Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil.

Science.gov (United States)

Ribeiro, Thuanne Pires; Arraes, Fabricio Barbosa Monteiro; Lourenço-Tessutti, Isabela Tristan; Silva, Marilia Santos; Lisei-de-Sá, Maria Eugênia; Lucena, Wagner Alexandre; Macedo, Leonardo Lima Pepino; Lima, Janaina Nascimento; Santos Amorim, Regina Maria; Artico, Sinara; Alves-Ferreira, Márcio; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-08-01

Genetically modified (GM) cotton plants that effectively control cotton boll weevil (CBW), which is the most destructive cotton insect pest in South America, are reported here for the first time. This work presents the successful development of a new GM cotton with high resistance to CBW conferred by Cry10Aa toxin, a protein encoded by entomopathogenic Bacillus thuringiensis (Bt) gene. The plant transformation vector harbouring cry10Aa gene driven by the cotton ubiquitination-related promoter uceA1.7 was introduced into a Brazilian cotton cultivar by biolistic transformation. Quantitative PCR (qPCR) assays revealed high transcription levels of cry10Aa in both T 0 GM cotton leaf and flower bud tissues. Southern blot and qPCR-based 2 -ΔΔCt analyses revealed that T 0 GM plants had either one or two transgene copies. Quantitative and qualitative analyses of Cry10Aa protein expression showed variable protein expression levels in both flower buds and leaves tissues of T 0 GM cotton plants, ranging from approximately 3.0 to 14.0 μg g -1 fresh tissue. CBW susceptibility bioassays, performed by feeding adults and larvae with T 0 GM cotton leaves and flower buds, respectively, demonstrated a significant entomotoxic effect and a high level of CBW mortality (up to 100%). Molecular analysis revealed that transgene stability and entomotoxic effect to CBW were maintained in T 1 generation as the Cry10Aa toxin expression levels remained high in both tissues, ranging from 4.05 to 19.57 μg g -1 fresh tissue, and the CBW mortality rate remained around 100%. In conclusion, these Cry10Aa GM cotton plants represent a great advance in the control of the devastating CBW insect pest and can substantially impact cotton agribusiness. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Spatio Temporal Expression Pattern of an Insecticidal Gene (cry2A in Transgenic Cotton Lines

Directory of Open Access Journals (Sweden)

Allah BAKHSH

2012-11-01

Full Text Available The production of transgenic plants with stable, high-level transgene expression is important for the success of crop improvement programs based on genetic engineering. The present study was conducted to evaluate genomic integration and spatio temporal expression of an insecticidal gene (cry2A in pre-existing transgenic lines of cotton. Genomic integration of cry2A was evaluated using various molecular approaches. The expression levels of cry2A were determined at vegetative and reproductive stages of cotton at regular intervals. These lines showed a stable integration of insecticidal gene in advance lines of transgenic cotton whereas gene expression was found variable with at various growth stages as well as in different plant parts throughout the season. The leaves of transgenic cotton were found to have maximum expression of cry2A gene followed by squares, bolls, anthers and petals. The protein level in fruiting part was less as compared to other parts showing inconsistency in gene expression. It was concluded that for culturing of transgenic crops, strategies should be developed to ensure the foreign genes expression efficient, consistent and in a predictable manner.

Identification of top-down forces regulating cotton aphid population growth in transgenic Bt cotton in central China.

Directory of Open Access Journals (Sweden)

Peng Han

Full Text Available The cotton aphid Aphis gossypii Glover is the main aphid pest in cotton fields in the Yangtze River Valley Cotton-planting Zone (YRZ in central China. Various natural enemies may attack the cotton aphid in Bt cotton fields but no studies have identified potential specific top-down forces that could help manage this pest in the YRZ in China. In order to identify possibilities for managing the cotton aphid, we monitored cotton aphid population dynamics and identified the effect of natural enemies on cotton aphid population growth using various exclusion cages in transgenic Cry1Ac (Bt+CpTI (Cowpea trypsin inhibitor cotton field in 2011. The aphid population growth in the open field (control was significantly lower than those protected or restricted from exposure to natural enemies in the various exclusion cage types tested. The ladybird predator Propylaea japonica Thunberg represented 65% of Coccinellidae predators, and other predators consisted mainly of syrphids (2.1% and spiders (1.5%. The aphid parasitoids Aphidiines represented 76.7% of the total count of the natural enemy guild (mainly Lysiphlebia japonica Ashmead and Binodoxys indicus Subba Rao & Sharma. Our results showed that P. japonica can effectively delay the establishment and subsequent population growth of aphids during the cotton growing season. Aphidiines could also reduce aphid density although their impact may be shadowed by the presence of coccinellids in the open field (likely both owing to resource competition and intraguild predation. The implications of these results are discussed in a framework of the compatibility of transgenic crops and top-down forces exerted by natural enemy guild.

Effects of Elevated Carbon Dioxide on the Growth and Foliar Chemistry of Transgenic Bt Cotton

Institute of Scientific and Technical Information of China (English)

Gang Wu; Fa-Jun Chen; Feng Ge; Yu-Cheng Sun

2007-01-01

A field study was carried out to quantify plant growth and the foliar chemistry of transgenic Bacillus thuringiensis (Bt)cotton (cv. GK-12) exposed to ambient CO2 and elevated (double-ambient) CO2 for different lengths of time (1, 2 and 3 months) in 2004 and 2005. The results indicated that CO2 levels significantly affected plant height, leaf area per plant and leaf chemistry of transgenic Bt cotton. Significantly, higher plant height and leaf area per plant were observed after cotton plants that were grown in elevated CO2 were compared with plants grown in ambient CO2 for 1, 2 and 3 months in the investigation. Simultaneously, significant interaction between CO2 level x investigating year was observed in leaf area per plant. Moreover, foliar total amino acids were increased by 14%, 13%, 11% and 12%, 14%, 10% in transgenic Bt cotton after exposed to elevated CO2 for 1, 2 or 3 months compared with ambient CO2 in 2004 and 2005, respectively. Condensed tannin occurrence increased by 17%, 11%, 9% in 2004 and 12%, 11%, 9% in 2005 in transgenic Bt cotton after being exposed to elevated CO2 for 1, 2 or 3 months compared with ambient CO2 for the same time. However, Bt toxin decreased by 3.0%,2.9%, 3.1% and 2.4%, 2.5%, 2.9% in transgenic Bt cotton after exposed to elevated CO2 for 1, 2 or 3months compared with ambient CO2 for same time in 2004 and 2005, respectively. Furthermore, there was prominent interaction on the foliar total amino acids between the CO2 level and the time of cotton plant being exposed to elevated CO2. It is presumed that elevated CO2 can alter the plant growth and hence ultimately the phenotype allocation to foliar chemistical components of transgenic Bt cotton, which may in turn, affect the plant-herbivore interactions.

The halo effect: suppression of pink bollworm on non-Bt cotton by Bt cotton in China.

Directory of Open Access Journals (Sweden)

Peng Wan

Full Text Available In some previously reported cases, transgenic crops producing insecticidal proteins from Bacillus thuringiensis (Bt have suppressed insect pests not only in fields planted with such crops, but also regionally on host plants that do not produce Bt toxins. Here we used 16 years of field data to determine if Bt cotton caused this "halo effect" against pink bollworm (Pectinophora gossypiella in six provinces of the Yangtze River Valley of China. In this region, the percentage of cotton hectares planted with Bt cotton increased from 9% in 2000 to 94% in 2009 and 2010. We found that Bt cotton significantly decreased the population density of pink bollworm on non-Bt cotton, with net decreases of 91% for eggs and 95% for larvae on non-Bt cotton after 11 years of Bt cotton use. Insecticide sprays targeting pink bollworm and cotton bollworm (Helicoverpa armigera decreased by 69%. Previously reported evidence of the early stages of evolution of pink bollworm resistance to Bt cotton in China has raised concerns that if unchecked, such resistance could eventually diminish or eliminate the benefits of Bt cotton. The results reported here suggest that it might be possible to find a percentage of Bt cotton lower than the current level that causes sufficient regional pest suppression and reduces the risk of resistance.

Gone with transgenic cotton cropping in the USA. A perception of the presentations and interactions at the Beltwide Cotton Conferences, New Orleans (Louisiana, USA, 4-7/01/2010

Directory of Open Access Journals (Sweden)

Fok, M.

2011-01-01

Full Text Available The 2010 Beltwide Cotton Conferences provided a new vision of the consequences of about 15 years of widespread and uncoordinated cropping of transgenic cotton in the United States. Insect-resistant and/or herbicide-tolerant cotton varieties modified parasite complexes, namely those of insects and weeds damaging cotton crops. The Conferences have revealed that the adaptation solutions so far proposed make illusory the expectations at the launch of transgenic cotton, in terms of effective pest control, cost reduction, and antagonism between chemical and biotech methods. The USA case points out that the technical and economic sustainability of transgenic varieties must lie in a systemic and coordinated approach.

Assessment of Bollgard II cotton pollen mediated transgenes flow to ...

African Journals Online (AJOL)

INERA05

2013-08-14

Aug 14, 2013 ... insects such as honey bees, bumble bees and butterflies. Genetic materials ... cotton fields separated from the transgenes source by wide open space. In Boni ..... Breeding: new strategies in plant improvement. International ...

Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

Science.gov (United States)

Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

2013-01-01

Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

Early warning of cotton bollworm resistance associated with intensive planting of Bt cotton in China.

Directory of Open Access Journals (Sweden)

Haonan Zhang

Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins kill some key insect pests, but evolution of resistance by pests can reduce their efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to promote survival of susceptible pests. To delay pest resistance to transgenic cotton producing Bt toxin Cry1Ac, farmers in the United States and Australia planted refuges of non-Bt cotton, while farmers in China have relied on "natural" refuges of non-Bt host plants other than cotton. Here we report data from a 2010 survey showing field-evolved resistance to Cry1Ac of the major target pest, cotton bollworm (Helicoverpa armigera, in northern China. Laboratory bioassay results show that susceptibility to Cry1Ac was significantly lower in 13 field populations from northern China, where Bt cotton has been planted intensively, than in two populations from sites in northwestern China where exposure to Bt cotton has been limited. Susceptibility to Bt toxin Cry2Ab did not differ between northern and northwestern China, demonstrating that resistance to Cry1Ac did not cause cross-resistance to Cry2Ab, and implying that resistance to Cry1Ac in northern China is a specific adaptation caused by exposure to this toxin in Bt cotton. Despite the resistance detected in laboratory bioassays, control failures of Bt cotton have not been reported in China. This early warning may spur proactive countermeasures, including a switch to transgenic cotton producing two or more toxins distinct from Cry1A toxins.

Engineering cotton (Gossypium hirsutum L.) for resistance to cotton leaf curl disease using viral truncated AC1 DNA sequences.

Science.gov (United States)

Hashmi, Jamil A; Zafar, Yusuf; Arshad, Muhammad; Mansoor, Shahid; Asad, Shaheen

2011-04-01

Several important biological processes are performed by distinct functional domains found on replication-associated protein (Rep) encoded by AC1 of geminiviruses. Two truncated forms of replicase (tAC1) gene, capable of expressing only the N-terminal 669 bp (5'AC1) and C-terminal 783 bp (3'AC1) nucleotides cloned under transcriptional control of the CaMV35S were introduced into cotton (Gossypium hirsutum L.) using LBA4404 strain of Agrobacterium tumefaciens to make use of an interference strategy for impairing cotton leaf curl virus (CLCuV) infection in transgenic cotton. Compared with nontransformed control, we observed that transgenic cotton plants overexpressing either N-terminal (5'AC1) or C-terminal (3'AC1) sequences confer resistance to CLCuV by inhibiting replication of viral genomic and β satellite DNA components. Molecular analysis by Northern blot hybridization revealed high transgene expression in early and late growth stages associated with inhibition of CLCuV replication. Of the eight T(1) transgenic lines tested, six had delayed and minor symptoms as compared to nontransformed control lines which developed disease symptoms after 2-3 weeks of whitefly-mediated viral delivery. Virus biological assay and growth of T(2) plants proved that transgenic cotton plants overexpressing 5'- and 3'AC1 displayed high resistance level up to 72, 81%, respectively, as compared to non-transformed control plants following inoculation with viruliferous whiteflies giving significantly high cotton seed yield. Progeny analysis of these plants by polymerase chain reaction (PCR), Southern blotting and virus biological assay showed stable transgene, integration, inheritance and cotton leaf curl disease (CLCuD) resistance in two of the eight transgenic lines having single or two transgene insertions. Transgenic cotton expressing partial AC1 gene of CLCuV can be used as virus resistance source in cotton breeding programs aiming to improve virus resistance in cotton crop.

Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line using 18S and ITS rDNA Sequences over Four Seasons

Directory of Open Access Journals (Sweden)

Xiemin Qi

2016-07-01

Full Text Available Long-term growth of genetically modified plants (GMPs has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S and region II (ITS1, 5.8S and ITS2 rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10 and 15-year plantation of various transgenic cotton cultivars (TC-15mix over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC were also compared. No notable differences were observed in soil fertility variables among CC, TC-10 and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.

Overexpression of a cotton (Gossypium hirsutum) WRKY gene, GhWRKY34, in Arabidopsis enhances salt-tolerance of the transgenic plants.

Science.gov (United States)

Zhou, Li; Wang, Na-Na; Gong, Si-Ying; Lu, Rui; Li, Yang; Li, Xue-Bao

2015-11-01

Soil salinity is one of the most serious threats in world agriculture, and often influences cotton growth and development, resulting in a significant loss in cotton crop yield. WRKY transcription factors are involved in plant response to high salinity stress, but little is known about the role of WRKY transcription factors in cotton so far. In this study, a member (GhWRKY34) of cotton WRKY family was functionally characterized. This protein containing a WRKY domain and a zinc-finger motif belongs to group III of cotton WRKY family. Subcellular localization assay indicated that GhWRKY34 is localized to the cell nucleus. Overexpression of GhWRKY34 in Arabidopsis enhanced the transgenic plant tolerance to salt stress. Several parameters (such as seed germination, green cotyledons, root length and chlorophyll content) in the GhWRKY34 transgenic lines were significantly higher than those in wild type under NaCl treatment. On the contrary, the GhWRKY34 transgenic plants exhibited a substantially lower ratio of Na(+)/K(+) in leaves and roots dealing with salt stress, compared with wild type. Growth status of the GhWRKY34 transgenic plants was much better than that of wild type under salt stress. Expressions of the stress-related genes were remarkably up-regulated in the transgenic plants under salt stress, compared with those in wild type. Based on the data presented in this study, we hypothesize that GhWRKY34 as a positive transcription regulator may function in plant response to high salinity stress through maintaining the Na(+)/K(+) homeostasis as well as activating the salt stress-related genes in cells. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Environmental effect of conventional and GM crops of cotton (Gossipium hirsitum L. and corn (Zea mays L.

Directory of Open Access Journals (Sweden)

Kelly Ávila

2011-12-01

Full Text Available In the corn belt of Valle de San Juan and in the cotton zone of El Espinal, municipalities in the department of Tolima (Colombia, 10 conventional corn producers, 10 producers of genetically modified corn, five producers of conventional cotton and 15 producers of transgenic cotton were surveyed in the first half of 2009 to contrast the differences in the environmental impact associated with use of insecticides and herbicides, which were evaluated by estimating the environmental index quotient-EIQ. In the case of maize, an EIQ of 42 was found in the conventional type, while transgenic technology had an EIQ of 3.03. In the cultivation of cotton, an EIQ of 263.59 was found for the conventional type while for transgenic technology this value varied between 335.75 (Nuopal BG/RR and 324.79 (DP 455 BG/RR. These data showed a lower environmental impact using GM technology in the cultivation of maize when compared to the conventional counterpart, in connection with the use of insecticides and herbicides, in the context of time, space and genotypic analysis. This effect was not observed in the case of cotton, where environmental impacts were similar

Overexpression of cotton RAV1 gene in Arabidopsis confers transgenic plants high salinity and drought sensitivity.

Science.gov (United States)

Li, Xiao-Jie; Li, Mo; Zhou, Ying; Hu, Shan; Hu, Rong; Chen, Yun; Li, Xue-Bao

2015-01-01

RAV (related to ABI3/VP1) protein containing an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which belongs to AP2 transcription factor family, is unique in higher plants. In this study, a gene (GhRAV1) encoding a RAV protein of 357 amino acids was identified in cotton (Gossypium hirsutum). Transient expression analysis of the eGFP:GhRAV1 fusion genes in tobacco (Nicotiana tabacum) epidermal cells revealed that GhRAV1 protein was localized in the cell nucleus. Quantitative RT-PCR analysis indicated that expression of GhRAV1 in cotton is induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Overexpression of GhRAV1 in Arabidopsis resulted in plant sensitive to ABA, NaCl and PEG. With abscisic acid (ABA) treatment, seed germination and green seedling rates of the GhRAV1 transgenic plants were remarkably lower than those of wild type. In the presence of NaCl, the seed germination and seedling growth of the GhRAV1 transgenic lines were inhibited greater than those of wild type. And chlorophyll content and maximum photochemical efficiency of the transgenic plants were significantly lower than those of wild type. Under drought stress, the GhRAV1 transgenic plants displayed more severe wilting than wild type. Furthermore, expressions of the stress-related genes were altered in the GhRAV1 transgenic Arabidopsis plants under high salinity and drought stresses. Collectively, our data suggested that GhRAV1 may be involved in response to high salinity and drought stresses through regulating expressions of the stress-related genes during cotton development.

Cotton transformation via pollen tube pathway.

Science.gov (United States)

Wang, Min; Zhang, Baohong; Wang, Qinglian

2013-01-01

Although many gene transfer methods have been employed for successfully obtaining transgenic cotton, the major constraint in cotton improvement is the limitation of genotype because the majority of transgenic methods require plant regeneration from a single transformed cell which is limited by cotton tissue culture. Comparing with other plant species, it is difficult to induce plant regeneration from cotton; currently, only a limited number of cotton cultivars can be cultured for obtaining regenerated plants. Thus, development of a simple and genotype-independent genetic transformation method is particularly important for cotton community. In this chapter, we present a simple, cost-efficient, and genotype-independent cotton transformation method-pollen tube pathway-mediated transformation. This method uses pollen tube pathway to deliver transgene into cotton embryo sacs and then insert foreign genes into cotton genome. There are three major steps for pollen tube pathway-mediated genetic transformation, which include injection of -foreign genes into pollen tube, integration of foreign genes into plant genome, and selection of transgenic plants.

Effects of Soil Salinity on the Expression of Bt Toxin (Cry1Ac and the Control Efficiency of Helicoverpa armigera in Field-Grown Transgenic Bt Cotton.

Directory of Open Access Journals (Sweden)

Jun-Yu Luo

Full Text Available An increasing area of transgenic Bacillus thuringiensis (Bt cotton is being planted in saline-alkaline soil in China. The Bt protein level in transgenic cotton plants and its control efficiency can be affected by abiotic stress, including high temperature, water deficiency and other factors. However, how soil salinity affects the expression of Bt protein, thus influencing the control efficiency of Bt cotton against the cotton bollworm (CBW Helicoverpa armigera (Hübner in the field, is poorly understood. Our objective in the present study was to investigate the effects of soil salinity on the expression of Bt toxin (Cry1Ac and the control efficiency of Helicoverpa armigera in field-grown transgenic Bt cotton using three natural saline levels (1.15 dS m-1 [low soil-salinity], 6.00 dS m-1 [medium soil-salinity] and 11.46 dS m-1 [high soil-salinity]. We found that the Bt protein content in the transgenic Bt cotton leaves and the insecticidal activity of Bt cotton against CBW decreased with the increasing soil salinity in laboratory experiments during the growing season. The Bt protein content of Bt cotton leaves in the laboratory were negatively correlated with the salinity level. The CBW populations were highest on the Bt cotton grown in medium-salinity soil instead of the high-salinity soil in field conditions. A possible mechanism may be that the relatively high-salinity soil changed the plant nutritional quality or other plant defensive traits. The results from this study may help to identify more appropriate practices to control CBW in Bt cotton fields with different soil salinity levels.

High Expression of Cry1Ac Protein in Cotton (Gossypium hirsutum by Combining Independent Transgenic Events that Target the Protein to Cytoplasm and Plastids.

Directory of Open Access Journals (Sweden)

Amarjeet Kumar Singh

Full Text Available Transgenic cotton was developed using two constructs containing a truncated and codon-modified cry1Ac gene (1,848 bp, which was originally characterized from Bacillus thuringiensis subspecies kurstaki strain HD73 that encodes a toxin highly effective against many lepidopteran pests. In Construct I, the cry1Ac gene was cloned under FMVde, a strong constitutively expressing promoter, to express the encoded protein in the cytoplasm. In Construct II, the encoded protein was directed to the plastids using a transit peptide taken from the cotton rbcSIb gene. Genetic transformation experiments with Construct I resulted in a single copy insertion event in which the Cry1Ac protein expression level was 2-2.5 times greater than in the Bacillus thuringiensis cotton event Mon 531, which is currently used in varieties and hybrids grown extensively in India and elsewhere. Another high expression event was selected from transgenics developed with Construct II. The Cry protein expression resulting from this event was observed only in the green plant parts. No transgenic protein expression was observed in the non-green parts, including roots, seeds and non-green floral tissues. Thus, leucoplasts may lack the mechanism to allow entry of a protein tagged with the transit peptide from a protein that is only synthesized in tissues containing mature plastids. Combining the two events through sexual crossing led to near additive levels of the toxin at 4-5 times the level currently used in the field. The two high expression events and their combination will allow for effective resistance management against lepidopteran insect pests, particularly Helicoverpa armigera, using a high dosage strategy.

ptxD gene in combination with phosphite serves as a highly effective selection system to generate transgenic cotton (Gossypium hirsutum L.).

Science.gov (United States)

Pandeya, Devendra; Campbell, LeAnne M; Nunes, Eugenia; Lopez-Arredondo, Damar L; Janga, Madhusudhana R; Herrera-Estrella, Luis; Rathore, Keerti S

2017-12-01

This report demonstrates the usefulness of ptxD/phosphite as a selection system that not only provides a highly efficient and simple means to generate transgenic cotton plants, but also helps address many of the concerns related to the use of antibiotic and herbicide resistance genes in the production of transgenic crops. Two of the most popular dominant selectable marker systems for plant transformation are based on either antibiotic or herbicide resistance genes. Due to concerns regarding their safety and in order to stack multiple traits in a single plant, there is a need for alternative selectable marker genes. The ptxD gene, derived from Pseudomonas stutzeri WM88, that confers to cells the ability to convert phosphite (Phi) into orthophosphate (Pi) offers an alternative selectable marker gene as demonstrated for tobacco and maize. Here, we show that the ptxD gene in combination with a protocol based on selection medium containing Phi, as the sole source of phosphorus (P), can serve as an effective and efficient system to select for transformed cells and generate transgenic cotton plants. Fluorescence microscopy examination of the cultures under selection and molecular analyses on the regenerated plants demonstrate the efficacy of the system in recovering cotton transformants following Agrobacterium-mediated transformation. Under the ptxD/Phi selection, an average of 3.43 transgenic events per 100 infected explants were recovered as opposed to only 0.41% recovery when bar/phosphinothricin (PPT) selection was used. The event recovery rates for nptII/kanamycin and hpt/hygromycin systems were 2.88 and 2.47%, respectively. Molecular analysis on regenerated events showed a selection efficiency of ~ 97% under the ptxD/Phi system. Thus, ptxD/Phi has proven to be a very efficient, positive selection system for the generation of transgenic cotton plants with equal or higher transformation efficiencies compared to the commonly used, negative selection systems.

Transgenic cotton coexpressing Vip3A and Cry1Ac has a broad insecticidal spectrum against lepidopteran pests.

Science.gov (United States)

Chen, Wen-Bo; Lu, Guo-Qing; Cheng, Hong-Mei; Liu, Chen-Xi; Xiao, Yu-Tao; Xu, Chao; Shen, Zhi-Cheng; Wu, Kong-Ming

2017-10-01

Although farmers in China have grown transgenic Bt-Cry1Ac cotton to resist the major pest Helicoverpa armigera since 1997 with great success, many secondary lepidopteran pests that are tolerant to Cry1Ac are now reported to cause considerable economic damage. Vip3AcAa, a chimeric protein with the N-terminal part of Vip3Ac and the C-terminal part of Vip3Aa, has a broad insecticidal spectrum against lepidopteran pests and has no cross resistance to Cry1Ac. In the present study, we tested insecticidal activities of Vip3AcAa against Spodoptera litura, Spodoptera exigua, and Agrotis ipsilon, which are relatively tolerant to Cry1Ac proteins. The bioassay results showed that insecticidal activities of Vip3AcAa against these three pests are superior to Cry1Ac, and after an activation pretreatment, Vip3AcAa retained insecticidal activity against S. litura, S. exigua and A. ipsilon that was similar to the unprocessed protein. The putative receptor for this chimeric protein in the brush border membrane vesicle (BBMV) in the three pests was also identified using biotinylated Vip3AcAa toxin. To broaden Bt cotton activity against a wider spectrum of pests, we introduced the vip3AcAa and cry1Ac genes into cotton. Larval mortality rates for S. litura, A. ipsilon and S. exigua that had fed on this new cotton increased significantly compared with larvae fed on non-Bt cotton and Bt-Cry1Ac cotton in a laboratory experiment. These results suggested that the Vip3AcAa protein is an excellent option for a "pyramid" strategy for integrated pest management in China. Copyright © 2017 Elsevier Inc. All rights reserved.

Recent long-distance transgene flow into wild populations conforms to historical patterns of gene flow in cotton (Gossypium hirsutum) at its centre of origin.

Science.gov (United States)

Wegier, A; Piñeyro-Nelson, A; Alarcón, J; Gálvez-Mariscal, A; Alvarez-Buylla, E R; Piñero, D

2011-10-01

Over 95% of the currently cultivated cotton was domesticated from Gossypium hirsutum, which originated and diversified in Mexico. Demographic and genetic studies of this species at its centre of origin and diversification are lacking, although they are critical for cotton conservation and breeding. We investigated the actual and potential distribution of wild cotton populations, as well as the contribution of historical and recent gene flow in shaping cotton genetic diversity and structure. We evaluated historical gene flow using chloroplast microsatellites and recent gene flow through the assessment of transgene presence in wild cotton populations, exploiting the fact that genetically modified cotton has been planted in the North of Mexico since 1996. Assessment of geographic structure through Bayesian spatial analysis, BAPS and Genetic Algorithm for Rule-set Production (GARP), suggests that G. hirsutum seems to conform to a metapopulation scheme, with eight distinct metapopulations. Despite evidence for long-distance gene flow, genetic variation among the metapopulations of G. hirsutum is high (He = 0.894 ± 0.01). We identified 46 different haplotypes, 78% of which are unique to a particular metapopulation, in contrast to a single haplotype detected in cotton cultivars. Recent gene flow was also detected (m = 66/270 = 0.24), with four out of eight metapopulations having transgenes. We discuss the implications of the data presented here with respect to the conservation and future breeding of cotton populations and genetic diversity at its centre of crop origin. © 2011 Blackwell Publishing Ltd.

Energy budgeting and carbon footprint of transgenic cotton-wheat production system through peanut intercropping and FYM addition.

Science.gov (United States)

Singh, Raman Jeet; Ahlawat, I P S

2015-05-01

Two of the most pressing sustainability issues are the depletion of fossil energy resources and the emission of atmospheric green house gases like carbon dioxide to the atmosphere. The aim of this study was to assess energy budgeting and carbon footprint in transgenic cotton-wheat cropping system through peanut intercropping with using 25-50% substitution of recommended dose of nitrogen (RDN) of cotton through farmyard manure (FYM) along with 100% RDN through urea and control (0 N). To quantify the residual effects of previous crops and their fertility levels, a succeeding crop of wheat was grown with varying rates of nitrogen, viz. 0, 50, 100, and 150 kg ha(-1). Cotton + peanut-wheat cropping system recorded 21% higher system productivity which ultimately helped to maintain higher net energy return (22%), energy use efficiency (12%), human energy profitability (3%), energy productivity (7%), carbon outputs (20%), carbon efficiency (17%), and 11% lower carbon footprint over sole cotton-wheat cropping system. Peanut addition in cotton-wheat system increased the share of renewable energy inputs from 18 to 21%. With substitution of 25% RDN of cotton through FYM, share of renewable energy resources increased in the range of 21% which resulted into higher system productivity (4%), net energy return (5%), energy ratio (6%), human energy profitability (74%), energy productivity (6%), energy profitability (5%), and 5% lower carbon footprint over no substitution. The highest carbon footprint (0.201) was recorded under control followed by 50 % substitution of RDN through FYM (0.189). With each successive increase in N dose up to 150 kg N ha(-1) to wheat, energy productivity significantly reduced and share of renewable energy inputs decreased from 25 to 13%. Application of 100 kg N ha(-1) to wheat maintained the highest grain yield (3.71 t ha(-1)), net energy return (105,516 MJ ha(-1)), and human energy profitability (223.4) over other N doses applied to wheat

No evidence for change in oviposition behaviour of Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) after widespread adoption of transgenic insecticidal cotton.

Science.gov (United States)

Zalucki, M P; Cunningham, J P; Downes, S; Ward, P; Lange, C; Meissle, M; Schellhorn, N A; Zalucki, J M

2012-08-01

Cotton growing landscapes in Australia have been dominated by dual-toxin transgenic Bt varieties since 2004. The cotton crop has thus effectively become a sink for the main target pest, Helicoverpa armigera. Theory predicts that there should be strong selection on female moths to avoid laying on such plants. We assessed oviposition, collected from two cotton-growing regions, by female moths when given a choice of tobacco, cotton and cabbage. Earlier work in the 1980s and 1990s on populations from the same geographic locations indicated these hosts were on average ranked as high, mid and low preference plants, respectively, and that host rankings had a heritable component. In the present study, we found no change in the relative ranking of hosts by females, with most eggs being laid on tobacco, then cotton and least on cabbage. As in earlier work, some females laid most eggs on cotton and aspects of oviposition behaviour had a heritable component. Certainly, cotton is not avoided as a host, and the implications of these finding for managing resistance to Bt cotton are discussed.

Effect of Iranian Bt cotton on life table of Bemisia tabaci (Hemiptera: Alyrodidae and Cry 1Ab detection in the whitefly honeydew

Directory of Open Access Journals (Sweden)

Solmaz Azimi

2016-09-01

Full Text Available Transgenic cotton expressing the Cry 1Ab protein of Bacillus thuringiensis developing against Helocoverpa armigera may be affect on secondary pest such as Bemisia tabaci. In this study effects of Bt cotton on demographic parameters of B. tabaci were assessed and the data analyzed using the age specific, two-sex life table parameters. Results showed that getting to the adulthood stage, was faster on non-Bt cotton in comparison with Bt cotton. Also the fecundity was higher on non-Bt cotton than that on Bt cotton. Some of the population parameters (r, R0 and T of B. tabaci were affected by the Bt cotton significantly. The intrinsic rate of increase (r on Bt and non-Bt cotton was 0.07 day-1 and 0.1 day-1 , respectively. The net reproductive rate (R0 was 20.68 and 15.04 offspring/individual on Bt and non-Bt cotton, respectively. Mean generation time (T in non-Bt cotton was 27.22 and 34.62 days in Bt cotton. The results indicated that the life history of B. tabaci in the laboratory condition was influenced by host plant quality and Bt cotton was not a suitable host for B. tabaci. The western immunoblot method showed that the Cry protein detection in honeydew was positive which indicated that the Cry protein was ingested. Results revealed that the transgenic cotton could adversely affect the secondary pest and the natural enemies which feed on such pests as a host or their honeydew as a food source should be considered.

Rapid characterization of transgenic and non-transgenic soybean oils by chemometric methods using NIR spectroscopy

Science.gov (United States)

Luna, Aderval S.; da Silva, Arnaldo P.; Pinho, Jéssica S. A.; Ferré, Joan; Boqué, Ricard

Near infrared (NIR) spectroscopy and multivariate classification were applied to discriminate soybean oil samples into non-transgenic and transgenic. Principal Component Analysis (PCA) was applied to extract relevant features from the spectral data and to remove the anomalous samples. The best results were obtained when with Support Vectors Machine-Discriminant Analysis (SVM-DA) and Partial Least Squares-Discriminant Analysis (PLS-DA) after mean centering plus multiplicative scatter correction. For SVM-DA the percentage of successful classification was 100% for the training group and 100% and 90% in validation group for non transgenic and transgenic soybean oil samples respectively. For PLS-DA the percentage of successful classification was 95% and 100% in training group for non transgenic and transgenic soybean oil samples respectively and 100% and 80% in validation group for non transgenic and transgenic respectively. The results demonstrate that NIR spectroscopy can provide a rapid, nondestructive and reliable method to distinguish non-transgenic and transgenic soybean oils.

A R2R3-MYB transcription factor that is specifically expressed in cotton (Gossypium hirsutum) fibers affects secondary cell wall biosynthesis and deposition in transgenic Arabidopsis.

Science.gov (United States)

Sun, Xiang; Gong, Si-Ying; Nie, Xiao-Ying; Li, Yang; Li, Wen; Huang, Geng-Qing; Li, Xue-Bao

2015-07-01

Secondary cell wall (SCW) is an important industrial raw material for pulping, papermaking, construction, lumbering, textiles and potentially for biofuel production. The process of SCW thickening of cotton fibers lays down the cellulose that will constitute the bulk (up to 96%) of the fiber at maturity. In this study, a gene encoding a MYB-domain protein was identified in cotton (Gossypium hirsutum) and designated as GhMYBL1. Quantitative real-time polymerase chain reaction (RT-PCR) analysis revealed that GhMYBL1 was specifically expressed in cotton fibers at the stage of secondary wall deposition. Further analysis indicated that this protein is a R2R3-MYB transcription factor, and is targeted to the cell nucleus. Overexpression of GhMYBL1 in Arabidopsis affected the formation of SCW in the stem xylem of the transgenic plants. The enhanced SCW thickening also occurred in the interfascicular fibers, xylary fibers and vessels of the GhMYBL1-overexpression transgenic plants. The expression of secondary wall-associated genes, such as CesA4, CesA7, CesA8, PAL1, F5H and 4CL1, were upregulated, and consequently, cellulose and lignin biosynthesis were enhanced in the GhMYBL1 transgenic plants. These data suggested that GhMYBL1 may participate in modulating the process of secondary wall biosynthesis and deposition of cotton fibers. © 2014 Scandinavian Plant Physiology Society.

Severity of cotton whitefly (bemisia tabaci genn.) population with special reference to abiotic factors

International Nuclear Information System (INIS)

Zia, K.; Bashir, M.H.; Khan, B.S.; Khan, R.R.; Hafeez, F.

2013-01-01

Bemisia tabaci is serious insect and constantly destabilizing the cotton production. The research was conducted to evaluate cotton cultivars (transgenic and non transgenic) for resistance against whitefly and further correlated with weather factors such as temperature, relative humidity and rainfall, during the cropping seasons 2010 and 2011. However, peak population (6.36 per leaf) was recorded from FH-113 followed FH-167 and FH-114, whereas minimum population was recorded from FH-4243 in transgenic group whereas peak population (5.24 per leaf) was recorded from FH- 941 followed by FH-100 and FH- 901 while minimum population was recorded from FH-207, in non transgenic group of cultivars in the year 2010. The incidence and abundance was much high and reaching towards two folds in the year 2011 but the trend of whitefly varied with peak population (11.03 per leaf) recorded from FH -167 followed by FH- 4243 and FH113 (from transgenic group of cultivars) whereas a peak of 10.77 per leaf population of whitefly, recorded followed by FH-901 and FH-941 (from non transgenic group of cultivars). FH-207 found more resistant from all ten cultivars studied in 2011. Correlation among weather factors and whitefly population showed that rainfall was negatively correlated while temperature and relative humidity were positively correlated with whitefly population. In addition to that situation is becoming worse because of shifting from conventional to more advanced transgenic cultivars that are susceptible and serve as host. Moreover, climatic conditions provide addition favor and helps in population buildup, abundance and incidence. (author)

Saussurea involucrata SiDhn2 gene confers tolerance to drought stress in upland cotton

International Nuclear Information System (INIS)

Liu, B.; Zhu, J.; Mu, J.; Zhu, J.; Liang, Z.; Zhang, L.

2017-01-01

Severe water shortage has long been acknowledged as one major limiting factor for global cotton production, and cultivation of cotton varieties with strong drought resistance is of important economic and social significances. In this study, the Xinjiang upland cotton variety Xinluzao 42 was transformed with the SiDhn2 gene by optimized agrobacterium transformation system. The integration of SiDhn2 gene into cotton genome was confirmed by PCR and Southern blot hybridization, and the drought resistance of transgenic and corresponding receptor cotton plants and their physiological indexes under drought stress were detailedly analyzed. Multiple physiological and biochemical indexes including soluble sugar content, free proline content, chlorophyll content, relative water content, net photosynthetic rate, transpiration rate, intercellular CO/sub 2/ concentration in transgenic cotton expressing SiDhn2 gene under drought stress were significantly higher than those of receptor cotton. More importantly, the transgenic cotton plants exhibited remarkably decreased boll abscission rate and highly increased seed yield, indicating the significant role of SiDhn2 gene in cotton drought resistance and its great application potential in agricultural production. (author)

Evaluating potassium-use-efficiency of five cotton genotypes of pakistan

International Nuclear Information System (INIS)

Hassan, Z.U.; Kubar, K.A.

2014-01-01

Potassium (K) deficiency in Pakistani soils has been recently reported as the major limiting factor affecting sustainable cotton production. The present study was conducted to envisage how K nutrition affect the growth, biomass production, yield and K-use-efficiency of five cotton genotypes, NIBGE-3701, NIBGE-1524 (Bt-transgenic), Sadori, Sindh-1 and SAU-2 (non-Bt conventional), commonly grown in Pakistan. All five genotypes were raised at deficient and adequate K levels, i.e. 0 and 60 kg K/sub 2/O ha-1, respectively. The experiment was performed in plastic pots following a completely randomized factorial design with three repeats. Adequate K nutrition significantly increased various plant growth traits and yield of all cotton genotypes under study, viz. number of sympodia (21%), number of leaves (34%), leaf dry biomass (30%), shoot dry biomass (31%), number of bolls (50%) and yield of seed cotton (92%). Substantial variations were observed among cotton genotypes for their K-use-efficiency and K-response-efficiency. Sadori and SAU-2 were screened as most K-use-efficient cotton genotypes, while Sindh-1 and SAU-2 were ranked as the most K-responsive cotton genotypes. Interestingly, Sadori did not respond to K nutrition. Moreover, Bt cotton genotypes accumulated more K as compared to non-Bt genotypes. The cotton genotype SAU-2 was identified as efficient-response genotype for better adaptation for both low- and high-K-input sustainable cotton agriculture systems. (author)

Distribution and Potential Impact of Feral Cotton on the ...

African Journals Online (AJOL)

Transgenic Bt cotton with insecticidal properties presents a potential solution to the bollworm infestation in Tanzania. However, concerns associated with transgenic crops viz.; transgene flow to wild and feral relatives, increased potential for resistance evolution, need to be addressed prior to adoption of any transgenic crop.

Non-cellulosic polysaccharides from cotton fibre are differently impacted by textile processing

DEFF Research Database (Denmark)

Runavot, Jean-Luc; Guo, Xiaoyuan; Willats, William George Tycho

2014-01-01

-cellulosic cotton fibre polysaccharides during different steps of cotton textile processing using GC-MS, HPLC and comprehensive microarray polymer profiling to obtain monosaccharide and polysaccharide amounts and linkage compositions. Additionally, in situ detection was used to obtain information on polysaccharide......Cotton fibre is mainly composed of cellulose, although non-cellulosic polysaccharides play key roles during fibre development and are still present in the harvested fibre. This study aimed at determining the fate of non-cellulosic polysaccharides during cotton textile processing. We analyzed non...... localization and accessibility. We show that pectic and hemicellulosic polysaccharide levels decrease during cotton textile processing and that some processing steps have more impact than others. Pectins and arabinose-containing polysaccharides are strongly impacted by the chemical treatments, with most being...

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Science.gov (United States)

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Soil microflora and enzyme activities in rhizosphere of Transgenic Bt cotton hybrid under different intercropping systems and plant protection schedules

Science.gov (United States)

Biradar, D. P.; Alagawadi, A. R.; Basavanneppa, M. A.; Udikeri, S. S.

2012-04-01

Field experiments were conducted over three rainy seasons of 2005-06 to 2007-08 on a Vertisol at Dharwad, Karnataka, India to study the effect of intercropping and plant protection schedules on productivity, soil microflora and enzyme activities in the rhizosphere of transgenic Bt cotton hybrid. The experiment consisted of four intercropping systems namely, Bt cotton + okra, Bt cotton + chilli, Bt cotton + onion + chilli and Bt cotton + redgram with four plant protection schedules (zero protection, protection for Bt cotton, protection for intercrop and protection for both crops). Observations on microbial populations and enzyme activities were recorded at 45, 90, 135 and 185 (at harvest) days after sowing (DAS). Averaged over years, Bt cotton + okra intercropping had significantly higher total productivity than Bt cotton + chilli and Bt cotton + redgram intercropping system and was similar to Bt cotton + chilli + onion intercropping system. With respect to plant protection schedules for bollworms, protection for both cotton and intercrops recorded significantly higher yield than the rest of the treatments. Population of total bacteria, fungi, actinomycetes, P-solubilizers, free-living N2 fixers as well as urease, phosphatase and dehydrogenase enzyme activities increased up to 135 days of crop growth followed by a decline. Among the intercropping systems, Bt cotton + chilli recorded significantly higher population of microorganisms and enzyme activities than other cropping systems. While Bt cotton with okra as intercrop recorded the least population of total bacteria and free-living N2 fixers as well as urease activity. Intercropping with redgram resulted in the least population of actinomycetes, fungi and P-solubilizers, whereas Bt cotton with chilli and onion recorded least activities of dehydrogenase and phosphatase. Among the plant protection schedules, zero protection recorded maximum population of microorganisms and enzyme activities. This was followed by the

The phosphatidylinositol synthase gene (GhPIS) contributes to longer, stronger, and finer fibers in cotton.

Science.gov (United States)

Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan

2018-05-11

Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.

Fitness of Bt-resistant cabbage loopers on Bt cotton plants.

Science.gov (United States)

Tetreau, Guillaume; Wang, Ran; Wang, Ping

2017-10-01

Development of resistance to the insecticidal toxins from Bacillus thuringiensis (Bt) in insects is the major threat to the continued success of transgenic Bt crops in agriculture. The fitness of Bt-resistant insects on Bt and non-Bt plants is a key parameter that determines the development of Bt resistance in insect populations. In this study, a comprehensive analysis of the fitness of Bt-resistant Trichoplusia ni strains on Bt cotton leaves was conducted. The Bt-resistant T. ni strains carried two genetically independent mechanisms of resistance to Bt toxins Cry1Ac and Cry2Ab. The effects of the two resistance mechanisms, individually and in combination, on the fitness of the T. ni strains on conventional non-Bt cotton and on transgenic Bt cotton leaves expressing a single-toxin Cry1Ac (Bollgard I) or two Bt toxins Cry1Ac and Cry2Ab (Bollgard II) were examined. The presence of Bt toxins in plants reduced the fitness of resistant insects, indicated by decreased net reproductive rate (R 0 ) and intrinsic rate of increase (r). The reduction in fitness in resistant T. ni on Bollgard II leaves was greater than that on Bollgard I leaves. A 12.4-day asynchrony of adult emergence between the susceptible T. ni grown on non-Bt cotton leaves and the dual-toxin-resistant T. ni on Bollgard II leaves was observed. Therefore, multitoxin Bt plants not only reduce the probability for T. ni to develop resistance but also strongly reduce the fitness of resistant insects feeding on the plants. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Inheritance and segregation of exogenous genes in transgenic cotton

Indian Academy of Sciences (India)

1Key Laboratory of Cotton Genetic Improvement of the Ministry of Agriculture, Cotton Research Institute, Chinese. Academy of Agricultural Sciences, Anyang Henan 455 112, People's Republic of China. 2Institute ..... Athens, Greece. Xie D. X. ...

Gibberellin overproduction promotes sucrose synthase expression and secondary cell wall deposition in cotton fibers.

Directory of Open Access Journals (Sweden)

Wen-Qin Bai

Full Text Available Bioactive gibberellins (GAs comprise an important class of natural plant growth regulators and play essential roles in cotton fiber development. To date, the molecular base of GAs' functions in fiber development is largely unclear. To address this question, the endogenous bioactive GA levels in cotton developing fibers were elevated by specifically up-regulating GA 20-oxidase and suppressing GA 2-oxidase via transgenic methods. Higher GA levels in transgenic cotton fibers significantly increased micronaire values, 1000-fiber weight, cell wall thickness and cellulose contents of mature fibers. Quantitative RT-PCR and biochemical analysis revealed that the transcription of sucrose synthase gene GhSusA1 and sucrose synthase activities were significantly enhanced in GA overproducing transgenic fibers, compared to the wild-type cotton. In addition, exogenous application of bioactive GA could promote GhSusA1 expression in cultured fibers, as well as in cotton hypocotyls. Our results suggested that bioactive GAs promoted secondary cell wall deposition in cotton fibers by enhancing sucrose synthase expression.

Genetic transformation of cry1EC gene into cotton ( Gossypium ...

African Journals Online (AJOL)

Cotton is the chief fibre crop of global importance. It plays a significant role in the national economy. Cotton crop is vulnerable to a number of insect species, especially to the larvae of lepidopteron pests. 60% insecticides sprayed on cotton are meant to control the damage caused by bollworm complex. Transgenic ...

Leaf tissue assay for lepidopteran pests of Bt cotton

Science.gov (United States)

Laboratory measurements of susceptibility to Bt toxins can be a poor indicator of the ability of an insect to survive on transgenic crops. We investigated the potential of using cotton leaf tissue for evaluating heliothine susceptibilities to two dual-gene Bt cottons. A preliminary study was conduct...

Does transgenic Cry1Ac + CpTI cotton pollen affect hypopharyngeal gland development and midgut proteolytic enzyme activity in the honey bee Apis mellifera L. (Hymenoptera, Apidae)?

Science.gov (United States)

Han, Peng; Niu, Chang-Ying; Biondi, Antonio; Desneux, Nicolas

2012-11-01

The transgenic Cry1Ac (Bt toxin) + CpTI (Cowpea Trypsin Inhibitor) cotton cultivar CCRI41 is increasingly used in China and potential side effects on the honey bee Apis mellifera L. have been documented recently. Two studies have assessed potential lethal and sublethal effects in young bees fed with CCRI41 cotton pollen but no effect was observed on learning capacities, although lower feeding activity in exposed honey bees was noted (antifeedant effect). The present study aimed at providing further insights into potential side effects of CCRI41 cotton on honey bees. Emerging honey bees were exposed to different pollen diets using no-choice feeding protocols (chronic exposure) in controlled laboratory conditions and we aimed at documenting potential mechanisms underneath the CCRI41 antifeedant effect previously reported. Activity of midgut proteolytic enzyme of young adult honey bees fed on CCRI41 cotton pollen were not significantly affected, i.e. previously observed antifeedant effect was not linked to disturbed activity of the proteolytic enzymes in bees' midgut. Hypopharyngeal gland development was assessed by quantifying total extractable proteins from the glands. Results suggested that CCRI41 cotton pollen carries no risk to hypopharyngeal gland development of young adult honey bees. In the two bioassays, honey bees exposed to 1 % soybean trypsin inhibitor were used as positive controls for both midgut proteolytic enzymes and hypopharyngeal gland proteins quantification, and bees exposed to 48 ppb (part per billion) (i.e. 48 ng g(-1)) imidacloprid were used as controls for exposure to a sublethal concentration of toxic product. The results show that the previously reported antifeedant effect of CCRI41 cotton pollen on honey bees is not linked to effects on their midgut proteolytic enzymes or on the development of their hypopharyngeal glands. The results of the study are discussed in the framework of risk assessment of transgenic crops on honey bees.

Non-motor and motor features in LRRK2 transgenic mice.

Directory of Open Access Journals (Sweden)

Zoë Bichler

Full Text Available Non-motor symptoms are increasingly recognized as important features of Parkinson's disease (PD. LRRK2 mutations are common causes of familial and sporadic PD. Non-motor features have not been yet comprehensively evaluated in LRRK2 transgenic mouse models.Using a transgenic mouse model overexpressing the R1441G mutation of the human LRRK2 gene, we have investigated the longitudinal correlation between motor and non-motor symptoms and determined if specific non-motor phenotypes precede motor symptoms.We investigated the onset of motor and non-motor phenotypes on the LRRK2(R1441G BAC transgenic mice and their littermate controls from 4 to 21 month-old using a battery of behavioral tests. The transgenic mutant mice displayed mild hypokinesia in the open field from 16 months old, with gastrointestinal dysfunctions beginning at 6 months old. Non-motor features such as depression and anxiety-like behaviors, sensorial functions (pain sensitivity and olfaction, and learning and memory abilities in the passive avoidance test were similar in the transgenic animals compared to littermate controls.LRRK2(R1441G BAC transgenic mice displayed gastrointestinal dysfunction at an early stage but did not have abnormalities in fine behaviors, olfaction, pain sensitivity, mood disorders and learning and memory compared to non-transgenic littermate controls. The observations on olfaction and gastrointestinal dysfunction in this model validate findings in human carriers. These mice did recapitulate mild Parkinsonian motor features at late stages but compensatory mechanisms modulating the progression of PD in these models should be further evaluated.

Transgene mobilization and regulatory uncertainty for non-GE fruit products of transgenic rootstocks.

Science.gov (United States)

Haroldsen, Victor M; Chi-Ham, Cecilia L; Bennett, Alan B

2012-10-31

Genetically engineered (GE) rootstocks may offer some advantages for biotechnology applications especially in woody perennial crops such as grape or walnut. Transgrafting combines horticultural grafting practices with modern GE methods for crop improvement. Here, a non-GE conventional scion (upper stem portion) is grafted onto a transgenic GE rootstock. Thus, the scion does not contain the genetic modification present in the rootstock genome. We examined transgene presence in walnut and tomato GE rootstocks and non-GE fruit-bearing scions. Mobilization of transgene DNA, protein, and mRNA across the graft was not detected. Though transgenic siRNA mobilization was not observed in grafted tomatoes or walnut scions, transgenic siRNA signal was detected in walnut kernels. Prospective benefits from transgrafted plants include minimized risk of GE pollen flow (Lev-Yadun and Sederoff, 2001), possible use of more than one scion per approved GE rootstock which could help curb the estimated US$136 million (CropLife International, 2011) cost to bring a GE crop to international markets, as well as potential for improved consumer and market acceptance since the consumable product is not itself GE. Thus, transgrafting provides an alternative option for agricultural industries wishing to expand their biotechnology portfolio. Copyright © 2012 Elsevier B.V. All rights reserved.

Carbon contributions from roots in cotton based rotations

Science.gov (United States)

Tan, D. K. Y.; Hulugalle, N. R.

2012-04-01

C/ha/year) than with no-tillage (16.8 t C/ha/year), although values were higher than those of corn. A large proportion of the carbon inputs from sorghum roots came from depths > 0.6 m. Averaged between both treatments, 65% of the total root mass was located in the 0.6-1.0 m depth. Carbon added to soil by roots of C4 crops such as corn and sorghum was higher than that added by roots of C3 crops such as wheat, vetch and cotton. Carbon added by roots of a Bollgard cotton variety was less than that added by roots of its non-Bollgard counterpart.

Cotton (Gossypium hirsutum L.).

Science.gov (United States)

Rathore, Keerti S; Campbell, LeAnne M; Sherwood, Shanna; Nunes, Eugenia

2015-01-01

Cotton continues to be a crop of great economic importance in many developing and some developed countries. Cotton plants expressing the Bt gene to deter some of the major pests have been enthusiastically and widely accepted by the farmers in three of the major producing countries, i.e., China, India, and the USA. Considering the constraints related to its production and the wide variety of products derived from the cotton plant, it offers several target traits that can be improved through genetic engineering. Thus, there is a great need to accelerate the application of biotechnological tools for cotton improvement. This requires a simple, yet robust gene delivery/transformant recovery system. Recently, a protocol, involving large-scale, mechanical isolation of embryonic axes from germinating cottonseeds followed by direct transformation of the meristematic cells has been developed by an industrial laboratory. However, complexity of the mechanical device and the patent restrictions are likely to keep this method out of reach of most academic laboratories. In this chapter, we describe the method developed in our laboratory that has undergone further refinements and involves Agrobacterium-mediated transformation of cotton cells, selection of stable transgenic callus lines, and recovery of plants via somatic embryogenesis.

The natural refuge policy for Bt cotton (Gossypium L. in Pakistan – a situation analysis

Directory of Open Access Journals (Sweden)

Muhammad Sajjad Ali

2013-07-01

Full Text Available Bt cotton (event Cry1Ac was formally commercialized in Pakistan in 2010. However, there has been an increasing trend of planting unauthorized Bt cotton germplasm in farmers' fields since 2003 with a high rate of adoption in the core cotton areas especially in the province Punjab. The transgenic cotton technology has provided the growers with substantial economic benefits and has reduced their dependence on pesticides for pest control, especially against Helicoverpa armigera (Hubner. However, keeping in view the capacity of this insect to develop resistance against novel chemical formulations, it is easily speculated that Bt toxin, too, is no exception. Refuge crop policy for mono transgenic crop events has helped in delaying the rate of resistance evolution in the target pests. Thus, in Pakistan, where planting of structured refuge crops along Bt cotton fields is not mandatory, the effectiveness and durability of Bt cotton technology may decrease due to a number of factors which are discussed in this review.

A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis.

Science.gov (United States)

Lu, Pu; Magwanga, Richard Odongo; Lu, Hejun; Kirungu, Joy Nyangasi; Wei, Yangyang; Dong, Qi; Wang, Xingxing; Cai, Xiaoyan; Zhou, Zhongli; Wang, Kunbo; Liu, Fang

2018-04-12

Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs) are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 ( TOM1 ), a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum , 9 in Gossypium arboreum , and 11 in Gossypium raimondii . The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY) values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM) was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H₂O₂. The low malondialdehyde (MDA) level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM) can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress-tolerant cotton

A Novel G-Protein-Coupled Receptors Gene from Upland Cotton Enhances Salt Stress Tolerance in Transgenic Arabidopsis

Directory of Open Access Journals (Sweden)

Pu Lu

2018-04-01

Full Text Available Plants have developed a number of survival strategies which are significant for enhancing their adaptation to various biotic and abiotic stress factors. At the transcriptome level, G-protein-coupled receptors (GPCRs are of great significance, enabling the plants to detect a wide range of endogenous and exogenous signals which are employed by the plants in regulating various responses in development and adaptation. In this research work, we carried out genome-wide analysis of target of Myb1 (TOM1, a member of the GPCR gene family. The functional role of TOM1 in salt stress tolerance was studied using a transgenic Arabidopsis plants over-expressing the gene. By the use of the functional domain PF06454, we obtained 16 TOM genes members in Gossypium hirsutum, 9 in Gossypium arboreum, and 11 in Gossypium raimondii. The genes had varying physiochemical properties, and it is significant to note that all the grand average of hydropathy (GRAVY values were less than one, indicating that all are hydrophobic in nature. In all the genes analysed here, both the exonic and intronic regions were found. The expression level of Gh_A07G0747 (GhTOM was significantly high in the transgenic lines as compared to the wild type; a similar trend in expression was observed in all the salt-related genes tested in this study. The study in epidermal cells confirmed the localization of the protein coded by the gene TOM1 in the plasma membrane. Analysis of anti-oxidant enzymes showed higher concentrations of antioxidants in transgenic lines and relatively lower levels of oxidant substances such as H2O2. The low malondialdehyde (MDA level in transgenic lines indicated that the transgenic lines had relatively low level of oxidative damage compared to the wild types. The results obtained indicate that Gh_A07G0747 (GhTOM can be a putative target gene for enhancing salt stress tolerance in plants and could be exploited in the future for the development of salt stress

A proteomic study to identify soya allergens--the human response to transgenic versus non-transgenic soya samples.

Science.gov (United States)

Batista, Rita; Martins, Isabel; Jeno, Paul; Ricardo, Cândido Pinto; Oliveira, Maria Margarida

2007-01-01

In spite of being among the main foods responsible for allergic reactions worldwide, soybean (Glycine max)-derived products continue to be increasingly widespread in a variety of food products due to their well-documented health benefits. Soybean also continues to be one of the elected target crops for genetic modification. The aim of this study was to characterize the soya proteome and, specifically, IgE-reactive proteins as well as to compare the IgE response in soya-allergic individuals to genetically modified Roundup Ready soya versus its non-transgenic control. We performed two-dimensional gel electrophoresis of protein extracts from a 5% genetically modified Roundup Ready flour sample and its non-transgenic control followed by Western blotting with plasma from 5 soya-sensitive individuals. We used peptide tandem mass spectrometry to identify soya proteins (55 protein matches), specifically IgE-binding ones, and to evaluate differences between transgenic and non-transgenic samples. We identified 2 new potential soybean allergens--one is maturation associated and seems to be part of the late embryogenesis abundant proteins group and the other is a cysteine proteinase inhibitor. None of the individuals tested reacted differentially to the transgenic versus non-transgenic samples under study. Soybean endogenous allergen expression does not seem to be altered after genetic modification. Proteomics should be considered a powerful tool for functional characterization of plants and for food safety assessment. Copyright (c) 2007 S. Karger AG, Basel.

