictions within 10% of the experimental results if the structure of the diffusing species could be estimated. The effect of the increased diffusion rates on mass transfer rates in supercritical water oxidation applications was quantified, with emphasis on heterogeneous oxidation processes. This study and results published elsewhere showed that diffusion limited conditions are much more likely to be encountered in SCWO processes than commonly acknowledged.

Renal water molecular diffusion characteristics in healthy native kidneys: assessment with diffusion tensor MR imaging.

Directory of Open Access Journals (Sweden)

Zhenfeng Zheng

Full Text Available BACKGROUND: To explore the characteristics of diffusion tensor imaging (DTI and magnetic resonance (MR imaging in healthy native kidneys. METHODS: Seventy-three patients without chronic kidney disease underwent DTI-MRI with spin echo-echo planar (SE-EPI sequences accompanied by an array spatial sensitivity encoding technique (ASSET. Cortical and medullary mean, axial and radial diffusivity (MD, AD and RD, fractional anisotropy (FA and primary, secondary and tertiary eigenvalues (λ1, λ2, λ3 were analysed in both kidneys and in different genders. RESULTS: Cortical MD, λ2, λ3, and RD values were higher than corresponding medullary values. The cortical FA value was lower than the medullary FA value. Medullary λ1 and RD values in the left kidney were lower than in the right kidney. Medullary λ2, and λ3 values in women were higher than those in men. Medullary FA values in women were lower than those in men. Medullary FA (r = 0.351, P = 0.002 and λ1 (r = 0.277, P = 0.018 positively correlated with eGFR. Medullary FA (r = -0.25, P = 0.033 negatively correlated with age. CONCLUSIONS: Renal water molecular diffusion differences exist in human kidneys and genders. Age and eGFR correlate with medullary FA and primary eigenvalue.

A non-local structural derivative model for characterization of ultraslow diffusion in dense colloids

Science.gov (United States)

Liang, Yingjie; Chen, Wen

2018-03-01

Ultraslow diffusion has been observed in numerous complicated systems. Its mean squared displacement (MSD) is not a power law function of time, but instead a logarithmic function, and in some cases grows even more slowly than the logarithmic rate. The distributed-order fractional diffusion equation model simply does not work for the general ultraslow diffusion. Recent study has used the local structural derivative to describe ultraslow diffusion dynamics by using the inverse Mittag-Leffler function as the structural function, in which the MSD is a function of inverse Mittag-Leffler function. In this study, a new stretched logarithmic diffusion law and its underlying non-local structural derivative diffusion model are proposed to characterize the ultraslow diffusion in aging dense colloidal glass at both the short and long waiting times. It is observed that the aging dynamics of dense colloids is a class of the stretched logarithmic ultraslow diffusion processes. Compared with the power, the logarithmic, and the inverse Mittag-Leffler diffusion laws, the stretched logarithmic diffusion law has better precision in fitting the MSD of the colloidal particles at high densities. The corresponding non-local structural derivative diffusion equation manifests clear physical mechanism, and its structural function is equivalent to the first-order derivative of the MSD.

Observational Constraints for Modeling Diffuse Molecular Clouds

Science.gov (United States)

Federman, S. R.

2014-02-01

Ground-based and space-borne observations of diffuse molecular clouds suggest a number of areas where further improvements to modeling efforts is warranted. I will highlight those that have the widest applicability. The range in CO fractionation caused by selective isotope photodissociation, in particular the large 12C16O/13C16O ratios observed toward stars in Ophiuchus, is not reproduced well by current models. Our ongoing laboratory measurements of oscillator strengths and predissociation rates for Rydberg transitions in CO isotopologues may help clarify the situtation. The CH+ abundance continues to draw attention. Small scale structure seen toward ζ Per may provide additional constraints on the possible synthesis routes. The connection between results from optical transitions and those from radio and sub-millimeter wave transitions requires further effort. A study of OH+ and OH toward background stars reveals that these species favor different environments. This brings to focus the need to model each cloud along the line of sight separately, and to allow the physical conditions to vary within an individual cloud, in order to gain further insight into the chemistry. Now that an extensive set of data on molecular excitation is available, the models should seek to reproduce these data to place further constraints on the modeling results.

To What Degree Does Handling Concrete Molecular Models Promote the Ability to Translate and Coordinate between 2D and 3D Molecular Structure Representations? A Case Study with Algerian Students

Science.gov (United States)

Mohamed-Salah, Boukhechem; Alain, Dumon

2016-01-01

This study aims to assess whether the handling of concrete ball-and-stick molecular models promotes translation between diagrammatic representations and a concrete model (or vice versa) and the coordination of the different types of structural representations of a given molecular structure. Forty-one Algerian undergraduate students were requested…

Hydroxyl and molecular H2O diffusivity in a haploandesitic melt

Science.gov (United States)

Ni, Huaiwei; Xu, Zhengjiu; Zhang, Youxue

2013-02-01

H2O diffusion in a haploandesitic melt (a high-silica and Fe-free andesitic melt, NBO/T = 0.173) has been investigated at 1 GPa in a piston-cylinder apparatus. We adopted a double diffusion couple technique, in which one couple was composed of a nominally anhydrous glass with 0.01 wt.% H2O and a hydrous glass with 5.7 wt.% H2O, and the other contained the same nominally anhydrous glass and a hydrous glass with 3.3 wt.% H2O. Both couples were annealed in a single experimental run and hence experienced exactly the same P-T history, which is crucial for constraining the dependence of H2O diffusivity on water content. H2O concentration profiles were measured by both Fourier transform infrared (FTIR) microspectroscopy and confocal Raman microspectroscopy. Nearly identical profiles were obtained from Raman and FTIR methods for profile length >1 mm (produced at 1619-1842 K). By contrast, for profile lengths <100 μm (produced at 668-768 K), FTIR profiles show marked convolution effects compared to Raman profiles. A comparison between the short FTIR and Raman profiles indicates that the real spatial resolution (FWHM) of FTIR analyses is about 28 μm for a 7 μm wide aperture on ˜200 μm thick glasses. While the short profiles are not reliable for quantitative modeling, the long diffusion profiles at superliquidus temperatures can be fit reasonably well by a diffusivity model previously developed for felsic melts, in which molecular H2O (H2Om) is the only diffusive species and its diffusivity (D) increases exponentially with the content of total water (H2Ot). However, there is noticeable misfit of the data at low H2Ot concentrations, suggesting that OH diffusivity (DOH) cannot be neglected in this andesitic melt at high temperatures and low water contents. We hence develop a new fitting procedure that simultaneously fits both diffusion profiles from a single experimental run and accounts for the roles of both OH and H2Om diffusion. With this procedure, DOH/D is constrained

Molecular dynamics simulation of helium and oxygen diffusion in UO2±x

International Nuclear Information System (INIS)

Govers, K.; Lemehov, S.; Hou, M.; Verwerft, M.

2009-01-01

Atomic scale simulation techniques based on empirical potentials have been considered in the present work to get insight on helium diffusion in uranium dioxide. By varying the stoichiometry, together with the system temperature, the performed molecular dynamics simulations indicate two diffusion regimes for He. The first one presents a low activation energy (0.5 eV) and suggests oxygen vacancies assisted migration. This regime seems to provide the major contribution to diffusion when structural defects are present (extrinsic defects, imposed, e.g. by the stoichiometry). The second regime presents a higher activation energy, around 2 eV, and dominates in the higher temperature range or at perfect stoichiometry, suggesting an intrinsic migration process. Considering the dependence of He behaviour with oxygen defects, oxygen diffusion has been considered as well in the different stoichiometry domains. Finally, further investigations were made with nudged elastic bands calculations for a better interpretation of the operating migration mechanisms, both for He and O.

Translational Aspects of Diet and Non-Alcoholic Fatty Liver Disease

Directory of Open Access Journals (Sweden)

Nicolas Goossens

2017-09-01

Full Text Available Non-alcoholic fatty liver disease (NAFLD is a spectrum of diseases ranging from simple steatosis without inflammation or fibrosis to nonalcoholic steatohepatitis (NASH. Despite the strong association between dietary factors and NAFLD, no dietary animal model of NAFLD fully recapitulates the complex metabolic and histological phenotype of the disease, although recent models show promise. Although animal models have significantly contributed to our understanding of human diseases, they have been less successful in accurate translation to predict effective treatment strategies. We discuss strategies to overcome this challenge, in particular the adoption of big data approaches combining clinical phenotype, genomic heterogeneity, transcriptomics, and metabolomics changes to identify the ideal NAFLD animal model for a given scientific question or to test a given drug. We conclude by noting that novel big data approaches may help to bridge the translational gap for selecting dietary models of NAFLD.

The molecular biology in wound healing & non-healing wound.

Science.gov (United States)

Qing, Chun

2017-08-01

The development of molecular biology and other new biotechnologies helps us to recognize the wound healing and non-healing wound of skin in the past 30 years. This review mainly focuses on the molecular biology of many cytokines (including growth factors) and other molecular factors such as extracellular matrix (ECM) on wound healing. The molecular biology in cell movement such as epidermal cells in wound healing was also discussed. Moreover many common chronic wounds such as pressure ulcers, leg ulcers, diabetic foot wounds, venous stasis ulcers, etc. usually deteriorate into non-healing wounds. Therefore the molecular biology such as advanced glycation end products (AGEs) and other molecular factors in diabetes non-healing wounds were also reviewed. Copyright © 2017 Daping Hospital and the Research Institute of Surgery of the Third Military Medical University. Production and hosting by Elsevier B.V. All rights reserved.

Prediction and validation of diffusion coefficients in a model drug delivery system using microsecond atomistic molecular dynamics simulation and vapour sorption analysis.

Science.gov (United States)

Forrey, Christopher; Saylor, David M; Silverstein, Joshua S; Douglas, Jack F; Davis, Eric M; Elabd, Yossef A

2014-10-14

Diffusion of small to medium sized molecules in polymeric medical device materials underlies a broad range of public health concerns related to unintended leaching from or uptake into implantable medical devices. However, obtaining accurate diffusion coefficients for such systems at physiological temperature represents a formidable challenge, both experimentally and computationally. While molecular dynamics simulation has been used to accurately predict the diffusion coefficients, D, of a handful of gases in various polymers, this success has not been extended to molecules larger than gases, e.g., condensable vapours, liquids, and drugs. We present atomistic molecular dynamics simulation predictions of diffusion in a model drug eluting system that represent a dramatic improvement in accuracy compared to previous simulation predictions for comparable systems. We find that, for simulations of insufficient duration, sub-diffusive dynamics can lead to dramatic over-prediction of D. We present useful metrics for monitoring the extent of sub-diffusive dynamics and explore how these metrics correlate to error in D. We also identify a relationship between diffusion and fast dynamics in our system, which may serve as a means to more rapidly predict diffusion in slowly diffusing systems. Our work provides important precedent and essential insights for utilizing atomistic molecular dynamics simulations to predict diffusion coefficients of small to medium sized molecules in condensed soft matter systems.

Dynamic scaling for the growth of non-equilibrium fluctuations during thermophoretic diffusion in microgravity.

Science.gov (United States)

Cerbino, Roberto; Sun, Yifei; Donev, Aleksandar; Vailati, Alberto

2015-09-30

Diffusion processes are widespread in biological and chemical systems, where they play a fundamental role in the exchange of substances at the cellular level and in determining the rate of chemical reactions. Recently, the classical picture that portrays diffusion as random uncorrelated motion of molecules has been revised, when it was shown that giant non-equilibrium fluctuations develop during diffusion processes. Under microgravity conditions and at steady-state, non-equilibrium fluctuations exhibit scale invariance and their size is only limited by the boundaries of the system. In this work, we investigate the onset of non-equilibrium concentration fluctuations induced by thermophoretic diffusion in microgravity, a regime not accessible to analytical calculations but of great relevance for the understanding of several natural and technological processes. A combination of state of the art simulations and experiments allows us to attain a fully quantitative description of the development of fluctuations during transient diffusion in microgravity. Both experiments and simulations show that during the onset the fluctuations exhibit scale invariance at large wave vectors. In a broader range of wave vectors simulations predict a spinodal-like growth of fluctuations, where the amplitude and length-scale of the dominant mode are determined by the thickness of the diffuse layer.

Enhancing Rotational Diffusion Using Oscillatory Shear

KAUST Repository

Leahy, Brian D.; Cheng, Xiang; Ong, Desmond C.; Liddell-Watson, Chekesha; Cohen, Itai

2013-01-01

Taylor dispersion - shear-induced enhancement of translational diffusion - is an important phenomenon with applications ranging from pharmacology to geology. Through experiments and simulations, we show that rotational diffusion is also enhanced

Propagator formalism and computer simulation of restricted diffusion behaviors of inter-molecular multiple-quantum coherences

International Nuclear Information System (INIS)

Cai Congbo; Chen Zhong; Cai Shuhui; Zhong Jianhui

2005-01-01

In this paper, behaviors of single-quantum coherences and inter-molecular multiple-quantum coherences under restricted diffusion in nuclear magnetic resonance experiments were investigated. The propagator formalism based on the loss of spin phase memory during random motion was applied to describe the diffusion-induced signal attenuation. The exact expression of the signal attenuation under the short gradient pulse approximation for restricted diffusion between two parallel plates was obtained using this propagator method. For long gradient pulses, a modified formalism was proposed. The simulated signal attenuation under the effects of gradient pulses of different width based on the Monte Carlo method agrees with the theoretical predictions. The propagator formalism and computer simulation can provide convenient, intuitive and precise methods for the study of the diffusion behaviors

Collective diffusion in carbon nanotubes: Crossover between one dimension and three dimensions

International Nuclear Information System (INIS)

Chen Pei-Rong; Xu Zhi-Cheng; Gu Yu; Zhong Wei-Rong

2016-01-01

Using non-equilibrium molecular dynamics and Monte Carlo methods, we study the collective diffusion of helium in carbon nanotubes. The results show that the collective diffusion coefficient (CDC) increases with the dimension of the channel. The collective diffusion coefficient has a linear relationship with the temperature and the concentration. There exist a ballistic transport in short carbon nanotubes and a diffusive transport in long carbon nanotubes. Fick’s law has an invalid region in the nanoscale channel. (paper)

Photoinduced diffusion molecular transport

Energy Technology Data Exchange (ETDEWEB)

Rozenbaum, Viktor M., E-mail: vik-roz@mail.ru, E-mail: litrakh@gmail.com [Chuiko Institute of Surface Chemistry, National Academy of Sciences of Ukraine, Generala Naumova St. 17, Kiev 03164 (Ukraine); Dekhtyar, Marina L. [Institute of Organic Chemistry, National Academy of Sciences of Ukraine, Murmanskaya St. 5, Kiev 02094 (Ukraine); Lin, Sheng Hsien [Department of Applied Chemistry, National Chiao Tung University, 1001 Ta Hsuen Road, Hsinchu 300, Taiwan (China); Trakhtenberg, Leonid I., E-mail: vik-roz@mail.ru, E-mail: litrakh@gmail.com [Semenov Institute of Chemical Physics, Russian Academy of Sciences, Kosygin Street 4, Moscow 119991, Russia and Moscow Institute of Physics and Technology (State University), Institutskii Per. 9, Dolgoprudnyi, Moscow Region 141700 (Russian Federation)

2016-08-14

We consider a Brownian photomotor, namely, the directed motion of a nanoparticle in an asymmetric periodic potential under the action of periodic rectangular resonant laser pulses which cause charge redistribution in the particle. Based on the kinetics for the photoinduced electron redistribution between two or three energy levels of the particle, the time dependence of its potential energy is derived and the average directed velocity is calculated in the high-temperature approximation (when the spatial amplitude of potential energy fluctuations is small relative to the thermal energy). The thus developed theory of photoinduced molecular transport appears applicable not only to conventional dichotomous Brownian motors (with only two possible potential profiles) but also to a much wider variety of molecular nanomachines. The distinction between the realistic time dependence of the potential energy and that for a dichotomous process (a step function) is represented in terms of relaxation times (they can differ on the time intervals of the dichotomous process). As shown, a Brownian photomotor has the maximum average directed velocity at (i) large laser pulse intensities (resulting in short relaxation times on laser-on intervals) and (ii) excited state lifetimes long enough to permit efficient photoexcitation but still much shorter than laser-off intervals. A Brownian photomotor with optimized parameters is exemplified by a cylindrically shaped semiconductor nanocluster which moves directly along a polar substrate due to periodically photoinduced dipole moment (caused by the repetitive excited electron transitions to a non-resonant level of the nanocylinder surface impurity).

Non-opioid analgesic drug flupirtine: Spectral analysis, DFT computations, in vitro bioactivity and molecular docking study

Science.gov (United States)

Leenaraj, D. R.; Hubert Joe, I.

2017-06-01

Spectral features of non-opioid analgesic drug flupirtine have been explored by the Fourier transform infrared, Raman and Nuclear magnetic resonance spectroscopic techniques combined with density functional theory computations. The bioactive conformer of flupirtine is stabilized by an intramolecular Csbnd H⋯N hydrogen bonding resulting by the steric strain of hydrogen atoms. Natural bond orbital and natural population analysis support this result. The charge redistribution also has been analyzed. Antimicrobial activities of flupirtine have been screened by agar well disc diffusion and molecular docking methods, which exposes the importance of triaminopyridine in flupirtine.

Variability of non-Gaussian diffusion MRI and intravoxel incoherent motion (IVIM) measurements in the breast.

Science.gov (United States)

Iima, Mami; Kataoka, Masako; Kanao, Shotaro; Kawai, Makiko; Onishi, Natsuko; Koyasu, Sho; Murata, Katsutoshi; Ohashi, Akane; Sakaguchi, Rena; Togashi, Kaori

2018-01-01

We prospectively examined the variability of non-Gaussian diffusion magnetic resonance imaging (MRI) and intravoxel incoherent motion (IVIM) measurements with different numbers of b-values and excitations in normal breast tissue and breast lesions. Thirteen volunteers and fourteen patients with breast lesions (seven malignant, eight benign; one patient had bilateral lesions) were recruited in this prospective study (approved by the Internal Review Board). Diffusion-weighted MRI was performed with 16 b-values (0-2500 s/mm2 with one number of excitations [NEX]) and five b-values (0-2500 s/mm2, 3 NEX), using a 3T breast MRI. Intravoxel incoherent motion (flowing blood volume fraction [fIVIM] and pseudodiffusion coefficient [D*]) and non-Gaussian diffusion (theoretical apparent diffusion coefficient [ADC] at b value of 0 sec/mm2 [ADC0] and kurtosis [K]) parameters were estimated from IVIM and Kurtosis models using 16 b-values, and synthetic apparent diffusion coefficient (sADC) values were obtained from two key b-values. The variabilities between and within subjects and between different diffusion acquisition methods were estimated. There were no statistical differences in ADC0, K, or sADC values between the different b-values or NEX. A good agreement of diffusion parameters was observed between 16 b-values (one NEX), five b-values (one NEX), and five b-values (three NEX) in normal breast tissue or breast lesions. Insufficient agreement was observed for IVIM parameters. There were no statistical differences in the non-Gaussian diffusion MRI estimated values obtained from a different number of b-values or excitations in normal breast tissue or breast lesions. These data suggest that a limited MRI protocol using a few b-values might be relevant in a clinical setting for the estimation of non-Gaussian diffusion MRI parameters in normal breast tissue and breast lesions.

Intravoxel Incoherent Motion and Quantitative Non-Gaussian Diffusion MR Imaging: Evaluation of the Diagnostic and Prognostic Value of Several Markers of Malignant and Benign Breast Lesions.

Science.gov (United States)

Iima, Mami; Kataoka, Masako; Kanao, Shotaro; Onishi, Natsuko; Kawai, Makiko; Ohashi, Akane; Sakaguchi, Rena; Toi, Masakazu; Togashi, Kaori

2018-05-01

Purpose To investigate the performance of integrated approaches that combined intravoxel incoherent motion (IVIM) and non-Gaussian diffusion parameters compared with the Breast Imaging and Reporting Data System (BI-RADS) to establish multiparameter thresholds scores or probabilities by using Bayesian analysis to distinguish malignant from benign breast lesions and their correlation with molecular prognostic factors. Materials and Methods Between May 2013 and March 2015, 411 patients were prospectively enrolled and 199 patients (allocated to training [n = 99] and validation [n = 100] sets) were included in this study. IVIM parameters (flowing blood volume fraction [fIVIM] and pseudodiffusion coefficient [D*]) and non-Gaussian diffusion parameters (theoretical apparent diffusion coefficient [ADC] at b value of 0 sec/mm 2 [ADC 0 ] and kurtosis [K]) by using IVIM and kurtosis models were estimated from diffusion-weighted image series (16 b values up to 2500 sec/mm 2 ), as well as a synthetic ADC (sADC) calculated by using b values of 200 and 1500 (sADC 200-1500 ) and a standard ADC calculated by using b values of 0 and 800 sec/mm 2 (ADC 0-800 ). The performance of two diagnostic approaches (combined parameter thresholds and Bayesian analysis) combining IVIM and diffusion parameters was evaluated and compared with BI-RADS performance. The Mann-Whitney U test and a nonparametric multiple comparison test were used to compare their performance to determine benignity or malignancy and as molecular prognostic biomarkers and subtypes of breast cancer. Results Significant differences were found between malignant and benign breast lesions for IVIM and non-Gaussian diffusion parameters (ADC 0 , K, fIVIM, fIVIM · D*, sADC 200-1500, and ADC 0-800 ; P < .05). Sensitivity and specificity for the validation set by radiologists A and B were as follows: sensitivity, 94.7% and 89.5%, and specificity, 75.0% and 79.2% for sADC 200-1500 , respectively; sensitivity, 94.7% and 96.1%, and

Empirical molecular-dynamics study of diffusion in liquid semiconductors

Science.gov (United States)

Yu, W.; Wang, Z. Q.; Stroud, D.

1996-11-01

We report the results of an extensive molecular-dynamics study of diffusion in liquid Si and Ge (l-Si and l-Ge) and of impurities in l-Ge, using empirical Stillinger-Weber (SW) potentials with several choices of parameters. We use a numerical algorithm in which the three-body part of the SW potential is decomposed into products of two-body potentials, thereby permitting the study of large systems. One choice of SW parameters agrees very well with the observed l-Ge structure factors. The diffusion coefficients D(T) at melting are found to be approximately 6.4×10-5 cm2/s for l-Si, in good agreement with previous calculations, and about 4.2×10-5 and 4.6×10-5 cm2/s for two models of l-Ge. In all cases, D(T) can be fitted to an activated temperature dependence, with activation energies Ed of about 0.42 eV for l-Si, and 0.32 or 0.26 eV for two models of l-Ge, as calculated from either the Einstein relation or from a Green-Kubo-type integration of the velocity autocorrelation function. D(T) for Si impurities in l-Ge is found to be very similar to the self-diffusion coefficient of l-Ge. We briefly discuss possible reasons why the SW potentials give D(T)'s substantially lower than ab initio predictions.

Thermodiffusion, molecular diffusion and Soret coefficient of binary and ternary mixtures of n-hexane, n-dodecane and toluene.

Science.gov (United States)

Alonso de Mezquia, David; Wang, Zilin; Lapeira, Estela; Klein, Michael; Wiegand, Simone; Mounir Bou-Ali, M

2014-11-01

In this study, the thermodiffusion, molecular diffusion, and Soret coefficients of 12 binary mixtures composed of toluene, n-hexane and n-dodecane in the whole range of concentrations at atmospheric pressure and temperatures of 298.15 K and 308.15 K have been determined. The experimental measurements have been carried out using the Thermogravitational Column, the Sliding Symmetric Tubes and the Thermal Diffusion Forced Rayleigh Scattering techniques. The results obtained using the different techniques show a maximum deviation of 9% for the thermodiffusion coefficient, 8% for the molecular diffusion coefficient and 2% for the Soret coefficient. For the first time we report a decrease of the thermodiffusion coefficient with increasing ratio of the thermal expansion coefficient and viscosity for a binary mixture of an organic ring compound with a short n-alkane. This observation is discussed in terms of interactions between the different components. Additionally, the thermogravitational technique has been used to measure the thermodiffusion coefficients of four ternary mixtures consisting of toluene, n-hexane and n-dodecane at 298.15 K. In order to complete the study, the values obtained for the molecular diffusion coefficient in binary mixtures, and the thermodiffusion coefficient of binary and ternary mixtures have been compared with recently derived correlations.

Raman molecular imaging of brain frozen tissue sections.

Science.gov (United States)

Kast, Rachel E; Auner, Gregory W; Rosenblum, Mark L; Mikkelsen, Tom; Yurgelevic, Sally M; Raghunathan, Aditya; Poisson, Laila M; Kalkanis, Steven N

2014-10-01

Raman spectroscopy provides a molecular signature of the region being studied. It is ideal for neurosurgical applications because it is non-destructive, label-free, not impacted by water concentration, and can map an entire region of tissue. The objective of this paper is to demonstrate the meaningful spatial molecular information provided by Raman spectroscopy for identification of regions of normal brain, necrosis, diffusely infiltrating glioma and solid glioblastoma (GBM). Five frozen section tissues (1 normal, 1 necrotic, 1 GBM, and 2 infiltrating glioma) were mapped in their entirety using a 300-µm-square step size. Smaller regions of interest were also mapped using a 25-µm step size. The relative concentrations of relevant biomolecules were mapped across all tissues and compared with adjacent hematoxylin and eosin-stained sections, allowing identification of normal, GBM, and necrotic regions. Raman peaks and peak ratios mapped included 1003, 1313, 1431, 1585, and 1659 cm(-1). Tissue maps identified boundaries of grey and white matter, necrosis, GBM, and infiltrating tumor. Complementary information, including relative concentration of lipids, protein, nucleic acid, and hemoglobin, was presented in a manner which can be easily adapted for in vivo tissue mapping. Raman spectroscopy can successfully provide label-free imaging of tissue characteristics with high accuracy. It can be translated to a surgical or laboratory tool for rapid, non-destructive imaging of tumor margins.

A combined cryo-EM and molecular dynamics approach reveals the mechanism of ErmBL-mediated translation arrest

Science.gov (United States)

Arenz, Stefan; Bock, Lars V.; Graf, Michael; Innis, C. Axel; Beckmann, Roland; Grubmüller, Helmut; Vaiana, Andrea C.; Wilson, Daniel N.

2016-07-01

Nascent polypeptides can induce ribosome stalling, regulating downstream genes. Stalling of ErmBL peptide translation in the presence of the macrolide antibiotic erythromycin leads to resistance in Streptococcus sanguis. To reveal this stalling mechanism we obtained 3.6-Å-resolution cryo-EM structures of ErmBL-stalled ribosomes with erythromycin. The nascent peptide adopts an unusual conformation with the C-terminal Asp10 side chain in a previously unseen rotated position. Together with molecular dynamics simulations, the structures indicate that peptide-bond formation is inhibited by displacement of the peptidyl-tRNA A76 ribose from its canonical position, and by non-productive interactions of the A-tRNA Lys11 side chain with the A-site crevice. These two effects combine to perturb peptide-bond formation by increasing the distance between the attacking Lys11 amine and the Asp10 carbonyl carbon. The interplay between drug, peptide and ribosome uncovered here also provides insight into the fundamental mechanism of peptide-bond formation.

Strip biosensor for amplified detection of nerve growth factor-beta based on a molecular translator and catalytic DNA circuit.

Science.gov (United States)

Liu, Jun; Lai, Ting; Mu, Kejie; Zhou, Zheng

2014-10-07

We have demonstrated a new visual detection approach based on a molecular translator and a catalytic DNA circuit for the detection of nerve growth factor-beta (NGF-β). In this assay, a molecular translator based on the binding-induced DNA strand-displacement reaction was employed to convert the input protein to an output DNA signal. The molecular translator is composed of a target recognition element and a signal output element. Target recognition is achieved by the binding of the anti-NGF-β antibody to the target protein. Polyclonal anti-NGF-β antibody is conjugated to DNA1 and DNA2. The antibody conjugated DNA1 is initially hybridized to DNA3 to form a stable DNA1/DNA3 duplex. In the presence of NGF-β, the binding of the same target protein brings DNA1 and DNA2 into close proximity, resulting in an increase in their local effective concentration. This process triggers the strand-displacement reaction between DNA2 and DNA3 and releases the output DNA3. The released DNA3 is further amplified by a catalytic DNA circuit. The product of the catalytic DNA circuit is detected by a strip biosensor. This proposed assay has high sensitivity and selectivity with a dynamic response ranging from 10 fM to 10 pM, and its detection limit is 10 fM of NGF-β. This work provides a sensitive, enzyme-free, and universal strategy for the detection of other proteins.

Molecular sieving through a graphene nanopore: non-equilibrium molecular dynamics simulation

Institute of Scientific and Technical Information of China (English)

Chengzhen Sun; Bofeng Bai

2017-01-01

Two-dimensional graphene nanopores have shown great promise as ultra-permeable molecular sieves based on their size-sieving effects.We design a nitrogen/hydrogen modified graphene nanopore and conduct a transient non-equilibrium molecular dynamics simulation on its molecular sieving effects.The distinct time-varying molecular crossing numbers show that this special nanopore can efficiently sieve CO2 and H2S molecules from CH4 molecules with high selectivity.By analyzing the molecular structure and pore functionalization-related molecular orientation and permeable zone in the nanopore,density distribution in the molecular adsorption layer on the graphene surface,as well as other features,the molecular sieving mechanisms of graphene nanopores are revealed.Finally,several implications on the design of highly-efficient graphene nanopores,especially for determining the porosity and chemical functionalization,as gas separation membranes are summarized based on the identified phenomena and mechanisms.

Ab initio molecular dynamics study of lithium diffusion in tetragonal Li{sub 7}La{sub 3}Zr{sub 2}O{sub 12}

Energy Technology Data Exchange (ETDEWEB)

Andriyevsky, B., E-mail: bohdan.andriyevskyy@tu.koszalin.pl [Faculty of Electronics and Computer Sciences, Koszalin University of Technology, 2 Śniadeckich Str., PL-75-453, Koszalin (Poland); Institute of Electrochemistry, Ulm University, Albert-Einstein-Allee 47, D-89069, Ulm (Germany); Doll, K. [Institute of Electrochemistry, Ulm University, Albert-Einstein-Allee 47, D-89069, Ulm (Germany); Institute of Theoretical Chemistry, Pfaffenwaldring 55, D-70569, Stuttgart (Germany); Jacob, T. [Institute of Electrochemistry, Ulm University, Albert-Einstein-Allee 47, D-89069, Ulm (Germany); Helmholtz Institute Ulm (HIU) for Electrochemical Energy Storage, Albert-Einstein-Allee 11, D-89081, Ulm (Germany)

2017-01-01

Using ab initio density functional theory the thermally-stimulated migration of lithium ions in the garnet-type material Li{sub 7}La{sub 3}Zr{sub 2}O{sub 12} is investigated. The methods of ab initio molecular dynamics have been applied to calculate the lithium ion self-diffusion coefficient and the diffusion barriers as function of lithium ion concentration. The concentration of lithium in the initial Li{sub 7}La{sub 3}Zr{sub 2}O{sub 12} crystal unit cell is varied from 53 to 59 atoms, where 56 lithium atoms represent the stoichiometric concentration. Almost monotonous dependencies of the main characteristics on the number of lithium atoms N{sup (Li)} have been found, except for a non-monotonous peculiarity of the stoichiometric compound (N{sup (Li)} = 56). Finally, the influence of the unit cell volume change on lithium ion diffusion parameters as well as lithium ion hopping rates has been studied. - Highlights: • Partial lithium atoms subtraction from LLZO increases diffusion coefficient D{sup (Li)}. • Partial subtraction of lithium atoms from LLZO decreases activation energy E{sub a}{sup (Li)}. • Activation energy E{sub a}{sup (Li)} is the smallest for tetrahedral oxygen surrounding. • Compression of LLZO leads to a decrease of lithium ion diffusion coefficient D{sup (Li)}.