Transgenic Bacillus thuringiensis (Bt rice is safer to aquatic ecosystems than its non-transgenic counterpart.

Directory of Open Access Journals (Sweden)

Guangsheng Li

Full Text Available Rice lines genetically modified with the crystal toxin genes from Bacillus thuringiensis (Bt have experienced rapid development, with biosafety certificates for two Bt rice lines issued in 2009. There has still been no commercial release of these lines yet due to public concerns about human health and environmental risks. Some studies confirmed that Bt rice was as safe as conventional rice to non-target organisms when pesticides were not applied, however, pesticides are still required in Bt rice to control non-lepidopteran pests. In this study, we assessed the environmental effects of two Bt rice lines expressing either the cry1Ab/1Ac or cry2A genes, respectively, by using zooplanktons as indicator species under normal field management practices using pesticides when required. In the whole rice growing season, non-Bt rice was sprayed 5 times while Bt rice was sprayed 2 times, which ensured both rice achieved a normal yield. Field investigations showed that rice type (Bt and non-Bt significantly influenced zooplankton abundance and diversity, which were up to 95% and 80% lower in non-Bt rice fields than Bt rice fields. Laboratory rearing showed that water from non-Bt rice fields was significantly less suitable for the survival and reproduction of Daphnia magna and Paramecium caudatum in comparison with water from Bt rice fields. Higher pesticide residues were detected in the water from non-Bt than Bt rice fields, accounting for the bad performance of zooplankton in non-Bt field water. Our results demonstrate that Bt rice is safer to aquatic ecosystems than non-Bt rice, and its commercialization will be beneficial for biodiversity restoration in rice-based ecosystems.

The non-linear coupled spin 2-spin 3 Cotton equation in three dimensions

Energy Technology Data Exchange (ETDEWEB)

Linander, Hampus; Nilsson, Bengt E.W. [Department of Physics, Theoretical PhysicsChalmers University of Technology, S-412 96 Göteborg (Sweden)

2016-07-05

In the context of three-dimensional conformal higher spin theory we derive, in the frame field formulation, the full non-linear spin 3 Cotton equation coupled to spin 2. This is done by solving the corresponding Chern-Simons gauge theory system of equations, that is, using F=0 to eliminate all auxiliary fields and thus expressing the Cotton equation in terms of just the spin 3 frame field and spin 2 covariant derivatives and tensors (Schouten). In this derivation we neglect the spin 4 and higher spin sectors and approximate the star product commutator by a Poisson bracket. The resulting spin 3 Cotton equation is complicated but can be related to linearized versions in the metric formulation obtained previously by other authors. The expected symmetry (spin 3 “translation”, “Lorentz” and “dilatation”) properties are verified for Cotton and other relevant tensors but some perhaps unexpected features emerge in the process, in particular in relation to the non-linear equations. We discuss the structure of this non-linear spin 3 Cotton equation but its explicit form is only presented here, in an exact but not completely refined version, in appended files obtained by computer algebra methods. Both the frame field and metric formulations are provided.

A point mutation (L1015F) of the voltage-sensitive sodium channel gene associated with lambda-cyhalothrin resistance in Apolygus lucorum (Meyer-Dür) population from the transgenic Bt cotton field of China.

Science.gov (United States)

Zhen, Congai; Gao, Xiwu

2016-02-01

In China, the green mirid bug, Apolygus lucorum (Meyer-Dür), has caused severe economic damage to many kinds of crops, especially the cotton and jujubes. Pyrethroid insecticides have been widely used for controlling this pest in the transgenic Bt cotton field. Five populations of A. lucorum collected from cotton crops at different locations in China were evaluated for lambda-cyhalothrin resistance. The results showed that only the population collected from Shandong Province exhibited 30-fold of resistance to lambda-cyhalothrin. Neither PBO nor DEF had obvious synergism when compared the synergistic ratio between SS and RR strain which was originated from the Shandong population. Besides, there were no statistically significant differences (p>0.05) in the carboxylesterase, glutathione S-transferase, or 7-ethoxycoumarin O-deethylase activities between the Shandong population and the laboratory susceptible strain (SS). The full-length sodium channel gene named AlVSSC encoding 2028 amino acids was obtained by RT-PCR and rapid amplification of cDNA ends (RACE). One single point mutation L1015F in the AlVSSC was detected only in the Shandong population. Our results revealed that the L1015F mutation associated with pyrethroid resistance was identified in A. lucorum populations in China. These results will be useful for the rational chemical control of A. lucorum in the transgenic Bt cotton field. Copyright © 2015 Elsevier Inc. All rights reserved.

Performance and cross-crop resistance of Cry1F-maize selected Spodoptera frugiperda on transgenic Bt cotton: implications for resistance management.

Science.gov (United States)

Yang, Fei; Kerns, David L; Brown, Sebe; Kurtz, Ryan; Dennehy, Tim; Braxton, Bo; Head, Graham; Huang, Fangneng

2016-06-15

Transgenic crops producing Bacillus thuringiensis (Bt) proteins have become a primary tool in pest management. Due to the intensive use of Bt crops, resistance of the fall armyworm, Spodoptera frugiperda, to Cry1F maize has occurred in Puerto Rico, Brazil, and some areas of the southeastern U.S. The sustainability of Bt crops faces a great challenge because the Cry1F-maize resistant S. frugiperda may also infest other Bt crops in multiple cropping ecosystems. Here we examined the survival and plant injury of a S. frugiperda population selected with Cry1F maize on three single-gene and five pyramided Bt cotton products. Larvae of Cry1F-susceptible (SS), -heterozygous (RS), and -resistant (RR) genotypes of S. frugiperda were all susceptible to the pyramided cotton containing Cry1Ac/Cry2Ab, Cry1Ac/Cry1F/Vip3A, Cry1Ab/Cry2Ae, or Cry1Ab/Cry2Ae/Vip3A, and the single-gene Cry2Ae cotton. Pyramided cotton containing Cry1Ac/Cry1F was effective against SS and RS, but not for RR. These findings show that the Cry1F-maize selected S. frugiperda can cause cross-crop resistance to other Bt crops expressing similar insecticidal proteins. Resistance management and pest management programs that utilize diversify mortality factors must be implemented to ensure the sustainability of Bt crops. This is especially important in areas where resistance to single-gene Bt crops is already widespread.

The recovery of Bt toxin content after temperature stress termination in transgenic cotton

Energy Technology Data Exchange (ETDEWEB)

Chen, Y.; Wen, Y.; Zhang, X.; Wang, Y.; Chen, D.

2013-06-01

The insecticidal efficacy of Bt cotton under different environments has generated controversy in recent years. The objective of this study was to investigate possible reasons of the conflicting results caused by temperature stress. Two different types of Bt transgenic cotton cultivars (a Bt cultivar, Sikang1, and an hybrid Bt cultivar, Sikang3) were selected. The plants of the two Bt cultivars were exposed to high temperature (37 degree centigrade), low temperature (18 degree centigrade), and the control (27 degree centigrade) for short (24 h) and long (48 h) periods of stress at peak boll stage, and then moved to the glasshouse where the control plants were maintained. The results showed that the leaf insecticidal toxin content fully recovered within 24 h to the level of control after the end of short duration high-temperature treatment, and recovered mostly within 48 h of the termination of 24 h low-temperature stress. Under long duration high temperature treatment the Bt toxin content required longer recovery periods (48 and 72 h for Sikang3 and Sikang1, respectively) to reach the control level. The Bt protein content only recovered partially at 96 h after the end of the long-duration low-temperature stress, and the concentrations of the Cry1Ac protein were 74% and 77% of the corresponding control for Sikang1 and Sikang3, respectively. The different recovery and increase slowly of the leaf nitrogen metabolic rates after ceasing the heat and cold stress may be possible reason for the above difference. In summary, the duration and type of temperature (cold or heat) stress may cause different Bt insecticidal protein recovery rate due to different recovery rate of enzymes. (Author) 31 refs.

Tri-trophic interactions between Bt cotton, the herbivore Aphis gossypii Glover (Homoptera: Aphididae), and the predator Chrysopa pallens (Rambur) (Neuroptera: Chrysopidae).

Science.gov (United States)

Guo, Jian-Ying; Wan, Fang-Hao; Dong, Liang; Lövei, Gábor L; Han, Zhao-Jun

2008-02-01

Tri-trophic impacts of transgenic Bacillus thuringiensis (Bt) cotton GK12 and NuCOTN 99B were studied using a predator, the great lacewing Chrysopa pallens (Rambur), and its prey, the cotton aphid Aphis gossypii Glover, in laboratory feeding experiments. The parental nontransgenic cotton cultivar of GK12 was used as control. The predator was fed with uniform (aphids from a single cultivar) or mixed prey (aphids from the three cotton cultivars provided on alternate days). Mortality and development of the immature stages, pupal body mass, adult sex ratio, fecundity, and egg viability of C. pallens were measured. When fed GK12-originated aphid prey, pupal body mass of C. pallens was significantly higher than that of the control, more females emerged, and these females laid significantly more eggs. Other parameters were not impacted. Females emerging from larvae maintained on NuCOTN 99B-originated prey laid fewer eggs than those maintained on GK12. Other measurements did not differ significantly between the two Bt cotton cultivars. Compared with the control, mixed feeding significantly prolonged pupal development time and increased pupal body mass and percentage of females but did not affect other parameters. These results indicate that C. pallens is sensitive to aphid prey from different cotton cultivars. Transgenic Bt cotton GK12-originated aphid prey has no adverse impact on survival, development, and fecundity of C. pallens. Between the two Bt cotton cultivars, NuCOTN 99B-originated aphid prey provided to C. pallens in the larval stage may lower female fecundity. Mixed feeding of C. pallens with the two Bt cotton-originated prey and non-Bt prey may have some adverse impacts on pupal development.

Suppression of cotton leaf curl disease symptoms in Gossypium hirsutum through over expression of host-encoded miRNAs.

Science.gov (United States)

Akmal, Mohd; Baig, Mirza S; Khan, Jawaid A

2017-12-10

Cotton leaf curl disease (CLCuD), a major factor resulting in the enormous yield losses in cotton crop, is caused by a distinct monopartite begomovirus in association with Cotton leaf curl Multan betasatellite (CLCuMB). Micro(mi)RNAs are known to regulate gene expression in eukaryotes, including antiviral defense in plants. In a previous study, we had computationally identified a set of cotton miRNAs, which were shown to have potential targets in the genomes of Cotton leaf curl Multan virus (CLCuMuV) and CLCuMB at multiple loci. In the current study, effect of Gossypium arboreum-encoded miRNAs on the genome of CLCuMuV and CLCuMB was investigated in planta. Two computationally predicted cotton-encoded miRNAs (miR398 and miR2950) that showed potential to bind multiple Open Reading Frames (ORFs; C1, C4, V1, and non- coding intergenic region) of CLCuMuV, and (βC1) of CLCuMB were selected. Functional validation of miR398 and miR2950 was done by overexpression approach in G. hirsutum var. HS6. A total of ten in vitro cotton plants were generated from independent events and subjected to biological and molecular analyses. Presence of the respective Precursor (pre)-miRNA was confirmed through PCR and Southern blotting, and their expression level was assessed by semi quantitative RT-PCR, Real Time quantitative PCR and northern hybridization in the PCR-positive lines. Southern hybridization revealed 2-4 copy integration of T-DNA in the genome of the transformed lines. Remarkably, expression of pre-miRNAs was shown up to 5.8-fold higher in the transgenic (T 0 ) lines as revealed by Real Time PCR. The virus resistance was monitored following inoculation of the transgenic cotton lines with viruliferous whitefly (Bemisia tabaci) insect vector. After inoculation, four of the transgenic lines remained apparently symptom free. While a very low titre of viral DNA could be detected by Rolling circle amplification, betasatellite responsible for symptom induction could not be detected

ANALYSIS OF EXCHANGE RATE LINKED SUBSIDIES FOR NON-PRICE EXPORT PROMOTION: THE CASE OF COTTON

OpenAIRE

Paudel, Laxmi; Adhikari, Murali; Houston, Jack E.; Kinnucan, Henry W.

2002-01-01

An equilibrium displacement framework was developed to evaluate the effect of exchange rate linked subsidies for non-price export promotion for US cotton. Study results show that an increase in promotion expenditure increased the dollar value and producer welfare of cotton growers. The gross gain to the domestic cotton producers from the exchange-rate linked subsidy scheme was positive. These evidences support exchange rate linked subsidies for US cotton export promotion.

Single-Event Transgene Product Levels Predict Levels in Genetically Modified Breeding Stacks.

Science.gov (United States)

Gampala, Satyalinga Srinivas; Fast, Brandon J; Richey, Kimberly A; Gao, Zhifang; Hill, Ryan; Wulfkuhle, Bryant; Shan, Guomin; Bradfisch, Greg A; Herman, Rod A

2017-09-13

The concentration of transgene products (proteins and double-stranded RNA) in genetically modified (GM) crop tissues is measured to support food, feed, and environmental risk assessments. Measurement of transgene product concentrations in breeding stacks of previously assessed and approved GM events is required by many regulatory authorities to evaluate unexpected transgene interactions that might affect expression. Research was conducted to determine how well concentrations of transgene products in single GM events predict levels in breeding stacks composed of these events. The concentrations of transgene products were compared between GM maize, soybean, and cotton breeding stacks (MON-87427 × MON-89034 × DAS-Ø15Ø7-1 × MON-87411 × DAS-59122-7 × DAS-40278-9 corn, DAS-81419-2 × DAS-44406-6 soybean, and DAS-21023-5 × DAS-24236-5 × SYN-IR102-7 × MON-88913-8 × DAS-81910-7 cotton) and their component single events (MON-87427, MON-89034, DAS-Ø15Ø7-1, MON-87411, DAS-59122-7, and DAS-40278-9 corn, DAS-81419-2, and DAS-44406-6 soybean, and DAS-21023-5, DAS-24236-5, SYN-IR102-7, MON-88913-8, and DAS-81910-7 cotton). Comparisons were made within a crop and transgene product across plant tissue types and were also made across transgene products in each breeding stack for grain/seed. Scatter plots were generated comparing expression in the stacks to their component events, and the percent of variability accounted for by the line of identity (y = x) was calculated (coefficient of identity, I 2 ). Results support transgene concentrations in single events predicting similar concentrations in breeding stacks containing the single events. Therefore, food, feed, and environmental risk assessments based on concentrations of transgene products in single GM events are generally applicable to breeding stacks composed of these events.

Principal variance component analysis of crop composition data: a case study on herbicide-tolerant cotton.

Science.gov (United States)

Harrison, Jay M; Howard, Delia; Malven, Marianne; Halls, Steven C; Culler, Angela H; Harrigan, George G; Wolfinger, Russell D

2013-07-03

Compositional studies on genetically modified (GM) and non-GM crops have consistently demonstrated that their respective levels of key nutrients and antinutrients are remarkably similar and that other factors such as germplasm and environment contribute more to compositional variability than transgenic breeding. We propose that graphical and statistical approaches that can provide meaningful evaluations of the relative impact of different factors to compositional variability may offer advantages over traditional frequentist testing. A case study on the novel application of principal variance component analysis (PVCA) in a compositional assessment of herbicide-tolerant GM cotton is presented. Results of the traditional analysis of variance approach confirmed the compositional equivalence of the GM and non-GM cotton. The multivariate approach of PVCA provided further information on the impact of location and germplasm on compositional variability relative to GM.

Analysis of transgenic wheat (Triticum aestivum L.) harboring a maize (Zea mays L.) gene for plastid EF-Tu: segregation pattern, expression and effects of the transgene.

Science.gov (United States)

Fu, Jianming; Ristic, Zoran

2010-06-01

We previously reported that transgenic wheat (Triticum aestivum L.) carrying a maize (Zea mays L.) gene (Zmeftu1) for chloroplast protein synthesis elongation factor, EF-Tu, displays reduced thermal aggregation of leaf proteins, reduced injury to photosynthetic membranes (thylakoids), and enhanced rate of CO(2) fixation following exposure to heat stress (18 h at 45 degrees C) [Fu et al. in Plant Mol Biol 68:277-288, 2008]. In the current study, we investigated the segregation pattern and expression of the transgene Zmeftu1 and determined the grain yield of transgenic plants after exposure to a brief heat stress (18 h at 45 degrees C). We also assessed thermal aggregation of soluble leaf proteins in transgenic plants, testing the hypothesis that increased levels of EF-Tu will lead to a non-specific protection of leaf proteins against thermal aggregation. The transgenic wheat displayed a single-gene pattern of segregation of Zmeftu1. Zmeftu1 was expressed, and the transgenic plants synthesized and accumulated three anti-EF-Tu cross-reacting polypeptides of similar molecular mass but different pI, suggesting the possibility of posttranslational modification of this protein. The transgenic plants also showed better grain yield after exposure to heat stress compared with their non-transgenic counterparts. Soluble leaf proteins of various molecular masses displayed lower thermal aggregation in transgenic than in non-transgenic wheat. The results suggest that overexpression of chloroplast EF-Tu can be beneficial to wheat tolerance to heat stress. Moreover, the results also support the hypothesis that EF-Tu contributes to heat tolerance by acting as a molecular chaperone and protecting heat-labile proteins from thermal aggregation in a non-specific manner.

Cotton Study: Albumin Binding and its Effect on Elastase Activity in the Chronic Non-Healing Wound

Energy Technology Data Exchange (ETDEWEB)

Castro, N.; Goheen, S.

2005-01-01

Cotton, as it is used in wound dressings is composed of nearly pure cellulose. During the wound-healing process, cotton is exposed to various blood components including water, salts, cells, and blood proteins. Albumin is the most prominent protein in blood. Elastase is an enzyme secreted by white blood cells and takes an active role in tissue reconstruction. In the chronic non-healing wound, elastase is often over-expressed such that this enzyme digests tissue and growth factors, and interferes with the normal healing process. Our goal is to design a cotton wound dressing that will sequester elastase or assist in reducing elastase activity in the presence of other blood proteins such as albumin. The ability of cotton and various cotton derivatives to sequester elastase and albumin has been studied by examining the adsorption of these two proteins separately. We undertook the present work to confirm the binding of albumin to cotton and to quantify the activity of elastase in the presence of various derivatives of cotton. We previously observed a slight increase in elastase activity when exposed to cotton. We also observed a continuous accumulation of albumin on cotton using high-performance liquid chromatography methods. In the present study, we used an open-column-absorption technique coupled with a colorimetric protein assay to confirm losses of albumin to cotton. We have also confirmed increased elastase activity after exposure to cotton. The results are discussed in relation to the porosity of cotton and the use of cotton for treating chronic non-healing wounds.

Herbicide-resistant cotton (Gossypium hirsutum) plants: an alternative way of manual weed removal.

Science.gov (United States)

Latif, Ayesha; Rao, Abdul Qayyum; Khan, Muhammad Azmat Ullah; Shahid, Naila; Bajwa, Kamran Shehzad; Ashraf, Muhammad Aleem; Abbas, Malik Adil; Azam, Muhammad; Shahid, Ahmad Ali; Nasir, Idrees Ahmad; Husnain, Tayyab

2015-09-17

Cotton yield has been badly affected by different insects and weed competition. In Past Application of multiple chemicals is required to manage insects and weed control was achieved by different conventional means, such as hand weeding, crop rotation and polyculture, because no synthetic chemicals were available. The control methods shifted towards high input and target-oriented methods after the discovery of synthetic herbicide in the 1930s. To utilise the transgenic approach, cotton plants expressing the codon-optimised CEMB GTGene were produced in the present study. Local cotton variety CEMB-02 containing Cry1Ac and Cry2A in single cassette was transformed by synthetic codon-optimised 5-enolpyruvylshikimate-3-phosphate synthase gene cloned into pCAMBIA 1301 vector under 35S promoter with Agrobacterium tumifaciens. Putative transgenic plants were screened in MS medium containing 120 µmol/L glyphosate. Integration and expression of the gene were evaluated by PCR from genomic DNA and ELISA from protein. A 1.4-kb PCR product for Glyphosate and 167-bp product for Cry2A were obtained by amplification through gene specific primers. Expression level of Glyphosate and Bt proteins in two transgenic lines were recorded to be 0.362, 0.325 µg/g leaf and 0.390, 0.300 µg/g leaf respectively. FISH analysis of transgenic lines demonstrates the presence of one and two copy no. of Cp4 EPSPS transgene respectively. Efficacy of the transgene Cp4 EPSPS was further evaluated by Glyphosate spray (41 %) assay at 1900 ml/acre and insect bioassay which shows 100 %mortality of insect feeding on transgenic lines as compared to control. The present study shows that the transgenic lines produced in this study were resistant not only to insects but also equally good against 1900 ml/acre field spray concentration of glyphosate.

Genome Editing in Cotton with the CRISPR/Cas9 System

Directory of Open Access Journals (Sweden)

Wei Gao

2017-08-01

Full Text Available Genome editing is an important tool for gene functional studies as well as crop improvement. The recent development of the CRISPR/Cas9 system using single guide RNA molecules (sgRNAs to direct precise double strand breaks in the genome has the potential to revolutionize agriculture. Unfortunately, not all sgRNAs are equally efficient and it is difficult to predict their efficiency by bioinformatics. In crops such as cotton (Gossypium hirsutum L., with labor-intensive and lengthy transformation procedures, it is essential to minimize the risk of using an ineffective sgRNA that could result in the production of transgenic plants without the desired CRISPR-induced mutations. In this study, we have developed a fast and efficient method to validate the functionality of sgRNAs in cotton using a transient expression system. We have used this method to validate target sites for three different genes GhPDS, GhCLA1, and GhEF1 and analyzed the nature of the CRISPR/Cas9-induced mutations. In our experiments, the most frequent type of mutations observed in cotton cotyledons were deletions (∼64%. We prove that the CRISPR/Cas9 system can effectively produce mutations in homeologous cotton genes, an important requisite in this allotetraploid crop. We also show that multiple gene targeting can be achieved in cotton with the simultaneous expression of several sgRNAs and have generated mutations in GhPDS and GhEF1 at two target sites. Additionally, we have used the CRISPR/Cas9 system to produce targeted gene fragment deletions in the GhPDS locus. Finally, we obtained transgenic cotton plants containing CRISPR/Cas9-induced gene editing mutations in the GhCLA1 gene. The mutation efficiency was very high, with 80.6% of the transgenic lines containing mutations in the GhCLA1 target site resulting in an intense albino phenotype due to interference with chloroplast biogenesis.

Spatial Distribution of Eggs of Alabama argillacea Hübner and Heliothis virescens Fabricius (Lepidoptera: Noctuidae on Bt and non-BtCotton

Directory of Open Access Journals (Sweden)

TATIANA R. RODRIGUES

2015-12-01

Full Text Available ABSTRACT Among the options to control Alabama argillacea (Hübner, 1818 and Heliothis virescens (Fabricius, 1781 on cotton, insecticide spraying and biological control have been extensively used. The GM'Bt' cotton has been introduced as an extremely viable alternative, but it is yet not known how transgenic plants affect populations of organisms that are interrelated in an agroecosystem. For this reason, it is important to know how the spatial arrangement of pests and beneficial insect are affected, which may call for changes in the methods used for sampling these species. This study was conducted with the goal to investigate the pattern of spatial distribution of eggs of A. argillacea and H. virescens in DeltaOpalTM (non-Bt and DP90BTMBt cotton cultivars. Data were collected during the agricultural year 2006/2007 in two areas of 5,000 m2, located in in the district of Nova América, Caarapó municipality. In each sampling area, comprising 100 plots of 50 m2, 15 evaluations were performed on two plants per plot. The sampling consisted in counting the eggs. The aggregation index (variance/mean ratio, Morisita index and exponent k of the negative binomial distribution and chi-square fit of the observed and expected values to the theoretical frequency distribution (Poisson, Binomial and Negative Binomial Positive, showed that in both cultivars, the eggs of these species are distributed according to the aggregate distribution model, fitting the pattern of negative binomial distribution.

Genetic engineering of cotton with a novel cry2AX1 gene to impart insect resistance against Helicoverpa armigera

Directory of Open Access Journals (Sweden)

Karunamurthy Dhivya

2016-09-01

Full Text Available Embryogenic calli of cotton (Coker310 were cocultivated with the Agrobacterium tumefaciens strain LBA4404 harbouring the codon-optimised, chimeric cry2AX1 gene consisting of sequences from cry2Aa and cry2Ac genes isolated from Indian strains of Bacillus thuringiensis. Forty-eight putative transgenic plants were regenerated, and PCR analysis of these plants revealed the presence of the cry2AX1 gene in 40 plants. Southern blot hybridisation analysis of selected transgenic plants confirmed stable T-DNA integration in the genome of transformed plants. The level of Cry2AX1 protein expression in PCR positive plants ranged from 4.9 to 187.5 ng g-1 of fresh tissue. A transgenic cotton event, TP31, expressing the cry2AX1 gene showed insecticidal activity of 56.66 per cent mortality against Helicoverpa armigera in detached leaf disc bioassay. These results indicate that the chimeric cry2AX1 gene expressed in transgenic cotton has insecticidal activity against H. armigera.

Preliminarily study on the maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on gastropods

Science.gov (United States)

Zhu, Tingbing; Zhang, Lihong; Zhang, Tanglin; Wang, Yaping; Hu, Wei; Olsen, Rolf Eric; Zhu, Zuoyan

2017-10-01

The present study preliminarily examined the differences in maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on four gastropods species (Bellamya aeruginosa, Radix auricularia, Parafossarulus sinensis and Alocinma longicornis) under laboratory conditions. In the maximum handling size trial, five fish from each age group (1-year-old and 2-year-old) and each genotype (transgenic and non-transgenic) of common carp were individually allowed to feed on B. aeruginosa with wide shell height range. The results showed that maximum handling size increased linearly with fish length, and there was no significant difference in maximum handling size between the two genotypes. In the size selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on three size groups of B. aeruginosa. The results show that the two genotypes of C. carpio favored the small-sized group over the large-sized group. In the species selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on thin-shelled B. aeruginosa and thick-shelled R. auricularia, and five pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on two gastropods species (P. sinensis and A. longicornis) with similar size and shell strength. The results showed that both genotypes preferred thin-shelled Radix auricularia rather than thick-shelled B. aeruginosa, but there were no significant difference in selectivity between the two genotypes when fed on P. sinensis and A. longicornis. The present study indicates that transgenic and non-transgenic C. carpio show similar selectivity of predation on the size- and species-limited gastropods. While this information may be useful for assessing the environmental risk of transgenic carp, it does not necessarily demonstrate that transgenic common carp might

Transgene flow: Facts, speculations and possible countermeasures

Science.gov (United States)

Ryffel, Gerhart U

2014-01-01

Convincing evidence has accumulated that unintended transgene escape occurs in oilseed rape, maize, cotton and creeping bentgrass. The escaped transgenes are found in variant cultivars, in wild type plants as well as in hybrids of sexually compatible species. The fact that in some cases stacked events are present that have not been planted commercially, implies unintended recombination of transgenic traits. As the consequences of this continuous transgene escape for the ecosystem cannot be reliably predicted, I propose to use more sophisticated approaches of gene technology in future. If possible GM plants should be constructed using either site-directed mutagenesis or cisgenic strategies to avoid the problem of transgene escape. In cases where a transgenic trait is needed, efficient containment should be the standard approach. Various strategies available or in development are discussed. Such a cautious approach in developing novel types of GM crops will enhance the sustainable potential of GM crops and thus increase the public trust in green gene technology. PMID:25523171

Post harvest fertility status of some cotton based leguminous and non-leguminous intercropping systems

International Nuclear Information System (INIS)

Khan, M.B.; Khaliq, A.

2003-01-01

Residual effect of different leguminous and non-leguminous intercropping systems on cotton planted in two planting patterns was studied at Agronomic Research Area, Univ. of Agriculture, Faisalabad under irrigated conditions of Central Punjab. Soil samples were collected from 0-15 cm and 15-30 cm depths before planting and after harvesting of each crop, each year to evaluate the impact of leguminous and non-leguminous crops included in this study. Experiment was laid out in randomized complete block design (R.C.B.D.) with split arrangement and four replications. Patterns were randomized in main plots and intercrops in sub plots. Plot size was 4.8 m x 7 m. All the intercrops produced substantially smaller yields when grown in association with cotton in either planting pattern compared to their sole crop yields. Residual nitrogen was improved in leguminous intercropping systems as compared to cotton alone as well non-legume intercropping systems. Similarly organic matter was also improved in all intercropping treatments, and maximum increase was recorded due to cowpeas. Phosphorus was depleted in all intercropping systems during both years under study as well as in relation to cotton alone. The same trend (depletion) was also observed in case of residual soil Potassium.(author)

Indian Bt cotton varieties do not affect the performance of cotton aphids.

Directory of Open Access Journals (Sweden)

Nora C Lawo

Full Text Available Cotton varieties expressing Cry proteins derived from the soil bacterium Bacillus thuringiensis (Bt are grown worldwide for the management of pest Lepidoptera. To prevent non-target pest outbreaks and to retain the biological control function provided by predators and parasitoids, the potential risk that Bt crops may pose to non-target arthropods is addressed prior to their commercialization. Aphids play an important role in agricultural systems since they serve as prey or host to a number of predators and parasitoids and their honeydew is an important energy source for several arthropods. To explore possible indirect effects of Bt crops we here examined the impact of Bt cotton on aphids and their honeydew. In climate chambers we assessed the performance of cotton aphids, Aphis gossypii Glover (Hemiptera: Aphididae when grown on three Indian Bt (Cry1Ac cotton varieties (MECH 12, MECH 162, MECH 184 and their non-transformed near isolines. Furthermore, we examined whether aphids pick up the Bt protein and analyzed the sugar composition of aphid honeydew to evaluate its suitability for honeydew-feeders. Plant transformation did not have any influence on aphid performance. However, some variation was observed among the three cotton varieties which might partly be explained by the variation in trichome density. None of the aphid samples contained Bt protein. As a consequence, natural enemies that feed on aphids are not exposed to the Cry protein. A significant difference in the sugar composition of aphid honeydew was detected among cotton varieties as well as between transformed and non-transformed plants. However, it is questionable if this variation is of ecological relevance, especially as honeydew is not the only sugar source parasitoids feed on in cotton fields. Our study allows the conclusion that Bt cotton poses a negligible risk for aphid antagonists and that aphids should remain under natural control in Bt cotton fields.

Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots

DEFF Research Database (Denmark)

Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke

2014-01-01

induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots...

Non-recessive Bt toxin resistance conferred by an intracellular cadherin mutation in field-selected populations of cotton bollworm.

Directory of Open Access Journals (Sweden)

Haonan Zhang

Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins have been planted widely to control insect pests, yet evolution of resistance by the pests can reduce the benefits of this approach. Recessive mutations in the extracellular domain of toxin-binding cadherin proteins that confer resistance to Bt toxin Cry1Ac by disrupting toxin binding have been reported previously in three major lepidopteran pests, including the cotton bollworm, Helicoverpa armigera. Here we report a novel allele from cotton bollworm with a deletion in the intracellular domain of cadherin that is genetically linked with non-recessive resistance to Cry1Ac. We discovered this allele in each of three field-selected populations we screened from northern China where Bt cotton producing Cry1Ac has been grown intensively. We expressed four types of cadherin alleles in heterologous cell cultures: susceptible, resistant with the intracellular domain mutation, and two complementary chimeric alleles with and without the mutation. Cells transfected with each of the four cadherin alleles bound Cry1Ac and were killed by Cry1Ac. However, relative to cells transfected with either the susceptible allele or the chimeric allele lacking the intracellular domain mutation, cells transfected with the resistant allele or the chimeric allele containing the intracellular domain mutation were less susceptible to Cry1Ac. These results suggest that the intracellular domain of cadherin is involved in post-binding events that affect toxicity of Cry1Ac. This evidence is consistent with the vital role of the intracellular region of cadherin proposed by the cell signaling model of the mode of action of Bt toxins. Considered together with previously reported data, the results suggest that both pore formation and cell signaling pathways contribute to the efficacy of Bt toxins.

Effects of Soil Water Deficit on Insecticidal Protein Expression in Boll Shells of Transgenic Bt Cotton and the Mechanism

Directory of Open Access Journals (Sweden)

Xiang Zhang

2017-12-01

Full Text Available This study was conducted to investigate the effects of soil water deficit on insecticidal protein expression in boll shells of cotton transgenic for a Bt gene. In 2014, Bt cotton cultivars Sikang 1 (a conventional cultivar and Sikang 3 (a hybrid cultivar were planted in pots and five soil water content treatments were imposed at peak boll stage: 15% (G1, 35% (G2, 40% (G3, 60% (G4, and 75% field capacity (CK, respectively. Four treatments (G2, G3, G4, and CK were repeated in 2015 in the field. Results showed that the insecticidal protein content of boll shells decreased with increasing water deficit. Compared with CK, boll shell insecticidal protein content decreased significantly when soil water content was below 60% of maximum water holding capacity for Sikang 1 and Sikang 3. However, increased Bt gene expression was observed when boll shell insecticidal protein content was significantly reduced. Activity assays of key enzymes in nitrogen metabolism showed that boll shell protease and peptidase increased but nitrogen reductase and glutamic-pyruvic transaminase (GPT decreased. Insecticidal protein content exhibited significant positive correlation with nitrogen reductase and GPT activities; and significant negative correlation with protease and peptidase activities. These findings suggest that the decrease of insecticidal protein content associated with increasing water deficit was a net result of decreased synthesis and increased decomposition.

GhWRKY25, a group I WRKY gene from cotton, confers differential tolerance to abiotic and biotic stresses in transgenic Nicotiana benthamiana.

Science.gov (United States)

Liu, Xiufang; Song, Yunzhi; Xing, Fangyu; Wang, Ning; Wen, Fujiang; Zhu, Changxiang

2016-09-01

WRKY transcription factors are involved in various processes, ranging from plant growth to abiotic and biotic stress responses. Group I WRKY members have been rarely reported compared with group II or III members, particularly in cotton (Gossypium hirsutum). In this study, a group I WRKY gene, namely, GhWRKY25, was cloned from cotton and characterized. Expression analysis revealed that GhWRKY25 can be induced or deduced by the treatments of abiotic stresses and multiple defense-related signaling molecules. Overexpression of GhWRKY25 in Nicotiana benthamiana reduced plant tolerance to drought stress but enhanced tolerance to salt stress. Moreover, more MDA and ROS accumulated in transgenic plants after drought treatment with lower activities of SOD, POD, and CAT. Our study further demonstrated that GhWRKY25 overexpression in plants enhanced sensitivity to the fungal pathogen Botrytis cinerea by reducing the expression of SA or ET signaling related genes and inducing the expression of genes involved in the JA signaling pathway. These results indicated that GhWRKY25 plays negative or positive roles in response to abiotic stresses, and the reduced pathogen resistance may be related to the crosstalk of the SA and JA/ET signaling pathways.

Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis).

Science.gov (United States)

Oliveira, Gustavo R; Silva, Maria C M; Lucena, Wagner A; Nakasu, Erich Y T; Firmino, Alexandre A P; Beneventi, Magda A; Souza, Djair S L; Gomes, José E; de Souza, José D A; Rigden, Daniel J; Ramos, Hudson B; Soccol, Carlos R; Grossi-de-Sa, Maria F

2011-09-09

The cotton boll weevil (Anthonomus grandis) is a serious insect-pest in the Americas, particularly in Brazil. The use of chemical or biological insect control is not effective against the cotton boll weevil because of its endophytic life style. Therefore, the use of biotechnological tools to produce insect-resistant transgenic plants represents an important strategy to reduce the damage to cotton plants caused by the boll weevil. The present study focuses on the identification of novel molecules that show improved toxicity against the cotton boll weevil. In vitro directed molecular evolution through DNA shuffling and phage display screening was applied to enhance the insecticidal activity of variants of the Cry8Ka1 protein of Bacillus thuringiensis. Bioassays carried out with A. grandis larvae revealed that the LC50 of the screened mutant Cry8Ka5 toxin was 3.15-fold higher than the wild-type Cry8Ka1 toxin. Homology modelling of Cry8Ka1 and the Cry8Ka5 mutant suggested that both proteins retained the typical three-domain Cry family structure. The mutated residues were located mostly in loops and appeared unlikely to interfere with molecular stability. The improved toxicity of the Cry8Ka5 mutant obtained in this study will allow the generation of a transgenic cotton event with improved potential to control A. grandis.

Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis

Directory of Open Access Journals (Sweden)

Gomes José E

2011-09-01

Full Text Available Abstract Background The cotton boll weevil (Anthonomus grandis is a serious insect-pest in the Americas, particularly in Brazil. The use of chemical or biological insect control is not effective against the cotton boll weevil because of its endophytic life style. Therefore, the use of biotechnological tools to produce insect-resistant transgenic plants represents an important strategy to reduce the damage to cotton plants caused by the boll weevil. The present study focuses on the identification of novel molecules that show improved toxicity against the cotton boll weevil. In vitro directed molecular evolution through DNA shuffling and phage display screening was applied to enhance the insecticidal activity of variants of the Cry8Ka1 protein of Bacillus thuringiensis. Results Bioassays carried out with A. grandis larvae revealed that the LC50 of the screened mutant Cry8Ka5 toxin was 3.15-fold higher than the wild-type Cry8Ka1 toxin. Homology modelling of Cry8Ka1 and the Cry8Ka5 mutant suggested that both proteins retained the typical three-domain Cry family structure. The mutated residues were located mostly in loops and appeared unlikely to interfere with molecular stability. Conclusions The improved toxicity of the Cry8Ka5 mutant obtained in this study will allow the generation of a transgenic cotton event with improved potential to control A. grandis.

Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

Science.gov (United States)

Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

2014-12-01

Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

PERIODS OF WEED INTERFERENCE ON TRANSGENIC COTTON ‘IMACD 6001LL’

Directory of Open Access Journals (Sweden)

MARCOS PAULO DA SILVA

2016-01-01

Full Text Available The objective of this study was to determine the periods of weed interference and its impact on productivity of cotton 'IMACD 6001LL'. The experiment was conducted in Jaboticabal, São Paulo, the second crop in 2011 and consisted of two treatment groups: the first culture remained free of competing weeds since of emergence up different periods of its development: (0-15 , 0-25, 0-35, 0-45, 0-55, 0-65, 0-75 and 0-183 days - harvest. In the second treatment group was held to the contrary: the crop was in harmony with the weeds since of emergence up to the same stages of development described above. The treatments were arranged in a randomized block design in four replications. During these periods was evaluated dry matter accumulation by weeds. The cotton yield data were subjected to regression analysis and resulting in a CPWC of 35 DAE, the CPWR was 133 DAE and .The weed community was composed mainly of Raphanus raphanistrum, Amaranthus spp., Cyperus rotundus, Alternanthera tenella and Eleusine indica. Living with this community throughout the cycle resulted in reduction almost 85% in cotton yield.

The discrimination of (non-denim) blue cotton.

Science.gov (United States)

Palmer, Ray; Hutchinson, William; Fryer, Verity

2009-03-01

This study was conducted to determine the degree of discrimination obtained between non-denim blue cotton fibres using visible-UV range microspectrophotometry alone. To this end, samples of fibres were taken from 100, nondenim, blue cotton, outer garments, including t-shirts, trousers and jumpers and subjected to analysis by both visible and UV range microspectrophotometry. The results obtained from the samples of each garment were compared to determine if they 'matched' or not. From an initial visual comparison of the garments it was possible to subdivide the samples into two populations consisting of 73 'dark blue' garments and 27 'mid-blue' garments. It was found that of the 73 'dark blue' garments, 22 distinct sub-populations could be distinguished using visible range MSP, this figure being increased to 43 when the analysis was extended into the UVW range. In the case of the 27 'mid-blue' garments, 9 distinct sub-populations were discriminated using visible range MSP, this figure being increased to 17 when the analysis was extended into the UV range. The discriminating power (i.e., the number of discriminated pairs divided by the number of possible pairs) of visible range microspectrophotometry was calculated as 0.89 for 'mid-blue' garments and 0.87 for 'dark blue' garments. Extending microspectrophotometry into the UV range increased discrimination by 7%, giving a discriminating power of 0.96 for both mid and dark blue cotton fibres which was similar to that reported by a previous study where this method was combined with light and fluorescence microscopy. Intra-garment variation was found to be negligible. The implications of this study for casework are discussed and a revised analytical pathway for the comparison of this fibre type/colour combination using microspectrophotometry as a primary screening tool, is proposed.

RNA interference of GhPEPC2 enhanced seed oil accumulation and salt tolerance in Upland cotton.

Science.gov (United States)

Zhao, Yanpeng; Huang, Yi; Wang, Yumei; Cui, Yupeng; Liu, Zhengjie; Hua, Jinping

2018-06-01

Phosphoenolpyruvate carboxylase (PEPCase) mainly produces oxaloacetic acid for tricarboxylic acid (TCA) cycle. Here we reported that GhPEPC2 silencing with PEPC2-RNAi vector could regulate oil and protein accumulation in cottonseeds. In GhPEPC2 transgenic plants, PEPCase activities in immature embryos were significantly reduced, and the oil content in seed kernel was increased 7.3 percentages, whereas total proteins decreased 5.65 percentages. Compared to wild type, agronomical traits of transgenic plant were obviously unaffected. Furthermore, gene expression profile of GhPEPC2 transgenic seeds were investigated using RNA-seq, most lipid synthesis related genes were up-regulated, but amino acid metabolic related genes were down-regulated. In addition, the GhPEPC2 transgenic cotton seedlings were stressed using sodium salts at seedling stage, and the salt tolerance was significantly enhanced. Our observations of GhPEPC2 in cotton would shade light on understanding the regulation of oil content, protein accumulation and salt tolerance enhancement in other plants. Copyright © 2018 Elsevier B.V. All rights reserved.

Effects of temperature on the feeding behavior of Alabama argillacea (Hübner (Lepidoptera: Noctuidae on Bt and non-Bt cotton plants

Directory of Open Access Journals (Sweden)

FRANCISCO S. RAMALHO

2017-12-01

Full Text Available ABSTRACT The host acceptance behavior and environmental factors as temperature affect the feeding behavior of Lepidoptera pests. Thus, they must be considered in studies about the risk potential of resistance evolution. The current study sets the differences in the feeding behavior of neonate Alabama argillacea (Hübner (Lepidoptera: Noctuidae larvae exposed to Bt and non-Bt cotton plants, under different temperatures and time gap after hatching. Two cotton cultivars were used: the Bt (DP 404 BG - bollgard and the non-transformed isoline, DP 4049. We found that the feeding behavior of neonate A. argillacea is significantly different between Bt and non-Bt cotton. Based on the number of larvae with vegetal tissue in their gut found on the plant and in the organza as well as on the amount of vegetal tissue ingested by the larvae. A. argillacea shows feeding preference for non-Bt cotton plants, in comparison to that on the Bt. However, factors such as temperature and exposure time may affect detection capacity and plant abandonment by the larvae and it results in lower ingestion of vegetal tissue. Such results are relevant to handle the resistance of Bt cotton cultivars to A. argillacea and they also enable determining how the cotton seeds mix will be a feasible handling option to hold back resistance evolution in A. argillacea populations on Bt cotton, when it is compared to other refuge strategies. The results can also be useful to determine which refuge distribution of plants is more effective for handling Bt cotton resistance to A. argillacea.

Changes in Actinomycetes community structure under the influence of Bt transgenic brinjal crop in a tropical agroecosystem.

Science.gov (United States)

Singh, Amit Kishore; Singh, Major; Dubey, Suresh Kumar

2013-05-29

The global area under brinjal cultivation is expected to be 1.85 million hectare with total fruit production about 32 million metric tons (MTs). Brinjal cultivars are susceptible to a variety of stresses that significantly limit productivity. The most important biotic stress is caused by the Brinjal fruit and shoot Borer (FSB) forcing farmers to deploy high doses of insecticides; a matter of serious health concern. Therefore, to control the adverse effect of insecticides on the environment including the soil, transgenic technology has emerged as the effective alternative. However, the reports, regarding the nature of interaction of transgenic crops with the native microbial community are inconsistent. The effect of a Bt transgenic brinjal expressing the bio-insecticidal protein (Cry1Ac) on the rhizospheric community of actinomycetes has been assessed and compared with its non-transgenic counterpart. Significant variation in the organic carbon observed between the crops (non-Bt and Bt brinjal) may be due to changes in root exudates quality and composition mediated by genetic attributes of Bt transgenic brinjal. Real time quantitative PCR indicated significant differences in the actinomycetes- specific 16S rRNA gene copy numbers between the non-Bt (5.62-27.86) × 1011 g-1 dws and Bt brinjal planted soil (5.62-24.04) × 1011 g-1 dws. Phylogenetic analysis indicated 14 and 11, actinomycetes related groups in soil with non-Bt and Bt brinjal crop, respectively. Micrococaceaea and Nocardiodaceae were the dominant groups in pre-vegetation, branching, flowering, maturation and post-harvest stage. However, Promicromonosporaceae, Streptosporangiaceae, Mycobacteriaceae, Geodermatophilaceae, Frankiaceae, Kineosporaceae, Actisymmetaceae and Streptomycetaceae were exclusively detected in a few stages in non-Bt brinjal rhizosphere soil while Nakamurellaceae, Corynebactericeae, Thermomonosporaceae and Pseudonocardiaceae in Bt brinjal counterpart. Field trails envisage

19 CFR 10.425 - Transit and transshipment of non-originating cotton or man-made fiber fabric or apparel goods.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 1 2010-04-01 2010-04-01 false Transit and transshipment of non-originating cotton or man-made fiber fabric or apparel goods. 10.425 Section 10.425 Customs Duties U.S. CUSTOMS AND... § 10.425 Transit and transshipment of non-originating cotton or man-made fiber fabric or apparel goods...

Quantification of toxins in a Cry1Ac?+?CpTI cotton cultivar and its potential effects on the honey bee Apis mellifera L.

OpenAIRE

Han, Peng; Niu, Chang-Ying; Lei, Chao-Liang; Cui, Jin-Jie; Desneux, Nicolas

2010-01-01

Transgenic Cry1Ac?+?CpTI cotton (CCRI41) is increasingly planted throughout China. However, negative effects of this cultivar on the honey bee Apis mellifera L., the most important pollinator for cultivated ecosystem, remained poorly investigated. The objective of our study was to evaluate the potential side effects of transgenic Cry1Ac?+?CpTI pollen from cotton on young adult honey bees A. mellifera L. Two points emphasized the significance of our study: (1) A higher expression level of inse...

Transgenic plants with enhanced growth characteristics

Energy Technology Data Exchange (ETDEWEB)

Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

2018-01-09

The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

Transgenic plants with enhanced growth characteristics

Energy Technology Data Exchange (ETDEWEB)

Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

2016-09-06

The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

Performance of some transgenic cotton cultivars against insect pest complex, virus incidence and yield

International Nuclear Information System (INIS)

Babar, T.K.; Karar, H.; Hasnain, M.; Saleem, M.; Ali, A.

2013-01-01

Five cultivars of cotton i.e., IR4-NIBGE, IR5-NIBGE Bt-121, Sitara-10M and Sitara-11M were screened for resistance against insect pest complex and Cotton Leaf Curl Virus (CLCuV) incidence in the research area of Cotton Research Station, Multan. The result depicted that the most resistant variety against jassids was IR4-NIBGE and Sitara-11M whereas IR4-NIBGE showed the maximum resistance against whitefly infestation. The least susceptible variety to the infestation of thrips was Sitara-10M. The most susceptible variety to the prevalence of Red Cotton Bug (RCB) was IR4-NIBGE. The genotype Bt-121 showed the attack of spotted bollworm. The high population of Dusky Cotton Bug (DCB) was observed on Bt-121 throughout the season. The incidence of virus percentage increased with the passage of time; however, the variety IR5-NIBGE exhibited maximum level of tolerance. Variety Bt-121 gave the maximum yield i.e., 1852 kg per acre followed by IR5-NIBGE, Sitara-11M, Sitara-10M 1584, 1503, 1466 kg per acre respectively. Our results suggest that IR4-NIBGE and Sitara -11M are comparatively tolerant to jassids and whitefly which are the yield losing pest. So IR4-NIBGE and Sitara -11M varieties can be included in IPM programme for the management of these voracious pests. (author)

Functional Characterization of Cotton GaMYB62L, a Novel R2R3 TF in Transgenic Arabidopsis.

Directory of Open Access Journals (Sweden)

Hamama Islam Butt

Full Text Available Drought stress can trigger the production of ABA in plants, in response to adverse conditions, which induces the transcript of stress-related marker genes. The R2R3 MYB TFs are implicated in regulation of various plants developmental, metabolic and multiple environmental stress responses. Here, a R2R3-MYB cloned gene, GaMYB62L, was transformed in Arabidopsis and was functionally characterized. The GaMYB62L protein contains two SANT domains with a conserved R2R3 imperfect repeats. The GaMYB62L cDNA is 1,017 bp with a CDS of 879, encodes a 292-residue polypeptide with MW of 38.78 kD and a pI value of 8.91. Overexpressed GaMYB62L transgenic Arabidopsis have increased proline and chlorophyll content, superior seed germination rate under salt and osmotic stress, less water loss rate with reduced stomatal apertures, high drought avoidance as compared to WT on water deprivation and also significant plant survival rates at low temperature. In addition, overexpressed GaMYB62L lines were more sensitive to ABA mediated germination and root elongation assay. Moreover, ABA induced GaMYB62L overexpression, enhanced the expression of ABA stress related marker genes like RD22, COR15A, ADH1, and RD29A. Together, overexpression of GaMYB62L suggested having developed better drought, salt and cold tolerance in transgenic Arabidopsis and thus presented it as a prospective candidate gene to achieve better abiotic stress tolerance in cotton crop.

Drought coping strategies in cotton: increased crop per drop.

Science.gov (United States)

Ullah, Abid; Sun, Heng; Yang, Xiyan; Zhang, Xianlong

2017-03-01

The growth and yield of many crops, including cotton, are affected by water deficit. Cotton has evolved drought specific as well as general morpho-physiological, biochemical and molecular responses to drought stress, which are discussed in this review. The key physiological responses against drought stress in cotton, including stomata closing, root development, cellular adaptations, photosynthesis, abscisic acid (ABA) and jasmonic acid (JA) production and reactive oxygen species (ROS) scavenging, have been identified by researchers. Drought stress induces the expression of stress-related transcription factors and genes, such as ROS scavenging, ABA or mitogen-activated protein kinases (MAPK) signalling genes, which activate various drought-related pathways to induce tolerance in the plant. It is crucial to elucidate and induce drought-tolerant traits via quantitative trait loci (QTL) analysis, transgenic approaches and exogenous application of substances. The current review article highlights the natural as well as engineered drought tolerance strategies in cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

A method for the production and expedient screening of CRISPR/Cas9-mediated non-transgenic mutant plants.

Science.gov (United States)

Chen, Longzheng; Li, Wei; Katin-Grazzini, Lorenzo; Ding, Jing; Gu, Xianbin; Li, Yanjun; Gu, Tingting; Wang, Ren; Lin, Xinchun; Deng, Ziniu; McAvoy, Richard J; Gmitter, Frederick G; Deng, Zhanao; Zhao, Yunde; Li, Yi

2018-01-01

Developing CRISPR/Cas9-mediated non-transgenic mutants in asexually propagated perennial crop plants is challenging but highly desirable. Here, we report a highly useful method using an Agrobacterium -mediated transient CRISPR/Cas9 gene expression system to create non-transgenic mutant plants without the need for sexual segregation. We have also developed a rapid, cost-effective, and high-throughput mutant screening protocol based on Illumina sequencing followed by high-resolution melting (HRM) analysis. Using tetraploid tobacco as a model species and the phytoene desaturase ( PDS ) gene as a target, we successfully created and expediently identified mutant plants, which were verified as tetra-allelic mutants. We produced pds mutant shoots at a rate of 47.5% from tobacco leaf explants, without the use of antibiotic selection. Among these pds plants, 17.2% were confirmed to be non-transgenic, for an overall non-transgenic mutation rate of 8.2%. Our method is reliable and effective in creating non-transgenic mutant plants without the need to segregate out transgenes through sexual reproduction. This method should be applicable to many economically important, heterozygous, perennial crop species that are more difficult to regenerate.

Incipient resistance of Helicoverpa punctigera to the Cry2Ab Bt toxin in Bollgard II cotton.

Directory of Open Access Journals (Sweden)

Sharon Downes

Full Text Available Combinations of dissimilar insecticidal proteins ("pyramids" within transgenic plants are predicted to delay the evolution of pest resistance for significantly longer than crops expressing a single transgene. Field-evolved resistance to Bacillus thuringiensis (Bt transgenic crops has been reported for first generation, single-toxin varieties and the Cry1 class of proteins. Our five year data set shows a significant exponential increase in the frequency of alleles conferring Cry2Ab resistance in Australian field populations of Helicoverpa punctigera since the adoption of a second generation, two-toxin Bt cotton expressing this insecticidal protein. Furthermore, the frequency of cry2Ab resistance alleles in populations from cropping areas is 8-fold higher than that found for populations from non-cropping regions. This report of field evolved resistance to a protein in a dual-toxin Bt-crop has precisely fulfilled the intended function of monitoring for resistance; namely, to provide an early warning of increases in frequencies that may lead to potential failures of the transgenic technology. Furthermore, it demonstrates that pyramids are not 'bullet proof' and that rapid evolution to Bt toxins in the Cry2 class is possible.

Gene flow from transgenic common beans expressing the bar gene.

Science.gov (United States)

Faria, Josias C; Carneiro, Geraldo E S; Aragão, Francisco J L

2010-01-01

Gene flow is a common phenomenon even in self-pollinated plant species. With the advent of genetically modified plants this subject has become of the utmost importance due to the need for controlling the spread of transgenes. This study was conducted to determine the occurrence and intensity of outcrossing in transgenic common beans. In order to evaluate the outcross rates, four experiments were conducted in Santo Antonio de Goiás (GO, Brazil) and one in Londrina (PR, Brazil), using transgenic cultivars resistant to the herbicide glufosinate ammonium and their conventional counterparts as recipients of the transgene. Experiments with cv. Olathe Pinto and the transgenic line Olathe M1/4 were conducted in a completely randomized design with ten replications for three years in one location, whereas the experiments with cv. Pérola and the transgenic line Pérola M1/4 were conducted at two locations for one year, with the transgenic cultivar surrounded on all sides by the conventional counterpart. The outcross occurred at a negligible rate of 0.00741% in cv. Pérola, while none was observed (0.0%) in cv. Olathe Pinto. The frequency of gene flow was cultivar dependent and most of the observed outcross was within 2.5 m from the edge of the pollen source. Index terms: Phaseolus vulgaris, outcross, glufosinate ammonium.

Quantification of toxins in a Cry1Ac + CpTI cotton cultivar and its potential effects on the honey bee Apis mellifera L.

Science.gov (United States)

Han, Peng; Niu, Chang-Ying; Lei, Chao-Liang; Cui, Jin-Jie; Desneux, Nicolas

2010-11-01

Transgenic Cry1Ac + CpTI cotton (CCRI41) is increasingly planted throughout China. However, negative effects of this cultivar on the honey bee Apis mellifera L., the most important pollinator for cultivated ecosystem, remained poorly investigated. The objective of our study was to evaluate the potential side effects of transgenic Cry1Ac + CpTI pollen from cotton on young adult honey bees A. mellifera L. Two points emphasized the significance of our study: (1) A higher expression level of insecticidal protein Cry1Ac in pollen tissues was detected (when compared with previous reports). In particular, Cry1Ac protein was detected at 300 ± 4.52 ng g(-1) [part per billion (ppb)] in pollen collected in July, (2) Effects on chronic mortality and feeding behaviour in honey bees were evaluated using a no-choice dietary feeding protocol with treated pollen, which guarantee the highest exposure level to bees potentially occurring in natural conditions (worst case scenario). Tests were also conducted using imidacloprid-treated pollen at a concentration of 48 ppb as positive control for sublethal effect on feeding behaviour. Our results suggested that Cry1Ac + CpTI pollen carried no lethal risk for honey bees. However, during a 7-day oral exposure to the various treatments (transgenic, imidacloprid-treated and control), honey bee feeding behaviour was disturbed and bees consumed significantly less CCRI41 cotton pollen than in the control group in which bees were exposed to conventional cotton pollen. It may indicate an antifeedant effect of CCRI41 pollen on honey bees and thus bees may be at risk because of large areas are planted with transgenic Bt cotton in China. This is the first report suggesting a potential sublethal effect of CCRI41 cotton pollen on honey bees. The implications of the results are discussed in terms of risk assessment for bees as well as for directions of future work involving risk assessment of CCRI41 cotton.