Multicomponent diffusion in molten salt LiF-BeF{sub 2}: Dynamical correlations and Maxwell–Stefan diffusivities

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, Brahmananda, E-mail: brahma@barc.gov.in; Ramaniah, Lavanya M. [High Pressure & Synchrotron Radiation Physics Division, Bhabha Atomic Research Centre, Trombay, Mumbai-400085 (India)

2015-06-24

Applying Green–Kubo formalism and equilibrium molecular dynamics (MD) simulations, we have studied the dynamic correlation, Onsager coeeficients and Maxwell–Stefan (MS) Diffusivities of molten salt LiF-BeF{sub 2}, which is used as coolant in high temperature reactor. All the diffusive flux correlations show back-scattering or cage dynamics which becomes pronouced at higher temperature. Although the MS diffusivities are expected to depend very lightly on the composition due to decoupling of thermodynamic factor, the diffusivity Đ{sub Li-F} and Đ{sub Be-F} decreases sharply for higher concentration of LiF and BeF{sub 2} respectively. Interestingly, all three MS diffusivities have highest magnitude for eutectic mixture at 1000K (except Đ{sub Be-F} at lower LiF mole fraction) which is desirable from coolant point of view. Although the diffusivity for positive-positive ion pair is negative it is not in violation of the second law of thermodynamics as it satisfies the non-negative entropic constraints.

Non-kinematic Flux-transport Dynamos Including the Effects of Diffusivity Quenching

Energy Technology Data Exchange (ETDEWEB)

Ichimura, Chiaki; Yokoyama, Takaaki [Department of Earth and Planetary Science, The University of Tokyo, Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan)

2017-04-10

Turbulent magnetic diffusivity is quenched when strong magnetic fields suppress turbulent motion in a phenomenon known as diffusivity quenching. Diffusivity quenching can provide a mechanism for amplifying magnetic field and influencing global velocity fields through Lorentz force feedback. To investigate this effect, we conducted mean field flux-transport dynamo simulations that included the effects of diffusivity quenching in a non-kinematic regime. We found that toroidal magnetic field strength is amplified by up to approximately 1.5 times in the convection zone as a result of diffusivity quenching. This amplification is much weaker than that in kinematic cases as a result of Lorentz force feedback on the system’s differential rotation. While amplified toroidal fields lead to the suppression of equatorward meridional flow locally near the base of the convection zone, large-scale equatorward transport of magnetic flux via meridional flow, which is the essential process of the flux-transport dynamo, is sustainable in our calculations.

Non-probabilistic solutions of imprecisely defined fractional-order diffusion equations

International Nuclear Information System (INIS)

Chakraverty, S.; Tapaswini, Smita

2014-01-01

The fractional diffusion equation is one of the most important partial differential equations (PDEs) to model problems in mathematical physics. These PDEs are more practical when those are combined with uncertainties. Accordingly, this paper investigates the numerical solution of a non-probabilistic viz. fuzzy fractional-order diffusion equation subjected to various external forces. A fuzzy diffusion equation having fractional order 0 < α ≤ 1 with fuzzy initial condition is taken into consideration. Fuzziness appearing in the initial conditions is modelled through convex normalized triangular and Gaussian fuzzy numbers. A new computational technique is proposed based on double parametric form of fuzzy numbers to handle the fuzzy fractional diffusion equation. Using the single parametric form of fuzzy numbers, the original fuzzy diffusion equation is converted first into an interval-based fuzzy differential equation. Next, this equation is transformed into crisp form by using the proposed double parametric form of fuzzy numbers. Finally, the same is solved by Adomian decomposition method (ADM) symbolically to obtain the uncertain bounds of the solution. Computed results are depicted in terms of plots. Results obtained by the proposed method are compared with the existing results in special cases. (general)

Modified free volume theory of self-diffusion and molecular theory of shear viscosity of liquid carbon dioxide.

Science.gov (United States)

Nasrabad, Afshin Eskandari; Laghaei, Rozita; Eu, Byung Chan

2005-04-28

In previous work on the density fluctuation theory of transport coefficients of liquids, it was necessary to use empirical self-diffusion coefficients to calculate the transport coefficients (e.g., shear viscosity of carbon dioxide). In this work, the necessity of empirical input of the self-diffusion coefficients in the calculation of shear viscosity is removed, and the theory is thus made a self-contained molecular theory of transport coefficients of liquids, albeit it contains an empirical parameter in the subcritical regime. The required self-diffusion coefficients of liquid carbon dioxide are calculated by using the modified free volume theory for which the generic van der Waals equation of state and Monte Carlo simulations are combined to accurately compute the mean free volume by means of statistical mechanics. They have been computed as a function of density along four different isotherms and isobars. A Lennard-Jones site-site interaction potential was used to model the molecular carbon dioxide interaction. The density and temperature dependence of the theoretical self-diffusion coefficients are shown to be in excellent agreement with experimental data when the minimum critical free volume is identified with the molecular volume. The self-diffusion coefficients thus computed are then used to compute the density and temperature dependence of the shear viscosity of liquid carbon dioxide by employing the density fluctuation theory formula for shear viscosity as reported in an earlier paper (J. Chem. Phys. 2000, 112, 7118). The theoretical shear viscosity is shown to be robust and yields excellent density and temperature dependence for carbon dioxide. The pair correlation function appearing in the theory has been computed by Monte Carlo simulations.

Membrane re-modelling by BAR domain superfamily proteins via molecular and non-molecular factors.

Science.gov (United States)

Nishimura, Tamako; Morone, Nobuhiro; Suetsugu, Shiro

2018-04-17

Lipid membranes are structural components of cell surfaces and intracellular organelles. Alterations in lipid membrane shape are accompanied by numerous cellular functions, including endocytosis, intracellular transport, and cell migration. Proteins containing Bin-Amphiphysin-Rvs (BAR) domains (BAR proteins) are unique, because their structures correspond to the membrane curvature, that is, the shape of the lipid membrane. BAR proteins present at high concentration determine the shape of the membrane, because BAR domain oligomers function as scaffolds that mould the membrane. BAR proteins co-operate with various molecular and non-molecular factors. The molecular factors include cytoskeletal proteins such as the regulators of actin filaments and the membrane scission protein dynamin. Lipid composition, including saturated or unsaturated fatty acid tails of phospholipids, also affects the ability of BAR proteins to mould the membrane. Non-molecular factors include the external physical forces applied to the membrane, such as tension and friction. In this mini-review, we will discuss how the BAR proteins orchestrate membrane dynamics together with various molecular and non-molecular factors. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Non-Adiabatic Molecular Dynamics Methods for Materials Discovery

Energy Technology Data Exchange (ETDEWEB)

Furche, Filipp [Univ. of California, Irvine, CA (United States); Parker, Shane M. [Univ. of California, Irvine, CA (United States); Muuronen, Mikko J. [Univ. of California, Irvine, CA (United States); Roy, Saswata [Univ. of California, Irvine, CA (United States)

2017-04-04

The flow of radiative energy in light-driven materials such as photosensitizer dyes or photocatalysts is governed by non-adiabatic transitions between electronic states and cannot be described within the Born-Oppenheimer approximation commonly used in electronic structure theory. The non-adiabatic molecular dynamics (NAMD) methods based on Tully surface hopping and time-dependent density functional theory developed in this project have greatly extended the range of molecular materials that can be tackled by NAMD simulations. New algorithms to compute molecular excited state and response properties efficiently were developed. Fundamental limitations of common non-linear response methods were discovered and characterized. Methods for accurate computations of vibronic spectra of materials such as black absorbers were developed and applied. It was shown that open-shell TDDFT methods capture bond breaking in NAMD simulations, a longstanding challenge for single-reference molecular dynamics simulations. The methods developed in this project were applied to study the photodissociation of acetaldehyde and revealed that non-adiabatic effects are experimentally observable in fragment kinetic energy distributions. Finally, the project enabled the first detailed NAMD simulations of photocatalytic water oxidation by titania nanoclusters, uncovering the mechanism of this fundamentally important reaction for fuel generation and storage.

Chemical insight from density functional modeling of molecular adsorption: Tracking the bonding and diffusion of anthracene derivatives on Cu(111) with molecular orbitals

Science.gov (United States)

Wyrick, Jonathan; Einstein, T. L.; Bartels, Ludwig

2015-03-01

We present a method of analyzing the results of density functional modeling of molecular adsorption in terms of an analogue of molecular orbitals. This approach permits intuitive chemical insight into the adsorption process. Applied to a set of anthracene derivates (anthracene, 9,10-anthraquinone, 9,10-dithioanthracene, and 9,10-diselenonanthracene), we follow the electronic states of the molecules that are involved in the bonding process and correlate them to both the molecular adsorption geometry and the species' diffusive behavior. We additionally provide computational code to easily repeat this analysis on any system.

Diffusion of CO2 Molecules in Polyethylene Terephthalate/Polylactide Blends Estimated by Molecular Dynamics Simulations

International Nuclear Information System (INIS)

Liao, Liqiong; Fu, Yizheng; Liang, Ziaoyan; Mei, Linyu; Liu, Yaqing

2013-01-01

Molecular dynamics (MD) simulations have been used to study the diffusion behavior of small gas molecules (CO 2 ) in polyethylene terephthalate (PET)/polylactide (PLA) blends. The Flory-Huggins interaction parameters (χ) determined from the cohesive energy densities are smaller than the critical value of Flory-Huggins interaction parameters (χ critical ), and that indicates the good compatibility of PET/PLA blends. The diffusion coefficients of CO 2 are determined via MD simulations at 298 K. That the order of diffusion coefficients is correlated with the availably fractional free volume (FFV) of CO 2 in the PET/PLA blends means that the FFV plays a vital role in the diffusion behavior of CO 2 molecules in PET/PLA blends. The slopes of the log (MSD) as a function of log (t) are close to unity over the entire composition range of PET/PLA blends, which confirms the feasibility of MD approach reaches the normal diffusion regime of CO 2 in PET/PLA blends

Molecular dynamics simulation of helium and oxygen diffusion in UO{sub 2+}-{sub x}

Energy Technology Data Exchange (ETDEWEB)

Govers, K., E-mail: kgovers@sckcen.b [Service de Metrologie Nucleaire (CP 165/84), Universite Libre de Bruxelles, 50 av. F.D. Roosevelt, B-1050 Bruxelles (Belgium); Institute for Nuclear Materials Sciences, SCK-CEN, Boeretang 200, B-2400 Mol (Belgium); Lemehov, S. [Institute for Nuclear Materials Sciences, SCK-CEN, Boeretang 200, B-2400 Mol (Belgium); Hou, M. [Physique des Solides Irradies et des Nanostructures (CP 234), Universite Libre de Bruxelles, Bd du Triomphe, B-1050 Bruxelles (Belgium); Verwerft, M. [Institute for Nuclear Materials Sciences, SCK-CEN, Boeretang 200, B-2400 Mol (Belgium)

2009-12-15

Atomic scale simulation techniques based on empirical potentials have been considered in the present work to get insight on helium diffusion in uranium dioxide. By varying the stoichiometry, together with the system temperature, the performed molecular dynamics simulations indicate two diffusion regimes for He. The first one presents a low activation energy (0.5 eV) and suggests oxygen vacancies assisted migration. This regime seems to provide the major contribution to diffusion when structural defects are present (extrinsic defects, imposed, e.g. by the stoichiometry). The second regime presents a higher activation energy, around 2 eV, and dominates in the higher temperature range or at perfect stoichiometry, suggesting an intrinsic migration process. Considering the dependence of He behaviour with oxygen defects, oxygen diffusion has been considered as well in the different stoichiometry domains. Finally, further investigations were made with nudged elastic bands calculations for a better interpretation of the operating migration mechanisms, both for He and O.

Adiabatic translation factors in slow ion-atom collisions

International Nuclear Information System (INIS)

Vaaben, J.; Taulbjerg, K.

1981-01-01

The general properties of translation factors in slow atomic collisions are discussed. It is emphasised that an acceptable form of translation factors must be conceptually consistent with the basic underlying assumption of the molecular model; i.e. translation factors must relax adiabatically at intermediate and small internuclear separations. A simple physical argument is applied to derive a general parameter-free expression for the translation factor pertinent to an electron in a two-centre Coulomb field. Within the present approach the adiabatic translation factor is considered to be a property of the two-centre field independently of the molecular state under consideration. The generalisation to many-electron systems is therefore readily made. (author)

Anomalous diffusion of water molecules at grain boundaries in ice Ih.

Science.gov (United States)

Moreira, Pedro Augusto Franco Pinheiro; Veiga, Roberto Gomes de Aguiar; Ribeiro, Ingrid de Almeida; Freitas, Rodrigo; Helfferich, Julian; de Koning, Maurice

2018-05-23

Using ab initio and classical molecular dynamics simulations, we study pre-melting phenomena in pristine coincident-site-lattice grain boundaries (GBs) in proton-disordered hexagonal ice Ih at temperatures just below the melting point Tm. Concerning pre-melt-layer thicknesses, the results are consistent with the available experimental estimates for low-disorder impurity-free GBs. With regard to molecular mobility, the simulations provide a key new insight: the translational motion of the water molecules is found to be subdiffusive for time scales from ∼10 ns up to at least 0.1 μs. Moreover, the fact that the anomalous diffusion occurs even at temperatures just below Tm where the bulk supercooled liquid still diffuses normally suggests that it is related to the confinement of the GB pre-melt layers by the surrounding crystalline environment. Furthermore, we show that this behavior can be characterized by continuous-time random walk models in which the waiting-time distributions decay according to power-laws that are very similar to those describing dynamics in glass-forming systems.

Molecular motions in a viscous organic liquid: ferrocene in cold butyl phthalate

International Nuclear Information System (INIS)

Ruby, S.L.; Zabransky, B.J.; Flinn, P.A.

1976-01-01

The two main purposes of this work were to learn (a) if rotational diffusion can be seen along with translational, and (b) is [x(T) 2 ] unusual as the sample is heated from a glass to a liquid. Our observations show that (a) rotational molecular diffusion is not likely ever to be observed by quadrupole relaxation and (b) that there is indeed a fast increase in [x 2 ] above T/sub g/. This increase is correlated with a rapid and linear increase of the number of ''soft modes'' for the liquid above the glass transition temperature

Ionic Diffusion in a Ternary Superionic Conductor: An {ital Ab Initio} Molecular Dynamics Study

Energy Technology Data Exchange (ETDEWEB)

Wengert, S.; Nesper, R.; Andreoni, W.; Parrinello, M. [Laboratorium fuer Anorganische Chemie, ETH Zuerich, 8092 Zuerich (Switzerland)]|[IBM Research Division, Zurich Research Laboratory, 8803 Rueschlikon (Switzerland)]|[Max-Planck-Institut fuer Festkoerperforschung, 70569 Stuttgart (Germany)

1996-12-01

We present Car-Parrinello molecular dynamics simulations of a novel superionic conductor, Li{sub 2{minus}2{ital x}}Mg{sub 1+{ital x}}Si ({ital x}{approximately}0.06), at different temperatures. The calculations clarify the nature of the ionic conduction and lead to the prediction of the first inorganic magnesium superionic conductor. In fact, both lithium and magnesium are found to act as charge carriers. The diffusion is fast and can be described as vacancy migration through directed jumps. The calculated diffusion constants for lithium are consistent with recent electrochemical measurements. {copyright} {ital 1996 The American Physical Society.}

Molecular dynamics simulations of the diffusion and coalescence of helium in tungsten

International Nuclear Information System (INIS)

Zhou, Y.L.; Wang, J.; Hou, Q.; Deng, A.H.

2014-01-01

Molecular dynamics (MD) simulations are performed on the diffusion and coalescence of helium in tungsten. A new method for determining the effective capture radii (ECRs) and the dissociation energies of helium-related defects is proposed in this work. It is observed that the ECR of an interstitial helium atom trapping helium interstitials (denoted as He–He n , n = 1–3) decreases with increasing temperature, except for He–He 2 at T n for helium clusters are also investigated. He 2 migrates more quickly than a single He atom does at T 2 changes at higher temperatures. Another counterintuitive observation is that D 5 > D 3 > D 4 at T 5 . The Arrhenius relation describes the diffusion of He n well in the temperature range from 300 K to 550 K, whereas the diffusion is not a standard thermally activated process at higher temperatures. Taken together, these results help elucidate the initial stage of helium bubble formation in tungsten as well as the requirements of long-term evolution methods such as KMC or RT models

Diffusion in confinement as a microscopic relaxation mechanism in glass-forming liquids

International Nuclear Information System (INIS)

Mamontov, Eugene

2012-01-01

Using quasielastic neutron scattering, we compare dynamics in single-element liquids, glass-forming selenium and non glass-forming gallium. There is a single jump-diffusion process in gallium, whereas in selenium there is also a faster, spatially localized process. The fast and slow processes describe β- and α-relaxation, respectively. We then analyze an archetypical glass-former, glycerol, to show that the two-component fit, with β- and α-relaxations explicitly separated, yields the correct value for the translational diffusion coefficient and provides information on the spatial localization of the β-relaxation that is not experimentally accessible otherwise.

Molecular dynamics simulation of phosphorylated KID post-translational modification.

Directory of Open Access Journals (Sweden)

Hai-Feng Chen

2009-08-01

Full Text Available Kinase-inducible domain (KID as transcriptional activator can stimulate target gene expression in signal transduction by associating with KID interacting domain (KIX. NMR spectra suggest that apo-KID is an unstructured protein. After post-translational modification by phosphorylation, KID undergoes a transition from disordered to well folded protein upon binding to KIX. However, the mechanism of folding coupled to binding is poorly understood.To get an insight into the mechanism, we have performed ten trajectories of explicit-solvent molecular dynamics (MD for both bound and apo phosphorylated KID (pKID. Ten MD simulations are sufficient to capture the average properties in the protein folding and unfolding.Room-temperature MD simulations suggest that pKID becomes more rigid and stable upon the KIX-binding. Kinetic analysis of high-temperature MD simulations shows that bound pKID and apo-pKID unfold via a three-state and a two-state process, respectively. Both kinetics and free energy landscape analyses indicate that bound pKID folds in the order of KIX access, initiation of pKID tertiary folding, folding of helix alpha(B, folding of helix alpha(A, completion of pKID tertiary folding, and finalization of pKID-KIX binding. Our data show that the folding pathways of apo-pKID are different from the bound state: the foldings of helices alpha(A and alpha(B are swapped. Here we also show that Asn139, Asp140 and Leu141 with large Phi-values are key residues in the folding of bound pKID. Our results are in good agreement with NMR experimental observations and provide significant insight into the general mechanisms of binding induced protein folding and other conformational adjustment in post-translational modification.

Translation system engineering in Escherichia coli enhances non-canonical amino acid incorporation into proteins.

Science.gov (United States)

Gan, Rui; Perez, Jessica G; Carlson, Erik D; Ntai, Ioanna; Isaacs, Farren J; Kelleher, Neil L; Jewett, Michael C

2017-05-01

The ability to site-specifically incorporate non-canonical amino acids (ncAAs) into proteins has made possible the study of protein structure and function in fundamentally new ways, as well as the bio synthesis of unnatural polymers. However, the task of site-specifically incorporating multiple ncAAs into proteins with high purity and yield continues to present a challenge. At the heart of this challenge lies the lower efficiency of engineered orthogonal translation system components compared to their natural counterparts (e.g., translation elements that specifically use a ncAA and do not interact with the cell's natural translation apparatus). Here, we show that evolving and tuning expression levels of multiple components of an engineered translation system together as a whole enhances ncAA incorporation efficiency. Specifically, we increase protein yield when incorporating multiple p-azido-phenylalanine(pAzF) residues into proteins by (i) evolving the Methanocaldococcus jannaschii p-azido-phenylalanyl-tRNA synthetase anti-codon binding domain, (ii) evolving the elongation factor Tu amino acid-binding pocket, and (iii) tuning the expression of evolved translation machinery components in a single vector. Use of the evolved translation machinery in a genomically recoded organism lacking release factor one enabled enhanced multi-site ncAA incorporation into proteins. We anticipate that our approach to orthogonal translation system development will accelerate and expand our ability to site-specifically incorporate multiple ncAAs into proteins and biopolymers, advancing new horizons for synthetic and chemical biotechnology. Biotechnol. Bioeng. 2017;114: 1074-1086. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Ubiquity of non-diffusive momentum transport in JET H-modes

NARCIS (Netherlands)

Weisen, H.; Camenen, Y.; Salmi, A.; Versloot, T. W.; de Vries, P. C.; Maslov, M.; Tala, T.; Beurskens, M.; Giroud, C.; JET-EFDA Contributors,

2012-01-01

A broad survey of the experimental database of neutral beam heated baseline H-modes and hybrid scenarios in the JET tokamak has established the ubiquity of non-diffusive momentum transport mechanisms in rotating plasmas. As a result of their presence, the normalized angular frequency gradient R

Molecular dynamics simulations of self-diffusion near a symmetrical tilt grain boundary in UO{sub 2}

Energy Technology Data Exchange (ETDEWEB)

Vincent-Aublant, E.; Delaye, J.M. [CEA-Marcoule, DEN/DTCD/SECM, B.P. 17171, 30207 Bagnols sur Ceze cedex (France); Van Brutzel, L. [CEA-Saclay, DEN-DANS/DPC/SCP/LM2T, 91191 Gif-sur-Yvette (France)

2008-07-01

Molecular dynamics (MD) simulations have been used to study the influence of symmetrical tilt grain boundaries (GBs) in stoichiometric UO{sub 2} on uranium and oxygen self-diffusions. The study was performed on a large range of temperature varying from 300 K to 2100 K. First, the effect of the temperature on the structure and the formation energies of 6 relaxed tilt GBs was investigated. The {sigma}5 and {sigma}41 GBs geometries were chosen to study the diffusion. O and U diffusion coefficients have been calculated and compared to those obtained in a perfect stoichiometric UO{sub 2} as well as in over and under-stoichiometric matrices. (authors)

Ab initio molecular dynamics simulation of interstitial diffusion in Ni–Cr alloys and implications for radiation induced segregation

Energy Technology Data Exchange (ETDEWEB)

Barnard, L., E-mail: lmbarnard@wisc.edu; Morgan, D., E-mail: ddmorgan@wisc.edu

2014-06-01

In this study, ab initio molecular dynamics, implemented via density functional theory, is used to simulate self-interstitial diffusion in pure Ni and in the Ni-18 at.% Cr model alloy. Interstitial tracer diffusivities are measured from simulation results for pure Ni and for both Ni and Cr in the Ni–18Cr alloy. An Arrhenius function fit to these tracer diffusivities is then used in a rate theory model for radiation induced segregation, along with the experimentally measured vacancy diffusivities. It is predicted that interstitial diffusion has a tendency to cause Cr enrichment near grain boundaries, partially counterbalancing the tendency for vacancy diffusion to cause Cr depletion. This results in more mild Cr depletion than would result if only the vacancy diffusion were accounted for, in better agreement with experiment. This physical description of RIS in Ni–Cr alloys, which invokes the effects of both vacancy and interstitial diffusion, is distinct from the conventional description which accounts only for the effect of vacancy diffusion.

Ab initio molecular dynamics simulation of interstitial diffusion in Ni–Cr alloys and implications for radiation induced segregation

International Nuclear Information System (INIS)

Barnard, L.; Morgan, D.

2014-01-01

In this study, ab initio molecular dynamics, implemented via density functional theory, is used to simulate self-interstitial diffusion in pure Ni and in the Ni-18 at.% Cr model alloy. Interstitial tracer diffusivities are measured from simulation results for pure Ni and for both Ni and Cr in the Ni–18Cr alloy. An Arrhenius function fit to these tracer diffusivities is then used in a rate theory model for radiation induced segregation, along with the experimentally measured vacancy diffusivities. It is predicted that interstitial diffusion has a tendency to cause Cr enrichment near grain boundaries, partially counterbalancing the tendency for vacancy diffusion to cause Cr depletion. This results in more mild Cr depletion than would result if only the vacancy diffusion were accounted for, in better agreement with experiment. This physical description of RIS in Ni–Cr alloys, which invokes the effects of both vacancy and interstitial diffusion, is distinct from the conventional description which accounts only for the effect of vacancy diffusion

INCORPORATING AMBIPOLAR AND OHMIC DIFFUSION IN THE AMR MHD CODE RAMSES

International Nuclear Information System (INIS)

Masson, J.; Mulet-Marquis, C.; Chabrier, G.; Teyssier, R.; Hennebelle, P.

2012-01-01

We have implemented non-ideal magnetohydrodynamics (MHD) effects in the adaptive mesh refinement code RAMSES, namely, ambipolar diffusion and Ohmic dissipation, as additional source terms in the ideal MHD equations. We describe in details how we have discretized these terms using the adaptive Cartesian mesh, and how the time step is diminished with respect to the ideal case, in order to perform a stable time integration. We have performed a large suite of test runs, featuring the Barenblatt diffusion test, the Ohmic diffusion test, the C-shock test, and the Alfvén wave test. For the latter, we have performed a careful truncation error analysis to estimate the magnitude of the numerical diffusion induced by our Godunov scheme, allowing us to estimate the spatial resolution that is required to address non-ideal MHD effects reliably. We show that our scheme is second-order accurate, and is therefore ideally suited to study non-ideal MHD effects in the context of star formation and molecular cloud dynamics.

Double-diffusive mixed convection in a lid-driven cavity with non ...

Indian Academy of Sciences (India)

S SIVASANKARAN

2017-11-11

Nov 11, 2017 ... transfer are solved using the finite-volume method. The numerical ... Keywords. Mixed convection; double diffusion; non-uniform heating; lid-driven cavity. 1. ... exhaustive research due to its importance in various engi- neering ...

Modeling bioluminescent photon transport in tissue based on Radiosity-diffusion model

Science.gov (United States)

Sun, Li; Wang, Pu; Tian, Jie; Zhang, Bo; Han, Dong; Yang, Xin

2010-03-01

Bioluminescence tomography (BLT) is one of the most important non-invasive optical molecular imaging modalities. The model for the bioluminescent photon propagation plays a significant role in the bioluminescence tomography study. Due to the high computational efficiency, diffusion approximation (DA) is generally applied in the bioluminescence tomography. But the diffusion equation is valid only in highly scattering and weakly absorbing regions and fails in non-scattering or low-scattering tissues, such as a cyst in the breast, the cerebrospinal fluid (CSF) layer of the brain and synovial fluid layer in the joints. A hybrid Radiosity-diffusion model is proposed for dealing with the non-scattering regions within diffusing domains in this paper. This hybrid method incorporates a priori information of the geometry of non-scattering regions, which can be acquired by magnetic resonance imaging (MRI) or x-ray computed tomography (CT). Then the model is implemented using a finite element method (FEM) to ensure the high computational efficiency. Finally, we demonstrate that the method is comparable with Mont Carlo (MC) method which is regarded as a 'gold standard' for photon transportation simulation.

Non-Equivalence at Idiomatic and Expressional Level and the Strategies to Deal with: English Translation into Persian

Directory of Open Access Journals (Sweden)

Ahmad Ezzati Vazifehkhah

2017-10-01

Full Text Available The main purpose of this paper is to throw some light on non-equivalence at an idiomatic and expressional level in a contrastive analysis framework from English translation into Persian. The present paper makes an effort to analyze six main strategies such as using an idiom or an expression of similar meaning and form, similar meaning but dissimilar form, borrowing the source language, translation by paraphrase, translation by omission of a play on idiom or expression and translation by omission of entire idiom or expression (Baker, 2011. Hence, the core properties of this issue are described both in English and Persian languages. Moreover, within the text, there is a comparison which is conducted to highlight the matches and mismatches between these two languages. Further, other translators may well take this information as one of the main platforms from which they find out some strategies in translation idioms and expressions. This study concludes Baker’s (2011 proposed strategies are applicable and then proposes some weighty recommendations to be taken by translators in such a demanding issue.

Passivation Using Molecular Halides Increases Quantum Dot Solar Cell Performance.

Science.gov (United States)

Lan, Xinzheng; Voznyy, Oleksandr; Kiani, Amirreza; García de Arquer, F Pelayo; Abbas, Abdullah Saud; Kim, Gi-Hwan; Liu, Mengxia; Yang, Zhenyu; Walters, Grant; Xu, Jixian; Yuan, Mingjian; Ning, Zhijun; Fan, Fengjia; Kanjanaboos, Pongsakorn; Kramer, Illan; Zhitomirsky, David; Lee, Philip; Perelgut, Alexander; Hoogland, Sjoerd; Sargent, Edward H

2016-01-13

A solution-based passivation scheme is developed featuring the use of molecular iodine and PbS colloidal quantum dots (CQDs). The improved passivation translates into a longer carrier diffusion length in the solid film. This allows thicker solar-cell devices to be built while preserving efficient charge collection, leading to a certified power conversion efficiency of 9.9%, which is a new record in CQD solar cells. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Diffusion of non-traditional cookstoves across western Honduras: A social network analysis

International Nuclear Information System (INIS)

Ramirez, Sebastian; Dwivedi, Puneet; Ghilardi, Adrian; Bailis, Robert

2014-01-01

A third of the world's population uses inefficient biomass stoves, contributing to severe health problems, forest degradation, and climate change. Clean burning, fuel-efficient, non-traditional cookstoves (NTCS) are a promising solution; however, numerous projects fail during the diffusion process. We use social network analysis to reveal patterns driving a successful stove intervention in western Honduras. The intervention lacks formal marketing, but has spread across a wide area in just a few years. To understand the process, we map the social network of active community members who drove diffusion across a large swath of the country. We find that most ACMs heard about stoves twice before sharing information about it with others and introducing the stove into their own communities. On average, the social distance between ACMs and the project team is 3 degrees of separation. Both men and women are critical to the diffusion process, but men tend to communicate over longer distances, while women principally communicate over shorter distances. Government officials are also crucial to diffusion. Understanding how information moves through social networks and across geographic space allows us to theorize how knowledge about beneficial technologies spreads in the absence of formal marketing and inform policies for NTCS deployment worldwide. - Highlights: • We build a chain of referrals to track spread of information about non traditional cookstoves. • We find differences among gender and occupations that should inform policy. • People hear about the stoves twice before becoming suppliers of information. • Government officials play a substantial role in the diffusion. • Males play leading role in diffusion over long distances, females in short distances

Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

Energy Technology Data Exchange (ETDEWEB)

Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Hupalo, Myron [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Wang, Yangang [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Supercomputing Center of Computer Network Information Center, CAS, Beijing 100190 (China); McDougall, Dan; Tringides, Michael; Ho, Kaiming [Ames Laboratory, USDOE, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)

2013-12-14

The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H{sub 2} molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H{sub 2} molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

A study of MRI-guided diffuse fluorescence molecular tomography for monitoring PDT effects in pancreas cancer

Science.gov (United States)

Samkoe, Kimberley S.; Davis, Scott C.; Srinivasan, Subhadra; O'Hara, Julia A.; Hasan, Tayyaba; Pogue, Brian W.

2009-06-01

Over the last several decades little progress has been made in the therapy and treatment monitoring of pancreas adenocarcinoma, a devastating and aggressive form of cancer that has a 5-year patient survival rate of 3%. Currently, investigations for the use of interstitial Verteporfin photodynamic therapy (PDT) are being undertaken in both orthotopic xenograft mouse models and in human clinical trials. In the mouse models, magnetic resonance (MR) imaging has been used as a measure of surrogate response to Verteporfin PDT; however, MR imaging alone lacks the molecular information required to assess the metabolic function and growth rates of the tumor immediately after treatment. We propose the implementation of MR-guided fluorescence tomography in conjunction with a fluorescently labeled (IR-Dye 800 CW, LI-COR) epidermal growth factor (EGF) as a molecular measure of surrogate response. To demonstrate the effectiveness of MR-guided diffuse fluorescence tomography for molecular imaging, we have used the AsPC-1 (+EGFR) human pancreatic adenocarcinoma in an orthotopic mouse model. EGF IRDye 800CW was injected 48 hours prior to imaging. MR image sequences were collected simultaneously with the fluorescence data using a MR-coupled diffuse optical tomography system. Image reconstruction was performed multiple times with varying abdominal organ segmentation in order to obtain a optimal tomographic image. It is shown that diffuse fluorescence tomography of the orthotopic pancreas model is feasible, with consideration of confounding fluorescence signals from the multiple organs and tissues surrounding the pancreas. MR-guided diffuse fluorescence tomography will be used to monitor EGF response after photodynamic therapy. Additionally, it provide the opportunity to individualize subsequent therapies based on response to PDT as well as to evaluate the success of combination therapies, such as PDT with chemotherapy, antibody therapy or even radiation.

Molecular and macro-scale analysis of enzyme-crosslinked silk hydrogels for rational biomaterial design.

Science.gov (United States)

McGill, Meghan; Coburn, Jeannine M; Partlow, Benjamin P; Mu, Xuan; Kaplan, David L

2017-11-01

Silk fibroin-based hydrogels have exciting applications in tissue engineering and therapeutic molecule delivery; however, their utility is dependent on their diffusive properties. The present study describes a molecular and macro-scale investigation of enzymatically-crosslinked silk fibroin hydrogels, and demonstrates that these systems have tunable crosslink density and diffusivity. We developed a liquid chromatography tandem mass spectroscopy (LC-MS/MS) method to assess the quantity and order of covalent tyrosine crosslinks in the hydrogels. This analysis revealed between 28 and 56% conversion of tyrosine to dityrosine, which was dependent on the silk concentration and reactant concentration. The crosslink density was then correlated with storage modulus, revealing that both crosslinking and protein concentration influenced the mechanical properties of the hydrogels. The diffusive properties of the bulk material were studied by fluorescence recovery after photobleaching (FRAP), which revealed a non-linear relationship between silk concentration and diffusivity. As a result of this work, a model for synthesizing hydrogels with known crosslink densities and diffusive properties has been established, enabling the rational design of silk hydrogels for biomedical applications. Hydrogels from naturally-derived silk polymers offer versitile opportunities in the biomedical field, however, their design has largely been an empirical process. We present a fundamental study of the crosslink density, storage modulus, and diffusion behavior of enzymatically-crosslinked silk hydrogels to better inform scaffold design. These studies revealed unexpected non-linear trends in the crosslink density and diffusivity of silk hydrogels with respect to protein concentration and crosslink reagent concentration. This work demonstrates the tunable diffusivity and crosslinking in silk fibroin hydrogels, and enables the rational design of biomaterials. Further, the characterization methods

Spectral function and quark diffusion constant in non-critical holographic QCD

Energy Technology Data Exchange (ETDEWEB)

Bu Yanyan, E-mail: yybu@itp.ac.cn [Institute of Theoretical Physics, Academia Sinica, Beijing 100190 (China); Yang Jinmin, E-mail: jmyang@itp.ac.cn [Institute of Theoretical Physics, Academia Sinica, Beijing 100190 (China)

2012-02-11

Motivated by recent studies of intersecting D-brane systems in critical string theory and phenomenological AdS/QCD models, we present a detailed analysis for the vector and scalar fluctuations in a non-critical holographic QCD model in the high temperature phase, i.e., the chiral symmetric phase. This model is described by N{sub f} pairs of D4 and D4{sup Macron} probe branes in a non-critical AdS{sub 6} black hole background. Focusing on the hydrodynamic as well as the high frequency limit, we analytically obtain spectral functions for vector and scalar modes on the flavor probe. Then we extract the light quark diffusion constant for flavor current using three different methods and find that different methods give the same results. We also compute the heavy quark diffusion constant for comparison with the light quark case.

Modelling and simulation of diffusive processes methods and applications

CERN Document Server

Basu, SK

2014-01-01

This book addresses the key issues in the modeling and simulation of diffusive processes from a wide spectrum of different applications across a broad range of disciplines. Features: discusses diffusion and molecular transport in living cells and suspended sediment in open channels; examines the modeling of peristaltic transport of nanofluids, and isotachophoretic separation of ionic samples in microfluidics; reviews thermal characterization of non-homogeneous media and scale-dependent porous dispersion resulting from velocity fluctuations; describes the modeling of nitrogen fate and transport

Cleavable DNA-protein hybrid molecular beacon: A novel efficient signal translator for sensitive fluorescence anisotropy bioassay.

Science.gov (United States)

Hu, Pan; Yang, Bin

2016-01-15

Due to its unique features such as high sensitivity, homogeneous format, and independence on fluorescent intensity, fluorescence anisotropy (FA) assay has become a hotspot of study in oligonucleotide-based bioassays. However, until now most FA probes require carefully customized structure designs, and thus are neither generalizable for different sensing systems nor effective to obtain sufficient signal response. To address this issue, a cleavable DNA-protein hybrid molecular beacon was successfully engineered for signal amplified FA bioassay, via combining the unique stable structure of molecular beacon and the large molecular mass of streptavidin. Compared with single DNA strand probe or conventional molecular beacon, the DNA-protein hybrid molecular beacon exhibited a much higher FA value, which was potential to obtain high signal-background ratio in sensing process. As proof-of-principle, this novel DNA-protein hybrid molecular beacon was further applied for FA bioassay using DNAzyme-Pb(2+) as a model sensing system. This FA assay approach could selectively detect as low as 0.5nM Pb(2+) in buffer solution, and also be successful for real samples analysis with good recovery values. Compatible with most of oligonucleotide probes' designs and enzyme-based signal amplification strategies, the molecular beacon can serve as a novel signal translator to expand the application prospect of FA technology in various bioassays. Copyright © 2015 Elsevier B.V. All rights reserved.

An Evaluation of Twenty Years of EU Framework Programme-funded Immune-mediated Inflammatory Translational Research in Non-human Primates

Directory of Open Access Journals (Sweden)

Krista Geraldine Haanstra

2016-11-01

Full Text Available Ageing western societies are facing an increasing prevalence of chronic inflammatory and degenerative diseases for which often no effective treatments exist, resulting in increasing health care expenditure. Despite high investments in drug development, the number of promising new drug candidates decreases. We propose that preclinical research in non-human primate can help to bridge the gap between drug discovery and drug prescription.Translational research covers various stages of drug development of which pre-clinical efficacy tests in valid animal models is usually the last stage. Pre-clinical research in non-human primates may be essential in the evaluation of new drugs or therapies when a relevant rodent model is not available. Non-human primate models for life-threatening or severely debilitating diseases in humans are available at the Biomedical Primate Research Centre (BPRC. These have been instrumental in translational research for several decades.In order to stimulate European health research and innovation from bench to bedside, the European Commission (EC has invested heavily in access to non-human primate research for more than 20 years. BPRC has hosted European users in a series of transnational access programs covering a wide range of research areas with the common theme being immune-mediated inflammatory disorders. We present an overview of the results and give an account of the studies performed as part of European Union Framework Programme (EU FP-funded translational non-human primate research performed at the BPRC. The data illustrate value of translational non-human primate research for the development of new therapies and emphasize the importance of EU FP funding

Thermo-diffusion effect on free convection heat and mass transfer in a thermally linearly stratified non-darcy porous media

KAUST Repository

Murthy, P.V.S.N.

2011-12-26

Thermo-diffusion effect on free convection heat and mass transfer from a vertical surface embedded in a liquid saturated thermally stratified non - Darcy porous medium has been analyzed using a local non-similar procedure. The wall temperature and concentration are constant and the medium is linearly stratified in the vertical direction with respect to the thermal conditions. The fluid flow, temperature and concentration fields are affected by the complex interactions among the diffusion ratio Le, buoyancy ratio N, thermo-diffusion parameter Sr and stratification parameter ?. Non-linear interactions of all these parameters on the convective transport has been analyzed and variation of heat and mass transfer coefficients with thermo-diffusion parameter in the thermally stratified non-Darcy porous media is presented through computer generated plots.

Thermo-diffusion effect on free convection heat and mass transfer in a thermally linearly stratified non-darcy porous media

KAUST Repository

Murthy, P.V.S.N.; El-Amin, Mohamed

2011-01-01

Thermo-diffusion effect on free convection heat and mass transfer from a vertical surface embedded in a liquid saturated thermally stratified non - Darcy porous medium has been analyzed using a local non-similar procedure. The wall temperature and concentration are constant and the medium is linearly stratified in the vertical direction with respect to the thermal conditions. The fluid flow, temperature and concentration fields are affected by the complex interactions among the diffusion ratio Le, buoyancy ratio N, thermo-diffusion parameter Sr and stratification parameter ?. Non-linear interactions of all these parameters on the convective transport has been analyzed and variation of heat and mass transfer coefficients with thermo-diffusion parameter in the thermally stratified non-Darcy porous media is presented through computer generated plots.

Passivation Using Molecular Halides Increases Quantum Dot Solar Cell Performance

KAUST Repository

Lan, Xinzheng; Voznyy, Oleksandr; Kiani, Amirreza; Garcí a de Arquer, F. Pelayo; Abbas, Abdullah Saud; Kim, Gi-Hwan; Liu, Mengxia; Yang, Zhenyu; Walters, Grant; Xu, Jixian; Yuan, Mingjian; Ning, Zhijun; Fan, Fengjia; Kanjanaboos, Pongsakorn; Kramer, Illan; Zhitomirsky, David; Lee, Philip; Perelgut, Alexander; Hoogland, Sjoerd; Sargent, Edward H.

2015-01-01

© 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim. Here we report a solution-based passivation scheme is developed featuring the use of molecular iodine and PbS colloidal quantum dots (CQDs). The improved passivation translates into a longer carrier diffusion length in the solid film. This allows thicker solar-cell devices to be built while preserving efficient charge collection, leading to a certified power conversion efficiency of 9.9%, which is a new record in CQD solar cells.

Passivation Using Molecular Halides Increases Quantum Dot Solar Cell Performance

KAUST Repository

Lan, Xinzheng

2015-11-18

© 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim. Here we report a solution-based passivation scheme is developed featuring the use of molecular iodine and PbS colloidal quantum dots (CQDs). The improved passivation translates into a longer carrier diffusion length in the solid film. This allows thicker solar-cell devices to be built while preserving efficient charge collection, leading to a certified power conversion efficiency of 9.9%, which is a new record in CQD solar cells.

Numerical solution of non-linear diffusion problems

International Nuclear Information System (INIS)

Carmen, A. del; Ferreri, J.C.

1998-01-01

This paper presents a method for the numerical solution of non-linear diffusion problems using finite-differences in moving grids. Due to the presence of steep fronts in the solution domain and to the presence of advective terms originating in the grid movement, an implicit TVD scheme, first order in time and second order in space has been developed. Some algebraic details of the derivation are given. Results are shown for the pure advection of a scalar as a test case and an example dealing with the slow spreading of viscous fluids over plane surfaces. The agreement between numerical and analytical solutions is excellent. (author). 8 refs., 3 figs

Lost in Translation?

NARCIS (Netherlands)

Jonkers, Peter

2017-01-01

Translating sacred scriptures is not only a praxis that is crucial for the fruitful, i.e. non-distorted and unbiased dialogue between different religious traditions, but also raises some fundamental theoretical questions when it comes to translating the sacred texts of the religious other or

Molecular Profiling to Optimize Treatment in Non-Small Cell Lung Cancer: A Review of Potential Molecular Targets for Radiation Therapy by the Translational Research Program of the Radiation Therapy Oncology Group

International Nuclear Information System (INIS)

Ausborn, Natalie L.; Le, Quynh Thu; Bradley, Jeffrey D.; Choy, Hak; Dicker, Adam P.; Saha, Debabrata; Simko, Jeff; Story, Michael D.; Torossian, Artour; Lu, Bo

2012-01-01

Therapeutic decisions in non-small cell lung cancer (NSCLC) have been mainly based on disease stage, performance status, and co-morbidities, and rarely on histological or molecular classification. Rather than applying broad treatments to unselected patients that may result in survival increase of only weeks to months, research efforts should be, and are being, focused on identifying predictive markers for molecularly targeted therapy and determining genomic signatures that predict survival and response to specific therapies. The availability of such targeted biologics requires their use to be matched to tumors of corresponding molecular vulnerability for maximum efficacy. Molecular markers such as epidermal growth factor receptor (EGFR), K-ras, vascular endothelial growth factor (VEGF), mammalian target of rapamycin (mTOR), and anaplastic lymphoma kinase (ALK) represent potential parameters guide treatment decisions. Ultimately, identifying patients who will respond to specific therapies will allow optimal efficacy with minimal toxicity, which will result in more judicious and effective application of expensive targeted therapy as the new paradigm of personalized medicine develops.

Molecular dynamics simulations of the diffusion and coalescence of helium in tungsten

Energy Technology Data Exchange (ETDEWEB)

Zhou, Y.L. [Key Lab for Radiation Physics and Technology, Institute of Nuclear Science and Technology, Sichuan University, Chengdu 610064 (China); Department of Physics, Guangxi University, Nanning 530004 (China); Wang, J. [Key Lab for Radiation Physics and Technology, Institute of Nuclear Science and Technology, Sichuan University, Chengdu 610064 (China); Hou, Q., E-mail: qhou@scu.edu.cn [Key Lab for Radiation Physics and Technology, Institute of Nuclear Science and Technology, Sichuan University, Chengdu 610064 (China); Deng, A.H. [Department of Physics, Sichuan University, Chengdu 610064 (China)

2014-03-15

Molecular dynamics (MD) simulations are performed on the diffusion and coalescence of helium in tungsten. A new method for determining the effective capture radii (ECRs) and the dissociation energies of helium-related defects is proposed in this work. It is observed that the ECR of an interstitial helium atom trapping helium interstitials (denoted as He–He{sub n}, n = 1–3) decreases with increasing temperature, except for He–He{sub 2} at T < 400 K. The traditional view that the ECR is approximately equal to the lattice constant, which has been widely used in kinetic Monte Carlo (KMC) and rate theory (RT) models, is only valid in some cases. However, the ECR between an interstitial helium atom and a substitutional helium atom (denoted as He–HeV) always approximates the third nearest-neighbor tetrahedral positions of the HeV. The diffusion coefficients D{sub n} for helium clusters are also investigated. He{sub 2} migrates more quickly than a single He atom does at T < 400 K, whereas the diffusion path of He{sub 2} changes at higher temperatures. Another counterintuitive observation is that D{sub 5} > D{sub 3} > D{sub 4} at T < 500 K, which can be attributed to the disordered structure of He{sub 5}. The Arrhenius relation describes the diffusion of He{sub n} well in the temperature range from 300 K to 550 K, whereas the diffusion is not a standard thermally activated process at higher temperatures. Taken together, these results help elucidate the initial stage of helium bubble formation in tungsten as well as the requirements of long-term evolution methods such as KMC or RT models.

Uniqueness and non-uniqueness of semigroups generated by singular diffusion operators

CERN Document Server

Eberle, Andreas

1999-01-01

This book addresses both probabilists working on diffusion processes and analysts interested in linear parabolic partial differential equations with singular coefficients. The central question discussed is whether a given diffusion operator, i.e., a second order linear differential operator without zeroth order term, which is a priori defined on test functions over some (finite or infinite dimensional) state space only, uniquely determines a strongly continuous semigroup on a corresponding weighted Lp space. Particular emphasis is placed on phenomena causing non-uniqueness, as well as on the relation between different notions of uniqueness appearing in analytic and probabilistic contexts.

Molecular classification of fatty liver by high-throughput profiling of protein post-translational modifications.

Science.gov (United States)

Urasaki, Yasuyo; Fiscus, Ronald R; Le, Thuc T

2016-04-01

We describe an alternative approach to classifying fatty liver by profiling protein post-translational modifications (PTMs) with high-throughput capillary isoelectric focusing (cIEF) immunoassays. Four strains of mice were studied, with fatty livers induced by different causes, such as ageing, genetic mutation, acute drug usage, and high-fat diet. Nutrient-sensitive PTMs of a panel of 12 liver metabolic and signalling proteins were simultaneously evaluated with cIEF immunoassays, using nanograms of total cellular protein per assay. Changes to liver protein acetylation, phosphorylation, and O-N-acetylglucosamine glycosylation were quantified and compared between normal and diseased states. Fatty liver tissues could be distinguished from one another by distinctive protein PTM profiles. Fatty liver is currently classified by morphological assessment of lipid droplets, without identifying the underlying molecular causes. In contrast, high-throughput profiling of protein PTMs has the potential to provide molecular classification of fatty liver. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Sorbate Transport in Carbon Molecular Sieve Membranes and FAU/EMT Intergrowth by Diffusion NMR

Directory of Open Access Journals (Sweden)

John J. Low

2012-02-01

Full Text Available In this paper we present and discuss selected results of our recent studies of sorbate self-diffusion in microporous materials. The main focus is given to transport properties of carbon molecular sieve (CMS membranes as well as of the intergrowth of FAU-type and EMT-type zeolites. CMS membranes show promise for applications in separations of mixtures of small gas molecules, while FAU/EMT intergrowth can be used as an active and selective cracking catalyst. For both types of applications diffusion of guest molecules in the micropore networks of these materials is expected to play an important role. Diffusion studies were performed by a pulsed field gradient (PFG NMR technique that combines advantages of high field (17.6 T NMR and high magnetic field gradients (up to 30 T/m. This technique has been recently introduced at the University of Florida in collaboration with the National Magnet Lab. In addition to a more conventional proton PFG NMR, also carbon-13 PFG NMR was used.

Diffusion in membranes: Toward a two-dimensional diffusion map

Directory of Open Access Journals (Sweden)

Toppozini Laura

2015-01-01

Full Text Available For decades, quasi-elastic neutron scattering has been the prime tool for studying molecular diffusion in membranes over relevant nanometer distances. These experiments are essential to our current understanding of molecular dynamics of lipids, proteins and membrane-active molecules. Recently, we presented experimental evidence from X-ray diffraction and quasi-elastic neutron scattering demonstrating that ethanol enhances the permeability of membranes. At the QENS 2014/WINS 2014 conference we presented a novel technique to measure diffusion across membranes employing 2-dimensional quasi-elastic neutron scattering. We present results from our preliminary analysis of an experiment on the cold neutron multi-chopper spectrometer LET at ISIS, where we studied the self-diffusion of water molecules along lipid membranes and have the possibility of studying the diffusion in membranes. By preparing highly oriented membrane stacks and aligning them horizontally in the spectrometer, our aim is to distinguish between lateral and transmembrane diffusion. Diffusion may also be measured at different locations in the membranes, such as the water layer and the hydrocarbon membrane core. With a complete analysis of the data, 2-dimensional mapping will enable us to determine diffusion channels of water and ethanol molecules to quantitatively determine nanoscale membrane permeability.

Fluorescence Correlation Spectroscopy to Study Diffusion of Polymer Chains within Layered Hydrogen-Bonded Polymer Films

Science.gov (United States)

Pristinski, Denis; Kharlampieva, Evguenia; Sukhishvili, Svetlana

2002-03-01

Fluorescence Correlation Spectroscopy (FCS) has been used to probe molecular motions within polymer multilayers formed by hydrogen-bonding sequential self-assembly. Polyethylene glycol (PEG) molecules were end-labeled with the fluorescent tags, and self-assembled with polymethacrylic acid (PMAA) using layer-by-layer deposition. We have found that molecules included in the top adsorbed layer have significant mobility at the millisecond time scale, probably due to translational diffusion. However, their dynamics deviate from classical Brownian motion with a single diffusion time. Possible reasons for the deviation are discussed. We found that motions were significantly slowed with increasing depth within the PEG/PMAA multilayer. This phenomena occured in a narrow pH range around 4.0 in which intermolecular interactions were relatively weak.

Electron-translation effects in heavy-ion scattering

International Nuclear Information System (INIS)

Heinz, U.; Greiner, W.; Mueller, B.

1981-01-01

The origin and importance of electron-translation effects within a molecular description of electronic excitations in heavy-ion collisions is investigated. First, a fully consistent quantum-mechanical description of the scattering process is developed; the electrons are described by relativistic molecular orbitals, while the nuclear motion is approximated nonrelativistically. Leaving the quantum-mechanical level by using the semiclassical approximation for the nuclear motion, a set of coupled differential equations for the occupation amplitudes of the molecular orbitals is derived. In these coupled-channel equations the spurious asymptotic dynamical couplings are corrected for by additional matrix elements stemming from the electron translation. Hence, a molecular description of electronic excitations in heavy-ion scattering has been achieved, which is free from the spurious asymptotic couplings of the conventional perturbated stationary-state approach. The importance of electron-translation effects for continuum electrons and positrons is investigated. To this end an algorithm for the description of continuum electrons is proposed, which for the first time should allow for the calculation of angular distributions for delta electrons. Finally, the practical consequences of electron-translation effects are studied by calculating the corrected coupling matrix elements for the Pb-Cm system and comparing the corresponding K-vacancy probabilities with conventional calculations. We critically discuss conventional methods for cutting off the coupling matrix elements in coupled-channel calculations

JavaScript DNA translator: DNA-aligned protein translations.

Science.gov (United States)

Perry, William L

2002-12-01

There are many instances in molecular biology when it is necessary to identify ORFs in a DNA sequence. While programs exist for displaying protein translations in multiple ORFs in alignment with a DNA sequence, they are often expensive, exist as add-ons to software that must be purchased, or are only compatible with a particular operating system. JavaScript DNA Translator is a shareware application written in JavaScript, a scripting language interpreted by the Netscape Communicator and Internet Explorer Web browsers, which makes it compatible with several different operating systems. While the program uses a familiar Web page interface, it requires no connection to the Internet since calculations are performed on the user's own computer. The program analyzes one or multiple DNA sequences and generates translations in up to six reading frames aligned to a DNA sequence, in addition to displaying translations as separate sequences in FASTA format. ORFs within a reading frame can also be displayed as separate sequences. Flexible formatting options are provided, including the ability to hide ORFs below a minimum size specified by the user. The program is available free of charge at the BioTechniques Software Library (www.Biotechniques.com).

Translational and rotational motions of proteins in a protein crowded environment

NARCIS (Netherlands)

Zorilla, S.; Hink, M.A.; Visser, A.J.W.G.; Lillo, M.P.

2007-01-01

Fluorescence correlation spectroscopy (FCS) was used to measure the translational diffusion of labeled apomyoglobin (tracer) in concentrated solutions of ribonuclease A and human serum albumin (crowders), as a quantitative model system of protein diffusive motions in crowded physiological

Diffusion of hydrocarbons in confined media: Translational and ...

Indian Academy of Sciences (India)

Unknown

At a more fundamental level, the laws governing the diffusion and other properties of ..... Partial financial support from the Council of Scientific and Industrial Research ... Authors also wish to thank Department of Science & Technology, New.

Molecular dynamics simulation of self-diffusion processes in titanium in bulk material, on grain junctions and on surface.

Science.gov (United States)

Sushko, Gennady B; Verkhovtsev, Alexey V; Yakubovich, Alexander V; Schramm, Stefan; Solov'yov, Andrey V

2014-08-21

The process of self-diffusion of titanium atoms in a bulk material, on grain junctions and on surface is explored numerically in a broad temperature range by means of classical molecular dynamics simulation. The analysis is carried out for a nanoscale cylindrical sample consisting of three adjacent sectors and various junctions between nanocrystals. The calculated diffusion coefficient varies by several orders of magnitude for different regions of the sample. The calculated values of the bulk diffusion coefficient correspond reasonably well to the experimental data obtained for solid and molten states of titanium. Investigation of diffusion in the nanocrystalline titanium is of a significant importance because of its numerous technological applications. This paper aims to reduce the lack of data on diffusion in titanium and describe the processes occurring in bulk, at different interfaces and on surface of the crystalline titanium.

Thermal diffusion (1963); Diffusion thermique (1963)

Energy Technology Data Exchange (ETDEWEB)

Lemarechal, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

1963-07-01

This report brings together the essential principles of thermal diffusion in the liquid and gaseous phases. The macroscopic and molecular aspects of the thermal diffusion constant are reviewed, as well as the various measurement method; the most important developments however concern the operation of the CLUSIUS and DICKEL thermo-gravitational column and its applications. (author) [French] Ce rapport rassemble les principes essentiels de la diffusion thermique en phase liquide et en phase gazeuse. Les aspects macroscopique et moleculaire de la constante de diffusion thermique sont passes en revue ainsi que ses differentes methodes de mesure; mais les developpements les plus importants concernent le fonctionnement de ls colonne thermogravitationnelle de CLUSIUS et DICKEL et ses applications. (auteur)

Molecular dynamics simulations of adsorption and diffusion of Xe on bare and Xe covered Pt(111)

NARCIS (Netherlands)

Jong, de F.; Jansen, A.P.J.

1994-01-01

Molecular dynamics simulations are used to calculate adsorption probabilities and diffusion coefficients of Xe on Pt(111) and Xe/Pt(111). Experimental trends are reproduced. The adsorption mechanism is found to be the modified Kisliuk model, with the addition of direct and indirect insertion in the

Effects of substrate anisotropy and edge diffusion on submonolayer growth during molecular beam epitaxy: A Kinetic Monte Carlo study

International Nuclear Information System (INIS)

Devkota, J.; Shrestha, S.P.

2007-12-01

We have performed Kinetic Monte Carlo simulation work to study the effect of diffusion anisotropy, bonding anisotropy and edge diffusion on island formation at different temperatures during the sub-monolayer film growth in Molecular Beam Epitaxy. We use simple cubic solid on solid model and event based Bortz, Kalos and Labowitch (BKL) algorithm on the Kinetic Monte Carlo method to simulate the physical phenomena. We have found that the island morphology and growth exponent are found to be influenced by substrate anisotropy as well as edge diffusion, however they do not play a significant role in island elongation. The growth exponent and island size distribution are observed to be influenced by substrate anisotropy but are negligibly influenced by edge diffusion. We have found fractal islands when edge diffusion is excluded and compact islands when edge diffusion is included. (author)

Effects of fluctuations and noise on the neutron monitor diurnal anisotropy. II. Non-field-aligned diffusion

International Nuclear Information System (INIS)

Owens, A.J.

1977-01-01

The effects of non-field-aligned diffusion (i.e., terms in the diffusion tensor proportional to the antisymmetric coefficient kappa/sub A/) on the observed day-to-day deviation of the diffusive diurnal anisotropy from the daily average magnetic field direction are considered. Using reasonable parameters for the diffusion of cosmic rays in interplanetary space, I show that these terms give a natural explanation for the angular difference between the anisotropy and field directions during normal quiet interplanetary epochs

A molecular dynamics study of nuclear quantum effect on the diffusion of hydrogen in condensed phase

International Nuclear Information System (INIS)

Nagashima, Hiroki; Tokumasu, Takashi; Tsuda, Shin-ichi; Tsuboi, Nobuyuki; Koshi, Mitsuo; Hayashie, A. Koichi

2014-01-01

In this paper, the quantum effect of hydrogen molecule on its diffusivity is analyzed using Molecular Dynamics (MD) method. The path integral centroid MD (CMD) method is applied for the reproduction method of time evolution of the molecules. The diffusion coefficient of liquid hydrogen is calculated using the Green-Kubo method. The simulation is performed at wide temperature region and the temperature dependence of the quantum effect of hydrogen molecule is addressed. The calculation results are compared with those of classical MD results. As a result, it is confirmed that the diffusivity of hydrogen molecule is changed depending on temperature by the quantum effect. It is clarified that this result can be explained that the dominant factor by quantum effect on the diffusivity of hydrogen changes from the swollening the potential to the shallowing the potential well around 30 K. Moreover, it is found that this tendency is related to the temperature dependency of the ratio of the quantum kinetic energy and classical kinetic energy

Line emission processes in atomic and molecular shocks

International Nuclear Information System (INIS)

Shull, J.M.

1988-01-01

The review discusses the observations and theoretical models of interstellar shock waves in diffuse and molecular clouds. After summarizing the relevant gas dynamics, atomic, molecular and grain processes, and physics of radiative and magnetic precursors, the author describes observational diagnostics of shocks. This paper concludes with a discussion of two topics: unstable or non-steady shocks and thermal conduction in metal-rich shocks

Dark field differential dynamic microscopy enables accurate characterization of the roto-translational dynamics of bacteria and colloidal clusters

Science.gov (United States)

Cerbino, Roberto; Piotti, Davide; Buscaglia, Marco; Giavazzi, Fabio

2018-01-01

Micro- and nanoscale objects with anisotropic shape are key components of a variety of biological systems and inert complex materials, and represent fundamental building blocks of novel self-assembly strategies. The time scale of their thermal motion is set by their translational and rotational diffusion coefficients, whose measurement may become difficult for relatively large particles with small optical contrast. Here we show that dark field differential dynamic microscopy is the ideal tool for probing the roto-translational Brownian motion of anisotropic shaped particles. We demonstrate our approach by successful application to aqueous dispersions of non-motile bacteria and of colloidal aggregates of spherical particles.