Evaluation of two cotton varieties CRSP1 and CRSP2 for genetic transformation efficiency, expression of transgenes Cry1Ac + Cry2A, GT gene and insect mortality

Directory of Open Access Journals (Sweden)

Arfan Ali

2016-03-01

Full Text Available Expression of the transgene with a desirable character in crop plant is the ultimate goal of transgenic research. Transformation of two Bt genes namely Cry1Ac and Cry2A cloned as separate cassette under 35S promoter in pKHG4 plant expression vector was done by using shoot apex cut method of Agrobacterium. Molecular confirmation of putative transgenic cotton plants for Cry1Ac, Cry2A and GT gene was done through PCR and ELISA. Transformation efficiency of CRSP-1 and CRSP-2 was calculated to be 1.2 and 0.8% for Cry1Ac while 0.9 and 0.6% for Cry2A and 1.5 and 0.7% for GTG respectively. CRSP-1 was found to adopt natural environment (acclimatized earlier than CRSP-2 when exposed to sunlight for one month. Expression of Cry1Ac, Cry2A and GTG was found to be 1.2, 1 and 1.3 ng/μl respectively for CRSP-1 as compared to CRSP-2 where expression was recorded to be 0.9, 0.5 and 0.9 ng/μl respectively. FISH analysis of the transgenic CRSP-1 and CRSP-2 demonstrated the presence of one and two copy numbers respectively. Similarly, the response of CRSP-1 against Glyphosate @1900 ml/acre was far better with almost negligible necrotic spot and efficient growth after spray as compared to CRSP-2 where some plants were found to have necrosis and negative control where the complete decay of plant was observed after seven days of spray assay. Similarly, almost 100% mortality of 2nd instar larvae of Heliothis armigera was recorded after three days in CRSP-1 as compared CRSP-2 where insect mortality was found to be less than 90%. Quantitatively speaking non transgenic plants were found with 23–90% leaf damage by insect, while CRSP-1 was with less than 5% and CRSP-2 with 17%. Taken together CRSP1 was found to have better insect control and weedicide resistance along with its natural ability of genetic modification and can be employed by the valuable farmers for better insect control and simultaneously for better production.

Insect pests management of bt cotton through the manipulation of different eco-friendly techniques

International Nuclear Information System (INIS)

Ahmad, N.; Khan, M.H.; Tofique, M.

2011-01-01

This study was designed to manage insect pests of Bt cotton through the manipulation of different eco-friendly techniques. A perusal of data, based on the overall performance of different treatments reflected that lowest population of jassids (0.29) was observed in bio-control treated Bt cotton followed by bio-control treated conventional cotton (0.41). Mean per leaf population of thrips was found lowest in insecticide treated Bt cotton (0.97) which was statically at par with bi-control treated conventional cotton (0.95), biocontrol treated Bt cotton (1.09) and colour traps treated Bt cotton (1.50). In case of white flies, bio-control treated Bt cotton and bio-control treated conventional cotton again proved effective in maintaining the population at lower levels per leaf (0.33 and 0.35 respectively). No bollworms infestation was recorded in transgenic cotton whereas higher attack of the same was observed in the untreated conventional cotton block. The best results were achieved with the application of bio-control agents in combination with Bt cotton resulting in least infestation by insect pests and maximum seed yield of 3657 kg/ha. The population of Chrysoperla carnea was significantly higher in Bt and conventional cotton treated with bio-control agents as compared to the other treatments. The parasitism percentage of Trichogramma chilonis was observed significantly higher in bio-control treated conventional cotton. The studies manifested that combination of bio-control technology with Bt cotton effectively preserves the local beneficial insect fauna indicating its potential to be used as integrated management system against different insect pests of cotton. (author)

Amplicon based RNA interference targeting V2 gene of cotton leaf curl Kokhran virus-Burewala strain can provide resistance in transgenic cotton plants

Science.gov (United States)

An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...

What are farmers really planting? Measuring the presence and effectiveness of Bt cotton in Pakistan.

Directory of Open Access Journals (Sweden)

David J Spielman

Full Text Available Genetically modified, insect-resistant Bacillus thuringiensis (Bt cotton is cultivated extensively in Pakistan. Past studies, however, have raised concerns about the prevalence of Bt cotton varieties possessing weak or nonperforming insect-resistance traits conferred by the cry gene. We examine this issue using data drawn from a representative sample of cotton-growing households that were surveyed in six agroclimatic zones spanning 28 districts in Pakistan in 2013, as well as measurements of Cry protein levels in cotton tissue samples collected from the sampled households' main fields. The resultant dataset combines information from 593 sampled households with corresponding plant tissue diagnostics from 70 days after sowing, as well as information from 589 sampled households with corresponding diagnostics from 120 days after sowing. Our analysis indicates that 11 percent of farmers believed they were cultivating Bt cotton when, in fact, the Cry toxin was not present in the tested tissue at 70 days after sowing (i.e., a Type I error. The analysis further indicates that 5 percent of farmers believed they were cultivating non-Bt cotton when, in fact, the Cry toxin was present in the tested tissue (i.e., a Type II error. In addition, 17 percent of all sampled farmers were uncertain whether or not they were cultivating Bt cotton. Overall, 33 percent of farmers either did not know or were mistaken in their beliefs about the presence of the cry gene in the cotton they cultivated. Results also indicate that toxic protein levels in the plant tissue samples occurred below threshold levels for lethality in a significant percentage of cases, although these measurements may also be affected by factors related to tissue sample collection, handling, storage, and testing procedures. Nonetheless, results strongly suggest wide variability both in farmers' beliefs and in gene expression. Such variability has implications for policy and regulation in Pakistan

Field performance of transgenic citrus trees: assessment of the long-term expression of uidA and nptII transgenes and its impact on relevant agronomic and phenotypic characteristics.

Science.gov (United States)

Pons, Elsa; Peris, Josep E; Peña, Leandro

2012-07-15

The future of genetic transformation as a tool for the improvement of fruit trees depends on the development of proper systems for the assessment of unintended effects in field-grown GM lines. In this study, we used eight transgenic lines of two different citrus types (sweet orange and citrange) transformed with the marker genes β-glucuronidase (uidA) and neomycin phosphotransferase II (nptII) as model systems to study for the first time in citrus the long-term stability of transgene expression and whether transgene-derived pleiotropic effects occur with regard to the morphology, development and fruit quality of orchard-grown GM citrus trees. The stability of the integration and expression of the transgenes was confirmed in 7-year-old, orchard-grown transgenic lines by Southern blot analysis and enzymatic assays (GUS and ELISA NPTII), respectively. Little seasonal variation was detected in the expression levels between plants of the same transgenic line in different organs and over the 3 years of analysis, confirming the absence of rearrangements and/or silencing of the transgenes after transferring the plants to field conditions. Comparisons between the GM citrus lines with their non-GM counterparts across the study years showed that the expression of these transgenes did not cause alterations of the main phenotypic and agronomic plant and fruit characteristics. However, when comparisons were performed between diploid and tetraploid transgenic citrange trees and/or between juvenile and mature transgenic sweet orange trees, significant and consistent differences were detected, indicating that factors other than their transgenic nature induced a much higher phenotypic variability. Our results indicate that transgene expression in GM citrus remains stable during long-term agricultural cultivation, without causing unexpected effects on crop characteristics. This study also shows that the transgenic citrus trees expressing the selectable marker genes that are most

Understanding the relationship between cotton fiber properties and non-cellulosic cell wall polysaccharides

DEFF Research Database (Denmark)

Rajasundaram, Dhivyaa; Runavot, Jean-Luc; Guo, Xiaoyuan

2014-01-01

cotton fibers, which are of both biological and industrial importance. To this end, we attempted to study cotton fiber characteristics together with glycan arrays using regression based approaches. Taking advantage of the comprehensive microarray polymer profiling technique (CoMPP), 32 cotton lines from...... different cotton species were studied. The glycan array was generated by sequential extraction of cell wall polysaccharides from mature cotton fibers and screening samples against eleven extensively characterized cell wall probes. Also, phenotypic characteristics of cotton fibers such as length, strength...

Response of AtNPR1-expressing cotton plants to Fusarium oxysporum f. sp. vasinfectum isolates

Science.gov (United States)

In our earlier investigation, we had demonstrated that transgenic cotton plants expressing AtNPR1 showed significant tolerance to Fusarium oxysporum f. sp. vasinfectum, isolate 11 (Fov11) and several other pathogens. The current study was designed to further characterize the nature of the protectio...

Comparative studies focusing on transgenic through cp4EPSPS gene and non-transgenic soybean plants: an analysis of protein species and enzymes.

Science.gov (United States)

Arruda, Sandra C C; Barbosa, Herbert S; Azevedo, Ricardo A; Arruda, Marco A Z

2013-11-20

This work evaluates the activity of a few key enzymes involved in combating reactive oxygen species (ROS), such as ascorbate peroxidase (EC 1.11.1.11), catalase (EC 1.11.1.6), glutathione reductase (EC 1.6.4.2), and superoxide dismutase (EC 1.15.1.1), as well as the concentration of malondialdehyde and hydrogen peroxide in transgenic and non-transgenic soybean leaves. Additionally, differential protein species from leaves of both genotypes were evaluated by applying a regulation factor of ≥1.8 to further corroborate the hypothesis that genetic modification itself can be a stress factor for these plants. For this task, transgenic soybean plants were obtained from seeds modified with the cp4EPSPS gene. The results revealed higher activities of all evaluated enzymes in transgenic than in non-transgenic soybean leaves (ranging from 13.8 to 70.1%), as well as higher concentrations of malondialdehyde and hydrogen peroxide in transgenic soybean leaves, clearly indicating a condition of oxidative stress established in the transgenic genotype. Additionally, 47 proteins were differentially abundant when comparing the leaves of both plants, with 26 species accurately identified, including the protein involved in the genetic modification (CP4EPSPS). From these results, it is possible to conclude that the plant is searching for a new equilibrium to maintain its metabolism because the stress condition is being maintained within levels that can be tolerated by the plant. The present paper is the first one in the literature where are shown translational aspects involving plant stress and the genetic modification for soybean involving the cp4 EPSPS gene. The main biological importance of this work is to make possible the demystification of the genetic modification, allowing answers for some questions that still remain unknown, and enlarge our knowledge about genetically modified organisms. This article is part of a Special Issue entitled: Translational Plant Proteomics. Copyright

Agrobacterium-mediated transformation of cotton (Gossypium hirsutum) shoot apex with a fungal phytase gene improves phosphorus acquisition.

Science.gov (United States)

Ma, Zhiying; Liu, Jianfeng; Wang, Xingfen

2013-01-01

Cotton is an important world economic crop plant. It is considered that cotton is recalcitrant to in vitro proliferation. Somatic embryogenesis and plant regeneration has been successful by using hypocotyl, whereas it is highly genotype dependent. Here, a genotype-independent cotton regeneration protocol from shoot apices is presented. Shoot apices from 3- to 5-day-old seedlings of cotton are infected with an Agrobacterium strain, EHA105, carrying the binary vector pC-KSA contained phytase gene (phyA) and the marker gene neomycin phosphotransferase (NPTII), and directly regenerated as shoots in vitro. Rooted shoots can be obtained within 6-8 weeks. Plants that survived by leaf painting kanamycin (kan) were -further analyzed by DNA and RNA blottings. The transgenic plants with increased the phosphorus (P) acquisition efficiency were obtained following the transformation method.

Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

Science.gov (United States)

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

Metabolism of the herbicide glufosinate-ammonium in plant cell cultures of transgenic (rhizomania-resistant) and non-transgenic sugarbeet (Beta vulgaris), carrot (Daucus carota), purple foxglove (Digitalis purpurea) and thorn apple (Datura stramonium).

Science.gov (United States)

Müller, B P; Zumdick, A; Schuphan, I; Schmidt, B

2001-01-01

The metabolism of the herbicide glufosinate-ammonium was investigated in heterotrophic cell suspension and callus cultures of transgenic (bar-gene) and non-transgenic sugarbeet (Beta vulgaris). Similar studies were performed with suspensions of carrot (Daucus carota), purple foxglove (Digitalis purpurea) and thorn apple (Datura stramonium). 14C-labelled chemicals were the (racemic) glufosinate, L-glufosinate, and D-glufosinate, as well as the metabolites N-acetyl L-glufosinate and 3-(hydroxymethylphosphinyl)propionic acid (MPP). Cellular absorption was generally low, but depended noticeably on plant species, substance and enantiomer. Portions of non-extractable residues ranged from 0.1% to 1.2% of applied 14C. Amounts of soluble metabolites resulting from glufosinate or L-glufosinate were between 0.0% and 26.7% of absorbed 14C in non-transgenic cultures and 28.2% and 59.9% in transgenic sugarbeet. D-Glufosinate, MPP and N-acetyl L-glufosinate proved to be stable. The main metabolite in transgenic sugarbeet was N-acetyl L-glufosinate, besides traces of MPP and 4-(hydroxymethylphosphinyl)butanoic acid (MPB). In non-transgenic sugarbeet, glufosinate was transformed to a limited extent to MPP and trace amounts of MPB. In carrot, D stramonium and D purpurea, MPP was also the main product; MPB was identified as a further trace metabolite in D stramonium and D purpurea.

Stochastic Corn Yield Response Functions to Nitrogen for Corn after Corn, Corn after Cotton, and Corn after Soybeans

OpenAIRE

Boyer, Christopher N.; Larson, James A.; Roberts, Roland K.; McClure, Angela T.; Tyler, Donald D.; Zhou, Vivian

2013-01-01

Deterministic and stochastic yield response plateau functions were estimated to determine the expected profit-maximizing nitrogen rates, yields, and net returns for corn grown after corn, cotton, and soybeans. The stochastic response functions were more appropriate than their deterministic counterparts, and the linear response stochastic plateau described the data the best. The profit-maximizing nitrogen rates were similar for corn after corn, cotton, and soybeans, but relative to corn after ...

Non-bleaching heather method for improved whiteness of greige cotton

Science.gov (United States)

In accordance with the color space theory known as additive light mixing, the presence of dispersed blue-dyed fiber reduced the overall yellowness of a blended greige fiber and they were perceived as “whiter”. Various intimate blends of blue-dyed cotton fiber in greige cotton fiber were analyzed for...

Flavonoid biosynthesis controls fiber color in naturally colored cotton

Directory of Open Access Journals (Sweden)

Hai-Feng Liu

2018-04-01

Full Text Available The existence of only natural brown and green cotton fibers (BCF and GCF, respectively, as well as poor fiber quality, limits the use of naturally colored cotton (Gossypium hirsutum L.. A better understanding of fiber pigment regulation is needed to surmount these obstacles. In this work, transcriptome analysis and quantitative reverse transcription PCR revealed that 13 and 9 phenylpropanoid (metabolic pathway genes were enriched during pigment synthesis, while the differential expression of phenylpropanoid (metabolic and flavonoid metabolic pathway genes occurred among BCF, GCF, and white cotton fibers (WCF. Silencing the chalcone flavanone isomerase gene in a BCF line resulted in three fiber phenotypes among offspring of the RNAi lines: BCF, almost WCF, and GCF. The lines with almost WCF suppressed chalcone flavanone isomerase, while the lines with GCF highly expressed the glucosyl transferase (3GT gene. Overexpression of the Gh3GT or Arabidopsis thaliana 3GT gene in BCF lines resulted in GCF. Additionally, the phenylpropanoid and flavonoid metabolites of BCF and GCF were significantly higher than those of WCF as assessed by a metabolomics analysis. Thus, the flavonoid biosynthetic pathway controls both brown and green pigmentation processes. Like natural colored fibers, the transgenic colored fibers were weaker and shorter than WCF. This study shows the potential of flavonoid pathway modifications to alter cotton fibers’ color and quality.

MicroRNA expression profiling during upland cotton gland forming ...

African Journals Online (AJOL)

Jane

2011-08-15

Aug 15, 2011 ... 2Key Laboratory of Cotton Genetic Improvement, Cotton Research Institute of the Chinese Academy of Agricultural. Sciences, Ministry of ... terpenoid aldehyde biosynthesis pathway, genetic engineering and molecular breeding of cotton. ... toxic to non-ruminant animals and humans, which means that large ...

CRISPR/Cas9-mediated targeted mutagenesis in upland cotton (Gossypium hirsutum L.).

Science.gov (United States)

Janga, Madhusudhana R; Campbell, LeAnne M; Rathore, Keerti S

2017-07-01

The clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR associated (Cas)9 protein system has emerged as a simple and efficient tool for genome editing in eukaryotic cells. It has been shown to be functional in several crop species, yet there are no reports on the application of this or any other genome editing technologies in the cotton plant. Cotton is an important crop that is grown mainly for its fiber, but its seed also serves as a useful source of edible oil and feed protein. Most of the commercially-grown cotton is tetraploid, thus making it much more difficult to target both sets of homeologous alleles. Therefore, in order to understand the efficacy of the CRISPR/Cas9 system to target a gene within the genome of cotton, we made use of a transgenic cotton line previously generated in our laboratory that had a single copy of the green fluorescent protein (GFP) gene integrated into its genome. We demonstrate, for the first time, the use of this powerful new tool in targeted knockout of a gene residing in the cotton genome. By following the loss of GFP fluorescence, we were able to observe the cells that had undergone targeted mutations as a result of CRISPR/Cas9 activity. In addition, we provide examples of the different types of indels obtained by Cas9-mediated cleavage of the GFP gene, guided by three independent sgRNAs. The results provide useful information that will help us target important native genes in the cotton plant in future.

The Cotton WRKY Gene GhWRKY41 Positively Regulates Salt and Drought Stress Tolerance in Transgenic Nicotiana benthamiana.

Directory of Open Access Journals (Sweden)

Xiaoqian Chu

Full Text Available WRKY transcription factors constitute a very large family of proteins in plants and participate in modulating plant biological processes, such as growth, development and stress responses. However, the exact roles of WRKY proteins are unclear, particularly in non-model plants. In this study, Gossypium hirsutum WRKY41 (GhWRKY41 was isolated and transformed into Nicotiana benthamiana. Our results showed that overexpression of GhWRKY41 enhanced the drought and salt stress tolerance of transgenic Nicotiana benthamiana. The transgenic plants exhibited lower malondialdehyde content and higher antioxidant enzyme activity, and the expression of antioxidant genes was upregulated in transgenic plants exposed to osmotic stress. A β-glucuronidase (GUS staining assay showed that GhWRKY41 was highly expressed in the stomata when plants were exposed to osmotic stress, and plants overexpressing GhWRKY41 exhibited enhanced stomatal closure when they were exposed to osmotic stress. Taken together, our findings demonstrate that GhWRKY41 may enhance plant tolerance to stress by functioning as a positive regulator of stoma closure and by regulating reactive oxygen species (ROS scavenging and the expression of antioxidant genes.

The crosstalk between Target of Rapamycin (TOR) and Jasmonic Acid (JA) signaling existing in Arabidopsis and cotton.

Science.gov (United States)

Song, Yun; Zhao, Ge; Zhang, Xueyan; Li, Linxuan; Xiong, Fangjie; Zhuo, Fengping; Zhang, Chaojun; Yang, Zuoren; Datla, Raju; Ren, Maozhi; Li, Fuguang

2017-04-04

Target of rapamycin (TOR) acts as an important regulator of cell growth, development and stress responses in most examined diploid eukaryotes. However, little is known about TOR in tetraploid species such as cotton. Here, we show that TORC1-S6K-RPS6, the major signaling components, are conserved and further expanded in cotton genome. Though the cotton seedlings are insensitive to rapamycin, AZD8055, the second-generation inhibitor of TOR, can significantly suppress the growth in cotton. Global transcriptome analysis revealed that genes associated with jasmonic acid (JA) biosynthesis and transduction were significantly altered in AZD8055 treated cotton seedlings, suggesting the potential crosstalk between TOR and JA signaling. Pharmacological and genetic approaches have been employed to get further insights into the molecular mechanism of the crosstalk between TOR and JA. Combination of AZD8055 with methyl jasmonate can synergistically inhibit cotton growth, and additionally JA levels were significantly increased when cotton seedlings were subjected to AZD8055. JA biosynthetic and signaling mutants including jar1, coi1-2 and myc2-2 displayed TOR inhibitor-resistant phenotypes, whereas COI1 overexpression transgenic lines and jaz10 exhibited sensitivity to AZD8055. Consistently, cotton JAZ can partially rescue TOR-suppressed phenotypes in Arabidopsis. These evidences revealed that the crosstalk between TOR and JA pathway operates in cotton and Arabidopsis.

Survival of Skin Graft between Transgenic Cloned Dogs and Non-Transgenic Cloned Dogs

Science.gov (United States)

Kim, Geon A; Oh, Hyun Ju; Kim, Min Jung; Jo, Young Kwang; Choi, Jin; Park, Jung Eun; Park, Eun Jung; Lim, Sang Hyun; Yoon, Byung Il; Kang, Sung Keun; Jang, Goo; Lee, Byeong Chun

2014-01-01

Whereas it has been assumed that genetically modified tissues or cells derived from somatic cell nuclear transfer (SCNT) should be accepted by a host of the same species, their immune compatibility has not been extensively explored. To identify acceptance of SCNT-derived cells or tissues, skin grafts were performed between cloned dogs that were identical except for their mitochondrial DNA (mtDNA) haplotypes and foreign gene. We showed here that differences in mtDNA haplotypes and genetic modification did not elicit immune responses in these dogs: 1) skin tissues from genetically-modified cloned dogs were successfully transplanted into genetically-modified cloned dogs with different mtDNA haplotype under three successive grafts over 63 days; and 2) non-transgenic cloned tissues were accepted into transgenic cloned syngeneic recipients with different mtDNA haplotypes and vice versa under two successive grafts over 63 days. In addition, expression of the inserted gene was maintained, being functional without eliciting graft rejection. In conclusion, these results show that transplanting genetically-modified tissues into normal, syngeneic or genetically-modified recipient dogs with different mtDNA haplotypes do not elicit skin graft rejection or affect expression of the inserted gene. Therefore, therapeutically valuable tissue derived from SCNT with genetic modification might be used safely in clinical applications for patients with diseased tissues. PMID:25372489

Superamphiphobic cotton fabrics with enhanced stability

Energy Technology Data Exchange (ETDEWEB)

Xu, Bi, E-mail: xubi@dhu.edu.cn [National Engineering Research Center for Dyeing and Finishing of Textiles, Donghua University, Shanghai 201620 (China); Key Laboratory of Science & Technology of Eco-Textile, Ministry of Education, Donghua University, Shanghai 201620 (China); College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Ding, Yinyan; Qu, Shaobo [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Cai, Zaisheng, E-mail: zshcai@dhu.edu [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China)

2015-11-30

Highlights: • Superamphiphobic cotton fabrics were prepared. • Water and hexadecane contact angels reach to 164.4° and 156.3°, respectively. • Nanoporous organically modified silica alcogel particles were synthesized. • The superamphiphobic cotton fabrics exhibit enhanced stability against abrasion, laundering and acid. - Abstract: Superamphiphobic cotton fabrics were prepared by alternately depositing organically modified silica alcogel (ormosil) particles onto chitosan precoated cotton fabrics and subsequent 1H, 1H, 2H, 2H-perfluorooctyltrimethoxysilane (PFOTMS) modification. Transmission electron microscopy and scanning electron microscopy images reveal that the ormosil particles display a fluffy, sponge-like nanoporous structure, and the entire cotton fiber surface is covered with highly porous networks. PFOTMS acts as not only a modifier to lower the surface energy of the cotton fabric but also a binder to enhance the coating stability against abrasion and washing. The treated cotton fabrics show highly liquid repellency with the water, cooking oil and hexadecane contact angels reaching to 164.4°, 160.1° and 156.3°, respectively. Meanwhile, the treated cotton fabrics exhibit good abrasion resistance and high laundering durability, which can withstand 10,000 cycles of abrasion and 30 cycles of machine wash without apparently changing the superamphiphobicity. The superamphiphobic cotton fabric also shows high acid stability, and can withstand 98% H{sub 2}SO{sub 4}. Moreover, the superamphiphobic coating has almost no influence on the other physical properties of the cotton fabrics including tensile strength, whiteness and air permeability. This durable non-wetting surface may provide a wide range of new applications in the future.

Helper-dependent adenovirus achieve more efficient and persistent liver transgene expression in non-human primates under immunosuppression.

Science.gov (United States)

Unzu, C; Melero, I; Hervás-Stubbs, S; Sampedro, A; Mancheño, U; Morales-Kastresana, A; Serrano-Mendioroz, I; de Salamanca, R E; Benito, A; Fontanellas, A

2015-11-01

Helper-dependent adenoviral (HDA) vectors constitute excellent gene therapy tools for metabolic liver diseases. We have previously shown that an HDA vector encoding human porphobilinogen deaminase (PBGD) corrects acute intermittent porphyria mice. Now, six non-human primates were injected in the left hepatic lobe with the PBGD-encoding HDA vector to study levels and persistence of transgene expression. Intrahepatic administration of 5 × 10(12) viral particles kg(-1) (10(10) infective units kg(-1)) of HDA only resulted in transient (≈14 weeks) transgene expression in one out of three individuals. In contrast, a more prolonged 90-day immunosuppressive regimen (tacrolimus, mycophenolate, rituximab and steroids) extended meaningful transgene expression for over 76 weeks in two out of two cases. Transgene expression under immunosuppression (IS) reached maximum levels 6 weeks after HDA administration and gradually declined reaching a stable plateau within the therapeutic range for acute porphyria. The non-injected liver lobes also expressed the transgene because of vector circulation. IS controlled anticapsid T-cell responses and decreased the induction of neutralizing antibodies. Re-administration of HDA-hPBGD at week +78 achieved therapeutically meaningful transgene expression only in those animals receiving IS again at the time of this second vector exposure. Overall, immunity against adenoviral capsids poses serious hurdles for long-term HDA-mediated liver transduction, which can be partially circumvented by pharmacological IS.

Increased frequency of pink bollworm resistance to Bt toxin Cry1Ac in China.

Directory of Open Access Journals (Sweden)

Peng Wan

Full Text Available Transgenic crops producing insecticidal proteins from Bacillus thuringiensis (Bt kill some key insect pests, but evolution of resistance by pests can reduce their efficacy. The main approach for delaying pest adaptation to Bt crops uses non-Bt host plants as "refuges" to increase survival of susceptible pests. To delay evolution of pest resistance to transgenic cotton producing Bt toxin Cry1Ac, the United States and some other countries have required refuges of non-Bt cotton, while farmers in China have relied on "natural" refuges of non-Bt host plants other than cotton. The "natural" refuge strategy focuses on cotton bollworm (Helicoverpa armigera, the primary target of Bt cotton in China that attacks many crops, but it does not apply to another major pest, pink bollworm (Pectinophora gossypiella, which feeds almost entirely on cotton in China. Here we report data showing field-evolved resistance to Cry1Ac by pink bollworm in the Yangtze River Valley of China. Laboratory bioassay data from 51 field-derived strains show that the susceptibility to Cry1Ac was significantly lower during 2008 to 2010 than 2005 to 2007. The percentage of field populations yielding one or more survivors at a diagnostic concentration of Cry1Ac increased from 0% in 2005-2007 to 56% in 2008-2010. However, the median survival at the diagnostic concentration was only 1.6% from 2008 to 2010 and failure of Bt cotton to control pink bollworm has not been reported in China. The early detection of resistance reported here may promote proactive countermeasures, such as a switch to transgenic cotton producing toxins distinct from Cry1A toxins, increased planting of non-Bt cotton, and integration of other management tactics together with Bt cotton.

Non-enzymatic depolymerization of cotton cellulose by fungal mimicking metabolites

DEFF Research Database (Denmark)

Hastrup, Anne Christine Steenkjær; Howell, Caitlin; Jensen, Bo

2011-01-01

peroxide, iron, and oxalic acid. The former two are involved in the Fenton reaction in which they react to form hydroxyl radicals, which cause an accelerated depolymerization in cotton cellulose. We found the same reaction to be caused by both iron Fe3+ and Fe2+. A 10 mM oxalic acid solution showed...... significant depolymerization effect on cotton cellulose. An oxalic acid/sodium oxalate buffered pH gradient had an inhibitory effect on the reduction of cellulose polymers at increased pH values. The organic iron chelator, EDTA, was found to promote depolymerization of cellulose in combination with Fenton......’s reagents, but inhibited the effect of oxalic acid in the absence of iron and hydrogen peroxide. Manganese was tested to see if metals other than iron could generate a significant impact on the degree of polymerization (DP) in cotton cellulose. Depolymerizing properties comparable to iron were seen...

Fourier Transform Infrared Spectroscopy (FT-IR) and Simple Algorithm Analysis for Rapid and Non-Destructive Assessment of Developmental Cotton Fibers.

Science.gov (United States)

Liu, Yongliang; Kim, Hee-Jin

2017-06-22

With cotton fiber growth or maturation, cellulose content in cotton fibers markedly increases. Traditional chemical methods have been developed to determine cellulose content, but it is time-consuming and labor-intensive, mostly owing to the slow hydrolysis process of fiber cellulose components. As one approach, the attenuated total reflection Fourier transform infrared (ATR FT-IR) spectroscopy technique has also been utilized to monitor cotton cellulose formation, by implementing various spectral interpretation strategies of both multivariate principal component analysis (PCA) and 1-, 2- or 3-band/-variable intensity or intensity ratios. The main objective of this study was to compare the correlations between cellulose content determined by chemical analysis and ATR FT-IR spectral indices acquired by the reported procedures, among developmental Texas Marker-1 (TM-1) and immature fiber ( im ) mutant cotton fibers. It was observed that the R value, CI IR , and the integrated intensity of the 895 cm -1 band exhibited strong and linear relationships with cellulose content. The results have demonstrated the suitability and utility of ATR FT-IR spectroscopy, combined with a simple algorithm analysis, in assessing cotton fiber cellulose content, maturity, and crystallinity in a manner which is rapid, routine, and non-destructive.

A General Approach to the Non-Invasive Imaging of Transgenes Using Cis-Linked Herpes Simplex Virus Thymidine Kinase

Directory of Open Access Journals (Sweden)

Juri G. Tjuvajev

1999-10-01

Full Text Available Non-invasive imaging of gene expression opens new prospects for the study of transgenic animals and the implementation of genetically based therapies in patients. We have sought to establish a general paradigm to enable whole body non-invasive imaging of any transgene. We show that the expression and imaging of HSV1-tk (a marker gene can be used to monitor the expression of the LacZ gene (a second gene under the transcriptional control of a single promoter within a bicistronic unit that includes a type II internal ribosomal entry site. In cells bearing a single copy of the vector, the expression of the two genes is proportional and constant, both in vitro and in vivo. We demonstrate that non-invasive imaging of HSV1-tk gene accurately reflects the topology and activity of the other cis-linked transgene.

Transgenic Epigenetics: Using Transgenic Organisms to Examine Epigenetic Phenomena

Directory of Open Access Journals (Sweden)

Lori A. McEachern

2012-01-01

Full Text Available Non-model organisms are generally more difficult and/or time consuming to work with than model organisms. In addition, epigenetic analysis of model organisms is facilitated by well-established protocols, and commercially-available reagents and kits that may not be available for, or previously tested on, non-model organisms. Given the evolutionary conservation and widespread nature of many epigenetic mechanisms, a powerful method to analyze epigenetic phenomena from non-model organisms would be to use transgenic model organisms containing an epigenetic region of interest from the non-model. Interestingly, while transgenic Drosophila and mice have provided significant insight into the molecular mechanisms and evolutionary conservation of the epigenetic processes that target epigenetic control regions in other model organisms, this method has so far been under-exploited for non-model organism epigenetic analysis. This paper details several experiments that have examined the epigenetic processes of genomic imprinting and paramutation, by transferring an epigenetic control region from one model organism to another. These cross-species experiments demonstrate that valuable insight into both the molecular mechanisms and evolutionary conservation of epigenetic processes may be obtained via transgenic experiments, which can then be used to guide further investigations and experiments in the species of interest.

Field evaluation of Bt cotton crop impact on nontarget pests: cotton aphid and boll weevil.

Science.gov (United States)

Sujii, E R; Togni, P H B; de A Ribeiro, P; de A Bernardes, T; Milane, P V G N; Paula, D P; Pires, C S S; Fontes, E M G

2013-02-01

Bt cotton plants expressing Cry1Ac protein have high specificity for the control of lepidopteran larvae. However, studies conducted in several countries have shown these plants have a differential impact on nontarget herbivores. The aim of this study was to compare the colonization rates and population abundance of the cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae) and the boll weevil, Anthonomus grandis Boheman (Coleoptera: Curculionidae), in plots of Bt (Nuopal) and non-Bt cotton (Delta Opal) in an experimental field in Brasilia, DF, Brazil. No difference was observed in the preference and colonization by winged aphids to plants from the two treatments. There was no significant difference in abundance of wingless aphids or in the production of winged aphids between treatments. Apparently, the parameters that control factors such as fecundity, survival, and dispersal were similar on both Bt and non-Bt plants. Monitoring of plants for coccinellids, a specialist predator of aphids, and ants that act on the dispersal of aphids among plants showed no significant difference between Bt and non-Bt plants, supporting the inference above. Regarding the effect on boll weevil, there was also no significant difference between treatments in the total number of fruiting structures attacked in each plot, the percentage of fruiting structures attacked per plant or on the number of weevils emerging from fruits with boll weevil damage from egg-laying, when damaged fruit samples were held in the laboratory. Based on these results, we conclude that there is no impact of Bt cotton crop expressing Cry1Ac on the nontarget herbivores tested under field conditions.

Double layer approach to create durable superhydrophobicity on cotton fabric using nano silica and auxiliary non fluorinated materials

Energy Technology Data Exchange (ETDEWEB)

Manatunga, Danushika Charyangi [Sri Lanka Institute of Nanotechnology, Nanotechnology & Science Park, Mahenwatte, Pitipana, Homagama (Sri Lanka); Silva, Rohini M. de [Department of Chemistry, University of Colombo, Colombo 03 (Sri Lanka); Nalin de Silva, K.M., E-mail: nalinds@slintec.lk [Sri Lanka Institute of Nanotechnology, Nanotechnology & Science Park, Mahenwatte, Pitipana, Homagama (Sri Lanka); Department of Chemistry, University of Colombo, Colombo 03 (Sri Lanka)

2016-01-01

Graphical abstract: - Highlights: • Superhydrophobicity using nonfluorinated agents on cotton roughened with nanosilica. • Sol–gel method to hydrophobize with HDTMS, SA, OTES, and HDTMS/SA HDTMS/OTES hybrids. • WCA of 150° or greater with the treatment. • Increased hydrophobicity and soil repellency obtained when a hybrid mixture is used. • Combinational treatment is effective when compared with the fluorosilane treatment. - Abstract: Creation of differential superhydrophobicity by applying different non-fluorinated hydrophobization agents on a cotton fabric roughened with silica nanoparticles was studied. Cotton fabric surface has been functionalized with silica nanoparticles and further hydrophobized with different hydrophobic agents such as hexadecyltrimethoxy silane (HDTMS), stearic acid (SA), triethoxyoctyl silane (OTES) and hybrid mixtures of HDTMS/SA and HDTMS/OTES. The cotton fabrics before and after the treatment were characterized using scanning electron microscopy (SEM), atomic force microscopy (AFM) and thermogravimetric analysis (TGA). The wetting behavior of cotton samples was investigated by water contact angle (WCA) measurement, water uptake, water repellency and soil repellency testing. The treated fabrics exhibited excellent water repellency and high water contact angles (WCA). When the mixture of two hydrophobization agents such as HDTMS/OTES and HDTMS/SA is used, the water contact angle has increased (145°–160°) compared to systems containing HDTMS, OTES, SA alone (130°–140°). It was also noted that this fabricated double layer (silica + hydrophobization agent) was robust even after applying harsh washing conditions and there is an excellent anti-soiling effect observed over different stains. Therefore superhydrophobic cotton surfaces with high WCA and soil repellency could be obtained with silica and mixture of hydrophobization agents which are cost effective and environmentally friendly when compared with the fluorosilane

Characterization and comparison of transgenic Artemisia annua GYR and wild-type NON-GYR plants in an environmental release trial.

Science.gov (United States)

Liu, H; Wu, G G; Wang, J B; Wu, X; Bai, L; Jiang, W; Lv, B B; Pan, A H; Jia, J W; Li, P; Zhao, K; Jiang, L X; Tang, X M

2016-08-26

The anti-malarial drug, artemisinin, is quite expensive as a result of its slow content in Artemisia annua. Recent investigations have suggested that genetic engineering of A. annua is a promising approach to improve the yield of artemisinin. In this study, the transgenic A. annua strain GYR, which has high artemisinin content, was evaluated in an environmental release trial. First, GYR plants were compared with the wild-type variety NON-GYR, with regard to phenotypic characters (plant height, crown width, stem diameter, germination rate, leaf dry weight, 1000-seed weight, leave shape). Second, stress resistance in the two varieties (salt, drought, herbicide, and cold resistance) was evaluated under different experimental conditions. Finally, gene flow was estimated. The results indicated that there were significant differences in several agronomic traits (plant height, stem diameter, and leave dry weight) between the transgenic GYR and NON-GYR plants. Salt stress in transgenic and control plants was similar, except under high NaCl concentrations (1.6%, w/w). Leaf water, proline, and MDA content (increased significantly) were significantly different. Transgenic A. annua GYR plants did not grow better than NON-GYR plants with respect to drought and herbicide resistance. The two varieties maintained vitality through the winter. Third, gene flow was studied in an environmental risk trial for transgenic GYR. The maximum gene flow frequency was 2.5%, while the maximum gene flow distance was 24.4 m; gene flow was not detected at 29.2 m at any direction. Our findings may provide an opportunity for risk assessment in future commercialization of transgenic A. annua varieties.

Hyperactive hypothalamus, motivated and non-distractible chronic overeating in ADAR2 transgenic mice.

Science.gov (United States)

Akubuiro, A; Bridget Zimmerman, M; Boles Ponto, L L; Walsh, S A; Sunderland, J; McCormick, L; Singh, M

2013-04-01

ADAR2 transgenic mice misexpressing the RNA editing enzyme ADAR2 (Adenosine Deaminase that act on RNA) show characteristics of overeating and experience adult onset obesity. Behavioral patterns and brain changes related to a possible addictive overeating in these transgenic mice were explored as transgenic mice display chronic hyperphagia. ADAR2 transgenic mice were assessed in their food preference and motivation to overeat in a competing reward environment with ad lib access to a running wheel and food. Metabolic activity of brain and peripheral tissue were assessed with [(18) F] fluorodeoxyglucose positron emission tomography (FDG-PET) and RNA expression of feeding related genes, ADAR2, dopamine and opiate receptors from the hypothalamus and striatum were examined. The results indicate that ADAR2 transgenic mice exhibit, (1) a food preference for diets with higher fat content, (2) significantly increased food intake that is non-distractible in a competing reward environment, (3) significantly increased messenger RNA (mRNA) expressions of ADAR2, serotonin 2C receptor (5HT2C R), D1, D2 and mu opioid receptors and no change in corticotropin-releasing hormone mRNAs and significantly reduced ADAR2 protein expression in the hypothalamus, (4) significantly increased D1 receptor and altered bioamines with no change in ADAR2, mu opioid and D2 receptor mRNA expression in the striatum and (5) significantly greater glucose metabolism in the hypothalamus, brain stem, right hippocampus, left and right mid brain regions and suprascapular peripheral tissue than controls. These results suggest that highly motivated and goal-oriented overeating behaviors of ADAR2 transgenic mice are associated with altered feeding, reward-related mRNAs and hyperactive brain mesolimbic region. Genes, Brain and Behavior © 2013 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

Synthesis of Cotton from Tossa Jute Fiber and Comparison with Original Cotton

Directory of Open Access Journals (Sweden)

Md. Mizanur Rahman

2015-01-01

Full Text Available Cotton fibers were synthesized from tossa jute and characteristics were compared with original cotton by using FTIR and TGA. The FTIR results indicated that the peak intensity of OH group from jute cotton fibers occurred at 3336 cm−1 whereas the peak intensity of original cotton fibers occurred at 3338 cm−1. This indicated that the synthesized cotton fiber properties were very similar to the original cotton fibers. The TGA result showed that maximum rate of mass loss, the onset of decomposition, end of decomposition, and activation energy of synthesized cotton were higher than original cotton. The activation energy of jute cotton fibers was higher than the original cotton fibers.

Sampling Strategies for Evaluating the Rate of Adventitious Transgene Presence in Non-Genetically Modified Crop Fields.

Science.gov (United States)

Makowski, David; Bancal, Rémi; Bensadoun, Arnaud; Monod, Hervé; Messéan, Antoine

2017-09-01

According to E.U. regulations, the maximum allowable rate of adventitious transgene presence in non-genetically modified (GM) crops is 0.9%. We compared four sampling methods for the detection of transgenic material in agricultural non-GM maize fields: random sampling, stratified sampling, random sampling + ratio reweighting, random sampling + regression reweighting. Random sampling involves simply sampling maize grains from different locations selected at random from the field concerned. The stratified and reweighting sampling methods make use of an auxiliary variable corresponding to the output of a gene-flow model (a zero-inflated Poisson model) simulating cross-pollination as a function of wind speed, wind direction, and distance to the closest GM maize field. With the stratified sampling method, an auxiliary variable is used to define several strata with contrasting transgene presence rates, and grains are then sampled at random from each stratum. With the two methods involving reweighting, grains are first sampled at random from various locations within the field, and the observations are then reweighted according to the auxiliary variable. Data collected from three maize fields were used to compare the four sampling methods, and the results were used to determine the extent to which transgene presence rate estimation was improved by the use of stratified and reweighting sampling methods. We found that transgene rate estimates were more accurate and that substantially smaller samples could be used with sampling strategies based on an auxiliary variable derived from a gene-flow model. © 2017 Society for Risk Analysis.

Cadmium-induced ultramorphological and physiological changes in leaves of two transgenic cotton cultivars and their wild relative

International Nuclear Information System (INIS)

Daud, M.K.; Variath, M.T.; Ali, Shafaqat; Najeeb, U.; Jamil, Muhammad; Hayat, Y.; Dawood, M.; Khan, Muhammad Imran; Zaffar, M.; Cheema, Sardar Alam; Tong, X.H.; Zhu Shuijin

2009-01-01

The present study describes cadmium-induced alterations in the leaves as well as at the whole plant level in two transgenic cotton cultivars (BR001 and GK30) and their wild relative (Coker 312) using both ultramorphological and physiological indices. With elevated levels of Cd (i.e. 10, 100, 1000 μM), the mean lengths of root, stem and leaf and leaf width as well as their fresh and dry biomasses linearly decreased over their respective controls. Moreover, root, stem and leaf water absorption capacities progressively stimulated, which were high in leaves followed by roots and stems. BR001 accumulated more cadmium followed by GK30 and Coker 312. Root and shoot cadmium uptakes were significantly and directly correlated with each other as well as with leaf, stem and root water absorption capacities. The ultrastructural modifications in leaf mesophyll cells were triggered with increase in Cd stress regime. They were more obvious in BR001 followed by GK30 and Coker 312. Changes in morphology of chloroplast, increase in number and size of starch grains as well as increase in number of plastoglobuli were the noticed qualitative effects of Cd on photosynthetic organ. Cd in the form of electron dense granules could be seen inside the vacuoles and attached to the cell walls in all these cultivars. From the present experiment, it can be well established that both apoplastic and symplastic bindings are involved in Cd detoxification in these cultivars. Absence of tonoplast invagination reveals that Cd toxic levels did not cause water stress in any cultivars. Additionally, these cultivars possess differential capabilities towards Cd accumulation and its sequestration.

A facile method to fabricate superhydrophobic cotton fabrics

Science.gov (United States)

Zhang, Ming; Wang, Shuliang; Wang, Chengyu; Li, Jian

2012-11-01

A facile and novel method for fabricating superhydrophobic cotton fabrics is described in the present work. The superhydrophobic surface has been prepared by utilizing cationic poly (dimethyldiallylammonium chloride) and silica particles together with subsequent modification of (heptadecafluoro-1,1,2,2-tetradecyl) trimethoxysilane. The size distribution of silica particles was measured by Particle Size Analyzer. The cotton textiles before and after treatment were characterized by using scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS). The wetting behavior of cotton samples was investigated by water contact angle measurement. Moreover, the superhydrophobic durability of coated cotton textiles has been evaluated by exposure, immersion and washing tests. The results show that the treated cotton fabrics exhibited excellent chemical stability and outstanding non-wettability with the WCA of 155 ± 2°, which offers an opportunity to accelerate the large-scale production of superhydrophobic textiles materials for new industrial applications.

Effect of pyramiding Bt and CpTI genes on resistance of cotton to Helicoverpa armigera (Lepidoptera: Noctuidae) under laboratory and field conditions

NARCIS (Netherlands)

Cui, J.J.; Luo, J.Y.; Werf, van der W.; Ma, Y.; Xia, J.Y.

2011-01-01

Transgenic cotton (Gossypium hirsutum L.) varieties, adapted to China, have been bred that express two genes for resistance to insects. the Cry1Ac gene from Bacillus thuringiensis (Berliner) (Bt), and a trypsin inhibitor gene from cowpea (CpTI). Effectiveness of the double gene modification in

A case to study population dynamics of bemisia tabaci and thrips tabaci on bt and non-bt cotton genotypes

International Nuclear Information System (INIS)

Akram, M.; Hussain, M.; Ahmed, S.; Hafeez, F.; Farooq, M.; Arshad, M.

2013-01-01

Studies were conducted to investigate the performance of eight bt and five non-bt cotton genotypes against whitefly and thrips and impact of abiotic factors on the population fluctuation of these sucking pests, at cotton research station, multan, during 2010 and 2011. The results exhibited that bt genotypes found more susceptible host for the whitefly and thirps than non-bt genotypes, during the course of years of study. Among bt genotypes, maximum and minimum temperature showed significant and positive effect on whitefly population whereas relative humidity exerted negative effect during 2010. During 2011, the effect of all the factors was non significant. On cumulative basis, there was positive correlation between population of whitefly and minimum temperature. But in case of non-bt, it has negative with maximum temperature whereas relative humidity had a positive effect on whitefly population. similar trend was observed for thrips population on bt varieties during both years but on non-bt varieties only minimum temperature exerted strong positive impact on thrips population. Hierarchical regression models for whitefly and thrips revealed that minimum temperature was the most important factor (Bt and non-Bt varieties). Maximum temperature was the major contributing factor for whitefly fluctuation on bt varieties during 2010. (author)

Toxicity to cotton boll weevil Anthonomus grandis of a trypsin inhibitor from chickpea seeds.

Science.gov (United States)

de P G Gomes, Angélica; Dias, Simoni C; Bloch, Carlos; Melo, Francislete R; Furtado, José R; Monnerat, Rose G; Grossi-de-Sá, Maria F; Franco, Octávio L

2005-02-01

Cotton (Gossypium hirsutum L.) is an important agricultural commodity, which is attacked by several pests such as the cotton boll weevil Anthonomus grandis. Adult A. grandis feed on fruits and leaf petioles, reducing drastically the crop production. The predominance of boll weevil digestive serine proteinases has motivated inhibitor screenings in order to discover new ones with the capability to reduce the digestion process. The present study describes a novel proteinase inhibitor from chickpea seeds (Cicer arietinum L.) and its effects against A. grandis. This inhibitor, named CaTI, was purified by using affinity Red-Sepharose Cl-6B chromatography, followed by reversed-phase HPLC (Vydac C18-TP). SDS-PAGE and MALDI-TOF analyses, showed a unique monomeric protein with a mass of 12,877 Da. Purified CaTI showed significant inhibitory activity against larval cotton boll weevil serine proteinases (78%) and against bovine pancreatic trypsin (73%), when analyzed by fluorimetric assays. Although the molecular mass of CaTI corresponded to alpha-amylase/trypsin bifunctional inhibitors masses, no inhibitory activity against insect and mammalian alpha-amylases was observed. In order to observe CaTI in vivo effects, an inhibitor rich fraction was added to an artificial diet at different concentrations. At 1.5% (w/w), CaTI caused severe development delay, several deformities and a mortality rate of approximately 45%. These results suggested that CaTI could be useful in the production of transgenic cotton plants with enhanced resistance toward cotton boll weevil.

Nutrient Uptake by High-Yielding Cotton Crop in Brazil

Directory of Open Access Journals (Sweden)

José Luís Vilela Vieira

2018-02-01

Full Text Available ABSTRACT: Determining nutrient uptake and accumulation rates by cotton crops is important to define management strategies, especially for transgenic varieties, which are cultivated using high-technology approaches that require substantial investment to maximize yield. Currently in Brazil, the states of Bahia and Mato Grosso are responsible for 84.4 % of the total cotton growing area. In the present study, two trials were conducted in 2013, one that involved planting FM 940 GLT, FM 980 GLT, and FM 913 GLT varieties in the state of Bahia and the other which involved FM 940 GLT and FM 980 GLT varieties in the state of Mato Grosso. The aim of the two trials was to represent the two regions that currently encompass the largest areas of cotton cultivation. Tissue samples, consisting of leaves, stems, and reproductive components, were collected eleven times during the crop cycle for determination of nutrient content and shoot dry matter. After weighing, plant tissue samples were dried and ground to determine nutrient contents. Because there were no overall differences in nutrient contents and biomass accumulation of the varieties during the crop cycle, we undertook joint analysis of the data from all varieties at each site. Favorable climatic conditions in Bahia promoted plant biomass production that was twice as much as plants grown in Mato Grosso, with cotton yields of 6.2 and 3.8 t ha−1 of lint and seed, respectively. The maximum nutrient accumulation occurred between 137-150 days after emergence (DAE for N; 143-148 for P; 172-185 for K; 100 for Ca; 144-149 for Mg; and 153-158 for S. Maximum uptake ranged from 218-362 kg ha−1 N; 26-53 kg ha−1 P; 233-506 kg ha−1 K; 91-202 kg ha−1 Ca; 28-44 kg ha−1 Mg; and 19-61 kg ha−1 S. On average, the sites revealed nutrient export of 14, 2, 23, 3, 2, and 2 kg t−1 of lint and seed for N, P, K, Ca, Mg, and S, respectively, with little variation among sites. Extraction of nutrients per area by cotton

Glyphostate-drift but not herbivory alters the rate of transgene flow from single and stacked trait transgenic canola (Brassica napus L.) to non-transgenic B. napus and B. rapa

Science.gov (United States)

While transgenic plants can offer agricultural benefits, the escape of transgenes out of crop fields is a major environmental concern. Escape of transgenic herbicide resistance has occurred between transgenic Brassica napus (canola) and weedy species in numerous locations. In t...

Use of ATR FT-IR spectroscopy in non-destructive and rapid assessment of developmental cotton fibers

Science.gov (United States)

The knowledge of chemical and compositional components in cotton fibers is of value to cotton breeders and growers for cotton enhancement and to textile processors for quality control. In this work, we applied the previously proposed simple algorithms to analyze the attenuated total reflection Fouri...

Transgenic plants expressing the AaIT/GNA fusion protein show increased resistance and toxicity to both chewing and sucking pests.

Science.gov (United States)

Liu, Shu-Min; Li, Jie; Zhu, Jin-Qi; Wang, Xiao-Wei; Wang, Cheng-Shu; Liu, Shu-Sheng; Chen, Xue-Xin; Li, Sheng

2016-04-01

The adoption of pest-resistant transgenic plants to reduce yield losses and decrease pesticide use has been successful. To achieve the goal of controlling both chewing and sucking pests in a given transgenic plant, we generated transgenic tobacco, Arabidopsis, and rice plants expressing the fusion protein, AaIT/GNA, in which an insecticidal scorpion venom neurotoxin (Androctonus australis toxin, AaIT) is fused to snowdrop lectin (Galanthus nivalis agglutinin, GNA). Compared with transgenic tobacco and Arabidopsis plants expressing AaIT or GNA, transgenic plants expressing AaIT/GNA exhibited increased resistance and toxicity to one chewing pest, the cotton bollworm, Helicoverpa armigera. Transgenic tobacco and rice plants expressing AaIT/GNA showed increased resistance and toxicity to two sucking pests, the whitefly, Bemisia tabaci, and the rice brown planthopper, Nilaparvata lugens, respectively. Moreover, in the field, transgenic rice plants expressing AaIT/GNA exhibited a significant improvement in grain yield when infested with N. lugens. This study shows that expressing the AaIT/GNA fusion protein in transgenic plants can be a useful approach for controlling pests, particularly sucking pests which are not susceptible to the toxin in Bt crops. © 2015 Institute of Zoology, Chinese Academy of Sciences.

Seletividade de amonio-glufosinate isolado e em mistura com pyrithiobac-sodium em algodoeiro transgênico LL® Selectivity of ammonium-glufosinate applied alone or in mixture with pyrithiobac sodium in transgenic LL® cotton

Directory of Open Access Journals (Sweden)

G.B.P. Braz

2012-12-01

Full Text Available Com a recente introdução no Brasil de variedades transgênicas de algodoeiro que apresentam resistência ao amonio-glufosinate (LL®, há escassez de informações tanto a respeito da seletividade de reaplicações desse herbicida, quanto no que se refere a misturas com outros herbicidas. Objetivou-se no presente trabalho avaliar a seletividade de aplicações sequenciais de amonio-glufosinate isolado e em associação com pyrithiobac-sodium em algodão transgênico LL®. Dessa forma, foi instalado um experimento em delineamento de blocos casualizados em arranjo fatorial (3x3+1, empregando-se oito repetições. O primeiro fator correspondeu à aplicação dos tratamentos amonio-glufosinate (500 g ha-1 e amonio-glufosinate + pyrithiobac-sodium (500 + 42 g ha-1 e 500 + 56 g ha-1. O segundo fator foi o número de aplicações sequenciais em pós-emergência do algodoeiro (uma, duas ou três. O tratamento adicional foi composto por testemunha sem aplicação de herbicida. A associação do pyrithiobac-sodium ao amonio-glufosinate causou maiores níveis de fitointoxicação inicial, embora não tenham havido mais sintomas duas semanas após as aplicações. A qualidade de fibra do algodoeiro não foi influenciada por nenhum dos tratamentos herbicidas. O amonio-glufosinate isolado foi seletivo para o algodão LL® em até três aplicações em pós-emergência. O algodoeiro apresentou ainda tolerância a uma aplicação da mistura de amonio-glufosinate + pyrithiobac-sodium, e não se observou qualquer efeito negativo sobre a produtividade de algodão em caroço.Due to the recent introduction of transgenic cotton varities with resistance to ammonium-glufosinate (LL® in Brazil, there is a lack of information related both to the selectivity of sequential reapplications of ammonium-glufosinate and to tank mixture with other herbicides. This work aimed to evaluate the selectivity of sequential applications of ammonium-glufosinate isolated or in

Transgenic and conventional Brazilian soybeans don't cause or prevent preneoplastic colon lesions or oxidative stress in a 90-day in vivo study

Directory of Open Access Journals (Sweden)

Felipe Augusto Sbruzzi

2013-08-01

Full Text Available OBJECTIVE: The study presents the results of a 90-day safety assessment of rats fed with four varieties of soybeans, BRS 245 RR and BRS Valiosa RR (transgenic, BRS 133 and MG BR46 Conquista (non-transgenic. METHODS: Diets were prepared by incorporating toasted soybean flour to a commercial diet at 1%, 10% or 20% weight In the in vivo experimental the rats' body weight, body weight gain, food consumption, number of aberrant crypt foci, oxidative stress biomarkers, urea and creatinine levels were analyzed and compared between experimental groups, as well as histopathological observations (digestive tract, liver, kidneys. RESULTS: The results indicate that glyphosate-tolerant soy varieties neither induce nor prevent aberrant crypt foci induction, nor do their conventional counterparts. Similarly, none of the four soybean varieties tested induced changes in the digestive tract, liver or kidney. Serum biochemical parameters were also unchanged. CONCLUSION: The consumption of both, conventional and transgenic soybeans, were insufficient to ameliorate dimethylhydrazine-induced oxidative stress.

China's Cotton Policy and the Impact of China's WTO Accession and Bt Cotton Adoption on the Chinese and U.S. Cotton Sectors

OpenAIRE

Cheng Fang; Bruce A. Babcock

2003-01-01

In this paper we provide an analysis of China's cotton policy and develop a framework to quantify the impact of both China's World Trade Organization (WTO) accession and Bt (Bacillus thuringiensis) cotton adoption on Chinese and U.S. cotton sectors. We use a Chinese cotton sector model consisting of supply, demand, price linkages, and textiles output equations. A two-stage framework model provides gross cropping area and total area for cotton and major subsitute crops from nine cotton-produci...

Brazilian Free-tailed Bats (Tadarida brasiliensis) as Insect Pest Regulators in Transgenic and Conventional Cotton Crops

Science.gov (United States)

During the past 12,000 years agricultural systems have transitioned from natural habitats to conventional agricultural regions, and recently to large areas of genetically- engineered (GE) croplands. This GE revolution occurred for cotton in a span of slightly more than a decade w...

Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement.

Science.gov (United States)

Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey

2015-05-01

Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines.

Production of transgenic pigs over-expressing the antiviral gene Mx1

Directory of Open Access Journals (Sweden)

Quanmei Yan

2014-01-01

Full Text Available The myxovirus resistance gene (Mx1 has a broad spectrum of antiviral activities. It is therefore an interesting candidate gene to improve disease resistance in farm animals. In this study, we report the use of somatic cell nuclear transfer (SCNT to produce transgenic pigs over-expressing the Mx1 gene. These transgenic pigs express approximately 15–25 times more Mx1 mRNA than non-transgenic pigs, and the protein level of Mx1 was also markedly enhanced. We challenged fibroblast cells isolated from the ear skin of transgenic and control pigs with influenza A virus and classical swine fever virus (CFSV. Indirect immunofluorescence assay (IFA revealed a profound decrease of influenza A proliferation in Mx1 transgenic cells. Growth kinetics showed an approximately 10-fold reduction of viral copies in the transgenic cells compared to non-transgenic controls. Additionally, we found that the Mx1 transgenic cells were more resistant to CSFV infection in comparison to non-transgenic cells. These results demonstrate that the Mx1 transgene can protect against viral infection in cells of transgenic pigs and indicate that the Mx1 transgene can be harnessed to develop disease-resistant pigs.

Impact of Bollgard cotton on Indian cotton production and Income of ...

Indian Academy of Sciences (India)

Impact of Bollgard cotton on Indian cotton production and Income of cotton farmers. Presentation made in the Seventy Second Annual Meeting Indian Academy of Sciences, Bangalore at Devi Ahilya Vishwavidyalaya Indore 11th November 2006.