DIFFUSIVE PROPAGATION OF ENERGY IN A NON-ACOUSTIC CHAIN

OpenAIRE

Komorowski , Tomasz; Olla , Stefano

2017-01-01

International audience; We consider a non acoustic chain of harmonic oscil-lators with the dynamics perturbed by a random local exchange of momentum, such that energy and momentum are conserved. The macroscopic limits of the energy density, momentum and the curvature (or bending) of the chain satisfy a system of evolution equations. We prove that, in a diffusive space-time scaling, the curvature and momentum evolve following a linear system that corresponds to a damped Euler-Bernoulli beam eq...

Accurate reaction-diffusion operator splitting on tetrahedral meshes for parallel stochastic molecular simulations

Energy Technology Data Exchange (ETDEWEB)

Hepburn, I.; De Schutter, E., E-mail: erik@oist.jp [Computational Neuroscience Unit, Okinawa Institute of Science and Technology Graduate University, Onna, Okinawa 904 0495 (Japan); Theoretical Neurobiology & Neuroengineering, University of Antwerp, Antwerp 2610 (Belgium); Chen, W. [Computational Neuroscience Unit, Okinawa Institute of Science and Technology Graduate University, Onna, Okinawa 904 0495 (Japan)

2016-08-07

Spatial stochastic molecular simulations in biology are limited by the intense computation required to track molecules in space either in a discrete time or discrete space framework, which has led to the development of parallel methods that can take advantage of the power of modern supercomputers in recent years. We systematically test suggested components of stochastic reaction-diffusion operator splitting in the literature and discuss their effects on accuracy. We introduce an operator splitting implementation for irregular meshes that enhances accuracy with minimal performance cost. We test a range of models in small-scale MPI simulations from simple diffusion models to realistic biological models and find that multi-dimensional geometry partitioning is an important consideration for optimum performance. We demonstrate performance gains of 1-3 orders of magnitude in the parallel implementation, with peak performance strongly dependent on model specification.

Translation as a Way of Intercultural Communication

Directory of Open Access Journals (Sweden)

Marina Alexeevna Laskovets

2014-09-01

Full Text Available The article focuses on the role of translation in teaching foreign languages to non-linguistic students and postgraduates. The translation is a way of intercultural communication. At present, the translation is not only a means of teaching and control, but also an objective of foreign language teaching and additional qualification, which is “translator of vocationally oriented texts”. The article highlights a number of issues of teaching specialized translation to non-linguistic students and postgraduates as a part of higher education in the Russian Federation.

How molecular motors are arranged on a cargo is important for vesicular transport.

Directory of Open Access Journals (Sweden)

Robert P Erickson

2011-05-01

Full Text Available The spatial organization of the cell depends upon intracellular trafficking of cargos hauled along microtubules and actin filaments by the molecular motor proteins kinesin, dynein, and myosin. Although much is known about how single motors function, there is significant evidence that cargos in vivo are carried by multiple motors. While some aspects of multiple motor function have received attention, how the cargo itself--and motor organization on the cargo--affects transport has not been considered. To address this, we have developed a three-dimensional Monte Carlo simulation of motors transporting a spherical cargo, subject to thermal fluctuations that produce both rotational and translational diffusion. We found that these fluctuations could exert a load on the motor(s, significantly decreasing the mean travel distance and velocity of large cargos, especially at large viscosities. In addition, the presence of the cargo could dramatically help the motor to bind productively to the microtubule: the relatively slow translational and rotational diffusion of moderately sized cargos gave the motors ample opportunity to bind to a microtubule before the motor/cargo ensemble diffuses out of range of that microtubule. For rapidly diffusing cargos, the probability of their binding to a microtubule was high if there were nearby microtubules that they could easily reach by translational diffusion. Our simulations found that one reason why motors may be approximately 100 nm long is to improve their 'on' rates when attached to comparably sized cargos. Finally, our results suggested that to efficiently regulate the number of active motors, motors should be clustered together rather than spread randomly over the surface of the cargo. While our simulation uses the specific parameters for kinesin, these effects result from generic properties of the motors, cargos, and filaments, so they should apply to other motors as well.

Fourth order Douglas implicit scheme for solving three dimension reaction diffusion equation with non-linear source term

Science.gov (United States)

Hasnain, Shahid; Saqib, Muhammad; Mashat, Daoud Suleiman

2017-07-01

This research paper represents a numerical approximation to non-linear three dimension reaction diffusion equation with non-linear source term from population genetics. Since various initial and boundary value problems exist in three dimension reaction diffusion phenomena, which are studied numerically by different numerical methods, here we use finite difference schemes (Alternating Direction Implicit and Fourth Order Douglas Implicit) to approximate the solution. Accuracy is studied in term of L2, L∞ and relative error norms by random selected grids along time levels for comparison with analytical results. The test example demonstrates the accuracy, efficiency and versatility of the proposed schemes. Numerical results showed that Fourth Order Douglas Implicit scheme is very efficient and reliable for solving 3-D non-linear reaction diffusion equation.

Fourth order Douglas implicit scheme for solving three dimension reaction diffusion equation with non-linear source term

Directory of Open Access Journals (Sweden)

Shahid Hasnain

2017-07-01

Full Text Available This research paper represents a numerical approximation to non-linear three dimension reaction diffusion equation with non-linear source term from population genetics. Since various initial and boundary value problems exist in three dimension reaction diffusion phenomena, which are studied numerically by different numerical methods, here we use finite difference schemes (Alternating Direction Implicit and Fourth Order Douglas Implicit to approximate the solution. Accuracy is studied in term of L2, L∞ and relative error norms by random selected grids along time levels for comparison with analytical results. The test example demonstrates the accuracy, efficiency and versatility of the proposed schemes. Numerical results showed that Fourth Order Douglas Implicit scheme is very efficient and reliable for solving 3-D non-linear reaction diffusion equation.

A molecular doorstop ensures a trickle through translational repression.

Science.gov (United States)

Brook, Matthew; Smith, Richard W P; Gray, Nicola K

2012-03-30

Switching mRNA translation off and on is central to regulated gene expression, but what mechanisms moderate the extent of switch-off? Yao et al. describe how basal expression from interferon-gamma-induced transcripts is maintained during mRNA-specific translational repression. This antagonistic mechanism utilizes a truncated RNA-binding factor generated by a unique alternative polyadenylation event. Copyright © 2012 Elsevier Inc. All rights reserved.

Translating Alcohol Research

Science.gov (United States)

Batman, Angela M.; Miles, Michael F.

2015-01-01

Alcohol use disorder (AUD) and its sequelae impose a major burden on the public health of the United States, and adequate long-term control of this disorder has not been achieved. Molecular and behavioral basic science research findings are providing the groundwork for understanding the mechanisms underlying AUD and have identified multiple candidate targets for ongoing clinical trials. However, the translation of basic research or clinical findings into improved therapeutic approaches for AUD must become more efficient. Translational research is a multistage process of streamlining the movement of basic biomedical research findings into clinical research and then to the clinical target populations. This process demands efficient bidirectional communication across basic, applied, and clinical science as well as with clinical practitioners. Ongoing work suggests rapid progress is being made with an evolving translational framework within the alcohol research field. This is helped by multiple interdisciplinary collaborative research structures that have been developed to advance translational work on AUD. Moreover, the integration of systems biology approaches with collaborative clinical studies may yield novel insights for future translational success. Finally, appreciation of genetic variation in pharmacological or behavioral treatment responses and optimal communication from bench to bedside and back may strengthen the success of translational research applications to AUD. PMID:26259085

Enzymatic and acidic degradation of high molecular weight dextran into low molecular weight and its characterizations using novel Diffusion-ordered NMR spectroscopy.

Science.gov (United States)

Iqbal, Samina; Marchetti, Roberta; Aman, Afsheen; Silipo, Alba; Qader, Shah Ali Ul; Molinaro, Antonio

2017-10-01

Low molecular weight fractions were derived from native high molecular weight dextran produced by Leuconostoc mesenteroides KIBGE-IB26. Structural characterization of native and low molecular weight fractions obtained after acidic and enzymatic hydrolysis was done using FTIR and NMR spectroscopy. The molecular weight was estimated using Diffusion Ordered NMR spectroscopy. Native dextran (892kDa) is composed of α-(1→6) glycosidic linkage along with α-(1→3) branching. Major proportion of 528kDa dextran was obtained after prolong enzymatic hydrolysis however, an effective acidic treatment at pH-1.4 up to 02 and 04h of exposure resulted in the formation of 77kDa and 57kDa, respectively. The increment in pH from 1.4 to 1.8 lowered the hydrolysis efficiency and resulted in the formation of 270kDa dextran fraction. The results suggest that derived low molecular weight water soluble fractions can be utilized as a drug delivery carrier along with multiple application relating pharmaceutical industries. Copyright © 2017 Elsevier B.V. All rights reserved.

The effects of size, shape, and surface composition on the diffusive behaviors of nanoparticles at/across water–oil interfaces via molecular dynamics simulations

Energy Technology Data Exchange (ETDEWEB)

Gao, Wei; Jiao, Yang; Dai, Lenore L., E-mail: Lenore.Dai@asu.edu [Arizona State University, School of Engineering of Matter, Transport, and Energy (United States)

2016-04-15

We have employed molecular dynamics simulations to systematically investigate the effects of nanoparticles’ structural and chemical properties on their diffusive behaviors at/across the water–benzene interface. Four different nanoparticles were studied: modified hydrocarbon nanoparticles with a mean diameter of 1.2 nm (1.2HCPs), modified hydrocarbon nanoparticles with a mean diameter of 0.6 nm (0.6HCPs), single-walled carbon nanotubes (SWCNTs), and buckyballs. We found that the diffusion coefficients of 0.6 and 1.2HCP were larger than the corresponding values predicted using the Stokes–Einstein (SE) equation and attributed this deviation to the small particle size and the anisotropy of the interface system. In addition, the observed directional diffusive behaviors for various particles were well-correlated with the derivative of the potential of mean force (PMF), which might indicate an effective driving force for the particles along the direction perpendicular to the interface. We also found that nanoparticles with isotropic shape and uniform surface, e.g., buckyballs, tend to have smaller diffusion coefficients than those of nanoparticles with comparable dimensions but anisotropic shapes and non-uniform surface composition, e.g., SWCNT and 0.6HCP. One possible hypothesis for this behavior is that the “perfect” isotropic shape and uniform surface of buckyballs result in a better-defined “solvation shell” (i.e., a shell of solution molecules), which leads to a larger “effective radius” of the particle, and thus, a reduced diffusion coefficient.

Translation initiation mediated by nuclear cap-binding protein complex.

Science.gov (United States)

Ryu, Incheol; Kim, Yoon Ki

2017-04-01

In mammals, cap-dependent translation of mRNAs is initiated by two distinct mechanisms: cap-binding complex (CBC; a heterodimer of CBP80 and 20)-dependent translation (CT) and eIF4E-dependent translation (ET). Both translation initiation mechanisms share common features in driving cap- dependent translation; nevertheless, they can be distinguished from each other based on their molecular features and biological roles. CT is largely associated with mRNA surveillance such as nonsense-mediated mRNA decay (NMD), whereas ET is predominantly involved in the bulk of protein synthesis. However, several recent studies have demonstrated that CT and ET have similar roles in protein synthesis and mRNA surveillance. In a subset of mRNAs, CT preferentially drives the cap-dependent translation, as ET does, and ET is responsible for mRNA surveillance, as CT does. In this review, we summarize and compare the molecular features of CT and ET with a focus on the emerging roles of CT in translation. [BMB Reports 2017; 50(4): 186-193].

MRI Evaluation of Non-Necrotic T2-Hyperintense Foci in Pediatric Diffuse Intrinsic Pontine Glioma.

Science.gov (United States)

Clerk-Lamalice, O; Reddick, W E; Li, X; Li, Y; Edwards, A; Glass, J O; Patay, Z

2016-05-19

The conventional MR imaging appearance of diffuse intrinsic pontine glioma suggests intralesional histopathologic heterogeneity, and various distinct lesion components, including T2-hypointense foci, have been described. Here we report the prevalence, conventional MR imaging semiology, and advanced MR imaging features of non-necrotic T2-hyperintense foci in diffuse intrinsic pontine glioma. Twenty-five patients with diffuse intrinsic pontine gliomas were included in this study. MR imaging was performed at 3T by using conventional and advanced MR imaging sequences. Perfusion (CBV), vascular permeability (v e , K trans ), and diffusion (ADC) metrics were calculated and used to characterize non-necrotic T2-hyperintense foci in comparison with other lesion components, namely necrotic T2-hyperintense foci, T2-hypointense foci, peritumoral edema, and normal brain stem. Statistical analysis was performed by using Kruskal-Wallis and Wilcoxon rank sum tests. Sixteen non-necrotic T2-hyperintense foci were found in 12 tumors. In these foci, ADC values were significantly higher than those in either T2-hypointense foci (P = .002) or normal parenchyma (P = .0002), and relative CBV values were significantly lower than those in either T2-hypointense (P = .0002) or necrotic T2-hyperintense (P = .006) foci. Volume transfer coefficient values in T2-hyperintense foci were lower than those in T2-hypointense (P = .0005) or necrotic T2-hyperintense (P = .0348) foci. Non-necrotic T2-hyperintense foci are common, distinct lesion components within diffuse intrinsic pontine gliomas. Advanced MR imaging data suggest low cellularity and an early stage of angioneogenesis with leaky vessels resulting in expansion of the extracellular space. Because of the lack of biopsy validation, the underlying histoarchitectural and pathophysiologic changes remain unclear; therefore, these foci may correspond to a poorly understood biologic event in tumor evolution. © 2016 American Society of Neuroradiology.

Performance of active feedforward control systems in non-ideal, synthesized diffuse sound fields.

Science.gov (United States)

Misol, Malte; Bloch, Christian; Monner, Hans Peter; Sinapius, Michael

2014-04-01

The acoustic performance of passive or active panel structures is usually tested in sound transmission loss facilities. A reverberant sending room, equipped with one or a number of independent sound sources, is used to generate a diffuse sound field excitation which acts as a disturbance source on the structure under investigation. The spatial correlation and coherence of such a synthesized non-ideal diffuse-sound-field excitation, however, might deviate significantly from the ideal case. This has consequences for the operation of an active feedforward control system which heavily relies on the acquisition of coherent disturbance source information. This work, therefore, evaluates the spatial correlation and coherence of ideal and non-ideal diffuse sound fields and considers the implications on the performance of a feedforward control system. The system under consideration is an aircraft-typical double panel system, equipped with an active sidewall panel (lining), which is realized in a transmission loss facility. Experimental results for different numbers of sound sources in the reverberation room are compared to simulation results of a comparable generic double panel system excited by an ideal diffuse sound field. It is shown that the number of statistically independent noise sources acting on the primary structure of the double panel system depends not only on the type of diffuse sound field but also on the sample lengths of the processed signals. The experimental results show that the number of reference sensors required for a defined control performance exhibits an inverse relationship to control filter length.

Molecular diffusion of stable water isotopes in polar firn as a proxy for past temperatures

Science.gov (United States)

Holme, Christian; Gkinis, Vasileios; Vinther, Bo M.

2018-03-01

Polar precipitation archived in ice caps contains information on past temperature conditions. Such information can be retrieved by measuring the water isotopic signals of δ18O and δD in ice cores. These signals have been attenuated during densification due to molecular diffusion in the firn column, where the magnitude of the diffusion is isotopologue specific and temperature dependent. By utilizing the differential diffusion signal, dual isotope measurements of δ18O and δD enable multiple temperature reconstruction techniques. This study assesses how well six different methods can be used to reconstruct past surface temperatures from the diffusion-based temperature proxies. Two of the methods are based on the single diffusion lengths of δ18O and δD , three of the methods employ the differential diffusion signal, while the last uses the ratio between the single diffusion lengths. All techniques are tested on synthetic data in order to evaluate their accuracy and precision. We perform a benchmark test to thirteen high resolution Holocene data sets from Greenland and Antarctica, which represent a broad range of mean annual surface temperatures and accumulation rates. Based on the benchmark test, we comment on the accuracy and precision of the methods. Both the benchmark test and the synthetic data test demonstrate that the most precise reconstructions are obtained when using the single isotope diffusion lengths, with precisions of approximately 1.0 °C . In the benchmark test, the single isotope diffusion lengths are also found to reconstruct consistent temperatures with a root-mean-square-deviation of 0.7 °C . The techniques employing the differential diffusion signals are more uncertain, where the most precise method has a precision of 1.9 °C . The diffusion length ratio method is the least precise with a precision of 13.7 °C . The absolute temperature estimates from this method are also shown to be highly sensitive to the choice of fractionation factor

Translational analysis of mouse and human placental protein and mRNA reveals distinct molecular pathologies in human preeclampsia.

Science.gov (United States)

Cox, Brian; Sharma, Parveen; Evangelou, Andreas I; Whiteley, Kathie; Ignatchenko, Vladimir; Ignatchenko, Alex; Baczyk, Dora; Czikk, Marie; Kingdom, John; Rossant, Janet; Gramolini, Anthony O; Adamson, S Lee; Kislinger, Thomas

2011-12-01

Preeclampsia (PE) adversely impacts ~5% of pregnancies. Despite extensive research, no consistent biomarkers or cures have emerged, suggesting that different molecular mechanisms may cause clinically similar disease. To address this, we undertook a proteomics study with three main goals: (1) to identify a panel of cell surface markers that distinguish the trophoblast and endothelial cells of the placenta in the mouse; (2) to translate this marker set to human via the Human Protein Atlas database; and (3) to utilize the validated human trophoblast markers to identify subgroups of human preeclampsia. To achieve these goals, plasma membrane proteins at the blood tissue interfaces were extracted from placentas using intravascular silica-bead perfusion, and then identified using shotgun proteomics. We identified 1181 plasma membrane proteins, of which 171 were enriched at the maternal blood-trophoblast interface and 192 at the fetal endothelial interface with a 70% conservation of expression in humans. Three distinct molecular subgroups of human preeclampsia were identified in existing human microarray data by using expression patterns of trophoblast-enriched proteins. Analysis of all misexpressed genes revealed divergent dysfunctions including angiogenesis (subgroup 1), MAPK signaling (subgroup 2), and hormone biosynthesis and metabolism (subgroup 3). Subgroup 2 lacked expected changes in known preeclampsia markers (sFLT1, sENG) and uniquely overexpressed GNA12. In an independent set of 40 banked placental specimens, GNA12 was overexpressed during preeclampsia when co-incident with chronic hypertension. In the current study we used a novel translational analysis to integrate mouse and human trophoblast protein expression with human microarray data. This strategy identified distinct molecular pathologies in human preeclampsia. We conclude that clinically similar preeclampsia patients exhibit divergent placental gene expression profiles thus implicating divergent

Multi-charge-state molecular dynamics and self-diffusion coefficient in the warm dense matter regime

Science.gov (United States)

Fu, Yongsheng; Hou, Yong; Kang, Dongdong; Gao, Cheng; Jin, Fengtao; Yuan, Jianmin

2018-01-01

We present a multi-ion molecular dynamics (MIMD) simulation and apply it to calculating the self-diffusion coefficients of ions with different charge-states in the warm dense matter (WDM) regime. First, the method is used for the self-consistent calculation of electron structures of different charge-state ions in the ion sphere, with the ion-sphere radii being determined by the plasma density and the ion charges. The ionic fraction is then obtained by solving the Saha equation, taking account of interactions among different charge-state ions in the system, and ion-ion pair potentials are computed using the modified Gordon-Kim method in the framework of temperature-dependent density functional theory on the basis of the electron structures. Finally, MIMD is used to calculate ionic self-diffusion coefficients from the velocity correlation function according to the Green-Kubo relation. A comparison with the results of the average-atom model shows that different statistical processes will influence the ionic diffusion coefficient in the WDM regime.

Hybrid [{sup 18}F]-FDG PET/MRI including non-Gaussian diffusion-weighted imaging (DWI): Preliminary results in non-small cell lung cancer (NSCLC)

Energy Technology Data Exchange (ETDEWEB)

Heusch, Philipp [Univ Dusseldorf, Medical Faculty, Department of Diagnostic and Interventional Radiology, D-40225 Dusseldorf (Germany); Univ Duisburg-Essen, Medical Faculty, Department of Diagnostic and Interventional Radiology and Neuroradiology, D-45147 Essen (Germany); Köhler, Jens [Univ Duisburg-Essen, Medical Faculty, Department of Medical Oncology, D-45147 Essen (Germany); Wittsack, Hans-Joerg [Univ Dusseldorf, Medical Faculty, Department of Diagnostic and Interventional Radiology, D-40225 Dusseldorf (Germany); Heusner, Till A., E-mail: Heusner@med.uni-duesseldorf.de [Univ Dusseldorf, Medical Faculty, Department of Diagnostic and Interventional Radiology, D-40225 Dusseldorf (Germany); Buchbender, Christian [Univ Dusseldorf, Medical Faculty, Department of Diagnostic and Interventional Radiology, D-40225 Dusseldorf (Germany); Poeppel, Thorsten D. [Univ Duisburg-Essen, Medical Faculty, Department of Nuclear Medicine, D-45147 Essen (Germany); Nensa, Felix; Wetter, Axel [Univ Duisburg-Essen, Medical Faculty, Department of Diagnostic and Interventional Radiology and Neuroradiology, D-45147 Essen (Germany); Gauler, Thomas [Univ Duisburg-Essen, Medical Faculty, Department of Medical Oncology, D-45147 Essen (Germany); Hartung, Verena [Univ Duisburg-Essen, Medical Faculty, Department of Nuclear Medicine, D-45147 Essen (Germany); Lanzman, Rotem S. [Univ Dusseldorf, Medical Faculty, Department of Diagnostic and Interventional Radiology, D-40225 Dusseldorf (Germany)

2013-11-01

Purpose: To assess the feasibility of non-Gaussian DWI as part of a FDG-PET/MRI protocol in patients with histologically proven non-small cell lung cancer. Material and methods: 15 consecutive patients with histologically proven NSCLC (mean age 61 ± 11 years) were included in this study and underwent whole-body FDG-PET/MRI following whole-body FDG-PET/CT. As part of the whole-body FDG-PET/MRI protocol, an EPI-sequence with 5 b-values (0, 100, 500, 1000 and 2000 s/mm{sup 2}) was acquired for DWI of the thorax during free-breathing. Volume of interest (VOI) measurements were performed to determine the maximum and mean standardized uptake value (SUV{sub max}; SUV{sub mean}). A region of interest (ROI) was manually drawn around the tumor on b = 0 images and then transferred to the corresponding parameter maps to assess ADC{sub mono}, D{sub app} and K{sub app}. To assess the goodness of the mathematical fit R{sup 2} was calculated for monoexponential and non-Gaussian analysis. Spearman's correlation coefficients were calculated to compare SUV values and diffusion coefficients. A Student's t-test was performed to compare the monoexponential and non-Gaussian diffusion fitting (R{sup 2}). Results: T staging was equal between FDG-PET/CT and FDG-PET/MRI in 12 of 15 patients. For NSCLC, mean ADC{sub mono} was 2.11 ± 1.24 × 10{sup −3} mm{sup 2}/s, D{sub app} was 2.46 ± 1.29 × 10{sup −3} mm{sup 2}/s and mean K{sub app} was 0.70 ± 0.21. The non-Gaussian diffusion analysis (R{sup 2} = 0.98) provided a significantly better mathematical fitting to the DWI signal decay than the monoexponetial analysis (R{sup 2} = 0.96) (p < 0.001). SUV{sub max} and SUV{sub mean} of NSCLC was 13.5 ± 7.6 and 7.9 ± 4.3 for FDG-PET/MRI. ADC{sub mono} as well as D{sub app} exhibited a significant inverse correlation with the SUV{sub max} (ADC{sub mono}: R = −0.67; p < 0.01; D{sub app}: R = −0.69; p < 0.01) as well as with SUV{sub mean} assessed by FDG-PET/MRI (ADC{sub mono}: R

Demonstrating the feasibility of monitoring the molecular-level structures of moving polymer/silane interfaces during silane diffusion using SFG.

Science.gov (United States)

Chen, Chunyan; Wang, Jie; Loch, Cheryl L; Ahn, Dongchan; Chen, Zhan

2004-02-04

In this paper, the feasibility of monitoring molecular structures at a moving polymer/liquid interface by sum frequency generation (SFG) vibrational spectroscopy has been demonstrated. N-(2-Aminoethyl)-3-aminopropyltrimethoxysilane (AATM, NH2(CH2)2NH(CH2)3Si(OCH3)3) has been brought into contact with a deuterated poly(methyl methacrylate) (d-PMMA) film, and the interfacial silane structure has been monitored using SFG. Upon initial contact, the SFG spectra can be detected, but as time progresses, the spectral intensity changes and finally disappears. Additional experiments indicate that these silane molecules can diffuse into the polymer film and the detected SFG signals are actually from the moving polymer/silane interface. Our results show that the molecular order of the polymer/silane interface exists during the entire diffusion process and is lost when the silane molecules traverse through the thickness of the d-PMMA film. The loss of the SFG signal is due to the formation of a new disordered substrate/silane interface, which contributes no detectable SFG signal. The kinetics of the diffusion of the silane into the polymer have been deduced from the time-dependent SFG signals detected from the AATM molecules as they diffuse through polymer films of different thickness.

Modeling diffusion coefficients in binary mixtures of polar and non-polar compounds

DEFF Research Database (Denmark)

Medvedev, Oleg; Shapiro, Alexander

2005-01-01

The theory of transport coefficients in liquids, developed previously, is tested on a description of the diffusion coefficients in binary polar/non-polar mixtures, by applying advanced thermodynamic models. Comparison to a large set of experimental data shows good performance of the model. Only f...

Deriving appropriate boundary conditions, and accelerating position-jump simulations, of diffusion using non-local jumping

International Nuclear Information System (INIS)

Taylor, P R; Baker, R E; Yates, C A

2015-01-01

In this paper we explore lattice-based position-jump models of diffusion, and the implications of introducing non-local jumping; particles can jump to a range of nearby boxes rather than only to their nearest neighbours. We begin by deriving conditions for equivalence with traditional local jumping models in the continuum limit. We then generalize a previously postulated implementation of the Robin boundary condition for a non-local process of arbitrary maximum jump length, and present a novel implementation of flux boundary conditions, again generalized for a non-local process of arbitrary maximum jump length. In both these cases we validate our results using stochastic simulation. We then proceed to consider two variations on the basic diffusion model: a hybrid local/non-local scheme suitable for models involving sharp concentration gradients, and the implementation of biased jumping. In all cases we show that non-local jumping can deliver substantial time savings for stochastic simulations. (paper)

Translation Initiation from Conserved Non-AUG Codons Provides Additional Layers of Regulation and Coding Capacity

Directory of Open Access Journals (Sweden)

Ivaylo P. Ivanov

2017-06-01

Full Text Available Neurospora crassa cpc-1 and Saccharomyces cerevisiae GCN4 are homologs specifying transcription activators that drive the transcriptional response to amino acid limitation. The cpc-1 mRNA contains two upstream open reading frames (uORFs in its >700-nucleotide (nt 5′ leader, and its expression is controlled at the level of translation in response to amino acid starvation. We used N. crassa cell extracts and obtained data indicating that cpc-1 uORF1 and uORF2 are functionally analogous to GCN4 uORF1 and uORF4, respectively, in controlling translation. We also found that the 5′ region upstream of the main coding sequence of the cpc-1 mRNA extends for more than 700 nucleotides without any in-frame stop codon. For 100 cpc-1 homologs from Pezizomycotina and from selected Basidiomycota, 5′ conserved extensions of the CPC1 reading frame are also observed. Multiple non-AUG near-cognate codons (NCCs in the CPC1 reading frame upstream of uORF2, some deeply conserved, could potentially initiate translation. At least four NCCs initiated translation in vitro. In vivo data were consistent with initiation at NCCs to produce N-terminally extended N. crassa CPC1 isoforms. The pivotal role played by CPC1, combined with its translational regulation by uORFs and NCC utilization, underscores the emerging significance of noncanonical initiation events in controlling gene expression.

INFLUENCE VARIOUS REAGENTS ON THE MOLECULAR DIFFUSION INDEX OF SUCROSE FROM BEET

Directory of Open Access Journals (Sweden)

N. G. Kulneva

2015-01-01

Full Text Available Food products from vegetable raw materials play a special role in the food industry. Sugar is one of the strategically important products. The significance of its is great due to its wide use in confectionery, bakery, liquor, canning, biochemical, pharmaceutical and other branches of human activity. Effective development of the domestic sugar industry depends on the terms of competition with European partners. Production of granulated sugar includes a significant amount of energy-intensive and technologically complex operations, one of which is the extraction of sucrose from beet chips by means of hot countercurrent extraction. The most important criterion for the extraction process efficiency evaluation is the coefficient of molecular diffusion. The efficiency of using of beet chips thermo chemical processing before extraction depending on the quality of processed beet was investigated. It was found out that when using a low quality beet the diffusion coefficient decreases compared to healthy beet. The use of solutio ns of some salts for beet chips heat treatment has an overall positive effect on the diffusion coefficient. A method for recovering sucrose from beet with the use of compounds of Al2(SO4, Ca(SO4, and (NH42SO4 as the extractants was proposed. It was found out that beet samples treatment with solutions of proposed salts provides a sucrose smooth transition from the pores of sugar beet tissue into the extractant due to intense convective washout. It is caused by the high degree of tissue cells plasmolysis achieved in its processing with solutions of proposed reagents. The results obtained indicate a significant increase of the sucrose diffusion coefficient in the ammonium sulfate solution used as the extractant.

Preclinical, fluorescence and diffuse optical tomography: non-contact instrumentation, modeling and time-resolved 3D reconstruction

International Nuclear Information System (INIS)

Nouizi, F.

2011-09-01

Time-Resolved Diffuse Optical Tomography (TR-DOT) is a new non-invasive imaging technique increasingly used in the clinical and preclinical fields. It yields optical absorption and scattering maps of the explored organs, and related physiological parameters. Time-Resolved Fluorescence Diffuse Optical Tomography (TR-FDOT) is based on the detection of fluorescence photons. It provides spatio-temporal maps of fluorescent probe concentrations and life times, and allows access to metabolic and molecular imaging which is important for diagnosis and therapeutic monitoring, particularly in oncology. The main goal of this thesis was to reconstruct 3D TR-DOT/TR-FDOT images of small animals using time-resolved optical technology. Data were acquired using optical fibers fixed around the animal without contact with its surface. The work was achieved in four steps: 1)- Setting up an imaging device to record the 3D coordinates of an animal's surface; 2)- Modeling the no-contact approach to solve the forward problem; 3)- Processing of the measured signals taking into account the impulse response of the device; 4)- Implementation of a new image reconstruction method based on a selection of carefully chosen points. As a result, good-quality 3D optical images were obtained owing to reduced cross-talk between absorption and scattering. Moreover, the computation time was cut down, compared to full-time methods using whole temporal profiles. (author)

How to Verify and Manage the Translational Plagiarism?

Science.gov (United States)

Wiwanitkit, Viroj

2016-01-01

The use of Google translator as a tool for determining translational plagiarism is a big challenge. As noted, plagiarism of the original papers written in Macedonian and translated into other languages can be verified after computerised translation in other languages. Attempts to screen the translational plagiarism should be supported. The use of Google Translate tool might be helpful. Special focus should be on any non-English reference that might be the source of plagiarised material and non-English article that might translate from an original English article, which cannot be detected by simple plagiarism screening tool. It is a hard job for any journal to detect the complex translational plagiarism but the harder job might be how to effectively manage the case. PMID:27703588

Non-equilibrium coupling of protein structure and function to translation-elongation kinetics.

Science.gov (United States)

Sharma, Ajeet K; O'Brien, Edward P

2018-04-01

Protein folding research has been dominated by the assumption that thermodynamics determines protein structure and function. And that when the folding process is compromised in vivo the proteostasis machinery-chaperones, deaggregases, the proteasome-work to restore proteins to their soluble, functional form or degrade them to maintain the cellular pool of proteins in a quasi-equilibrium state. During the past decade, however, more and more proteins have been identified for which altering only their speed of synthesis alters their structure and function, the efficiency of the down-stream processes they take part in, and cellular phenotype. Indeed, evidence has emerged that evolutionary selection pressures have encoded translation-rate information into mRNA molecules to coordinate diverse co-translational processes. Thus, non-equilibrium physics can play a fundamental role in influencing nascent protein behavior, mRNA sequence evolution, and disease. Here, we discuss how our understanding of this phenomenon is being advanced by the application of theoretical tools from the physical sciences. Copyright © 2018 Elsevier Ltd. All rights reserved.

Non-stationary classical diffusion in field - reversed configurations

International Nuclear Information System (INIS)

Clemente, R.A.; Sakanaka, P.H.; Mania, A.J.

1988-01-01

Plasma decay in field-reversed configurations (FRC) is described using resistive MHD equations. Assuming non-stationariety together with uniform but time dependent plasma temperature and neglecting inertial effects in the momentum balance equation, it is possible to show that the functional dependence of the plasma pressure with the poloidal magnetic flux remains fixed during diffusion. This allows to describe FRC evolution as a continuous sequence of plasma equilibria satisfying proper boundary conditions. The method is applied to pressure profiles linear with the poloidal magnetic flux obtaining the evolution of the flux, the number of confined particles and the size of the plasma boundary. (author) [pt

Note: Local thermal conductivities from boundary driven non-equilibrium molecular dynamics simulations

International Nuclear Information System (INIS)

Bresme, F.; Armstrong, J.

2014-01-01

We report non-equilibrium molecular dynamics simulations of heat transport in models of molecular fluids. We show that the “local” thermal conductivities obtained from non-equilibrium molecular dynamics simulations agree within numerical accuracy with equilibrium Green-Kubo computations. Our results support the local equilibrium hypothesis for transport properties. We show how to use the local dependence of the thermal gradients to quantify the thermal conductivity of molecular fluids for a wide range of thermodynamic states using a single simulation

Intramolecular diffusive motion in alkane monolayers studied by high-resolution quasielastic neutron scattering and molecular dynamics simulations

DEFF Research Database (Denmark)

Hansen, Flemming Yssing; Criswell, L.; Fuhrmann, D

2004-01-01

Molecular dynamics simulations of a tetracosane (n-C24H50) monolayer adsorbed on a graphite basal-plane surface show that there are diffusive motions associated with the creation and annihilation of gauche defects occurring on a time scale of similar to0.1-4 ns. We present evidence...... that these relatively slow motions are observable by high-energy-resolution quasielastic neutron scattering (QNS) thus demonstrating QNS as a technique, complementary to nuclear magnetic resonance, for studying conformational dynamics on a nanosecond time scale in molecular monolayers....

Molecular Diffusion Coefficients: Experimental Determination and Demonstration.

Science.gov (United States)

Fate, Gwendolyn; Lynn, David G.

1990-01-01

Presented are laboratory methods which allow the demonstration and determination of the diffusion coefficients of compounds ranging in size from water to small proteins. Included are the procedures involving the use of a spectrometer, UV cell, triterated agar, and oxygen diffusion. Results including quantification are described. (CW)

Molecular rotations and diffusion in solids, in particular hydrogen in metals

International Nuclear Information System (INIS)

Springer, T.

1977-01-01

The chapter deals mainly with problems related to physical chemistry. The author treats diffusion in solids, in particular of hydrogen in metals, and studies of molecular rotations, in particular studies of tunneling transitions which is a relatively new and rapidly developing field of high resolution neutron spectroscopy. Typical neutron spectra to be discussed appear in energy ranges of a few 10 -6 to a few 10 -3 eV, or 10 -5 to 10 -2 cm -1 . The discussion is restricted to scattering from the protons which is predominantly incoherent. This means that only the motions, or excitations, of individual protons or protonic groups are discussed, ignoring collective excitations and interference. (HPOE) [de

Multi-Dimensional Impact of the Public-Private Center for Translational Molecular Medicine (CTMM) in the Netherlands: Understanding New 21(st) Century Institutional Designs to Support Innovation-in-Society.

Science.gov (United States)

Steuten, Lotte M

2016-05-01

Knowledge translation is at the epicenter of 21st century life sciences and integrative biology. Several innovative institutional designs have been formulated to cultivate knowledge translation. One of these organizational innovations has been the Center for Translational Molecular Medicine (CTMM), a multi-million public-private partnership in the Netherlands. The CTMM aims to accelerate molecular diagnostics and imaging technologies to forecast disease susceptibilities in healthy populations and early diagnosis and personalized treatment of patients. This research evaluated CTMM's impact on scientific, translational, clinical, and economic dimensions. A pragmatic, operationally-defined process indicators approach was used. Data were gathered from CTMM administrations, through a CTMM-wide survey (n = 167) and group interviews. We found that the CTMM focused on disease areas with high human, clinical, and economic burden to society (i.e., oncology, cardiovascular, neurologic, infection, and immunity diseases). CTMM displayed a robust scientific impact that rests 15%-80% above international reference values regarding publication volume and impact. Technology translation to the clinic was accelerated, with >50% of projects progressing from pre-clinical development to clinical testing within 5 years. Furthermore, CTMM has generated nearly 1500 Full Time Equivalent (FTE) of translational R&D capacity. Its positive impact on translational, (future) clinical, and economic aspects is recognized across all surveyed stakeholders. As organizational innovation is increasingly considered critical to forge linkages between life sciences discoveries and innovation-in-society, lessons learned from this study may inform other institutions with similar objectives such as the Clinical and Translational Science Awards (CTSA) Program of the National Institutes of Health (NIH) in the United States.

Approaches to translational plant science

DEFF Research Database (Denmark)

Dresbøll, Dorte Bodin; Christensen, Brian; Thorup-Kristensen, Kristian

2015-01-01

is lessened. In our opinion, implementation of translational plant science is a necessity in order to solve the agricultural challenges of producing food and materials in the future. We suggest an approach to translational plant science forcing scientists to think beyond their own area and to consider higher......Translational science deals with the dilemma between basic research and the practical application of scientific results. In translational plant science, focus is on the relationship between agricultural crop production and basic science in various research fields, but primarily in the basic plant...... science. Scientific and technological developments have allowed great progress in our understanding of plant genetics and molecular physiology, with potentials for improving agricultural production. However, this development has led to a separation of the laboratory-based research from the crop production...

Förster resonance energy transfer: Role of diffusion of fluorophore orientation and separation in observed shifts of FRET efficiency.

Directory of Open Access Journals (Sweden)

Bram Wallace

Full Text Available Förster resonance energy transfer (FRET is a widely used single-molecule technique for measuring nanoscale distances from changes in the non-radiative transfer of energy between donor and acceptor fluorophores. For macromolecules and complexes this observed transfer efficiency is used to infer changes in molecular conformation under differing experimental conditions. However, sometimes shifts are observed in the FRET efficiency even when there is strong experimental evidence that the molecular conformational state is unchanged. We investigate ways in which such discrepancies can arise from kinetic effects. We show that significant shifts can arise from the interplay between excitation kinetics, orientation diffusion of fluorophores, separation diffusion of fluorophores, and non-emitting quenching.

Dynamics and diffusive-conformational coupling in polymer bulk samples and surfaces: a molecular dynamics study

International Nuclear Information System (INIS)

Vree, C; Mayr, S G

2010-01-01

The impact of free surfaces on the mobility and conformational fluctuations of model polymer chains is investigated with the help of classical molecular dynamics simulations over a broad temperature range. Below a critical temperature, T*, similar to the critical temperature of the mode coupling theory, the center-of-mass displacements and temporal fluctuations of the radius of gyration of individual chains-as a fingerprint of structural reconfigurations-reveal a strong enhancement close to surfaces, while this effect diminishes with increasing temperature and observation time. Interpreting conformational fluctuations as a random walk in conformational space, identical activation enthalpies for structural reconfigurations and diffusion are obtained within the error bars in the bulk and at the surfaces, thus indicating a coupling of diffusive and conformational dynamics.

Exact diagonalization of cubic lattice models in commensurate Abelian magnetic fluxes and translational invariant non-Abelian potentials

DEFF Research Database (Denmark)

Burrello, M.; Fulga, Ion Cosma; Lepori, L.

2017-01-01

of a translational invariant non-Abelian coupling for multi-component spinors does not affect the dimension of the minimal Hamiltonian blocks, nor the dimension of the magnetic Brillouin zone. General formulas are presented for the U(2) case and explicit examples are investigated involving π and 2π/3 magnetic fluxes......We present a general analytical formalism to determine the energy spectrum of a quantum particle in a cubic lattice subject to translationally invariant commensurate magnetic fluxes and in the presence of a general spaceindependent non-Abelian gauge potential. We first review and analyze the case...... of purely Abelian potentials, showing also that the so-called Hasegawa gauge yields a decomposition of the Hamiltonian into sub-matrices having minimal dimension. Explicit expressions for such matrices are derived, also for general anisotropic fluxes. Later on, we show that the introduction...

Molecular theory for nuclear magnetic relaxation in protein solutions and tissue; Surface diffusion and free-volume analogy

Energy Technology Data Exchange (ETDEWEB)

Kimmich, R; Nusser, W; Gneiting, T [Ulm Universitaet (Federal Republic of Germany). Sektion Kernresonanzspektroskopie

1990-04-01

A model theory is presented explaining a series of striking phenomena observed with nuclear magnetic relaxation in protein systems such as solutions or tissue. The frequency, concentration and temperature dependences of proton or deuteron relaxation times of protein solutions and tissue are explained. It is concluded that the translational diffusion of water molecules along the rugged surfaces of proteins and, to a minor degree, protein backbone fluctuations are crucial processes. The rate limiting factor of macromolecular tumbling is assumed to be given by the free water content in a certain analogy to the free-volume model of Cohen ad Turnbull. There are two characteristic water mass fractions indicating the saturation of the hydration shells and the onset of protein tumbling. A closed and relatively simple set of relaxation formulas is presented. The potentially fractal nature of the diffusion of water molecules on the protein surface is discussed. (author). 43 refs.; 4 figs.

Behavior of specific heat and self diffusion coefficient of sodium near transition temperature: a molecular dynamics study

International Nuclear Information System (INIS)

Ahmed, N.; Khan, G.

1990-09-01

In this report the author used of a very useful technique of simulation and applied it to successfully for determining the various properties of sodium, both in liquid and solid phase near transition point. As a first step the determination of specific heat and diffusion coefficient have been carried out. In liquid state the molecular dynamics (MD) values calculated matched the experimental data. But in solid state the diffusion coefficient obtained were not consistent with the one expected for a solid, rather the values obtained suggested that sodium remained in liquid state even below the melting point. (A.B.)

Stable isotope separation by thermal diffusion

International Nuclear Information System (INIS)

Vasaru, Gheorghe

2001-01-01

Thermal diffusion in both gaseous and liquid phase has been subject of extensive experimental and theoretical investigations, especially after the invention of K. Clusius and G. Dickel of the thermal diffusion column, sixty three years ago. This paper gives a brief overview of the most important research and developments performed during the time at the National Institute for Research and Development for Isotopic and Molecular Technology (ITIM) at Cluj - Napoca, Romania in the field of separation of stable isotopes by thermal diffusion. An retrospective analysis of the research and results concerning isotope separation by thermal diffusion entails the following conclusions: - thermal diffusion is an adequate method for hydrogen isotope separation (deuterium and tritium) and for noble gas isotope separation (He, Ne, Ar, Kr, Xe); - thermal diffusion is attractive also for 13 C enrichment using methane as raw material for separation, when annual yields of up to 100 g are envisaged; - lately, the thermal diffusion appears to be chosen as a final enrichment step for 17 O. An obvious advantage of this method is its non-specificity, i.e. the implied equipment can be utilized for isotope separation of other chemical elements too. Having in view the low investment costs for thermal diffusion cascades the method appears economically attractive for obtaining low-scale, laboratory isotope production. The paper has the following content: 1. The principle of method; 2. The method's application; 3. Research in the field of thermal diffusion at ITIM; 4. Thermal diffusion cascades for N, C, Ne, Ar and Kr isotope separation; 5. Conclusion

On Medium Chemical Reaction in Diffusion-Based Molecular Communication: a Two-Way Relaying Example

OpenAIRE

Farahnak-Ghazani, Maryam; Aminian, Gholamali; Mirmohseni, Mahtab; Gohari, Amin; Nasiri-Kenari, Masoumeh

2016-01-01

Chemical reactions are a prominent feature of molecular communication (MC) systems, with no direct parallels in wireless communications. While chemical reactions may be used inside the transmitter nodes, receiver nodes or the communication medium, we focus on its utility in the medium in this paper. Such chemical reactions can be used to perform computation over the medium as molecules diffuse and react with each other (physical-layer computation). We propose the use of chemical reactions for...

Translational Applications of Nanodiamonds: From Biocompatibility to Theranostics

Science.gov (United States)

Moore, Laura Kent

Nanotechnology marks the next phase of development for drug delivery, contrast agents and gene therapy. For these novel systems to achieve success in clinical translation we must see that they are both effective and safe. Diamond nanoparticles, also known as nanodiamonds (NDs), have been gaining popularity as molecular delivery vehicles over the last decade. The uniquely faceted, carbon nanoparticles possess a number of beneficial properties that are being harnessed for applications ranging from small-molecule drug delivery to biomedical imaging and gene therapy. In addition to improving the effectiveness of a variety of therapeutics and contrast agents, initial studies indicate that NDs are biocompatible. In this work we evaluate the translational potential of NDs by demonstrating efficacy in molecular delivery and scrutinizing particle tolerance. Previous work has demonstrated that NDs are effective vehicles for the delivery of anthracycline chemotherapeutics and gadolinium(III) based contrast agents. We have sought to enhance the gains made in both areas through the addition of active targeting. We find that ND-mediated targeted delivery of epirubicin to triple negative breast cancers induces tumor regression and virtually eliminates drug toxicities. Additionally, ND-mediated delivery of the MRI contrast agent ProGlo boosts the per gadolinium relaxivity four fold, eliminates water solubility issues and effectively labels progesterone receptor expressing breast cancer cells. Both strategies open the door to the development of targeted, theranostic constructs based on NDs, capable of treating and labeling breast cancers at the same time. Although we have seen that NDs are effective vehicles for molecular delivery, for any nanoparticle to achieve clinical utility it must be biocompatible. Preliminary research has shown that NDs are non-toxic, however only a fraction of the ND-subtypes have been evaluated. Here we present an in depth analysis of the cellular

Necroptosis: Molecular Signalling and Translational Implications

Directory of Open Access Journals (Sweden)

Claudia Giampietri

2014-01-01

Full Text Available Necroptosis is a form of programmed necrosis whose molecular players are partially shared with apoptotic cell death. Here we summarize what is known about molecular signalling of necroptosis, particularly focusing on fine tuning of FLIP and IAP proteins in the apoptosis/necroptosis balance. We also emphasize necroptosis involvement in physiological and pathological conditions, particularly in the regulation of immune homeostasis.

The inherent dynamics of a molecular liquid: Geodesic pathways through the potential energy landscape of a liquid of linear molecules

Science.gov (United States)

Jacobson, Daniel; Stratt, Richard M.

2014-05-01

Because the geodesic pathways that a liquid follows through its potential energy landscape govern its slow, diffusive motion, we suggest that these pathways are logical candidates for the title of a liquid's "inherent dynamics." Like their namesake "inherent structures," these objects are simply features of the system's potential energy surface and thus provide views of the system's structural evolution unobstructed by thermal kinetic energy. This paper shows how these geodesic pathways can be computed for a liquid of linear molecules, allowing us to see precisely how such molecular liquids mix rotational and translational degrees of freedom into their dynamics. The ratio of translational to rotational components of the geodesic path lengths, for example, is significantly larger than would be expected on equipartition grounds, with a value that scales with the molecular aspect ratio. These and other features of the geodesics are consistent with a picture in which molecular reorientation adiabatically follows translation—molecules largely thread their way through narrow channels available in the potential energy landscape.

"O tradutor e os seus trebelhos": Fred P. Ellison and Translation

Science.gov (United States)

Frizzi, Adria

2016-01-01

In this article, Adria Frizzi provides a brief overview of Fred Ellison's work in the field of literary translation. Frizzi does so by outlining Ellison's trajectory as a translator--highlighting how his choices in this area of his scholarship fit into a broader, multipronged approach to the study and diffusion of the language, culture, and…

Simulation of anisotropic diffusion by means of a diffusion velocity method

CERN Document Server

Beaudoin, A; Rivoalen, E

2003-01-01

An alternative method to the Particle Strength Exchange method for solving the advection-diffusion equation in the general case of a non-isotropic and non-uniform diffusion is proposed. This method is an extension of the diffusion velocity method. It is shown that this extension is quite straightforward due to the explicit use of the diffusion flux in the expression of the diffusion velocity. This approach is used to simulate pollutant transport in groundwater and the results are compared to those of the PSE method presented in an earlier study by Zimmermann et al.

Modelling the influence of metabolite diffusion on non-starter lactic acid bacteria growth in ripening Cheddar cheese

DEFF Research Database (Denmark)

Czárán, Tamás; Rattray, Fergal P.; Møller, Cleide O.de A.

2018-01-01

The influence of metabolite diffusion within the cheese matrix on growth of non-starter lactic acid bacteria (NSLAB) during Cheddar cheese ripening was mathematically modelled. The model was calibrated at a realistic range of diffusion of metabolites and the decay and growth parameters...

Controlling molecular condensation/diffusion of copper phthalocyanine by local electric field induced with scanning tunneling microscope tip

Science.gov (United States)

Nagaoka, Katsumi; Yaginuma, Shin; Nakayama, Tomonobu

2018-02-01

We have discovered the condensation/diffusion phenomena of copper phthalocyanine (CuPc) molecules controlled with a pulsed electric field induced by the scanning tunneling microscope tip. This behavior is not explained by the conventional induced dipole model. In order to understand the mechanism, we have measured the electronic structure of the molecule by tunneling spectroscopy and also performed theoretical calculations on molecular orbitals. These data clearly indicate that the molecule is positively charged owing to charge transfer to the substrate, and that hydrogen bonding exists between CuPc molecules, which makes the molecular island stable.

Ionic diffusion through confined geometries: from Langevin equations to partial differential equations

International Nuclear Information System (INIS)

Nadler, Boaz; Schuss, Zeev; Singer, Amit; Eisenberg, R S

2004-01-01

Ionic diffusion through and near small domains is of considerable importance in molecular biophysics in applications such as permeation through protein channels and diffusion near the charged active sites of macromolecules. The motion of the ions in these settings depends on the specific nanoscale geometry and charge distribution in and near the domain, so standard continuum type approaches have obvious limitations. The standard machinery of equilibrium statistical mechanics includes microscopic details, but is also not applicable, because these systems are usually not in equilibrium due to concentration gradients and to the presence of an external applied potential, which drive a non-vanishing stationary current through the system. We present a stochastic molecular model for the diffusive motion of interacting particles in an external field of force and a derivation of effective partial differential equations and their boundary conditions that describe the stationary non-equilibrium system. The interactions can include electrostatic, Lennard-Jones and other pairwise forces. The analysis yields a new type of Poisson-Nernst-Planck equations, that involves conditional and unconditional charge densities and potentials. The conditional charge densities are the non-equilibrium analogues of the well studied pair correlation functions of equilibrium statistical physics. Our proposed theory is an extension of equilibrium statistical mechanics of simple fluids to stationary non-equilibrium problems. The proposed system of equations differs from the standard Poisson-Nernst-Planck system in two important aspects. First, the force term depends on conditional densities and thus on the finite size of ions, and second, it contains the dielectric boundary force on a discrete ion near dielectric interfaces. Recently, various authors have shown that both of these terms are important for diffusion through confined geometries in the context of ion channels

Lost in translation?: Comparing three Scandinavian translations of the Beliefs about Medicines Questionnaire.

Science.gov (United States)

Granas, Anne Gerd; Nørgaard, Lotte Stig; Sporrong, Sofia Kälvemark

2014-08-01

The "Beliefs about Medicines Questionnaire" (BMQ) assess balance of necessity and concern of medicines. The BMQ has been translated from English to many languages. However, the original meaning of statements, such as "My medicine is a mystery to me", may be lost in translation. The aim of this study is to compare three Scandinavian translations of the BMQ. (1) How reliable are the translations? (2) Are they still valid after translation? Translated Norwegian, Swedish and Danish versions of the BMQ were scrutinized by three native Scandinavian researchers. Linguistic differences and ambiguities in the 5-point Likert scale and the BMQ statements were compared. In the Scandinavian translations, the Likert scale expanded beyond the original version at one endpoint (Swedish) or both endpoints (Danish). In the BMQ statements, discrepancies ranged from smaller inaccuracies toward completely different meaning. Some dissimilarities reflect different cultural beliefs about medicines. When translating questionnaires, bilingual researchers should scrutinize translations across similar languages to address content validity across different countries and languages. Our findings are of relevance to other BMQ translations in non-English countries, as direct comparisons between different translations might not be reliable or valid. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Entropy as a measure of diffusion

International Nuclear Information System (INIS)

Aghamohammadi, Amir; Fatollahi, Amir H.; Khorrami, Mohammad; Shariati, Ahmad

2013-01-01

The time variation of entropy, as an alternative to the variance, is proposed as a measure of the diffusion rate. It is shown that for linear and time-translationally invariant systems having a large-time limit for the density, at large times the entropy tends exponentially to a constant. For systems with no stationary density, at large times the entropy is logarithmic with a coefficient specifying the speed of the diffusion. As an example, the large-time behaviors of the entropy and the variance are compared for various types of fractional-derivative diffusions.

Entropy as a measure of diffusion

Energy Technology Data Exchange (ETDEWEB)

Aghamohammadi, Amir, E-mail: mohamadi@alzahra.ac.ir; Fatollahi, Amir H., E-mail: fath@alzahra.ac.ir; Khorrami, Mohammad, E-mail: mamwad@mailaps.org; Shariati, Ahmad, E-mail: shariati@mailaps.org

2013-10-15

The time variation of entropy, as an alternative to the variance, is proposed as a measure of the diffusion rate. It is shown that for linear and time-translationally invariant systems having a large-time limit for the density, at large times the entropy tends exponentially to a constant. For systems with no stationary density, at large times the entropy is logarithmic with a coefficient specifying the speed of the diffusion. As an example, the large-time behaviors of the entropy and the variance are compared for various types of fractional-derivative diffusions.

Quasielastic neutron scattering and molecular dynamics simulation studies of the melting transition in butane and hexane monolayers adsorbed on graphite

DEFF Research Database (Denmark)

Hervig, K.W.; Wu, Z.; Dai, P.

1997-01-01

Quasielastic neutron scattering experiments and molecular dynamics (MD) simulations have been used to investigate molecular diffusive motion near the melting transition of monolayers of flexible rod-shaped molecules. The experiments were conducted on butane and hexane monolayers adsorbed...... comparison with experiment, quasielastic spectra calculated from the MD simulations were analyzed using the same models and fitting algorithms as for the neutron spectra. This combination of techniques gives a microscopic picture of the melting process in these two monolayers which is consistent with earlier...... neutron diffraction experiments. Butane melts abruptly to a liquid phase where the molecules in the trans conformation translationally diffuse while rotating about their center of mass. In the case of the hexane monolayer, the MD simulations show that the appearance of quasielastic scattering below T...

Self-consistent Non-LTE Model of Infrared Molecular Emissions and Oxygen Dayglows in the Mesosphere and Lower Thermosphere

Science.gov (United States)

Feofilov, Artem G.; Yankovsky, Valentine A.; Pesnell, William D.; Kutepov, Alexander A.; Goldberg, Richard A.; Mauilova, Rada O.

2007-01-01

We present the new version of the ALI-ARMS (for Accelerated Lambda Iterations for Atmospheric Radiation and Molecular Spectra) model. The model allows simultaneous self-consistent calculating the non-LTE populations of the electronic-vibrational levels of the O3 and O2 photolysis products and vibrational level populations of CO2, N2,O2, O3, H2O, CO and other molecules with detailed accounting for the variety of the electronic-vibrational, vibrational-vibrational and vibrational-translational energy exchange processes. The model was used as the reference one for modeling the O2 dayglows and infrared molecular emissions for self-consistent diagnostics of the multi-channel space observations of MLT in the SABER experiment It also allows reevaluating the thermalization efficiency of the absorbed solar ultraviolet energy and infrared radiative cooling/heating of MLT by detailed accounting of the electronic-vibrational relaxation of excited photolysis products via the complex chain of collisional energy conversion processes down to the vibrational energy of optically active trace gas molecules.

Non-periodic molecular dynamics simulations of coarse grained lipid bilayer in water

DEFF Research Database (Denmark)

Kotsalis, E. M.; Hanasaki, I.; Walther, Jens Honore

2010-01-01

We present a multiscale algorithm that couples coarse grained molecular dynamics (CGMD) with continuum solver. The coupling requires the imposition of non-periodic boundary conditions on the coarse grained Molecular Dynamics which, when not properly enforced, may result in spurious fluctuations o...... in simulating more complex systems by performing a non-periodic Molecular Dynamics simulation of a DPPC lipid in liquid coarse grained water.......We present a multiscale algorithm that couples coarse grained molecular dynamics (CGMD) with continuum solver. The coupling requires the imposition of non-periodic boundary conditions on the coarse grained Molecular Dynamics which, when not properly enforced, may result in spurious fluctuations...... of the material properties of the system represented by CGMD. In this paper we extend a control algorithm originally developed for atomistic simulations [3], to conduct simulations involving coarse grained water molecules without periodic boundary conditions. We demonstrate the applicability of our method...

Separation of type and grade in cervical tumours using non-mono-exponential models of diffusion-weighted MRI

International Nuclear Information System (INIS)

Winfield, Jessica M.; Collins, David J.; Morgan, Veronica A.; DeSouza, Nandita M.; Orton, Matthew R.; Ind, Thomas E.J.; Attygalle, Ayoma; Hazell, Steve

2017-01-01

Assessment of empirical diffusion-weighted MRI (DW-MRI) models in cervical tumours to investigate whether fitted parameters distinguish between types and grades of tumours. Forty-two patients (24 squamous cell carcinomas, 14 well/moderately differentiated, 10 poorly differentiated; 15 adenocarcinomas, 13 well/moderately differentiated, two poorly differentiated; three rare types) were imaged at 3 T using nine b-values (0 to 800 s mm -2 ). Mono-exponential, stretched exponential, kurtosis, statistical, and bi-exponential models were fitted. Model preference was assessed using Bayesian Information Criterion analysis. Differences in fitted parameters between tumour types/grades and correlation between fitted parameters were assessed using two-way analysis of variance and Pearson's linear correlation coefficient, respectively. Non-mono-exponential models were preferred by 83 % of tumours with bi-exponential and stretched exponential models preferred by the largest numbers of tumours. Apparent diffusion coefficient (ADC) and diffusion coefficients from non-mono-exponential models were significantly lower in poorly differentiated tumours than well/moderately differentiated tumours. α (stretched exponential), K (kurtosis), f and D* (bi-exponential) were significantly different between tumour types. Strong correlation was observed between ADC and diffusion coefficients from other models. Non-mono-exponential models were preferred to the mono-exponential model in DW-MRI data from cervical tumours. Parameters of non-mono-exponential models showed significant differences between types and grades of tumours. (orig.)

Separation of type and grade in cervical tumours using non-mono-exponential models of diffusion-weighted MRI

Energy Technology Data Exchange (ETDEWEB)

Winfield, Jessica M.; Collins, David J.; Morgan, Veronica A.; DeSouza, Nandita M. [The Royal Marsden NHS Foundation Trust, MRI Unit, Sutton, Surrey (United Kingdom); The Institute of Cancer Research, Cancer Research UK Cancer Imaging Centre, Division of Radiotherapy and Imaging, London (United Kingdom); Orton, Matthew R. [The Institute of Cancer Research, Cancer Research UK Cancer Imaging Centre, Division of Radiotherapy and Imaging, London (United Kingdom); Ind, Thomas E.J. [The Royal Marsden NHS Foundation Trust, Gynaecology Unit, London (United Kingdom); Attygalle, Ayoma; Hazell, Steve [The Royal Marsden NHS Foundation Trust, Department of Histopathology, London (United Kingdom)

2017-02-15

Assessment of empirical diffusion-weighted MRI (DW-MRI) models in cervical tumours to investigate whether fitted parameters distinguish between types and grades of tumours. Forty-two patients (24 squamous cell carcinomas, 14 well/moderately differentiated, 10 poorly differentiated; 15 adenocarcinomas, 13 well/moderately differentiated, two poorly differentiated; three rare types) were imaged at 3 T using nine b-values (0 to 800 s mm{sup -2}). Mono-exponential, stretched exponential, kurtosis, statistical, and bi-exponential models were fitted. Model preference was assessed using Bayesian Information Criterion analysis. Differences in fitted parameters between tumour types/grades and correlation between fitted parameters were assessed using two-way analysis of variance and Pearson's linear correlation coefficient, respectively. Non-mono-exponential models were preferred by 83 % of tumours with bi-exponential and stretched exponential models preferred by the largest numbers of tumours. Apparent diffusion coefficient (ADC) and diffusion coefficients from non-mono-exponential models were significantly lower in poorly differentiated tumours than well/moderately differentiated tumours. α (stretched exponential), K (kurtosis), f and D* (bi-exponential) were significantly different between tumour types. Strong correlation was observed between ADC and diffusion coefficients from other models. Non-mono-exponential models were preferred to the mono-exponential model in DW-MRI data from cervical tumours. Parameters of non-mono-exponential models showed significant differences between types and grades of tumours. (orig.)