Genotype-by-sowing date interaction effects on cotton yield and quality in irrigated condition of dera ismail khan, pakistan

International Nuclear Information System (INIS)

Usman, K.; Khan, S.; Ayatullah, A.

2016-01-01

Cotton is a major export commodity of Pakistan. It is affected by variable environmental conditions throughout the country which limits its production. A 2-year field study was conducted in 2012 and 2013 at Cotton Research Station, Dera Ismail Khan, Pakistan to evaluate the effects of six sowing dates on yield and quality attributes of four cotton genotypes. The experiments were laid out in split-plot within a randomized complete block design with three replications. Main plots treatments were six sowing dates, namely March 20, April 4, April 19, May 4, May 19, and June 3 while subplots treatments were four approved transgenic varieties of cotton (CIM-598, CIM-599, CIM-602, and Ali Akber-703). Results revealed that earlier planting produced more vegetative growth rather than lint yield while late planting induced flowering and boll formation when temperature was much cold that adversely affected cotton yield and quality. The results further indicate that the genotype CIM-599 scored first rank in number of bolls plant-1, boll weight, seed cotton yield, ginning out turn, fiber length, fiber strength, fiber fineness, and fiber uniformity when sown on April 19. CIM-598 was the next suitable genotype after CIM-599 which produced higher yield and quality traits in April 19 sowing. Earlier and later sowing than April 19 resulted in lower cotton yield and quality characters due to unfavorable environmental conditions and shorter growth period, respectively. Thus it is concluded that the genotype, CIM-599 sown on April 19 suits well to the study area and had the potential to optimize cotton yield and quality in irrigated condition of Dera Ismail Khan, Pakistan. (author)

Impact of efficient refuge policies for Bt cotton in India on world cotton trade

OpenAIRE

Singla, Rohit; Johnson, Phillip N.; Misra, Sukant K.

2010-01-01

India is a major cotton producing country in the world along with the U.S. and China. A change in the supply of and demand for cotton in the Indian market has the potential to have an impact on world cotton trade. This study evaluates the implications of efficient Bt cotton refuge policies in India on world and U.S. cotton markets. It can be hypothesized that increased refuge requirements for Bt cotton varieties in India could decrease the world supply of cotton because of the lower yield pot...

Dictionary of Cotton

Science.gov (United States)

The Dictionary of Cotton has over 2,000 terms and definitions that were compiled by 33 researchers. It reflects the ongoing commitment of the International Cotton Advisory Committee, through its Technical Information Section, to the spread of knowledge about cotton to all those who have an interest ...

Analysis of flavonoids and the flavonoid structural genes in brown fiber of upland cotton.

Directory of Open Access Journals (Sweden)

Hongjie Feng

Full Text Available BACKGROUND: As a result of changing consumer preferences, cotton (Gossypium Hirsutum L. from varieties with naturally colored fibers is becoming increasingly sought after in the textile industry. The molecular mechanisms leading to colored fiber development are still largely unknown, although it is expected that the color is derived from flavanoids. EXPERIMENTAL DESIGN: Firstly, four key genes of the flavonoid biosynthetic pathway in cotton (GhC4H, GhCHS, GhF3'H, and GhF3'5'H were cloned and studied their expression profiles during the development of brown- and white cotton fibers by QRT-PCR. And then, the concentrations of four components of the flavonoid biosynthetic pathway, naringenin, quercetin, kaempferol and myricetin in brown- and white fibers were analyzed at different developmental stages by HPLC. RESULT: The predicted proteins of the four flavonoid structural genes corresponding to these genes exhibit strong sequence similarity to their counterparts in various plant species. Transcript levels for all four genes were considerably higher in developing brown fibers than in white fibers from a near isogenic line (NIL. The contents of four flavonoids (naringenin, quercetin, kaempferol and myricetin were significantly higher in brown than in white fibers and corresponding to the biosynthetic gene expression levels. CONCLUSIONS: Flavonoid structural gene expression and flavonoid metabolism are important in the development of pigmentation in brown cotton fibers.

The Role of Transgenic Crops in the Future of Global Food and Feed

OpenAIRE

O. Škubna; H. Řezbová

2012-01-01

The paper is aimed on the problematic of biotech crops planting (GM, transgenic crops). The main aim of this paper is to analyze the trends in the main biotech crops planting groups in the sense of their use for food and feed in the future. The selected groups of biotech crops analyzed in this article are soybeans, maize (corn), cotton and rapeseed (canola). The used methods are chain and basic indexes and regression analysis of times series/ trend data - for predicting on next four years (20...

Various rates of k and Na influence growth, seed cotton yield and ionic ratio of two cotton varieties in soil culture

International Nuclear Information System (INIS)

Ali, L.; Maqsood, M.A.; Ashraf, M.

2009-01-01

Cotton is generally grown on alkaline calcareous soils in arid and semi-arid areas of the country. Sodium can interact with other earth cations like K, Ca and Mg. Therefore, a pot study was conducted to investigate the growth, yield and ionic response of two cotton varieties. Four levels of K and Na were developed after considering indigenous K, Na status in soil. The treatments of K+Na in mg/kg were adjusted as, 105+37.5, 135+30 135+37.5 and 105+30 (control). Control treatment represented indigenous K, Na status of soil. The experiment continued until maturity. Application of K and Na increased seed cotton yield and boll weight significantly (p<0.01). Both varieties varied non-significantly with respect to K:Na ratio in leaf. The beneficial effects of Na with K application over control on seed cotton yield and boll weight were greater in NIBGE-2 than in MNH-786. Increase in seed cotton yield was attributed to maximum boll weight of both varieties. Significant negative correlation (r= -0.89, - 0.76, n= 4) was found between K:Na ratio and K use efficiency in shoot of NIBGE-2 and MNH-786, respectively. (author)

THE ABILITY OF FAST-GROWING TRANSGENIC AFRICAN CATFISH (Clarias gariepinus ON PREDATOR AVOIDANCE

Directory of Open Access Journals (Sweden)

Huria Marnis

2016-12-01

Full Text Available Research Institute for Fish Breeding has produced transgenic African catfish (Clarias gariepinus containing stripped catfish growth hormone gene (PccBA-PhGH with growth 19.86% faster than that of non-transgenic fish. This fish has high potential to be released and utilized for fish farming sector to increase national production. However, there is not yet information about environmental risk of this fish. One of the major fitness traits determining potential environmental risk is predator avoidance. This study aimed to determine the predator avoidance ability of transgenic African catfish in an experimental laboratory condition. In this study, thirty five individuals each of transgenic and non-transgenic with body weight of about 0.1 ± 0.019 g were communally stocked in 60 cm x 40 cm x 40 cm aquarium with limited feeding frequency (ad libitum twice a day. One day after the fish were stocked, the predators were added to each aquarium. The non-transgenic and transgenic with body weight of 1.0 ± 0.024 g were stocked as predators as many as five individual in each aquarium. After approximately two weeks of predation, all remaining fish were collected for transgenic verification by PCR method. Genomic DNA was isolated from fin tissue of individually survivors. The results of this study showed that the transgenic fish had worse predator avoidance and lower cannibal than non-transgenic (P0.05 in limited food. The transgenic fish may have lower fitness than non-transgenic.

Use of transgenic seeds in Brazilian agriculture and concentration of agricultural production to large agribusinesses.

Science.gov (United States)

Marinho, C D; Martins, F J O; Amaral Júnior, A T; Gonçalves, L S A; Amaral, S C S; de Mello, M P

2012-07-19

We identified the commercial releases of genetically modified organisms (GMOs) in Brazil, their characteristics, the types of genetic transformation used, and the companies responsible for the development of these GMOs, classifying them into two categories: private companies, subdivided into multinational and national, and public institutions. The data came from the data bank of the national registration of cultivars and the service of national protection of cultivars of the Ministry of Agriculture, Fishing and Supply (MAPA). This survey was carried out from 1998 to February 12, 2011. Until this date, 27 GMOs had been approved, including five for soybean, 15 for maize and seven for cotton cultivars. These GMOs have been used for the development of 766 cultivars, of which, 305 are soybean, 445 are maize, and 13 are cotton cultivars. The Monsato Company controls 73.2% of the transgenic cultivars certified by the MAPA; a partnership between Dow AgroSciences and DuPont accounts for 21.4%, and Syngenta controls 4.96%. Seed supply by these companies is almost a monopoly supported by law, giving no choice for producers and leading to the fast replacement of conventional cultivars by transgenic cultivars, which are expensive and exclude small producers from the market, since seeds cannot be kept for later use. This situation concentrates production in the hands of a few large national agribusiness entrepreneurs.

Exploring potential and opportunities for pakistan cotton export

International Nuclear Information System (INIS)

Afridi, G. S.; Tariq, S. A.

2016-01-01

Agriculture is the single largest shareholder to GDP an employment to labour force. It has major share in export but unfortunately unable to meet international standards. This study aims to analyze the pattern of Pakistan cotton export, and to explore sector's export potential and opportunities. This new research endeavor with well-tested analytical tools enabled the trade experts and policy makers to explore the answer of lackness for diversification in export, HS-2- digits aggregated data for cotton sub-sectors have been used with latest data from 2004 to 2013 for the panel 39 countries. Revealed comparative advantage (RCA) index and gravity model approach was employed considering country and time specific fixed effect. The RCA index revealed that cotton sub-sectors have comparative advantage in export and there is gradual gain in the competitiveness with time. The opportunity exists in the markets of low, lower-middle and upper middle income countries and countries those have fair trade (low tariff and non-tariff barriers) for cotton export. Greater export potential lies with malaysia, kenya jordan, thailand, mauritius, netherlands norway, Australia and russian federation for export of cotton, however, export potential for cotton has been exhausted with canada, france, india, iran and saudi arabia. The study provide the policy information that countries of Latin america, eastern europe, central asia and northern africa are virgin for export. Therefore, pakistan should penetrate in these markets for export of cotton and other agricultural products. cognizant to new trade theories, pakistan focus on quality to gain maximum trade volume in the markets of high income countries, Pakistan may develop trade agreement with ASEAN, SAFTA, and EU-27 for export of agricultural products. (author)

Global alteration of microRNAs and transposon-derived small RNAs in cotton (Gossypium hirsutum) during Cotton leafroll dwarf polerovirus (CLRDV) infection.

Science.gov (United States)

Romanel, Elisson; Silva, Tatiane F; Corrêa, Régis L; Farinelli, Laurent; Hawkins, Jennifer S; Schrago, Carlos E G; Vaslin, Maite F S

2012-11-01

Small RNAs (sRNAs) are a class of non-coding RNAs ranging from 20- to 40-nucleotides (nts) that are present in most eukaryotic organisms. In plants, sRNAs are involved in the regulation of development, the maintenance of genome stability and the antiviral response. Viruses, however, can interfere with and exploit the silencing-based regulatory networks, causing the deregulation of sRNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs). To understand the impact of viral infection on the plant sRNA pathway, we deep sequenced the sRNAs in cotton leaves infected with Cotton leafroll dwarf virus (CLRDV), which is a member of the economically important virus family Luteoviridae. A total of 60 putative conserved cotton miRNAs were identified, including 19 new miRNA families that had not been previously described in cotton. Some of these miRNAs were clearly misregulated during viral infection, and their possible role in symptom development and disease progression is discussed. Furthermore, we found that the 24-nt heterochromatin-associated siRNAs were quantitatively and qualitatively altered in the infected plant, leading to the reactivation of at least one cotton transposable element. This is the first study to explore the global alterations of sRNAs in virus-infected cotton plants. Our results indicate that some CLRDV-induced symptoms may be correlated with the deregulation of miRNA and/or epigenetic networks.

Agrobacterium rhizogenes-induced cotton hairy root culture as an alternative tool for cotton functional genomics

Science.gov (United States)

Although well-accepted as the ultimate method for cotton functional genomics, Agrobacterium tumefaciens-mediated cotton transformation is not widely used for functional analyses of cotton genes and their promoters since regeneration of cotton in tissue culture is lengthy and labor intensive. In cer...

Market forces and technological substitutes cause fluctuations in the value of bat pest-control services for cotton.

Directory of Open Access Journals (Sweden)

Laura López-Hoffman

Full Text Available Critics of the market-based, ecosystem services approach to biodiversity conservation worry that volatile market conditions and technological substitutes will diminish the value of ecosystem services and obviate the "economic benefits" arguments for conservation. To explore the effects of market forces and substitutes on service values, we assessed how the value of the pest-control services provided by Mexican free-tailed bats (Tadarida brasiliensis mexicana to cotton production in the southwestern U.S. has changed over time. We calculated service values each year from 1990 through 2008 by estimating the value of avoided crop damage and the reduced social and private costs of insecticide use in the presence of bats. Over this period, the ecosystem service value declined by 79% ($19.09 million U.S. dollars due to the introduction and widespread adoption of Bt (Bacillus thuringiensis cotton transgenically modified to express its own pesticide, falling global cotton prices and the reduction in the number of hectares in the U.S. planted with cotton. Our results demonstrate that fluctuations in market conditions can cause temporal variation in ecosystem service values even when ecosystem function--in this case bat population numbers--is held constant. Evidence is accumulating, however, of the evolution of pest resistance to Bt cotton, suggesting that the value of bat pest-control services may increase again. This gives rise to an economic option value argument for conserving Mexican free-tailed bat populations. We anticipate that these results will spur discussion about the role of ecosystem services in biodiversity conservation in general, and bat conservation in particular.

Market forces and technological substitutes cause fluctuations in the value of bat pest-control services for cotton

Science.gov (United States)

López-Hoffman, Laura; Wiederholt, Ruscena; Sansone, Chris; Bagstad, Kenneth J.; Cryan, Paul M.; Diffendorfer, James E.; Goldstein, Joshua; LaSharr, Kelsie; Loomis, John; McCracken, Gary; Medellin, Rodrigo A.; Russell, Amy; Semmens, Darius J.

2014-01-01

Critics of the market-based, ecosystem services approach to biodiversity conservation worry that volatile market conditions and technological substitutes will diminish the value of ecosystem services and obviate the “economic benefits” arguments for conservation. To explore the effects of market forces and substitutes on service values, we assessed how the value of the pest-control services provided by Mexican free-tailed bats (Tadarida brasiliensis mexicana) to cotton production in the southwestern U.S. has changed over time. We calculated service values each year from 1990 through 2008 by estimating the value of avoided crop damage and the reduced social and private costs of insecticide use in the presence of bats. Over this period, the ecosystem service value declined by 79% ($19.09 million U.S. dollars) due to the introduction and widespread adoption of Bt (Bacillus thuringiensis) cotton transgenically modified to express its own pesticide, falling global cotton prices and the reduction in the number of hectares in the U.S. planted with cotton. Our results demonstrate that fluctuations in market conditions can cause temporal variation in ecosystem service values even when ecosystem function – in this case bat population numbers – is held constant. Evidence is accumulating, however, of the evolution of pest resistance to Bt cotton, suggesting that the value of bat pest-control services may increase again. This gives rise to an economic option value argument for conserving Mexican free-tailed bat populations. We anticipate that these results will spur discussion about the role of ecosystem services in biodiversity conservation in general, and bat conservation in particular.

Transformation and evaluation of Cry1Ac+Cry2A and GTGene in Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

Agung Nugroho Puspito

2015-11-01

Full Text Available More than 50 countries around the globe cultivate cotton on a large scale. It is a major cash crop of Pakistan and is considered white gold because it is highly important to the economy of Pakistan. In addition to its importance, cotton cultivation faces several problems, such as insect pests, weeds, and viruses. In the past, insects have been controlled by insecticides, but this method caused a severe loss to the economy. However, conventional breeding methods have provided considerable breakthroughs in the improvement of cotton, but it also has several limitations. In comparison with conventional methods, biotechnology has the potential to create genetically modified plants that are environmentally safe and economically viable. In this study, a local cotton variety VH 289 was transformed with two Bt genes (Cry1Ac and Cry2A and a herbicide resistant gene (cp4 EPSPS using the Agrobacterium mediated transformation method. The constitutive CaMV 35S promoter was attached to the genes taken from Bacillus thuringiensis (Bt and to an herbicide resistant gene during cloning, and this promoter was used for the expression of the genes in cotton plants. This construct was used to develop the Glyphosate Tolerance Gene (GTGene for herbicide tolerance and insecticidal gene (Cry1Ac and Cry2A for insect tolerance in the cotton variety VH 289. The transgenic cotton variety performed 85% better compared with the non-transgenic variety. The study results suggest that farmers should use the transgenic cotton variety for general cultivation to improve the production of cotton.

Chemical compounds related to nutraceutical and industrial qualities of non-transgenic soybean genotypes.

Science.gov (United States)

Carrera, Constanza S; Dardanelli, Julio L; Soldini, Diego O

2014-05-01

Information about the chemical profile of soybean seed is valuable for breeding programs aimed at obtaining value-added products to meet the demands of niche markets. The objective of this study was to determine seed composition of non-transgenic soybean genotypes with specialty characters in different environments of Argentina. Protein and oil contents ranged from 396 to 424 g kg⁻¹ and from 210 to 226 g kg⁻¹, respectively. Oleic and linolenic acid ratio, the general indicator of oil quality, varied from 2.7 to 3.8. The oil contained high levels of total tocopherols (1429-1558 mg kg⁻¹) and the meal exhibited high levels of total isoflavones (2.91-4.62 mg g⁻¹). The biplot showed that oleic, linoleic and linolenic acids, γ-, δ- and total tocopherols, genistin, malonyl daidzin and genistin, acetyl daidzin and glycitin and total isoflavones allowed the greatest discrimination among the genotypes studied. Different chemical profiles of each non-transgenic genotype analyzed were established and, therefore, their identity was defined. These results are important for breeders who intend to obtain new genotypes with improved meal and oil quality, as well as for processors and exporters, who could use them directly as raw material for soyfood processing for nutraceutical purposes. © 2013 Society of Chemical Industry.

Perspectives on transgenic, herbicide-resistant crops in the United States almost 20 years after introduction.

Science.gov (United States)

Duke, Stephen O

2015-05-01

Herbicide-resistant crops have had a profound impact on weed management. Most of the impact has been by glyphosate-resistant maize, cotton, soybean and canola. Significant economic savings, yield increases and more efficacious and simplified weed management have resulted in widespread adoption of the technology. Initially, glyphosate-resistant crops enabled significantly reduced tillage and reduced the environmental impact of weed management. Continuous use of glyphosate with glyphosate-resistant crops over broad areas facilitated the evolution of glyphosate-resistant weeds, which have resulted in increases in the use of tillage and other herbicides with glyphosate, reducing some of the initial environmental benefits of glyphosate-resistant crops. Transgenic crops with resistance to auxinic herbicides, as well as to herbicides that inhibit acetolactate synthase, acetyl-CoA carboxylase and hydroxyphenylpyruvate dioxygenase, stacked with glyphosate and/or glufosinate resistance, will become available in the next few years. These technologies will provide additional weed management options for farmers, but will not have all of the positive effects (reduced cost, simplified weed management, lowered environmental impact and reduced tillage) that glyphosate-resistant crops had initially. In the more distant future, other herbicide-resistant crops (including non-transgenic ones), herbicides with new modes of action and technologies that are currently in their infancy (e.g. bioherbicides, sprayable herbicidal RNAi and/or robotic weeding) may affect the role of transgenic, herbicide-resistant crops in weed management. Published 2014. This article is a U.S. Government work and is in the public domain in the USA. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

Impaired growth of pancreatic exocrine cells in transgenic mice expressing human activin βE subunit

International Nuclear Information System (INIS)

Hashimoto, Osamu; Ushiro, Yuuki; Sekiyama, Kazunari; Yamaguchi, Osamu; Yoshioka, Kazuki; Mutoh, Ken-Ichiro; Hasegawa, Yoshihisa

2006-01-01

Activins, TGF-β superfamily members, have multiple functions in a variety of cells and tissues. Recently, additional activin β subunit genes, βC and βE, have been identified. To explore the role of activin E, we created transgenic mice overexpressing human activin βE subunit. There were pronounced differences in the pancreata of the transgenic animals as compared with their wild-type counterparts. Pancreatic weight, expressed relative to total body weight, was significantly reduced. Histologically, adipose replacement of acini in the exocrine pancreas was observed. There was a significant decrease in the number of PCNA-positive cells in the acinar cells, indicating reduced proliferation in the exocrine pancreas of the transgenic mice. However, quantitative pancreatic morphometry showed that the total number and mass of the islets of the transgenic mice were comparable with those of the nontransgenic control mice. Our findings suggest a role for activin E in regulating the proliferation of pancreatic exocrine cells

GhCAX3 gene, a novel Ca(2+/H(+ exchanger from cotton, confers regulation of cold response and ABA induced signal transduction.

Directory of Open Access Journals (Sweden)

Lian Xu

Full Text Available As a second messenger, Ca(2+ plays a major role in cold induced transduction via stimulus-specific increases in [Ca(2+]cyt, which is called calcium signature. During this process, CAXs (Ca(2+/H(+ exchangers play critical role. For the first time, a putative Ca(2+/H(+ exchanger GhCAX3 gene from upland cotton (Gossypium hirsutum cv. 'YZ-1' was isolated and characterized. It was highly expressed in all tissues of cotton except roots and fibers. This gene may act as a regulator in cotton's response to abiotic stresses as it could be up-regulated by Ca(2+, NaCl, ABA and cold stress. Similar to other CAXs, it was proved that GhCAX3 also had Ca(2+ transport activity and the N-terminal regulatory region (NRR through yeast complementation assay. Over-expression of GhCAX3 in tobacco showed less sensitivity to ABA during seed germination and seedling stages, and the phenotypic difference between wild type (WT and transgenic plants was more significant when the NRR was truncated. Furthermore, GhCAX3 conferred cold tolerance in yeast as well as in tobacco seedlings based on physiological and molecular studies. However, transgenic plant seeds showed more sensitivity to cold stress compared to WT during seed germination, especially when expressed in N-terminal truncated version. Finally, the extent of sensitivity in transgenic lines was more severe than that in WT line under sodium tungstate treatment (an ABA repressor, indicating that ABA could alleviate cold sensitivity of GhCAX3 seeds, especially in short of its NRR. Meanwhile, we also found that overexpression of GhCAX3 could enhance some cold and ABA responsive marker genes. Taken together, these results suggested that GhCAX3 plays important roles in the cross-talk of ABA and cold signal transduction, and compared to full-length of GhCAX3, the absence of NRR could enhance the tolerance or sensitivity to cold stress, depending on seedling's developmental stages.

Dictionary of cotton: Picking & ginning

Science.gov (United States)

Cotton is an essential commodity for textiles and has long been an important item of trade in the world’s economy. Cotton is currently grown in over 100 countries by an estimated 100 producers. The basic unit of the cotton trade is the cotton bale which consists of approximately 500 pounds of raw c...

Chloroplast localization of Cry1Ac and Cry2A protein- an alternative way of insect control in cotton

Directory of Open Access Journals (Sweden)

Adnan Muzaffar

2015-01-01

Full Text Available BACKGROUND: Insects have developed resistance against Bt-transgenic plants. A multi-barrier defense system to weaken their resistance development is now necessary. One such approach is to use fusion protein genes to increase resistance in plants by introducing more Bt genes in combination. The locating the target protein at the point of insect attack will be more effective. It will not mean that the non-green parts of the plants are free of toxic proteins, but it will inflict more damage on the insects because they are at maximum activity in the green parts of plants. RESULTS: Successful cloning was achieved by the amplification of Cry2A, Cry1Ac, and a transit peptide. The appropriate polymerase chain reaction amplification and digested products confirmed that Cry1Ac and Cry2A were successfully cloned in the correct orientation. The appearance of a blue color in sections of infiltrated leaves after 72 hours confirmed the successful expression of the construct in the plant expression system. The overall transformation efficiency was calculated to be 0.7%. The amplification of Cry1Ac-Cry2A and Tp2 showed the successful integration of target genes into the genome of cotton plants. A maximum of 0.673 μg/g tissue of Cry1Ac and 0.568 μg/g tissue of Cry2A was observed in transgenic plants. We obtained 100% mortality in the target insect after 72 hours of feeding the 2nd instar larvae with transgenic plants. The appearance of a yellow color in transgenic cross sections, while absent in the control, through phase contrast microscopy indicated chloroplast localization of the target protein. CONCLUSION: Locating the target protein at the point of insect attack increases insect mortality when compared with that of other transgenic plants. The results of this study will also be of great value from a biosafety point of view.

Developing Cotton IPM by Conserving Parasitoids and Predators of The Main Pest

Directory of Open Access Journals (Sweden)

Nurindah Nurindah

2015-09-01

Full Text Available On early development of intensive cotton program, insect pests were considered as an important aspect in cotton cultivation, so that it needed to be scheduled sprays. The frequency of sprays was 7 times used 12L of chemical insecticides per hectare per season. Development of cotton IPM was emphasized on non-chemical control methods through optimally utilize natural enemies of the cotton main pests (Amrasca biguttulla (IshidaHelicoverpa armigera (Hübner. Conservation of parasitoids and predators by providing the environment that support their population development is an act of supporting the natural enemies as an effective biotic mortality factor of the insect pests. The conservation could be done by improving the plant matter and cultivation techniques that include the use of resistant variety to leafhopper, intercropping cotton with secondary food plants, mulch utilization, using action threshold that considered the presence of natural enemies, and application of botanical insecticides, if needed. Conservation of parasitoids and predators in cotton IPM could control the insect pests without any insecticide spray in obtaining the production of cotton seed. As such, the use of IPM method would increase farmers’ income.

Functional characterization of AGAMOUS-subfamily members from cotton during reproductive development and in response to plant hormones.

Science.gov (United States)

de Moura, Stéfanie Menezes; Artico, Sinara; Lima, Cássio; Nardeli, Sarah Muniz; Berbel, Ana; Oliveira-Neto, Osmundo Brilhante; Grossi-de-Sá, Maria Fátima; Ferrándiz, Cristina; Madueño, Francisco; Alves-Ferreira, Márcio

2017-03-01

Expression analysis of the AG -subfamily members from G. hirsutum during flower and fruit development. Reproductive development in cotton, including the fruit and fiber formation, is a complex process; it involves the coordinated action of gene expression regulators, and it is highly influenced by plant hormones. Several studies have reported the identification and expression of the transcription factor family MADS-box members in cotton ovules and fibers; however, their roles are still elusive during the reproductive development in cotton. In this study, we evaluated the expression profiles of five MADS-box genes (GhMADS3, GhMADS4, GhMADS5, GhMADS6 and GhMADS7) belonging to the AGAMOUS-subfamily in Gossypium hirsutum. Phylogenetic and protein sequence analyses were performed using diploid (G. arboreum, G. raimondii) and tetraploid (G. barbadense, G. hirsutum) cotton genomes, as well as the AG-subfamily members from Arabidopsis thaliana, Petunia hybrida and Antirrhinum majus. qPCR analysis showed that the AG-subfamily genes had high expression during flower and fruit development in G. hirsutum. In situ hybridization analysis also substantiates the involvement of AG-subfamily members on reproductive tissues of G. hirsutum, including ovule and ovary. The effect of plant hormones on AG-subfamily genes expression was verified in cotton fruits treated with gibberellin, auxin and brassinosteroid. All the genes were significantly regulated in response to auxin, whereas only GhMADS3, GhMADS4 and GhMADS7 genes were also regulated by brassinosteroid treatment. In addition, we have investigated the GhMADS3 and GhMADS4 overexpression effects in Arabidopsis plants. Interestingly, the transgenic plants from both cotton AG-like genes in Arabidopsis significantly altered the fruit size compared to the control plants. This alteration suggests that cotton AG-like genes might act regulating fruit formation. Our results demonstrate that members of the AG-subfamily in G. hirsutum

Analyse comparative de la rentabilité des systèmes de production de coton biologique, conventionnel et transgénique au Burkina Faso

Directory of Open Access Journals (Sweden)

Vognan, G.

2017-01-01

Full Text Available Comparative Analysis of the Profitability of Organic, Conventional, and Transgenic Cotton Farming Systems in Burkina Faso. This research aimed to compare the profitability of cotton cropping systems (cotton and rotation crops according to three production modes: organic, conventional, and transgenic. The study was conducted in Burkina Faso on a sample of 180 households of which 60 households from organic cotton system, 60 households from conventional cotton system, and 60 households from transgenic cotton system. It came out that the production costs of the various crops in the transgenic and conventional systems are higher than those of the organic system. The differences in the production costs for the three modes of production are highly significant especially for cotton, corn, sorghum and groundnut. In terms of profitability, there's no significant difference in the margins generated by the different modes of cotton production. On the other hand, the sensitivity analysis revealed that organic cotton is financially more resilient to cotton price fluctuation and chemical inputs cost. Actually, organic cotton production seems to be a viable option to alleviate poverty in the present context of climate change.

Detecting mismatches in the phenology of cotton bollworm larvae and cotton flowering in response to climate change

Science.gov (United States)

Huang, Jian; Hao, HongFei

2018-05-01

Current evidence suggests that climate change has directly affected the phenology of many invertebrate species associated with agriculture. Such changes in phenology have the potential to cause temporal mismatches between predators and prey and may lead to a disruption in natural pest control ecosystem. Understanding the synchrony between pest insects and host plant responses to climate change is a key step to improve integrated pest management strategies. Cotton bollworm larvae damage cotton, and thus, data from Magaiti County, China, collected during the period of 1990-2015 were analyzed to assess the effects of climate change on cotton bollworm larvae and cotton flowering. The results showed that a warming climate advanced the phenology of cotton bollworm larvae and cotton flowering. However, the phenological rate of change was faster in cotton bollworm larvae than that in cotton flowering, and the larval period was prolonged, resulting in a great increase of the larval population. The abrupt phenological changes in cotton bollworm larvae occurred earlier than that in cotton, and the abrupt phenological changes in cotton flowering occurred earlier than that in larval abundance. However, the timing of abrupt changes in larval abundance all occurred later than that in temperature. Thus, the abrupt changes that occurred in larvae, cotton flowering and climate were asynchronous. The interval days between the cotton flowering date (CFD) and the half-amount larvae date (HLD) expanded by 3.41 and 4.41 days with a 1 °C increase of T mean in May and June, respectively. The asynchrony between cotton bollworm larvae and cotton flowering will likely broaden as the climate changes. The effective temperature in March and April and the end date of larvae (ED) were the primary factors affecting asynchrony.

Detecting mismatches in the phenology of cotton bollworm larvae and cotton flowering in response to climate change.

Science.gov (United States)

Huang, Jian; Hao, HongFei

2018-05-11

Current evidence suggests that climate change has directly affected the phenology of many invertebrate species associated with agriculture. Such changes in phenology have the potential to cause temporal mismatches between predators and prey and may lead to a disruption in natural pest control ecosystem. Understanding the synchrony between pest insects and host plant responses to climate change is a key step to improve integrated pest management strategies. Cotton bollworm larvae damage cotton, and thus, data from Magaiti County, China, collected during the period of 1990-2015 were analyzed to assess the effects of climate change on cotton bollworm larvae and cotton flowering. The results showed that a warming climate advanced the phenology of cotton bollworm larvae and cotton flowering. However, the phenological rate of change was faster in cotton bollworm larvae than that in cotton flowering, and the larval period was prolonged, resulting in a great increase of the larval population. The abrupt phenological changes in cotton bollworm larvae occurred earlier than that in cotton, and the abrupt phenological changes in cotton flowering occurred earlier than that in larval abundance. However, the timing of abrupt changes in larval abundance all occurred later than that in temperature. Thus, the abrupt changes that occurred in larvae, cotton flowering and climate were asynchronous. The interval days between the cotton flowering date (CFD) and the half-amount larvae date (HLD) expanded by 3.41 and 4.41 days with a 1 °C increase of T mean in May and June, respectively. The asynchrony between cotton bollworm larvae and cotton flowering will likely broaden as the climate changes. The effective temperature in March and April and the end date of larvae (ED) were the primary factors affecting asynchrony.

Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection

Directory of Open Access Journals (Sweden)

Broder Christopher C

2009-05-01

Full Text Available Abstract Background Current small animal models for studying HIV-1 infection are very limited, and this continues to be a major obstacle for studying HIV-1 infection and pathogenesis, as well as for the urgent development and evaluation of effective anti-HIV-1 therapies and vaccines. Previously, it was shown that HIV-1 can infect cotton rats as indicated by development of antibodies against all major proteins of the virus, the detection of viral cDNA in spleen and brain of challenged animals, the transmission of infectious virus, albeit with low efficiency, from animal to animal by blood, and an additional increase in the mortality in the infected groups. Results Using in vitro experiments, we now show that cotton rat cell lines engineered to express human receptor complexes for HIV-1 (hCD4 along with hCXCR4 or hCCR5 support virus entry, viral cDNA integration, and the production of infectious virus. Conclusion These results further suggest that the development of transgenic cotton rats expressing human HIV-1 receptors may prove to be useful small animal model for HIV infection.

Phytoremediation of small organic contaminants using transgenic plants

Science.gov (United States)

James, C Andrew; Strand, Stuart E

2010-01-01

The efficacy of transgenic plants in the phytoremediation of small organic contaminants has been investigated. Two principal strategies have been pursued (1) the manipulation of phase I metabolic activity to enhance in planta degradation rates, or to impart novel metabolic activity, and (2) the enhanced secretion of reactive enzymes from roots leading to accelerated ex planta degradation of organic contaminants. A pair of dehalogenase genes from Xanthobacter autotrophicus was expressed in tobacco resulting in the dehalogenation of 1,2-dichloroethane, which was otherwise recalcitrant. A laccase gene from cotton was overexpressed in Arabidopsis thaliana resulting in increased secretory laccase activity and the enhanced resistance to trichlorophenol in soils. Although the results to date are promising, much of the work has been limited to laboratory settings; field demonstrations are needed. PMID:19342219

Bt crop effects on functional guilds of non-target arthropods: a meta-analysis.

Directory of Open Access Journals (Sweden)

L LaReesa Wolfenbarger

Full Text Available BACKGROUND: Uncertainty persists over the environmental effects of genetically-engineered crops that produce the insecticidal Cry proteins of Bacillus thuringiensis (Bt. We performed meta-analyses on a modified public database to synthesize current knowledge about the effects of Bt cotton, maize and potato on the abundance and interactions of arthropod non-target functional guilds. METHODOLOGY/PRINCIPAL FINDINGS: We compared the abundance of predators, parasitoids, omnivores, detritivores and herbivores under scenarios in which neither, only the non-Bt crops, or both Bt and non-Bt crops received insecticide treatments. Predators were less abundant in Bt cotton compared to unsprayed non-Bt controls. As expected, fewer specialist parasitoids of the target pest occurred in Bt maize fields compared to unsprayed non-Bt controls, but no significant reduction was detected for other parasitoids. Numbers of predators and herbivores were higher in Bt crops compared to sprayed non-Bt controls, and type of insecticide influenced the magnitude of the difference. Omnivores and detritivores were more abundant in insecticide-treated controls and for the latter guild this was associated with reductions of their predators in sprayed non-Bt maize. No differences in abundance were found when both Bt and non-Bt crops were sprayed. Predator-to-prey ratios were unchanged by either Bt crops or the use of insecticides; ratios were higher in Bt maize relative to the sprayed non-Bt control. CONCLUSIONS/SIGNIFICANCE: Overall, we find no uniform effects of Bt cotton, maize and potato on the functional guilds of non-target arthropods. Use of and type of insecticides influenced the magnitude and direction of effects; insecticde effects were much larger than those of Bt crops. These meta-analyses underscore the importance of using controls not only to isolate the effects of a Bt crop per se but also to reflect the replacement of existing agricultural practices. Results will

Analysis Of The Reactivity Of Radpro Solution With Cotton Rags

International Nuclear Information System (INIS)

Marusich, R.M.

2009-01-01

Rags containing RadPro(reg s ign) solution will be generated during the decontamination of the Plutonium Finishing Plant (PFP). Under normal conditions, the rags will be neutralized with sodium carbonate prior to placing in the drums. The concern with RadPro solutions and cotton rags is that some of the RadPro solutions contain nitric acid. Under the right conditions, nitric acid and cotton rags exothermically react. The concern is, will RadPro solutions react with cotton rags exothermically? The potential for a runaway reaction for any of the RadPro solutions used was studied in Section 5.2 of PNNL-15410, Thermal Stability Studies of Candidate Decontamination Agents for Hanford's Plutonium Finishing Plant Plutonium-Contaminated Gloveboxes. This report shows the thermal behavior of cotton rags having been saturated in one of the various neutralized and non-neutralized RadPro solutions. The thermal analysis was performed using thermogravimetric Analysis (TGA), Differential Thermal Analysis (DTA) and Accelerating Rate Calorimetry (ARC).

Evaluation of the Impact of Genetically Modified Cotton After 20 Years of Cultivation in Mexico

Directory of Open Access Journals (Sweden)

Martha G. Rocha-Munive

2018-06-01

Full Text Available For more than 20 years cotton has been the most widely sown genetically modified (GM crop in Mexico. Its cultivation has fulfilled all requirements and has gone through the different regulatory stages. During the last 20 years, both research-institutions and biotech-companies have generated scientific and technical information regarding GM cotton cultivation in Mexico. In this work, we collected data in order to analyze the environmental and agronomic effects of the use of GM cotton in Mexico. In 1996, the introduction of Bt cotton made it possible to reactivate this crop, which in previous years was greatly reduced due to pest problems, production costs and environmental concerns. Bt cotton is a widely accepted tool for cotton producers and has proven to be efficient for the control of lepidopteran pests. The economic benefits of its use are variable, and depend on factors such as the international cotton-prices and other costs associated with its inputs. So far, the management strategies used to prevent development of insect resistance to GM cotton has been successful, and there are no reports of insect resistance development to Bt cotton in Mexico. In addition, no effects have been observed on non-target organisms. For herbicide tolerant cotton, the prevention of herbicide resistance has also been successful since unlike other countries, the onset of resistance weeds is still slow, apparently due to cultural practices and rotation of different herbicides. Environmental benefits have been achieved with a reduction in chemical insecticide applications and the subsequent decrease in primary pest populations, so that the inclusion of other technologies—e.g., use of non-Bt cotton- can be explored. Nevertheless, control measures need to be implemented during transport of the bolls and fiber to prevent dispersal of volunteer plants and subsequent gene flow to wild relatives distributed outside the GM cotton growing areas. It is still necessary to

Cotton proteomics for deciphering the mechanism of environment stress response and fiber development.

Science.gov (United States)

Zhou, Meiliang; Sun, Guoqing; Sun, Zhanmin; Tang, Yixiong; Wu, Yanmin

2014-06-13

that are widely employed during last 5years, with the aim to generate novel insight useful for cotton improvement. This article is part of a Special Issue entitled: Proteomics of non-model organisms. Copyright © 2014 Elsevier B.V. All rights reserved.

Identification of a New Cotton Disease Caused by an Atypical Cotton Leafroll Dwarf Virus in Argentina.

Science.gov (United States)

Agrofoglio, Yamila C; Delfosse, Verónica C; Casse, María F; Hopp, Horacio E; Kresic, Iván Bonacic; Distéfano, Ana J

2017-03-01

An outbreak of a new disease occurred in cotton (Gossypium hirsutum) fields in northwest Argentina starting in the 2009-10 growing season and is still spreading steadily. The characteristic symptoms of the disease included slight leaf rolling and a bushy phenotype in the upper part of the plant. In this study, we determined the complete nucleotide sequences of two independent virus genomes isolated from cotton blue disease (CBD)-resistant and -susceptible cotton varieties. This virus genome comprised 5,866 nucleotides with an organization similar to that of the genus Polerovirus and was closely related to cotton leafroll dwarf virus, with protein identity ranging from 88 to 98%. The virus was subsequently transmitted to a CBD-resistant cotton variety using Aphis gossypii and symptoms were successfully reproduced. To study the persistence of the virus, we analyzed symptomatic plants from CBD-resistant varieties from different cotton-growing fields between 2013 and 2015 and showed the presence of the same virus strain. In addition, a constructed full-length infectious cDNA clone from the virus caused disease symptoms in systemic leaves of CBD-resistant cotton plants. Altogether, the new leafroll disease in CBD-resistant cotton plants is caused by an atypical cotton leafroll dwarf virus.

GhZFP1, a novel CCCH-type zinc finger protein from cotton, enhances salt stress tolerance and fungal disease resistance in transgenic tobacco by interacting with GZIRD21A and GZIPR5.

Science.gov (United States)

Guo, Ying-Hui; Yu, Yue-Ping; Wang, Dong; Wu, Chang-Ai; Yang, Guo-Dong; Huang, Jin-Guang; Zheng, Cheng-Chao

2009-01-01

* Zinc finger proteins are a superfamily involved in many aspects of plant growth and development. However, CCCH-type zinc finger proteins involved in plant stress tolerance are poorly understood. * A cDNA clone designated Gossypium hirsutum zinc finger protein 1 (GhZFP1), which encodes a novel CCCH-type zinc finger protein, was isolated from a salt-induced cotton (G. hirsutum) cDNA library using differential hybridization screening and further studied in transgenic tobacco Nicotiana tabacum cv. NC89. Using yeast two-hybrid screening (Y2H), proteins GZIRD21A (GhZFP1 interacting and responsive to dehydration protein 21A) and GZIPR5 (GhZFP1 interacting and pathogenesis-related protein 5), which interacted with GhZFP1, were isolated. * GhZFP1 contains two typical zinc finger motifs (Cx8Cx5Cx3H and Cx5Cx4Cx3H), a putative nuclear export sequence (NES) and a potential nuclear localization signal (NLS). Transient expression analysis using a GhZFP1::GFP fusion gene in onion epidermal cells indicated a nuclear localization for GhZFP1. RNA blot analysis showed that the GhZFP1 transcript was induced by salt (NaCl), drought and salicylic acid (SA). The regions in GhZFP1 that interact with GZIRD21A and GZIPR5 were identified using truncation mutations. * Overexpression of GhZFP1 in transgenic tobacco enhanced tolerance to salt stress and resistance to Rhizoctonia solani. Therefore, it appears that GhZFP1 might be involved as an important regulator in plant responses to abiotic and biotic stresses.

Superoleophobic cotton textiles

NARCIS (Netherlands)

Leng, B.; Shao, Z.; With, de G.; Ming, W.

2009-01-01

Common cotton textiles are hydrophilic and oleophilic in nature. Superhydrophobic cotton textiles have the potential to be used as self-cleaning fabrics, but they typically are not super oil-repellent. Poor oil repellency may easily compromise the self-cleaning property of these fabrics. Here, we

7 CFR 1205.319 - Cotton-producing region.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing region means each of the following groups of cotton-producing States: (a) Southeast Region: Alabama...

Examining cotton in rotation with rice and cotton in rotation with other crops using natural experiment

Science.gov (United States)

Sun, Ling; Zhu, Zesheng

2017-08-01

This paper is to show the ability of remote sensing image analysis combined with statistical analysis to characterize the environmental risk assessment of cotton in rotation with rice and cotton in rotation with other crops in two ways: (1) description of rotation period of cotton in rotation with rice and cotton in rotation with other crops by the observational study or natural experiment; (2) analysis of rotation period calculation of cotton in rotation with rice and cotton in rotation with other crops. Natural experimental results show that this new method is very promising for determining crop rotation period for estimating regional averages of environmental risk. When it is applied to determining crop rotation period, two requested remote sensing images of regional crop are required at least.

Polyploidization altered gene functions in cotton (Gossypium spp.).

Science.gov (United States)

Xu, Zhanyou; Yu, John Z; Cho, Jaemin; Yu, Jing; Kohel, Russell J; Percy, Richard G

2010-12-16

Cotton (Gossypium spp.) is an important crop plant that is widely grown to produce both natural textile fibers and cottonseed oil. Cotton fibers, the economically more important product of the cotton plant, are seed trichomes derived from individual cells of the epidermal layer of the seed coat. It has been known for a long time that large numbers of genes determine the development of cotton fiber, and more recently it has been determined that these genes are distributed across At and Dt subgenomes of tetraploid AD cottons. In the present study, the organization and evolution of the fiber development genes were investigated through the construction of an integrated genetic and physical map of fiber development genes whose functions have been verified and confirmed. A total of 535 cotton fiber development genes, including 103 fiber transcription factors, 259 fiber development genes, and 173 SSR-contained fiber ESTs, were analyzed at the subgenome level. A total of 499 fiber related contigs were selected and assembled. Together these contigs covered about 151 Mb in physical length, or about 6.7% of the tetraploid cotton genome. Among the 499 contigs, 397 were anchored onto individual chromosomes. Results from our studies on the distribution patterns of the fiber development genes and transcription factors between the At and Dt subgenomes showed that more transcription factors were from Dt subgenome than At, whereas more fiber development genes were from At subgenome than Dt. Combining our mapping results with previous reports that more fiber QTLs were mapped in Dt subgenome than At subgenome, the results suggested a new functional hypothesis for tetraploid cotton. After the merging of the two diploid Gossypium genomes, the At subgenome has provided most of the genes for fiber development, because it continues to function similar to its fiber producing diploid A genome ancestor. On the other hand, the Dt subgenome, with its non-fiber producing D genome ancestor

Review of the cotton market in Pakistan and its future prospects

Directory of Open Access Journals (Sweden)

Malik Tassawar Hussain

2016-11-01

Full Text Available Pakistan is the world’s 4th largest producer of cotton. Cultivation along the Indus River extends across nearly 3 million hectares and serves as the backbone of the economy. Despite this importance, information on the cotton sector in Pakistan, in particular with regard to cotton oils, is scanty and not available from a single source. This review seeks to remedy that gap. Though cultivated mainly for fiber, its kernel seed oil is also used as an edible vegetable oil and accounts for a large share of the local oil industry; per capita consumption of edible oils is nearly 14 kg, which is much higher than consumption in countries at similar levels of economic development. Pakistan fulfills 17.7% of its demand for edible oils through cottonseed oil. Total demand for this purpose in 2029–30 is estimated at 5.36 million tons of which local production will be 1.98 million tons. Genetically modified (Bt cotton was introduced in Pakistan in 2010 to control three deleterious lepidopterous insects; it now accounts for more than 85% of the cotton cultivated. There is good scope for organic cotton production in Pakistan, especially in non-traditional cotton growing areas where there is less insect pressure. High temperature and water scarcity associated with climate change are a major concern, since current cultivation takes place in areas that already experience extremely high temperatures.

A review of the processing of wool and wool blends on the short staple (Cotton) system

CSIR Research Space (South Africa)

Erdursun, HH

1981-11-01

Full Text Available of the material and the processing sequences will require a certain form of input material while the end-product will determine the blend composition. Wool in various forms such as scoured and carbonised stocks, tops, cut- 7 and stretch-broken tops has been... generally required lower twist factors than their cotton/wool counterparts to attain the optimum strength. Rotor (Open-end) Spinning Since its introduction in the late 1960's, the application of the rotor- spinning process has been extended by intensive...

The Impacts of U.S. Cotton Programs on the West and Central African Countries Cotton Export Earnings

OpenAIRE

Fadiga, Mohamadou L.; Mohanty, Samarendu; Pan, Suwen

2005-01-01

This study uses a stochastic simulation approach based on a partial equilibrium structural econometric model of the world fiber market to examine the effects of a removal of U.S. cotton programs on the world market. The effects on world cotton prices and African export earnings were analyzed. The results suggest that on average an elimination of U.S. cotton programs would lead to a marginal increase in the world cotton prices thus resulting in minimal gain for cotton exporting countries in Af...

Drought tolerance studies through WSSI and stomata in upland cotton

International Nuclear Information System (INIS)

Baloch, M.J.; Jatoi, W.A.; Soomro, Z.A.; Khan, N.U.; Hassan, G.; Khakwani, A.A.; Veesar, N.F.

2011-01-01

Water stress susceptibility index (WSSI) and stomatal conductance were used to determine the stress tolerance of 10 upland cotton cultivars during 2009 at Sindh Agriculture University, Tandojam, Pakistan. The experiment was conducted in spilt plot design with irrigations as main plots and cultivars as sub-plots. Two irrigation treatments were used i.e. one has two irrigations (water stress) and other has eight irrigations (non-stress). Analysis of variance revealed significant genotypic differences about WSSI for all the traits. Non-significant interaction between irrigations and cultivars for seed cotton yield and boll weight exhibited varietals stability over irrigation regimes, whereas significant interactions between above parameters for plant height and bolls per plant suggested genotypic instability over irrigation treatments for these traits. Overall, cultivars mean performance for all the traits in stress conditions was poor as compared to non-stress conditions, nevertheless some cultivars exhibited nonsignificant mean differences in both irrigation regimes, thus showing higher stress tolerance. The WSSI values of seed cotton yield as displayed in bi plot revealed that cultivars CRIS-477, CRIS-483 and CRIS-486 were found highly susceptible to water stress. Cultivars CRIS-476, CRIS-482, CRIS-487 and NIAB-78 were characterized as highly susceptible with minimum production even under optimum irrigation conditions. Cultivar CRIS-9 was moderately tolerant as produced low production. However, cultivars CRIS-485 and CRIS-484 were found highly stress tolerant because of minimum WSSI value and lower stomatal conductance. Negative correlations between water stress and WSSI for seed cotton yield and plant height revealed that any increase in the degree of stress caused a corresponding decrease in WSSI. (author)

Locally Grown: Examining Attitudes and Perceptions About Organic Cotton Production and Manufacturing Between Mississippi Cotton Growers and Consumers

Directory of Open Access Journals (Sweden)

Charles Freeman

2016-06-01

Full Text Available The purpose of this study is to examine attitudes and perceptions about organic cotton of Mississippi cotton growers and producers in comparison to fashion-conscious consumers, including advantages/disadvantages of growing and production processes, quality control, consumer preferences, and competitive price structures/profit margins. A sample size of 16 local Mississippi growers and/or producers and 44 undergraduate students at a mid-major Southeastern university were chosen to participate in the study. Instruments were developed based on current research and the definition of organic cotton production defined by the United States Department of Agriculture. Results indicate 75% of growers and producers do not perceive a quality difference between organic and conventionally grown cotton, while 72.7% of the consumers report organically grown cotton is capable of producing a higher quality product compared to conventionally grown cotton. Even with an increase in organic cotton prices (25- 40% higher premium, only 25% of growers and producers would be willing to convert, while a majority (52.3% of consumers would not be willing to spend more than 25% extra for an organically grown cotton product. Consumers indicate the negative effects of conventionally grown cotton, yet many report little knowledge about organic cotton production, while growers/producers immediately dismiss organically grown cotton as a retail marketing strategy.

Effect of cotton leaf-curl virus on the yield-components and fibre properties of cotton genotypes under varying plant spacing and nitrogen fertilizer

International Nuclear Information System (INIS)

Ahmad, S.; Hayat, K.; Ashraf, F.; Sadiq, M.A.

2008-01-01

Cotton leaf-curl virus (CLCu VB. Wala strain) is one of the major biotic constraints of cotton production in Punjab. Development of resistant cotton genotype is the most feasible, economical and effective method to combat this hazardous problem, but so far no resistant genotype has been reported. Therefore, the objective of this study was to compare yield and yield-components and fiber traits of different genotypes/varieties under different plant spacing and nitrogen fertilizer as a management strategy to cope with this viral disease. Field experiment was conducted during 2006-07 to evaluate the effect of genotype, plant spacing and nitrogen fertilizer on cotton. Five genotypes (MNH-786, MNH-789, MNH- 6070, CIM- 496, and BH-160), three plant-spacings (15, 30 and 45 cm) and three nitrogen fertilizer-levels (6.5, 8.6 and 11 bags Urea / ha) were studied. Results showed that significant differences exist for plant height, no. of bolls/m/sup -2/, seed-cotton yield (kg/ha) due to genotype, interaction of genotype with plant spacing and nitrogen fertilizer level. Whereas boll weight, ginning out-turn, staple length and fiber fineness were not affected significantly by the plant spacing and nitrogen fertilizer, the effect due to genotype was significant for these traits. CLCuV infestation varied significantly with genotypes, while all other factors, i.e., plant spacing and nitrogen fertilizers, have non-significant effect. As the major objective of cotton cultivation is production of lint for the country and seed- cotton yield for the farmers, it is noted that genotypes grown in narrow plant-spacing (15 cm) and higher nitrogen fertilizer level (11.0 bags of urea/ha) produced maximum seed-cotton yield under higher CLCu V infestation in case of CIM-496, MNH-789 and BH-I60, while the new strain MNH-6070 gave maximum yield under 30cm plant-spacing and 8.6 bags of urea/ha has the 2.3% CLCu V infestation was observed in this variety. From the present study, it is concluded that

A possible human counterpart of the principle of increasing entropy

International Nuclear Information System (INIS)

Liang, Y.; An, K.N.; Yang, G.; Huang, J.P.

2014-01-01

It is well-known that the principle of increasing entropy holds for isolated natural systems that contain non-adaptive molecules. Here we present, for the first time, an experimental evidence for a possible human counterpart of the principle in an isolated social system that involves adaptive humans. Our work shows that the human counterpart is valid even though interactions among humans in social systems are distinctly different from those among molecules in natural systems. Thus, it becomes possible to understand social systems from this natural principle, at least to some extent.

Transgenic Overexpression of the Proprotein Convertase Furin Enhances Skin Tumor Growth

Directory of Open Access Journals (Sweden)

Jian Fu

2012-04-01

Full Text Available Furin, one of the members of the family of proprotein convertases (PCs, ubiquitously expressed as a type I membrane-bound proteinase, activates several proteins that contribute to tumor progression. In vitro studies using cancer cell lines and clinical specimens demonstrated that furin processes important substrates such as insulin-like growth factor 1 receptor (IGF-1R and transforming growth factor β, leading to increased tumor growth and progression. Despite the numerous studies associating furin with tumor development, its effects in preclinical models has not been comprehensively studied. In this study, we sought to determine the protumorigenic role of furin in vivo after a two-stage chemical carcinogenesis protocol in transgenic mice in which furin expression was targeted to the epidermal basal layer. We found that processing of the PC substrate IGF-1R and the proliferation rate of mouse epidermis was enhanced in transgenic mice when compared with their WT counterparts. Histopathologic diagnoses of the tumors demonstrated that furin transgenic mice (line F47 developed twice as many squamous carcinomas as the control, WT mice (P < .002. Similarly, tumors cells from transgenic mice were able to process PC substrates more efficiently than tumor cells from WT mice. Furthermore, furin expression resulted in a higher SCC volume in transgenic mice as well as an increase in the percentage of high-grade SCC, including poorly differentiated and spindle cell carcinomas. In conclusion, expression of furin in the basal layer of the epidermis increased tumor development and enhanced tumor growth, supporting the consideration of furin as a potential target for cancer treatment.

Stable integration and expression of a cry1Ia gene conferring resistance to fall armyworm and boll weevil in cotton plants.

Science.gov (United States)

Silva, Carliane Rc; Monnerat, Rose; Lima, Liziane M; Martins, Érica S; Melo Filho, Péricles A; Pinheiro, Morganna Pn; Santos, Roseane C

2016-08-01

Boll weevil is a serious pest of cotton crop. Effective control involves applications of chemical insecticides, increasing the cost of production and environmental pollution. The current genetically modified Bt crops have allowed great benefits to farmers but show activity limited to lepidopteran pests. This work reports on procedures adopted for integration and expression of a cry transgene conferring resistance to boll weevil and fall armyworm by using molecular tools. Four Brazilian cotton cultivars were microinjected with a minimal linear cassette generating 1248 putative lines. Complete gene integration was found in only one line (T0-34) containing one copy of cry1Ia detected by Southern blot. Protein was expressed in high concentration at 45 days after emergence (dae), decreasing by approximately 50% at 90 dae. Toxicity of the cry protein was demonstrated in feeding bioassays revealing 56.7% mortality to boll weevil fed buds and 88.1% mortality to fall armyworm fed leaves. A binding of cry1Ia antibody was found in the midgut of boll weevils fed on T0-34 buds in an immunodetection assay. The gene introduced into plants confers resistance to boll weevil and fall armyworm. Transmission of the transgene occurred normally to T1 progeny. All plants showed phenotypically normal growth, with fertile flowers and abundant seeds. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Food safety knowledge on the Bt mutant protein Cry8Ka5 employed in the development of coleopteran-resistant transgenic cotton plants.

Science.gov (United States)

Farias, Davi F; Peijnenburg, Ad A C M; Grossi-de-Sá, Maria F; Carvalho, Ana F U

2015-01-01

Insecticidal Cry proteins from Bacillus thuringiensis (Bt) have been exploited in the development of genetically modified (GM) crops for pest control. However, several pests are still difficult to control such as the coleopteran boll weevil Anthonomus grandis. By applying in vitro molecular evolution to the cry8Ka1 gene sequence, variants were generated with improved activity against A. grandis. Among them, Cry8Ka5 mutant protein showed coleoptericidal activity 3-fold higher (LC50 2.83 μg/mL) than that of the original protein (Cry8Ka1). Cry8Ka5 has been used in breeding programs in order to obtain coleopteran-resistant cotton plants. Nevertheless, there is some concern in relation to the food safety of transgenic crops, especially to the heterologously expressed proteins. In this context, our research group has performed risk assessment studies on Cry8Ka5, using the tests recommended by Codex as well as tests that we proposed as alternative and/or complementary approaches. Our results on the risk analysis of Cry8Ka5 taken together with those of other Cry proteins, point out that there is a high degree of certainty on their food safety. It is reasonable to emphasize that most safety studies on Cry proteins have essentially used the Codex approach. However, other methodologies would potentially provide additional information such as studies on the effects of Cry proteins and derived peptides on the indigenous gastrointestinal microbiota and on intestinal epithelial cells of humans. Additionally, emerging technologies such as toxicogenomics potentially will offer sensitive alternatives for some current approaches or methods.