Nuclear Quantum Effects in H+ and OH- Diffusion Along Confined Water Wires from Ab Initio Path Integral Molecular Dyanmics

Science.gov (United States)

Rossi, Mariana; Ceriotti, Michele; Manolopoulos, David

Diffusion of H+ and OH- along water wires provides an efficient mechanism for charge transport that is exploited by biological systems and shows promise in technological applications. However, what is lacking for a better control and design of these systems is a thorough theoretical understanding of the diffusion process at the atomic scale. Here we consider H+ and OH- in finite water wires using density functional theory. We employ machine learning techniques to identify the charged species, thus obtaining an agnostic definition of the charge. We employ thermostated ring polymer molecular dynamics and extract a ``universal'' diffusion coefficient from simulations with different wire sizes by considering Langevin dynamics on the potential of mean force of the charged species. In the classical case, diffusion coefficients depend significantly on the potential energy surface, in particular on how dispersion forces modulate O-O distances. NQEs, however, make the diffusion less sensitive to the underlying potential and geometry of the wire, presumably making them more robust to environment fluctuations.

Ion diffusion in compacted bentonite

Energy Technology Data Exchange (ETDEWEB)

Lehikoinen, J. [VTT Chemical Technology, Espoo (Finland)

1999-03-01

In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K{sub d}, unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.) 45 refs.

Ion diffusion in compacted bentonite

International Nuclear Information System (INIS)

Lehikoinen, J.

1999-03-01

In the study, a two-dimensional molecular-level diffusion model, based on a modified form of the Gouy-Chapman (GC) theory of the electrical double layers, for hydrated ionic species in compacted bentonite was developed. The modifications to the GC theory, which forms the very kernel of the diffusion model, stem from various non-conventional features: ionic hydration, dielectric saturation, finite ion-sizes and specific adsorption. The principal objectives of the study were met. With the aid of the consistent diffusion model, it is a relatively simple matter to explain the experimentally observed macroscopic exclusion for anions as well as the postulated, but greatly controversial, surface diffusion for cations. From purely theoretical grounds, it was possible to show that the apparent diffusivities of cations, anions and neutral molecules (i) do not exhibit order-or-magnitude differences, and (ii) are practically independent of the solution ionic strength used and, consequently, of the distribution coefficient, K d , unless they experience specific binding onto the substrate surface. It was also of interest to investigate the equilibrium anionic concentration distribution in the pore geometry of the GMM model as a function of the solution ionic strength, and to briefly speculate its consequences to diffusion. An explicit account of the filter-plate effect was taken by developing a computerised macroscopic diffusion model, which is based upon the very robust and efficient Laplace Transform Finite-Difference technique. Finally, the inherent limitations as well as the potential fields of applications of the models were addressed. (orig.)

Diffusion weighted MR imaging in non-infarct lesions of the brain

Energy Technology Data Exchange (ETDEWEB)

Karaarslan, E. [Department of Radiology, American Hospital, Sisli, Istanbul (Turkey)], E-mail: ercankaraarslan@yahoo.com; Arslan, A. [Department of Radiology, Kocaeli University Medical School, Kocaeli (Turkey)], E-mail: arzuarslan@netscape.net

2008-03-15

Diffusion weighted imaging (DWI) is a relatively new method in which the images are formed by the contrast produced by the random microscopic motion of water molecules in different tissues. Although DWI has been tried for different organ systems, it has been found its primary use in the central nervous system. The most widely used clinical application is in the detection of hyperacute infarcts and the differentiation of acute or subacute infarction from chronic infarction. Recently DWI has been applied to various other cerebral diseases. In this pictorial paper the authors demonstrated different DWI patterns of non-infarct lesions of the brain which are hyperintense in the diffusion trace image, such as infectious, neoplastic and demyelinating diseases, encephalopathies - including hypoxic-ischemic, hypertensive, eclamptic, toxic, metabolic and mitochondrial encephalopathies - leukodystrophies, vasculitis and vasculopathies, hemorrhage and trauma.

Non-equilibrium dynamics in disordered materials: Ab initio molecular dynamics simulations

International Nuclear Information System (INIS)

Ohmura, Satoshi; Nagaya, Kiyonobu; Yao, Makoto; Shimojo, Fuyuki

2015-01-01

The dynamic properties of liquid B 2 O 3 under pressure and highly-charged bromophenol molecule are studied by using molecular dynamics (MD) simulations based on density functional theory (DFT). Diffusion properties of covalent liquids under high pressure are very interesting in the sense that they show unexpected pressure dependence. It is found from our simulation that the magnitude relation of diffusion coefficients for boron and oxygen in liquid B 2 O 3 shows the anomalous pressure dependence. The simulation clarified the microscopic origin of the anomalous diffusion properties. Our simulation also reveals the dissociation mechanism in the coulomb explosion of the highly-charged bromophenol molecule. When the charge state n is 6, hydrogen atom in the hydroxyl group dissociates at times shorter than 20 fs while all hydrogen atoms dissociate when n is 8. After the hydrogen dissociation, the carbon ring breaks at about 100 fs. There is also a difference on the mechanism of the ring breaking depending on charge states, in which the ring breaks with expanding (n = 6) or shrink (n = 8)

Detection of a high-molecular-weight LHRH precursor by cell-free translation of mRNA from human, rat, and mouse hypothalamus

International Nuclear Information System (INIS)

Curtis, A.; Szelke, M.; Fink, G.

1986-01-01

Large precursors have also been predicted using the immunoprecipitation technique which relies upon the identification of large immunoreactive molecules following in vitro translation of mRNA. The mRNA is presumed to represent the largest form of a nascent precursor polypeptide molecule irrespective of the number of biosynthetic cleavage steps which are necessary to liberate the active peptide. However, as has been shown for somatostatin, nonprotein modifications may be made which apparently increase molecular weight, such as glycosylation or phosphorylation of the molecule. The authors employed the immunoprecipitation technique to confirm earlier chromatographic studies that the hypothalamic decapeptide, luteinizing hormone releasing hormone (LHRH) is also synthesized by way of a large precursor form. The authors' finding show that the translation of hypothalamic mRNA produces a primary translation product with an apparent molecule weight of 28,000 which contains an amino acid sequence immunologically similar to that of biologically active LHRH. The procedure involved the incorporation of a radioactive amino acid into polypeptides synthesized by in vitro translation of hypothalamic messenger RNA. The resulting complex protein mixture was immunoprecipitated with a specific anti-LHRH serum, and the immunoprecipitate was identified by polyacrylamide gel electrophoresis and autoradiography

Contributions of different degrees of freedom to thermal transport in the C60 molecular crystal

Science.gov (United States)

Kumar, Sushant; Shao, Cheng; Lu, Simon; McGaughey, Alan J. H.

2018-03-01

Three models of the C60 molecular crystal are studied using molecular dynamics simulations to resolve the roles played by intermolecular and intramolecular degrees of freedom (DOF) in its structural, mechanical, and thermal properties at temperatures between 35 and 400 K. In the full DOF model, all DOF are active. In the rigid body model, the intramolecular DOF are frozen, such that only center of mass (COM) translations and molecular rotations/librations are active. In the point mass model, the molecule is replaced by a point mass, such that only COM translations are active. The zero-pressure lattice constants and bulk moduli predicted from the three models fall within ranges of 0.15 and 20%. The thermal conductivity of the point mass model is the largest across the temperature range, showing a crystal-like temperature dependence (i.e., it decreases with increasing temperature) due to the presence of phonon modes associated with the COM translations. The rigid body model thermal conductivity is the smallest and follows two distinct regimes. It is crystal-like at low temperatures and becomes temperature invariant at high temperatures. The latter is typical of the behavior of an amorphous material. By calculating the rotational diffusion coefficient, the transition between the two regimes is found to occur at the temperature where the molecules begin to rotate freely. Above this temperature, phonons related to COM translations are scattered by the rotational DOF. The full DOF model thermal conductivity is larger than that of the rigid body model, indicating that intramolecular DOF contribute to thermal transport.

The influence of molecular rotation on vibration--translation energy transfer

International Nuclear Information System (INIS)

McKenzie, R.L.

1977-01-01

The role of molecular rotations in the exchange of vibrational and translational energy is investigated for collisions between anharmonic diatomic molecules and structureless atoms. A three-dimensional, semiclassical, impact parameter description is applied with emphasis directed towards the influence of rotational coupling on the net rate of vibrational energy transfer summed over all final rotational states. These results are then related to the predictions of an equivalent collinear collision model, and their comparison allows an evaluation of the collinear approximation. The mechanisms of vibrational energy transfer including rotational transitions are shown to be separable into three classes, with the molecules belonging to each class identified first and foremost by their ratio of fundamental vibrational and rotational frequencies, ω/sub e//B/sub e/, and second by the proximity of their initial state to a near-resonant vibration--rotation transition with a small change in angular momentum. While the dynamics of molecules with ω/sub e//B/sub e/ ratios that are comparable to the range of angular momentum transitions having strong coupling are found to require a complete three-dimensional description, the rates of vibrational energy transfer in molecules with large ω/sub e//B/sub e/ ratios appear to be well approximated by a collinear collision model

Investigating the relative influences of molecular dimensions and binding energies on diffusivities of guest species inside nanoporous crystalline materials

NARCIS (Netherlands)

Krishna, R.; van Baten, J.M.

2012-01-01

The primary objective of this article is to investigate the relative influences of molecular dimensions and adsorption binding energies on unary diffusivities of guest species inside nanoporous crystalline materials such as zeolites and metal-organic frameworks (MOFs). The investigations are based

Shannon Meets Fick on the Microfluidic Channel: Diffusion Limit to Sum Broadcast Capacity for Molecular Communication.

Science.gov (United States)

Bicen, A Ozan; Lehtomaki, Janne J; Akyildiz, Ian F

2018-03-01

Molecular communication (MC) over a microfluidic channel with flow is investigated based on Shannon's channel capacity theorem and Fick's laws of diffusion. Specifically, the sum capacity for MC between a single transmitter and multiple receivers (broadcast MC) is studied. The transmitter communicates by using different types of signaling molecules with each receiver over the microfluidic channel. The transmitted molecules propagate through microfluidic channel until reaching the corresponding receiver. Although the use of different types of molecules provides orthogonal signaling, the sum broadcast capacity may not scale with the number of the receivers due to physics of the propagation (interplay between convection and diffusion based on distance). In this paper, the performance of broadcast MC on a microfluidic chip is characterized by studying the physical geometry of the microfluidic channel and leveraging the information theory. The convergence of the sum capacity for microfluidic broadcast channel is analytically investigated based on the physical system parameters with respect to the increasing number of molecular receivers. The analysis presented here can be useful to predict the achievable information rate in microfluidic interconnects for the biochemical computation and microfluidic multi-sample assays.

Mode-coupling theory of self-diffusion in diblock copolymers. II. Model calculations and experimental comparisons

International Nuclear Information System (INIS)

Guenza, M.; Schweizer, K.S.

1998-01-01

The predictions of polymer-mode-coupling theory for self-diffusion in entangled structurally and interaction symmetric diblock copolymer fluids are illustrated by explicit numerical calculations. We find that retardation of translational motion emerges near and somewhat below the order endash disorder transition (ODT) in an approximately exponential and/or thermally activated manner. At fixed reduced temperature, suppression of diffusion is enhanced with increasing diblock molecular weight, compositional symmetry, and/or copolymer concentration. At very low temperatures, a new entropic-like regime of mobility suppression is predicted based on an isotropic supercooled liquid description of the copolymer structure. Preliminary generalization of the theory to treat diblock tracer diffusion is also presented. Quantitative applications to recent self and tracer diffusion measurements on compositionally symmetric polyolefin diblock materials have been carried out, and very good agreement between theory and experiment is found. Asymmetry in block local friction constants is predicted to significantly influence mobility suppression, with the largest effects occurring when the minority block is also the high friction species. New experiments to further test the predictions of the theory are suggested. copyright 1998 American Institute of Physics

Convergence to a pulsating travelling wave for an epidemic reaction-diffusion system with non-diffusive susceptible population.

Science.gov (United States)

Ducrot, Arnaud; Giletti, Thomas

2014-09-01

In this work we study the asymptotic behaviour of the Kermack-McKendrick reaction-diffusion system in a periodic environment with non-diffusive susceptible population. This problem was proposed by Kallen et al. as a model for the spatial spread for epidemics, where it can be reasonable to assume that the susceptible population is motionless. For arbitrary dimensional space we prove that large classes of solutions of such a system have an asymptotic spreading speed in large time, and that the infected population has some pulse-like asymptotic shape. The analysis of the one-dimensional problem is more developed, as we are able to uncover a much more accurate description of the profile of solutions. Indeed, we will see that, for some initially compactly supported infected population, the profile of the solution converges to some pulsating travelling wave with minimal speed, that is to some entire solution moving at a constant positive speed and whose profile's shape is periodic in time.

Translational-rotational interaction in dynamics and thermodynamics of 2D atomic crystal with molecular impurity

International Nuclear Information System (INIS)

Antsygina, T.N.; Poltavskaya, M.I.; Chishko, K.A.

2003-01-01

The interaction between the rotational degrees of freedom of a diatomic molecular impurity and the phonon excitations of a two-dimensional atomic matrix commensurate with a substrate is investigated theoretically. It is shown, that the translational-rotational interaction changes the form of the rotational kinetic energy operator as compared to the corresponding expression for a free rotator, and also renormalized the parameters of the crystal field without change in its initial form. The contribution of the impurity rotational degrees of freedom to the low-temperature heat capacity for a dilute solution of diatomic molecules in an atomic two-dimensional matrix is calculated. The possibility of experimental observation of the effects obtained is discussed

Kapitza thermal conductance at the interface between Lennard-Jones crystals using non-equilibrium molecular dynamics simulations

International Nuclear Information System (INIS)

Merabia, Samy; Termentzidis, Konstantinos

2012-01-01

We characterize the thermal Kapitza conductance between Lennard-Jones solids using non-equilibrium molecular dynamics simulations. We consider a series of perfect interfaces between mass-mismatched solids. We show that both the acoustic mismatch model (AMM) and the diffuse mismatch model (DMM) fail to predict the interfacial conductance even for large acoustic mismatched solids. This poor agreement may be explained by the use of equilibrium distributions of phonons in the expression of the conductance. On the other hand, we show that an extension of AMM taking into account the out-of-equilibrium phonon distribution on both sides of the interface leads to a good agreement with the simulation results, even for interfaces between almost similar materials. This opens the way to understand interfacial heat transport across real semi-conductors and dielectrics.

Molecular ultrasound imaging: current status and future directions

International Nuclear Information System (INIS)

Deshpande, N.; Needles, A.; Willmann, J.K.

2010-01-01

Targeted contrast-enhanced ultrasound (molecular ultrasound) is an emerging imaging strategy that combines ultrasound technology with novel molecularly-targeted ultrasound contrast agents for assessing biological processes at the molecular level. Molecular ultrasound contrast agents are nano- or micro-sized particles that are targeted to specific molecular markers by adding high-affinity binding ligands onto the surface of the particles. Following intravenous administration, these targeted ultrasound contrast agents accumulate at tissue sites overexpressing specific molecular markers, thereby enhancing the ultrasound imaging signal. High spatial and temporal resolution, real-time imaging, non-invasiveness, relatively low costs, lack of ionising irradiation and wide availability of ultrasound systems are advantages compared to other molecular imaging modalities. In this article we review current concepts and future directions of molecular ultrasound imaging, including different classes of molecular ultrasound contrast agents, ongoing technical developments of pre-clinical and clinical ultrasound systems, the potential of molecular ultrasound for imaging different diseases at the molecular level, and the translation of molecular ultrasound into the clinic.

Frequent alteration of MDM2 and p53 in the molecular progression of recurring non-Hodgkin's lymphoma

DEFF Research Database (Denmark)

Møller, Michael Boe; Nielsen, O; Pedersen, Niels Tinggaard

2002-01-01

-Hodgkin's lymphoma. METHODS AND RESULTS: We have analysed sequential biopsies from 42 non-Hodgkin's lymphoma patients immunohistochemically for p53 alterations (based on p53 and p21Waf1 expression), as well as for expression of MDM2, p27Kip1 and cyclin D3. Relapse of follicle centre lymphoma was associated with p53...... alterations as 5/6 (83%) follicle centre lymphomas with normal p53 at diagnosis showed p53 alterations at relapse. Of these cases, three showed transformation to diffuse large B-cell lymphoma. p53 alteration was also associated with relapse of de novo diffuse large B-cell lymphoma and T-cell non......-Hodgkin's lymphoma, as 2/5 (40%) diffuse large B-cell lymphomas and 3/9 (33%) T-cell non-Hodgkin's lymphomas with normal p53 at diagnosis showed p53 alterations at relapse. No indolent non-Hodgkin's lymphoma case showed MDM2 over-expression at diagnosis, whereas 4/5 (80%) transformed diffuse large B-cell lymphomas...

Communication: Modeling of concentration dependent water diffusivity in ionic solutions: Role of intermolecular charge transfer

Energy Technology Data Exchange (ETDEWEB)

Yao, Yi; Berkowitz, Max L., E-mail: maxb@unc.edu, E-mail: ykanai@unc.edu; Kanai, Yosuke, E-mail: maxb@unc.edu, E-mail: ykanai@unc.edu [Department of Chemistry, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599 (United States)

2015-12-28

The translational diffusivity of water in solutions of alkali halide salts depends on the identity of ions, exhibiting dramatically different behavior even in solutions of similar salts of NaCl and KCl. The water diffusion coefficient decreases as the salt concentration increases in NaCl. Yet, in KCl solution, it slightly increases and remains above bulk value as salt concentration increases. Previous classical molecular dynamics simulations have failed to describe this important behavior even when polarizable models were used. Here, we show that inclusion of dynamical charge transfer among water molecules produces results in a quantitative agreement with experiments. Our results indicate that the concentration-dependent diffusivity reflects the importance of many-body effects among the water molecules in aqueous ionic solutions. Comparison with quantum mechanical calculations shows that a heterogeneous and extended distribution of charges on water molecules around the ions due to ion-water and also water-water charge transfer plays a very important role in controlling water diffusivity. Explicit inclusion of the charge transfer allows us to model accurately the difference in the concentration-dependent water diffusivity between Na{sup +} and K{sup +} ions in simulations, and it is likely to impact modeling of a wide range of systems for medical and technological applications.

UPAR targeted molecular imaging of cancers with small molecule-based probes.

Science.gov (United States)

Ding, Feng; Chen, Seng; Zhang, Wanshu; Tu, Yufeng; Sun, Yao

2017-10-15

Molecular imaging can allow the non-invasive characterization and measurement of biological and biochemical processes at the molecular and cellular levels in living subjects. The imaging of specific molecular targets that are associated with cancers could allow for the earlier diagnosis and better treatment of diseases. Small molecule-based probes play prominent roles in biomedical research and have high clinical translation ability. Here, with an emphasis on small molecule-based probes, we review some recent developments in biomarkers, imaging techniques and multimodal imaging in molecular imaging and highlight the successful applications for molecular imaging of cancers. Copyright © 2017 Elsevier Ltd. All rights reserved.

Translational friction coefficient of a permeable cylinder in a sheet of viscous fluid

NARCIS (Netherlands)

Wiegel, F.W.

1979-01-01

The author calculates the translational friction coefficient and the translational diffusion coefficient of a permeable cylinder moving in a sheet of fluid which is embedded on both sides in a fluid of much lower viscosity. The result, which is an asymptotic expression valid in the limit of small

Diffusion in crowded biological environments: applications of Brownian dynamics

OpenAIRE

Długosz, Maciej; Trylska, Joanna

2011-01-01

Biochemical reactions in living systems occur in complex, heterogeneous media with total concentrations of macromolecules in the range of 50 - 400 mg/ml. Molecular species occupy a significant fraction of the immersing medium, up to 40% of volume. Such complex and volume-occupied environments are generally termed 'crowded' and/or 'confined'. In crowded conditions non-specific interactions between macromolecules may hinder diffusion - a major process determining metabolism, transport, and sign...

Non-Local Diffusion of Energetic Electrons during Solar Flares

Science.gov (United States)

Bian, N. H.; Emslie, G.; Kontar, E.

2017-12-01

The transport of the energy contained in suprathermal electrons in solar flares plays a key role in our understanding of many aspects of flare physics, from the spatial distributions of hard X-ray emission and energy deposition in the ambient atmosphere to global energetics. Historically the transport of these particles has been largely treated through a deterministic approach, in which first-order secular energy loss to electrons in the ambient target is treated as the dominant effect, with second-order diffusive terms (in both energy and angle) generally being either treated as a small correction or even neglected. Here, we critically analyze this approach, and we show that spatial diffusion through pitch-angle scattering necessarily plays a very significant role in the transport of electrons. We further show that a satisfactory treatment of the diffusion process requires consideration of non-local effects, so that the electron flux depends not just on the local gradient of the electron distribution function but on the value of this gradient within an extended region encompassing a significant fraction of a mean free path. Our analysis applies generally to pitch-angle scattering by a variety of mechanisms, from Coulomb collisions to turbulent scattering. We further show that the spatial transport of electrons along the magnetic field of a flaring loop can be modeled as a Continuous Time Random Walk with velocity-dependent probability distribution functions of jump sizes and occurrences, both of which can be expressed in terms of the scattering mean free path.

Diffusion of Botulinum Toxins

Directory of Open Access Journals (Sweden)

Matthew A. Brodsky

2012-08-01

Full Text Available Background: It is generally agreed that diffusion of botulinum toxin occurs, but the extent of the spread and its clinical importance are disputed. Many factors have been suggested to play a role but which have the most clinical relevance is a subject of much discussion.Methods: This review discusses the variables affecting diffusion, including protein composition and molecular size as well as injection factors (e.g., volume, dose, injection method. It also discusses data on diffusion from comparative studies in animal models and human clinical trials that illustrate differences between the available botulinum toxin products (onabotulinumtoxinA, abobotulinumtoxinA, incobotulinumtoxinA, and rimabotulinumtoxinB.Results: Neither molecular weight nor the presence of complexing proteins appears to affect diffusion; however, injection volume, concentration, and dose all play roles and are modifiable. Both animal and human studies show that botulinum toxin products are not interchangeable, and that some products are associated with greater diffusion and higher rates of diffusion-related adverse events than others.Discussion: Each of the botulinum toxins is a unique pharmacologic entity. A working knowledge of the different serotypes is essential to avoid unwanted diffusion-related adverse events. In addition, clinicians should be aware that the factors influencing diffusion may range from properties intrinsic to the drug to accurate muscle selection as well as dilution, volume, and dose injected.

Protein diffusion in photopolymerized poly(ethylene glycol) hydrogel networks

International Nuclear Information System (INIS)

Engberg, Kristin; Frank, Curtis W

2011-01-01

In this study, protein diffusion through swollen hydrogel networks prepared from end-linked poly(ethylene glycol)-diacrylate (PEG-DA) was investigated. Hydrogels were prepared via photopolymerization from PEG-DA macromonomer solutions of two molecular weights, 4600 Da and 8000 Da, with three initial solid contents: 20, 33 and 50 wt/wt% PEG. Diffusion coefficients for myoglobin traveling across the hydrogel membrane were determined for all PEG network compositions. The diffusion coefficient depended on PEG molecular weight and initial solid content, with the slowest diffusion occurring through lower molecular weight, high-solid-content networks (D gel = 0.16 ± 0.02 x 10 -8 cm 2 s -1 ) and the fastest diffusion occurring through higher molecular weight, low-solid-content networks (D gel = 11.05 ± 0.43 x 10 -8 cm 2 s -1 ). Myoglobin diffusion coefficients increased linearly with the increase of water content within the hydrogels. The permeability of three larger model proteins (horseradish peroxidase, bovine serum albumin and immunoglobulin G) through PEG(8000) hydrogel membranes was also examined, with the observation that globular molecules as large as 10.7 nm in hydrodynamic diameter can diffuse through the PEG network. Protein diffusion coefficients within the PEG hydrogels ranged from one to two orders of magnitude lower than the diffusion coefficients in free water. Network defects were determined to be a significant contributing factor to the observed protein diffusion.

La traduction: moyen de diffusion des valeurs culturelles en Amerique latin (Translation as a Means of Diffusion of Cultural Values in Latin America).

Science.gov (United States)

Ronai, Paulo

1980-01-01

Describes the activities and growth of ABRATES (Brazilian Translators Association). This association, although private in character and financed by members' dues, has gained government recognition, has helped to organize courses for translators, and has taken the first steps to protect the rights of the translator, demanding appropriate labor…

Differences in Gaussian diffusion tensor imaging and non-Gaussian diffusion kurtosis imaging model-based estimates of diffusion tensor invariants in the human brain.

Science.gov (United States)

Lanzafame, S; Giannelli, M; Garaci, F; Floris, R; Duggento, A; Guerrisi, M; Toschi, N

2016-05-01

/RK/AK values, indicating substantial anatomical variability of these discrepancies. In the HCP dataset, the median voxelwise percentage differences across the whole white matter skeleton were (nonlinear least squares algorithm) 14.5% (8.2%-23.1%) for MD, 4.3% (1.4%-17.3%) for FA, -5.2% (-48.7% to -0.8%) for MO, 12.5% (6.4%-21.2%) for RD, and 16.1% (9.9%-25.6%) for AD (all ranges computed as 0.01 and 0.99 quantiles). All differences/trends were consistent between the discovery (HCP) and replication (local) datasets and between estimation algorithms. However, the relationships between such trends, estimated diffusion tensor invariants, and kurtosis estimates were impacted by the choice of fitting routine. Model-dependent differences in the estimation of conventional indexes of MD/FA/MO/RD/AD can be well beyond commonly seen disease-related alterations. While estimating diffusion tensor-derived indexes using the DKI model may be advantageous in terms of mitigating b-value dependence of diffusivity estimates, such estimates should not be referred to as conventional DTI-derived indexes in order to avoid confusion in interpretation as well as multicenter comparisons. In order to assess the potential and advantages of DKI with respect to DTI as well as to standardize diffusion-weighted imaging methods between centers, both conventional DTI-derived indexes and diffusion tensor invariants derived by fitting the non-Gaussian DKI model should be separately estimated and analyzed using the same combination of fitting routines.

Molecular dynamics investigation of tracer diffusion in a simple liquid

International Nuclear Information System (INIS)

Ould-Kaddour, F.; Barrat, J.L.

1991-05-01

Extensive Molecular-Dynamics (MD) simulations have been carried out for a model trace-solvent system made up of 100 solvent molecules and 8 tracer molecules interacting through truncated Lennard-Jones potentials. The influence of the size ratio between solute and solvent, of their mass ratio and of the solvent viscosity on the diffusivity of a small tracer were investigated. Positive deviations from a Stokes-Einstein behaviour are observed, in qualitative agreement with experimental observations. It was also observed that as tracer and solvent become increasingly dissimilar, their respective dynamics becomes decoupled. We suggest that such decouplings can be interpreted by writing their mobility of the tracer as the sum of two terms, the first one arising from a coupling between tracer dynamics and hydrodynamics modes of the solvent, and the second one describing jump motion in a locally nearly frozen environment. (author). 17 refs, 4 figs, 6 tabs

Translation research: from accurate diagnosis to appropriate treatment

Directory of Open Access Journals (Sweden)

Pass Harvey I

2004-10-01

Full Text Available Abstract This review article focuses on the various aspects of translational research, where research on human subjects can ultimately enhance the diagnosis and treatment of future patients. While we will use specific examples relating to the asbestos related cancer mesothelioma, it should be stressed that the general approach outlined throughout this review is readily applicable to other diseases with an underlying molecular basis. Through the integration of molecular-based technologies, systematic tissue procurement and medical informatics, we now have the ability to identify clinically applicable "genotype"-"phenotype" associations across cohorts of patients that can rapidly be translated into useful diagnostic and treatment strategies. This review will touch on the various steps in the translational pipeline, and highlight some of the most essential elements as well as possible roadblocks that can impact success of the program. Critical issues with regard to Institutional Review Board (IRB and Health Insurance Portability and Accountability Act (HIPAA compliance, data standardization, sample procurement, quality control (QC, quality assurance (QA, data analysis, preclinical models and clinical trials are addressed. The various facets of the translational pipeline have been incorporated into a fully integrated computational system, appropriately named Dx2Tx. This system readily allows for the identification of new diagnostic tests, the discovery of biomarkers and drugable targets, and prediction of optimal treatments based upon the underlying molecular basis of the disease.

Thermal diffusion (1963)

International Nuclear Information System (INIS)

Lemarechal, A.

1963-01-01

This report brings together the essential principles of thermal diffusion in the liquid and gaseous phases. The macroscopic and molecular aspects of the thermal diffusion constant are reviewed, as well as the various measurement method; the most important developments however concern the operation of the CLUSIUS and DICKEL thermo-gravitational column and its applications. (author) [fr

Translational Bioinformatics and Clinical Research (Biomedical) Informatics.

Science.gov (United States)

Sirintrapun, S Joseph; Zehir, Ahmet; Syed, Aijazuddin; Gao, JianJiong; Schultz, Nikolaus; Cheng, Donavan T

2015-06-01

Translational bioinformatics and clinical research (biomedical) informatics are the primary domains related to informatics activities that support translational research. Translational bioinformatics focuses on computational techniques in genetics, molecular biology, and systems biology. Clinical research (biomedical) informatics involves the use of informatics in discovery and management of new knowledge relating to health and disease. This article details 3 projects that are hybrid applications of translational bioinformatics and clinical research (biomedical) informatics: The Cancer Genome Atlas, the cBioPortal for Cancer Genomics, and the Memorial Sloan Kettering Cancer Center clinical variants and results database, all designed to facilitate insights into cancer biology and clinical/therapeutic correlations. Copyright © 2015 Elsevier Inc. All rights reserved.

Neutron quasi-elastic scattering study of translational motions in the smectic H, C and A phases of TBBA

International Nuclear Information System (INIS)

Dianoux, A.J.; Volino, F.; Heidemann, A.; Hervet, H.

1975-01-01

Neutron quasi-elastic scattering experiments in the smectic H, C and A phases of TBBA are presented, using the high resolution backscattering technique. The data are analyzed in terms of translational motion and are characterized by an apparent self diffusion coefficient Dsub(ap). The physical meaning of Dsub(ap) is discussed in terms of the true bulk self diffusion tensor and other kinds of translational motions [fr

twentieth-century english bible translations 1. introduction

African Journals Online (AJOL)

boys, ascertained the meaning of the Greek text before proceeding to express it in contemporary English. In other words, Weymouth was interested in the way in which an inspired writer would have written had he lived in a later period of time. The translation is couched in modern, dignified but diffused English.

Origin of CH+ in diffuse molecular clouds. Warm H2 and ion-neutral drift

Science.gov (United States)

Valdivia, Valeska; Godard, Benjamin; Hennebelle, Patrick; Gerin, Maryvonne; Lesaffre, Pierre; Le Bourlot, Jacques

2017-04-01

Context. Molecular clouds are known to be magnetised and to display a turbulent and complex structure where warm and cold phases are interwoven. The turbulent motions within molecular clouds transport molecules, and the presence of magnetic fields induces a relative velocity between neutrals and ions known as the ion-neutral drift (vd). These effects all together can influence the chemical evolution of the clouds. Aims: This paper assesses the roles of two physical phenomena which have previously been invoked to boost the production of CH+ under realistic physical conditions: the presence of warm H2 and the increased formation rate due to the ion-neutral drift. Methods: We performed ideal magnetohydrodynamical (MHD) simulations that include the heating and cooling of the multiphase interstellar medium (ISM), and where we treat dynamically the formation of the H2 molecule. In a post-processing step we compute the abundances of species at chemical equilibrium using a solver that we developed. The solver uses the physical conditions of the gas as input parameters, and can also prescribe the H2 fraction if needed. We validate our approach by showing that the H2 molecule generally has a much longer chemical evolution timescale compared to the other species. Results: We show that CH+ is efficiently formed at the edge of clumps, in regions where the H2 fraction is low (0.3-30%) but nevertheless higher than its equilibrium value, and where the gas temperature is high (≳ 300 K). We show that warm and out of equilibrium H2 increases the integrated column densities of CH+ by one order of magnitude up to values still 3-10 times lower than those observed in the diffuse ISM. We balance the Lorentz force with the ion-neutral drag to estimate the ion-drift velocities from our ideal MHD simulations. We find that the ion-neutral drift velocity distribution peaks around 0.04 km s-1, and that high drift velocities are too rare to have a significant statistical impact on the

Traveling Chaucer: Comparative Translation and Cosmopolitan Humanism

Science.gov (United States)

Barrington, Candace

2014-01-01

Through the comparative study of non-Anglophone translations of Geoffrey Chaucer's "The Canterbury Tales," we can achieve the progressive goals of Emily Apter's "translational transnationalism" and Edward Said's "cosmopolitan humanism." Both translation and humanism were intrinsic to Chaucer's…

Diffusive wave in the low Mach limit for non-viscous and heat-conductive gas

Science.gov (United States)

Liu, Yechi

2018-06-01

The low Mach number limit for one-dimensional non-isentropic compressible Navier-Stokes system without viscosity is investigated, where the density and temperature have different asymptotic states at far fields. It is proved that the solution of the system converges to a nonlinear diffusion wave globally in time as Mach number goes to zero. It is remarked that the velocity of diffusion wave is proportional with the variation of temperature. Furthermore, it is shown that the solution of compressible Navier-Stokes system also has the same phenomenon when Mach number is suitably small.

Diffusion of Supercritical Fluids through Single-Layer Nanoporous Solids: Theory and Molecular Simulations.

Science.gov (United States)

Oulebsir, Fouad; Vermorel, Romain; Galliero, Guillaume

2018-01-16

With the advent of graphene material, membranes based on single-layer nanoporous solids appear as promising devices for fluid separation, be it liquid or gaseous mixtures. The design of such architectured porous materials would greatly benefit from accurate models that can predict their transport and separation properties. More specifically, there is no universal understanding of how parameters such as temperature, fluid loading conditions, or the ratio of the pore size to the fluid molecular diameter influence the permeation process. In this study, we address the problem of pure supercritical fluids diffusing through simplified models of single-layer porous materials. Basically, we investigate a toy model that consists of a single-layer lattice of Lennard-Jones interaction sites with a slit gap of controllable width. We performed extensive equilibrium and biased molecular dynamics simulations to document the physical mechanisms involved at the molecular scale. We propose a general constitutive equation for the diffusional transport coefficient derived from classical statistical mechanics and kinetic theory, which can be further simplified in the ideal gas limit. This transport coefficient relates the molecular flux to the fluid density jump across the single-layer membrane. It is found to be proportional to the accessible surface porosity of the single-layer porous solid and to a thermodynamic factor accounting for the inhomogeneity of the fluid close to the pore entrance. Both quantities directly depend on the potential of mean force that results from molecular interactions between solid and fluid atoms. Comparisons with the simulations data show that the kinetic model captures how narrowing the pore size below the fluid molecular diameter lowers dramatically the value of the transport coefficient. Furthermore, we demonstrate that our general constitutive equation allows for a consistent interpretation of the intricate effects of temperature and fluid loading

Protein Crowding in Lipid Bilayers Gives Rise to Non-Gaussian Anomalous Lateral Diffusion of Phospholipids and Proteins

Czech Academy of Sciences Publication Activity Database

Jeon, J. H.; Javanainen, M.; Martinez-Seara, Hector; Metzler, R.; Vattulainen, I.

2016-01-01

Roč. 6, č. 2 (2016), č. článku 021006. ISSN 2160-3308 Institutional support: RVO:61388963 Keywords : protein crowding * membranes * simulations * diffusion * non-Gaussian anomalous diffusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 12.789, year: 2016 http://journals.aps.org/prx/abstract/10.1103/PhysRevX.6.021006

Can molecular diffusion explain Space Shuttle plume spreading?

Science.gov (United States)

Meier, R. R.; Plane, John M. C.; Stevens, Michael H.; Paxton, L. J.; Christensen, A. B.; Crowley, G.

2010-04-01

The satellite-borne Global Ultraviolet Imager (GUVI) has produced more than 20 images of NASA Space Shuttle main engine plumes in the lower thermosphere. These reveal atomic hydrogen and, by inference, water vapor transport over hemispherical-scale distances with speeds much faster than expected from models of thermospheric wind motions. Furthermore, the hydrogen plumes expand rapidly. We find rates that exceed the horizontal diffusion speed at nominal plume altitudes of 104-112 km. Kelley et al. (2009) have proposed a 2-D turbulence mechanism to explain the observed spreading rates (and rapid advection) of the plumes. But upon further investigation, we conclude that H atom diffusion can indeed account for the observed expansion rates by recognizing that vertical diffusion quickly conveys atoms to higher altitudes where horizontal diffusion is much more rapid. We also find evidence for H atom production directly during the Shuttle's main engine burn.

Recommendations for the future of translational radiobiology research: a Canadian perspective

International Nuclear Information System (INIS)

Bristow, Robert G.

2004-01-01

The use of molecular medicine is now merging into clinical practice with the advent of molecular targeting agents, molecular pathology and molecular imaging for both diagnosis and treatment response. Radiation oncologists must therefore gain expertise in utilizing this information to drive new treatment protocols. Recognizing the importance of this issue, the Canadian Association of Radiation Oncologists (CARO) charged a Task Force in Translational Radiobiology to: (1) critically assess training programs and research infrastructure in relation to current and future translational radiobiology requirements; and (2) make specific recommendations to accelerate the implementation of translational science into day-to-day practice. Selected Task Force recommendations included the principle that universities and departmental Chairs increase the opportunities for academic promotion, funding, and tenure track positions of radiobiologists and translational radiation oncologists. The dedication of 4 to 5 national centers as translational 'hubs', can serve as an interface between clinicians, clinical specimens and radiobiological sciences within the context of correlative clinical trials. The model of the clinician-scientist was encouraged as an important adjunct to good clinical care to be associated with strong enticement, training and mentoring programs and 75%-protected research time. Finally, an integrated model of radiobiological training programs and mutual continuing education between clinicians and basic scientists can be facilitated through a new national radiobiology meeting sponsored by CARO. These recommendations have been accepted by the national radiation oncology membership. Such a framework may serve useful for national programs wishing to develop rapid conduits from the lab to the clinic as a means of integrating molecular biology and the day-to-day practice of radiation oncology

Diffusion-weighted imaging features of breast tumours and the surrounding stroma reflect intrinsic heterogeneous characteristics of molecular subtypes in breast cancer

KAUST Repository

Fan, Ming; He, Ting; Zhang, Peng; Cheng, Hu; Zhang, Juan; Gao, Xin; Li, Lihua

2017-01-01

Breast cancer heterogeneity is the main obstacle preventing the identification of patients with breast cancer with poor prognoses and treatment responses; however, such heterogeneity has not been well characterized. The purpose of this retrospective study was to reveal heterogeneous patterns in the apparent diffusion coefficient (ADC) signals in tumours and the surrounding stroma to predict molecular subtypes of breast cancer. A dataset of 126 patients with breast cancer, who underwent preoperative diffusion-weighted imaging (DWI) on a 3.0-T image system, was collected. Breast images were segmented into regions comprising the tumour and surrounding stromal shells in which features that reflect heterogeneous ADC signal distribution were extracted. For each region, imaging features were computed, including the mean, minimum, variance, interquartile range (IQR), range, skewness, kurtosis and entropy of ADC values. Univariate and stepwise multivariate logistic regression modelling was performed to identify the magnetic resonance imaging features that optimally discriminate luminal A, luminal B, human epidermal growth factor 2 (HER2)-enriched and basal-like molecular subtypes. The performance of the predictive models was evaluated using the area under the receiver operating characteristic curve (AUC). Univariate logistic regression analysis showed that the skewness in the tumour boundary achieved an AUC of 0.718 for discrimination between luminal A and non-luminal A tumours, whereas the IQR of the ADC value in the tumour boundary had an AUC of 0.703 for classification of the HER2-enriched subtype. Imaging features in the tumour boundary and the proximal peritumoral stroma corresponded to a higher overall prediction performance than those in other regions. A multivariate logistic regression model combining features in all the regions achieved an overall AUC of 0.800 for the classification of the four tumour subtypes. These findings suggest that features in the tumour

Diffusion-weighted imaging features of breast tumours and the surrounding stroma reflect intrinsic heterogeneous characteristics of molecular subtypes in breast cancer

KAUST Repository

Fan, Ming

2017-12-16

Breast cancer heterogeneity is the main obstacle preventing the identification of patients with breast cancer with poor prognoses and treatment responses; however, such heterogeneity has not been well characterized. The purpose of this retrospective study was to reveal heterogeneous patterns in the apparent diffusion coefficient (ADC) signals in tumours and the surrounding stroma to predict molecular subtypes of breast cancer. A dataset of 126 patients with breast cancer, who underwent preoperative diffusion-weighted imaging (DWI) on a 3.0-T image system, was collected. Breast images were segmented into regions comprising the tumour and surrounding stromal shells in which features that reflect heterogeneous ADC signal distribution were extracted. For each region, imaging features were computed, including the mean, minimum, variance, interquartile range (IQR), range, skewness, kurtosis and entropy of ADC values. Univariate and stepwise multivariate logistic regression modelling was performed to identify the magnetic resonance imaging features that optimally discriminate luminal A, luminal B, human epidermal growth factor 2 (HER2)-enriched and basal-like molecular subtypes. The performance of the predictive models was evaluated using the area under the receiver operating characteristic curve (AUC). Univariate logistic regression analysis showed that the skewness in the tumour boundary achieved an AUC of 0.718 for discrimination between luminal A and non-luminal A tumours, whereas the IQR of the ADC value in the tumour boundary had an AUC of 0.703 for classification of the HER2-enriched subtype. Imaging features in the tumour boundary and the proximal peritumoral stroma corresponded to a higher overall prediction performance than those in other regions. A multivariate logistic regression model combining features in all the regions achieved an overall AUC of 0.800 for the classification of the four tumour subtypes. These findings suggest that features in the tumour

Diffuse interstellar clouds

International Nuclear Information System (INIS)

Black, J.H.

1987-01-01

The author defines and discusses the nature of diffuse interstellar clouds. He discusses how they contribute to the general extinction of starlight. The atomic and molecular species that have been identified in the ultraviolet, visible, and near infrared regions of the spectrum of a diffuse cloud are presented. The author illustrates some of the practical considerations that affect absorption line observations of interstellar atoms and molecules. Various aspects of the theoretical description of diffuse clouds required for a full interpretation of the observations are discussed

Diffusion weighted imaging in patients with rectal cancer: Comparison between Gaussian and non-Gaussian models.

Directory of Open Access Journals (Sweden)

Georgios C Manikis

Full Text Available The purpose of this study was to compare the performance of four diffusion models, including mono and bi-exponential both Gaussian and non-Gaussian models, in diffusion weighted imaging of rectal cancer.Nineteen patients with rectal adenocarcinoma underwent MRI examination of the rectum before chemoradiation therapy including a 7 b-value diffusion sequence (0, 25, 50, 100, 500, 1000 and 2000 s/mm2 at a 1.5T scanner. Four different diffusion models including mono- and bi-exponential Gaussian (MG and BG and non-Gaussian (MNG and BNG were applied on whole tumor volumes of interest. Two different statistical criteria were recruited to assess their fitting performance, including the adjusted-R2 and Root Mean Square Error (RMSE. To decide which model better characterizes rectal cancer, model selection was relied on Akaike Information Criteria (AIC and F-ratio.All candidate models achieved a good fitting performance with the two most complex models, the BG and the BNG, exhibiting the best fitting performance. However, both criteria for model selection indicated that the MG model performed better than any other model. In particular, using AIC Weights and F-ratio, the pixel-based analysis demonstrated that tumor areas better described by the simplest MG model in an average area of 53% and 33%, respectively. Non-Gaussian behavior was illustrated in an average area of 37% according to the F-ratio, and 7% using AIC Weights. However, the distributions of the pixels best fitted by each of the four models suggest that MG failed to perform better than any other model in all patients, and the overall tumor area.No single diffusion model evaluated herein could accurately describe rectal tumours. These findings probably can be explained on the basis of increased tumour heterogeneity, where areas with high vascularity could be fitted better with bi-exponential models, and areas with necrosis would mostly follow mono-exponential behavior.

Non-thermal escape of molecular hydrogen from Mars

Science.gov (United States)

Gacesa, M.; Zhang, P.; Kharchenko, V.

2012-05-01

We present a detailed theoretical analysis of non-thermal escape of molecular hydrogen from Mars induced by collisions with hot atomic oxygen from the Martian corona. To accurately describe the energy transfer in O + H2(v, j) collisions, we performed extensive quantum-mechanical calculations of state-to-state elastic, inelastic, and reactive cross sections. The escape flux of H2 molecules was evaluated using a simplified 1D column model of the Martian atmosphere with realistic densities of atmospheric gases and hot oxygen production rates for low solar activity conditions. An average intensity of the non-thermal escape flux of H2 of 1.9 × 105 cm-2s-1 was obtained considering energetic O atoms produced in dissociative recombinations of O2+ ions. Predicted ro-vibrational distribution of the escaping H2 was found to contain a significant fraction of higher rotational states. While the non-thermal escape rate was found to be lower than Jeans rate for H2 molecules, the non-thermal escape rates of HD and D2 are significantly higher than their respective Jeans rates. The accurate evaluation of the collisional escape flux of H2 and its isotopes is important for understanding non-thermal escape of molecules from Mars, as well as for the formation of hot H2 Martian corona. The described molecular ejection mechanism is general and expected to contribute to atmospheric escape of H2 and other light molecules from planets, satellites, and exoplanetary bodies.

Translational control of Nrf2 within the open reading frame

International Nuclear Information System (INIS)

Perez-Leal, Oscar; Barrero, Carlos A.; Merali, Salim

2013-01-01

Highlights: •Identification of a novel Nrf2 translational repression mechanism. •The repressor is within the 3′ portion of the Nrf2 ORF. •The translation of Nrf2 or eGFP is reduced by the regulatory element. •The translational repression can be reversed with synonymous codon substitutions. •The molecular mechanism requires the mRNA sequence, but not the encoded amino acids. -- Abstract: Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) is a transcription factor that is essential for the regulation of an effective antioxidant and detoxifying response. The regulation of its activity can occur at transcription, translation and post-translational levels. Evidence suggests that under environmental stress conditions, new synthesis of Nrf2 is required – a process that is regulated by translational control and is not fully understood. Here we described the identification of a novel molecular process that under basal conditions strongly represses the translation of Nrf2 within the open reading frame (ORF). This mechanism is dependent on the mRNA sequence within the 3′ portion of the ORF of Nrf2 but not in the encoded amino acid sequence. The Nrf2 translational repression can be reversed with the use of synonymous codon substitutions. This discovery suggests an additional layer of control to explain the reason for the low Nrf2 concentration under quiescent state

Model of cap-dependent translation initiation in sea urchin: a step towards the eukaryotic translation regulation network.

Science.gov (United States)

Bellé, Robert; Prigent, Sylvain; Siegel, Anne; Cormier, Patrick

2010-03-01

The large and rapid increase in the rate of protein synthesis following fertilization of the sea urchin egg has long been a paradigm of translational control, an important component of the regulation of gene expression in cells. This translational up-regulation is linked to physiological changes that occur upon fertilization and is necessary for entry into first cell division cycle. Accumulated knowledge on cap-dependent initiation of translation makes it suited and timely to start integrating the data into a system view of biological functions. Using a programming environment for system biology coupled with model validation (named Biocham), we have built an integrative model for cap-dependent initiation of translation. The model is described by abstract rules. It contains 51 reactions involved in 74 molecular complexes. The model proved to be coherent with existing knowledge by using queries based on computational tree logic (CTL) as well as Boolean simulations. The model could simulate the change in translation occurring at fertilization in the sea urchin model. It could also be coupled with an existing model designed for cell-cycle control. Therefore, the cap-dependent translation initiation model can be considered a first step towards the eukaryotic translation regulation network.

Non-Contact Measurement of Thermal Diffusivity in Ion-Implanted Nuclear Materials

Science.gov (United States)

Hofmann, F.; Mason, D. R.; Eliason, J. K.; Maznev, A. A.; Nelson, K. A.; Dudarev, S. L.

2015-11-01

Knowledge of mechanical and physical property evolution due to irradiation damage is essential for the development of future fission and fusion reactors. Ion-irradiation provides an excellent proxy for studying irradiation damage, allowing high damage doses without sample activation. Limited ion-penetration-depth means that only few-micron-thick damaged layers are produced. Substantial effort has been devoted to probing the mechanical properties of these thin implanted layers. Yet, whilst key to reactor design, their thermal transport properties remain largely unexplored due to a lack of suitable measurement techniques. Here we demonstrate non-contact thermal diffusivity measurements in ion-implanted tungsten for nuclear fusion armour. Alloying with transmutation elements and the interaction of retained gas with implantation-induced defects both lead to dramatic reductions in thermal diffusivity. These changes are well captured by our modelling approaches. Our observations have important implications for the design of future fusion power plants.

Non-Contact Measurement of Thermal Diffusivity in Ion-Implanted Nuclear Materials

International Nuclear Information System (INIS)

Hofmann, F.; Mason, D. R.; Eliason, J. K.; Maznev, A. A.; Nelson, K. A.; Dudarev, S. L.

2015-01-01

Knowledge of mechanical and physical property evolution due to irradiation damage is essential for the development of future fission and fusion reactors. Ion-irradiation provides an excellent proxy for studying irradiation damage, allowing high damage doses without sample activation. Limited ion-penetration-depth means that only few-micron-thick damaged layers are produced. Substantial effort has been devoted to probing the mechanical properties of these thin implanted layers. Yet, whilst key to reactor design, their thermal transport properties remain largely unexplored due to a lack of suitable measurement techniques. Here we demonstrate non-contact thermal diffusivity measurements in ion-implanted tungsten for nuclear fusion armour. Alloying with transmutation elements and the interaction of retained gas with implantation-induced defects both lead to dramatic reductions in thermal diffusivity. These changes are well captured by our modelling approaches. Our observations have important implications for the design of future fusion power plants

Generalized extended Navier-Stokes theory: correlations in molecular fluids with intrinsic angular momentum.

Science.gov (United States)

Hansen, J S; Daivis, Peter J; Dyre, Jeppe C; Todd, B D; Bruus, Henrik

2013-01-21

The extended Navier-Stokes theory accounts for the coupling between the translational and rotational molecular degrees of freedom. In this paper, we generalize this theory to non-zero frequencies and wavevectors, which enables a new study of spatio-temporal correlation phenomena present in molecular fluids. To discuss these phenomena in detail, molecular dynamics simulations of molecular chlorine are performed for three different state points. In general, the theory captures the behavior for small wavevector and frequencies as expected. For example, in the hydrodynamic regime and for molecular fluids with small moment of inertia like chlorine, the theory predicts that the longitudinal and transverse intrinsic angular velocity correlation functions are almost identical, which is also seen in the molecular dynamics simulations. However, the theory fails at large wavevector and frequencies. To account for the correlations at these scales, we derive a phenomenological expression for the frequency dependent rotational viscosity and wavevector and frequency dependent longitudinal spin viscosity. From this we observe a significant coupling enhancement between the molecular angular velocity and translational velocity for large frequencies in the gas phase; this is not observed for the supercritical fluid and liquid state points.

Molecular dynamics study of Ar flow and He flow inside carbon nanotube junction as a molecular nozzle and diffuser

Directory of Open Access Journals (Sweden)

Itsuo Hanasaki, Akihiro Nakatani and Hiroshi Kitagawa

2004-01-01

Full Text Available A carbon nanotube junction consists of two connected nanotubes with different diameters. It has been extensively investigated as a molecular electronic device since carbon nanotubes can be metallic and semiconductive, depending on their structure. However, a carbon nanotube junction can also be viewed as a nanoscale nozzle andv diffuser. Here, we focus on the nanotube junction from the perspective of an intersection between machine, material and device. We have conducted a molecular dynamics simulation of the molecular flow inside a modeled (12,12–(8,8 nanotube junction. A strong gravitational field and a periodic boundary condition are applied in the flow direction. We investigated dense-Ar flows and dense-He flows while controlling the temperature of the nanotube junction. The results show that Ar atoms tend to be near to the wall and the density of the Ar is higher in the wide (12,12 nanotube than in the narrow (8,8 nanotube, while it is lower in the wide tube when no flow occurs. The streaming velocities of both the Ar and the He are higher in the narrow nanotube than in the wide nanotube, but the velocity of the Ar is higher than the velocity of the He and the temperature of the flowing Ar is higher than the temperature of the He when the same magnitude of gravitational field is applied.

Translating Dominant Institutional Logics in Practice

DEFF Research Database (Denmark)

Agger Nielsen, Jeppe; Jensen, Tina Blegind

In this paper we examine the proliferation of a new mobile technology in a structured setting of home care in Denmark, focusing on how actions at multiple levels interact to enable technology diffusion and institutionalization. The case study shows how a dominating field level logic...... that combining an institutional logic perspective with a translation perspective furthers our understanding of the malleability of institutional logics....

Non-invasive Prenatal Testing and the Unveiling of an Impaired Translation Process.

Science.gov (United States)

Murdoch, Blake; Ravitsky, Vardit; Ogbogu, Ubaka; Ali-Khan, Sarah; Bertier, Gabrielle; Birko, Stanislav; Bubela, Tania; De Beer, Jeremy; Dupras, Charles; Ellis, Meika; Granados Moreno, Palmira; Joly, Yann; Kamenova, Kalina; Master, Zubin; Marcon, Alessandro; Paulden, Mike; Rousseau, François; Caulfield, Timothy

2017-01-01

Non-invasive prenatal testing (NIPT) is an exciting technology with the potential to provide a variety of clinical benefits, including a reduction in miscarriages, via a decline in invasive testing. However, there is also concern that the economic and near-future clinical benefits of NIPT have been overstated and the potential limitations and harms underplayed. NIPT, therefore, presents an opportunity to explore the ways in which a range of social pressures and policies can influence the translation, implementation, and use of a health care innovation. NIPT is often framed as a potential first tier screen that should be offered to all pregnant women, despite concerns over cost-effectiveness. Multiple forces have contributed to a problematic translational environment in Canada, creating pressure towards first tier implementation. Governments have contributed to commercialization pressure by framing the publicly funded research sector as a potential engine of economic growth. Members of industry have an incentive to frame clinical value as beneficial to the broadest possible cohort in order to maximize market size. Many studies of NIPT were directly funded and performed by private industry in laboratories lacking strong independent oversight. Physicians' fear of potential liability for failing to recommend NIPT may further drive widespread uptake. Broad social endorsement, when combined with these translation pressures, could result in the "routinization" of NIPT, thereby adversely affecting women's reproductive autonomy. Policymakers should demand robust independent evidence of clinical and public health utility relevant to their respective jurisdictions before making decisions regarding public funding for NIPT. Copyright © 2017 The Society of Obstetricians and Gynaecologists of Canada/La Société des obstétriciens et gynécologues du Canada. Published by Elsevier Inc. All rights reserved.

Increasing the sensitivity of NMR diffusion measurements by paramagnetic longitudinal relaxation enhancement, with application to ribosome–nascent chain complexes

International Nuclear Information System (INIS)

Chan, Sammy H. S.; Waudby, Christopher A.; Cassaignau, Anaïs M. E.; Cabrita, Lisa D.; Christodoulou, John

2015-01-01

The translational diffusion of macromolecules can be examined non-invasively by stimulated echo (STE) NMR experiments to accurately determine their molecular sizes. These measurements can be important probes of intermolecular interactions and protein folding and unfolding, and are crucial in monitoring the integrity of large macromolecular assemblies such as ribosome–nascent chain complexes (RNCs). However, NMR studies of these complexes can be severely constrained by their slow tumbling, low solubility (with maximum concentrations of up to 10 μM), and short lifetimes resulting in weak signal, and therefore continuing improvements in experimental sensitivity are essential. Here we explore the use of the paramagnetic longitudinal relaxation enhancement (PLRE) agent NiDO2A on the sensitivity of 15 N XSTE and SORDID heteronuclear STE experiments, which can be used to monitor the integrity of these unstable complexes. We exploit the dependence of the PLRE effect on the gyromagnetic ratio and electronic relaxation time to accelerate recovery of 1 H magnetization without adversely affecting storage on N z during diffusion delays or introducing significant transverse relaxation line broadening. By applying the longitudinal relaxation-optimized SORDID pulse sequence together with NiDO2A to 70S Escherichia coli ribosomes and RNCs, NMR diffusion sensitivity enhancements of up to 4.5-fold relative to XSTE are achieved, alongside ∼1.9-fold improvements in two-dimensional NMR sensitivity, without compromising the sample integrity. We anticipate these results will significantly advance the use of NMR to probe dynamic regions of ribosomes and other large, unstable macromolecular assemblies.Graphical Abstract

Stroke-Related Translational Research

Science.gov (United States)

Caplan, Louis R.; Arenillas, Juan; Cramer, Steven C.; Joutel, Anne; Lo, Eng H.; Meschia, James; Savitz, Sean; Tournier-Lasserve, Elizabeth

2013-01-01

Stroke-related translational research is multifaceted. Herein, we highlight genome-wide association studies and genetic studies of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy, COL4A1 mutations, and cerebral cavernous malformations; advances in molecular biology and biomarkers; newer brain imaging research; and recovery from stroke emphasizing cell-based and other rehabilitative modalities. PMID:21555605

Translation initiation complex eIF4F is a therapeutic target for dual mTOR kinase inhibitors in non-Hodgkin lymphoma

Science.gov (United States)

Stenson, Mary J.; Maurer, Matthew J.; Wellik, Linda E.; Link, Brian; Hege, Kristen; Dogan, Ahmet; Sotomayor, Eduardo; Witzig, Thomas; Gupta, Mamta

2015-01-01

Deregulated mRNA translation has been implicated in disease development and in part is controlled by a eukaryotic initiation complex eIF4F (composed of eIF4E, eIF4G and eIF4A). We demonstrate here that the cap bound fraction from lymphoma cells was enriched with eIF4G and eIF4E indicating that lymphoma cells exist in an activated translational state. Moreover, 77% (110/142) of diffuse large B cell lymphoma tumors expressed eIF4E and this was associated with an inferior event free survival. Over-expression of wild-type eIF4E (eIF4EWT) but not cap-mutant eIF4E (eIF4Ecap mutant) increased the activation of the eIF4F complex. Treatment with the active-site dual mTOR inhibitor CC214-1 reduced the level of the eIF4F complex by decreasing the cap bound fraction of eIF4G and increasing the levels of 4E-BP1. CC214-1 inhibited both the cap dependent and global protein translation. CC214-1 inhibited c-Myc, and cyclin D3 translation by decreasing polysomal fractions from lymphoma cells. Inhibition of eIF4E with shRNA further decreased the CC214-1 induced inhibition of the eIF4F complex, c-Myc, cyclin D3 translation, and colony formation. These studies demonstrate that the eIF4F complex is deregulated in aggressive lymphoma and that dual mTOR therapy has therapeutic potential in these patients. PMID:25839159

Levelling-out and register variation in the translations of experienced and inexperienced translators: a corpus-based study

Directory of Open Access Journals (Sweden)

Karien Redelinghuys

2016-07-01

Full Text Available Explicitation, simplification, normalisation and levelling-out, the four features of translation proposed by Baker (1996, have attracted considerable attention in translation studies. Although the first three have been studied extensively, levelling-out has been the subject of less empirical investigation. Furthermore, there are no studies to date that have investigated the extent to which levelling-out occurs in translations by experienced translators and inexperienced translators. In this study, levelling-out is operationalised in terms of register. It is hypothesised that less register variation will be apparent in translations by inexperienced translators and, in keeping with the features of translation hypothesis, it is predicted that select linguistic features will demonstrate less register variation in translations than in non-translations. A custom-built corpus was compiled to test these hypotheses. While some light is shed on how translation expertise contributes to register sensitivity and the distribution of certain features across different registers, little evidence could be found for levelling-out as register variation is evident in the translation corpora.

The translational science training program at NIH: Introducing early career researchers to the science and operation of translation of basic research to medical interventions.

Science.gov (United States)

Gilliland, C Taylor; Sittampalam, G Sitta; Wang, Philip Y; Ryan, Philip E

2017-01-02

Translational science is an emerging field that holds great promise to accelerate the development of novel medical interventions. As the field grows, so does the demand for highly trained biomedical scientists to fill the positions that are being created. Many graduate and postdoctorate training programs do not provide their trainees with sufficient education to take advantage of this growing employment sector. To help better prepare the trainees at the National Institutes of Health for possible careers in translation, we have created the Translational Science Training Program (TSTP). The TSTP is an intensive 2- to 3-day training program that introduces NIH postdoctoral trainees and graduate students to the science and operation of turning basic research discoveries into a medical therapeutic, device or diagnostic, and also exposes them to the variety of career options in translational science. Through a combination of classroom teaching from practicing experts in the various disciplines of translation and small group interactions with pre-clinical development teams, participants in the TSTP gain knowledge that will aid them in obtaining a career in translational science and building a network to make the transition to the field. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(1):13-24, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

Diffusion-stress coupling in liquid phase during rapid solidification of binary mixtures

International Nuclear Information System (INIS)

Sobolev, S.L.

2014-01-01

An analytical model has been developed to describe the diffusion-viscous stress coupling in the liquid phase during rapid solidification of binary mixtures. The model starts with a set of evolution equations for diffusion flux and viscous pressure tensor, based on extended irreversible thermodynamics. It has been demonstrated that the diffusion-stress coupling leads to non-Fickian diffusion effects in the liquid phase. With only diffusive dynamics, the model results in the nonlocal diffusion equations of parabolic type, which imply the transition to complete solute trapping only asymptotically at an infinite interface velocity. With the wavelike dynamics, the model leads to the nonlocal diffusion equations of hyperbolic type and describes the transition to complete solute trapping and diffusionless solidification at a finite interface velocity in accordance with experimental data and molecular dynamic simulation. -- Highlights: •We propose the diffusion-stress coupling model for binary solidification. •The coupling arises at deep undercooling. •With diffusive dynamics, the models result in parabolic transfer equations. •With the wavelike dynamics, the models lead to hyperbolic transfer equations. •The coupling strongly affects the solute partition coefficient

A novel clinically translatable fluorescent nanoparticle for targeted molecular imaging of tumors in living subjects.