Biomass Accumulation, Photosynthetic Traits and Root Development of Cotton as Affected by Irrigation and Nitrogen-Fertilization

Directory of Open Access Journals (Sweden)

Zongkui Chen

2018-02-01

Full Text Available Limitations of soil water and nitrogen (N are factors which cause a substantial reduction in cotton (Gossypium hirsutum L. yield, especially in an arid environment. Suitable management decisions like irrigation method and nitrogen fertilization are the key yield improvement technologies in cotton production systems. Therefore, we hypothesized that optimal water-N supply can increase cotton plant biomass accumulation by maintaining leaf photosynthetic capacity and improving root growth. An outdoor polyvinyl chloride (PVC tube study was conducted to investigate the effects of two water-N application depths, i.e., 20 cm (H20 or 40 cm (H40 from soil surface and four water-N combinations [deficit irrigation (W55 and no N (N0 (W55N0, W55 and moderate N (N1 (W55N1, moderate irrigation (W75 and N0 (W75N0, W75N1] on the roots growth, leaf photosynthetic traits and dry mass accumulation of cotton crops. H20W55N1 combination increased total dry mass production by 29–82% and reproductive organs biomass by 47–101% compared with other counterparts. Root protective enzyme and nitrate reductase (NR activity, potential quantum yield of photosystem (PS II (Fv/Fm, PSII quantum yield in the light [Y(II] and electron transport rate of PSII were significantly higher in H20W55N1 prior to 82 days after emergence. Root NR activity and protective enzyme were significantly correlated with chlorophyll, Fv/Fm, Y(II and stomatal conductance. Hence, shallow irrigation (20 cm with moderate irrigation and N-fertilization application could increase cotton root NR activity and protective enzyme leading to enhance light capture and photochemical energy conversion of PSII before the full flowering stage. This enhanced photoassimilate to reproductive organs.

Expression of an osmotin-like protein from Solanum nigrum confers drought tolerance in transgenic soybean.

Science.gov (United States)

Weber, Ricardo Luís Mayer; Wiebke-Strohm, Beatriz; Bredemeier, Christian; Margis-Pinheiro, Márcia; de Brito, Giovani Greigh; Rechenmacher, Ciliana; Bertagnolli, Paulo Fernando; de Sá, Maria Eugênia Lisei; Campos, Magnólia de Araújo; de Amorim, Regina Maria Santos; Beneventi, Magda Aparecida; Margis, Rogério; Grossi-de-Sa, Maria Fátima; Bodanese-Zanettini, Maria Helena

2014-12-10

Drought is by far the most important environmental factor contributing to yield losses in crops, including soybeans [Glycine max (L.) Merr.]. To address this problem, a gene that encodes an osmotin-like protein isolated from Solanum nigrum var. americanum (SnOLP) driven by the UBQ3 promoter from Arabidopsis thaliana was transferred into the soybean genome by particle bombardment. Two independently transformed soybean lines expressing SnOLP were produced. Segregation analyses indicated single-locus insertions for both lines. qPCR analysis suggested a single insertion of SnOLP in the genomes of both transgenic lines, but one copy of the hpt gene was inserted in the first line and two in the second line. Transgenic plants exhibited no remarkable phenotypic alterations in the seven analyzed generations. When subjected to water deficit, transgenic plants performed better than the control ones. Leaf physiological measurements revealed that transgenic soybean plants maintained higher leaf water potential at predawn, higher net CO2 assimilation rate, higher stomatal conductance and higher transpiration rate than non-transgenic plants. Grain production and 100-grain weight were affected by water supply. Decrease in grain productivity and 100-grain weight were observed for both transgenic and non-transgenic plants under water deficit; however, it was more pronounced for non-transgenic plants. Moreover, transgenic lines showed significantly higher 100-grain weight than non-transgenic plants under water shortage. This is the first report showing that expression of SnOLP in transgenic soybeans improved physiological responses and yield components of plants when subjected to water deficit, highlighting the potential of this gene for biotechnological applications.

U.S. Cotton Prices and the World Cotton Market: Forecasting and Structural Change

OpenAIRE

Isengildina-Massa, Olga; MacDonald, Stephen

2009-01-01

The purpose of this study was to analyze structural changes that took place in the cotton industry in recent years and develop a statistical model that reflects the current drivers of U.S. cotton prices. Legislative changes authorized the U.S. Department of Agriculture to resume publishing cotton price forecasts for the first time in 79 years. In addition, systematic problems have become apparent in the forecasting models used by USDA and elsewhere, highlighting the need for an updated review...

Ear leaf photosynthesis and related parameters of transgenic and non-GMO maize hybrids

Science.gov (United States)

Hybrid maize (Zea mays L.) has undergone transformation by using transgenic technology to include d-endotoxins for insect control and tolerance for the herbicides glyphosate and glufosinate . Maize hybrids are being grown with multiple transgenic traits into their genotype (stacked-gene). Limited...

The water footprint of cotton consumption: An assessment of the impact of worldwide consumption of cotton products on the water resources in the cotton producing countries

NARCIS (Netherlands)

Chapagain, Ashok; Hoekstra, Arjen Ysbert; Savenije, H.H.G.; Gautam, R.

2006-01-01

The consumption of a cotton product is connected to a chain of impacts on the water resources in the countries where cotton is grown and processed. The aim of this paper is to assess the ‘water footprint’ of worldwide cotton consumption, identifying both the location and the character of the

Separation and recycling of cotton from cotton/PET blends by depolymerization of PET catalyzed by bases and ionic liquids

NARCIS (Netherlands)

Bouwhuis, G.H. (Gerrit); Brinks, G.J. (Ger); Groeneveld, R.A.J. (Richard); Oelerich, J. (Jens)

2014-01-01

The recycling of post consumer cotton textile waste is highly requested, due to the high environmental impact of cotton production. Often cotton is mixed in blends with polyethylene terephthalate (PET). For the generation of high value products from recycled cotton, it essential that PET is

Preliminary Examinations for the Identification of U.S. Domestic and International Cotton Fibers by Near-Infrared Spectroscopy

Directory of Open Access Journals (Sweden)

Chanel Fortier

2014-09-01

Full Text Available Cotton is and has been a large cash crop in the United States and abroad for many years. Part of the widespread interest and utility of this product is due to its attractive chemical and physical properties for use in textiles. The textile industry could benefit from the presentation of a quick, reliable method to classify U.S. from foreign cottons so that the appropriate tariffs can be levied for non-American cottons. In addition, there is some interest in avoiding cotton identity theft. Thus, an accurate and precise instrumental method would be of interest to correctly identify the country of origin of cotton. This study provides an analytical method to identify domestic and foreign cotton fibers using near-infrared (NIR spectroscopy coupled with principal component analysis (PCA. Samples from American cottons were evaluated along with a representative amount of international samples. The results provide a proof of concept that indicates that PCA analysis can be used to separate the respective domestic and foreign cotton groups.

The Development of a Remote Sensor System and Decision Support Systems Architecture to Monitor Resistance Development in Transgenic Crops

Science.gov (United States)

Cacas, Joseph; Glaser, John; Copenhaver, Kenneth; May, George; Stephens, Karen

2008-01-01

The United States Environmental Protection Agency (EPA) has declared that "significant benefits accrue to growers, the public, and the environment" from the use of transgenic pesticidal crops due to reductions in pesticide usage for crop pest management. Large increases in the global use of transgenic pesticidal crops has reduced the amounts of broad spectrum pesticides used to manage pest populations, improved yield and reduced the environmental impact of crop management. A significant threat to the continued use of this technology is the evolution of resistance in insect pest populations to the insecticidal Bt toxins expressed by the plants. Management of transgenic pesticidal crops with an emphasis on conservation of Bt toxicity in field populations of insect pests is important to the future of sustainable agriculture. A vital component of this transgenic pesticidal crop management is establishing the proof of concept basic understanding, situational awareness, and monitoring and decision support system tools for more than 133650 square kilometers (33 million acres) of bio-engineered corn and cotton for development of insect resistance . Early and recent joint NASA, US EPA and ITD remote imagery flights and ground based field experiments have provided very promising research results that will potentially address future requirements for crop management capabilities.

The "Cotton Problem"

OpenAIRE

Baffes, John

2005-01-01

Cotton is an important cash crop in many developing economies, supporting the livelihoods of millions of poor households. In some countries it contributes as much as 40 percent of merchandise exports and more than 5 percent of gross domestic product (GDP). The global cotton market, however, has been subject to numerous policy interventions, to the detriment of nonsubsidized producers. This ...

Tensile Properties of Single Jersey and 1×1 Rib Knitted Fabrics Made from 100% Cotton and Cotton/Lycra Yarns

Directory of Open Access Journals (Sweden)

Dereje Berihun Sitotaw

2017-01-01

Full Text Available The tensile properties such as tensile strength which is measured as breaking force in Newton (N and elongation percent (% at break of single jersey and 1×1 rib (knitted with full needles knitted fabrics made from 100% cotton and cotton/Lycra yarns (5% Lycra yarn content in 95% combed cotton yarn are investigated in this research. The sample fabrics are conditioned for 24 hours at 20±1°C temperature and 65±2% relative humidity before testing. Ten specimens (five for lengthwise and five for widthwise have been taken from each of the two knitted structures, those made from 100% cotton and cotton/Lycra (at 95/5 percent ratio blend yarns. According to the discussion and as found from the investigations, the tensile properties of single jersey and 1×1 rib knitted fabrics made from 100% cotton and cotton/Lycra yarns are significantly different from each other and both of the knitted fabrics have high elongation percent at break with cotton/Lycra blend yarns as compared to 100% cotton yarn. Knitted fabrics made from cotton/Lycra blended yarn have low breaking force and high elongation percent at break relative to knitted fabrics made from 100% cotton yarns.

The Commodification and Underdevelopment of Ishan Cotton in ...

African Journals Online (AJOL)

The paper concluded that the root cause of Nigeria's post-imperial dependence on imported textile and cotton products is the result of the non-development of cash crops in backwards integration. It recommended the qualitative transformation of indigenous skills and resources to animate the spirit of local enterprise.

Effects of Transgenic cry1Ca Rice on the Development of Xenopus laevis.

Directory of Open Access Journals (Sweden)

Xiuping Chen

Full Text Available In fields of genetically modified, insect-resistant rice expressing Bacillus thuringiensis (Bt proteins, frogs are exposed to Bt Cry proteins by consuming both target and non-target insects, and through their highly permeable skin. In the present study, we assessed the potential risk posed by transgenic cry1Ca rice (T1C-19 on the development of a frog species by adding purified Cry1Ca protein or T1C-19 rice straw into the rearing water of Xenopus laevis tadpoles, and by feeding X. laevis froglets diets containing rice grains of T1C-19 or its non-transformed counterpart MH63. Our results showed that there were no significant differences among groups receiving 100 μg L-1 or 10 μg L-1 Cry1Ca and the blank control in terms of time to completed metamorphosis, survival rate, body weight, body length, organ weight and liver enzyme activity after being exposed to the Cry1Ca (P > 0.05. Although some detection indices in the rice straw groups were significantly different from those of the blank control group (P < 0.05, there was no significant difference between the T1C-19 and MH63 rice straw groups. Moreover, there were no significant differences in the mortality rate, body weight, daily weight gain, liver and fat body weight of the froglets between the T1C-19 and MH63 dietary groups after 90 days, and there were no abnormal pathological changes in the stomach, intestines, livers, spleens and gonads. Thus, we conclude that the planting of transgenic cry1Ca rice will not adversely affect frog development.

Transgenic chickens expressing human urokinase-type plasminogen activator.

Science.gov (United States)

Lee, Sung Ho; Gupta, Mukesh Kumar; Ho, Young Tae; Kim, Teoan; Lee, Hoon Taek

2013-09-01

Urokinase-type plasminogen activator is a serine protease that is clinically used in humans for the treatment of thrombolytic disorders and vascular diseases such as acute ischemic stroke and acute peripheral arterial occlusion. This study explored the feasibility of using chickens as a bioreactor for producing human urokinase-type plasminogen activator (huPA). Recombinant huPA gene, under the control of a ubiquitous Rous sarcoma virus promoter, was injected into the subgerminal cavity of freshly laid chicken eggs at stage X using the replication-defective Moloney murine leukemia virus (MoMLV)-based retrovirus vectors encapsidated with VSV-G (vesicular stomatitis virus G) glycoprotein. A total of 38 chicks, out of 573 virus-injected eggs, hatched and contained the huPA gene in their various body parts. The mRNA transcript of the huPA gene was present in various organs, including blood and egg, and was germ-line transmitted to the next generation. The level of active huPA protein was 16-fold higher in the blood of the transgenic chicken than in the nontransgenic chicken (P huPA protein in eggs increased from 7.82 IU/egg in the G0 generation to 17.02 IU/egg in the G1 generation. However, huPA-expressing embryos had reduced survival and hatchability at d 18 and 21 of incubation, respectively, and the blood clotting time was significantly higher in transgenic chickens than their nontransgenic counterparts (P huPA transgenic chickens could be successfully produced by the retroviral vector system. Transgenic chickens, expressing the huPA under the control of a ubiquitous promoter, may not only be used as a bioreactor for pharming of the huPA drug but also be useful for studying huPA-induced bleeding and other disorders.

Holographic perfect fluidity, Cotton energy-momentum duality and transport properties

Energy Technology Data Exchange (ETDEWEB)

Mukhopadhyay, Ayan [Centre de Physique Théorique, Ecole Polytechnique, CNRS UMR 7644,Route de Saclay, 91128 Palaiseau Cedex (France); Institut de Physique Théorique, CEA, CNRS URA 2306,91191 Gif-sur-Yvette (France); Petkou, Anastasios C. [Institute of Theoretical Physics, Department of Physics, Aristotle University of Thessaloniki,54124 Thessaloniki (Greece); Petropoulos, P. Marios; Pozzoli, Valentina [Centre de Physique Théorique, Ecole Polytechnique, CNRS UMR 7644,Route de Saclay, 91128 Palaiseau Cedex (France); Siampos, Konstadinos [Service de Mécanique et Gravitation, Université de Mons, UMONS,20 Place du Parc, 7000 Mons (Belgium)

2014-04-23

We investigate background metrics for 2+1-dimensional holographic theories where the equilibrium solution behaves as a perfect fluid, and admits thus a thermodynamic description. We introduce stationary perfect-Cotton geometries, where the Cotton-York tensor takes the form of the energy-momentum tensor of a perfect fluid, i.e. they are of Petrov type D{sub t}. Fluids in equilibrium in such boundary geometries have non-trivial vorticity. The corresponding bulk can be exactly reconstructed to obtain 3+1-dimensional stationary black-hole solutions with no naked singularities for appropriate values of the black-hole mass. It follows that an infinite number of transport coefficients vanish for holographic fluids. Our results imply an intimate relationship between black-hole uniqueness and holographic perfect equilibrium. They also point towards a Cotton/energy-momentum tensor duality constraining the fluid vorticity, as an intriguing boundary manifestation of the bulk mass/nut duality.

Holographic perfect fluidity, Cotton energy-momentum duality and transport properties

International Nuclear Information System (INIS)

Mukhopadhyay, Ayan; Petkou, Anastasios C.; Petropoulos, P. Marios; Pozzoli, Valentina; Siampos, Konstadinos

2014-01-01

We investigate background metrics for 2+1-dimensional holographic theories where the equilibrium solution behaves as a perfect fluid, and admits thus a thermodynamic description. We introduce stationary perfect-Cotton geometries, where the Cotton-York tensor takes the form of the energy-momentum tensor of a perfect fluid, i.e. they are of Petrov type D t . Fluids in equilibrium in such boundary geometries have non-trivial vorticity. The corresponding bulk can be exactly reconstructed to obtain 3+1-dimensional stationary black-hole solutions with no naked singularities for appropriate values of the black-hole mass. It follows that an infinite number of transport coefficients vanish for holographic fluids. Our results imply an intimate relationship between black-hole uniqueness and holographic perfect equilibrium. They also point towards a Cotton/energy-momentum tensor duality constraining the fluid vorticity, as an intriguing boundary manifestation of the bulk mass/nut duality

Non-specific activities of the major herbicide-resistance gene BAR.

Science.gov (United States)

Christ, Bastien; Hochstrasser, Ramon; Guyer, Luzia; Francisco, Rita; Aubry, Sylvain; Hörtensteiner, Stefan; Weng, Jing-Ke

2017-12-01

Bialaphos resistance (BAR) and phosphinothricin acetyltransferase (PAT) genes, which convey resistance to the broad-spectrum herbicide phosphinothricin (also known as glufosinate) via N-acetylation, have been globally used in basic plant research and genetically engineered crops 1-4 . Although early in vitro enzyme assays showed that recombinant BAR and PAT exhibit substrate preference toward phosphinothricin over the 20 proteinogenic amino acids 1 , indirect effects of BAR-containing transgenes in planta, including modified amino acid levels, have been seen but without the identification of their direct causes 5,6 . Combining metabolomics, plant genetics and biochemical approaches, we show that transgenic BAR indeed converts two plant endogenous amino acids, aminoadipate and tryptophan, to their respective N-acetylated products in several plant species. We report the crystal structures of BAR, and further delineate structural basis for its substrate selectivity and catalytic mechanism. Through structure-guided protein engineering, we generated several BAR variants that display significantly reduced non-specific activities compared with its wild-type counterpart in vivo. The transgenic expression of enzymes can result in unintended off-target metabolism arising from enzyme promiscuity. Understanding such phenomena at the mechanistic level can facilitate the design of maximally insulated systems featuring heterologously expressed enzymes.

Some results from a temperature evaluation of a cotton field with infrared thermometer for agricultural use

International Nuclear Information System (INIS)

Ovcharova, A.; Kolev, N.; Nedkov, N.

2005-01-01

The aims of the present study were connected with evaluation of the basic soil properties, distribution of thermal, hydrological and electronic soil properties and criteria for minimization of the measurement points, obtained in the cotton non-irrigated field of the Institute of durum wheat and cotton near Chirpan. It were measured crop temperature of cotton field and soil surface temperature distribution during the main vegetative stages. Using the energy balance equation and soil water balance equation was calculated the intensity of evapotranspiration during the days of measurements

The growth performance of F1 transgenic mutiara catfish

Science.gov (United States)

Iskandar; Buwono, I. D.; Agung, M. U. K.

2018-04-01

The growth of catfish (African or Sangkuriang strain) these days is tend to decreased. One of the solutions due to this problem is to improve the genetics of growth using transgenesis technology, toward more profitable. The specific objective of the research is to detect the transmission of exogenous GH (African catfish GH inserts) inside the F1 transgenic Mutiara catfish using PCR (Polymerase Chain Reaction) method and to evaluate the growth performance of transgenic Mutiara catfish made using the parameters of feed conversion (FCR = Feed Conversion Ratio). Transgenic catfish (strain mutiara) F0 and F1 carried African catfish GH (600 bp) can be produced. Superiority characters of transgenic catfish represented heritability (h2 ) and heterosis (H), indicating that the offspring of hybrid F1 transgenic mutiara catfish had phenotypes rapid growth (h2 = 17.55 % and H = 42.83 %) compared to non-transgenic catfish (h 2 = 10.07 % and H = 18.56 %). Evaluation of the efficiency of feed use parameters feed conversion ratio, shows that F1 transgenic mutiara catfish (FCR = 0.85) more efficient in converting feed into meat.

Effects of seed mixture sowing with transgenic Bt rice and its parental line on the population dynamics of target stemborers and leafrollers, and non-target planthoppers.

Science.gov (United States)

Li, Zhuo; Li, Li-Kun; Liu, Bin; Wang, Long; Parajulee, Megha N; Chen, Fa-Jun

2018-01-24

The widespread planting of insect-resistant crops has caused a dramatic shift in agricultural landscapes, thus raising concerns about the potential impacts on both target and non-target pests. In this study, we examined the potential effects of intra-specific seed mixture sowing with transgenic Bt rice (Bt) and its parental non-transgenic line (Nt) (100% Bt rice [Bt 100 ], 5% Nt+95% Bt [Nt 05 Bt 95 ], 10% Nt+90% Bt [Nt 10 Bt 90 ], 20% Nt+80% Bt [Nt 20 Bt 80 ], 40% Nt+60% Bt [Nt 40 Bt 60 ] and 100% Nt rice [Nt 100 ]) on target and non-target pests in a 2-year field trial in southern China. The occurrence of target pests, Sesamia inferens, Chilo suppressalis and Cnaphalocrocis medinalis, decreased with the increased ratio of Bt rice, and the mixture ratios with more than 90% Bt rice (Bt 100 and Nt 05 Bt 95 ) significantly increased the pest suppression efficiency, with the lowest occurrences of non-target planthoppers, Nilaparvata lugens and Sogatella furcifera in Nt 100 and Nt 05 Bt 95 . Furthermore, there were no significant differences in 1000-grain dry weight and grain dry weight per 100 plants between Bt 100 and Nt 05 Bt 95 . Seed mixture sowing of Bt rice with ≤10% (especially 5%) of its parent line was sufficient to overcome potential compliance issues that exist with the use of block or structured refuge to provide most effective control of both target and non-target pests without compromising the grain yield. It is also expected that the strategy of seed mixture sowing with transgenic Bt rice and the non-transgenic parental line would provide rice yield stability while decreasing the insecticide use frequency in rice production. © 2018 Institute of Zoology, Chinese Academy of Sciences.

The water footprint of cotton consumption

NARCIS (Netherlands)

Chapagain, Ashok; Hoekstra, Arjen Ysbert; Savenije, H.H.G.; Gautam, R.

2005-01-01

The consumption of a cotton product is connected to a chain of impacts on the water resources in the countries where cotton is grown and processed. The aim of this report is to assess the ‘water footprint’ of worldwide cotton consumption, identifying both the location and the character of the

Response of successive three generations of cotton bollworm, Helicoverpa armigera (Hübner), fed on cotton bolls, under elevated CO2

Institute of Scientific and Technical Information of China (English)

无

2007-01-01

The growth, development and consumption of successive three generations of cotton bollworm, Helicoverpa armigera (Hübner), fed on cotton bolls grown under elevated CO2 (double-ambient vs. ambient) in open-top chambers were examined. Significant decreases in protein, total amino acid, water and nitrogen content and increases in free fatty acid were observed in cotton bolls. Changes in quality of cotton bolls affected the growth, development and food utilization of H. armigera. Significantly longer larval development duration in three successive generations and lower pupal weight of the second and third generations were observed in cotton bollworm fed on cotton bolls grown under elevated CO2. Significantly lower fecundity was also found in successive three generations of H. armigera fed on cotton bolls grown under elevated CO2. The consumption per larva occurred significant increase in successive three generations and frass per larva were also significantly increased during the second and third generations under elevated CO2. Significantly lower relative growth rate, efficiency of conversion of ingested food and significant higher relative consumption rate in successive three generations were observed in cotton bollworm fed on cotton bolls grown under elevated CO2. Significantly lower potential female fecundity, larval numbers and population consumption were found in the second and third generations of cotton bollworm fed on cotton bolls grown under elevated CO2. The integrative effect of higher larval mortality rate and lower adult fecundity resulted in significant decreases in potential population consumption in the latter two generations. The results show that elevated CO2 adversely affects cotton bolls quality, which indicates the potential population dynamics and potential population consumption of cotton bollworm will alleviate the harm to the plants in the future rising CO2 atmosphere.

Glycinebetaine synthesizing transgenic potato plants exhibit enhanced tolerance to salt and cold stresses

International Nuclear Information System (INIS)

Ahmad, R.; Hussain, J.

2014-01-01

Abiotic stresses are the most important contributors towards low productivity of major food crops. Various attempts have been made to enhance abiotic stress tolerance of crop plants by classical breeding and genetic transformation. Genetic transformation with glycinebetaine (GB) synthesizing enzymes' gene(s) in naturally non accumulating plants has resulted in enhanced tolerance against variety of abiotic stresses. Present study was aimed to evaluate the performance of GB synthesizing transgenic potato plants against salt and cold stresses. Transgenic potato plants were challenged against salt and cold stresses at whole plant level. Transgenic lines were characterized to determine the transgene copy number. Different parameters like integrity, chlorophyll contents, tuber yield and vegetative biomass were studied to monitor the stress tolerance of transgenic potato plants. The results were compared with Non-transgenic (NT) plants and statistically analyzed to evaluate significant differences. Multi-copy insertion of expression cassette was found in both transgenic lines. Upon salt stress, transgenic plants maintained better growth as compared to NT plants. The tuber yield of transgenic plants was significantly greater than NT plants in salt stress. Transgenic plants showed improved membrane integrity against cold stress by depicting appreciably reduced ion leakage as compared to NT plants. Moreover, transgenic plants showed significantly less chlorophyll bleaching than NT plants upon cold stress. In addition, NT plants accumulated significantly less biomass, and yielded fewer tubers as compared to transgenic plants after cold stress treatment. The study will be a committed step for field evaluation of transgenic plants with the aim of commercialization. (author)

Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L. Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

Directory of Open Access Journals (Sweden)

Renesh Bedre

Full Text Available Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L. pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.

Effects of Bt-transgenic rice cultivation on planktonic communities in paddy fields and adjacent ditches

Energy Technology Data Exchange (ETDEWEB)

Liu, Yongbo, E-mail: liuyb@craes.org.cn [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Liu, Fang [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Wang, Chao [Pearl River Fisheries Research Institute, Chinese Academy of Fishery Science, Guangzhou 510380 (China); Quan, Zhanjun [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Li, Junsheng, E-mail: lijsh@creas.org.cn [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China)

2016-09-15

The non-target effects of transgenic plants are issues of concern; however, their impacts in cultivated agricultural fields and adjacent natural aquatic ecosystems are poorly understood. We conducted field experiments during two growing seasons to determine the effects of cultivating Bacillus thuringiensis (Bt)-transgenic rice on the phytoplankton and zooplankton communities in a paddy field and an adjacent ditch. Bt toxin was detected in soil but not in water. Water quality was not significantly different between non-Bt and Bt rice fields, but varied among up-, mid- and downstream locations in the ditch. Cultivation of Bt-transgenic rice had no effects on zooplankton communities. Phytoplankton abundance and biodiversity were not significantly different between transgenic and non-transgenic rice fields in 2013; however, phytoplankton were more abundant in the transgenic rice field than in the non-transgenic rice field in 2014. Water quality and rice type explained 65.9% and 12.8% of this difference in 2014, respectively. Phytoplankton and zooplankton were more abundant in mid- and downstream, than upstream, locations in the ditch, an effect that we attribute to water quality differences. Thus, the release of Bt toxins into field water during the cultivation of transgenic crops had no direct negative effects on plankton community composition, but indirect effects that alter environmental conditions should be taken into account during the processes of management planning and policymaking. - Highlights: • We detect fusion Cry1Ab/1Ac proteins from Bt rice entering into aquatic ecosystems. • Bt-transgenic rice cultivation have no significant effect on zooplankton community. • Bt-transgenic rice cultivation have indirect effect on phytoplankton community. • Water quality explains the difference of plankton communities in adjacent ditches.

Effects of Bt-transgenic rice cultivation on planktonic communities in paddy fields and adjacent ditches

International Nuclear Information System (INIS)

Liu, Yongbo; Liu, Fang; Wang, Chao; Quan, Zhanjun; Li, Junsheng

2016-01-01

The non-target effects of transgenic plants are issues of concern; however, their impacts in cultivated agricultural fields and adjacent natural aquatic ecosystems are poorly understood. We conducted field experiments during two growing seasons to determine the effects of cultivating Bacillus thuringiensis (Bt)-transgenic rice on the phytoplankton and zooplankton communities in a paddy field and an adjacent ditch. Bt toxin was detected in soil but not in water. Water quality was not significantly different between non-Bt and Bt rice fields, but varied among up-, mid- and downstream locations in the ditch. Cultivation of Bt-transgenic rice had no effects on zooplankton communities. Phytoplankton abundance and biodiversity were not significantly different between transgenic and non-transgenic rice fields in 2013; however, phytoplankton were more abundant in the transgenic rice field than in the non-transgenic rice field in 2014. Water quality and rice type explained 65.9% and 12.8% of this difference in 2014, respectively. Phytoplankton and zooplankton were more abundant in mid- and downstream, than upstream, locations in the ditch, an effect that we attribute to water quality differences. Thus, the release of Bt toxins into field water during the cultivation of transgenic crops had no direct negative effects on plankton community composition, but indirect effects that alter environmental conditions should be taken into account during the processes of management planning and policymaking. - Highlights: • We detect fusion Cry1Ab/1Ac proteins from Bt rice entering into aquatic ecosystems. • Bt-transgenic rice cultivation have no significant effect on zooplankton community. • Bt-transgenic rice cultivation have indirect effect on phytoplankton community. • Water quality explains the difference of plankton communities in adjacent ditches.

Advancing environmental risk assessment for transgenic biofeedstock crops

Directory of Open Access Journals (Sweden)

Wolt Jeffrey D

2009-11-01

Full Text Available Abstract Transgenic modification of plants is a key enabling technology for developing sustainable biofeedstocks for biofuels production. Regulatory decisions and the wider acceptance and development of transgenic biofeedstock crops are considered from the context of science-based risk assessment. The risk assessment paradigm for transgenic biofeedstock crops is fundamentally no different from that of current generation transgenic crops, except that the focus of the assessment must consider the unique attributes of a given biofeedstock crop and its environmental release. For currently envisioned biofeedstock crops, particular emphasis in risk assessment will be given to characterization of altered metabolic profiles and their implications relative to non-target environmental effects and food safety; weediness and invasiveness when plants are modified for abiotic stress tolerance or are domesticated; and aggregate risk when plants are platforms for multi-product production. Robust risk assessments for transgenic biofeedstock crops are case-specific, initiated through problem formulation, and use tiered approaches for risk characterization.

Evaluation of cotton stalks destroyers

OpenAIRE

Bianchini, Aloisio; Borges, Pedro H. de M.

2013-01-01

The destruction of the cotton crop residues (cotton stalks) is a mandatory procedure in Brazil for prophylactic issues, but is a subject unexplored by the research and there are few studies that deal with this issue. However, this is not encouraged in recent decades, studies aimed at developing and evaluating equipment for this purpose. The present study had the objective to evaluate six methods for mechanical destruction of cotton crop residues. Each method was defined based on the principle...

Cotton : Market setting, trade policies, and issues

OpenAIRE

Baffes, John

2004-01-01

The value of world cotton production in 2000-01 has been estimated at about $20 billion, down from $35 billion in 1996-97 when cotton prices were 50 percent higher. Although cotton's share in world merchandise trade is insignificant (about 0.12 percent), it is very important to a number of developing countries. Cotton accounts for approximately 40 percent of total merchandise export earnin...

The multi-year effects of repeatedly growing cotton with moderate resistance to Meloidogyne incognita

Science.gov (United States)

Kemerait, Robert C.

2009-01-01

Meloidogyne incognita causes more damage to cotton in the US than any other pathogen. The objective of this study was to document the cumulative effect of moderate resistance on M. incognita population density, root galling, and yield suppression in the southern United States on a moderately resistant cotton genotype grown continuously for three years. Cotton genotypes were Phytogen PH98-3196 (77% suppression of M. incognita), Acala NemX (85% suppression of M. incognita), and Delta and Pine Land DP458 B/R (susceptible standard, 0% suppression). Cotton was grown in fumigated and non-fumigated plots to measure yield loss. Each genotype and nematicide combination was planted in the same place for three years at two sites to document cumulative effects. In 2006, following three years of the different genotypes, all plots at one site were planted with susceptible cotton to document residual effects of planting resistant genotypes. Root galling and nematode population densities in the soil were significantly lower, and percentage yield suppression was numerically lower, when moderately resistant cotton was grown compared to the susceptible standard in both fields in all three years. Differences between susceptible and moderately resistant genotypes are established quickly (after only one season) and then either maintained at similar levels or slightly increased in subsequent years depending on initial nematode levels. However, when susceptible cotton was grown following three years of the moderately resistant genotypes, the nematode suppression provided by moderate resistance was undetectable by the end of the first season. Moderately resistant cotton genotypes are more beneficial than previously reported and should be pursued for nematode management. Rotation of moderately resistant and susceptible cotton could be used along with nematicides to manage root-knot nematodes in a continuous cotton cropping system and reduce selection pressure on the nematodes. PMID:22661787

TRACTION RESISTANCE IN CHITOSAN TREATED COTTON

Directory of Open Access Journals (Sweden)

LOX Wouter

2015-05-01

Full Text Available Nowadays natural products interest has increased. However, when some products are included on textile fibers, they have no affinity and need some binders or other kind of auxiliaries to improve the yeld of the process, and some of them are not so natural as the product which are binding and consequently the “bio” definition is missed as some of them can be considered as highly pollutant. Chitosan is a common used bonding agent for cotton. It improves the antimicrobial and antifungal activity, improves wound healing and is a non-toxic bonding agent. The biopolymer used in this work is chitosan, which is a deacetylated derivative of chitin. These properties depend on the amount of deacetylation (DD and the Molecular weight (MW. Along with these improving properties, as it requires some acid pH to ve solved the treatment with chitosan can have some decreasing mechanical properties. The aim of that paper is to evaluate the change in breaking force of the treated samples and a change in elongation of those samples. It compared different amounts of concentration of chitosan with non treated cotton. The traction resistance test were performed on a dynamometer. The test was conducted according to the UNE EN ISO 13934-1 standard.

Infrared Counterparts to Chandra X-Ray Sources in the Antennae

Science.gov (United States)

Clark, D. M.; Eikenberry, S. S.; Brandl, B. R.; Wilson, J. C.; Carson, J. C.; Henderson, C. P.; Hayward, T. L.; Barry, D. J.; Ptak, A. F.; Colbert, E. J. M.

2007-03-01

We use deep J (1.25 μm) and Ks (2.15 μm) images of the Antennae (NGC 4038/4039) obtained with the Wide-field InfraRed Camera on the Palomar 200 inch (5 m) telescope, together with the Chandra X-ray source list of Zezas and coworkers to search for infrared counterparts to X-ray point sources. We establish an X-ray/IR astrometric frame tie with ~0.5" rms residuals over a ~4.3' field. We find 13 ``strong'' IR counterparts brighter than Ks=17.8 mag and 99.9% confidence level that IR counterparts to X-ray sources are ΔMKs~1.2 mag more luminous than average non-X-ray clusters. We also note that the X-ray/IR matches are concentrated in the spiral arms and ``overlap'' regions of the Antennae. This implies that these X-ray sources lie in the most ``super'' of the Antennae's super star clusters, and thus trace the recent massive star formation history here. Based on the NH inferred from the X-ray sources without IR counterparts, we determine that the absence of most of the ``missing'' IR counterparts is not due to extinction, but that these sources are intrinsically less luminous in the IR, implying that they trace a different (possibly older) stellar population. We find no clear correlation between X-ray luminosity classes and IR properties of the sources, although small-number statistics hamper this analysis.

Cotton leaf curl Burewala virus with intact or mutant transcriptional activator proteins: complexity of cotton leaf curl disease.

Science.gov (United States)

Kumar, Jitendra; Gunapati, Samatha; Alok, Anshu; Lalit, Adarsh; Gadre, Rekha; Sharma, Naresh C; Roy, Joy K; Singh, Sudhir P

2015-05-01

Cotton leaf curl disease (CLCuD) is a serious disease of cotton on the Indian subcontinent. In the present study, three cotton leaf curl viruses, cotton leaf curl Burewala virus (CLCuBuV), cotton leaf curl Kokhran virus (CLCuKoV) and cotton leaf curl Multan virus (CLCuMV), and their associated satellites, cotton leaf curl Multan betasatellite (CLCuMB) and cotton leaf curl Multan alphasatellite (CLCuMA), were detected. CLCuBuV with either intact (CLCuBuV-1) or mutant (CLCuBuV-2) transcriptional activator protein (TrAP) were detected in different plants. Agroinoculation with CLCuBuV-1 or CLCuBuV-2 together with CLCuMB and CLCuMA, resulted in typical leaf curling and stunting of tobacco plants. Inoculation with CLCuKoV or an isolate of CLCuMV (CLCuMV-2), together with CLCuMB and CLCuMA, induced severe leaf curling, while the other isolate of CLCuMV (CLCuMV-1), which was recombinant in origin, showed mild leaf curling in tobacco. To investigate the effect of intact or mutant TrAP and also the recombination events, CLCuBuV-1, CLCuBuV-2, CLCuMV-1 or CLCuMV-2 together with the satellites (CLCuMA and CLCuMB) were transferred to cotton via whitefly-mediated transmission. Cotton plants containing CLCuBuV-1, CLCuBuV-2 or CLCuMV-2 together with satellites showed curling and stunting, whereas the plants having CLCuMV-1 and the satellites showed only mild and indistinguishable symptoms. CLCuBuV-1 (intact TrAP) showed severe symptoms in comparison to CLCuBuV-2 (mutant TrAP). The present study reveals that two types of CLCuBuV, one with an intact TrAP and the other with a mutant TrAP, exist in natural infection of cotton in India. Additionally, CLCuMuV-1, which has a recombinant origin, induces mild symptoms in comparison to the other CLCuMV isolates.

Processing and properties of PCL/cotton linter compounds

Energy Technology Data Exchange (ETDEWEB)

Bezerra, Elieber Barros; Franca, Danyelle Campos; Morais, Dayanne Diniz de Souza; Araujo, Edcleide Maria [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Departamento de Engenharia de Materiais; Rosa, Morsyleide de Freitas; Morais, Joao Paulo Saraiva [Embrapa Tropical Agroindustia, Fortaleza, CE (Brazil); Wellen, Renate Maria Ramos, E-mail: wellen.renate@gmail.com [Universidade Federal da Paraiaba (UFPB), Joao Pessoa, PB (Brazil)

2017-03-15

Biodegradable compounds of poly(ε-caprolactone) (PCL)/ cotton linter were melting mixed with filling content ranging from 1% to 5% w/w. Cotton linter is an important byproduct of textile industry; in this work it was used in raw state and after acid hydrolysis. According to the results of torque rheometry no decaying of viscosity took place during compounding, evidencing absence of breaking down in molecular weight. The thermal stability increased by 20% as observed in HDT for PCL/cotton nanolinter compounds. Adding cotton linter to PCL did not change its crystalline character as showed by XRD; however an increase in degree of crystallinity was observed by means of DSC. From mechanical tests in tension was observed an increase in ductility of PCL, and from mechanical tests in flexion an increase in elastic modulus upon addition of cotton linter, whereas impact strength presented lower values for PCL/cotton linter and PCL/cotton nanolinter compounds. SEM images showed that PCL presents plastic fracture and cotton linter has an interlacing fibril structure with high L/D ratio, which are in agreement with matrix/fibril morphology observed for PCL/cotton linter compounds. PCL/cotton linter compounds made in this work cost less than neat PCL matrix and presented improved properties making feasible its commercial use. (author)

Combination of Trichoderma harzianum endochitinase and a membrane-affecting fungicide on control of Alternaria leaf spot in transgenic broccoli plants.

Science.gov (United States)

Mora, A; Earle, E D

2001-04-01

Progeny from transgenic broccoli (cv. Green Comet) expressing a Trichoderma harzianum endochitinase gene were used to assess the interaction between endochitinase and the fungicide Bayleton in the control of Alternaria brassicicola. In vitro assays have shown synergistic effects of endochitinase and fungicides on fungal pathogens. Our study examined the in planta effects of endochitinase and Bayleton, individually and in combination. Two month old transgenic and non-transgenic plants were sprayed with ED50 levels of Bayleton and/or inoculated with an A. brassicicola spore suspension. Disease levels in non-sprayed transgenic plants were not statistically different from sprayed transgenic plants nor from sprayed non-transgenic controls. Thus endochitinase-transgenic plants alone provided a significant reduction of disease severity, comparable to the protection by fungicide on non-transgenic plants. Comparison of the expected additive and observed effects revealed no synergism between endochitinase and Bayleton (at ED50 level), and usually less than an additive effect. Some transgenic lines sprayed with fungicide at doses higher than ED50 showed resistance similar to the non-sprayed transgenic lines, again suggesting no synergistic effect. Lack of synergism may be due to incomplete digestion of the cell wall by endochitinase, so that the effect of Bayleton at the cell membrane is not enhanced.

Biological control of cotton aphid (Aphis gossypii Glover) in cotton (inter)cropping systems in China : a simulation study

NARCIS (Netherlands)

Xia, J.

1997-01-01

Cotton aphid ( Aphis gossypii Glover) is the key insect pest of seedling cotton ( Gossypium hirsutum L. ) in China, particularly in the North China cotton region. The resulting annual losses amount to 10-15% of the attainable yield. Sole reliance on

Direct characterization of cotton fabrics treated with di-epoxide by nuclear magnetic resonance.

Science.gov (United States)

Xiao, Min; Chéry, Joronia; Keresztes, Ivan; Zax, David B; Frey, Margaret W

2017-10-15

A non-acid-based, di-functional epoxide, neopentyl glycol diglycidyl ether (NPGDGE), was used to modify cotton fabrics. Direct characterization of the modified cotton was conducted by Nuclear Magnetic Resonance (NMR) without grinding the fabric into a fine powder. NaOH and MgBr 2 were compared in catalyzing the reaction between the epoxide groups of NPGDGE and the hydroxyl groups of cellulose. Possible reaction routes were discussed. Scanning electron microscopy (SEM) images showed that while the MgBr 2 -catalyzed reaction resulted in self-polymerization of NPGDGE, the NaOH-catalyzed reaction did not. Fourier transform infrared spectroscopy (FTIR) showed that at high NaOH concentration cellulose restructures from allomorph I to II. NMR studies verified the incorporation of NPGDGE into cotton fabrics with a clear NMR signal, and confirmed that at higher NaOH concentration the efficiency of grafting of NPGDGE was increased. This demonstrates that use of solid state NMR directly on woven fabric samples can simultaneously characterize chemical modification and crystalline polymorph of cotton. No loss of tensile strength was observed for cotton fabrics modified with NPGDGE. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effects of genetically modified cotton stalks on antibiotic resistance genes, intI1, and intI2 during pig manure composting.

Science.gov (United States)

Duan, Manli; Gu, Jie; Wang, Xiaojuan; Li, Yang; Zhang, Sheqi; Yin, Yanan; Zhang, Ranran

2018-01-01

Genetically modified (GM) cotton production generates a large yield of stalks and their disposal is difficult. In order to study the feasibility of using GM cotton stalks for composting and the changes that occur in antibiotic resistance genes (ARGs) during composting, we supplemented pig manure with GM or non-GM cotton stalks during composting and we compared their effects on the absolute abundances (AA) of intI1, intI2, and ARGs under the two treatments. The compost was mature after processing based on the germination index and C/N ratio. After composting, the AAs of ARGs, intI1, and intI2 were reduced by 41.7% and 45.0% in the non-GM and GM treatments, respectively. The ARG profiles were affected significantly by temperature and ammonia nitrogen. In addition, excluding tetC, GM cotton stalks had no significant effects on ARGs, intI1, and intI2 compared with the non-GM treatment (p composting with livestock manure, and the AAs of ARGs can be reduced. Furthermore, the results of this study provide a theoretical basis for the harmless utilization of GM cotton stalks. Copyright © 2017 Elsevier Inc. All rights reserved.

Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

Science.gov (United States)

Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

Development and validation of SUCROS-Cotton : A potential crop growth simulation model for cotton

NARCIS (Netherlands)

Zhang, L.; Werf, van der W.; Cao, W.; Li, B.; Pan, X.; Spiertz, J.H.J.

2008-01-01

A model for the development, growth and potential production of cotton (SUCROS-Cotton) was developed. Particular attention was given to the phenological development of the plant and the plasticity of fruit growth in response to temperature, radiation, daylength, variety traits, and management. The

Characterizing the sorption of polybrominated diphenyl ethers (PBDEs) to cotton and polyester fabrics under controlled conditions

Energy Technology Data Exchange (ETDEWEB)

Saini, Amandeep [Department of Physical and Environmental Sciences, University of Toronto Scarborough, 1265 Military trail, Toronto, ON M1C 1A4 (Canada); Rauert, Cassandra [School of Geography, Earth and Environmental Sciences, University of Birmingham, Birmingham B15 2TT (United Kingdom); Simpson, Myrna J. [Department of Physical and Environmental Sciences, University of Toronto Scarborough, 1265 Military trail, Toronto, ON M1C 1A4 (Canada); Harrad, Stuart [School of Geography, Earth and Environmental Sciences, University of Birmingham, Birmingham B15 2TT (United Kingdom); Diamond, Miriam L., E-mail: miriam.diamond@utoronto.ca [Department of Earth Sciences, 22 Russell Street, University of Toronto, Toronto, ON M5S 3B1 (Canada); Department of Physical and Environmental Sciences, University of Toronto Scarborough, 1265 Military trail, Toronto, ON M1C 1A4 (Canada)

2016-09-01

Cotton and polyester, physically and chemically different fabrics, were characterized for sorption of gas-phase polybrominated diphenyl ethers (PBDEs). Scanning electron microscopic (SEM) images and BET specific surface area (BET-SSA) analysis showed cotton's high microsurface area; NMR analysis showed richness of hexose- and aromatic-carbon in cotton and polyester, respectively. Cotton and polyester sorbed similar concentrations of gas-phase PBDEs in chamber studies, when normalized to planar surface area. However, polyester concentrations were 20–50 times greater than cotton when normalized to BET-SSA, greater than the 10 times difference in BET-SSA. The difference in sorption between cotton and polyester is hypothesized to be due to ‘dilution’ due to cotton's large BET-SSA and/or greater affinity of PBDEs for aromatic-rich polyester. Similar fabric-air area normalized distribution coefficients (K'{sub D}, 10{sup 3} to 10{sup 4} m) for cotton and polyester support air-side controlled uptake under non-equilibrium conditions. K'{sub D} values imply that 1 m{sup 2} of cotton or polyester fabrics would sorb gas-phase PBDEs present in 10{sup 3} to 10{sup 4} m{sup 3} of equivalent air volume at room temperature over one week, assuming similar air flow conditions. Sorption of PBDEs to fabrics has implications for their fate indoors and human exposure. - Highlights: • Sorption of gas-phase PBDEs by cotton and polyester fabrics • Similar sorption to cotton and polyester per unit planar surface area • Greater sorption by polyester/BET-SSA; cotton's dilution or polyester’s affinity • 1 m{sup 2} fabric sorbs PBDEs in 10{sup 3} to 10{sup 4} m{sup 3} of equivalent air volume • Clothing likely a large indoor sink of PBDEs and influence human exposure.

Cotton trends in India

Indian Academy of Sciences (India)

First page Back Continue Last page Graphics. Cotton trends in India. A crop of significant economic importance, valued at over Rs. 15000 Crs. Provides income to 60 million people. Crucial raw material for Rs 83000 Crores textile industry out of which Rs 45754 crores is exports. Approx. 20 Million acres of cotton provides ...

Ergonomic Evaluation of Battery Powered Portable Cotton Picker

Science.gov (United States)

Dixit, A.; Manes, G. S.; Singh, A.; Prakash, A.; Mahal, J. S.

2012-09-01

Ergonomic evaluation of battery powered portable manual cotton picker was carried out on two subjects for three cotton varieties and was compared against manual method of picking. It is a hand operated machine and has a pair of chain with small sharp edged teeth and sprockets and is operated by a light weight 12 V battery. Cotton gets entangled with the chain and is collected and guided into the collection bag. Average heart rate, oxygen consumption, workload, energy expenditure was more in case of cotton picking by manual cotton picker as compared to manual picking for both the subjects for all three cotton variety types. Oxygen consumption varied from 0.81 to 0.97 l/min, workload varied from 36.32 to 46.16 W and energy expenditure varied from 16.83 to 20.33 kJ/min for both the subject in case of machine picking for all three cotton varieties. The maximum discomfort experienced by the subjects during picking cotton by manual cotton picker was in right wrist palm, right forearm, upper and lower back, left shoulder and in lower legs and both feet.

Yield and size of oyster mushroom grown on rice/wheat straw basal substrate supplemented with cotton seed hull.

Science.gov (United States)

Yang, Wenjie; Guo, Fengling; Wan, Zhengjie

2013-10-01

Oyster mushroom (Pleurotus ostreatus) was cultivated on rice straw basal substrate, wheat straw basal substrate, cotton seed hull basal substrate, and wheat straw or rice straw supplemented with different proportions (15%, 30%, and 45% in rice straw substrate, 20%, 30%, and 40% in wheat straw substrate) of cotton seed hull to find a cost effective substrate. The effect of autoclaved sterilized and non-sterilized substrate on growth and yield of oyster mushroom was also examined. Results indicated that for both sterilized substrate and non-sterilized substrate, oyster mushroom on rice straw and wheat basal substrate have faster mycelial growth rate, comparatively poor surface mycelial density, shorter total colonization period and days from bag opening to primordia formation, lower yield and biological efficiency, lower mushroom weight, longer stipe length and smaller cap diameter than that on cotton seed hull basal substrate. The addition of cotton seed hull to rice straw and wheat straw substrate slowed spawn running, primordial development and fruit body formation. However, increasing the amount of cotton seed hull can increase the uniformity and white of mycelium, yield and biological efficiency, and increase mushroom weight, enlarge cap diameter and shorten stipe length. Compared to the sterilized substrate, the non-sterilized substrate had comparatively higher mycelial growth rate, shorter total colonization period and days from bag opening to primordia formation. However, the non-sterilized substrate did not gave significantly higher mushroom yield and biological efficiency than the sterilized substrate, but some undesirable characteristics, i.e. smaller mushroom cap diameter and relatively long stipe length.

Genetic and epigenetic status of triple exotic consanguinity cotton introgression lines.

Science.gov (United States)

He, S P; Sun, J L; Du, X M

2011-10-03

Introgression lines are some of the most important germplasm for breeding applications and other research conducted on cotton crops. The DNA methylation level among 10 introgression lines of cotton (Gossypium hirsutum) and three exotic parental species (G. arboreum, G. thurberi and G. barbadense) were assessed by methylation-sensitive amplified polymorphism (MSAP) technology. The methylation level in the introgression lines ranged from 33.3 to 51.5%. However, the lines PD0111 and PD0113 had the lowest methylation level (34.6 and 33.3%, respectively) due to demethylation of most non-coding sequences. Amplified fragment length polymorphism (AFLP) was used to evaluate the genetic polymorphism in the cotton introgression lines. A high degree of polymorphism was observed in all introgression lines (mean 47.2%) based on AFLP and MSAP analyses. This confirmed the effects of genetic improvement on cotton introgression lines. The low methylation varieties, PD0111 and PD0113 (introgression lines), clustered outside of the introgression lines based on MSAP data, which was incongruent with an AFLP-based dendrogram. This phenomenon could be caused by environmental changes or introgression of exotic DNA fragments.

Rapid method for identification of transgenic fish zygosity

Directory of Open Access Journals (Sweden)

. Alimuddin

2007-07-01

Full Text Available Identification of zygosity in transgenik fish is normally achieved by PCR analysis with genomic DNA template extracted from the tissue of progenies which are derived by mating the transgenic fish and wild-type counterpart.  This method needs relatively large amounts of fish material and is time- and labor-intensive. New approaches addressing this problem could be of great help for fish biotechnologists.  In this experiment, we applied a quantitative real-time PCR (qr-PCR method to analyze zygosity in a stable line of transgenic zebrafish (Danio rerio carrying masu salmon, Oncorhynchus masou D6-desaturase-like gene. The qr-PCR was performed using iQ SYBR Green Supermix in the iCycler iQ Real-time PCR Detection System (Bio-Rad Laboratories, USA.  Data were analyzed using the comparative cycle threshold method.  The results demonstrated a clear-cut identification of all transgenic fish (n=20 classified as a homozygous or heterozygous.  Mating of those fish with wild-type had revealed transgene transmission to the offspring following expected Mendelian laws. Thus, we found that the qTR-PCR to be effective for a rapid and precise determination of zygosity in transgenic fish. This technique could be useful in the establishment of breeding programs for mass transgenic fish production and in experiments in which zygosity effect could have a functional impact. Keywords: quantitative real-time PCR; zygosity; transgenic fish; mass production   ABSTRAK Identifikasi sigositas ikan transgenik biasanya dilakukan menggunakan analisa PCR dengan cetakan DNA genomik yang diekstraksi dari jaringan ikan hasil persilangan antara ikan transgenik dan ikan normal.   Metode ini memerlukan ikan dalam jumlah yang banyak, dan juga waktu serta tenaga.  Pendekatan baru untuk mengatasi masalah tersebut akan memberikan manfaat besar kepada peneliti bioteknologi perikanan.  Pada penelitian ini, kami menggunakan metode PCR real-time kuantitatif (krt-PCR untuk

Elevated atmospheric ozone increases concentration of insecticidal Bacillus thuringiensis (Bt) Cry1Ac protein in Bt Brassica napus and reduces feeding of a Bt target herbivore on the non-transgenic parent

International Nuclear Information System (INIS)

Himanen, Sari J.; Nerg, Anne-Marja; Nissinen, Anne; Stewart, C. Neal; Poppy, Guy M.; Holopainen, Jarmo K.

2009-01-01

Sustained cultivation of Bacillus thuringiensis (Bt) transgenic crops requires stable transgene expression under variable abiotic conditions. We studied the interactions of Bt toxin production and chronic ozone exposure in Bt cry1Ac-transgenic oilseed rape and found that the insect resistance trait is robust under ozone elevations. Bt Cry1Ac concentrations were higher in the leaves of Bt oilseed rape grown under elevated ozone compared to control treatment, measured either per leaf fresh weight or per total soluble protein of leaves. The mean relative growth rate of a Bt target herbivore, Plutella xylostella L. larvae was negative on Bt plants in all ozone treatments. On the non-transgenic plants, larval feeding damage was reduced under elevated ozone. Our results indicate the need for monitoring fluctuations in Bt toxin concentrations to reveal the potential of ozone exposure for altering dosing of Bt proteins to target and non-target herbivores in field environments experiencing increasing ozone pollution. - Elevated atmospheric ozone can induce fluctuations in insecticidal protein concentrations in transgenic plants

Elevated atmospheric ozone increases concentration of insecticidal Bacillus thuringiensis (Bt) Cry1Ac protein in Bt Brassica napus and reduces feeding of a Bt target herbivore on the non-transgenic parent

Energy Technology Data Exchange (ETDEWEB)

Himanen, Sari J. [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland)], E-mail: sari.himanen@uku.fi; Nerg, Anne-Marja [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland); Nissinen, Anne [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland); MTT Agrifood Research Finland, Plant Protection, FIN-31600 Jokioinen (Finland); Stewart, C. Neal [University of Tennessee, Department of Plant Sciences, Knoxville, TN 37996-4561 (United States); Poppy, Guy M. [University of Southampton, School of Biological Sciences, Southampton SO16 7PX (United Kingdom); Holopainen, Jarmo K. [University of Kuopio, Department of Environmental Science, P.O. Box 1627, FIN-70211 Kuopio (Finland)

2009-01-15

Sustained cultivation of Bacillus thuringiensis (Bt) transgenic crops requires stable transgene expression under variable abiotic conditions. We studied the interactions of Bt toxin production and chronic ozone exposure in Bt cry1Ac-transgenic oilseed rape and found that the insect resistance trait is robust under ozone elevations. Bt Cry1Ac concentrations were higher in the leaves of Bt oilseed rape grown under elevated ozone compared to control treatment, measured either per leaf fresh weight or per total soluble protein of leaves. The mean relative growth rate of a Bt target herbivore, Plutella xylostella L. larvae was negative on Bt plants in all ozone treatments. On the non-transgenic plants, larval feeding damage was reduced under elevated ozone. Our results indicate the need for monitoring fluctuations in Bt toxin concentrations to reveal the potential of ozone exposure for altering dosing of Bt proteins to target and non-target herbivores in field environments experiencing increasing ozone pollution. - Elevated atmospheric ozone can induce fluctuations in insecticidal protein concentrations in transgenic plants.

7 CFR 1427.1203 - Eligible ELS cotton.

Science.gov (United States)

2010-01-01

... OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Extra Long Staple (ELS) Cotton... must be either: (1) Baled lint, including baled lint classified by USDA's Agricultural Marketing..., under the provisions of this subpart, has been made available; (2) Imported ELS cotton; (3) Raw...

Functional characterization of a strong bi-directional constitutive plant promoter isolated from cotton leaf curl Burewala virus.

Directory of Open Access Journals (Sweden)

Zainul A Khan

Full Text Available Cotton leaf curl Burewala virus (CLCuBuV, belonging to the genus Begomovirus, possesses single-stranded monopartite DNA genome. The bidirectional promoters representing Rep and coat protein (CP genes of CLCuBuV were characterized and their efficacy was assayed. Rep and CP promoters of CLCuBuV and 35S promoter of Cauliflower mosaic virus (CaMV were fused with β-glucuronidase (GUS and green fluorescent protein (GFP reporter genes. GUS activity in individual plant cells driven by Rep, CP and 35S promoters was estimated using real-time PCR and fluorometric GUS assay. Histochemical staining of GUS in transformed tobacco (Nicotiana tabacum cv. Xanthi leaves showed highest expression driven by Rep promoter followed by 35S promoter and CP promoter. The expression level of GUS driven by Rep promoter in transformed tobacco plants was shown to be two to four-fold higher than that of 35S promoter, while the expression by CP promoter was slightly lower. Further, the expression of GFP was monitored in agroinfiltrated leaves of N. benthamiana, N. tabacum and cotton (Gossypium hirsutum plants using confocal laser scanning microscopy. Rep promoter showed strong consistent transient expression in tobacco and cotton leaves as compared to 35S promoter. The strong constitutive CLCuBuV Rep promoter developed in this study could be very useful for high level expression of transgenes in a wide variety of plant cells.