Science.gov (United States)

Gao, Jinhao; Chen, Kai; Luong, Richard; Bouley, Donna M; Mao, Hua; Qiao, Tiecheng; Gambhir, Sanjiv S; Cheng, Zhen

2012-01-11

The use of quantum dots (QDs) in biomedical research has grown tremendously, yet successful examples of clinical applications are absent due to many clinical concerns. Here, we report on a new type of stable and biocompatible dendron-coated InP/ZnS core/shell QD as a clinically translatable nanoprobe for molecular imaging applications. The QDs (QD710-Dendron) were demonstrated to hold several significant features: near-infrared (NIR) emission, high stability in biological media, suitable size with possible renal clearance, and ability of extravasation. More importantly, a pilot mouse toxicity study confirmed that QD710-Dendron lacks significant toxicity at the doses tested. The acute tumor uptake of QD710-Dendron resulted in good contrast from the surrounding nontumorous tissues, indicating the possibility of passive targeting of the QDs. The highly specific targeting of QD710-Dendron-RGD(2) to integrin α(v)β(3)-positive tumor cells resulted in high tumor uptake and long retention of the nanoprobe at tumor sites. In summary, QD710-Dendron and RGD-modified nanoparticles demonstrate small size, high stability, biocompatibility, favorable in vivo pharmacokinetics, and successful tumor imaging properties. These features satisfy the requirements for clinical translation and should promote efforts to further investigate the possibility of using QD710-Dendron-based nanoprobes in the clinical setting in the near future. © 2011 American Chemical Society

Pedagogic translation: Experiments and exercises to do in class

Directory of Open Access Journals (Sweden)

Elisa Figueira de Souza Corrêa

2017-12-01

Full Text Available This paper reports several experiments and proposals of exercises that were done in non-native language classrooms. The objective is to justify and promote pedagogic translation use in non-native language teaching. By these examples, it is clear that translation helps to enhance student’s language awareness and to develop a certain translation ability (i.e. a fifth skill – which is essential in life beyond classroom.

A Process for Modelling Diffuse Scattering from Disordered Molecular Crystals, Illustrated by Application to Monoclinic 9-Chloro-10-methylanthracene

Directory of Open Access Journals (Sweden)

D. J. Goossens

2015-01-01

Full Text Available Diffuse scattering from a crystal contains valuable information about the two-body correlations (related to the nanoscale order in the material. Despite years of development, the detailed analysis of single crystal diffuse scattering (SCDS has yet to become part of the everyday toolbox of the structural scientist. Recent decades have seen the pair distribution function approach to diffuse scattering (in fact, total scattering from powders become a relatively routine tool. However, analysing the detailed, complex, and often highly anisotropic three-dimensional distribution of SCDS remains valuable yet rare because there is no routine method for undertaking the analysis. At present, analysis requires significant investment of time to develop specialist expertise, which means that the analysis of diffuse scattering, which has much to offer, is not incorporated thorough studies of many compounds even though it has the potential to be a very useful adjunct to existing techniques. This article endeavours to outline in some detail how the diffuse scattering from a molecular crystal can be modelled relatively quickly and largely using existing software tools. It is hoped this will provide a template for other studies. To enable this, the entire simulation is included as deposited material.

Kinetics of CO2 diffusion in human carbonic anhydrase: a study using molecular dynamics simulations and the Markov-state model.

Science.gov (United States)

Chen, Gong; Kong, Xian; Lu, Diannan; Wu, Jianzhong; Liu, Zheng

2017-05-10

Molecular dynamics (MD) simulations, in combination with the Markov-state model (MSM), were applied to probe CO 2 diffusion from an aqueous solution into the active site of human carbonic anhydrase II (hCA-II), an enzyme useful for enhanced CO 2 capture and utilization. The diffusion process in the hydrophobic pocket of hCA-II was illustrated in terms of a two-dimensional free-energy landscape. We found that CO 2 diffusion in hCA-II is a rate-limiting step in the CO 2 diffusion-binding-reaction process. The equilibrium distribution of CO 2 shows its preferential accumulation within a hydrophobic domain in the protein core region. An analysis of the committors and reactive fluxes indicates that the main pathway for CO 2 diffusion into the active site of hCA-II is through a binding pocket where residue Gln 136 contributes to the maximal flux. The simulation results offer a new perspective on the CO 2 hydration kinetics and useful insights toward the development of novel biochemical processes for more efficient CO 2 sequestration and utilization.

Plant cytoplasmic GAPDH: redox post-translational modifications and moonlighting properties

Directory of Open Access Journals (Sweden)

Mirko eZaffagnini

2013-11-01

Full Text Available Glyceraldehyde-3-phosphate dehydrogenase (GAPDH is a ubiquitous enzyme involved in glycolysis and shown, particularly in animal cells, to play additional roles in several unrelated non-metabolic processes such as control of gene expression and apoptosis. This functional versatility is regulated, in part at least, by redox post-translational modifications that alter GAPDH catalytic activity and influence the subcellular localization of the enzyme. In spite of the well established moonlighting (multifunctional properties of animal GAPDH, little is known about non-metabolic roles of GAPDH in plants. Plant cells contain several GAPDH isoforms with different catalytic and regulatory properties, located both in the cytoplasm and in plastids, and participating in glycolysis and the Calvin-Benson cycle. A general feature of all GAPDH proteins is the presence of an acidic catalytic cysteine in the active site that is overly sensitive to oxidative modifications, including glutathionylation and S-nitrosylation. In Arabidopsis, oxidatively-modified cytoplasmic GAPDH has been successfully used as a tool to investigate the role of reduced glutathione, thioredoxins and glutaredoxins in the control of different types of redox post-translational modifications. Oxidative modifications inhibit GAPDH activity, but might enable additional functions in plant cells. Mounting evidence support the concept that plant cytoplasmic GAPDH may fulfill alternative, non-metabolic functions that are triggered by redox post-translational modifications of the protein under stress conditions. The aim of this review is to detail the molecular mechanisms underlying the redox regulation of plant cytoplasmic GAPDH in the light of its crystal structure, and to provide a brief inventory of the well known redox-dependent multi-facetted properties of animal GAPDH, together with the emerging roles of oxidatively-modified GAPDH in stress signaling pathways in plants.

Effects of different per translational kinetics on the dynamics of a core circadian clock model.

Science.gov (United States)

Nieto, Paula S; Revelli, Jorge A; Garbarino-Pico, Eduardo; Condat, Carlos A; Guido, Mario E; Tamarit, Francisco A

2015-01-01

Living beings display self-sustained daily rhythms in multiple biological processes, which persist in the absence of external cues since they are generated by endogenous circadian clocks. The period (per) gene is a central player within the core molecular mechanism for keeping circadian time in most animals. Recently, the modulation PER translation has been reported, both in mammals and flies, suggesting that translational regulation of clock components is important for the proper clock gene expression and molecular clock performance. Because translational regulation ultimately implies changes in the kinetics of translation and, therefore, in the circadian clock dynamics, we sought to study how and to what extent the molecular clock dynamics is affected by the kinetics of PER translation. With this objective, we used a minimal mathematical model of the molecular circadian clock to qualitatively characterize the dynamical changes derived from kinetically different PER translational mechanisms. We found that the emergence of self-sustained oscillations with characteristic period, amplitude, and phase lag (time delays) between per mRNA and protein expression depends on the kinetic parameters related to PER translation. Interestingly, under certain conditions, a PER translation mechanism with saturable kinetics introduces longer time delays than a mechanism ruled by a first-order kinetics. In addition, the kinetic laws of PER translation significantly changed the sensitivity of our model to parameters related to the synthesis and degradation of per mRNA and PER degradation. Lastly, we found a set of parameters, with realistic values, for which our model reproduces some experimental results reported recently for Drosophila melanogaster and we present some predictions derived from our analysis.

Translational Hyperactivity as a Target for Prostate Cancer

National Research Council Canada - National Science Library

Terrian, David

2003-01-01

... expression for PKCepsilon (PKCs) Molecular and biochemical approaches are being employed to specifically determine how PKCs activity influences reactivation of the translational repressor protein retinoblastoma (Rb...

THE ABUNDANCE OF MOLECULAR HYDROGEN AND ITS CORRELATION WITH MIDPLANE PRESSURE IN GALAXIES: NON-EQUILIBRIUM, TURBULENT, CHEMICAL MODELS

International Nuclear Information System (INIS)

Mac Low, Mordecai-Mark; Glover, Simon C. O.

2012-01-01

Observations of spiral galaxies show a strong linear correlation between the ratio of molecular to atomic hydrogen surface density R mol and midplane pressure. To explain this, we simulate three-dimensional, magnetized turbulence, including simplified treatments of non-equilibrium chemistry and the propagation of dissociating radiation, to follow the formation of H 2 from cold atomic gas. The formation timescale for H 2 is sufficiently long that equilibrium is not reached within the 20-30 Myr lifetimes of molecular clouds. The equilibrium balance between radiative dissociation and H 2 formation on dust grains fails to predict the time-dependent molecular fractions we find. A simple, time-dependent model of H 2 formation can reproduce the gross behavior, although turbulent density perturbations increase molecular fractions by a factor of few above it. In contradiction to equilibrium models, radiative dissociation of molecules plays little role in our model for diffuse radiation fields with strengths less than 10 times that of the solar neighborhood, because of the effective self-shielding of H 2 . The observed correlation of R mol with pressure corresponds to a correlation with local gas density if the effective temperature in the cold neutral medium of galactic disks is roughly constant. We indeed find such a correlation of R mol with density. If we examine the value of R mol in our local models after a free-fall time at their average density, as expected for models of molecular cloud formation by large-scale gravitational instability, our models reproduce the observed correlation over more than an order-of-magnitude range in density.

The Abundance of Molecular Hydrogen and Its Correlation with Midplane Pressure in Galaxies: Non-equilibrium, Turbulent, Chemical Models

Science.gov (United States)

Mac Low, Mordecai-Mark; Glover, Simon C. O.

2012-02-01

Observations of spiral galaxies show a strong linear correlation between the ratio of molecular to atomic hydrogen surface density R mol and midplane pressure. To explain this, we simulate three-dimensional, magnetized turbulence, including simplified treatments of non-equilibrium chemistry and the propagation of dissociating radiation, to follow the formation of H2 from cold atomic gas. The formation timescale for H2 is sufficiently long that equilibrium is not reached within the 20-30 Myr lifetimes of molecular clouds. The equilibrium balance between radiative dissociation and H2 formation on dust grains fails to predict the time-dependent molecular fractions we find. A simple, time-dependent model of H2 formation can reproduce the gross behavior, although turbulent density perturbations increase molecular fractions by a factor of few above it. In contradiction to equilibrium models, radiative dissociation of molecules plays little role in our model for diffuse radiation fields with strengths less than 10 times that of the solar neighborhood, because of the effective self-shielding of H2. The observed correlation of R mol with pressure corresponds to a correlation with local gas density if the effective temperature in the cold neutral medium of galactic disks is roughly constant. We indeed find such a correlation of R mol with density. If we examine the value of R mol in our local models after a free-fall time at their average density, as expected for models of molecular cloud formation by large-scale gravitational instability, our models reproduce the observed correlation over more than an order-of-magnitude range in density.

Ribonuclease inhibitor 1 regulates erythropoiesis by controlling GATA1 translation.

Science.gov (United States)

Chennupati, Vijaykumar; Veiga, Diogo Ft; Maslowski, Kendle M; Andina, Nicola; Tardivel, Aubry; Yu, Eric Chi-Wang; Stilinovic, Martina; Simillion, Cedric; Duchosal, Michel A; Quadroni, Manfredo; Roberts, Irene; Sankaran, Vijay G; MacDonald, H Robson; Fasel, Nicolas; Angelillo-Scherrer, Anne; Schneider, Pascal; Hoang, Trang; Allam, Ramanjaneyulu

2018-04-02

Ribosomal proteins (RP) regulate specific gene expression by selectively translating subsets of mRNAs. Indeed, in Diamond-Blackfan anemia and 5q- syndrome, mutations in RP genes lead to a specific defect in erythroid gene translation and cause anemia. Little is known about the molecular mechanisms of selective mRNA translation and involvement of ribosomal-associated factors in this process. Ribonuclease inhibitor 1 (RNH1) is a ubiquitously expressed protein that binds to and inhibits pancreatic-type ribonucleases. Here, we report that RNH1 binds to ribosomes and regulates erythropoiesis by controlling translation of the erythroid transcription factor GATA1. Rnh1-deficient mice die between embryonic days E8.5 and E10 due to impaired production of mature erythroid cells from progenitor cells. In Rnh1-deficient embryos, mRNA levels of Gata1 are normal, but GATA1 protein levels are decreased. At the molecular level, we found that RNH1 binds to the 40S subunit of ribosomes and facilitates polysome formation on Gata1 mRNA to confer transcript-specific translation. Further, RNH1 knockdown in human CD34+ progenitor cells decreased erythroid differentiation without affecting myelopoiesis. Our results reveal an unsuspected role for RNH1 in the control of GATA1 mRNA translation and erythropoiesis.

Diffusible signal factor-dependent quorum sensing in pathogenic bacteria and its exploitation for disease control.

Science.gov (United States)

Dow, J M

2017-01-01

Cell-to-cell signals of the diffusible signal factor (DSF) family are cis-2-unsaturated fatty acids of differing chain length and branching pattern. DSF signalling has been described in diverse bacteria to include plant and human pathogens where it acts to regulate functions such as biofilm formation, antibiotic tolerance and the production of virulence factors. DSF family signals can also participate in interspecies signalling with other bacteria and interkingdom signalling such as with the yeast Candida albicans. Interference with DSF signalling may afford new opportunities for the control of bacterial disease. Such strategies will depend in part on detailed knowledge of the molecular mechanisms underlying the processes of signal synthesis, perception and turnover. Here, I review both recent progress in understanding DSF signalling at the molecular level and prospects for translating this knowledge into approaches for disease control. © 2016 The Society for Applied Microbiology.

Slaved diffusion in phospholipid bilayers

Science.gov (United States)

Zhang, Liangfang; Granick, Steve

2005-01-01

The translational diffusion of phospholipids in supported fluid bilayers splits into two populations when polyelectrolytes adsorb at incomplete surface coverage. Spatially resolved measurements using fluorescence correlation spectroscopy show that a slow mode, whose magnitude scales inversely with the degree of polymerization of the adsorbate, coexists with a fast mode characteristic of naked lipid diffusion. Inner and outer leaflets of the bilayer are affected nearly equally. Mobility may vary from spot to spot on the membrane surface, despite the lipid composition being the same. This work offers a mechanism to explain how nanosized domains with reduced mobility arise in lipid membranes. PMID:15967988

Ways of Knowing, Sharing, and Translating Agricultural Knowledge and Perspectives: Alternative Epistemologies across Non-Formal and Informal Settings

Science.gov (United States)

Mars, Matthew M.; Ball, Anna L.

2016-01-01

The mainstream agricultural literacy movement has been mostly focused on school-based learning through formal curricula and standardized non-formal models (e.g., FFA, 4-H). The purpose of the current study is to qualitatively explore through a grounded theory approach, the development, sharing, and translation of diverse forms of agricultural…

Prognostic Relevance of Immunohistochemical Subclassification of Diffuse Large B-Cell Lymphoma in Two Prospective Phase III Clinical Trials

NARCIS (Netherlands)

Rayman, Nazik; Lam, King H.; van der Holt, Bronno; Koss, Clara; Veldhuizen, Dennis; Budel, Leo M.; Mulder, Andries H.; Verdonck, Leo F.; Delwel, Ruud; de Jong, Daphne; van Imhoff, Gustaaf W.; Sonneveld, Pieter

Purpose: Until now molecular biologic techniques have not been easily used in daily clinical practice to stratify patients for therapeutic purposes. Therefore, we have investigated the prognostic relevance of the immunohistochemical (IHC) germinal center B-cell (GCB) versus non-GCB diffuse large

Assessment of cerebral blood flow by means of non-diffusible tracers

Energy Technology Data Exchange (ETDEWEB)

Bagni, B; Carraro, P L; Candini, G; Feggi, L M

1985-01-01

A program for the evaluation of cerebral blood flow based on the analysis of the time activity curves is presented. The method is based on the Meier and Zierler formula, applying the partition coefficients suggested by Lassen et al. for the corrections deriving from the use of non-diffusible indicators (Technetium-99m-DTPA). Particular attention is given to the smoothing of the time-activity curve (using Legendre's polynomials) and to the correction function for reflux. The computation procedures and their validity are discussed.

Bulk-mediated surface diffusion: non-Markovian desorption and biased behaviour in an infinite system

International Nuclear Information System (INIS)

Revelli, Jorge A; Budde, Carlos E; Wio, Horacio S

2005-01-01

We analyse the dynamics of adsorbed molecules within the bulk-mediated surface diffusion framework. We consider that the particle's desorption mechanism is characterized by a non-Markovian process, while the particle's adsorption and its motion in the bulk are governed by Markovian dynamics, and include the effect of an external field in the form of a bias in the normal motion to the surface. We study this system for the diffusion of particles in a semi-infinite lattice, analysing the conditional probability to find the system on the reference absorptive plane as well as the surface dispersion as functions of time. The agreement between numerical and analytical asymptotic results is discussed

Non-Born-Oppenheimer electronic and nuclear densities for a Hooke-Calogero three-particle model: non-uniqueness of density-derived molecular structure.

Science.gov (United States)

Ludeña, E V; Echevarría, L; Lopez, X; Ugalde, J M

2012-02-28

We consider the calculation of non-Born-Oppenheimer, nBO, one-particle densities for both electrons and nuclei. We show that the nBO one-particle densities evaluated in terms of translationally invariant coordinates are independent of the wavefunction describing the motion of center of mass of the whole system. We show that they depend, however, on an arbitrary reference point from which the positions of the vectors labeling the particles are determined. We examine the effect that this arbitrary choice has on the topology of the one-particle density by selecting the Hooke-Calogero model of a three-body system for which expressions for the one-particle densities can be readily obtained in analytic form. We extend this analysis to the one-particle densities obtained from full Coulomb interaction wavefunctions for three-body systems. We conclude, in view of the fact that there is a close link between the choice of the reference point and the topology of one-particle densities that the molecular structure inferred from the topology of these densities is not unique. We analyze the behavior of one-particle densities for the Hooke-Calogero Born-Oppenheimer, BO, wavefunction and show that topological transitions are also present in this case for a particular mass value of the light particles even though in the BO regime the nuclear masses are infinite. In this vein, we argue that the change in topology caused by variation of the mass ratio between light and heavy particles does not constitute a true indication in the nBO regime of the emergence of molecular structure.

Effect of molecular topology on the transport properties of dendrimers in dilute solution at Θ temperature: A Brownian dynamics study

Science.gov (United States)

Bosko, Jaroslaw T.; Ravi Prakash, J.

2008-01-01

Structure and transport properties of dendrimers in dilute solution are studied with the aid of Brownian dynamics simulations. To investigate the effect of molecular topology on the properties, linear chain, star, and dendrimer molecules of comparable molecular weights are studied. A bead-spring chain model with finitely extensible springs and fluctuating hydrodynamic interactions is used to represent polymer molecules under Θ conditions. Structural properties as well as the diffusivity and zero-shear-rate intrinsic viscosity of polymers with varied degrees of branching are analyzed. Results for the free-draining case are compared to and found in very good agreement with the Rouse model predictions. Translational diffusivity is evaluated and the difference between the short-time and long-time behavior due to dynamic correlations is observed. Incorporation of hydrodynamic interactions is found to be sufficient to reproduce the maximum in the intrinsic viscosity versus molecular weight observed experimentally for dendrimers. Results of the nonequilibrium Brownian dynamics simulations of dendrimers and linear chain polymers subjected to a planar shear flow in a wide range of strain rates are also reported. The flow-induced molecular deformation of molecules is found to decrease hydrodynamic interactions and lead to the appearance of shear thickening. Further, branching is found to suppress flow-induced molecular alignment and deformation.

The long non-coding RNA GAS5 cooperates with the eukaryotic translation initiation factor 4E to regulate c-Myc translation.

Directory of Open Access Journals (Sweden)

Guangzhen Hu

Full Text Available Long noncoding RNAs (lncRNAs are important regulators of transcription; however, their involvement in protein translation is not well known. Here we explored whether the lncRNA GAS5 is associated with translation initiation machinery and regulates translation. GAS5 was enriched with eukaryotic translation initiation factor-4E (eIF4E in an RNA-immunoprecipitation assay using lymphoma cell lines. We identified two RNA binding motifs within eIF4E protein and the deletion of each motif inhibited the binding of GAS5 with eIF4E. To confirm the role of GAS5 in translation regulation, GAS5 siRNA and in vitro transcribed GAS5 RNA were used to knock down or overexpress GAS5, respectively. GAS5 siRNA had no effect on global protein translation but did specifically increase c-Myc protein level without an effect on c-Myc mRNA. The mechanism of this increase in c-Myc protein was enhanced association of c-Myc mRNA with the polysome without any effect on protein stability. In contrast, overexpression of in vitro transcribed GAS5 RNA suppressed c-Myc protein without affecting c-Myc mRNA. Interestingly, GAS5 was found to be bound with c-Myc mRNA, suggesting that GAS5 regulates c-Myc translation through lncRNA-mRNA interaction. Our findings have uncovered a role of GAS5 lncRNA in translation regulation through its interactions with eIF4E and c-Myc mRNA.

Insights into the Molecular Pathogenesis of Activated B-Cell-like Diffuse Large B-Cell Lymphoma and Its Therapeutic Implications

Directory of Open Access Journals (Sweden)

Georg Lenz

2015-05-01

Full Text Available Within the last couple of years, the understanding of the molecular mechanisms that drive the pathogenesis of diffuse large B-cell lymphoma (DLBCL has significantly improved. Large-scale gene expression profiling studies have led to the discovery of several molecularly defined subtypes that are characterized by specific oncogene addictions and significant differences in their outcome. Next generation sequencing efforts combined with RNA interference screens frequently identify crucial oncogenes that lead to constitutive activation of various signaling pathways that drive lymphomagenesis. This review summarizes our current understanding of the molecular pathogenesis of the activated B-cell-like (ABC DLBCL subtype that is characterized by poor prognosis. A special emphasis is put on findings that might impact therapeutic strategies of affected patients.

Insights into the Molecular Pathogenesis of Activated B-Cell-like Diffuse Large B-Cell Lymphoma and Its Therapeutic Implications

Energy Technology Data Exchange (ETDEWEB)

Lenz, Georg [Translational Oncology, Department of Medicine A, Albert-Schweitzer Campus 1, University Hospital Münster, 48149 Münster (Germany); Cluster of Excellence EXC 1003, Cells in Motion, 48149 Münster (Germany)

2015-05-22

Within the last couple of years, the understanding of the molecular mechanisms that drive the pathogenesis of diffuse large B-cell lymphoma (DLBCL) has significantly improved. Large-scale gene expression profiling studies have led to the discovery of several molecularly defined subtypes that are characterized by specific oncogene addictions and significant differences in their outcome. Next generation sequencing efforts combined with RNA interference screens frequently identify crucial oncogenes that lead to constitutive activation of various signaling pathways that drive lymphomagenesis. This review summarizes our current understanding of the molecular pathogenesis of the activated B-cell-like (ABC) DLBCL subtype that is characterized by poor prognosis. A special emphasis is put on findings that might impact therapeutic strategies of affected patients.

Relativistic collective diffusion in one-dimensional systems

Science.gov (United States)

Lin, Gui-Wu; Lam, Yu-Yiu; Zheng, Dong-Qin; Zhong, Wei-Rong

2018-05-01

The relativistic collective diffusion in one-dimensional molecular system is investigated through nonequilibrium molecular dynamics with Monte Carlo methods. We have proposed the relationship among the speed, the temperature, the density distribution and the collective diffusion coefficient of particles in a relativistic moving system. It is found that the relativistic speed of the system has no effect on the temperature, but the collective diffusion coefficient decreases to zero as the velocity of the system approaches to the speed of light. The collective diffusion coefficient is modified as D‧ = D(1 ‑w2 c2 )3 2 for satisfying the relativistic circumstances. The present results may contribute to the understanding of the behavior of the particles transport diffusion in a high speed system, as well as enlighten the study of biological metabolism at relativistic high speed situation.

Role of Rayleigh numbers on characteristics of double diffusive salt fingers

Science.gov (United States)

Rehman, F.; Singh, O. P.

2018-05-01

Double diffusion convection, driven by two constituents of the fluid with different molecular diffusivity, is widely applied in oceanography and large number of other fields like astrophysics, geology, chemistry and metallurgy. In case of ocean, heat (T) and salinity (S) are the two components with varying diffusivity, where heat diffuses hundred times faster than salt. Component (T) stabilizes the system whereas components (S) destabilizes the system with overall density remains stable and forms the rising and sinking fingers known as salt fingers. Recent observations suggest that salt finger characteristics such as growth rates, wavenumber, and fluxes are strongly depending on the Rayleigh numbers as major driving force. In this paper, we corroborate this observation with the help of experiments, numerical simulations and linear theory. An eigenvalue expression for growth rate is derived from the linearized governing equations with explicit dependence on Rayleigh numbers, density stability ratio, Prandtl number and diffusivity ratio. Expressions for fastest growing fingers are also derived as a function various non-dimensional parameter. The predicted results corroborate well with the data reported from the field measurements, experiments and numerical simulations.

Local Group dSph radio survey with ATCA - II. Non-thermal diffuse emission

Science.gov (United States)

Regis, Marco; Richter, Laura; Colafrancesco, Sergio; Profumo, Stefano; de Blok, W. J. G.; Massardi, Marcella

2015-04-01

Our closest neighbours, the Local Group dwarf spheroidal (dSph) galaxies, are extremely quiescent and dim objects, where thermal and non-thermal diffuse emissions lack, so far, of detection. In order to possibly study the dSph interstellar medium, deep observations are required. They could reveal non-thermal emissions associated with the very low level of star formation, or to particle dark matter annihilating or decaying in the dSph halo. In this work, we employ radio observations of six dSphs, conducted with the Australia Telescope Compact Array in the frequency band 1.1-3.1 GHz, to test the presence of a diffuse component over typical scales of few arcmin and at an rms sensitivity below 0.05 mJy beam-1. We observed the dSph fields with both a compact array and long baselines. Short spacings led to a synthesized beam of about 1 arcmin and were used for the extended emission search. The high-resolution data mapped background sources, which in turn were subtracted in the short-baseline maps, to reduce their confusion limit. We found no significant detection of a diffuse radio continuum component. After a detailed discussion on the modelling of the cosmic ray (CR) electron distribution and on the dSph magnetic properties, we present bounds on several physical quantities related to the dSphs, such that the total radio flux, the angular shape of the radio emissivity, the equipartition magnetic field, and the injection and equilibrium distributions of CR electrons. Finally, we discuss the connection to far-infrared and X-ray observations.

Hydroxide diffuses slower than hydronium in water because its solvated structure inhibits correlated proton transfer

Science.gov (United States)

Chen, Mohan; Zheng, Lixin; Santra, Biswajit; Ko, Hsin-Yu; DiStasio, Robert A., Jr.; Klein, Michael L.; Car, Roberto; Wu, Xifan

2018-03-01

Proton transfer via hydronium and hydroxide ions in water is ubiquitous. It underlies acid-base chemistry, certain enzyme reactions, and even infection by the flu. Despite two centuries of investigation, the mechanism underlying why hydroxide diffuses slower than hydronium in water is still not well understood. Herein, we employ state-of-the-art density-functional-theory-based molecular dynamics—with corrections for non-local van der Waals interactions, and self-interaction in the electronic ground state—to model water and hydrated water ions. At this level of theory, we show that structural diffusion of hydronium preserves the previously recognized concerted behaviour. However, by contrast, proton transfer via hydroxide is less temporally correlated, due to a stabilized hypercoordination solvation structure that discourages proton transfer. Specifically, the latter exhibits non-planar geometry, which agrees with neutron-scattering results. Asymmetry in the temporal correlation of proton transfer leads to hydroxide diffusing slower than hydronium.

Coupled radiative transfer equation and diffusion approximation model for photon migration in turbid medium with low-scattering and non-scattering regions

International Nuclear Information System (INIS)

Tarvainen, Tanja; Vauhkonen, Marko; Kolehmainen, Ville; Arridge, Simon R; Kaipio, Jari P

2005-01-01

In this paper, a coupled radiative transfer equation and diffusion approximation model is extended for light propagation in turbid medium with low-scattering and non-scattering regions. The light propagation is modelled with the radiative transfer equation in sub-domains in which the assumptions of the diffusion approximation are not valid. The diffusion approximation is used elsewhere in the domain. The two equations are coupled through their boundary conditions and they are solved simultaneously using the finite element method. The streamline diffusion modification is used to avoid the ray-effect problem in the finite element solution of the radiative transfer equation. The proposed method is tested with simulations. The results of the coupled model are compared with the finite element solutions of the radiative transfer equation and the diffusion approximation and with results of Monte Carlo simulation. The results show that the coupled model can be used to describe photon migration in turbid medium with low-scattering and non-scattering regions more accurately than the conventional diffusion model

Management of diffuse low-grade gliomas in adults - use of molecular diagnostics.

Science.gov (United States)

Buckner, Jan; Giannini, Caterina; Eckel-Passow, Jeanette; Lachance, Daniel; Parney, Ian; Laack, Nadia; Jenkins, Robert

2017-06-01

Diffuse WHO grade II gliomas are histologically and genetically heterogeneous. The 2016 WHO classification redefines grade II gliomas with respect to morphological and molecular tumour alterations: grade II oligodendrogliomas are defined by the presence of whole-arm codeletion in chromosomal arms 1p/19q, whereas isocitrate dehydrogenase (IDH) mutations define subclasses of astrocytoma. Although histological grade remains useful, the prognoses of patients with glioma are more tightly associated with molecular alterations than with grade, and chromosomal and gene array technologies are becoming increasingly beneficial in understanding tumour genetic heterogeneity. The indolent nature of the disease often creates subtle neurological symptoms that can be overlooked or misunderstood, resulting in delayed diagnosis. Seizures often herald the diagnosis, especially in patients who have IDH mutations, which are associated with an increased production of 2-hydroxyglutarate. Treatment paradigms have shifted, owing to new diagnostic criteria and new clinical trial evidence. Patients benefit more from chemoradiation than radiation alone, especially those with tumour IDH1 Arg132His mutations; gross total resection of the tumour, including tumours with IDH mutations, is associated with prolonged survival. Initial observation remains appropriate in patients whose rate of disease growth is not yet completely defined; such patients could include those with completely resected disease and those with 1p/19q codeleted tumours.

Local fractional variational iteration algorithm iii for the diffusion model associated with non-differentiable heat transfer