Differential antioxidative responses in transgenic peanut bear no relationship to their superior transpiration efficiency under drought stress.

Science.gov (United States)

Bhatnagar-Mathur, Pooja; Devi, M Jyostna; Vadez, Vincent; Sharma, Kiran K

2009-07-15

To counter the effects of environmental stresses, the plants must undergo detoxification that is crucial to avoid the accumulation of damaging free oxygen radicals (ROI). Here, we detail the oxidative damage, the antioxidant composition, and the osmoprotection achieved in transgenic plants of peanut overexpressing the AtDREB1A transgene, driven by a stress-inducible promoter (Atrd29A) when exposed to progressive water stress conditions. This study explored the biochemical mechanisms where (i) the antioxidants such as superoxide dismutase (SOD), ascorbate peroxidase (APOX), and glutathione reductase (GR) accumulated in the transgenic plants at comparably higher levels than their untransformed counterparts under dry soil conditions, (ii) a significant increase in the proline levels in the transgenic plants was observed in dry soils, and (iii) a dramatic increase in the lipid peroxidation in the untransformed controls in drier soils. Most of the biochemical parameters related to the antioxidative machinery in the tested peanut transgenics were triggered by the overexpression of AtDREB1A that appeared to differ from the untransformed controls. The antioxidants showed a negative correlation with the fraction of transpirable soil water (FTSW) thresholds, where the normalized transpiration rate (NTR) started decreasing in the tested plants. However, no significant relationship was observed between any of these biochemical indicators and the higher transpiration efficiency (TE) values found in the transgenic events. Our results show that changes in the antioxidative machinery in these transgenic peanut plants (overexpressing the AtDREB1A transcription factor) under water-limiting conditions played no causative role in improved TE.

A non-specific effect associated with conditional transgene expression based on Cre-loxP strategy in mice.

Directory of Open Access Journals (Sweden)

Linghua Qiu

Full Text Available Transgenes flanked by loxP sites have been widely used to generate transgenic mice where the transgene expression can be controlled spatially and temporally by Cre recombinase. Data from this approach has led to important conclusions in cancer, neurodevelopment and neurodegeneration. Using this approach to conditionally express micro RNAs (miRNAs in mice, we found that Cre-mediated recombination in neural progenitor cells caused microcephaly in five of our ten independent transgenic lines. This effect was not associated with the types or the quantity of miRNAs being expressed, nor was it associated with specific target knockdown. Rather, it was correlated with the presence of multiple tandem transgene copies and inverted (head-to-head or tail-to-tail transgene repeats. The presence of these inverted repeats caused a high level of cell death in the ventricular zone of the embryonic brain, where Cre was expressed. Therefore, results from this Cre-loxP approach to generate inducible transgenic alleles must be interpreted with caution and conclusions drawn in previous reports may need reexamination.

Screening of cotton (gossypium hirsutum l.) genotypes for heat tolerance

International Nuclear Information System (INIS)

Abro, S.; Khan, M.A.; Sial, M.A.

2015-01-01

Cotton yield is highly affected due to biotic (diseases and pests) and abiotic (heat, dought and salinity) Stresses. Among them, high temperature is the main environmental constraint which adversely reduces cotton yield and quality. High temperature above 36 degree C affects plant growth and development especially during reproductive phase. Present studies were carried out to assess the tolerance of fifty-eight newly evolved cotton genotypes to heat stresses, based on agronomic and physiological characteristics. The genotypes were screened in field conditions under two temperature regimes. The studies were conducted at experimental farm of Nuclear Institute of Agriculture, Tando Jam, Pakistan. The results showed that March sown crop experienced high temperature (i.e. > 44 degree C in May and June), which significantly affected crop growth and productivity. The genotypes were identified as heat-tolerant on the basis of relative cell injury percentage (RCI %), heat susceptibility index (HSI) values, boll retention and seed cotton yield (kg/ha). RCI level in cotton genotypes ranged from 39.0 to 86.0%. Out of 58, seventeen genotypes (viz.NIA-80, NIA-81, NIA-83, NIA-84, NIA-M-30, NIA-M31, NIA-HM-48, NIA-HM-327, NIA-H-32, NIA-HM-2-1, NIA-Bt1, NIA-Bt2, NIA-Perkh, CRIS-342, CRIS-134, NIAB-111 and check variety Sadori indicated high level of heat tolerance at both (heat-stressed and non-stressed) temperature regimes; as shown the lowest relative injury level and relatively heat resistant index (HSI<1) values. Such genotypes could be used as heattolerant genotypes under heat-stressed environments. (author)

Energy usage for cotton ginning in Australia

Energy Technology Data Exchange (ETDEWEB)

Ismail, S.A. [MARA Univ. of Technology, Shah Alam (Malaysia). Faculty of Applied Sciences; Southern Queensland Univ., Toowoomba, QLD (Australia). National Centre for Engineering in Agriculture; Chen, G.; Baillie, C.; Symes, T. [Southern Queensland Univ., Toowoomba, QLD (Australia). National Centre for Engineering in Agriculture

2010-07-01

This paper reported on a study that evaluated the energy consumption of cotton gins used in Australia. The average electricity use is 52.3 kWh per bale. In practicality, the electricity consumption for different gins is correlated linearly with the bale numbers produced. The cost of electricity is therefore important in cotton ginning operations. The power factor in all the gins monitored in this study was greater than 0.85. The study showed that the use of gas dryers was highly influenced by the cotton moisture and regulated drying temperature. In general, electricity and gas consumption comprised 61 and 39 per cent of total energy use respectively. The study showed that 60.38 kg of carbon dioxide are emitted for ginning each bale of cotton. This paper described a newly developed method for monitoring the energy performance in cotton gins. Detailed monitoring and analysis carried out at 2 gin sites revealed that electricity consumption is not influenced much by changes in trash content in the module, degree of moisture and lint quality. However, the cotton variety influences the energy consumption. Cotton handling constituted nearly 50 per cent of the power used in both gins.

[Effects of cotton stalk biochar on microbial community structure and function of continuous cropping cotton rhizosphere soil in Xinjiang, China].

Science.gov (United States)

Gu, Mei-ying; Tang, Guang-mu; Liu, Hong-liang; Li, Zhi-qiang; Liu, Xiao-wei; Xu, Wan-li

2016-01-01

In this study, field trials were conducted to examine the effects of cotton stalk biochar on microbial population, function and structural diversity of microorganisms in rhizosphere soil of continuous cotton cropping field in Xinjiang by plate count, Biolog and DGGE methods. The experiment was a factorial design with four treatments: 1) normal fertilization with cotton stalk removed (NPK); 2) normal fertilization with cotton stalk powdered and returned to field (NPKS); 3) normal fertilization plus cotton stalk biochar at 22.50 t · hm⁻² (NPKB₁); and 4) normal fertilization plus cotton stalk biochar at 45.00 t · hm⁻² (NPKB₂). The results showed that cotton stalk biochar application obviously increased the numbers of bacteria and actinomycetes in the rhizospheric soil. Compared with NPK treatment, the number of fungi was significantly increased in the NPKB₁treatment, but not in the NPKB₂ treatment. However, the number of fungi was generally lower in the biochar amended (NPKB₁, NPKB₂) than in the cotton stalk applied plots (NPKS). Application of cotton stalk biochar increased values of AWCD, and significantly improved microbial richness index, suggesting that the microbial ability of utilizing carbohydrates, amino acids and carboxylic acids, especially phenolic acids was enhanced. The number of DGGE bands of NPKB₂ treatment was the greatest, with some species of Gemmatimonadetes, Acidobacteria, Proteobacteria and Actinobacteria being enriched. UPGMC Cluster analysis pointed out that bacterial communities in the rhizospheric soil of NPKB₂ treatment were different from those in the NPK, NPKS and NPKB₁treatments, which belonged to the same cluster. These results indicated that application of cotton stalk biochar could significantly increase microbial diversity and change soil bacterial community structure in the cotton rhizosphere soil, thus improving the health of soil ecosystem.

Influence of Tencel/cotton blends on knitted fabric performance

Directory of Open Access Journals (Sweden)

Alaa Arafa Badr

2016-09-01

Full Text Available The requirements in terms of wearing comfort with sportswear, underwear and outerwear are widely linked to the use of new fibers. Today, Tencel fiber is one of the most important developments in regenerated cellulosic fiber. However, the relation between Tencel fiber properties and fabric characteristics has not been enough studied in the literature especially the influence of fiber materials on mechanical, Ultraviolet Protection Factor (UPF and absorption properties. Therefore, in this study, knitted fabric samples were manufactured with eight different yarns with two fabric types (single jersey and single jersey with Lycra. 30/1-Ne yarns from natural and regenerated cellulosic fibers: 50% Tencel-LF/50% cotton, 67% Tencel-LF/33% cotton, 67% Tencel-STD/33% cotton, 70% bamboo/30% cotton, 100% bamboo, 100% Modal, 100% Micro-Modal and 100% cotton were employed. Then, all the produced fabrics were subjected to five cycles laundering and then flat dried. The results show that 67% Tencel-LF/33% cotton has more flexural rigidity and withdrawing handle force than 67% Tencel-STD/33% cotton fabric, while 67% Tencel-STD/33% cotton has a merit of durability during bursting test. Blending Egyptian cotton fibers with bamboo and Tencel as in 70/30% bamboo/cotton and 50/50% Tencel-LF/cotton improve UPF of the produced fabric.

Semiochemicals from herbivory induced cotton plants enhance the foraging behavior of the cotton boll weevil, Anthonomus grandis.

Science.gov (United States)

Magalhães, D M; Borges, M; Laumann, R A; Sujii, E R; Mayon, P; Caulfield, J C; Midega, C A O; Khan, Z R; Pickett, J A; Birkett, M A; Blassioli-Moraes, M C

2012-12-01

The boll weevil, Anthonomus grandis, has been monitored through deployment of traps baited with aggregation pheromone components. However, field studies have shown that the number of insects caught in these traps is significantly reduced during cotton squaring, suggesting that volatiles produced by plants at this phenological stage may be involved in attraction. Here, we evaluated the chemical profile of volatile organic compounds (VOCs) emitted by undamaged or damaged cotton plants at different phenological stages, under different infestation conditions, and determined the attractiveness of these VOCs to adults of A. grandis. In addition, we investigated whether or not VOCs released by cotton plants enhanced the attractiveness of the aggregation pheromone emitted by male boll weevils. Behavioral responses of A. grandis to VOCs from conspecific-damaged, heterospecific-damaged (Spodoptera frugiperda and Euschistus heros) and undamaged cotton plants, at different phenological stages, were assessed in Y-tube olfactometers. The results showed that volatiles emitted from reproductive cotton plants damaged by conspecifics were attractive to adults boll weevils, whereas volatiles induced by heterospecific herbivores were not as attractive. Additionally, addition of boll weevil-induced volatiles from reproductive cotton plants to aggregation pheromone gave increased attraction, relative to the pheromone alone. The VOC profiles of undamaged and mechanically damaged cotton plants, in both phenological stages, were not different. Chemical analysis showed that cotton plants produced qualitatively similar volatile profiles regardless of damage type, but the quantities produced differed according to the plant's phenological stage and the herbivore species. Notably, vegetative cotton plants released higher amounts of VOCs compared to reproductive plants. At both stages, the highest rate of VOC release was observed in A. grandis-damaged plants. Results show that A. grandis uses

Superhydrophobic cotton by fluorosilane modification

CSIR Research Space (South Africa)

Erasmus, E

2009-12-01

Full Text Available the treatment with fluorinated or silicon compounds)1-4 and by enhancing the surface roughness with a fractal structure5-8. Cotton, a cellulose-based material, that is greatly hydrophilic, is more benefited when made hydrophobic. Modification of cotton...

ANALYSIS OF IMMUNE RESPONSES ON TRANSGENIC TIGER SHRIMP (Penaeus monodon AGAINST PATHOGENIC BACTERIUM Vibrio harveyi

Directory of Open Access Journals (Sweden)

Andi Parenrengi

2014-06-01

Full Text Available Vibriosis is one of main diseases of the black tiger shrimp Penaeus monodon infected by pathogenic bioluminous bacterium Vibrio harveyi that can cause mass mortalities in shrimp culture. The bacteria can also trigger the disease white spot syndrome virus (WSSV. An effort to produce shrimp disease-resistant strains has been done through transgenesis technology with antiviral gene transfection. By this technology, it is expected an increase in the immune response of shrimp in a variety of diseasecausing pathogens. This study aimed to determine the immune responses (total haemocytes, haemocyte differentiation, and phenoloxydase activity of transgenic tiger shrimp against pathogenic bacterium V. harveyi. Research using completely randomized design, which consists of two treatments and three replications. Test animals being used were transgenic and non-transgenic shrimp with size, weight 3.93±1.25 g and a total length of 7.59±0.87 cm. Treatments being tested were the injection of bacterium V. harveyi (density of 5x106 cfu/mL of 0.1 mL/individual on transgenic (A and non-transgenic shrimp (B. Immune response parameters such as total haemocytes, haemocyte differentiation, and phenoloxydase activity were observed on day 1, 3, and 6 days after challenging. Data were analyzed using t-test by SPSS software. The results showed that the total haemocyte of transgenic shrimp was not significantly different (P>0.05 from non-transgenic shrimp, but haemocyte differentiation and phenoloxydase activity were significantly different (P<0.05 especially on sixth days after being exposed to the bioluminescent bacteria. The study results implied that transgenic shrimp has a better immune response compared than non-transgenic shrimp.

Bioinspiration and Biomimicry: Possibilities for Cotton Byproducts

Science.gov (United States)

The byproducts from cotton gins have commonly been referred to as cotton gin trash or cotton gin waste primarily because the lint and seed were the main focus of the operation and the byproducts were a financial liability that did not have a consistent market. Even though the byproducts were called ...

Cadmium (Cd) Localization in Tissues of Cotton (Gossypium hirsutum L.), and Its Phytoremediation Potential for Cd-Contaminated Soils.

Science.gov (United States)

Chen, Zhifan; Zhao, Ye; Fan, Lidong; Xing, Liteng; Yang, Yujie

2015-12-01

Phytoremediation using economically valuable, large biomass, non-edible plants is a promising method for metal-contaminated soils. This study investigated cotton's tolerance for Cd and remediation potential through analyzing Cd bioaccumulation and localization in plant organs under different soil Cd levels. Results showed cotton presents good tolerance when soil Cd concentration ≤20.26 mg kg(-1). Cotton had good Cd accumulation ability under low soil Cd levels (soil Cd, while roots and stems were the main compartments of Cd storage. Cd complexation to other organic constituents in root and stem cell sap could be a primary detoxifying strategy. Therefore, cotton is a potential candidate for phytoremediation of Cd-contaminated soils.

Field response of aboveground non-target arthropod community to transgenic Bt-Cry1Ab rice plant residues in postharvest seasons.

Science.gov (United States)

Bai, Yao-Yu; Yan, Rui-Hong; Ye, Gong-Yin; Huang, Fangneng; Wangila, David S; Wang, Jin-Jun; Cheng, Jia-An

2012-10-01

Risk assessments of ecological effects of transgenic rice expressing lepidoptera-Cry proteins from Bacillus thuringiensis (Bt) on non-target arthropods have primarily focused on rice plants during cropping season, whereas few studies have investigated the effects in postharvest periods. Harvested rice fallow fields provide a critical over-wintering habitat for arthropods in the Chinese rice ecosystems, particularly in the southern region of the country. During 2006-08, two independent field trials were conducted in Chongqing, China to investigate the effects of transgenic Cry1Ab rice residues on non-target arthropod communities. In each trial, pitfall traps were used to sample arthropods in field plots planted with one non-Bt variety and two Bt rice lines expressing the Cry1Ab protein. Aboveground arthropods in the trial plots during the postharvest season were abundant, while community densities varied significantly between the two trials. A total of 52,386 individual insects and spiders, representing 93 families, was captured in the two trials. Predominant arthropods sampled were detritivores, which accounted for 91.9% of the total captures. Other arthropods sampled included predators (4.2%), herbivores (3.2%), and parasitoids (0.7%). In general, there were no significant differences among non-Bt and Bt rice plots in all arthropod community-specific parameters for both trials, suggesting no adverse impact of the Bt rice plant residues on the aboveground non-target arthropod communities during the postharvest season. The results of this study provide additional evidence that Bt rice is safe to non-target arthropod communities in the Chinese rice ecosystems.

Cotton fiber quality determined by fruit position, temperature and management

OpenAIRE

Wang, X.; Evers, J.B.; Zhang, L.; Mao, L.; Pan, X.; Li, Z.

2013-01-01

CottonXL is a tool to explore cotton fiber quality in relation to fruit position, to improve cotton quality by optimizing cotton plant structure, as well as to help farmers understand how the structure of the cotton plant determines crop growth and quality.

Detailed characterization of Mirafiori lettuce virus-resistant transgenic lettuce.

Science.gov (United States)

Kawazu, Yoichi; Fujiyama, Ryoi; Noguchi, Yuji; Kubota, Masaharu; Ito, Hidekazu; Fukuoka, Hiroyuki

2010-04-01

Lettuce big-vein disease is caused by Mirafiori lettuce virus (MiLV), which is vectored by the soil-borne fungus Olpidium brassicae. A MiLV-resistant transgenic lettuce line was developed through introducing inverted repeats of the MiLV coat protein (CP) gene. Here, a detailed characterization study of this lettuce line was conducted by comparing it with the parental, non-transformed 'Kaiser' cultivar. There were no significant differences between transgenic and non-transgenic lettuce in terms of pollen fertility, pollen dispersal, seed production, seed dispersal, dormancy, germination, growth of seedlings under low or high temperature, chromatographic patterns of leaf extracts, or effects of lettuce on the growth of broccoli or soil microflora. A significant difference in pollen size was noted, but the difference was small. The length of the cotyledons of the transgenic lettuce was shorter than that of 'Kaiser,' but there were no differences in other morphological characteristics. Agrobacterium tumefaciens used for the production of transgenic lettuce was not detected in transgenic seeds. The transgenic T(3), T(4), and T(5) generations showed higher resistance to MiLV and big-vein symptoms expression than the resistant 'Pacific' cultivar, indicating that high resistance to lettuce big-vein disease is stably inherited. PCR analysis showed that segregation of the CP gene was nearly 3:1 in the T(1) and T(2) generations, and that the transgenic T(3) generation was homozygous for the CP gene. Segregation of the neomycin phosphotransferase II (npt II) gene was about 3:1 in the T(1) generation, but the full length npt II gene was not detected in the T(2) or T(3) generation. The segregation pattern of the CP and npt II genes in the T(1) generation showed the expected 9:3:3:1 ratio. These results suggest that the fragment including the CP gene and that including the npt II gene have been integrated into two unlinked loci, and that the T(1) plant selected in our study did

Hydrophobic cotton textile surfaces using an amphiphilic graphene oxide (GO) coating

International Nuclear Information System (INIS)

Tissera, Nadeeka D.; Wijesena, Ruchira N.; Perera, J. Rangana; Nalin de Silva, K.M.; Amaratunge, Gehan A.J.

2015-01-01

Graphical abstract: - Highlights: • Different GO dispersions were prepared by sonicating different amounts of GO in water. Degree of exfoliation of these GO sheets in water was analyzed using Atomic Force Microscopy (AFM). • AFM results obtained showed higher the GO concentration on water more the size of GO sheets and lesser the degree of exfoliation. • GO with different amounts was deposited on cotton fabric using simple dyeing method. • High GO loading on cotton increase the surface area coverage of the textile fibers with GO sheets. This led to less edge to mid area ratio of grafted GO sheets. • As contribution of mid area of GO increase on fiber surface cotton fabric becomes more hydrophobic. • Amphiphilic property of GO sheets was used to lower the surface energy of the cotton fibers leading to hydrophobic property. - Abstract: We report for the first time hydrophobic properties on cotton fabric successfully achieved by grafting graphene oxide on the fabric surface, using a dyeing method. Graphite oxide synthesized by oxidizing natural flake graphite employing improved Hummer's method showed an inter layer spacing of ∼1 nm from XRD. Synthesized graphite oxide was exfoliated in water using ultrasound energy to obtain graphene oxide (GO). AFM data obtained for the graphene oxide dispersed in an aqueous medium revealed a non-uniform size distribution. FTIR characterization of the synthesized GO sheets showed both hydrophilic and hydrophobic functional groups present on the nano sheets giving them an amphiphilic property. GO flakes of different sizes were successfully grafted on to a cotton fabric surface using a dip dry method. Loading different amounts of graphene oxide on the cotton fiber surface allowed the fabric to demonstrate different degrees of hydrophobicity. The highest observed water contact angle was at 143° with the highest loading of graphene oxide. The fabric surfaces grafted with GO also exhibits adhesive type hydrophobicity

Cytomorphological studies in X-ray induced glandless haploids in Gossypium hirsutum L. (cotton)

Energy Technology Data Exchange (ETDEWEB)

Mehetre, S.S.; Thombre, M.V. (Mahatma Phule Krishi Vidyapeeth, Rahuri (India))

1981-08-01

Six haploid plants were obtained in M/sub 2/ generation of the 25 kr. X-ray irradiated Gossypium hirsutum L. cotton variety H.G. 108. The cytomorphological studies on these plants indicated highly irregular meiosis, giving on an average six bivalents, the range being 0-9. Unequal separation of chromosomes and chromatids at anaphase-1 and II respectively led to formation of abnormal tetrads and pollens with high size variations leading to high pollen sterility. These plants were characterized by miniature stature, shorter stem and internodes, smaller leaves, flowers and stomata with fewer chloroplasts, male and female sterility and halving of chromosomes. The reduction in morphological characters was nearly in the proportion of 1:2 as compared to their diploid counterparts. 31 refs.; 5 tables; 12 figures.

In vitro culture may be the major contributing factor for transgenic versus nontransgenic proteomic plant differences.

Science.gov (United States)

Fonseca, Cátia; Planchon, Sébastien; Serra, Tânia; Chander, Subhash; Saibo, Nelson J M; Renaut, Jenny; Oliveira, M Margarida; Batista, Rita

2015-01-01

Identification of differences between genetically modified plants and their original counterparts plays a central role in risk assessment strategy. Our main goal was to better understand the relevance of transgene presence, genetic, and epigenetic changes induced by transgene insertion, and in vitro culture in putative unintended differences between a transgenic and its comparator. Thus, we have used multiplex fluorescence 2DE coupled with MS to characterize the proteome of three different rice lines (Oryza sativa L. ssp. japonica cv. Nipponbare): a control conventional line (C), an Agrobacterium-transformed transgenic line (Ta) and a negative segregant (NSb). We observed that Ta and NSb appeared identical (with only one spot differentially abundant--fold difference ≥ 1.5), contrasting with the control (49 spots with fold difference ≥ 1.5, in both Ta and NSb vs. control). Given that in vitro culture was the only event in common between Ta and NSb, we hypothesize that in vitro culture stress was the most relevant condition contributing for the observed proteomic differences. MS protein identification support our hypothesis, indicating that Ta and NSb lines adjusted their metabolic pathways and altered the abundance of several stress related proteins in order to cope with in vitro culture. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cotton for removal of aquatic oil spills

International Nuclear Information System (INIS)

Parker, H.W.; Fedler, C.B.; Heintz, C.E.; Nash, P.T.; Carr, D.L.; Lu, M.

1992-01-01

Raw cotton has considerable potential for selective removal of spilled oil and oil products from surface waters, since the natural waxes on the raw cotton make it preferentially oil wet. This potential was recognized in the early seventies at Texas Tech University. More recently other research workers have considered cotton as an adsorbent for spilled oil. The adsorbent market is now dominated by synthetic materials, such as air-blown polypropylene fiber, inorganic clays, and recycled paper and paper products. This paper further examines the potential of cotton in relation to these other adsorbents. Emphasis is placed on the potential for complete biodegradation of oil-soaked cotton adsorbents as a means avoiding the expense for incineration and/or the long-term environmental risk associated with placing the used adsorbents in landfills

The merging of two dynasties--identification of an African cotton leaf curl disease-associated begomovirus with cotton in Pakistan.

Directory of Open Access Journals (Sweden)

Muhammad Nouman Tahir

Full Text Available Cotton leaf curl disease (CLCuD is a severe disease of cotton that occurs in Africa and Pakistan/northwestern India. The disease is caused by begomoviruses in association with specific betasatellites that differ between Africa and Asia. During survey of symptomatic cotton in Sindh (southern Pakistan Cotton leaf curl Gezira virus (CLCuGV, the begomovirus associated with CLCuD in Africa, was identified. However, the cognate African betasatellite (Cotton leaf curl Gezira betasatellite was not found. Instead, two Asian betasatellites, the CLCuD-associated Cotton leaf curl Multan betasatellite (CLCuMB and Chilli leaf curl betasatellite (ChLCB were identified. Inoculation of the experimental plant species Nicotiana benthamiana showed that CLCuGV was competent to maintain both CLCuMB and ChLCB. Interestingly, the enations typical of CLCuD were only induced by CLCuGV in the presence of CLCuMB. Also in infections involving both CLCuMB and ChLCB the enations typical of CLCuMB were less evident. This is the first time an African begomovirus has been identified on the Indian sub-continent, highlight the growing threat of begomoviruses and particularly the threat of CLCuD causing viruses to cotton cultivation in the rest of the world.

The signal peptide-like segment of hpaXm is required for its association to the cell wall in transgenic tobacco plants.

Science.gov (United States)

Li, Le; Miao, Weiguo; Liu, Wenbo; Zhang, Shujian

2017-01-01

Harpins, encoded by hrp (hypersensitive response and pathogenicity) genes of Gram-negative plant pathogens, are elicitors of hypersensitive response (HR). HpaXm is a novel harpin-like protein described from cotton leaf blight bacteria, Xanthomonas citri subsp. malvacearum-a synonym of X. campestris pv. malvacearum (Smith 1901-1978). A putative signal peptide (1-MNSLNTQIGANSSFL-15) of hpaXm was predicted in the nitroxyl-terminal (N-terminal)by SignalP (SignalP 3.0 server). Here, we explored the function of the N-terminal leader peptide like segment of hpaXm using transgenic tobacco (Nicotiana tabacum cv. Xanthi nc.). Transgenic tobacco lines expressing the full-length hpaXm and the signal peptide-like segment-deleted mutant hpaXmΔLP were developed using transformation mediated by Agrobacterium tumefaciens. The target genes were confirmed integrated into the tobacco genomes and expressed normally. Using immune colloidal-gold detection technique, hpaXm protein was found to be transferred to the cytoplasm, the cell membrane, and organelles such as chloroplasts, mitochondria, and nucleus, as well as the cell wall. However, the deletion mutant hpaXmΔLP expressed in transgenic tobacco was found unable to cross the membrane to reach the cell wall. Additionally, soluble proteins extracted from plants transformed with hpaXm and hpaXmΔLP were bio-active. Defensive micro-HR induced by the transgene expression of hpaXm and hpaXmΔLP were observed on transgenic tobacco leaves. Disease resistance bioassays to tobacco mosaic virus (TMV) showed that tobacco plants transformed with hpaXm and with hpaXmΔLP exhibited enhanced resistance to TMV. In summary, the N-terminal signal peptide-like segment (1-45 bp) in hpaXm sequence is not necessary for transgene expression, bioactivity of hpaXm and resistance to TMV in transgenic tobacco, but is required for the protein to be translocated to the cell wall.

Microbial contamination of water-soaked cotton gauze and its cause.

Science.gov (United States)

Oie, S; Yoshida, H; Kamiya, A

2001-01-01

Seven in-use cotton gauze samples and three cotton balls soaked in sterile distilled water in canisters were investigated 7 days after they were prepared in hospital. All samples were contaminated with bacteria including 10(6) to 10(7) colony forming units/ml of Pseudomonas aeruginosa. In vitro viability tests using cotton gauze and cotton balls soaked in sterile distilled water revealed rapid proliferation of P. aeruginosa, Serratia marcescens and Candida albicans. Since the cotton gauze and the cotton balls were soaked in water containing nutrients, such as protein and glucose, these materials may be readily contaminated with bacteria including P. aeruginosa. Thus, when using cotton gauze and cotton balls containing water, microbial contamination should be expected.

Radiation synthesis of silver nanostructures in cotton matrix

International Nuclear Information System (INIS)

Chmielewska, Dagmara; Sartowska, Bożena

2012-01-01

Cotton is one of the most popular natural fibres, composed mainly of cellulose, which finds a wide range of applications in paper, textile and health care products industry. Researchers have focused their interest on the synthesis of cotton nanocomposites, which enhances its mechanical, thermal and antimicrobial properties by the incorporation of various nanoparticles into the cotton matrix. Silver is one of the most popular antimicrobial agents with a wide spectrum of antibacterial and antifungal activity that results from a complex mechanism of its interactions with the cells of harmful microorganism. In this work, electron beam radiation was applied to synthesise silver nanostructures in cotton fibres. Investigations of the influence of the initial silver salt concentration on the size and distribution of the obtained silver nanostructures were carried out. A detailed characterisation of these nanocomposites with SEM-BSE and EDS methods was performed. TGA and DSC analyses were performed to assess the influence of different size silver nanoparticles and the effect of electron beam irradiation on the thermal properties of cotton fibres. A microbiological investigation to determine the antibacterial activity of Ag-cotton nanocomposites was carried out. - Highlights: ► Ag NPs embedded in cotton matrix were synthesised by electron beam irradiation. ► Concentration of silver salt solution influences on size of silver nanoparticles. ► Silver content as well as irradiation affect thermal properties of cotton fabrics. ► Ag-cotton nanocomposites exhibit antibacterial activity against bacteria and fungi.

(Pleurotus pulmonarius) grown on cotton waste and cassava peel

African Journals Online (AJOL)

This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...

mlo-based powdery mildew resistance in hexaploid bread wheat generated by a non-transgenic TILLING approach.

Science.gov (United States)

Acevedo-Garcia, Johanna; Spencer, David; Thieron, Hannah; Reinstädler, Anja; Hammond-Kosack, Kim; Phillips, Andrew L; Panstruga, Ralph

2017-03-01

Wheat is one of the most widely grown cereal crops in the world and is an important food grain source for humans. However, wheat yields can be reduced by many abiotic and biotic stress factors, including powdery mildew disease caused by Blumeria graminis f.sp. tritici (Bgt). Generating resistant varieties is thus a major effort in plant breeding. Here, we took advantage of the non-transgenic Targeting Induced Lesions IN Genomes (TILLING) technology to select partial loss-of-function alleles of TaMlo, the orthologue of the barley Mlo (Mildew resistance locus o) gene. Natural and induced loss-of-function alleles (mlo) of barley Mlo are known to confer durable broad-spectrum powdery mildew resistance, typically at the expense of pleiotropic phenotypes such as premature leaf senescence. We identified 16 missense mutations in the three wheat TaMlo homoeologues, TaMlo-A1, TaMlo-B1 and TaMlo-D1 that each lead to single amino acid exchanges. Using transient gene expression assays in barley single cells, we functionally analysed the different missense mutants and identified the most promising candidates affecting powdery mildew susceptibility. By stacking of selected mutant alleles we generated four independent lines with non-conservative mutations in each of the three TaMlo homoeologues. Homozygous triple mutant lines and surprisingly also some of the homozygous double mutant lines showed enhanced, yet incomplete, Bgt resistance without the occurrence of discernible pleiotropic phenotypes. These lines thus represent an important step towards the production of commercial non-transgenic, powdery mildew-resistant bread wheat varieties. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Acoustical evaluation of carbonized and activated cotton nonwovens.

Science.gov (United States)

Jiang, N; Chen, J Y; Parikh, D V

2009-12-01

An activated carbon fiber nonwoven (ACF) was manufactured from a cotton nonwoven fabric. For the ACF acoustic application, a nonwoven composite of ACF with cotton nonwoven as a base layer was developed. Also produced were the composites of the cotton nonwoven base layer with a layer of glassfiber nonwoven, and the cotton nonwoven base layer with a layer of cotton fiber nonwoven. Their noise absorption coefficients and sound transmission loss were measured using the Brüel and Kjaer impedance tube instrument. Statistical significance of the differences between the composites was tested using the method of Duncan's grouping. The study concluded that the ACF composite exhibited a greater ability to absorb normal incidence sound waves than the composites with either glassfiber or cotton fiber. The analysis of sound transmission loss revealed that the three composites still obeyed the mass law of transmission loss. The composite with the surface layer of cotton fiber nonwoven possessed a higher fabric density and therefore showed a better sound insulation than the composites with glassfiber and ACF.

The ecological risks of transgenic plants.

Science.gov (United States)

Giovannetti, Manuela

2003-01-01

Biotechnologies have been utilized "ante litteram" for thousands of years to produce food and drink and genetic engineering techniques have been widely applied to produce many compounds for human use, from insulin to other medicines. The debate on genetically modified (GM) organisms broke out all over the world only when GM crops were released into the field. Plant ecologists, microbiologists and population geneticists carried out experiments aimed at evaluating the environmental impact of GM crops. The most significant findings concern: the spread of transgenes through GM pollen diffusion and its environmental impact after hybridisation with closely related wild species or subspecies; horizontal gene transfer from transgenic plants to soil microbes; the impact of insecticide proteins released into the soil by transformed plants on non-target microbial soil communities. Recent developments in genetic engineering produced a technology, dubbed "Terminator", which protects patented genes introduced in transgenic plants by killing the seeds in the second generation. This genetic construct, which interferes so heavily with fundamental life processes, is considered dangerous and should be ex-ante evaluated taking into account the data on "unexpected events", as here discussed, instead of relying on the "safe until proven otherwise" claim. Awareness that scientists, biotechnologists and genetic engineers cannot answer the fundamental question "how likely is that transgenes will be transferred from cultivated plants into the natural environment?" should foster long-term studies on the ecological risks and benefits of transgenic crops.

Improved antioxidant activity in transgenic Perilla frutescens plants via overexpression of the γ-tocopherol methyltransferase (γ-tmt) gene.

Science.gov (United States)

Ghimire, Bimal Kumar; Seong, Eun Soo; Lee, Chan Ok; Lee, Jae Geun; Yu, Chang Yeon; Kim, Seung Hyun; Chung, Ill Min

2015-09-01

The main goal of this study was to generate transgenic Perilla frutescens with enhanced antioxidant properties by overexpressing the γ-tocopherol methyltransferase (γ-tmt) gene. In this study, the antioxidant activity of methanolic crude extracts of transgenic and non-transgenic control plants was investigated using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging method. Free radical scavenging activity was evaluated using α-tocopherol and butylated hydroxyl toluene as standard antioxidants. In general, the ethyl acetate fraction of transgenic P. frutescens showed stronger DPPH radical scavenging activity than the ethyl acetate fraction from non-transgenic control plants (IC50 2.00 ± 0.10 and 5.53 ± 0.40 μg ∙ ml(-1), respectively). High-performance liquid chromatography analysis of phenolic acids in leaf extracts confirmed increased levels of 16 individual phenolic compounds in two transgenic lines (pf47-5 and pf47-8) compared with control plants. Changes in the phenolic compound profile and α-tocopherol content were correlated with the antioxidant properties of transgenic plants, indicating that the introduction of transgene γ-tmt influenced the metabolism of phenolic compounds and subsequently produced biochemical changes in the transformants. There were no significant differences in photosynthetic rate in the transgenic plants as compared to the non-transgenic control plants, suggesting that the alteration of phenolic compounds and tocopherol composition had little impact on photosynthesis.

Using cotton plant residue to produce briquettes

Energy Technology Data Exchange (ETDEWEB)

Coates, W. [University of Arizona, Tucson, AZ (United States). Bioresources Research Facility

2000-07-01

In Arizona, cotton (Gossypium) plant residue left in the field following harvest must be buried to prevent it from serving as an overwintering site for insects such as the pink bollworm. Most tillage operations employed to incorporate the residue into the soil are energy intensive and often degrade soil structure. Trials showed that cotton plant residue could be incorporated with pecan shells to produce commercially acceptable briquettes. Pecan shell briquettes containing cotton residue rather than waste paper were slightly less durable, when made using equivalent weight mixtures and moisture contents. Proximate and ultimate analyses showed the only difference among briquette samples to be a higher ash content in those made using cotton plant residue. Briquettes made with paper demonstrated longer flame out time, and lower ash percentage, compared to those made with cotton plant residue. (author)

Use of attenuated total reflection Fourier transform infrared (ATR FT-IR) spectroscopy in direct, non-destructive, and rapid assessment of developmental cotton fibers grown in planta and in culture

Science.gov (United States)

Cotton fibers are routinely harvested from cotton plants (in planta), and their end-use qualities depend on their development stages. Cotton fibers are also cultured at controlled laboratory environments, so that cotton researchers can investigate many aspects of experimental protocols in cotton bre...

Construction and Quality Analysis of Transgenic Rehmannia glutinosa Containing TMV and CMV Coat Protein

Directory of Open Access Journals (Sweden)

Zhongqiu Teng

2016-08-01

Full Text Available Plant viruses, especially tobacco mosaic virus (TMV and cucumber mosaic virus (CMV are serious threats to Rehmannia glutinosa which is a “top grade” herb in China. In the present study, TMV- and CMV-resistant Rehmannia glutinosa Libosch. plants were constructed by transforming the protein (CP genes of TMV and CMV into Rehmannia glutinosa via a modified procedure of Agrobacterium tumefaciens-mediated transformation. Integration and expression of TMV CP and CMV CP transgenes in 2 lines, LBA-1 and LBA-2, were confirmed by PCR, Southern blot and RT-PCR. Both LBA-1 and LBA-2 were resistant to infection of homologous TMV and CMV strains. The quality of transgenic Rehmanniae Radix was evaluated based on fingerprint analysis and components quantitative analysis comparing with control root tubes. These results showed that chemical composition of transgenic Rehmanniae Radix were similar to non-transgenic ones, which demonstrated that the medical quality and biosafety of transgenic Rehmanniae Radix were equivalent to non-transgenic material when consumed as traditional Chinese medicinal (TCM.

Maternal endometrial oedema may increase perinatal mortality of cloned and transgenic piglets

DEFF Research Database (Denmark)

Schmidt, Mette; Winter, K.D.; Dantzer, Vibeke

2011-01-01

The perinatal mortality of cloned animals is a well-known problem. In the present retrospective study, we report on mortality of cloned transgenic or non-transgenic piglets produced as part of several investigations. Large White (LW) sows (n = 105) received hand-made cloned LW or minipig...... endometrial oedema in sows pregnant with cloned and transgenic piglets, as well as in empty recipients, at term. The growth of certain organs in some of the cloned piglets was reduced and the rate of stillborn piglets was greater in cloned and transgenic piglets delivered vaginally, possibly because of oedema...

7 CFR 27.21 - Preparation of samples of cotton.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Preparation of samples of cotton. 27.21 Section 27.21... REGULATIONS COTTON CLASSIFICATION UNDER COTTON FUTURES LEGISLATION Regulations Inspection and Samples § 27.21 Preparation of samples of cotton. The samples from each bale shall be prepared as specified in this section...

Chitinase activities, scab resistance, mycorrhization rates and biomass of own-rooted and grafted transgenic apple

Directory of Open Access Journals (Sweden)

Tina Schäfer

2012-01-01

Full Text Available This study investigated the impact of constitutively expressed Trichoderma atroviride genes encoding exochitinase nag70 or endochitinase ech42 in transgenic lines of the apple cultivar Pinova on the symbiosis with arbuscular mycorrhizal fungi (AMF. We compared the exo- and endochitinase activities of leaves and roots from non-transgenic Pinova and the transgenic lines T386 and T389. Local and systemic effects were examined using own-rooted trees and trees grafted onto rootstock M9. Scab susceptibility was also assessed in own-rooted and grafted trees. AMF root colonization was assessed microscopically in the roots of apple trees cultivated in pots with artificial substrate and inoculated with the AMF Glomus intraradices and Glomus mosseae. Own-rooted transgenic lines had significantly higher chitinase activities in their leaves and roots compared to non-transgenic Pinova. Both of the own-rooted transgenic lines showed significantly fewer symptoms of scab infection as well as significantly lower root colonization by AMF. Biomass production was significantly reduced in both own-rooted transgenic lines. Rootstock M9 influenced chitinase activities in the leaves of grafted scions. When grafted onto M9, the leaf chitinase activities of non-transgenic Pinova (M9/Pinova and transgenic lines (M9/T386 and M9/T389 were not as different as when grown on their own roots. M9/T386 and M9/T389 were only temporarily less infected by scab than M9/Pinova. M9/T386 and M9/T389 did not differ significantly from M9/Pinova in their root chitinase activities, AMF root colonization and biomass.

Enhancing the functionality of cotton fabric by physical and chemical pre-treatments: A comparative study.

Science.gov (United States)

Gargoubi, Sondes; Tolouei, Ranna; Chevallier, Pascale; Levesque, Lucie; Ladhari, Neji; Boudokhane, Chedly; Mantovani, Diego

2016-08-20

Recently, antimicrobial and decontaminating textiles, such as cotton a natural carbohydrate polymer, are generating more attention. Plant materials used for natural dyes are expected to impart biofunctional properties and high added valued functional textiles. In the current study, surface modification of cotton to maximize the dye amount on the surface has been investigated. Physical modification using nitrogen-hydrogen plasma, chemical modification using chitosan and chemical modification using dopamine as biopolymers imparting amino groups were explored. Furthermore, dye exhaustion of curcumin, as a natural functional dye has been studied. Dye stability tests were also performed after fabric washing using hospital washing protocol to predict the durability of the functionalizations. The results demonstrated that cotton surfaces treated with dopamine exhibit a high level of dye uptake (78%) and a good washing fastness. The use of non-toxic and natural additives during cotton finishing process could give the opportunity of cradle to cradle design for antimicrobial textile industries. Copyright © 2016 Elsevier Ltd. All rights reserved.

STIFFNESS MODIFICATION OF COTTON IN CHITOSAN TREATMENT

Directory of Open Access Journals (Sweden)

CAMPOS Juan

2017-05-01

Full Text Available Chitosan is a biopolymer obtained from chitin, and among their most important aspects highlights its applications in a lot of industrial sectors due to its intrinsic properties, especially in the textile sector. In the last years, chitosan is widely used in the cotton and wool finishing processes due to its bond between them and its properties as an antifungical and antimicrobial properties. In this paper three different molecular weight chitosan are used in the finishing process of cotton to evaluate its influence in the surface properties modification. In order to evaluate the effect of the treatment with chitosan, flexural stiffness test is performed in warp and weft direction, and then the total value is calculated. The cotton fabric is treated with 5 g/L of different types of chitosan in an impregnation bath. This study shows the extent of surface properties modification of the cotton provided by three types of chitosan treatment. The results show that all types of chitosan modify the cotton flexural rigidity properties but the one which modifies it in a relevant manner is chitosan originated from shrimps. Chitosan, textile, flexural stiffnes, chitin, cotton.

Genome-Wide Characterization of Major Intrinsic Proteins in Four Grass Plants and Their Non-Aqua Transport Selectivity Profiles with Comparative Perspective.

Directory of Open Access Journals (Sweden)

Abul Kalam Azad

Full Text Available Major intrinsic proteins (MIPs, commonly known as aquaporins, transport not only water in plants but also other substrates of physiological significance and heavy metals. In most of the higher plants, MIPs are divided into five subfamilies (PIPs, TIPs, NIPs, SIPs and XIPs. Herein, we identified 68, 42, 38 and 28 full-length MIPs, respectively in the genomes of four monocot grass plants, specifically Panicum virgatum, Setaria italica, Sorghum bicolor and Brachypodium distachyon. Phylogenetic analysis showed that the grass plants had only four MIP subfamilies including PIPs, TIPs, NIPs and SIPs without XIPs. Based on structural analysis of the homology models and comparing the primary selectivity-related motifs [two NPA regions, aromatic/arginine (ar/R selectivity filter and Froger's positions (FPs] of all plant MIPs that have been experimentally proven to transport non-aqua substrates, we predicted the transport profiles of all MIPs in the four grass plants and also in eight other plants. Groups of MIP subfamilies based on ar/R selectivity filter and FPs were linked to the non-aqua transport profiles. We further deciphered the substrate selectivity profiles of the MIPs in the four grass plants and compared them with their counterparts in rice, maize, soybean, poplar, cotton, Arabidopsis thaliana, Physcomitrella patens and Selaginella moellendorffii. In addition to two NPA regions, ar/R filter and FPs, certain residues, especially in loops B and C, contribute to the functional distinctiveness of MIP groups. Expression analysis of transcripts in different organs indicated that non-aqua transport was related to expression of MIPs since most of the unexpressed MIPs were not predicted to facilitate the transport of non-aqua molecules. Among all MIPs in every plant, TIP (BdTIP1;1, SiTIP1;2, SbTIP2;1 and PvTIP1;2 had the overall highest mean expression. Our study generates significant information for understanding the diversity, evolution, non

Design and Management of Field Trials of Transgenic Cereals

Science.gov (United States)

Bedő, Zoltán; Rakszegi, Mariann; Láng, László

The development of gene transformation systems has allowed the introgression of alien genes into plant genomes, thus providing a mechanism for broadening the genetic resources available to plant breeders. The design and the management of field trials vary according to the purpose for which transgenic cereals are developed. Breeders study the phenotypic and genotypic stability of transgenic plants, monitor the increase in homozygosity of transgenic genotypes under field conditions, and develop backcross generations to transfer the introduced genes into secondary transgenic cereal genotypes. For practical purposes, they may also multiply seed of the transgenic lines to produce sufficient amounts of grain for the detailed analysis of trait(s) of interest, to determine the field performance of transgenic lines, and to compare them with the non-transformed parental genotypes. Prior to variety registration, the Distinctness, Uniformity and Stability (DUS) tests and Value for Cultivation and Use (VCU) experiments are carried out in field trials. Field testing includes specific requirements for transgenic cereals to assess potential environmental risks. The capacity of the pollen to survive, establish and disseminate in the field test environment, the potential for gene transfer, the effects of products expressed by the introduced sequences and phenotypic and genotypic instability that might cause deleterious effects must all be specifically monitored, as required by EU Directives 2003/701/EC (1) on the release of genetically modified higher plants in the environment.

Genome-wide analysis of the HD-ZIP IV transcription factor family in Gossypium arboreum and GaHDG11 involved in osmotic tolerance in transgenic Arabidopsis.

Science.gov (United States)

Chen, Eryong; Zhang, Xueyan; Yang, Zhaoen; Wang, Xiaoqian; Yang, Zuoren; Zhang, Chaojun; Wu, Zhixia; Kong, Depei; Liu, Zhao; Zhao, Ge; Butt, Hamama Islam; Zhang, Xianlong; Li, Fuguang

2017-06-01

HD-ZIP IV proteins belong to the homeodomain-leucine zipper (HD-ZIP) transcription factor family and are involved in trichome development and drought stress in plants. Although some functions of the HD-ZIP IV group are well understood in Arabidopsis, little is known about their function in cotton. In this study, HD-ZIP genes were identified from three Gossypium species (G. arboreum, G. raimondii and G. hirsutum) and clustered into four families (HD-ZIP I, II, III and IV) to separate HD-ZIP IV from the other three families. Systematic analyses of phylogeny, gene structure, conserved domains, and expression profiles in different plant tissues and the expression patterns under osmotic stress in leaves were further conducted in G. arboreum. More importantly, ectopic overexpression of GaHDG11, a representative of the HD-ZIP IV family, confers enhanced osmotic tolerance in transgenic Arabidopsis plants, possibly due to elongated primary root length, lower water loss rates, high osmoprotectant proline levels, significant levels of antioxidants CAT, and/or SOD enzyme activity with reduced levels of MDA. Taken together, these observations may lay the foundation for future functional analysis of cotton HD-ZIP IV genes to unravel their biological roles in cotton.

The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

Science.gov (United States)

Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

2014-02-13

Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

Thwarting one of cotton's nemeses

International Nuclear Information System (INIS)

Senft, D.

1991-01-01

There's not much good to be said for the pink bollworm, cotton's most destructive pest, except that it is being controlled to cut crop damage. Scientists have developed strategies, such as increasing native populations of predatory insects and pest-resistant cotton varieties. Thanks to research, growers today can also use cultural practices such as early plowdown of harvested cotton to break up stalks and bury overwintering pink bollworms. And they can disrupt normal mating by releasing sterile insects and using copies of natural compounds, called pheromones, that the pink bollworm uses to attract mates. Such strategies, together with judicious use of insecticides, put together in various combinations, form what is called an integrated pest management system

75 FR 50847 - Cotton Program Changes for Upland Cotton, Adjusted World Price, and Active Shipping Orders

Science.gov (United States)

2010-08-18

... Cotton Program Changes for Upland Cotton, Adjusted World Price, and Active Shipping Orders AGENCY... Assistance Program (EAAP) and clarifying the definition of ``active shipping order.'' DATES: Effective Date... address that matter this rule amends in the payment calculation for semi-processed and reginned motes in 7...

THE ELASTICITY OF EXPORT DEMAND FOR US COTTON

OpenAIRE

Paudel, Laxmi; Houston, Jack E.; Adhikari, Murali; Devkota, Nirmala

2004-01-01

There exist conflicting views among the researchers about the magnitudes of US cotton export demand elasticity, ranging from the highly inelastic to highly elastic. An Armington model was used to analyze the export demand elasticity of US Cotton. Our analysis confirms an elastic nature of US cotton export demand.

7 CFR 1427.23 - Cotton loan deficiency payments.

Science.gov (United States)

2010-01-01

..., DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Nonrecourse Cotton Loan and Loan... intentions to receive a loan deficiency payment on the identified commodity or (ii) A completed request for a... cotton based on a locked-in adjusted world price, provide identifying numbers for modules or other...

Fourier transform infrared imaging of Cotton trash mixtures

Science.gov (United States)

There is much interest in the identification of trash types comingled with cotton lint. A good understanding of the specific trash types present can lead to the fabrication of new equipment which can identify and sort cotton trash found with cotton fiber. Conventional methods, including the High Vo...

Transgenic expression of phytase in wheat endosperm increases bioavailability of iron and zinc in grains.

Science.gov (United States)

Abid, Nabeela; Khatoon, Asia; Maqbool, Asma; Irfan, Muhammad; Bashir, Aftab; Asif, Irsa; Shahid, Muhammad; Saeed, Asma; Brinch-Pedersen, Henrik; Malik, Kauser A

2017-02-01

Phytate is a major constituent of wheat seeds and chelates metal ions, thus reducing their bioavailability and so the nutritional value of grains. Transgenic plants expressing heterologous phytase are expected to enhance degradation of phytic acid stored in seeds and are proposed to increase the in vitro bioavailability of mineral nutrients. Wheat transgenic plants expressing Aspergillus japonicus phytase gene (phyA) in wheat endosperm were developed till T 3 generation. The transgenic lines exhibited 18-99 % increase in phytase activity and 12-76 % reduction of phytic acid content in seeds. The minimum phytic acid content was observed in chapatti (Asian bread) as compared to flour and dough. The transcript profiling of phyA mRNA indicated twofold to ninefold higher expression as compared to non transgenic controls. There was no significant difference in grain nutrient composition of transgenic and non-transgenic seeds. In vitro bioavailability assay for iron and zinc in dough and chapatti of transgenic lines revealed a significant increase in iron and zinc contents. The development of nutritionally enhanced cereals is a step forward to combat nutrition deficiency for iron and zinc in malnourished human population, especially women and children.

Non-uniform distribution pattern for differentially expressed genes of transgenic rice Huahui 1 at different developmental stages and environments.

Directory of Open Access Journals (Sweden)

Zhi Liu

Full Text Available DNA microarray analysis is an effective method to detect unintended effects by detecting differentially expressed genes (DEG in safety assessment of genetically modified (GM crops. With the aim to reveal the distribution of DEG of GM crops under different conditions, we performed DNA microarray analysis using transgenic rice Huahui 1 (HH1 and its non-transgenic parent Minghui 63 (MH63 at different developmental stages and environmental conditions. Considerable DEG were selected in each group of HH1 under different conditions. For each group of HH1, the number of DEG was different; however, considerable common DEG were shared between different groups of HH1. These findings suggested that both DEG and common DEG were adequate for investigation of unintended effects. Furthermore, a number of significantly changed pathways were found in all groups of HH1, indicating genetic modification caused everlasting changes to plants. To our knowledge, our study for the first time provided the non-uniformly distributed pattern for DEG of GM crops at different developmental stages and environments. Our result also suggested that DEG selected in GM plants at specific developmental stage and environment could act as useful clues for further evaluation of unintended effects of GM plants.

Gene cloning: exploring cotton functional genomics and genetic improvement

Institute of Scientific and Technical Information of China (English)

Diqiu LIU; Xianlong ZHANG

2008-01-01

Cotton is the most important natural fiber plant in the world. The genetic improvement of the quality of the cotton fiber and agricultural productivity is imperative under the situation of increasing consumption and rapid development of textile technology. Recently, the study of cotton molecular biology has progressed greatly. A lot of specifically or preferentially expressed cotton fiber genes were cloned and analyzed. On the other hand, identification of stress response genes expressed in cotton was performed by other research groups. The major stress factors were studied including the wilt pathogens Verticillium dahliae, Fusarium oxy-sporum f. sp. vasinfectum, bacterial blight, root-knot nematode, drought, and salt stress. What is more, a few genes related to the biosynthesis of gossypol, other sesquiterpene phytoalexins and the major seed oil fatty acids were isolated from cotton. In the present review, we focused on the major advances in cotton gene cloning and expression profiling in the recent years.

Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

Science.gov (United States)

Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2014-01-01

The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

[TSA improve transgenic porcine cloned embryo development and transgene expression].

Science.gov (United States)

Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua

2011-07-01

Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.

Potential factors impacting season-long expression of Cry1Ac in 13 commercial varieties of Bollgard® cotton

Directory of Open Access Journals (Sweden)

John J. Adamczyk, Jr.

2001-11-01

Full Text Available Thirteen commercial varieties of transgenic Cry1Ac Bacillus thuringiensis Berliner (Bt cotton were examined across two sites in 2000 for potential factors that impact endotoxin expression. In all cases, two varieties (NuCOTN 33B and DP 458B/RR, Delta and Pineland Co., Scott, MS expressed more Cry1Ac than the other 11 varieties in various plant structures. These two varieties share the same parental background (DP 5415. Furthermore, when the next generation of plants were tested in the greenhouse, the same varietal patterns were exhibited. These data strongly suggest that factors such as parental background had a stronger impact on the expression of Cry1Ac than the environment.

ENERGY USE EFFICIENCY AND ECONOMICAL ANALYSIS IN COTTON PRODUCTION SYSTEM IN AN ARID REGION: A CASE STUDY FOR ISFAHAN PROVINCE, IRAN

Directory of Open Access Journals (Sweden)

Mortaza Zahedi

2014-01-01

Full Text Available The objective of this survey was to evaluate the energy consumption and the economic analysis of cotton production in Esfahan province of Iran. For this purpose, data were selected from 47 cotton growers using a face-to-face questionnaire. The results indicate that cotton production consumed a total energy of 52507.8 MJ ha-1. Among sources of input energy, the contribution of energy related to diesel fuel (47% was highest, followed by chemical fertilizers (20% and water for irrigation (12%. The shares of direct and non renewable energy were 68.3% and 77.7%, respectively. The impacts of indirect and non-renewable energy on cotton yield were higher than those of direct and renewable energy. Energy use efficiency, specific energy, energy productivity, energy intensiveness, and net energy were 0.7, 19.2 MJ-1 kg, 0.10 kg MJ-1, 27.2 MJ-1 $ -1, -15625.2 MJ-1ha-1, respectively. Total cost of cotton production was 1927.9 $ ha-1. About 67% of the cost of production was variable costs, while 33% was fixed costs. The benefit to cost ratio was estimated 1.22. It is suggested that efforts to increase energy efficiency of cotton production in the investigated area should primarily focus on proper use of fertilizers and irrigation systems and also on saving diesel fuel by improving machinery operating performance.

3rd stage seed-cotton cleaning system PM10 emission factors and rates for cotton gins

Science.gov (United States)

This manuscript is part of a series of manuscripts that characterize cotton gin emissions from the standpoint of stack sampling. The impetus behind this project was the urgent need to collect additional cotton gin emissions data to address current regulatory issues. A key component of this study was...

2nd stage seed-cotton cleaning system PM10 emission factors and rates for cotton gins

Science.gov (United States)

This manuscript is part of a series of manuscripts that characterize cotton gin emissions from the standpoint of stack sampling. The impetus behind this project was the urgent need to collect additional cotton gin emissions data to address current regulatory issues. A key component of this study was...

1st stage seed-cotton cleaning system PM10 emission factors and rates for cotton gins

Science.gov (United States)

This manuscript is part of a series of manuscripts that characterize cotton gin emissions from the standpoint of stack sampling. The impetus behind this project was the urgent need to collect additional cotton gin emissions data to address current regulatory issues. A key component of this study was...

Structure of cells chloroplasts and mitochondria of cotton leaves following gamma irradiation

Energy Technology Data Exchange (ETDEWEB)

Arslanova, S V [AN Uzbekskoj SSR, Tashkent. Inst. Ehksperimental' noj Biologii Rastenij

1975-01-01

The article investigates the structural changes in the plastides and mitochondria of cotton leaf cells after irradiation. Cotton seeds that had been moistened for 24 hours were irradiated by a gamma source with a dose of 10 kR (intensity: 19 R/s.). For the study of the plastides and mitochondria of the leaf cells samples were taken in the cotyledonous leaf and flowering phases of the cotton. The cells of the cotton leaf mesophillum in the standard consists of chloroplast with developed interior structures. Study of the ultrastructure of the cells of the mesophilic tissue of the cotyledonous leaf in irradiated cotton plants showed that the chloroplastide membranes are not damaged. A change in the form of the chloroplasts, an accumulation of starch and plastic substances in the chloroplasts, and a reduction in the number of inter-grain bonds were noted. It was discovered that gamma irradiation produces an excessive build-up of starch in the chloroplasts. The mitochondria are often located close to the plastides. The optical density is typical of the matrix of the mitochondria in non-irradiated plants. After cotton seeds that have sprouted are irradiated with a dose of 10 kR in the cotyledonous leaf phase, part of the mitochondria swells. The matrix becomes more transparent, and the number of chrysts decreases. Part of the mitochondria remains intact. The optical density and internal membranes of the mitochondria remain the same as in the control group. The disturbances of the chloroplast and the mitochondria are also observed in the budding and flowering phases (under conditions of a natural day). It was noted that a shortened day facilitated to some extent a normalization of metabolism, and this produced in turn a normal development of the chloroplasts, leaf mitochondria and ATF generation, which reduces the final biological effect of the radiation.

Cover Crop Biomass Harvest Influences Cotton Nitrogen Utilization and Productivity

Directory of Open Access Journals (Sweden)

F. Ducamp

2012-01-01

Full Text Available There is a potential in the southeastern US to harvest winter cover crops from cotton (Gossypium hirsutum L. fields for biofuels or animal feed use, but this could impact yields and nitrogen (N fertilizer response. An experiment was established to examine rye (Secale cereale L. residue management (RM and N rates on cotton productivity. Three RM treatments (no winter cover crop (NC, residue removed (REM and residue retained (RET and four N rates for cotton were studied. Cotton population, leaf and plant N concentration, cotton biomass and N uptake at first square, and cotton biomass production between first square and cutout were higher for RET, followed by REM and NC. However, leaf N concentration at early bloom and N concentration in the cotton biomass between first square and cutout were higher for NC, followed by REM and RET. Seed cotton yield response to N interacted with year and RM, but yields were greater with RET followed by REM both years. These results indicate that a rye cover crop can be beneficial for cotton, especially during hot and dry years. Long-term studies would be required to completely understand the effect of rye residue harvest on cotton production under conservation tillage.

Isolation and functional characterization of a cotton ubiquitination-related promoter and 5'UTR that drives high levels of expression in root and flower tissues.

Science.gov (United States)

Viana, Antonio A B; Fragoso, Rodrigo R; Guimarães, Luciane M; Pontes, Naiara; Oliveira-Neto, Osmundo B; Artico, Sinara; Nardeli, Sarah M; Alves-Ferreira, Marcio; Batista, João A N; Silva, Maria C M; Grossi-de-Sa, Maria F

2011-11-24

Cotton (Gossypium spp.) is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2) family member with no previous characterization. Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2) and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2) and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues.

Constitutive expression of a fungus-inducible carboxylesterase improves disease resistance in transgenic pepper plants.

Science.gov (United States)

Ko, Moonkyung; Cho, Jung Hyun; Seo, Hyo-Hyoun; Lee, Hyun-Hwa; Kang, Ha-Young; Nguyen, Thai Son; Soh, Hyun Cheol; Kim, Young Soon; Kim, Jeong-Il

2016-08-01

Resistance against anthracnose fungi was enhanced in transgenic pepper plants that accumulated high levels of a carboxylesterase, PepEST in anthracnose-susceptible fruits, with a concurrent induction of antioxidant enzymes and SA-dependent PR proteins. A pepper esterase gene (PepEST) is highly expressed during the incompatible interaction between ripe fruits of pepper (Capsicum annuum L.) and a hemibiotrophic anthracnose fungus (Colletotrichum gloeosporioides). In this study, we found that exogenous application of recombinant PepEST protein on the surface of the unripe pepper fruits led to a potentiated state for disease resistance in the fruits, including generation of hydrogen peroxide and expression of pathogenesis-related (PR) genes that encode mostly small proteins with antimicrobial activity. To elucidate the role of PepEST in plant defense, we further developed transgenic pepper plants overexpressing PepEST under the control of CaMV 35S promoter. Molecular analysis confirmed the establishment of three independent transgenic lines carrying single copy of transgenes. The level of PepEST protein was estimated to be approximately 0.002 % of total soluble protein in transgenic fruits. In response to the anthracnose fungus, the transgenic fruits displayed higher expression of PR genes, PR3, PR5, PR10, and PepThi, than non-transgenic control fruits did. Moreover, immunolocalization results showed concurrent localization of ascorbate peroxidase (APX) and PR3 proteins, along with the PepEST protein, in the infected region of transgenic fruits. Disease rate analysis revealed significantly low occurrence of anthracnose disease in the transgenic fruits, approximately 30 % of that in non-transgenic fruits. Furthermore, the transgenic plants also exhibited resistance against C. acutatum and C. coccodes. Collectively, our results suggest that overexpression of PepEST in pepper confers enhanced resistance against the anthracnose fungi by activating the defense signaling

Effects of Different Densities of Cotton (Gossypium Hirsutum and Common Lambsquarter (Chenopodium Album on Some Cotton Growth Characteristics in Birjand Condition

Directory of Open Access Journals (Sweden)

M. Velayati

2011-01-01

Full Text Available Abstract Weeds are problematic plants in agroecosystems as a competitor for crops. In order to evaluate effects of cotton (Gossypium hirsutum and common lambsquarter (Chenopodium album densities on some crop growth indices, a study was conducted during 2006 in Experimental Station of Faculty of Agriculture, The University of Birjand as factorial experiment based on complete randomized block design with four replications. Three densities of cotton (6, 9 and 12 Pl.m-2 and four weed densities (0, 6, 9 and 12 Pl.m-2 were used to provide different weed interference levels. Indeed, three plots in each replication were intended to cultivation of lambsquarter alone at 6, 9 or 12 Pl.m-2. Results showed that crop growth rate (CGR of cotton was influenced by weed density, and its relative growth rate (RGR and net assimilation rate (NAR indicated a declining trend as weed density increased. Dry matter accumulation of cotton also was affected negatively by weed densities, as interference of lambsquarter at 6, 9 and 12 Pl.m-2 resulted to 35, 42 and 48 percent dry matter reduction, respectively, than weed-free treatment. Increasing of cotton density could partly compensate for negative impact of weed attendance on cotton growth. Thus, it seems higher plant densities can be used as a managing tool against weeds in cotton fields to avoid reduction of yield. Keywords: Cotton, Density, Weed, competition, Growth analysis

21 CFR 182.70 - Substances migrating from cotton and cotton fabrics used in dry food packaging.

Science.gov (United States)

2010-04-01

... used in dry food packaging. 182.70 Section 182.70 Food and Drugs FOOD AND DRUG ADMINISTRATION... used in dry food packaging. Substances migrating to food from cotton and cotton fabrics used in dry food packaging that are generally recognized as safe for their intended use, within the meaning of...

Relay cropping of wheat (Triticum aestivum L.) in cotton (Gossypium hirsutum L.) improves the profitability of cotton-wheat cropping system in Punjab, Pakistan.

Science.gov (United States)

Sajjad, Aamer; Anjum, Shakeel Ahmad; Ahmad, Riaz; Waraich, Ejaz Ahmad

2018-01-01

Delayed sowing of wheat (Triticum aestivum L.) in cotton-based system reduces the productivity and profitability of the cotton-wheat cropping system. In this scenario, relay cropping of wheat in standing cotton might be a viable option to ensure the timely wheat sowing with simultaneous improvement in wheat yields and system profitability. This 2-year study (2012-2013 and 2013-2014) aimed to evaluate the influence of sowing dates and relay cropping combined with different management techniques of cotton sticks on the wheat yield, soil physical properties, and the profitability of the cotton-wheat system. The experiment consisted of five treatments viz. (S1) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, (S2) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator, (S3) sowing of wheat at the 7th of November as relay crop in standing cotton with broadcast method, (S4) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, and (S5) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator. The highest seed cotton yield was observed in the S5 treatment which was statistically similar with the S3 and S4 treatments; seed cotton yield in the S1 and S2 treatments has been the lowest in both years of experimentation. However, the S2 treatment produced substantially higher root length, biological yield, and grain yield of wheat than the other treatments. The lower soil bulk density at 0-10-cm depth was recorded in the S2 treatment which was statistically similar with the S5 treatment during both years of experimentation. The volumetric water contents, net

Response difference of transgenic and conventional rice (Oryza sativa) to nanoparticles (γFe₂O₃).

Science.gov (United States)

Gui, Xin; Deng, Yingqing; Rui, Yukui; Gao, Binbin; Luo, Wenhe; Chen, Shili; Nhan, Le Van; Li, Xuguang; Liu, Shutong; Han, Yaning; Liu, Liming; Xing, Baoshan

2015-11-01

Nanoparticles (NPs) are an increasingly common contaminant in agro-environments, and their potential effect on genetically modified (GM) crops has been largely unexplored. GM crop exposure to NPs is likely to increase as both technologies develop. To better understand the implications of nanoparticles on GM plants in agriculture, we performed a glasshouse study to quantify the uptake of Fe2O3 NPs on transgenic and non-transgenic rice plants. We measured nutrient concentrations, biomass, enzyme activity, and the concentration of two phytohormones, abscisic acid (ABA) and indole-3-acetic acid (IAA), and malondialdehyde (MDA). Root phytohormone inhibition was positively correlated with Fe2O3 NP concentrations, indicating that Fe2O3 had a significant influence on the production of these hormones. The activities of antioxidant enzymes were significantly higher as a factor of low Fe2O3 NP treatment concentration and significantly lower at high NP concentrations, but only among transgenic plants. There was also a positive correlation between the treatment concentration of Fe2O3 and iron accumulation, and the magnitude of this effect was greatest among non-transgenic plants. The differences in root phytohormone production and antioxidant enzyme activity between transgenic and non-transgenic rice plants in vivo suggests that GM crops may react to NP exposure differently than conventional crops. It is the first study of NPs that may have an impact on GM crops, and a realistic significance for food security and food safety.

Weed flora, yield losses and weed control in cotton crop

OpenAIRE

Jabran, Khawar

2016-01-01

Cotton (Gossypium spp.) is the most important fiber crop of world and provides fiber, oil, and animals meals. Weeds interfere with the growth activities of cotton plants and compete with it for resources. All kinds of weeds (grasses, sedges, and broadleaves) have been noted to infest cotton crop. Weeds can cause more than 30% decrease in cotton productivity. Several methods are available for weed control in cotton. Cultural control carries significance for weed control up to a certain extent....

Difference in leaf water use efficiency/photosynthetic nitrogen use efficiency of Bt-cotton and its conventional peer.

Science.gov (United States)

Guo, Ruqing; Sun, Shucun; Liu, Biao

2016-09-15

This study is to test the effects of Bt gene introduction on the foliar water/nitrogen use efficiency in cotton. We measured leaf stomatal conductance, photosynthetic rate, and transpiration rate under light saturation condition at different stages of a conventional cultivar (zhongmian no. 16) and its counterpart Bt cultivar (zhongmian no. 30) that were cultured on three levels of fertilization, based on which leaf instantaneous water use efficiency was derived. Leaf nitrogen concentration was measured to calculate leaf photosynthetic nitrogen use efficiency, and leaf δ(13)C was used to characterize long term water use efficiency. Bt cultivar was found to have lower stomatal conductance, net photosynthetic rates and transpiration rates, but higher instantaneous and long time water use efficiency. In addition, foliar nitrogen concentration was found to be higher but net photosynthetic rate was lower in the mature leaves of Bt cultivar, which led to lower photosynthetic nitrogen use efficiency. This might result from the significant decrease of photosynthetic rate due to the decrease of stomatal conductance. In conclusion, our findings show that the introduction of Bt gene should significantly increase foliar water use efficiency but decrease leaf nitrogen use efficiency in cotton under no selective pressure.

Global gene expression in cotton (Gossypium hirsutum L. leaves to waterlogging stress.

Directory of Open Access Journals (Sweden)

Yanjun Zhang

Full Text Available Cotton is sensitive to waterlogging stress, which usually results in stunted growth and yield loss. To date, the molecular mechanisms underlying the responses to waterlogging in cotton remain elusive. Cotton was grown in a rain-shelter and subjected to 0 (control-, 10-, 15- and 20-d waterlogging at flowering stage. The fourth-leaves on the main-stem from the top were sampled and immediately frozen in liquid nitrogen for physiological measurement. Global gene transcription in the leaves of 15-d waterlogged plants was analyzed by RNA-Seq. Seven hundred and ninety four genes were up-regulated and 1018 genes were down-regulated in waterlogged cotton leaves compared with non-waterlogged control. The differentially expressed genes were mainly related to photosynthesis, nitrogen metabolism, starch and sucrose metabolism, glycolysis and plant hormone signal transduction. KEGG (Kyoto Encyclopedia of Genes and Genomes analysis indicated that most genes related to flavonoid biosynthesis, oxidative phosphorylation, amino acid metabolism and biosynthesis as well as circadian rhythm pathways were differently expressed. Waterlogging increased the expression of anaerobic fermentation related genes, such as alcohol dehydrogenase (ADH, but decreased the leaf chlorophyll concentration and photosynthesis by down-regulating the expression of photosynthesis related genes. Many genes related to plant hormones and transcription factors were differently expressed under waterlogging stress. Most of the ethylene related genes and ethylene-responsive factor-type transcription factors were up-regulated under water-logging stress, suggesting that ethylene may play key roles in the survival of cotton under waterlogging stress.

Naturally transgenic plants as a model for the study of delayed environmental risks of cultivation of GMOs

Directory of Open Access Journals (Sweden)

Tat’yana Valer’yevna Matveeva

2015-06-01

Full Text Available The development of genetic engineering raises the question of biosafety of transgenic organisms. The greatest concerns about the negative effects of GMO cultivation are reduced to possible leakage of transgenes through cross-pollination of non-transgenic closely related forms by transgenic pollen. Naturally transgenic plants are species which have been subjected to Agrobacterium-mediated transformation and retained the T-DNA-like sequence in their genomes. These species can be considered as a model for the study of delayed environmental risks associated with leakage of transgenes. The review is devoted to this problem.

Increasing cotton stand establishment in soils prone to soil crusting

Science.gov (United States)

Many factors can contribute to poor cotton stand establishment, and cotton is notorious for its weak seedling vigor. Soil crusting can be a major factor hindering cotton seedling emergence in many of the cotton production regions of the US and the world. Crusting is mainly an issue in silty soils ...

7 CFR 28.107 - Original cotton standards and reserve sets.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Original cotton standards and reserve sets. 28.107... Standards Act Practical Forms of Cotton Standards § 28.107 Original cotton standards and reserve sets. (a) The containers of the original Universal Standards and other official cotton standards of the United...

Cotton Production in Mali: Subsidies or Sustainable Development?

Science.gov (United States)

Moore, Lindsey

2007-01-01

Current trade rules concerning cotton subsidies are intricately linked with poverty and hunger in Mali. Over half of Mali's economy and over 30 million people depend directly on cotton. It is the main cash crop and the most important source of export revenue. Cotton also plays a key role in development policies and in the fight against poverty by…

Genomic studies for drought tolerance in cotton (abstract)

International Nuclear Information System (INIS)

Mahboob-ur-Rehman; Ullah, I.; Asir, M.; Zafar, Y.; Malik, K.A.

2005-01-01

The cotton germplasm developed in Pakistan has not been screened comprehensively for their response to water stress, which is a pre-requisite in exploring different metabolic pathways, development of genome maps, isolation of genes etc. The objectives of the study were to identify drought tolerant/sensitive cotton genotypes, development of genetic linkage maps, and to identify the most robust DNA markers leading towards marker-assisted selection (MAS). A field trial was conducted to investigate variation in gas exchange parameters and productivity traits in 32 cotton cultivars/promising strains under water stress environment and to ascertain association among these physiological and productivity traits. Photosynthetic rate (P), stomatal conductance (gs) and transpiration rate (E) were significantly reduced under water stress. Substantial genotypic variation for gas exchange parameters especially photosynthetic rate were observed with a significant association with productivity traits under water-limited environment elucidating its use as an indirect selection criterion for seed cotton yield. Moreover, the genotypes FH-901 and CIM-1100 were found the most sensitive and tolerant cultivars, respectively. Four hundred eighty random primers were surveyed on different cotton genotypes involved in population development programs. Out of these, 32 polymorphic primers were identified which are being converted into sequence characterized amplified regions (SCARs). Similarly, 25 out of 150 microstatellite loci (SSRs) were polymorphic among the cotton genotypes. Amplified fragment length polymorphism (AFLP) fingerprinting technique is being exploited to search for additional polymorphisms. The study will have impact on cotton breeding programme by reducing span to develop drought tolerant cotton varieties. (author)

TURKISH TRADE POLICY AND THE EFFICIENCY OF TURKISH COTTON MARKETS

OpenAIRE

Schmitz, Troy G.

1999-01-01

Turkish cotton markets are affected by import duties, export taxes, and a range of domestic subsidies. The degree of economic inefficiency arising from these government policies is estimated through the use of two partial equilibrium models, one for the Aegean market and another for the non-Aegean market. The welfare implications of these policies are also explored.

[SSR analysis on stress effect of transgenic hybrid poplar 741 on Clostera anachoreta (Fabricius) (Lepidoptera: Notodontidae)].

Science.gov (United States)

Liu, Jun Xia; Song, Xiao Ying; Jiang, Wen Hu; Zhou, Guo Na; Gao, Bao Jia

2016-12-01

The genetic differentiation of the experimental population of Clostera anachoreta fed on different resistant transgenic 741 poplar leaves was analyzed by SSR molecular marker technique to investigate stress effect of transgenic poplar Bt gene as food on target insect. The experimental population of C. anachoreta fed on transgenic 741 poplar high resistant strains 'Pb29', medium resis-tant strains 'Pb17' and non-transgenic poplar (CK), and the screened ten pairs of SSR primers were used. The results showed that 76 alleles were observed in ten pairs of primers. The average allele was 7.6, the average effective number of alleles was 2.2, the average observed heterozygosity was 0.5167, the average expected heterozygosity was 0.5167, and the average percentage of polymorphic loci was 96.7%. The genetic diversity level of C. anachoreta experimental population fed on transgenic poplar 741 was significantly higher than that fed on non-transgenic populations, and C. anachoreta fed on high resistance had the lowest genetic similarity with CK samples, which showed an increasing trend of the genetic diversity of the experimental population fed on transgenic Bt poplar. It was thus clear that transgenic hybrid poplar 741 had stress effects on genetic differentiation of C. anachoreta experimental population by SSR.

Profile of small interfering RNAs from cotton plants infected with the polerovirus Cotton leafroll dwarf virus

Directory of Open Access Journals (Sweden)

Schrago Carlos EG

2011-08-01

Full Text Available Abstract Background In response to infection, viral genomes are processed by Dicer-like (DCL ribonuclease proteins into viral small RNAs (vsRNAs of discrete sizes. vsRNAs are then used as guides for silencing the viral genome. The profile of vsRNAs produced during the infection process has been extensively studied for some groups of viruses. However, nothing is known about the vsRNAs produced during infections of members of the economically important family Luteoviridae, a group of phloem-restricted viruses. Here, we report the characterization of a population of vsRNAs from cotton plants infected with Cotton leafroll dwarf virus (CLRDV, a member of the genus Polerovirus, family Luteoviridae. Results Deep sequencing of small RNAs (sRNAs from leaves of CLRDV-infected cotton plants revealed that the vsRNAs were 21- to 24-nucleotides (nt long and that their sequences matched the viral genome, with higher frequencies of matches in the 3- region. There were equivalent amounts of sense and antisense vsRNAs, and the 22-nt class of small RNAs was predominant. During infection, cotton Dcl transcripts appeared to be up-regulated, while Dcl2 appeared to be down-regulated. Conclusions This is the first report on the profile of sRNAs in a plant infected with a virus from the family Luteoviridae. Our sequence data strongly suggest that virus-derived double-stranded RNA functions as one of the main precursors of vsRNAs. Judging by the profiled size classes, all cotton DCLs might be working to silence the virus. The possible causes for the unexpectedly high accumulation of 22-nt vsRNAs are discussed. CLRDV is the causal agent of Cotton blue disease, which occurs worldwide. Our results are an important contribution for understanding the molecular mechanisms involved in this and related diseases.

Profile of small interfering RNAs from cotton plants infected with the polerovirus Cotton leafroll dwarf virus.

Science.gov (United States)

Silva, Tatiane F; Romanel, Elisson A C; Andrade, Roberto R S; Farinelli, Laurent; Østerås, Magne; Deluen, Cécile; Corrêa, Régis L; Schrago, Carlos E G; Vaslin, Maite F S

2011-08-24

In response to infection, viral genomes are processed by Dicer-like (DCL) ribonuclease proteins into viral small RNAs (vsRNAs) of discrete sizes. vsRNAs are then used as guides for silencing the viral genome. The profile of vsRNAs produced during the infection process has been extensively studied for some groups of viruses. However, nothing is known about the vsRNAs produced during infections of members of the economically important family Luteoviridae, a group of phloem-restricted viruses. Here, we report the characterization of a population of vsRNAs from cotton plants infected with Cotton leafroll dwarf virus (CLRDV), a member of the genus Polerovirus, family Luteoviridae. Deep sequencing of small RNAs (sRNAs) from leaves of CLRDV-infected cotton plants revealed that the vsRNAs were 21- to 24-nucleotides (nt) long and that their sequences matched the viral genome, with higher frequencies of matches in the 3- region. There were equivalent amounts of sense and antisense vsRNAs, and the 22-nt class of small RNAs was predominant. During infection, cotton Dcl transcripts appeared to be up-regulated, while Dcl2 appeared to be down-regulated. This is the first report on the profile of sRNAs in a plant infected with a virus from the family Luteoviridae. Our sequence data strongly suggest that virus-derived double-stranded RNA functions as one of the main precursors of vsRNAs. Judging by the profiled size classes, all cotton DCLs might be working to silence the virus. The possible causes for the unexpectedly high accumulation of 22-nt vsRNAs are discussed. CLRDV is the causal agent of Cotton blue disease, which occurs worldwide. Our results are an important contribution for understanding the molecular mechanisms involved in this and related diseases.

Coupling of MIC-3 overexpression with the chromosomes 11 and 14 root-knot nematode (RKN) (Meloidogyne incognita) resistance QTLs provides insights into the regulation of the RKN resistance response in Upland cotton (Gossypium hirsutum).

Science.gov (United States)

Wubben, Martin J; Callahan, Franklin E; Jenkins, Johnie N; Deng, Dewayne D

2016-09-01

Genetic analysis of MIC-3 transgene with RKN resistance QTLs provides insight into the resistance regulatory mechanism and provides a framework for testing additional hypotheses. Resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. The MIC-3 (Meloidogyne Induced Cotton3) protein accumulates specifically within the immature galls of RKN-resistant plants that possess these QTLs. Recently, we showed that MIC-3 overexpression in an RKN-susceptible cotton genotype suppressed RKN egg production but not RKN-induced root galling. In this study, the MIC-3 overexpression construct T-DNA in the single-copy transgenic line '14-7-1' was converted into a codominant molecular marker that allowed the marker assisted selection of F2:3 cotton lines, derived from a cross between 14-7-1 and M-240 RNR, having all possible combinations of the chromosomes 11 and 14 QTLs with and without the MIC-3 overexpression construct. Root-knot nematode reproduction (eggs g(-1) root) and severity of RKN-induced root galling were assessed in these lines. We discovered that the addition of MIC-3 overexpression suppressed RKN reproduction in lines lacking both resistance QTLs and in lines having only the chromosome 14 QTL, suggesting an additive effect of the MIC-3 construct with this QTL. In contrast, MIC-3 overexpression did not improve resistance in lines having the single chromosome 11 QTL or in lines having both resistance QTLs, suggesting an epistatic interaction between the chromosome 11 QTL and the MIC-3 construct. Overexpression of MIC-3 did not affect the severity of RKN-induced root galling regardless of QTL genotype. These data provide new insights into the relative order of action of the chromosomes 11 and 14 QTLs and their potential roles in regulating MIC-3 expression as part of the RKN resistance response.

study on the chopping and mixing of cotton stalks with soil | Sa glam ...

African Journals Online (AJOL)

-type, splined-type and vertical-blade rotating dredge). Field experiments were conducted with each type to determine the proportion of non-uprooted cotton stalks; mean “post-chopping height” of the stalks, measured from soil surface; and the ...

Renewable High-Performance Fibers from the Chemical Recycling of Cotton Waste Utilizing an Ionic Liquid.

Science.gov (United States)

Asaadi, Shirin; Hummel, Michael; Hellsten, Sanna; Härkäsalmi, Tiina; Ma, Yibo; Michud, Anne; Sixta, Herbert

2016-11-23

A new chemical recycling method for waste cotton is presented that allows the production of virgin textile fibers of substantially higher quality than that from the mechanical recycling methods that are used currently. Cotton postconsumer textile wastes were solubilized fully in the cellulose-dissolving ionic liquid 1,5-diazabicyclo[4.3.0]non-5-enium acetate ([DBNH]OAc) to be processed into continuous filaments. As a result of the heterogeneous raw material that had a different molar mass distribution and degree of polymerization, pretreatment to adjust the cellulose degree of polymerization by acid hydrolysis, enzyme hydrolysis, or blending the waste cotton with birch prehydrolyzed kraft pulp was necessary to ensure spinnability. The physical properties of the spun fibers and the effect of the processing parameters on the ultrastructural changes of the fibers were measured. Fibers with a tenacity (tensile strength) of up to 58 cN tex -1 (870 MPa) were prepared, which exceeds that of native cotton and commercial man-made cellulosic fibers. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cotton contamination

CSIR Research Space (South Africa)

Van der Sluijs, MHJ

2018-05-01

Full Text Available This review focusses on physical forms of contaminant including the presence, prevention and/or removal of foreign bodies, stickiness and seed-coat fragments rather than the type and quantity of chemical residues that might be present in cotton...

Minimization of operational impacts on spectrophotometer color measurements for cotton

Science.gov (United States)

A key cotton quality and processing property that is gaining increasing importance is the color of the cotton. Cotton fiber in the U.S. is classified for color using the Uster® High Volume Instrument (HVI), using the parameters Rd and +b. Rd and +b are specific to cotton fiber and are not typical ...

The cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae as a new menace to cotton in Egypt and its chemical control

Directory of Open Access Journals (Sweden)

El-Zahi El-Zahi Saber

2016-04-01

Full Text Available The cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae is a polyphagous sap sucking insect with a wide geographical and host range causing severe losses in economically important crops. This study represents the first record of P. solenopsis as a new insect attacking cotton plants (Gossypium barbadense var. Giza 86 in Kafr El-Sheikh governorate, Egypt. The insect was noticed on cotton plants for the first time during its growing season of 2014. The mealybug specimens were collected from infested cotton plants and identified as P. solenopsis. In an attempt to control this pest, eight toxic materials viz., imidacloprid, thiamethoxam, flonicamid, emamectin-benzoate, chlorpyrifos, methomyl, deltamethrin and mineral oil (KZ-oil, belonging to different chemical groups, were tested for their influence against P. solenopsis on cotton under field conditions. Methomyl, imidacloprid, thiamethoxam and chlorpyrifos showed the highest efficacy against P. solenopsis recording 92.3 to 80.4% reduction of the insect population. Flonicamid, emamectin-benzoate and KZ-oil failed to exhibit sufficient P. solenopsis control.

Genetic diversity in upland cotton for cotton leaf curl virus disease, earliness and fiber quality

International Nuclear Information System (INIS)

Saeed, F.; Farooq, J.; Mahmood, A.; Hussain, T.

2014-01-01

In Pakistan during last two decades the major factor limiting cotton production is cotton leaf curl virus disease (CLCuD). For estimation of genetic diversity regarding CLCuD tolerance, fiber quality and some yield contributing traits, 101 cotton genotypes imported from USA were evaluated. Different statistical procedures like cluster, principle components (PC) and correlation analysis were employed to identify the suitable genotypes that can be further exploited in breeding programme. Significant associations were found between yield contributing trait, boll weight and fiber related trait, staple length. Earliness related traits, like days taken to 1 square and days taken to 1 flower had positive correlation with each other and both these traits also showed their positive association with ginning out turn. The negative significant correlation of CLCuD was obtained with monopodial branches, sympodial branches and plant height. Principal component (PC) analysis showed first five PCs having eigen value >1 explaining 67.8% of the total variation with days to st 1 square and flowering along with plant height and sympodia plant which were being the most important characters in PC1. Cluster analysis classified 101 accessions into five divergent groups. The genotypes in st cluster 1 only showed reasonable values for days to 1 square and flower, sympodia per plant, ginning out turn, staple length and fiber fineness and the genotypes in cluster 5 showed promising values for the traits like cotton leaf curl virus, ginning out turn and fiber fineness. The genotypes in cluster 1 and 5 may be combined to obtain desirable traits related to earliness and better disease tolerance. Scatter plot and tree diagrams demonstrated sufficient diversity among the cotton accessions for various traits and some extent of association between various clusters. It is concluded that diversity among the genotypes could be utilized for the development of CLCuD resistant lines with increased seed

Transgenic Cavendish bananas with resistance to Fusarium wilt tropical race 4.

Science.gov (United States)

Dale, James; James, Anthony; Paul, Jean-Yves; Khanna, Harjeet; Smith, Mark; Peraza-Echeverria, Santy; Garcia-Bastidas, Fernando; Kema, Gert; Waterhouse, Peter; Mengersen, Kerrie; Harding, Robert

2017-11-14

Banana (Musa spp.) is a staple food for more than 400 million people. Over 40% of world production and virtually all the export trade is based on Cavendish banana. However, Cavendish banana is under threat from a virulent fungus, Fusarium oxysporum f. sp. cubense tropical race 4 (TR4) for which no acceptable resistant replacement has been identified. Here we report the identification of transgenic Cavendish with resistance to TR4. In our 3-year field trial, two lines of transgenic Cavendish, one transformed with RGA2, a gene isolated from a TR4-resistant diploid banana, and the other with a nematode-derived gene, Ced9, remain disease free. Transgene expression in the RGA2 lines is strongly correlated with resistance. Endogenous RGA2 homologs are also present in Cavendish but are expressed tenfold lower than that in our most resistant transgenic line. The expression of these homologs can potentially be elevated through gene editing, to provide non-transgenic resistance.

Non-destructive measurements of cottonseed nutritional trait diversity in the US National Cotton Germplasm Collection

Science.gov (United States)

Recent studies have suggested that cottonseed (Gossypium spp.) has the potential to contribute to the effort against world hunger, particularly by providing a high-quality protein source. This report analyzed the diversity in protein content and other seed quality factors in the U.S. National Cotton...

Response of cotton genotypes to boron under-b-adequate conditions

International Nuclear Information System (INIS)

Shah, J. A.; Sial, M. A.; Hassan, Z. U.; Rajpar, I.

2015-01-01

Balanced boron (B) application is well-known to enhance the cotton production; however, the narrow range between B-deficiency and toxicity levels makes it difficult to manage. Cotton genotypes extensively differ in their response to B requirements. The adequate dose of B for one genotype may be insufficient or even toxic to other genotype. The effects of boron (B) on seed cotton yield and its various yield associated traits were studied on 10 cotton genotypes of Pakistan. The pot studies were undertaken to categorize cotton genotypes using B-deficient (control) and B-adequate (2.0 kg B ha-1) levels arranged in CRD with four repeats. The results indicated that the seed cotton yield, yield attributes and B-uptake of genotypes were comparatively decreased in B-deficient stressed treatment. Genotype NIA-Ufaq exhibited wide range of adaptation and ranked as efficient-responsive, as it produced higher seed cotton yield under both B-regimes. SAU-2 and CIM-506 were highly-efficient and remaining all genotypes were medium-efficient. Genotype Sindh-1 produced low seed cotton yield under B deficient condition and ranked as low-efficient. B-efficient cotton genotypes can be grown in B deficient soils without B application. (author)

Expression analysis of fiber related genes in cotton (gossypium hirsutum l.) through real time pcr

International Nuclear Information System (INIS)

Iqbal, N.; Khatoon, A.; Asif, M.; Bashir, A.

2016-01-01

Cotton fibers are unicellular seed trichomes and the largest known plant cells. Fiber morphogenesis in cotton is a complex process involving a large number of genes expressed throughout fiber development process. The expression profiling of five gene families in various cotton tissues was carried out through real time PCR. Expression analysis revealed that transcripts of expansin, tubulin and E6 were elevated from 5 to 20 days post anthesis (DPA) fibers. Three Lipid transfer proteins (LTPs) including LTP1, LTP3, LTP7 exhibited highest expression in 10 - 20 DPA fibers. Transcripts of LTP3 were detected in fibers and non fiber tissues that of LTP7 were almost negligible in non fiber tissues. Sucrose phosphate synthase gene showed highest expression in 10 DPA fibers while sucrose synthse (susy) expressed at higher rate in 5-20 DPA fibers as well as roots. The results reveal that most of fiber related genes showed high expression in 5-20 DPA fibers. Comprehensive expression study may help to determine tissue and stage specificity of genes under study. The study may also help to explore complex process of fiber development and understand the role of these genes in fiber development process. Highly expressed genes in fibers may be transformed in cotton for improvement of fiber quality traits. Genes that were expressed specifically in fibers or other tissues could be used for isolation of upstream regulatory sequences. (author)

Insecticide use and practices among cotton farmers in northern ...

African Journals Online (AJOL)

Cotton (Gossypium hirsutum L.) is an important cash crop in Uganda. Insecticide application practices among cotton growers in northern Uganda were examined to determine the pests targeted and the compliance of control measures with the standards recommended by the Uganda's Cotton Development Organization ...

78 FR 68983 - Cotton Futures Classification: Optional Classification Procedure

Science.gov (United States)

2013-11-18

...-AD33 Cotton Futures Classification: Optional Classification Procedure AGENCY: Agricultural Marketing... regulations to allow for the addition of an optional cotton futures classification procedure--identified and... response to requests from the U.S. cotton industry and ICE, AMS will offer a futures classification option...

Producing Organic Cotton: A Toolkit - Crop Guide, Projekt guide, Extension tools

OpenAIRE

Eyhorn, Frank

2005-01-01

The CD compiles the following extension tools on organic cotton: Organic Cotton Crop Guide, Organic Cotton Training Manual, Soil Fertility Training Manual, Organic Cotton Project Guide, Record keeping tools, Video "Organic agriculture in the Nimar region", Photos for illustration.

Growth analysis of cotton crops infested with spider mites. I. Light interception and radiation-use efficiency

International Nuclear Information System (INIS)

Sadras, V.O.; Wilson, L.J.

1997-01-01

Two-spotted spider mites (Tetranychus urticae Koch) are important pests of cotton (Gossypium hirsutum L.). The effects of mites on cotton photosynthesis have been investigated at the leaf and cytological level but not at the canopy level. Our objective was to quantify the effects of timing and intensity of infestation by mites on cotton radiation-use efficiency (RUE). Leaf area, light interception, RUE, canopy temperature, and leaf nitrogen concentration (LNC) were assessed during two growing seasons in crops artificially infested with mites between 59 and 127 d after sowing. Normal and okra-leaf cultivars were compared. A mite index (MI = natural log of the area under the curve of mite number vs thermal time) was used to quantify the cumulative effects of mites on RUE, LNC, and canopy temperature. Crop growth reduction due to mites was greater in early- than in late-infested crops Growth reduction was primarily due to reductions in RUE, but in the more severe treatments accelerated leaf senescence and, hence. reduced light interception also contributed to reductions in crop growth. At a given date, infested okra-leaf crops usually had greater RUE than their normal-leaf counterparts. Both plant types, however. responded similarly to a given level of mite infestation. The ability of the okra-leaf cultivar to maintain greater RUE levels can be attributed. therefore, to its relative inhospitality for the development of mite colonies rather than to an intrinsically greater capacity to maintain photosynthesis under mite damage. Canopy temperature, LNC, and RUE showed a similar, biphasic pattern of response to Ml. In the first phase, response variables were almost unaffected by mites. In the second phase, there was a marked decline in RUE and LNC and a marked increase in canopy temperature with increasing MI. These results suggest (i) some degree of compensatory photosynthesis at low to moderate levels of mite infestation, and (ii) reductions in RUE of mite

Milkweed, stink bugs, and Georgia cotton

Science.gov (United States)

In peanut-cotton farmscapes in Georgia, stink bugs, i.e., Nezara viridula (L.)(Say) and Chinavia hilaris (Say), develop in peanut and then disperse at the crop-to-crop interface to feed on fruit in cotton. The main objective of this study was to examine the influence of a habitat of tropical milkwe...

Recombinant Cry1Ia protein is highly toxic to cotton boll weevil (Anthonomus grandis Boheman) and fall armyworm (Spodoptera frugiperda).

Science.gov (United States)

Martins, E S; Aguiar, R W D S; Martins, N F; Melatti, V M; Falcão, R; Gomes, A C M M; Ribeiro, B M; Monnerat, R G

2008-05-01

To evaluate the activity of cry1Ia gene against cotton pests, Spodoptera frugiperda and Anthonomus grandis. Had isolated and characterized a toxin gene from the Bacillus thuringiensis S1451 strain which have been previously shown to be toxic to S. frugiperda and A. grandis. The toxin gene (cry1Ia) was amplified by PCR, sequenced, and cloned into the genome of a baculovirus. The Cry1Ia protein was expressed in baculovirus infected insect cells, producing protein inclusions in infected cells. The Cry1Ia protein has used in bioassays against to S. frugiperda and A. grandis. Bioassays using the purified recombinant protein showed high toxicity to S. frugiperda and A. grandis larvae. Molecular modelling of the Cry1Ia protein translated from the DNA sequence obtained in this work, showed that this protein possibly posses a similar structure to the Cry3A protein. Ultrastructural analysis of midgut cells from A. grandis incubated with the Cry1Ia toxin, showed loss of microvilli integrity. The results indicate that the cry1Ia is a good candidate for the construction of transgenic plants resistant to these important cotton pests.

Extraction and separation of water soluble proteins from Bacillus thuringiensis-transgenic and non-transgenic maize species by CZE

Czech Academy of Sciences Publication Activity Database

Sázelová, Petra; Kašička, Václav; Ibanez, E.; Cifuentes, A.

2009-01-01

Roč. 32, č. 21 (2009), s. 3801-3808 ISSN 1615-9306 R&D Projects: GA ČR(CZ) GA203/08/1428 Grant - others:GA ČR(CZ) GA203/09/0675 Program:GA Institutional research plan: CEZ:AV0Z40550506 Keywords : Bacillus thuringiensis -transgenic maize * CZE-UV profiling * Maize proteins Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.551, year: 2009

Fabrication of cotton fabric with superhydrophobicity and flame retardancy.

Science.gov (United States)

Zhang, Ming; Wang, Chengyu

2013-07-25

A simple and facile method for fabricating the cotton fabric with superhydrophobicity and flame retardancy is described in the present work. The cotton fabric with the maximal WCA of 160° has been prepared by the covalent deposition of amino-silica nanospheres and the further graft with (heptadecafluoro-1,1,2,2-tetradecyl) trimethoxysilane. The geometric microstructure of silica spheres was measured by transmission electron microscopy (TEM). The cotton textiles before and after treatment were characterized by using scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS). The wetting behavior of cotton samples was investigated by water contact angle measurement. Moreover, diverse performances of superhydrophobic cotton textiles have been evaluated as well. The results exhibited the outstanding superhydrophobicity, excellent waterproofing durability and flame retardancy of the cotton fabric after treatment, offering a good opportunity to accelerate the large-scale production of superhydrophobic textiles materials for new industrial applications. Copyright © 2013 Elsevier Ltd. All rights reserved.

[Double-ambient CO2 concentration affects the growth, development and sucking behavior of non-target brown plant hopper Nilaparvata lugens fed on transgenic Bt rice.

Science.gov (United States)

Lu, Yong Qing; Dai, Yang; Yu, Xiu Ying; Yu, Fu-Lan; Jiang, Shou Lin; Zhou, Zong Yuan; Chen, Fa Jun

2018-02-01

In recent years, the two issues of climate change including elevated CO 2 etc., and resistance of transgenic Bt crops against non-target insect pests have received widespread attention. Elevated CO 2 can affect the herbivorous insects. To date, there is no consensus about the effect of elevated CO 2 on the suck-feeding insect pests (non-target insect pests of transgenic Bt crops). Its effects on the suck-feeding behavior have rarely been reported. In this study, CO 2 levels were set up in artificial climate chamber to examined the effects of ambient (400 μL·L -1 ) and double-ambient (800 μL·L -1 ) CO 2 levels on the suck-feeding behavior, growth, development, and reproduction of the non-target insect pest of transgenic Bt rice, brown planthopper, Nilaparvata lugens. The results showed that CO 2 level significantly affected the egg and nymph duration, longevity and body mass of adults, and feeding behavior of the 4th and 5th instar nymphs, while had no effect on the fecundity of N. lugens. The duration of eggs and nymphs, and the longevity of female adults were significantly shortened by 4.0%, 4.2% and 6.6% respectively, the proportion of the macropterous adults was significantly increased by 11.6%, and the body mass of newly hatched female adults was significantly decreased by 2.2% by elevated CO 2 . In addition, elevated CO 2 significantly enhanced the stylet puncturing efficiency of the 4th and 5th instar nymphs of N. lugens. The duration ofphloem ingestion of the N4b waveform was significantly prolonged by 60.0% and 50.1%, and the frequency significantly was increased by 230.0% and 155.9% for the 4th and 5th instar nymphs of N. lugens by elevated CO 2 , respectively. It was concluded that double-ambient CO 2 could promote the growth and development of N. lugens through enhancing its suck-feeding, shorten the generation life-span and increase the macropertous adults' proportion of N. lugens. Thus, it could result in the occurrence of non-target rice

At-line cotton color measurements by portable color spectrophotometers

Science.gov (United States)

As a result of reports of cotton bales that had significant color changes from their initial Uster® High Volume Instrument (HVI™) color measurements, a program was implemented to measure cotton fiber color (Rd, +b) at-line in remote locations (warehouse, mill, etc.). The measurement of cotton fiber...

7 CFR 27.25 - Additional samples of cotton; drawing.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Additional samples of cotton; drawing. 27.25 Section... Samples § 27.25 Additional samples of cotton; drawing. In addition to the samples hereinbefore prescribed, separate samples, if desired, may be drawn and furnished to the owner of the cotton. ...

DeepCotton: in-field cotton segmentation using deep fully convolutional network

Science.gov (United States)

Li, Yanan; Cao, Zhiguo; Xiao, Yang; Cremers, Armin B.

2017-09-01

Automatic ground-based in-field cotton (IFC) segmentation is a challenging task in precision agriculture, which has not been well addressed. Nearly all the existing methods rely on hand-crafted features. Their limited discriminative power results in unsatisfactory performance. To address this, a coarse-to-fine cotton segmentation method termed "DeepCotton" is proposed. It contains two modules, fully convolutional network (FCN) stream and interference region removal stream. First, FCN is employed to predict initially coarse map in an end-to-end manner. The convolutional networks involved in FCN guarantee powerful feature description capability, simultaneously, the regression analysis ability of neural network assures segmentation accuracy. To our knowledge, we are the first to introduce deep learning to IFC segmentation. Second, our proposed "UP" algorithm composed of unary brightness transformation and pairwise region comparison is used for obtaining interference map, which is executed to refine the coarse map. The experiments on constructed IFC dataset demonstrate that our method outperforms other state-of-the-art approaches, either in different common scenarios or single/multiple plants. More remarkable, the "UP" algorithm greatly improves the property of the coarse result, with the average amplifications of 2.6%, 2.4% on accuracy and 8.1%, 5.5% on intersection over union for common scenarios and multiple plants, separately.

Problems and achievements of cotton (Gossypium Hirsutum L. weeds control

Directory of Open Access Journals (Sweden)

T. Barakova

2017-09-01

Full Text Available Abstract. Weed control in the cultivation of cotton is critical to the yield and quality of production. The influence of economically important weeds was studied. Chemical control is the most effective method of weed control in cotton but much of the information on it relates to primary weed infestation. Problems with primary weed infestation in cotton have been solved to a significant extent. The question of secondary weed infestation with annual and perennial graminaceous weeds during the period of cotton vegetation is also determined largely by the use of antigraminaceous herbicides. The data related to herbicides to effectively control secondary germinated broadleaf weeds in conventional technology for cotton growing are quite scarce, even globally. We are still seeking effective herbicides for control of these weeds in cotton crops. Studies on their influence on the sowing characteristics of cotton seed and the quality of cotton fiber are still insufficient. In the scientific literature there is not enough information on these questions. The combinations of herbicides, as well as their tank mixtures with fertilizers or plant growth regulators are more efficient than autonomous application. Often during their combined application higher synergistic effect on yield is produced. There is information about cotton cultivars resistant to glyphosate. These cultivars are GMO and they are banned within the European Union, including Bulgaria.

Study of mungbean intercropping in cotton planted with different techniques

International Nuclear Information System (INIS)

Khan, M.B.; Khaliq, A.

2004-01-01

Bio-economic efficiency of different cotton-based intercropping systems was determined at the Agronomic Research Area, University of Agriculture, Faisalabad, (Pakistan) during 1996-1997 and 1997-98. Cotton cultivar NIAB-78 was planted in 80-cm apart single rows and 120-cm spaced double row strips with the help of a single row hand drill. Intercropping systems were cotton alone and cotton + mungbean. Experiment was laid out in a RCBD with split arrangements in four replications. Planting patterns were kept in main plots and intercropping systems in sub-plots. Inter crop was sown in the space between 80-cm apart single rows as well as 120-cm spaced double row strips. Competition functions like relative crowding coefficient, competitive ratio, aggressivity, land equivalent ratio and area time equivalent ratio were calculated for the assessment of the benefits of the intercropping. Partial budget was prepared for determining net field benefits of the systems under study. Growing of cotton in 120-cm spaced double row strips proved superior to 80-cm spaced single rows. Intercropping decreased the seed cotton production significantly in both years, however, inter crop not only covered this loss but also increased overall productivity. Higher net field benefit (NFB) was obtained from cotton + mungbean than sole cropping of cotton. Farmers with small land holdings, seriously constrained by low crop income can adopt the practice of intercropping of mungbean in cotton. (author)

Fourier-transform imaging of cotton and botanical and field trash mixtures

Science.gov (United States)

Botanical and field cotton trash comingled with cotton lint can greatly reduce the marketability and quality of cotton. Trash can be found comingled with cotton lint during harvesting, ginning, and processing, thus this study is of interest. Attenuated Total Reflectance-Fourier Transform Infrared (A...

Chronic Microdose Lithium Treatment Prevented Memory Loss and Neurohistopathological Changes in a Transgenic Mouse Model of Alzheimer's Disease.

Science.gov (United States)

Nunes, Marielza Andrade; Schöwe, Natalia Mendes; Monteiro-Silva, Karla Cristina; Baraldi-Tornisielo, Ticiana; Souza, Suzzanna Ingryd Gonçalves; Balthazar, Janaina; Albuquerque, Marilia Silva; Caetano, Ariadiny Lima; Viel, Tania Araujo; Buck, Hudson Sousa

2015-01-01

The use of lithium is well established in bipolar disorders and the benefits are being demonstrated in neurodegenerative disorders. Recently, our group showed that treatment with microdose lithium stabilized the cognitive deficits observed in Alzheimer's disease (AD) patients. In order to verify the lithium microdose potential in preventing the disease development, the aim of this work was to verify the effects of chronic treatment with microdose lithium given before and after the appearance of symptoms in a mouse model of a disease similar to AD. Transgenic mice (Cg-Tg(PDGFB-APPSwInd)20Lms/2J) and their non-transgenic litter mate genetic controls were treated with lithium carbonate (0.25mg/Kg/day in drinking water) for 16 or 8 months starting at two and ten months of age, respectively [corrected]. Similar groups were treated with water. At the end of treatments, both lithium treated transgenic groups and non-transgenic mice showed no memory disruption, different from what was observed in the water treated transgenic group. Transgenic mice treated with lithium since two months of age showed decreased number of senile plaques, no neuronal loss in cortex and hippocampus and increased BDNF density in cortex, when compared to non-treated transgenic mice. It is suitable to conclude that these data support the use of microdose lithium in the prevention and treatment of Alzheimer's disease, once the neurohistopathological characteristics of the disease were modified and the memory of transgenic animals was maintained.

Chronic Microdose Lithium Treatment Prevented Memory Loss and Neurohistopathological Changes in a Transgenic Mouse Model of Alzheimer's Disease.

Directory of Open Access Journals (Sweden)

Marielza Andrade Nunes

Full Text Available The use of lithium is well established in bipolar disorders and the benefits are being demonstrated in neurodegenerative disorders. Recently, our group showed that treatment with microdose lithium stabilized the cognitive deficits observed in Alzheimer's disease (AD patients. In order to verify the lithium microdose potential in preventing the disease development, the aim of this work was to verify the effects of chronic treatment with microdose lithium given before and after the appearance of symptoms in a mouse model of a disease similar to AD. Transgenic mice (Cg-Tg(PDGFB-APPSwInd20Lms/2J and their non-transgenic litter mate genetic controls were treated with lithium carbonate (0.25mg/Kg/day in drinking water for 16 or 8 months starting at two and ten months of age, respectively [corrected]. Similar groups were treated with water. At the end of treatments, both lithium treated transgenic groups and non-transgenic mice showed no memory disruption, different from what was observed in the water treated transgenic group. Transgenic mice treated with lithium since two months of age showed decreased number of senile plaques, no neuronal loss in cortex and hippocampus and increased BDNF density in cortex, when compared to non-treated transgenic mice. It is suitable to conclude that these data support the use of microdose lithium in the prevention and treatment of Alzheimer's disease, once the neurohistopathological characteristics of the disease were modified and the memory of transgenic animals was maintained.

Developing Bisexual Attract-and-Kill for Polyphagous Insects: Ecological Rationale versus Pragmatics.

Science.gov (United States)

Gregg, Peter C; Del Socorro, Alice P; Hawes, Anthony J; Binns, Matthew R

2016-07-01

We discuss the principles of bisexual attract-and-kill, in which females as well as males are targeted with an attractant, such as a blend of plant volatiles, combined with a toxicant. While the advantages of this strategy have been apparent for over a century, there are few products available to farmers for inclusion in integrated pest management schemes. We describe the development, registration, and commercialization of one such product, Magnet(®), which was targeted against Helicoverpa armigera and H. punctigera in Australian cotton. We advocate an empirical rather than theoretical approach to selecting and blending plant volatiles for such products, and emphasise the importance of field studies on ecologically realistic scales of time and space. The properties required of insecticide partners also are discussed. We describe the studies that were necessary to provide data for registration of the Magnet(®) product. These included evidence of efficacy, including local and area-wide impacts on the target pest, non-target impacts, and safety for consumers and applicators. In the decade required for commercial development, the target market for Magnet(®) has been greatly reduced by the widespread adoption of transgenic insect-resistant cotton in Australia. We discuss potential applications in resistance management for transgenic cotton, and for other pests in cotton and other crops.

7 CFR 1427.174 - Maturity of seed cotton loans.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Maturity of seed cotton loans. 1427.174 Section 1427.174 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION... Maturity of seed cotton loans. Seed cotton loans mature on demand by CCC but no later than May 31 following...

The preparation and antibacterial effects of dopa-cotton/AgNPs

International Nuclear Information System (INIS)

Xu Hong; Shi Xue; Ma Hui; Lv Yihang; Zhang Linping; Mao Zhiping

2011-01-01

Silver nanoparticles (AgNPs) have been known to have powerful antibacterial activity. In this paper, in situ generation of AgNPs on the surface of dopamine modified cotton fabrics (dopa-cotton/AgNPs) in aqueous solution under room temperature is presented. X-ray photoelectron spectroscopy (XPS) and field emission scanning electron microscope (FE-SEM) were used to analyze the surface chemical composition and the morphology of the modified cotton fabrics, respectively. The results indicated that the surface of cotton fabrics was successfully coated with polydopamine and AgNPs. The cotton fabrics with AgNPs showed durable antibacterial activity.

Transgenic mosquitoes expressing a phospholipase A(2 gene have a fitness advantage when fed Plasmodium falciparum-infected blood.

Directory of Open Access Journals (Sweden)

Ryan C Smith

Full Text Available Genetically modified mosquitoes have been proposed as an alternative strategy to reduce the heavy burden of malaria. In recent years, several proof-of-principle experiments have been performed that validate the idea that mosquitoes can be genetically modified to become refractory to malaria parasite development.We have created two transgenic lines of Anophelesstephensi, a natural vector of Plasmodium falciparum, which constitutively secrete a catalytically inactive phospholipase A2 (mPLA2 into the midgut lumen to interfere with Plasmodium ookinete invasion. Our experiments show that both transgenic lines expressing mPLA2 significantly impair the development of rodent malaria parasites, but only one line impairs the development of human malaria parasites. In addition, when fed on malaria-infected blood, mosquitoes from both transgenic lines are more fecund than non-transgenic mosquitoes. Consistent with these observations, cage experiments with mixed populations of transgenic and non-transgenic mosquitoes show that the percentage of transgenic mosquitoes increases when maintained on Plasmodium-infected blood.Our results suggest that the expression of an anti-Plasmodium effector gene gives transgenic mosquitoes a fitness advantage when fed malaria-infected blood. These findings have important implications for future applications of transgenic mosquito technology in malaria control.

Impact of industrial dry-milling on fumonisin redistribution in non-transgenic corn in Brazil.

Science.gov (United States)

Bordini, Jaqueline Gozzi; Ono, Mario Augusto; Garcia, Glauco Tironi; Fazani, Victor Hugo Meconi; Vizoni, Édio; Rodrigues, Karem Caroline Bonacin; Hirooka, Elisa Yoko; Ono, Elisabete Yurie Sataque

2017-04-01

The aim of this study was to evaluate the fate of fumonisins B 1 (FB 1 ) and B 2 (FB 2 ) during industrial dry-milling in two lots from 2014 (n=120) and 2015 (n=120) of non-transgenic corn and their fractions (germ, pericarp, endosperm, cornmeal and grits), collected from one of the major Brazilian milling industries. Fumonisins were concentrated in the germ and pericarp at a rate of 322% and 188% (lot 1) and 311% and 263% (lot 2), respectively. In the endosperm, cornmeal and grits fumonisin levels decreased from 60 to 95%. Fumonisin levels in cornmeal and grits were below the maximum limit tolerated by the European Commission. Therefore, corn industrial dry-milling can contribute to reducing fumonisin levels in corn products intended for human consumption. Copyright © 2016 Elsevier Ltd. All rights reserved.

Marketing policies and economic interests in the cotton sector of Kenya

NARCIS (Netherlands)

Dijkstra, T.

1990-01-01

This report, which is based on field research carried out in 1988, examines the marketing arrangements for raw cotton, cotton lint and cotton seed in Kenya, as well as the relationships and conflicts between the actors involved. The report starts with the history of cotton production and marketing

76 FR 32067 - Common Crop Insurance Regulations; Extra Long Staple Cotton Crop Provisions

Science.gov (United States)

2011-06-03

... ``Any AUP cotton'' and replacing it with the phrase ``Mature AUP cotton'' to clarify the AUP cotton must be mature in order to calculate a conversion factor between AUP cotton and ELS cotton. List of... dividing Price A by 85 percent of Price B. * * * * * (f) Mature AUP cotton harvested or appraised from...

Genome-wide cloning, identification, classification and functional analysis of cotton heat shock transcription factors in cotton (Gossypium hirsutum).

Science.gov (United States)

Wang, Jun; Sun, Na; Deng, Ting; Zhang, Lida; Zuo, Kaijing

2014-11-06

Heat shock transcriptional factors (Hsfs) play important roles in the processes of biotic and abiotic stresses as well as in plant development. Cotton (Gossypium hirsutum, 2n=4x=(AD)2=52) is an important crop for natural fiber production. Due to continuous high temperature and intermittent drought, heat stress is becoming a handicap to improve cotton yield and lint quality. Recently, the related wild diploid species Gossypium raimondii genome (2n=2x=(D5)2=26) has been fully sequenced. In order to analyze the functions of different Hsfs at the genome-wide level, detailed characterization and analysis of the Hsf gene family in G. hirsutum is indispensable. EST assembly and genome-wide analyses were applied to clone and identify heat shock transcription factor (Hsf) genes in Upland cotton (GhHsf). Forty GhHsf genes were cloned, identified and classified into three main classes (A, B and C) according to the characteristics of their domains. Analysis of gene duplications showed that GhHsfs have occurred more frequently than reported in plant genomes such as Arabidopsis and Populus. Quantitative real-time PCR (qRT-PCR) showed that all GhHsf transcripts are expressed in most cotton plant tissues including roots, stems, leaves and developing fibers, and abundantly in developing ovules. Three expression patterns were confirmed in GhHsfs when cotton plants were exposed to high temperature for 1 h. GhHsf39 exhibited the most immediate response to heat shock. Comparative analysis of Hsfs expression differences between the wild-type and fiberless mutant suggested that Hsfs are involved in fiber development. Comparative genome analysis showed that Upland cotton D-subgenome contains 40 Hsf members, and that the whole genome of Upland cotton contains more than 80 Hsf genes due to genome duplication. The expression patterns in different tissues in response to heat shock showed that GhHsfs are important for heat stress as well as fiber development. These results provide an improved

Production of transgenic brassica juncea with the synthetic chitinase gene (nic) conferring resistance to alternaria brassicicola

International Nuclear Information System (INIS)

Munir, I.; Hussan, W.; Kazi, M.; Mian, A.

2016-01-01

Brassica juncea is an important oil seed crop throughout the world. The demand and cultivation of oil seed crops has gained importance due to rapid increase in world population and industrialization. Fungal diseases pose a great threat to Brassica productivity worldwide. Absence of resistance genes against fungal infection within crossable germplasms of this crop necessitates deployment of genetic engineering approaches to produce transgenic plants with resistance against fungal infections. In the current study, hypocotyls and cotyledons of Brassica juncea, used as explants, were transformed with Agrobacterium tumefacien strain EHA101 harboring binary vector pEKB/NIC containing synthetic chitinase gene (NIC), an antifungal gene under the control of cauliflower mosaic virus promoter (CaMV35S). Bar genes and nptII gene were used as selectable markers. Presence of chitinase gene in trangenic lines was confirmed by PCR and southern blotting analysis. Effect of the extracted proteins from non-transgenic and transgenic lines was observed on the growth of Alternaria brassicicola, a common disease causing pathogen in brassica crop. In comparison to non-transgenic control lines, the leaf tissue extracts of the transgenic lines showed considerable resistance and antifungal activity against A. brassicicola. The antifungal activity in transgenic lines was observed as corresponding to the transgene copy number. (author)

Indirect effect of a transgenic wheat on aphids through enhanced powdery mildew resistance.

Directory of Open Access Journals (Sweden)

Simone von Burg

Full Text Available In agricultural ecosystems, arthropod herbivores and fungal pathogens are likely to colonise the same plant and may therefore affect each other directly or indirectly. The fungus that causes powdery mildew (Blumeria graminis tritici and cereal aphids are important pests of wheat but interactions between them have seldom been investigated. We studied the effects of powdery mildew of wheat on two cereal aphid species, Metopolophium dirhodum and Rhopalosiphum padi. We hypothesized that aphid number and size will be smaller on powdery mildew-infected plants than on non-infected plants. In a first experiment we used six commercially available wheat varieties whereas in the second experiment we used a genetically modified (GM mildew-resistant wheat line and its non-transgenic sister line. Because the two lines differed only in the presence of the transgene and in powdery mildew resistance, experiment 2 avoided the confounding effect of variety. In both experiments, the number of M. dirhodum but not of R. padi was reduced by powdery mildew infection. Transgenic mildew-resistant lines therefore harboured bigger aphid populations than the non-transgenic lines. For both aphid species individual size was mostly influenced by aphid number. Our results indicate that plants that are protected from a particular pest (powdery mildew became more favourable for another pest (aphids.

Indirect effect of a transgenic wheat on aphids through enhanced powdery mildew resistance.

Science.gov (United States)

von Burg, Simone; Álvarez-Alfageme, Fernando; Romeis, Jörg

2012-01-01

In agricultural ecosystems, arthropod herbivores and fungal pathogens are likely to colonise the same plant and may therefore affect each other directly or indirectly. The fungus that causes powdery mildew (Blumeria graminis tritici) and cereal aphids are important pests of wheat but interactions between them have seldom been investigated. We studied the effects of powdery mildew of wheat on two cereal aphid species, Metopolophium dirhodum and Rhopalosiphum padi. We hypothesized that aphid number and size will be smaller on powdery mildew-infected plants than on non-infected plants. In a first experiment we used six commercially available wheat varieties whereas in the second experiment we used a genetically modified (GM) mildew-resistant wheat line and its non-transgenic sister line. Because the two lines differed only in the presence of the transgene and in powdery mildew resistance, experiment 2 avoided the confounding effect of variety. In both experiments, the number of M. dirhodum but not of R. padi was reduced by powdery mildew infection. Transgenic mildew-resistant lines therefore harboured bigger aphid populations than the non-transgenic lines. For both aphid species individual size was mostly influenced by aphid number. Our results indicate that plants that are protected from a particular pest (powdery mildew) became more favourable for another pest (aphids).

Cotton in Benin: governance and pest management

NARCIS (Netherlands)

Togbe, C.E.

2013-01-01

Key words: cotton, synthetic pesticides, neem oil (Azadirachta indica), Beauveria bassiana,

Bacillus thuringiensis, field experiment, farmers’ participation

Pests are one of the main factors limiting cotton production worldwide. Most of the pest

control

Orientation of cotton growers of multan district about heal hazards and pesticide use

International Nuclear Information System (INIS)

Haq, Q.U.; Hussain, R.; Ali, T.; Ahmad, M.

2008-01-01

Cotton growing farmers and cotton pickers are the twin pillars of cotton growing community. Cotton growing farmers (male) are involved in monitoring of quality and quantity of cotton crops by handsome usage of pesticides for better marketing of cotton crops. Whereas, cotton pickers (female) are involved in picking of cotton mainly. To assess their knowledge and source of knowledge about pesticides related health problems, the study was designed and conducted in 20 villages of district Multan selected by multistage random sampling technique. From the selected 20 villages, from the list bearing the villages, mouzas and union councils of district Multan, 220 cotton growers and 150 cotton pickers were selected by simple random sampling technique and interviewed through a reliable and validated interview schedule. The data collected were processed through Statistical Package for Social Sciences (SPSS). The results showed that 75% of cotton growing farmers were having orientation about side effects of pesticides whereas, almost 8% of cotton growers were having no knowledge about side effects of pesticides. (author)

Ecoinformatics reveals effects of crop rotational histories on cotton yield.

Science.gov (United States)

Meisner, Matthew H; Rosenheim, Jay A

2014-01-01

Crop rotation has been practiced for centuries in an effort to improve agricultural yield. However, the directions, magnitudes, and mechanisms of the yield effects of various crop rotations remain poorly understood in many systems. In order to better understand how crop rotation influences cotton yield, we used hierarchical Bayesian models to analyze a large ecoinformatics database consisting of records of commercial cotton crops grown in California's San Joaquin Valley. We identified several crops that, when grown in a field the year before a cotton crop, were associated with increased or decreased cotton yield. Furthermore, there was a negative association between the effect of the prior year's crop on June densities of the pest Lygus hesperus and the effect of the prior year's crop on cotton yield. This suggested that some crops may enhance L. hesperus densities in the surrounding agricultural landscape, because residual L. hesperus populations from the previous year cannot continuously inhabit a focal field and attack a subsequent cotton crop. In addition, we found that cotton yield declined approximately 2.4% for each additional year in which cotton was grown consecutively in a field prior to the focal cotton crop. Because L. hesperus is quite mobile, the effects of crop rotation on L. hesperus would likely not be revealed by small plot experimentation. These results provide an example of how ecoinformatics datasets, which capture the true spatial scale of commercial agriculture, can be used to enhance agricultural productivity.

Ecoinformatics reveals effects of crop rotational histories on cotton yield.

Directory of Open Access Journals (Sweden)

Matthew H Meisner

Full Text Available Crop rotation has been practiced for centuries in an effort to improve agricultural yield. However, the directions, magnitudes, and mechanisms of the yield effects of various crop rotations remain poorly understood in many systems. In order to better understand how crop rotation influences cotton yield, we used hierarchical Bayesian models to analyze a large ecoinformatics database consisting of records of commercial cotton crops grown in California's San Joaquin Valley. We identified several crops that, when grown in a field the year before a cotton crop, were associated with increased or decreased cotton yield. Furthermore, there was a negative association between the effect of the prior year's crop on June densities of the pest Lygus hesperus and the effect of the prior year's crop on cotton yield. This suggested that some crops may enhance L. hesperus densities in the surrounding agricultural landscape, because residual L. hesperus populations from the previous year cannot continuously inhabit a focal field and attack a subsequent cotton crop. In addition, we found that cotton yield declined approximately 2.4% for each additional year in which cotton was grown consecutively in a field prior to the focal cotton crop. Because L. hesperus is quite mobile, the effects of crop rotation on L. hesperus would likely not be revealed by small plot experimentation. These results provide an example of how ecoinformatics datasets, which capture the true spatial scale of commercial agriculture, can be used to enhance agricultural productivity.

Weed hosts of cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae).

Science.gov (United States)

Vennila, S; Prasad, Y G; Prabhakar, M; Agarwal, Meenu; Sreedevi, G; Bambawale, O M

2013-03-01

The exotic cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) invaded India during 2006, and caused widespread infestation across all nine cotton growing states. P. solenopsis also infested weeds that aided its faster spread and increased severity across cotton fields. Two year survey carried out to document host plants of P. solenopsis between 2008 and 2010 revealed 27, 83, 59 and 108 weeds belonging to 8, 18, 10 and 32 families serving as alternate hosts at North, Central, South and All India cotton growing zones, respectively. Plant species of four families viz., Asteraceae, Amaranthaceae, Malvaceae and Lamiaceae constituted almost 50% of the weed hosts. While 39 weed species supported P. solenopsis multiplication during the cotton season, 37 were hosts during off season. Higher number of weeds as off season hosts (17) outnumbering cotton season (13) at Central over other zones indicated the strong carryover of the pest aided by weeds between two cotton seasons. Six, two and seven weed hosts had the extreme severity of Grade 4 during cotton, off and cotton + off seasons, respectively. Higher number of weed hosts of P. solenopsis were located at roadside: South (12) > Central (8) > North (3) zones. Commonality of weed hosts was higher between C+S zones, while no weed host was common between N+S zones. Paper furnishes the wide range of weed hosts of P. solenopsis, discusses their significance, and formulated general and specific cultural management strategies for nationwide implementation to prevent its outbreaks.

Elemental analysis of cotton by laser-induced breakdown spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Schenk, Emily R.; Almirall, Jose R.

2010-05-01

Laser-induced breakdown spectroscopy (LIBS) has been applied to the elemental characterization of unprocessed cotton. This research is important in forensic and fraud detection applications to establish an elemental fingerprint of U.S. cotton by region, which can be used to determine the source of the cotton. To the best of our knowledge, this is the first report of a LIBS method for the elemental analysis of cotton. The experimental setup consists of a Nd:YAG laser that operates at the fundamental wavelength as the LIBS excitation source and an echelle spectrometer equipped with an intensified CCD camera. The relative concentrations of elements Al, Ba, Ca, Cr, Cu, Fe, Mg, and Sr from both nutrients and environmental contributions were determined by LIBS. Principal component analysis was used to visualize the differences between cotton samples based on the elemental composition by region in the U.S. Linear discriminant analysis of the LIBS data resulted in the correct classification of >97% of the cotton samples by U.S. region and >81% correct classification by state of origin.

Effect of water pressure on absorbency of hydroentangled greige cotton nonwoven fabrics

Science.gov (United States)

A studied has been conducted to determine the effect of water pressure in a commercial-grade Fleissner MiniJet hydroentanglement system on the absorbency of greige (non-bleached) cotton lint-based nonwoven fabric. The study has shown that a water pressure of 125 Bar or higher on only two high-pressu...

Quantitate gossypol enantiomers in cotton flower petals and seed using capillary electrophoresis

Science.gov (United States)

Gossypol is a compound that occurs in the cotton plant and in leaves it protects the plant from insect herbivory. The compound also occurs in the seed. In this tissue it renders the seed toxic to non-ruminant animals. However, gossypol exists as a mixture of enantiomers referred to as (+)-gossypo...

Transgenic algae engineered for higher performance

Science.gov (United States)

Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J

2014-10-21

The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

Influence of Phytase Transgenic Corn on the Intestinal Microflora and the Fate of Transgenic DNA and Protein in Digesta and Tissues of Broilers

Science.gov (United States)

Li, Sufen; Li, Ang; Zhang, Liyang; Liu, Zhenhua; Luo, Xugang

2015-01-01

An experiment was conducted to investigate the effect of phytase transgenic corn (PTC) on intestinal microflora, and the fate of transgenic DNA and protein in the digesta and tissues of broilers. A total of 160 1-day-old Arbor Acres commercial male broilers were randomly assigned to 20 cages (8 chicks per cage) with 10 cages (replicates) for each treatment. Birds were fed with a diet containing either PTC (54.0% during 1–21 days and 61.0% during 22–42 days) or non-transgenic isogenic control corn (CC) for a duration of 42 days. There were no significant differences (P>0.05) between birds fed with the PTC diets and those fed with the CC diets in the quantities of aerobic bacteria, anaerobic bacteria, colibacillus and lactobacilli, or microbial diversities in the contents of ileum and cecum. Transgenic phyA2 DNA was not detected, but phyA2 protein was detected in the digesta of duodenum and jejunum of broilers fed with the PTC diets. Both transgenic phyA2 DNA and protein fragments were not found in the digesta of the ileum and rectum, heart, liver, kidney, and breast or thigh muscles of broilers fed with the PTC diets. It was concluded that PTC had no adverse effect on the quantity and diversity of gut microorganisms; Transgenic phyA2 DNA or protein was rapidly degraded in the intestinal tract and was not transferred to the tissues of broilers. PMID:26599444

Capillary electrophoretic profiling of tryptic digests of water soluble proteins from Bacillus thuringiensis-transgenic and non-transgenic maize species

Czech Academy of Sciences Publication Activity Database

Sázelová, Petra; Kašička, Václav; Leon, C.; Ibanez, E.; Cifuentes, A.

2012-01-01

Roč. 134, č. 3 (2012), s. 1607-1615 ISSN 0308-8146 R&D Projects: GA ČR(CZ) GA203/08/1428 Grant - others:AV ČR(CZ) 2008CZ0019 Institutional research plan: CEZ:AV0Z40550506 Keywords : Bt-transgenic maize * capillary zone electrophoresis * maize proteins Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 3.334, year: 2012

CATEGORIZATION OF EXTRANEOUS MATTER IN COTTON USING MACHINE VISION SYSTEMS

Science.gov (United States)

The Cotton Trash Identification System (CTIS) was developed at the Southwestern Cotton Ginning Research Laboratory to identify and categorize extraneous matter in cotton. The CTIS bark/grass categorization was evaluated with USDA-Agricultural Marketing Service (AMS) extraneous matter calls assigned ...

Up-regulation of alpha-smooth muscle actin in cardiomyocytes from non-hypertrophic and non-failing transgenic mouse hearts expressing N-terminal truncated cardiac troponin I

Directory of Open Access Journals (Sweden)

Stephanie Kern

2014-01-01

Full Text Available We previously reported that a restrictive N-terminal truncation of cardiac troponin I (cTnI-ND is up-regulated in the heart in adaptation to hemodynamic stresses. Over-expression of cTnI-ND in the hearts of transgenic mice revealed functional benefits such as increased relaxation and myocardial compliance. In the present study, we investigated the subsequent effect on myocardial remodeling. The alpha-smooth muscle actin (α-SMA isoform is normally expressed in differentiating cardiomyocytes and is a marker for myocardial hypertrophy in adult hearts. Our results show that in cTnI-ND transgenic mice of between 2 and 3 months of age (young adults, a significant level of α-SMA is expressed in the heart as compared with wild-type animals. Although blood vessel density was increased in the cTnI-ND heart, the mass of smooth muscle tissue did not correlate with the increased level of α-SMA. Instead, immunocytochemical staining and Western blotting of protein extracts from isolated cardiomyocytes identified cardiomyocytes as the source of increased α-SMA in cTnI-ND hearts. We further found that while a portion of the up-regulated α-SMA protein was incorporated into the sarcomeric thin filaments, the majority of SMA protein was found outside of myofibrils. This distribution pattern suggests dual functions for the up-regulated α-SMA as both a contractile component to affect contractility and as possible effector of early remodeling in non-hypertrophic, non-failing cTnI-ND hearts.

Hybridization of downregulated-COMT transgenic switchgrass lines with field selected switchgrass for improved biomass traits

Science.gov (United States)

Transgenic switchgrass (Panicum virgatum L.) has been produced for improved cell walls for biofuels. Downregulated caffeic acid 3-O-methyltransferase (COMT) switchgrass produced significantly more biomass and biofuel than the non-transgenic progenitor line. In the present study we sought to further...

Effects of saliva collection using cotton swabs on melatonin enzyme immunoassay.

Science.gov (United States)

Kozaki, Tomoaki; Lee, Soomin; Nishimura, Takayuki; Katsuura, Tetsuo; Yasukouchi, Akira

2011-01-10

Although various acceptable and easy-to-use devices have been used for saliva collection, cotton swabs are among the most common ones. Previous studies reported that cotton swabs yield a lower level of melatonin detection. However, this statistical method is not adequate for detecting an agreement between cotton saliva collection and passive saliva collection, and a test for bias is needed. Furthermore, the effects of cotton swabs have not been examined at lower melatonin level, a level at which melatonin is used for assessment of circadian rhythms, namely dim light melatonin onset (DLMO). In the present study, we estimated the effect of cotton swabs on the results of salivary melatonin assay using the Bland-Altman plot at lower level. Nine healthy males were recruited and each provided four saliva samples on a single day to yield a total of 36 samples. Saliva samples were directly collected in plastic tubes using plastic straws, and subsequently pipetted onto cotton swabs (cotton saliva collection) and into clear sterile tubes (passive saliva collection). The melatonin levels were analyzed in duplicate using commercially available ELISA kits. The mean melatonin concentration in cotton saliva collection samples was significantly lower than that in passive saliva collection samples at higher melatonin level (>6 pg/mL). The Bland-Altman plot indicated that cotton swabs causes relative and proportional biases in the assay results. For lower melatonin level (<6 pg/mL), although the BA plots didn't show proportional and relative biases, there was no significant correlation between passive and cotton saliva collection samples. Our findings indicate an interference effect of cotton swabs on the assay result of salivary melatonin at lower melatonin level. Cotton-based collection devices might, thus, not be suitable for assessment of DLMO.

Chemical analysis of plasma-assisted antimicrobial treatment on cotton

International Nuclear Information System (INIS)

Kan, C W; Lam, Y L; Yuen, C W M; Luximon, A; Lau, K W; Chen, K S

2013-01-01

This paper explores the use of plasma treatment as a pretreatment process to assist the application of antimicrobial process on cotton fabric with good functional effect. In this paper, antimicrobial finishing agent, Microfresh Liquid Formulation 9200-200 (MF), and a binder (polyurethane dispersion, Microban Liquid Formulation R10800-0, MB) will be used for treating the cotton fabric for improving the antimicrobial property and pre-treatment of cotton fabric by plasma under atmospheric pressure will be employed to improve loading of chemical agents. The chemical analysis of the treated cotton fabric will be conducted by Fourier transform Infrared Spectroscopy.

Pollen Competition as a Reproductive Isolation Barrier Represses Transgene Flow between Compatible and Co-Flowering Citrus Genotypes

Science.gov (United States)

Pons, Elsa; Navarro, Antonio; Ollitrault, Patrick; Peña, Leandro

2011-01-01

Background/Objective Despite potential benefits granted by genetically modified (GM) fruit trees, their release and commercialization raises concerns about their potential environmental impact, and the transfer via pollen of transgenes to cross-compatible cultivars is deemed to be the greatest source for environmental exposure. Information compiled from field trials on GM trees is essential to propose measures to minimize the transgene dispersal. We have conducted a field trial of seven consecutive years to investigate the maximum frequency of pollen-mediated crop-to-crop transgene flow in a citrus orchard, and its relation to the genetic, phenological and environmental factors involved. Methodology/Principal Findings Three different citrus genotypes carrying the uidA (GUS) tracer marker gene (pollen donors) and a non-GM self-incompatible contiguous citrus genotype (recipient) were used in conditions allowing natural entomophilous pollination to occur. The examination of 603 to 2990 seeds per year showed unexpectedly low frequencies (0.17–2.86%) of transgene flow. Paternity analyses of the progeny of subsets of recipient plants using 10 microsatellite (SSR) loci demonstrated a higher mating competence of trees from another non-GM pollen source population that greatly limited the mating chance of the contiguous cross-compatible and flowering-synchronized transgenic pollen source. This mating superiority could be explained by a much higher pollen competition capacity of the non-GM genotypes, as was confirmed through mixed-hand pollinations. Conclusions/Significance Pollen competition strongly contributed to transgene confinement. Based on this finding, suitable isolation measures are proposed for the first time to prevent transgene outflow between contiguous plantings of citrus types that may be extendible to other entomophilous transgenic fruit tree species. PMID:21991359

Attenuation of 6-hydroxydopamine-induced dopaminergic nigrostriatal lesions in superoxide dismutase transgenic mice

International Nuclear Information System (INIS)

Cadet, J.L.; Hirata, H.; Asanuma, M.

1998-01-01

6-Hydroxydopamine is a neurotoxin that produces degeneration of the nigrostriatal dopaminergic pathway in rodents. Its toxicity is thought to involve the generation of superoxide anion secondary to its autoxidation. To examine the effects of the overexpression of Cu,Zn-superoxide dismutase activity on 6-hydroxydopamine-induced dopaminergic neuronal damage, we have measured the effects of 6-hydroxydopamine on striatal and nigral dopamine transporters and nigral tyrosine hydroxylase-immunoreactive neurons in Cu,Zn-superoxide dismutase transgenic mice. Intracerebroventricular injection of 6-hydroxydopamine (50 μg) in non-transgenic mice produced reductions in the size of striatal area and an enlargement of the cerebral ventricle on both sides of the brains of mice killed two weeks after the injection. In addition, 6-hydroxydopamine caused marked decreases in striatal and nigral [ 125 I]RTI-121-labelled dopamine transporters not only on the injected side but also on the non-injected side of non-transgenic mice; this was associated with decreased cell number and size of tyrosine hydroxylase-immunoreactive dopamine neurons in the substantia nigra pars compacta on both sides in these mice. In contrast, superoxide dismutase transgenic mice were protected against these neurotoxic effects of 6-hydroxydopamine, with the homozygous transgenic mice showing almost complete protection.These results provide further support for a role of superoxide anion in the toxic effects of 6-hydroxydopamine. They also provide further evidence that reactive oxygen species may be the main determining factors in the neurodegenerative effects of catecholamines. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

Microbiologic Evaluation of Cotton and Polytetrafluoroethylene (PTFE) Tape as Endodontic Spacer Materials in Primary Molars An in Vivo Study.

Science.gov (United States)

Prabhakar, Attiguppe Ramasetty; Dixit, Kratika; Raju, O S

PTFE tape, which is commonly used as plumber's tape is an inorganic, non-fibrous, ribbon like material. The aim of this study was to evaluate PTFE tape as endodontic spacer material and to compare it with commonly used spacer material that is cotton, in primary teeth. Seventeen children undergoing pulpectomy of lower second primary molar bilaterally were included in the study. Cotton and PTFE tape were placed as spacers on each side randomly. Samples were taken from the access cavity at baseline and after seven days to check for microbial leakage. Spacer materials were also checked for microbial contamination. The results revealed that there was a significant increase in the bacterial colony count after seven days in cotton group. The access cavities were also positive for microbial leakage in the cotton group where the spacers showed positive growth. In PTFE group only two samples showed microbial contamination of spacer and out of two only one sample showed contamination of access cavity along with spacer. Within the limitations of this study, it can be concluded that PTFE tape performed better than cotton as endodontic spacer material. Thus, PTFE tape can be recommended as an endodontic spacer material as an alternative to cotton in primary teeth.

Field Comparison of Fertigation Vs. Surface Irrigation of Cotton Crop

International Nuclear Information System (INIS)

Janat, M.

2004-01-01

Based on previous results of the same nature, one nitrogen rate 180 kg N ha -1 was tested under two-irrigation methods, surface irrigation and drip fertigation of cotton (Cultivar Rakka-5) for two consecutive seasons 2000 and 2001. The study aimed to answer various questions regarding the applicability of drip fertigation at farm level and the effect of its employment on yield and growth parameters, compared to surface irrigation. Nitrogen fertilizer was either injected in eight equally split applications for the drip fertigated cotton or divided in four unequally split applications as recommend by Ministry of Agriculture (20% before planting, 40% at thinning, 20% after 60 days from planting and 20% after 75 days after planting). 15 N labeled urea was used to evaluate nitrogen fertilizer efficiency. The experimental design was randomized block design with seven replicates. Results showed that drip fertigation led to water saving exceeding 50% in some cases. Field germination percentage was highly increased under drip- fertigated cotton relative to surface-irrigated cotton. Dry matter and seed cotton yield of surface-irrigated cotton was slightly higher than that of drip-fertigated cotton in the first growing season. The reason for that was due to the hot spill that occurred in the region, which exposed the cotton crop to water stress and consequently pushed the cotton into early flowering. Lint properties were not affected by the introduction of drip-fertigation. Actually some properties were improved relative to the standard properties identified by the cotton Bureau.Nitrogen uptake was slightly increased under drip fertigation whereas nitrogen use efficiencies were not constant along the growing seasons. The reason for that could be lateral leaching and root proliferation into the labeled and unlabeled subplots. Field water use efficiency was highly increased for both growing seasons under drip fertigation practice. The rate of field water use efficiencies

Passive and active protection of cotton textiles

NARCIS (Netherlands)

Bochove, C. van

1967-01-01

In rotproofing of cotton a distinction is made between passive and active protection. In passive protection, the structure of the cotton fibre is modified in such a way that the fibre can longer be attacked. This modification of structure can be effected on different levels: microscopical,

Incorporating a Sorghum Habitat for Enhancing Lady Beetles (Coleoptera: Coccinellidae in Cotton

Directory of Open Access Journals (Sweden)

P. G. Tillman

2012-01-01

Full Text Available Lady beetles (Coleoptera: Coccinellidae prey on insect pests in cotton. The objective of this 2 yr on-farm study was to document the impact of a grain sorghum trap crop on the density of Coccinellidae on nearby cotton. Scymnus spp., Coccinella septempunctata (L., Hippodamia convergens Guérin-Méneville, Harmonia axyridis (Pallas, Coleomegilla maculata (De Geer, Cycloneda munda (Say, and Olla v-nigrum (Mulsant were found in sorghum over both years. Lady beetle compositions in sorghum and cotton and in yellow pyramidal traps were similar. For both years, density of lady beetles generally was higher on cotton with sorghum than on control cotton. Our results indicate that sorghum was a source of lady beetles in cotton, and thus incorporation of a sorghum habitat in farmscapes with cotton has great potential to enhance biocontrol of insect pests in cotton.

Satellite-based monitoring of cotton evapotranspiration

Science.gov (United States)

Dalezios, Nicolas; Dercas, Nicholas; Tarquis, Ana Maria

2016-04-01

Water for agricultural use represents the largest share among all water uses. Vulnerability in agriculture is influenced, among others, by extended periods of water shortage in regions exposed to droughts. Advanced technological approaches and methodologies, including remote sensing, are increasingly incorporated for the assessment of irrigation water requirements. In this paper, remote sensing techniques are integrated for the estimation and monitoring of crop evapotranspiration ETc. The study area is Thessaly central Greece, which is a drought-prone agricultural region. Cotton fields in a small agricultural sub-catchment in Thessaly are used as an experimental site. Daily meteorological data and weekly field data are recorded throughout seven (2004-2010) growing seasons for the computation of reference evapotranspiration ETo, crop coefficient Kc and cotton crop ETc based on conventional data. Satellite data (Landsat TM) for the corresponding period are processed to estimate cotton crop coefficient Kc and cotton crop ETc and delineate its spatiotemporal variability. The methodology is applied for monitoring Kc and ETc during the growing season in the selected sub-catchment. Several error statistics are used showing very good agreement with ground-truth observations.

Integrated nutrients management for 'desi' cotton

International Nuclear Information System (INIS)

Qazi, M.A.; Akram, M.; Ahmad, N.; Khattak, M.A.

2007-01-01

Intensive cropping with no return of crop residues and other organic inputs result in the loss of soil organic matter (SOM) and nutrient supply in (Desi) cotton-wheat cropping system in Pakistan. For appraisal of problem and finding solution to sustainability, we evaluated six treatments comprised of two fertilizer doses and three management techniques over a period of three years (2003-05) monitoring their effects on seed cotton yield and soil fertility. The techniques included chemical fertilizers, municipal solid waste manure (MSWM) integrated with chemical fertilizers in 1:4 ratios with, and without pesticides. The results revealed that cotton yields. Were enhanced by 19% due to site-specific fertilizer dose over conventional dose. Ignoring weeds control by means of herbicided application resulted in 5% decrease of seed cotton yield in IPNM technique positive effect of MSWM integration was noted on soil test phosphorus and SOM. Site-specific fertilizer application and integrated plant nutrient management by MSWM proved their suitability as the techniques not only improve soil quality in terms of sustained levels of organic matter and phosphorus but also provide a safe way of waste disposal. (author)

The influence of chronic stress on anxiety-like behavior and cognitive function in different human GFAP-ApoE transgenic adult male mice.

Science.gov (United States)

Meng, Fan-Tao; Zhao, Jun; Fang, Hui; Liu, Ya-Jing

2015-01-01

The apolipoprotein E (ApoE) ɛ4 allele (ApoE4) is an important genetic risk factor for the pathogenesis of Alzheimer's disease (AD). In addition to genetic factors, environmental factors such as stress may play a critical role in AD pathogenesis. This study was designed to investigate the anxiety-like behavioral and cognitive changes in different human glial fibrillary acidic protein (GFAP)-ApoE transgenic adult male mice under chronic stress conditions. On the open field test, anxiety-like behavior was increased in the non-stressed GFAP-ApoE4 transgenic mice relative to the corresponding GFAP-ApoE3 (ApoE ɛ3 allele) mice. Anxiety-like behavior was increased in the stressed GFAP-ApoE3 mice relative to non-stressed GFAP-ApoE3 mice, but was unexpectedly decreased in the stressed GFAP-ApoE4 mice relative to non-stressed GFAP-ApoE4 mice. On the novel object recognition task, both GFAP-ApoE4 and GFAP-ApoE3 mice exhibited long-term non-spatial memory impairment after chronic stress. Interestingly, short-term non-spatial memory impairment (based on the novel object recognition task) was observed only in the stressed GFAP-ApoE4 male mice relative to non-stressed GFAP-ApoE4 transgenic mice. In addition, short-term spatial memory impairment was observed in the stressed GFAP-ApoE3 transgenic male mice relative to non-stressed GFAP-ApoE3 transgenic male mice; however, short-term spatial memory performance of GFAP-ApoE4 transgenic male mice was not reduced compared to non-stressed control mice based on the Y-maze task. In conclusion, our findings suggested that chronic stress affects anxiety-like behavior and spatial and non-spatial memory in GFAP-ApoE transgenic mice in an ApoE isoform-dependent manner.

Effects of saliva collection using cotton swabs on melatonin enzyme immunoassay

Directory of Open Access Journals (Sweden)

Katsuura Tetsuo

2011-01-01

Full Text Available Abstract Background Although various acceptable and easy-to-use devices have been used for saliva collection, cotton swabs are among the most common ones. Previous studies reported that cotton swabs yield a lower level of melatonin detection. However, this statistical method is not adequate for detecting an agreement between cotton saliva collection and passive saliva collection, and a test for bias is needed. Furthermore, the effects of cotton swabs have not been examined at lower melatonin level, a level at which melatonin is used for assessment of circadian rhythms, namely dim light melatonin onset (DLMO. In the present study, we estimated the effect of cotton swabs on the results of salivary melatonin assay using the Bland-Altman plot at lower level. Methods Nine healthy males were recruited and each provided four saliva samples on a single day to yield a total of 36 samples. Saliva samples were directly collected in plastic tubes using plastic straws, and subsequently pipetted onto cotton swabs (cotton saliva collection and into clear sterile tubes (passive saliva collection. The melatonin levels were analyzed in duplicate using commercially available ELISA kits. Results The mean melatonin concentration in cotton saliva collection samples was significantly lower than that in passive saliva collection samples at higher melatonin level (>6 pg/mL. The Bland-Altman plot indicated that cotton swabs causes relative and proportional biases in the assay results. For lower melatonin level ( Conclusion Our findings indicate an interference effect of cotton swabs on the assay result of salivary melatonin at lower melatonin level. Cotton-based collection devices might, thus, not be suitable for assessment of DLMO.

Effect of Polylactic Acid-Degradable Film Mulch on Soil Temperature and Cotton Yield

Directory of Open Access Journals (Sweden)

ZHANG Ni

2016-03-01

Full Text Available Concern on biodegradable plastic film is increasing because of pollution problems caused by the plastic films currently used. The objective of this field experiment is to evaluate the effect of two thicknesses of polyactic acid-degradable film on soil temperature and cotton yield. The results showed that small holes appeared in the polyactic acid-degradable film at 17~22 d after it was installed. Burst period appeared about 60 d after installation. Splits were observed in the polyactic acid-degradable film at 130 d after installation. Soil temperatures rose slowly under polyactic acid-degradable film during the cotton seedling stage. Daytime soil temperatures were 0.8℃ and 6.2℃ lower under 18μm and 15μm thick polyactic acid-degradable film than non-degradable plastic film(CK, respectively. Nighttime soil temperatures under the polyactic acid-degradable film were about 1℃ warmer than CK. There was no significant difference in cotton yields between the 18μm polyactic acid degradable film treatment and CK. In contrast, yields in the 15μm degradable plastic film treatment were 8.9% less than that in CK. This study indicated that 18μm polyactic acid degradable plastic film had good degradability and no negative effect on cotton growth. The 18μm polyactic acid degradable plastic film can replace ordinary plastic film in agricultural production.

Processing and Properties of PCL/Cotton Linter Compounds

OpenAIRE

Bezerra,Elieber Barros; França,Danyelle Campos; Morais,Dayanne Diniz de Souza; Rosa,Morsyleide de Freitas; Morais,João Paulo Saraiva; Araújo,Edcleide Maria; Wellen,Renate Maria Ramos

2017-01-01

Biodegradable compounds of poly(ε-caprolactone) (PCL)/ cotton linter were melting mixed with filling content ranging from 1% to 5% w/w. Cotton linter is an important byproduct of textile industry; in this work it was used in raw state and after acid hydrolysis. According to the results of torque rheometry no decaying of viscosity took place during compounding, evidencing absence of breaking down in molecular weight. The thermal stability increased by 20% as observed in HDT for PCL/cotton...

Cycling of fertilizer and cotton crop residue nitrogen

International Nuclear Information System (INIS)

Rochester, I.J.; Constable, G.A.; MacLeod, D.A.

1993-01-01

Mineral nitrogen (N), nitrate and ammonium contents were monitored in N-fertilized soils supporting cotton crops to provide information on the nitrification, mineralization and immobilization processes operating in the soil. The relative contributions of fertilizer N, previous cotton crop residue N and indigenous soil N to the mineral N pools and to the current crop's N uptake were calculated. After N fertilizer (urea) application, the soil's mineral N content rose rapidly and subsequently declined at a slower rate. The recovery of 15 N-labelled urea as mineral N declined exponentially with time. Biological immobilization (and possibly denitrification to some extent) were believed to be the major processes reducing post-application soil mineral N content. Progressively less N was mineralized upon incubation of soil sampled through the growing season. Little soil N (either from urea or crop residue) was mineralized at crop maturity. Cycling of N was evident between the soil mineral and organic N pools throughout the cotton growing season. Considerable quantities of fertilizer N were immobilized by the soil micro biomass; immobilized N was remineralized and subsequently taken up by the cotton crop. A large proportion of the crop N was taken up in the latter part of the season when the soil mineral N content was low. It is suggested that much of the N taken up by cotton was derived from microbial sources, rather than crop residues. The application of cotton crop residue (stubble) slightly reduced the mineral N content in the soil by encouraging biological immobilization. 15 N was mineralized very slowly from the labelled crop residue and did not contribute significantly to the supply of N to the current crop. Recovery of labelled fertilizer N and labelled crop residue N by the cotton crop was 28% and 1%, respectively. In comparison, the apparent recovery of fertilizer N was 48%. Indigenous soil N contributed 68% of the N taken up by the cotton crop. 33 refs., 1 tab

Highly efficient generation of knock-in transgenic medaka by CRISPR/Cas9-mediated genome engineering.

Science.gov (United States)

Watakabe, Ikuko; Hashimoto, Hisashi; Kimura, Yukiko; Yokoi, Saori; Naruse, Kiyoshi; Higashijima, Shin-Ichi

2018-01-01

Medaka ( Oryzias latipes ) is a popular animal model used in vertebrate genetic analysis. Recently, an efficient (~ 30%) knock-in system via non-homologous end joining (NHEJ) was established in zebrafish using the CRISPR/Cas9 system. If the same technique were applicable in medaka, it would greatly expand the usefulness of this model organism. The question of the applicability of CRISPR/Cas9 in medaka, however, has yet to be addressed. We report the highly efficient generation of knock-in transgenic medaka via non-homologous end joining (NHEJ). Donor plasmid containing a heat-shock promoter and a reporter gene was co-injected with a short guide RNA (sgRNA) targeted for genome digestion, an sgRNA targeted for donor plasmid digestion, and Cas9 mRNA. Broad transgene expression in the expression domain of a target gene was observed in approximately 25% of injected embryos. By raising these animals, we established stable knock-in transgenic fish with several different constructs for five genetic loci, obtaining transgenic founders at efficiencies of > 50% for all five loci. Further, we show that the method is useful for obtaining mutant alleles. In the experiments where transgene integrations were targeted between the transcription start site and the initiation methionine, the resultant transgenic fish became mutant alleles. With its simplicity, design flexibility, and high efficiency, we propose that CRISPR/Cas9-mediated knock-in via NHEJ will become a standard method for the generation of transgenic and mutant medaka.

Resilient modulus of black cotton soil

Directory of Open Access Journals (Sweden)

K.H. Mamatha

2017-03-01

Full Text Available Resilient modulus (MR values of pavement layers are the basic input parameters for the design of pavements with multiple layers in the current mechanistic empirical pavement design guidelines. As the laboratory determination of resilient modulus is costly, time consuming and cumbersome, several empirical models are developed for the prediction of resilient modulus for different regions of the world based on the database of resilient modulus values of local soils. For use of these relationships there is a need to verify the suitability of these models for local conditions. Expansive clay called black cotton soil (BC soil is found in several parts of India and is characterized by low strength and high compressibility. This soil shows swell – shrink behaviour upon wetting and drying and are problematic. The BC soil shows collapse behaviour on soaking and therefore the strength of the soil needs to be improved. Additive stabilization is found to be very effective in stabilizing black cotton soils and generally lime is used to improve the strength and durability of the black cotton soil. In this paper, the results of repeated load tests on black cotton soil samples for the determination of MR under soaked and unsoaked conditions at a relative compaction levels of 100% and 95% of both standard and modified proctor conditions are reported. The results indicate that the black cotton soil fails to meet the density requirement of the subgrade soil and shows collapse behaviour under soaked condition. To overcome this, lime is added as an additive to improve the strength of black cotton soil and repeated load tests were performed as per AASHTO T 307 - 99 for MR determination. The results have shown that the samples are stable under modified proctor condition with MR values ranging from 36 MPa to 388 MPa for a lime content of 2.5% and curing period ranging from 7 to 28 days. Also, it is observed that, the CBR based resilient modulus is not in agreement

Changes in cotton gin energy consumption apportioned by ten functions

Science.gov (United States)

The public is concerned about air quality and sustainability. Cotton producers, gin owners and plant managers are concerned about rising energy prices. Both have an interest in cotton gin energy consumption trends. Changes in cotton gins’ energy consumption over the past fifty years, a period of ...

farmers' knowledge and perceptions of cotton insect pests and their

African Journals Online (AJOL)

Prince Acheampong

A survey of 337 cotton farmers in the three northern regions of Ghana was ... five applications were made during the season. ... Keywords: cotton, farmer knowledge and perception, insect pest control, Ghana. .... bordered on tests of farmers' knowledge of cotton insect pests, their damage ..... Agricultural Experiment Station.

Effect of carrageenan on properties of biodegradable thermoplastic cassava starch/low-density polyethylene composites reinforced by cotton fibers

International Nuclear Information System (INIS)

Prachayawarakorn, Jutarat; Pomdage, Wanida

2014-01-01

Highlights: • We prepared the TPCS/LDPE composites modified by carrageenan and/or cotton fibers. • The IR O–H stretching peak of the modified composites shifts to lower wavenumber. • Stress and Young’s modulus of the modified composites increase significantly. • The modified composites degrade faster than the non-modified composite. - Abstract: Applications of biodegradable thermoplastic starch (TPS) have been restricted due to its poor mechanical properties, limited processability and high water uptake. In order to improve properties and processability, thermoplastic cassava starch (TPCS) was compounded with low-density polyethylene (LDPE). The TPCS/LDPE blend was, then, modified by a natural gelling agent, i.e. carrageenan and natural fibers, i.e. cotton fibers. All composites were compounded and processed using an internal mixer and an injection molding machine, respectively. It was found that stress at maximum load and Young’s modulus of the TPCS/LDPE composites significantly increased by the addition of the carrageenan and/or the cotton fibers. The highest mechanical properties were obtained from the TPCS/LDPE composites modified by both the carrageenan and the cotton fibers. Percentage water absorption of all of the TPCS/LDPE composites was found to be similar. All modified composites were also degraded easier than the non-modified one. Furthermore, all the composites were analyzed using Fourier-transform infrared spectroscopy (FTIR), X-ray diffraction (XRD) and Scanning electron microscopy (SEM)

Remote sensing techniques for monitoring the Rio Grande Valley cotton stalk destruction program

Energy Technology Data Exchange (ETDEWEB)

Richardson, A.J.; Gerbermann, A.H.; Summy, K.R.; Anderson, G.L. (Department of Agriculture, Weslaco, TX (United States))

1993-09-01

Post harvest cotton (Gossypium hirsutum L.) stalk destruction is a cultural practice used in the Rio Grande Valley to suppress over wintering populations of boll weevils (Anthonomus grandis Boheman) without using chemicals. Consistent application of this practice could substantially reduce insecticide usage, thereby minimizing environmental hazards and increasing cotton production profits. Satellite imagery registered within a geographic information system was used to monitor the cotton stalk destruction program in the Rio Grande Valley. We found that cotton stalk screening procedures based on standard multispectral classification techniques could not reliably distinguish cotton from sorghum. Greenness screening for cotton plant stalks after the stalk destruction deadline was possible only where ground observations locating cotton fields were available. These findings indicate that a successful cotton stalk destruction monitoring program will require satellite images and earth referenced data bases showing cotton field locations.

Induced mutations for improvement of desi cotton

International Nuclear Information System (INIS)

Waghmare, V.N.; Mohan, Punit; Singh, Phundan; Gururajan, K.N.

2000-01-01

Desi cotton varieties of Gossypium arboreum have wide adaptability and are relatively tolerant to biotic (insect pests and diseases) and abiotic (moisture and salt) stresses. Desi varieties have got potential to yield even under adverse and low input situations. Most of them are synchronous in maturity and possess consistent fibre properties. Despite such merits, very little attention has been paid for improvement of desi cotton. The present area under arboreum varieties is 17.0% (15.30 lakh ha.) against 65% (35.75 lakh ha) during 1947-48. Deliberate attempts are required to improve G. arboreum for its economic and quality characters to compete with upland varieties in rainfed cotton ecology

Effects of saliva collection using cotton swab on cortisol enzyme immunoassay.

Science.gov (United States)

Kozaki, Tomoaki; Hashiguchi, Nobuko; Kaji, Yumi; Yasukouchi, Akira; Tochihara, Yutaka

2009-12-01

Cotton swabs are among the most commonly used devices for collecting saliva, but various studies have reported that their use impacts the results of salivary cortisol assays. These studies, however, estimated this impact by comparing the average of the concentration and/or scatter plots. In the present study, we estimated the impact of cotton swabs on the results of salivary cortisol enzyme immunoassay (EIA) by Bland-Altman plot. Eight healthy males (aged 20-23 years) provided four saliva samples on different days to yield a total of 32 samples. Saliva samples were collected directly in plastic tubes using plastic straws and then pipetted onto cotton swabs (cotton saliva collection) and into clear sterile tubes (passive saliva collection). There was a lower correlation between cotton and passive saliva collection. Individually, four subjects showed a negative correlation between passive and cotton saliva collection. A Bland-Altman plot indicated that cotton swabs causes a proportional bias on the EIA assay result. Our findings indicate a considerable effect of using cotton swabs for saliva collection, and subject-specific variability in the impact. A Bland-Altman plot further suggests possible reasons for this effect.

Molecular Markers and Cotton Genetic Improvement: Current Status and Future Prospects

Directory of Open Access Journals (Sweden)

Waqas Malik

2014-01-01

Full Text Available Narrow genetic base and complex allotetraploid genome of cotton (Gossypium hirsutum L. is stimulating efforts to avail required polymorphism for marker based breeding. The availability of draft genome sequence of G. raimondii and G. arboreum and next generation sequencing (NGS technologies facilitated the development of high-throughput marker technologies in cotton. The concepts of genetic diversity, QTL mapping, and marker assisted selection (MAS are evolving into more efficient concepts of linkage disequilibrium, association mapping, and genomic selection, respectively. The objective of the current review is to analyze the pace of evolution in the molecular marker technologies in cotton during the last ten years into the following four areas: (i comparative analysis of low- and high-throughput marker technologies available in cotton, (ii genetic diversity in the available wild and improved gene pools of cotton, (iii identification of the genomic regions within cotton genome underlying economic traits, and (iv marker based selection methodologies. Moreover, the applications of marker technologies to enhance the breeding efficiency in cotton are also summarized. Aforementioned genomic technologies and the integration of several other omics resources are expected to enhance the cotton productivity and meet the global fiber quantity and quality demands.

Isolation and functional characterization of a cotton ubiquitination-related promoter and 5'UTR that drives high levels of expression in root and flower tissues

Directory of Open Access Journals (Sweden)

Viana Antonio AB

2011-11-01

Full Text Available Abstract Background Cotton (Gossypium spp. is an important crop worldwide that provides raw material to 40% of the textile fiber industry. Important traits have been studied aiming the development of genetically modified crops including resistance to insect and diseases, and tolerance to drought, cold and herbicide. Therefore, the characterization of promoters and regulatory regions is also important to achieve high gene expression and/or a specific expression pattern. Commonly, genes involved in ubiquitination pathways are highly and differentially expressed. In this study, we analyzed the expression of a cotton ubiquitin-conjugating enzyme (E2 family member with no previous characterization. Results Nucleotide analysis revealed high identity with cotton E2 homologues. Multiple alignment showed a premature stop codon, which prevents the encoding of the conserved cysteine residue at the E2 active site, and an intron that is spliced in E2 homologues, but not in GhGDRP85. The GhGDRP85 gene is highly expressed in different organs of cotton plants, and has high transcript levels in roots. Its promoter (uceApro2 and the 5'UTR compose a regulatory region named uceA1.7, and were isolated from cotton and studied in Arabidopsis thaliana. uceA1.7 shows strong expression levels, equaling or surpassing the expression levels of CaMV35S. The uceA1.7 regulatory sequence drives GUS expression 7-fold higher in flowers, 2-fold in roots and at similar levels in leaves and stems. GUS expression levels are decreased 7- to 15-fold when its 5'UTR is absent in uceApro2. Conclusions uceA1.7 is a strong constitutive regulatory sequence composed of a promoter (uceApro2 and its 5'UTR that will be useful in genetic transformation of dicots, having high potential to drive high levels of transgene expression in crops, particularly for traits desirable in flower and root tissues.

Structural coloration of chitosan-cationized cotton fabric using photonic crystals

Science.gov (United States)

Yavuz, G.; Zille, A.; Seventekin, N.; Souto, A. P.

2017-10-01

In this work, poly (styrene-methyl methacrylate-acrylic acid) P(St-MMA-AA) composite nanospheres were deposited onto chitosan-cationized woven cotton fabrics followed by a second layer of chitosan. The deposited photonic crystals (PCs) on the fabrics were evaluated for coating efficiency and resistance, chemical analysis and color variation by optical and SEM microscopy, ATR-FTIR, diffuse reflectance spectroscopy and washing fastness. Chitosan deposition on cotton fabric provided cationic groups on the fiber surface promoting electrostatic interaction with photonic crystals. SEM images of the washed samples indicate that the PCs are firmly coated on the cotton surface only in the chitosan treated sample. The photonic nanospheres show an average diameter of 280 nm and display a face-centered cubic closepacking structure with an average thickness of 10 μm. A further chitosan post-treatment enhances color yield of the samples due to the chitosan transparent covering layer that induce bright reflections where the angles of incidence and reflection are the same. After washing, no photonic crystal can be detected on control fabric surface. However, the sample that received a chitosan post-treatment showed a good washing fastness maintaining a reasonable degree of iridescence. Chitosan fills the spaces between the polymer spheres in the matrix stabilizing the photonic structure. Sizeable variations in lattice spacing will allow color variations using more flexible non-close-packed photonic crystal arrays in chitosan hydrogels matrices.

Spatial and temporal distribution of cotton squares and small cotton bolls fallen on ground after damage by boll weevil and the efficiency of the equipment used to collect them

Directory of Open Access Journals (Sweden)

Carlos Alberto Domingues da Silva

Full Text Available ABSTRACT: In this study, we determined the spatial and temporal distribution of fallen cotton squares and small cotton bolls fallen damaged by boll weevil and the efficiency and time interval of the equipment used to collect cotton samples. Spatial and temporal distribution of cotton squares and small cotton bolls fallen on the soil damaged by boll weevil among cotton rows was determined in an experimental design of randomized blocks in a factorial arrangement of 4x3, represented by soil surface tracks located at 1-11cm, 12-22cm, 23-33cm, and 34-44cm away from the planting row of cotton plants 70, 85, and 100 days of age. Efficiency and collection time interval of the cotton samples fallen on the soil infested by boll weevil by plastic rakes that were straight or fan-shaped, big broom, collector instrument model CNPA and aspirator of leaves ‘Trapp’ were determined in randomized block design with five treatments, 10 repetitions for each. Results demonstrated that the collection of cotton samples must be performed with greater attention to soil strips located below the cotton top projection and aspirator ‘Trapp’ of leaves was more appropriate for the operation as it used less time of collection with similar efficiency to other available equipment.

A Grey Fuzzy Logic Approach for Cotton Fibre Selection

Science.gov (United States)

Chakraborty, Shankar; Das, Partha Protim; Kumar, Vidyapati

2017-06-01

It is a well known fact that the quality of ring spun yarn predominantly depends on various physical properties of cotton fibre. Any variation in these fibre properties may affect the strength and unevenness of the final yarn. Thus, so as to achieve the desired yarn quality and characteristics, it becomes imperative for the spinning industry personnel to identify the most suitable cotton fibre from a set of feasible alternatives in presence of several conflicting properties/attributes. This cotton fibre selection process can be modelled as a Multi-Criteria Decision Making (MCDM) problem. In this paper, a grey fuzzy logic-based approach is proposed for selection of the most apposite cotton fibre from 17 alternatives evaluated based on six important fibre properties. It is observed that the preference order of the top-ranked cotton fibres derived using the grey fuzzy logic approach closely matches with that attained by the past researchers which proves the application potentiality of this method in solving varying MCDM problems in textile industries.

Cattle mammary bioreactor generated by a novel procedure of transgenic cloning for large-scale production of functional human lactoferrin.

Directory of Open Access Journals (Sweden)

Penghua Yang

Full Text Available Large-scale production of biopharmaceuticals by current bioreactor techniques is limited by low transgenic efficiency and low expression of foreign proteins. In general, a bacterial artificial chromosome (BAC harboring most regulatory elements is capable of overcoming the limitations, but transferring BAC into donor cells is difficult. We describe here the use of cattle mammary bioreactor to produce functional recombinant human lactoferrin (rhLF by a novel procedure of transgenic cloning, which employs microinjection to generate transgenic somatic cells as donor cells. Bovine fibroblast cells were co-microinjected for the first time with a 150-kb BAC carrying the human lactoferrin gene and a marker gene. The resulting transfection efficiency of up to 15.79 x 10(-2 percent was notably higher than that of electroporation and lipofection. Following somatic cell nuclear transfer, we obtained two transgenic cows that secreted rhLF at high levels, 2.5 g/l and 3.4 g/l, respectively. The rhLF had a similar pattern of glycosylation and proteolytic susceptibility as the natural human counterpart. Biochemical analysis revealed that the iron-binding and releasing properties of rhLF were identical to that of native hLF. Importantly, an antibacterial experiment further demonstrated that rhLF was functional. Our results indicate that co-microinjection with a BAC and a marker gene into donor cells for somatic cell cloning indeed improves transgenic efficiency. Moreover, the cattle mammary bioreactors generated with this novel procedure produce functional rhLF on an industrial scale.

Epigenetic variants of a transgenic petunia line show hypermethylation in transgene DNA: an indication for specific recognition of foreign DNA in transgenic plants.

Science.gov (United States)

Meyer, P; Heidmann, I

1994-05-25

We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.

ACCOUNTING TREATMENTS SPECIFIC TO COUNTERPART COMMERCIAL TRANSACTIONS

Directory of Open Access Journals (Sweden)

Lucia PALIU - POPA

2010-12-01

Full Text Available Given the lack of availability of funds in foreign currency, felt in many countries, especially in the developing and developed countries and the economic or financial crisis in the global foreign exchange, counterpart commercial transactions were imposed as a “disarming” condition of the international trade. In the counterpart a purchase transaction is combined with a sale transaction, an import with an export in order to ensure balanced trade between the partners, trade that involves eliminating or reducing the currency as a payment source and its replacement with trade of goods and services. Thus, in the context of an acute need to export of greatly industrialized countries, where the overproduction phenomenon tends to have a chronic character, the counterpart has become a highly complex and sustainable phenomenon, which has seen a steady increase in the volume of amounts, with a geographical area and large variety of forms and mechanisms of implementation. Based on the characteristics and structure of counterpart transactions, we shall describe in this paper the accounting models specific to international trade, as part of the combined foreign trade transactions without neglecting the tax treatments that influence the entry in the accounts

Using atmospheric pressure plasma treatment for treating grey cotton fabric.

Science.gov (United States)

Kan, Chi-Wai; Lam, Chui-Fung; Chan, Chee-Kooi; Ng, Sun-Pui

2014-02-15

Conventional wet treatment, desizing, scouring and bleaching, for grey cotton fabric involves the use of high water, chemical and energy consumption which may not be considered as a clean process. This study aims to investigate the efficiency of the atmospheric pressure plasma (APP) treatment on treating grey cotton fabric when compared with the conventional wet treatment. Grey cotton fabrics were treated with different combinations of plasma parameters with helium and oxygen gases and also through conventional desizing, scouring and bleaching processes in order to obtain comparable results. The results obtained from wicking and water drop tests showed that wettability of grey cotton fabrics was greatly improved after plasma treatment and yielded better results than conventional desizing and scouring. The weight reduction of plasma treated grey cotton fabrics revealed that plasma treatment can help remove sizing materials and impurities. Chemical and morphological changes in plasma treated samples were analysed by FTIR and SEM, respectively. Finally, dyeability of the plasma treated and conventional wet treated grey cotton fabrics was compared and the results showed that similar dyeing results were obtained. This can prove that plasma treatment would be another choice for treating grey cotton fabrics. Copyright © 2013 Elsevier Ltd. All rights reserved.

Heterosis and correlation in interspecific and intraspecific hybrids of cotton.

Science.gov (United States)

Munir, S; Hussain, S B; Manzoor, H; Quereshi, M K; Zubair, M; Nouman, W; Shehzad, A N; Rasul, S; Manzoor, S A

2016-06-24

Interspecific and intraspecific hybrids show varying degrees of heterosis for yield and yield components. Yield-component traits have complex genetic relationships with each other. To determine the relationship of yield-component traits and fiber traits with seed cotton yield, six lines (Bt. CIM-599, CIM-573, MNH-786, CIM-554, BH-167, and GIZA-7) and three test lines (MNH-886, V4, and CIM-557) were crossed in a line x tester mating design. Heterosis was observed for seed cotton yield, fiber traits, and for other yield-component traits. Heterosis in interspecific hybrids for seed cotton yield was more prominent than in intraspecific hybrids. The interspecific hybrid Giza-7 x MNH-886 had the highest heterosis (114.77), while among intraspecific hybrids, CIM-554 x CIM-557 had the highest heterosis (61.29) for seed cotton yield. A major trait contributing to seed cotton yield was bolls/plant followed by boll weight. Correlation studies revealed that bolls/plant, boll weight, lint weight/boll, lint index, seed index, lint/seed, staple length, and staple strength were significantly and positively associated with seed cotton yield. Selection based on boll weight, boll number, lint weight/boll, and lint index will be helpful for improving cotton seed yield.

Antifungal genes expressed in transgenic pea (Pisum sativum L.) do not affect root colonization of arbuscular mycorrhizae fungi.

Science.gov (United States)

Kahlon, Jagroop Gill; Jacobsen, Hans-Jörg; Cahill, James F; Hall, Linda M

2017-10-01

Genetically modified crops have raised concerns about unintended consequences on non-target organisms including beneficial soil associates. Pea transformed with four antifungal genes 1-3 β glucanase, endochitinase, polygalacturonase-inhibiting proteins, and stilbene synthase is currently under field-testing for efficacy against fungal diseases in Canada. Transgenes had lower expression in the roots than leaves in greenhouse experiment. To determine the impact of disease-tolerant pea or gene products on colonization by non-target arbuscular mycorrhizae and nodulation by rhizobium, a field trial was established. Transgene insertion, as single gene or stacked genes, did not alter root colonization by arbuscular mycorrhiza fungus (AMF) or root nodulation by rhizobium inoculation in the field. We found no effect of transgenes on the plant growth and performance although, having a dual inoculant with both AMF and rhizobium yielded higher fresh weight shoot-to-root ratio in all the lines tested. This initial risk assessment of transgenic peas expressing antifungal genes showed no deleterious effect on non-target organisms.

Fiber quality challenges facing the cotton industry